HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
Patent Information
- Application Number
- AE202602272
- Authority / Receiving Office
- AE · AE
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-03-29
- Filing Date
- 2022-03-28
Smart Images

Figure ABST_ABST
Abstract
Description
HUNTINGTIN (HTT)iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 167,140, filed on March 29, 2021, the entire contents of which are incorporated herein by reference. SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 22, 2022, is named 121301_14420_SL.txt and is 198,616 bytes in size. BACKGROUND OF THE INVENTIONHuntington's disease is a progressive neurodegenerative disorder characterized by motor disturbance, cognitive loss and psychiatric manifestations (Martin and Gusella (1986) N. Engl. J. Med. 315:1267-1276). It is inherited in an autosomal dominant fashion, and affects about 1 / 10,000 individuals in most populations of European origin (Harper, P. S. et al., in Huntington's Disease, W. B. Saunders, Philadelphia, 1991). The hallmark of Huntington's disease is a distinctive choreic movement disorder that typically has a subtle, insidious onset in the fourth to fifth decade of life and gradually worsens over a course of 10 to 20 years until death. Occasionally, Huntington's disease is expressed in juveniles typically manifesting with more severe symptoms including rigidity and a more rapid course. Juvenile onset of Huntington's disease is associated with a preponderance of paternal transmission of the disease allele. The neuropathology of Huntington's disease also displays a distinctive pattern, with selective loss of neurons that is most severe in the caudate and putamen regions of the brain. Huntington's disease has been shown to be caused by an expanding glutamine repeat in exon 1 of a gene termed IT15 or Huntingtin (HTT). Although this gene is widely expressed and is required for normal development, the pathology of Huntington's disease is restricted to the brain, for reasons that remain poorly understood. In patients having HD (an autosomal dominant disease), the expansion of the polyglutamine repeat results in a wild-type transcript, a full-length mutant transcript having the expanded polyglutamine repeat, as well as a truncated mutant transcript having the expanded polyglutamine repeat. It has been shown that, although the Huntingtin gene product is expressed at similar levels in patients and controls, it is the expansion of the polyglutamine repeat and the presence of the full-length mutant transcript and the truncated mutant transcript that induces toxicity.Effective treatment for Huntington's disease is currently not available. The choreic movements and agitated behaviors may be suppressed, usually only partially, by antipsychotics (e.g., chlorpromazine) or reserpine until adverse effects of lethargy, hypotension, or parkinsonism occur. In addition, despite significant advances in the field of RNAi and Huntington's disease treatment, there remains a need for an agent that can selectively and efficiently silence the HD gene using the cell's own RNAi machinery that has both high biological activity and in vivo stability, and that can effectively inhibit expression of a target Huntingtin gene.BRIEF SUMMARY OF THE INVENTIONThe present disclosure provides RNAi agent compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a huntingin (HTT) gene. The HTT gene may be within a cell, e.g., a cell within a subject, such asa human. The present disclosure also provides methods of using the RNAi agent compositions of the disclosure for inhibiting the expression of an HTT gene or for treating a subject who would benefit from inhibiting or reducing the expression of an HTT gene, e.g., a subject suffering or prone to suffering from an HTT-associated disease.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT), in a cell, wherein the dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding HTT, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3, e.g., 3, 2, 1, or 0. nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-5. In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT), in a cell, wherein the dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, or 21, contiguous nucleotides differing by no more than three, e.g., 3, 2, 1, or 0, nucleotides from any one of the nucleotide sequence of nucleotides 4391-4669; 6500-6540; or 6009-6037 of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:6. In one embodiment, the sense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, or 21, contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 4398-4420; 4403-4425; or 6512-6534 of SEQ ID NO:1. In one embodiment, the sense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, or 21, contiguous nucleotides differing by no more than three nucleotides from nucleotides 4398-4420 of SEQ ID NO:1.In one embodiment, the antisense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, 21, 22, or 23, contiguous nucleotides differing by no more that three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1271085, AD-1271083, or AD-1271084.In one embodiment, the antisense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, 21, 22, or 23, contiguous nucleotides differing by no more that three nucleotides from the antisense strand nucleotide sequence of AD-1271085.In one embodiment, the sense strand comprises the nucleotide sequence 5’- GCUAUUCAUAAUCACAUUCGA-3’ (SEQ ID NO: 15).In one embodiment, the sense strand consists of the nucleotide sequence 5’- GCUAUUCAUAAUCACAUUCGA-3’(SEQ ID NO: 15).In one embodiment, the antisense strand comprises the nucleotide sequence 5’- UCGAAUGUGAUUAUGAAUAGCAU-3’ (SEQ ID NO: 16).In one embodiment, the antisense strand consists of the nucleotide sequence 5’- UCGAAUGUGAUUAUGAAUAGCAU-3’ (SEQ ID NO: 15).In one embodiment, the sense strand comprises the nucleotide sequence 5’- GCUAUUCAUAAUCACAUUCGA-3’ (SEQ ID NO: 15) and the antisense strand comprises the nucleotide sequence 5’- UCGAAUGUGAUUAUGAAUAGCAU-3’ (SEQ ID NO: 16).In one embodiment, the sense strand consists of the nucleotide sequence 5’- GCUAUUCAUAAUCACAUUCGA-3’ (SEQ ID NO: 15) and the antisense strand consists of the nucleotide sequence 5’- UCGAAUGUGAUUAUGAAUAGCAU-3’ (SEQ ID NO: 16).In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from nucleotides 26-77; or 142-202 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:6. In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from the nucleotide sequence of nucleotides 27-49; 55-77; 147-169; or 173-195 of SEQ ID NO:1. In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from nucleotides 147-169 of SEQ ID NO:1. In one embodiment, the antisense strand comprises at least 15 contiguous nucleotides differing by no more that three nucleotides from the antisense strand nucleotide sequence of a duplex selected from the group consisting of AD-1019448, AD-1498524, AD-1498526, or AD-1498528.In one embodiment, the antisense strand comprises at least 15 contiguous nucleotides differing by no more that three nucleotides from the antisense strand nucleotide sequence of AD-1498524. The sense strand, the antisense strand, or both the sense strand and the antisense strand may be conjugated to one or more lipophilic moieties. In some embodiments, the lipophilic moiety is conjugated to one or more internal positions in the double stranded region of the dsRNA agent, e.g., the one or more lipophilic moieties may be conjugated to one or more internal positions on the antisense strand. In some embodiments, the one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand via a linker or carrier. In some embodiments, lipophilicity of the lipophilic moiety, measured by logKow, exceeds 0. In some embodiments, the hydrophobicity of the dsRNA agent, measured by the unbound fraction in a plasma protein binding assay of the dsRNA agent, exceeds 0.2. In some embodiments, the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein. In some embodiments, the internal positions include all positions except the terminal two positions from each end of the sense strand or the antisense strand. In other embodiments, the internal positions include all positions except the terminal three positions from each end of the sense strand or the antisense strand. In some embodiments, the internal positions exclude a cleavage site region of the sense strand, such as the internal positions include all positions except positions 9-12, counting from the 5’-end of the sense strand or the internal positions include all positions except positions 11-13, counting from the 3’-end of the sense strand. In some embodiments, the internal positions exclude a cleavage site region of the antisense strand. In other embodiments, the internal positions include all positions except positions 12-14, counting from the 5’-end of the antisense strand. In some embodiments, the internal positions include all positions except positions 11-13 on the sense strand, counting from the 3’-end, and positions 12-14 on the antisense strand, counting from the 5’-end. In some embodiments, the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5’end of each strand. In some embodiments, the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5’-end of each strand. In some embodiments, the positions in the double stranded region exclude a cleavage site region of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand. In other embodiments, the sense strand is 21 nucleotides in length, the antisense strand is 23 nucleotides in length, and the lipophilic moiety is conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand. In some embodiments, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound. In some embodiments, the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine. In some embodiments, the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In some embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain. In some embodiments, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain. In some embodiments, the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6, counting from the 5’-end of the strand. In some embodiments, the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotide(s) in the internal position(s) or the double stranded region. In some embodiments, the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone. In some embodiments, the lipophilic moiety is conjugated to the dsRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate. In some embodiments, the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleosidic linkage. In some embodiments, the dsRNA agent comprises at least one modified nucleotide. In some embodiments, no more than five of the sense strand nucleotides and no more than five of the nucleotides of the antisense strand are unmodified nucleotides. In other embodiments, all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification. In some embodiments, at least one of the modified nucleotides is selected from the group a deoxy-nucleotide, a 3’-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, 2’-hydroxly-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic, a nucleotide comprising vinyl phosphonate, a nucleotide comprising adenosine-glycol nucleic acid (GNA), a nucleotide comprising thymidine-glycol nucleic acid (GNA) S-Isomer, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2’-deoxythymidine-3’phosphate, a nucleotide comprising 2’-deoxyguanosine-3’-phosphate, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisdecylamide group; and combinations thereof. In other embodiments, the modified nucleotide is selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, 3’-terminal deoxy-thymine nucleotides (dT), a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In some embodiments, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), and, a vinyl-phosphonate nucleotide; and combinations thereof. In some embodiments, at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification. In some embodiments, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; and destabilizing sugar modification, a 2’-deoxy modification, an acyclic nucleotide, an unlocked nucleic acids (UNA), and a glycerol nucleic acid (GNA) In some embodiments, the modified nucleotide comprises a short sequence of 3’-terminal deoxy-thymine nucleotides (dT). In some embodiments, the modifications on the nucleotides are 2’-O-methyl, GNA and 2’fluoro modifications. In some embodiments, the dsRNA agent further comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the dsRNA agent comprises 6-8 phosphorothioate internucleotide linkages. In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3’-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In a related embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5’-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In another embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the both the 5’- and 3’-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, at least one strand comprises a 3’ overhang of at least 1 nucleotide or a 3’ overhang of at least 2 nucleotides. The double stranded region may be 15-30 nucleotide pairs in length; 17-23 nucleotide pairs in length; 17-25 nucleotide pairs in length; 23-27 nucleotide pairs in length; 19-21 nucleotide pairs in length; or 21-23 nucleotide pairs in length. Each strand may be 19-30 nucleotides; 19-23 nucleotides; or 21-23 nucleotides. In some embodiments, the dsRNA agent further comprises a targeting ligand that targets a liver tissue. In some embodiments, the targeting ligand is a GalNAc conjugate. In other embodiments, the dsRNA agent does not comprise a targeting ligand that targets a liver tissue, such as a GalNAc conjugate. In certain embodiments, the double-stranded RNAi agent further includes a targeting ligand that targets a receptor which mediates delivery to a CNS tissue, e.g., a hydrophilic ligand. In certain embodiments, the targeting ligand is a C16 ligand. In one embodiment, the ligand is,where B is a nucleotide base or a nucleotide base analog, optionally where B is adenine, guanine, cytosine, thymine or uracil.In some embodiments, the dsRNA agent further includes a targeting ligand that targets a receptor which mediates delivery to a CNS tissue, e.g., a hydrophilic ligand, such as a C16 ligand, e.g.,,where B is a nucleotide base or a nucleotide base analog, optionally where B is adenine, guanine, cytosine, thymine or uracil and does not comprise a targeting ligand that targets a liver tissue, such as a GalNAc conjugate. In some embodiments, the lipophilic moeity or targeting ligand is conjugated via a bio-clevable linker selected from the group consisting of DNA, RNA, disulfide, amide, funtionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof. In some embodiments, the 3’ end of the sense strand is protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl. In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first internucleotide linkage at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp configuration or Sp configuration. In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first and second internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first, second and third internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first, and second internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the third internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the dsRNA agent further comprises a terminal, chiral modification occurring at the first, and second internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first, and second internucleotide linkages at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the dsRNA agent further comprises a phosphate or phosphate mimic at the 5’-end of the antisense strand. In some embodiments, the phosphate mimic is a 5’-vinyl phosphonate (VP). In some embodiments, the base pair at the 1 position of the 5′-end of the antisense strand of the duplex is an AU base pair. In some embodiments, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.In one embodiment, the antisense strand comprises the nucleotide sequence 5’- UAUCAGCUUUUCCAGGGUCGCCG -3’ (SEQ ID NO: 53).In one embodiment, the sense strand comprises the nucleotide sequence 5’- GCGACCCUGGAAAAGCUGAUA -3’ (SEQ ID NO: 40).In one embodiment, the sense strand comprises the nucleotide sequence 5’- GCGACCCUGGAAAAGCUGAUA -3’ (SEQ ID NO: 40) and the antisense strand comprises the nucleotide sequence 5’- UAUCAGCUUUUCCAGGGUCGCCG -3’ (SEQ ID NO: 53).In one embodiment, the antisense strand comprises the nucleotide sequence 5’- UAGGACTUGAGGGACUCGAAGGC -3’ (SEQ ID NO: 57). In one embodiment, the sense strand comprises the nucleotide sequence 5’- CUUCGAGUCCCUCAAGUCCUA -3’ (SEQ ID NO: 44).In one embodiment, the sense strand comprises the nucleotide sequence 5’- CUUCGAGUCCCUCAAGUCCUA -3’ (SEQ ID NO: 44) and the antisense strand comprises the nucleotide sequence 5’- UAGGACTUGAGGGACUCGAAGGC -3’(SEQ ID NO: 57).In one embodiment, the antisense strand comprises the nucleotide sequence 5’- UUAAAAGCAGAACCUGACCGGCC -3’ (SEQ ID NO: 59). In one embodiment, the sense strand comprises the nucleotide sequence 5’- CCGGUCAGGUUCUGCUUUUAA -3’ (SEQ ID NO: 46).In one embodiment, the sense strand comprises the nucleotide sequence 5’- CCGGUCAGGUUCUGCUUUUAA -3’ (SEQ ID NO: 46) and the antisense strand comprises the nucleotide sequence 5’- UUAAAAGCAGAACCUGACCGGCC -3’ (SEQ ID NO: 59).In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- gscsgac(Chd)CfuGfGfAfaaagcugasusa -3’ (SEQ ID NO:65) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusAfsucdAg(C2p)uuuudCcAfgdGgucgcscsg -3’ (SEQ ID NO:79), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Chd) is 2'-O-hexadecyl-cytosine-3'-phosphate; C2p is cytidine-2`-phosphate; and VP is 5’-vinyl phosphonate. In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- gscsgac(Chd)CfuGfGfAfaaagcugasusa -3’ (SEQ ID NO:65) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- VPusAfsucdAg(C2p)uuuudCcAfgdGgucgcscsg -3’ (SEQ ID NO:79).In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence 5’- gscsgac(Chd)CfuGfGfAfaaagcugasusa -3’ (SEQ ID NO:65) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence 5’- VPusAfsucdAg(C2p)uuuudCcAfgdGgucgcscsg -3’ (SEQ ID NO:79).In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence 5’- gscsgac(Chd)CfuGfGfAfaaagcugasusa -3’ (SEQ ID NO:65) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence 5’- VPusAfsucdAg(C2p)uuuudCcAfgdGgucgcscsg -3’ (SEQ ID NO:79).In one embodiment, the sense strand comprises the nucleotide sequence 5’- gscsgac(Chd)CfuGfGfAfaaagcugasusa -3’ (SEQ ID NO:65) and the antisense strand comprises the nucleotide sequence 5’-VPusAfsucdAg(C2p)uuuudCcAfgdGgucgcscsg -3’ (SEQ ID NO:79).In one embodiment, the sense strand consists of the nucleotide sequence 5’- gscsgac(Chd)CfuGfGfAfaaagcugasusa -3’ (SEQ ID NO:65) and the antisense strand consists of the nucleotide sequence 5’-VPusAfsucdAg(C2p)uuuudCcAfgdGgucgcscsg -3’ (SEQ ID NO:79).In another aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate; Tgn is thymidine-glycol nucleic acid (GNA) S-isomer; and VP is 5’-vinyl phosphonate. In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83).In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83).In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83).In one embodiment, the sense strand comprises the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand comprises the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83).In one embodiment, the sense strand consists of the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand consists of the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83).In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Chd) is 2'-O-hexadecyl-cytosine-3'-phosphate; and VP is 5’-vinyl phosphonate. In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85).In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85).In one embodiment, the sense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85).In one embodiment, the sense strand comprises the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand comprises the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85).In one embodiment, the sense strand consists of the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand consists of the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85).In another aspect, the present invention provides a double stranded RNAi agent for inhibiting expression of a huntingtin (HTT) gene in a cell, where the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region, where the sense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides differing by no more than 3 nucleotides (i.e., differing by 3, 2, 1, or 0 nucleotides) from the nucleotide sequence 5’- GCUAUUCAUAAUCACAUUCGA-3’ (SEQ ID NO: 15) and the antisense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides differing by no more than 3 nucleotides (i.e., differing by 3, 2, 1, or 0 nucleotides) from the nucleotide sequence 5’- UCGAAUGUGAUUAUGAAUAGCAU-3’ (SEQ ID NO: 16), wherein substantially all, e.g., no less than 18, 19, 20, or 21, of the nucleotides of the sense stand and substantially all, e.g., no less than 20, 21, 22, or 23, of the nucleotides of the antisense strand comprise a nucleotide modification selected from the group consisting of a 2’-O-methyl modification, a 2’-fluoro modification, and a 2'-O-hexadecyl modification, wherein the dsRNA agent comprises six to eight phosphorothioate internucleotide linkages, wherein the sense strand comprises one or more a vinyl phosphonate (VP) modifications, e.g., a single VP modification at the 5’-terminus of the antisense strand, and wherein the dsRNA agent does not comprise a ligand targeting a liver tissue, e.g., a GalNAc ligand. In one embodiment, the dsRNA agent comprises eight phosphorothioate internucleotide linkages.In another aspect, the present invention provides a double stranded RNAi agent for inhibiting expression of a huntingtin (HTT) gene in a cell, where the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region, where the sense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides differing by no more than 3 nucleotides (i.e., differing by 3, 2, 1, or 0 nucleotides) from the nucleotide sequence 5’- GCUAUUCAUAAUCACAUUCGA-3’ (SEQ ID NO: 15) and the antisense strand comprises at least 15, e.g., 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides differing by no more than 3 nucleotides (i.e., differing by 3, 2, 1, or 0 nucleotides) from the nucleotide sequence 5’- UCGAAUGUGAUUAUGAAUAGCAU-3’ (SEQ ID NO: 16), wherein substantially all, e.g., no less than 18, 19, 20, or 21, of the nucleotides of the sense stand and substantially all, e.g., no less than 20, 21, 22, or 23, of the nucleotides of the antisense strand comprise a nucleotide modification selected from the group consisting of a 2’-O-methyl modification, a 2’-fluoro modification, and a 2'-O-hexadecyl modification, wherein the sense strand comprises four phosphorothioate internucleotide linkages, e.g., two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the antisense strand comprises four phosphorothioate internucleotide linkages, e.g., two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the sense strand comprises one or more a vinyl phosphonate (VP) modifications, e.g., a single VP modification at the 5’-terminus of the antisense strand.In another embodiment, the sense strand comprises the nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa-3’ (SEQ ID NO: 17) and the antisense strand comprises the nucleotide sequence 5’-VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu-3’ (SEQ ID NO: 18), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) modified A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2′-fluoro modified A, C, G, and U, respectively; s is a phosphorothioate linkage; and VP is a vinyl phosphonate. In one embodiment, the dsRNA agent further comprises a ligand, such as N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.In one embodiment, the sense strand consists of the nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa-3’ (SEQ ID NO: 17) and the antisense strand consists of the nucleotide sequence 5’-VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu-3’ (SEQ ID NO: 18), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) modified A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2′-fluoro modified A, C, G, and U, respectively; s is a phosphorothioate linkage; and VP is a vinyl phosphonate. In one embodiment, the dsRNA agent further comprises a ligand, such as N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.In another embodiment, the sense strand comprises the nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa-3’ (SEQ ID NO: 17) and the antisense strand comprises the nucleotide sequence 5’-VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu-3’ (SEQ ID NO: 18), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) modified A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2′-fluoro modified A, C, G, and U, respectively; s is a phosphorothioate linkage; and VP is a vinyl phosphonate, and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic:wherein X is O.In one embodiment, the sense strand consists of the nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa-3’ (SEQ ID NO: 17) and the antisense strand consists of the nucleotide sequence 5’-VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu-3’ (SEQ ID NO: 18), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) modified A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2′-fluoro modified A, C, G, and U, respectively; s is a phosphorothioate linkage; and VP is a vinyl phosphonate, and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic:wherein X is O. In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the modified nucleotide sequence 5’- uscsaua(Ahd)UfcAfCfAfuucguuugsusa -3’ (SEQ ID NO:19) and the antisense strand comprises the modified nucleotide sequence 5’- VPusAfscaaAfcGfAfauguGfaUfuaugasasu -3’ (SEQ ID NO:20), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the modified nucleotide sequence 5’- gscsugg(Uhd)GfaAfUfCfggauuccusgsa -3’(SEQ ID NO:21) and the antisense strand comprises the modified nucleotide sequence 5’- VPusCfsaggAfaUfCfcgauUfcAfccagcsusc -3’ (SEQ ID NO:22), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U, respectively; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the modified nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa -3’ (SEQ ID NO:17) and the antisense strand comprises the modified nucleotide sequence 5’- VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu -3’ (SEQ ID NO:18), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Uf are 2′-fluoro A, C, and U, respectively; dG and dT are 2′-deoxy G and T, respectively; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the modified nucleotide sequence 5’- usgsgaa(Ahd)AfgCfUfGfaugaaggcscsa -3’ (SEQ ID NO:23) and the antisense strand comprises the modified nucleotide sequence 5’- VPusGfsgccu(Tgn)caucagCfuUfuuccasgsg -3’ (SEQ ID NO:24), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U, respectively; (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate; (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand consists of the modified nucleotide sequence 5’- uscsaua(Ahd)UfcAfCfAfuucguuugsusa -3’ (SEQ ID NO:19) and the antisense strand consists of the modified nucleotide sequence 5’- VPusAfscaaAfcGfAfauguGfaUfuaugasasu -3’ (SEQ ID NO:20), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U, respectively; (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand consists of the modified nucleotide sequence 5’- gscsugg(Uhd)GfaAfUfCfggauuccusgsa -3’(SEQ ID NO:21) and the antisense strand consists of the modified nucleotide sequence 5’- VPusCfsaggAfaUfCfcgauUfcAfccagcsusc -3’ (SEQ ID NO:22), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U, respectively; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand consists of the modified nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa -3’ (SEQ ID NO:17) and the antisense strand consists of the modified nucleotide sequence 5’- VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu -3’ (SEQ ID NO:18), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Uf are 2′-fluoro A, C, and U, respectively; dG and dT are 2′-deoxy G and T, respectively; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; and VP is 5’-vinyl phosphonate.In one aspect, the present invention provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand consists of the modified nucleotide sequence 5’- usgsgaa(Ahd)AfgCfUfGfaugaaggcscsa -3’ (SEQ ID NO:23) and the antisense strand consists of the modified nucleotide sequence 5’- VPusGfsgccu(Tgn)caucagCfuUfuuccasgsg -3’ (SEQ ID NO:24), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U, respectively; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate; (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and VP is 5’-vinyl phosphonate. The present invention further provides cells containing any of the dsRNA agents of the invention and pharmaceutical compositions for inhibiting expression of a gene encoding HTT, comprising any of the dsRNA agents of the invention. In one embodiment, the double stranded RNAi agent is in an unbuffered solution. Optionally, the unbuffered solution is saline or water. In another embodiment, the double stranded RNAi agent is in a buffer solution. Optionally, the buffer solution includes acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In another embodiment, the buffer solution is phosphate buffered saline (PBS). Another aspect of the disclosure provides a pharmaceutical composition that includes a double stranded RNAi agent of the instant disclosure and a lipid formulation. In one embodiment, the lipid formulation includes a lipid nanoparticle (LNP).The present invention provides a composition comprising two or more dsRNA agents for inhibiting expression of Huntingtin (HTT) in a cell, such as a first dsRNA agent targeting exon 1 of human HTT and a second dsRNA agent targeting full-length human HTT.In one aspect, the present invention provides a composition comprising two or more dsRNA agents for inhibiting expression of Huntingtin (HTT) in a cell, wherein each dsRNA agent independently comprises a sense strand and an antisense strand forming a double stranded region, wherein each of the antisense strands independently comprises a region of complementarity to an mRNA encoding HTT, and wherein the each of the regions of complementarity independently comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-5. In another aspect, the present invention provides a composition comprising two or more dsRNA agents for inhibiting expression of Huntingtin (HTT) in a cell, wherein each dsRNA agent independently comprises a sense strand and an antisense strand forming a double stranded region, wherein each of the sense strands independently comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 4391-4669; 6500-6540; or 6009-6037 of SEQ ID NO: 1, and each of the antisense strands independently comprises a nucleotide sequence comprising at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:6. In one embodiment, each of the the sense strand independently comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 4398-4420; 4403-4425; or 6512-6534 of SEQ ID NO:1. In one embodiment, one of the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from nucleotides 4398-4420 of SEQ ID NO:1. In one embodiment, each of the antisense strand comprises indepndently at least 15 contiguous nucleotides differing by no more that three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1271085, AD-1271083, or AD-1271084.In one embodiment, one of the antisense strand comprises at least 15 contiguous nucleotides differing by no more that three nucleotides from the antisense strand nucleotide sequence of AD-1271085.In one aspect, the present invention provides a composition comprising two or more dsRNA agents for inhibiting expression of Huntingtin (HTT) in a cell, wherein each dsRNA agent independently comprises a sense strand and an antisense strand forming a double stranded region, wherein each of the sense strands independently comprises a nucleotide sequence comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 26-77; or 142-202 of SEQ ID NO: 1, and each of the antisense strands independently comprises a nucleotide sequence comprising at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:6. In one embodiment, each of the sense strand independently comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 27-49; 55-77; 147-169; or 173-195 of SEQ ID NO:1. In one embodiment, one of the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from nucleotides 147-169 of SEQ ID NO:1. In one embodiment, each of the antisense strand comprises independently at least 15 contiguous nucleotides differing by no more that three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1019448; AD-1498524, AD-1498526, or AD-1498528.In one embodiment, one of the antisense strand comprises at least 15 contiguous nucleotides differing by no more that three nucleotides from the antisense strand nucleotide sequence of AD-1498524.In one embodiment, at least one of said sense strands or at least one of said antisense strands is independently conjugated to one or more lipophilic moieties. In one embodiment, all of the sense strands or all of the antisense strand of each of the dsRNA agents are independently conjugated to one or more lipophilic moieties.In one embodiment, each lipophilic moiety is independently conjugated to one or more positions in the double stranded region of the dsRNA agent.In one embodiment, each lipophilic moiety is independently conjugated via a linker or a carrier.In one embodiment, the lipophilicity of each lipophilic moiety, measured by logKow, independently exceeds 0. In one embodiment, the hydrophobicity of each double-stranded RNAi agent, measured by the unbound fraction in a plasma protein binding assay of the double-stranded RNAi agent, independently exceeds 0.2. In one embodiment, the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.In one embodiment, each of the dsRNA agents independently comprises at least one modified nucleotide.In one embodiment, each sense strand and each antisense strand of each dsRNA agent independently comprises no more than five unmodified nucleotides. In one embodiment, all of the nucleotides of each sense strand and all of the nucleotides of each antisense strand independently comprise a modification.In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 3’-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, a 2’-methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic, a nucleotide comprising vinyl phosphonate, a nucleotide comprising adenosine-glycol nucleic acid (GNA), a nucleotide comprising thymidine-glycol nucleic acid (GNA) S-Isomer, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2’-deoxythymidine-3’phosphate, a nucleotide comprising 2’-deoxyguanosine-3’-phosphate, a 2’-O hexadecyl nucleotide, a nucleotide comprising a 2’-phosphate, a cytidine-2`-phosphate nucleotide, a guanosine-2`-phosphate nucleotide, a 2'-O-hexadecyl-cytidine-3'-phosphate nucleotide, a 2'-O-hexadecyl-adenosine-3'-phosphate nucleotide, a 2'-O-hexadecyl-guanosine-3'-phosphate nucleotide, a 2'-O-hexadecyl-uridine-3'-phosphate nucleotide, a a 5’-vinyl phosphonate (VP), a 2`-deoxyadenosine-3`-phosphate nucleotide, a 2`-deoxycytidine-3`-phosphate nucleotide, a 2`-deoxyguanosine-3`-phosphate nucleotide, a 2`-deoxythymidine-3`-phosphate nucleotide, a 2`-deoxyuridine nucleotide, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisdecylamide group; and combinations thereof.In one embodiment, the modified nucleotide is independently selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, 3’-terminal deoxy-thymine nucleotides (dT), a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. In another embodiment, the modified nucleotide comprises a short sequence of 3’-terminal deoxy-thymine nucleotides (dT).In one embodiment, the modifications on the nucleotides are each independently selected from the group consisting of 2’-O-methyl modifications, 2'-deoxy-modifications, or 2’fluoro modifications.In one embodiment, at least one of the dsRNA agents further comprises at least one phosphorothioate internucleotide linkage.In one embodiment, at least one of the dsRNA agents comprises 6-8 phosphorothioate internucleotide linkages.In one embodiment, each strand of each dsRNA agent is independently no more than 30 nucleotides in length.In one embodiment, wherein at least one strand of at least one dsRNA agent independently comprises a 3’ overhang of at least 1 nucleotide.In another embodiment, at least one strand of at least one dsRNA agent independently comprises a 3’ overhang of at least 2 nucleotides.The double stranded region of each dsRNA agent may be independently 15-30 nucleotide pairs in length; 17-23 nucleotide pairs in length; 17-25 nucleotide pairs in length; 23-27 nucleotide pairs in length; 19-21 nucleotide pairs in lengthl or 21-23 nucleotide pairs in length.Each strand of each dsRNA agent may be independently has 19-30 nucleotides; 19-23 nucleotides in length; or 21-23 nucleotides in length.In one embodiment, each dsRNA agent comprises one or more lipophilic moieties independently conjugated to one or more internal positions on at least one strand.In one embodiment, the one or more lipophilic moieties are each independently conjugated to one or more internal positions on at least one strand via a linker or carrier. In one embodiment, each of the internal positions independently include all positions except the terminal two positions from each end of the at least one strand. In one embodiment, each of the internal positions independently include all positions except the terminal three positions from each end of the at least one strand. In one embodiment, each of the internal positions independently exclude a cleavage site region of the sense strand.In one embodiment, each of the internal positions indeepndently include all positions except positions 9-12, counting from the 5’-end of the sense strand.In one embodiment, each of the internal positions independently include all positions except positions 11-13, counting from the 3’-end of the sense strand.In one embodiment, each of the internal positions independently exclude a cleavage site region of the antisense strand.In one embodiment, each of the the internal positions independently include all positions except positions 12-14, counting from the 5’-end of the antisense strand.In one embodiment, each of the the internal positions independently include all positions except positions 11-13 on the sense strand, counting from the 3’-end, and positions 12-14 on the antisense strand, counting from the 5’-end.In one embodiment, each of the one or more lipophilic moieties are independently conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5’end of each strand.In one embodiment, the one or more lipophilic moieties are each independently conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5’-end of each strand.In one embodiment, each of the positions in the double stranded region independently exclude a cleavage site region of the sense strand.In one embodiment, each of the sense strands is independently 21 nucleotides in length, each of the the antisense strands is independently 23 nucleotides in length, and each of the lipophilic moieties is independently conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand. In one embodiment, each of the lipophilic moieties is independently conjugated to position 21, position 20, position 15, position 1, or position 7 of the sense strand. In one embodiment, each of the lipophilic moieties is independently conjugated to position 21, position 20, or position 15 of the sense strand. In one embodiment, each of the lipophilic moieties is independently conjugated to position 20 or position 15 of the sense strand. In one embodiment, each of the lipophilic moieties is independently conjugated to position 16 of the antisense strand.In one embodiment, each of the lipophilic moieties is independently an aliphatic, alicyclic, or polyalicyclic compound. In one embodiment, each of the lipophilic moieties is independently selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine. In one embodiment, each of the lipophilic moieties independently contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In one embodiment, each of the lipophilic moieties independently contains a saturated or unsaturated C6-C18 hydrocarbon chain.In one embodiment, each of the lipophilic moieties independently contains a saturated or unsaturated C16 hydrocarbon chain.In one embodiment, each of the saturated or unsaturated C16 hydrocarbon chain is independently conjugated to position 6, counting from the 5’-end of the strand.In one embodiment, each of the lipophilic moieties is independently conjugated via a carrier that replaces one or more nucleotide(s) in the internal position(s) or the double stranded region.In one embodiment, each of the carriers is independently a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone.In one embodiment, each of the lipophilic moieties is independently conjugated to the double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate. In one embodiment, each of the lipophilic moieties is independently conjugated to a nucleobase, sugar moiety, or internucleosidic linkage. In one embodiment, each of the lipophilic moieties or one or more targeting ligands is independently conjugated via a bio-clevable linker selected from the group consisting of DNA, RNA, disulfide, amide, funtionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.In one embodiment, the 3’ end of at least one of the sense strands is independently protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl. In one embodiment, at least one of the dsRNA agents further comprises a phosphate or phosphate mimic at the 5’-end of the antisense strand.In one embodiment, each of the phosphate mimic is independently a 5’-vinyl phosphonate (VP).In one embodiment, each of the sense strands independently has a total of 21 nucleotides and each of the the antisense strands independently has a total of 23 nucleotides.In another embodiment, the RNAi agent is a pharmaceutically acceptable salt thereof. “Pharmaceutically acceptable salts” of each of RNAi agents herein include, but are not limited to, a sodium salt, a calcium salt, a lithium salt, a potassium salt, an ammonium salt, a magnesium salt, an mixtures thereof. One skilled in the art will appreciate that the RNAi agent, when provided as a polycationic salt having one cation per free acid group of the optionally modified phosophodiester backbone and / or any other acidic modifications (e.g., 5’-terminal phosphonate groups). For example, an oligonucleotide of “n” nucleotides in length contains n-1 optionally modified phosophodiesters, so that an oligonucleotide of 21 nt in length may be provided as a salt having up to 20 cations (e.g., 20 sodium cations). Similarly, an RNAi agentshaving a sense strand of 21 nt in length and an antisense strand of 23 nt in length may be provided as a salt having up to 42 cations (e.g., 42 sodium cations). In the preceding example, where the RNAi agent also includes a 5’-terminal phosphate or a 5’-terminal vinylphosphonate group, the RNAi agent may be provided as a salt having up to 44 cations (e.g., 44 sodium cations). The present invention also provides cells and pharmaceutical compostions comprising the compositions of the invention, e.g., comprising a lipid formulation.An additional aspect of the disclosure provides a method of inhibiting expression of an HTT gene in a cell, the method including (a) contacting the cell with a double stranded RNAi agent of the instant disclosure, a composition of the invention, or a pharmaceutical composition of of the instant disclosure; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of an HTT gene, thereby inhibiting expression of the HTT gene in the cell.In one embodiment, the cell is contacted with two or more, e.g., 2, 3, or 4, of the dsRNA agents of the invention (or compositions of the invention), such as a first dsRNA agent targeting exon 1 of human HTT nd a second dsRNA agent targeting full-length human HTT.In one embodiment, the cell is within a subject. Optionally, the subject is a human.In certain embodiments, the subject is a rhesus monkey, a cynomolgous monkey, a mouse, or a rat. In certain embodiments HTT expression is inhibited by at least about 50% by the RNAi agent.In certain embodiments, the human subject has been diagnosed with an HTT-associated disease, e.g., Huntington’s disease. Another aspect of the disclosure provides a method of treating a subject diagnosed with an HTT-associated disease, e.g., Huntington’s disease, the method including administering to the subject a therapeutically effective amount of a double stranded RNAi agent of the disclosure, a composition of the invention, or a pharmaceutical composition of the disclosure, thereby treating the subject.In one embodiment, the subject is administered two or more, e.g., 2, 3, or 4, dsRNA agents of the invention (or compositions of the invention), such as a first dsRNA agent targeting exon 1 of human HTT nd a second dsRNA agent targeting full-length human HTT.The first and second dsRNA agents may be present in the same or separate compositions.The first and second dsRNA agents may be administered to the subject in the same time or different times. In one embodiment, treating comprises amelioration of at least on sign or symptom of the disease. In another embodiment, treating comprises prevention of progression of the disease. In some embodiments, the dsRNA agent is administered to the subject at a dose of about 0.01 mg / kg to about 50 mg / kg. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In one embodiment, the method reduces the expression of an HTT gene in a brain (e.g., striatum) or spine tissue. Optionally, the brain or spine tissue is striatum, cortex, cerebellum, cervical spine, lumbar spine, or thoracic spine. In some embodiments, the method further comprises measuring a level of HTT in a sample obtained from the subject.Another aspect of the instant disclosure provides a method of inhibiting the expression of huntingtin (HTT) in a subject, the method involving: administering to the subject a therapeutically effective amount of a double stranded RNAi agent of the disclosure or a pharmaceutical composition of the disclosure, thereby inhibiting the expression of HTT in the subject. In some embodiment, the method further comprises administering to the subject an additional agent suitable for treatment or prevention of an HTT-associated disorder. BRIEF DESCRIPTIONS OF THE FIGURESFigure 1 is a graph depicting HTT knockdown in the indicated regions of the brain and spine of non-human primates having greater than 1000 ng / mL siRNA in CSF at 24 hours post intrathecal administration of a single 60 mg dose of the indicated duplexes.Figure 2 is a table depicting the inhibition of HTT mRNA expression in the indicated regions of the brain and spine of non-human primates (n=5 per group) at 24 hours post intrathecal administration of a single 60 mg dose of the indicated duplexes.Figure 3A is a graph depicting the concentration of siRNA in the CSF of the indicated non-human primates (see Figure 2) at 24 hours post intrathecal administration of a single 60 mg dose of duplex.Figure 3B is a graph depicting the concentration of siRNA in the prefrontal cortex of the indicated non-human primates (see Figure 2) at 45 days post intrathecal administration of a single 60 mg dose of duplex.Figure 3Cis a graph depicting the concentration of siRNA in the straitum (caudate) of the indicated non-human primates (see Figure 2) at 45 days post intrathecal administration of a single 60 mg dose of duplex.Figure 3D is a graph depicting the concentration of siRNA in the striatum (putamen) of the indicated non-human primates (see Figure 2) at 45 days post intrathecal administration of a single 60 mg dose of duplex.Figure 3E is a graph depicting the concentration of siRNA in the thoracic spine of the indicated non-human primates (see Figure 2) at 45 days post intrathecal administration of a single 60 mg dose of duplex.Figure 4A is a graph depicting the correlation of siRNA concentration in brain and spinal tissues to the level of knock down of HTT in non-human primates intrathecaly administered a single 60 mg dose of all duplexes tested.Figure 4B is a graph depicting the correlation of siRNA concentration in brain and spinal tissues to the level of knock down of HTT in non-human primates intrathecaly administered a single 60 mg dose of duplex AD-1019465.Figure 4C is a graph depicting the correlation of siRNA concentration in brain and spinal tissues to the level of knock down of HTT in non-human primates intrathecaly administered a single 60 mg dose of duplex AD-1271082.Figure 4D is a graph depicting the correlation of siRNA concentration in brain and spinal tissues to the level of knock down of HTT in non-human primates intrathecaly administered a single 60 mg dose of duplex AD-1271085.Figure 5A is a graph depicting the concentration of siRNA in plasma samples over time following a single intrathecal 60 mg dose of duplex.Figure 5B is a graph depicting the concentration of siRNA in CSF and plasma at the indicated times following a single intrathecal administration of 60 mg of all tested duplexes (see Figure 2).Figure 6A is a graph depicting the level of knockdown of mutant human HTT mRNA in the frontal cortex of YAC128 administered a single 300 g / kg dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). For comparison purposes the effect of the antisense oligonucleotide, Tominersen (Roche, also known as IONIS-HTTRx and RG6042) is also shown.Figure 6B is a Western blot and a graph depicting the level of mutant human HTT protein and mouse wild type protein knock down in in the frontal cortex of YAC128 administered a single 300 g / kg dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). The human protein levels are quantified in the graph below. For comparison purposes the effect of the antisense oligonucleotide, Tominersen (Roche, also known as IONIS-HTTRx and RG6042) is also shown in the graph.Figure 7 schematically depicts the portion of the Htt transcipt assessed by each assay of the QuantiGene panel. From Papadopoulou, et al. (2019) Scientific Reports volume 9, Article number 16137.Figure 8A is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 with the polyA-site 1 (the 680 bp variant) expression in the spinal cord and striatum of Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control, and the level of Htt (mouse endogenous), intron 1 with the polyA-site 1 (the 680 bp variant) expression in the spinal cord and striatum of wild-type mice. Mean+ / -SD, ***p<0.001 (ANOVA with Dunnett’s multiple comparisons test) and ###p<0.001 (unpaired t-test with Si-control against WT). Normalized to geomean of 3 reference genes.Figure 8B is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 with the polyA-site 2 (the 1145 bp variant) expression in the spinal cord and striatum of Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control, and the level of Htt (mouse endogenous), intron 1 with the polyA-site 1 (the 680 bp variant) expression in the spinal cord and striatum of wild-type mice. Mean+ / -SD, *p<0.05 (ANOVA with Dunnett’s multiple comparisons test) and ##p<0.01; ###p<0.001 (unpaired t-test with Si-control against WT). Normalized to geomean of 3 reference genes.Figure 8C is a graph depicting the mean fluorescent intensity (MFI) of Huntingtin, full-length (total) expression in the spinal cord and striatum of Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control, and the level of Huntingtin, full-length (total) expression in the spinal cord and striatum of wild-type mice. Data is presented as mean with SD, n = 3-6 per group. Pairwise comparisons as indicated: *p<0.05; **p<0.01; ****p<0.0001 (ANOVA with Dunnett’s multiple comparisons test) and ###p<0.001; ####p<0.0001 (unpaired t-test with Si-control against WT). The comparison between group 1 and group 6 serves as a control for the model (genotype) effect. Normalized to geomean of 3 reference genes.Figure 8D is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 at its 3’ end expression (as a negtive control for detection of retained intronic region expression) in the spinal cord and striatum of Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control, and the level of Huntingtin, full-length (total) expression in the spinal cord and striatum of wild-type mice. Normalized to geomean of 3 reference genes.Figure 8E is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 3 expression (as a negative control for detection of retained intronic region expression) in the spinal cord and striatum of Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control, and the level of Huntingtin, full-length (total) expression in the spinal cord and striatum of wild-type mice. Normalized to geomean of 3 reference genes.Figure 8F is a graph depicting the concentration of mutant Huntingtin protein in the spinal cord and striatum of heterozygous Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents, a non-targting control agent, or aCSF control. The concentration of mutant Huntingtin protein is shown as femtomoles of mutant Huntingtin protein per milligram of total protein.Figure 8Gis a graph depicting the concentration of wild-type Huntingtin protein in the spinal cord and striatum of heterozygous Q175 KI mice following a single intracerebroventricular injection of 300 g of the indicated agents, a non-targeting control agent, or aCSF control. The concentration of wild-type Huntingtin protein is shown as femtomoles of wild-type Huntingtin protein per milligram of total protein.Figure 9 depicts the percent HTT protein reminaing in prefrontal cortex, hippocampus, striatum caudate, lumbar spine, and thoracic spine tissues of non-human primates intrathecally administered a single 60 mg dose of AD-1019465 (n=5), AD-1271082 (n=5), or AD-1271085 (n=5) at Day 45 post-dose. The percent of HTT protein remaining is relative to the level of HTT protein in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 10A is a graph depicting the level of knockdown of mutant human HTT mRNA in the frontal cortex of YAC128 administered a single 300 g or 600 g dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). For comparison purposes the effect of the antisense oligonucleotide, A-1800326 (Tominersen; Roche, also known as IONIS-HTTRx and RG6042) is also shown.Figure 10B is a graph depicting the level of knockdown of wild-type mouse HTT mRNA in the frontal cortex of YAC128 administered a single 300 g or 600 g dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). For comparison purposes the effect of the antisense oligonucleotide, A-1800326 (Tominersen; Roche, also known as IONIS-HTTRx and RG6042) is also shown.Figure 10C is a Western blot depicting the level of mutant human HTT protein and mouse wild type protein knock down in the frontal cortex of YAC128 mice administered a single 300 g or 600 g dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). “a-CSF” refers to artificial CSF; “476-600” refers to a 600 g / kg dose of AD-1019476; and “476-300” refers to a 300 g / kg dose of AD-1019476. MAB2166 (EMD Millipore) was used for protein detection.Figure 10D is a Western blot depicting the level of mutant human HTT protein and mouse wild type protein knock down in the frontal cortex of YAC128 mice administered a single 300 g or 600 g dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). “a-CSF” refers to artificial CSF; “079-600” refers to a 600 g / kg dose of AD-1443079; “079-300” refers to a 300 g / kg dose of AD-1443079; “080-600” refers to a 600 g / kg dose of AD-1443080; and “080-300” refers to a 300 g / kg dose of AD-1443080. MAB2166 (EMD Millipore) was used for protein detection.Figure 10E is a Western blot and graphs depicting the level of mutant human HTT protein and mouse wild type protein knock down in the frontal cortex of YAC128 administered a single 300 g or 600 g dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). Lysates from Figure 10C were re-analyzed with D7F7 antibody to confirm observed HTT protein knockdown. The mutant human HTT protein and mouse wild type protein levels are quantified in the graphs below. “a-CSF” refers to artificial CSF; “476-600” refers to a 600 g / kg dose of AD-1019476; and “476-300” refers to a 300 g / kg dose of AD-1019476.Figure 10F is a Western blot and graphs depicting the level of mutant human HTT protein and mouse wild type protein knock down in in the frontal cortex of YAC128 administered a single 300 g or 600 g dose of the indicated duplexes or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). Lysates from Figure 10D were re-analyzed with D7F7 antibody to confirm observed HTT protein knockdown. The mutant human HTT protein and mouse wild type protein levels are quantified in the graphs below. Quantififation from both blots (Figure 10E and Figure 10F blots) are shown side by side for comparison. “a-CSF” refers to artificial CSF; “079-600” refers to a 600 g / kg dose of AD-1443079; “079-300” refers to a 300 g / kg dose of AD-1443079; “080-600” refers to a 600 g / kg dose of AD-1443080; and “080-300” refers to a 300 g / kg dose of AD-1443080.Figure 11A is a graph depicting the level of mutant human HTT protein in the frontal cortex of YAC128 administered a single 37.5 g, 75 g, 150 g or 300 g dose of AD-1019476, or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). Two different antibodies were used, MAB2166 (EMD Millipore) and D7F7 (Cell Signaling), and the results from both antibodies demonstrated similar knockdown of HTT protein.Figure 11B is a graph depicting the level of mouse wild type protein in the frontal cortex of YAC128 administered a single 37.5 g, 75 g, 150 g or 300 g dose of AD-1019476, or artificial CSF (aCSF) control by intracerebroventricular injection (ICV). Two different antibodies were used, MAB2166 (EMD Millipore) and D7F7 (Cell Signaling), and the results from both antibodies demonstrated similar knockdown of HTT protein.Figure 12A is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 with the polyA-site 1 (the 680 bp variant) expression in the spinal cord of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. Statistical significances: **** p < 0.0001, Q175 HET Si-Control 10 mo vs. Q175 WT Si-Control 10 mo; * p < 0.05, *** p < 0.001, Q175 WT Si-Control 12 mo & Q175 HET AD-1498524 12 mo vs. Q175 HET Si-Control 12 mo (Unpaired t test with Welch correction / Welch's ANOVA test, Dunnett's T3 multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12B is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 with the polyA-site 2 (the 1145 bp variant) expression in the spinal cord of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. Statistical significances: ** p < 0.01, Q175 HET Si-Control 10 mo vs. Q175 WT Si-Control 10 mo; * p < 0.05, ** p < 0.001, Q175 WT Si-Control 12 mo, Q175 HET AD-1498524 12 mo & Q175 HET AD-1271085 12 mo vs. Q175 HET Si-Control 12 mo (Unpaired t test with Welch correction / Ordinary one-way ANOVA, Dunnett's multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12C is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 at its 3’ end expression (as a negtive control for detection of retained intronic region expression) in the spinal cord of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. Statistical significances: * p < 0.05, Q175 HET AD-1019448 10 mo vs. Q175 HET Si-Control 10 mo (Ordinary one-way ANOVA, Dunnett's multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12D is a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 3 expression (as a negative control for detection of retained intronic region expression) in the spinal cord of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. No statistical significances: p > 0.05, (Unpaired t test with Welch correction / Ordinary One-way ANOVA). Normalized to geomean of 3 reference genes.Figure 12E is a graph depicting the mean fluorescent intensity (MFI) of Huntingtin, full-length (total) expression in the spinal cord of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n = 3-10 per group. Statistical significances: ** p < 0.01, *** p < 0.001, **** p < 0.0001, Q175 WT Si-Control 10 mo, Q175 HET AD-1271085 10 mo, Q175 HET AD-1498524 10 mo, Q175 HET AD-1019448 10 mo vs. Q175 HET Si-Control 10 mo; *** p < 0.001, **** p < 0.0001, Q175 WT Si-Control 12 mo, Q175 HET AD-1271085 12 mo & Q175 HET AD-1498524 12 mo vs. Q175 HET Si-Control 12 mo (Unpaired t test with Welch correction / Ordinary one-way ANOVA, Dunnett's multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12Fis a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 with the polyA-site 1 (the 680 bp variant) expression in the striatum of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. Statistical significances: **** p < 0.0001, Q175 HET Si-Control 10 mo vs. Q175 WT Si-Control 10 mo; **** p < 0.0001, Q175 WT Si-Control 12 mo & Q175 HET AD-1498524 12 mo vs. Q175 HET Si-Control 12 mo (Unpaired t test with Welch correction / Welch's ANOVA test, Dunnett's T3 multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12Gis a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 with the polyA-site 2 (the 1145 bp variant) expression in the striatum of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. Statistical significances: *** p < 0.001, Q175 HET Si-Control 10 mo vs. Q175 WT Si-Control 10 mo; * p < 0.05, *** p < 0.001, Q175 WT Si-Control 12 mo & Q175 HET AD-1498524 12 mo vs. Q175 HET Si-Control 12 mo (Unpaired t test with Welch correction / Ordinary one-way ANOVA, Dunnett's multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12His a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 1 at its 3’ end expression (as a negtive control for detection of retained intronic region expression) in the striatum of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. Statistical significances: * p < 0.05, Q175 HET AD-1271085 10 mo & Q175 HET AD-1019448 10 mo vs. Q175 HET Si-Control 10 mo (Ordinary one-way ANOVA, Dunnett's multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12Iis a graph depicting the mean fluorescent intensity (MFI) of Htt (mouse endogenous), intron 3 expression (as a negative control for detection of retained intronic region expression) in the striatum of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n=3-10 per group. No statistical significances: p > 0.05, (Unpaired t test with Welch correction / Ordinary One-way ANOVA). Normalized to geomean of 3 reference genes.Figure 12J is a graph depicting the mean fluorescent intensity (MFI) of Huntingtin, full-length (total) expression in the striatum of Q175 WT and HET mice 10 months and 12 months following a single intracerebroventricular injection of 300 g of the indicated agents or aCSF control (Si-Control). Data is presented as mean with SD, n = 3-10 per group. Statistical significances: ** p < 0.01, *** p < 0.001, Q175 WT Si-Control 10 mo, Q175 HET AD-1271085 10 mo, Q175 HET AD-1498524 10 mo, Q175 HET AD-1019448 10 mo vs. Q175 HET Si-Control 10 mo; **** p < 0.0001, Q175 WT Si-Control 12 mo, Q175 HET AD-1271085 12 mo & Q175 HET AD-1498524 12 mo vs. Q175 HET Si-Control 12 mo (Unpaired t test with Welch correction / Ordinary one-way ANOVA, Dunnett's multiple comparisons test). Normalized to geomean of 3 reference genes.Figure 12K is a graph depicting the concentration of mutant Huntingtin protein (top) and the concentration of the total HTT protein (bottom) in the striatum of WT and Q175 HET mice following a single intracerebroventricular injection of 300 g of the indicated agents, or a CSF control (Si-Control). The concentration of mutant and total Huntingtin protein is shown as femtomoles of mutant Huntingtin protein per milligram of total protein. Statistical significances: Q175 Het Si-Control vs treatments: One-way ANOVA followed by Dunnett’s multiple comparisons test compared at the respective timepoint. *p ≤0.05, ***p <0.001, **p <0.01, ****p<0.0001.Figure 12L is a graph depicting the concentration of mutant Huntingtin protein (top) and the concentration of the total HTT protein (bottom) in the spinal cord of WT and Q175 HET mice following a single intracerebroventricular injection of 300 g of the indicated agents, or aCSF control (Si-Control). The concentration of mutant and total Huntingtin protein is shown as femtomoles of mutant Huntingtin protein per milligram of total protein. Statistical significances: Q175 Het Si-Control vs treatments: One-way ANOVA followed by Dunnett’s multiple comparisons test compared at the respective timepoint. ***p <0.001, **p <0.01, ****p<0.0001.Figure 13Ais a graph depicting the percent HTT transcript remaining in prefrontal cortex, hippocampus, striatum putamen, striatum caudate, and lumbar spine (spine L1-L3) tissues of non-human primates intrathecally administered a single 3 mg or 10 mg dose of AD-1271085 (n=8) at Day 33 post-dose. The percent of HTT transcript remaining is relative to the level of HTT transcript in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 13Bis a graph depicting the percent HTT transcript remaining in prefrontal cortex, hippocampus, striatum putamen, and striatum caudate tissues of non-human primates intrathecally administered a single 3 mg or 10 mg dose of AD-1271085 (n=8) at Day 33 post-dose. The percent of HTT transcript remaining is relative to the level of HTT transcript in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 13C is a graph depictingthe percent HTT protein remaining in prefrontal cortex, hippocampus, striatum putamen, striatum caudate, and lumbar spine (spine L1-L3) tissues of non-human primates intrathecally administered a single 3 mg or 10 mg dose of AD-1271085 (n=8) at Day 33 post-dose. The percent of HTT protein remaining is relative to the level of HTT protein in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 13Dis a graph depicting the percent HTT protein remaining in prefrontal cortex, hippocampus, striatum putamen, and striatum caudate tissues of non-human primates intrathecally administered a single 3 mg or 10 mg dose of AD-1271085 (n=8) at Day 33 post-dose. The percent of HTT protein remaining is relative to the level of HTT protein in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 13Eis a graph depicting the correlation of the effect of intrathecal administration of a single 3 mg or 10 mg dose of AD-1271085 (n=8) at Day 33 post-dose on the percent HTT transcript and protein remaining in prefrontal cortex, hippocampus, striatum putamen, striatum caudate, and lumbar spine (spine L1-L3) tissues of non-human primates. The percent of HTT protein and trancript remaining is relative to the level of HTT protein and transcript in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 14Ais a graph depicting the percent HTT protein remaining in striatum caudate, striatum putamen, hippocampus, prefrontal cortex, and lumbar spine tissues of non-human primates intrathecally administered a single 60 mg dose of AD-1498524, AD-1498526 or AD-1498528 (n=5) at Day 59 post-dose. The percent of HTT protein remaining is relative to the level of HTT protein in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 14B is a graph depicting the percent HTT transcript remaining in striatum caudate, striatum putamen, hippocampus, prefrontal cortex, and lumbar spine tissues of non-human primates intrathecally administered a single 60 mg dose of AD-1498524, AD-1498526 or AD-1498528 (n=5) at Day 59 post-dose. The percent of HTT transcript remaining is relative to the level of HTT transcript in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 14C is a graph depictingthe percent HTT transcript remaining in prefrontal cortex, hippocampus, striatum putamen, and lumbar spine tissues of non-human primates intrathecally administered a single 60 mg dose of AD-1498524, AD-1498526 or AD-1498528 (n=5) at Day 59 post-dose. The percent of HTT transcript remaining is relative to the level of HTT transcript in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 14D is a graph depictingthe correlation of the effect of intrathecal administration of a single 60 mg dose of AD-1498524, AD-1498526 or AD-1498528 (n=5) at Day 59 post-dose on the percent HTT transcript and protein remaining in tissues of non-human primates. The percent of HTT protein and trancript remaining is relative to the level of HTT protein and transcript in the corresponding tissues of non-human primates administered artificial CSF (aCSF).Figure 15 are schematics of the structuresof the indicated duplexes. Detailed Description of the InventionThe present disclosure provides RNAi compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a huntingtin (HTT) gene. The HTT gene may be within a cell, e.g., a cell within a subject, such asa human. The use of these iRNAs enables the targeted degradation of mRNAs of the corresponding gene (HTT gene) in mammals. The iRNAs of the invention have been designed to target a full-length HTT gene, including portions of the gene that are conserved in the HTT orthologs of other mammalian species, e.g., thereby targeting the full-length wild-type transcript and the full-length mutant transcript. Without intending to be limited by theory, it is believed that a combination or sub-combination of the foregoing properties and the specific target sites, or the specific modifications in these iRNAs confer to the iRNAs of the invention improved efficacy, stability, potency, durability, and safety. Accordingly, the present disclosure also provides methods of using the RNAi compositions of the disclosure, including., compositions comprising one or more, e.g., 2, 3, or 4, dsRNA agents of the invention, for inhibiting the expression of an HTT gene or for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of an HTT gene, e.g., an HTT-associated disesase, for example, Huntington’s disease (HD).The RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an HTT gene. In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 21-23 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an HTT gene. In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) which can include longer lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of an HTT gene. These RNAi agents with the longer length antisense strands preferably include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides. The use of these RNAi agents enables the targeted degradation of mRNAs of an HTT gene in mammals. Thus, methods and compositions including these RNAi agents are useful for treating a subject who would benefit by a reduction in the levels or activity of an HTT protein, such as a subject having an HTT-associated disease, such as Huntington’s disease (HD). The following detailed description discloses how to make and use compositions containing RNAi agents to inhibit the expression of an HTT gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition or reduction of the expression of the genes. I. DefinitionsIn order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure.The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. The term “at least”, “no less than”, or “or more”prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range. As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or intergers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. As used herein, methods of detection can include determination that the amount of analyte present is below the level of detection of the method. In the event of a conflict between an indicated target site and the nucleotide sequence for a sense or antisense strand, the indicated sequence takes precedence. In the event of a conflict between a chemical structure and a chemical name, the chemical structure takes precedence. The term “HTT” or “huntingtin”, also known as “Huntingtin,” “Huntington Disease Protein,” “IT15,” “HD,” HD Protein,” or “LOMARS,” refers to the well-known gene that encodes the protein, HTT, that is widely expressed, required for normal development and the disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons caused by an expanded, unstable trinucleotide (CAG) repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. Exemplary nucleotide and amino acid sequences of HTT can be found, for example, at GenBank Accession No. NM_002111.8 (Homo sapiens HTT, SEQ ID NO: 1, reverse complement, SEQ ID NO: 6); GenBank Accession No. NM_010414.3 (Mus musculus HTT, SEQ ID NO: 2; reverse complement, SEQ ID NO: 7); GenBank Accession No.: NM_024357.3 (Rattus norvegicus HTT, SEQ ID NO: 3, reverse complement, SEQ ID NO: 8); GenBank Accession No.: XM_015449989.1 (Macaca fascicularis HTT, SEQ ID NO: 4, reverse complement, SEQ ID NO: 9); and GenBank Accession No.: XM_028848247.1 (Macaca mulatta HTT, SEQ ID NO: 5, reverse complement, SEQ ID NO: 10).Additional examples of HTT sequences can be found in publically available databases, for example, GenBank, OMIM, and UniProt. Further information on HTT can be found, for example, at www.ncbi.nlm.nih.gov / gene / 3064. The entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.The term HTT, as used herein, also refers to variations of the HTT gene including variants provided in the SNP database. Numerous seuqnce variations within the HTT gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., www.ncbi.nlm.nih.gov / snp / ?LinkName=gene_snp&from_uid=3064, the entire contents of which is incorporated herein by reference as of the date of filing this application. As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an HTT gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodment, the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an HTT gene. The target sequence is about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In certain embodiments, the target sequence is 19-23 nucleotides in length, optionally 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.“G,” “C,” “A,” “T”, and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively in the context of a modified or unmodified nucleotide. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, thymidine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure. The terms “iRNA”, “RNAi agent,” “iRNA agent,” “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. RNA interference (RNAi) is a process that directs the sequence-specific degradation of mRNA. RNAi modulates, e.g., inhibits, the expression of HTT in a cell, e.g., a cell within a subject, such as a mammalian subject.In one embodiment, an RNAi agent of the disclosure includes a single stranded RNAi that interacts with a target RNA sequence, e.g., an HTT target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into double-stranded short interfering RNAs (siRNAs) comprising a sense strand and an antisense strand by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes these dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the disclosure relates to a single stranded RNA (ssRNA) (the antisense strand of a siRNA duplex) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., an HTT gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above.In another embodiment, the RNAi agent may be a single-stranded RNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAs are described in U.S. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.In another embodiment, a “RNAi agent” for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA” refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., an HTT gene. In some embodiments of the disclosure, a double stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.In general, a dsRNA molecule can include ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide, a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotide if present within an RNAi agent can be considered to constitute a modified nucleotide. The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 15-36 base pairs in length, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex region is 19-21 base pairs in length, e.g., 21 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides or nucleotides not directed to the target site of the dsRNA. In some embodiments, the hairpin loop can be 10 or fewer nucleotides. In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. In certain embodiments where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker” (though it is noted that certain other structures defined elsewhere herein can also be referred to as a “linker”). The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs. In one embodiment of the RNAi agent, at least one strand comprises a 3’ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5’ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3’ and the 5’ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.In one embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which independently comprises 19-23 nucleotides, that interacts with a target RNA sequence,e.g., an HTT target mRNA sequence, to direct the cleavage of the target RNA. As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an RNAi agent, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.In certain embodiments, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end or the 5’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.In certain embodiments, the overhang on the sense strand or the antisense strand, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.In certain embodiments, at least one end of at least one strand is extended beyond a duplex targeting region, including structures where one of the strands includes a thermodynamically -stabilizing tetraloop structure (see, e.g., U.S. Patent Nos. 8,513,207 and 8,927,705, as well as W02010033225, the entire contents of each of which are incorporated by reference herein). Such structures may include single-stranded extensions (on one or both sides of the molecule)as well as double-stranded extensions.In certain embodiments, the 3' end of the sense strand and the 5' end of the antisense strand are joined by a polynucleotide sequence comprising ribonucleotides, deoxyribonucleotides or both, optionally wherein the polynucleotide sequence comprises a tetraloop sequence. In certain embodiments, the sense strand is 25-35 nucleotides in length.A tetraloop may contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Typically, a tetraloop has 4 to 5 nucleotides. In some embodiments, the loop comprises a sequence set forth as GAAA. In some embodiments, at least one of the nucleotide of the loop (GAAA) comprises a nucleotide modification. In some embodiments, the modified nucleotide comprises a 2'-modification. In some embodiments, the 2 '-modification is a modification selected from the group consisting of 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'- aminodiethoxymethanol, 2'- adem, and 2'-deoxy-2'-fhioro- -d-arabinonucleic acid. In some embodiments, all of the nucleotides of the loop are modified. In some embodiments, the G in the GAAA sequence comprises a 2'-OH. In some embodiments, each of the nucleotides in the GAAA sequence comprises a 2'-O-methyl modification. In some embodiments, each of the A in the GAAA sequence comprises a 2'-OH and the G in the GAAA sequence comprises a 2'-O-methyl modification. In preferred embodiments, In some embodiments, each of the A in the GAAA sequence comprises a 2'-O-methoxyethyl (MOE) modification and the G in the GAAA sequence comprises a 2'-O-methyl modification; or each of the A in the GAAA sequence comprises a 2'- adem modification and the G in the GAAA sequence comprises a 2'-O-methyl modification. See, e.g., PCT Publication No. WO 2020 / 206350, the entire contents of which are incorporated herein by reference.An exemplary 2’adem modified nucleotide is shown below: . The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends,i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double stranded over its entire length. The term “antisense strand” or "guide strand" refers to the strand of an RNAi agent, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., an HTT mRNA. As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., an HTT nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions,e.g., within 5, 4, 3, or 2 nucleotides of the 5’- or 3’-terminus of the RNAi agent. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the antisense strand. In some embodiments, the antisense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the target mRNA, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the target mRNA. In some embodiments, the antisense strand double stranded RNA agent of the invention includes no more than 4 mismatches with the sense strand, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the sense strand. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the sense strand. In some embodiments, the sense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the antisense strand, e.g., the sense strand includes 4, 3, 2, 1, or 0 mismatches with the antisense strand. In some embodiments, the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3’-end of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3’-terminal nucleotide of the iRNA agent. In some embodiments, the mismatch(s) is not in the seed region.Thus, an RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5’- or 3’-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of an HTT gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of an HTT gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of an HTT gene is important, especially if the particular region of complementarity in an HTT gene is known to have polymorphic sequence variation within the population.The term “sense strand” or "passenger strand" as used herein, refers to the strand of an RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Complementary sequences within an RNAi agent, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.“Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an RNAi agent and a target sequence, as will be understood from the context of their use.As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding HTT). For example, a polynucleotide is complementary to at least a part of an HTT mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding HTT. Accordingly, in some embodiments, the antisense polynucleotides disclosed herein are fully complementary to the target HTT sequence. In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target complement component HTT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs:1-5, or a fragment of any one of SEQ ID NOs:1-5, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target HTT sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences in any one of any one of Tables 2-5, or a fragment of any one of the sense strand nucleotide sequences in any one of Tables 2-5, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary. In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is the same as a target HTT sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 6-10, or a fragment of any one of SEQ ID NOs:6-10, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary. In some embodiments, an iRNA of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target HTT sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the antisense strand nucleotide sequences in any one of any one of Tables 2-5, or a fragment of any one of the antisense strand nucleotide sequences in any one of Tables 2-5, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary.In one embodiment, at least partial suppression of the expression of an HTT gene, is assessed by a reduction of the amount of HTT mRNA which can be isolated from or detected in a first cell or group of cells in which an HTT gene is transcribed and which has or have been treated such that the expression of an HTT gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of:The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the central nervous system (CNS), optionally via intrathecal, intravitreal or other injection, or to the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain or be coupled to a ligand, e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in PCT / US2019 / 031170, which is incorporated herein by reference, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the CNS. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.In one embodiment, contacting a cell with an RNAi agent includes “introducing” or “delivering the RNAi agent into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an RNAi agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an RNAi agent into a cell may be in vitro or in vivo. For example, for in vivo introduction, an RNAi agent can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.The term “lipophile” or “lipophilic moiety” broadly refers to any compound or chemical moiety having an affinity for lipids. One way to characterize the lipophilicity of the lipophilic moiety is by the octanol-water partition coefficient, logKow, where Kow is the ratio of a chemical’s concentration in the octanol-phase to its concentration in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, for example, Tetko et al., J. Chem. Inf. Comput. Sci. 41:1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measure of the tendency of the substance to prefer a non-aqueous or oily milieu rather than water (i.e. its hydrophilic / lipophilic balance). In principle, a chemical substance is lipophilic in character when its logKow exceeds 0. Typically, the lipophilic moiety possesses a logKow exceeding 1, exceeding 1.5, exceeding 2, exceeding 3, exceeding 4, exceeding 5, or exceeding 10. For instance, the logKow of 6-amino hexanol, for instance, is predicted to be approximately 0.7. Using the same method, the logKow of cholesteryl N-(hexan-6-ol) carbamate is predicted to be 10.7.The lipophilicity of a molecule can change with respect to the functional group it carries. For instance, adding a hydroxyl group or amine group to the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., logKow) value of the lipophilic moiety.Alternatively, the hydrophobicity of the double-stranded RNAi agent, conjugated to one or more lipophilic moieties, can be measured by its protein binding characteristics. For instance, in certain embodiments, the unbound fraction in the plasma protein binding assay of the double-stranded RNAi agent could be determined to positively correlate to the relative hydrophobicity of the double-stranded RNAi agent, which could then positively correlate to the silencing activity of the double-stranded RNAi agent.In one embodiment, the plasma protein binding assay determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein. An exemplary protocol of this binding assay is illustrated in detail in, e.g., PCT / US2019 / 031170. The hydrophobicity of the double-stranded RNAi agent, measured by fraction of unbound siRNA in the binding assay, exceeds 0.15, exceeds 0.2, exceeds 0.25, exceeds 0.3, exceeds 0.35, exceeds 0.4, exceeds 0.45, or exceeds 0.5 for an enhanced in vivo delivery of siRNA.Accordingly, conjugating the lipophilic moieties to the internal position(s) of the double-stranded RNAi agent provides optimal hydrophobicity for the enhanced in vivo delivery of siRNA.The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., a rNAi agent or a plasmid from which an RNAi agent is transcribed. LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate (such as a a rat, or a mouse). In a preferred embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder, or condition that would benefit from reduction in HTT expression; a human at risk for a disease, disorder, or condition that would benefit from reduction in HTT expression; a human having a disease, disorder, or condition that would benefit from reduction in HTT expression; or human being treated for a disease, disorder, or condition that would benefit from reduction in HTT expression as described herein. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In one embodiment, the subject is an adult subject. In one embodiment, the subject is a pediatric subject. In another embodiment, the subject is a juvenile subject, i.e., a subject below 20 years of age.As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more signs or symptoms associated with HTT gene expression or HTT protein production, e.g., HTT-associated diseases, such as Huntington’s disease. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. The term “lower” in the context of the level of HTT in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, a decrease is at least 20%. In certain embodiments, the decrease is at least 50% in a disease marker, e.g., protein or gene expression level. “Lower” in the context of the level of HTT in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder. In certain embodiments, “lower” is the decrease in the difference between the level of a marker or symptom for a subject suffering from a disease and a level accepted within the range of normal for an individual, e.g., the level of decrease in bodyweight between an obese individual and an individual having a weight accepted within the range of normal. As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder, or condition thereof, that would benefit from a reduction in expression of an HTT gene or production of an HTT protein, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of an HTT-associated disease. The failure to develop a disease, disorder, or condition, or the reduction in the development of a symptom associated with such a disease, disorder, or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention. As used herein, the term “HTT-associated disease” or “HTT-associated disorder” is understood as any disease or disorder that would benefit from reduction in the expression and / or activity of HTT. Exemplary HTT-associated diseases include Huntington’s disease. “Huntington's disease,” also known as HD, Huntington's Chorea, Chorea Maior, Chronic Progressive Chorea, and Hereditary Chorea, is an autosomal dominant genetic disorder characterized by choreiform movements and progressive intellectual deterioration, usually beginning in middle age (35 to 50 yr). The disease affects both sexes equally. The caudate nucleus atrophies, the small-cell population degenerates, and levels of the neurotransmitters gamma-aminobutyric acid (GABA) and substance P decrease. This degeneration results in characteristic “boxcar ventricles” seen on CT scans.Symptoms and signs of HD develop insidiously. HD's most obvious symptoms are abnormal body movements called chorea and lack of coordination, but it also affects a number of mental abilities and some aspects of personality. These physical symptoms commonly become noticable in a person`s forties, but can occur at any age. If the age of onset is below 20 years then it is known as Juvenile HD. Dementia or psychiatric disturbances, ranging from apathy and irritability to full-blown bipolar or schizophreniform disorder, may precede the movement disorder or develop during its course. Anhedonia or asocial behavior may be the first behavioral manifestation. Motor manifestations include flicking movements of the extremities, a lilting gait, motor impersistence (inability to sustain a motor act, such as tongue protrusion), facial grimacing, ataxia, and dystonia.HD is caused by a trinucleotide repeat expansion in the Huntingtin (HTT) gene, and is one of several polyglutamine expansion (or PolyQ expansion) diseases. This produces an extended form of the mutant Huntingtin protein (mHtt), which causes cell death in selective areas of the brain."Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having an HTT-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. “Prophylactically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having an HTT-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated. A "therapeutically-effective amount" or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. An RNAi agent employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials (including salts), compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the brain (e.g., whole brain or certain segments of brain, e.g., striatum, or certain types of cells in the brain, such as, e.g., neurons and glial cells (astrocytes, oligodendrocytes, microglial cells)). In some embodiments, a “sample derived from a subject” refers to blood drawn from the subject or plasma or serum derived therefrom. In further embodiments, a “sample derived from a subject” refers to brain tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject. II. RNAi Agents of the Disclosure Described herein are RNAi agents which inhibit the expression of an HTT gene. In one embodiment, the RNAi agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an HTT gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having an HTT-associated disease, e.g., Huntington’s disease. The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an HTT gene. The region of complementarity is about 15-30 nucleotides or less in length. Upon contact with a cell expressing the HTT gene, the RNAi agent inhibits the expression of the HTT gene (e.g., a human gene, a primate gene, a non-primate gene) by at least 50% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western blotting or flow cytometric techniques. In one, the level of knockdown is assayed in Cos7 cells using a Dual-Luciferase assay method. A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of an HTT gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides. Generally, the duplex structure is 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain preferred embodiments, the duplex structure is 18 to 25 base pairs in length, e.g., 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-25, 20-24,20-23, 20-22, 20-21, 21-25, 21-24, 21-23, 21-22, 22-25, 22-24, 22-23, 23-25, 23-24 or 24-25 base pairs in length, for example, 19-21 basepairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. Similarly, the region of complementarity to the target sequence is 15 to 30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, for example 19-23 nucleotides in length or 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. In some embodiments, the duplex structure is 19 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 19 to 30 nucleotides in length.In some embodiments, the dsRNA is 15 to 23 nucleotides in length, 19 to 23 nucleotides in length, or 25 to 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 15 to 36 base pairs, e.g., 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs, for example, 19-21 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an RNAi agent useful to target HTT expression is not generated in the target cell by cleavage of a larger dsRNA. A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.A dsRNA can be synthesized by standard methods known in the art. Double stranded RNAi compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Similarly, single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both. In one aspect, a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence for HTT may be selected from the group of sequences provided in any one of Tables 2-5, and the corresponding nucleotide sequence of the antisense strand of the sense strand may be selected from the group of sequences of any one of Tables 2-5. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of an HTT gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 2-5, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 2 -5. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide. It will be understood that, although some of the sequences in Tables 2-5 are described as modified or conjugated sequences, the RNA of the RNAi agent of the disclosuree.g., a dsRNA of the disclosure, may comprise any one of the sequences set forth in any one of Tables 2-5 that is un-modified, un-conjugated, or modified or conjugated differently than described therein. For example, although the sense strands of the agents of the invention shown in Table 3 are conjugated to a C16 ligand, these agents may be conjugated to a moiety that directs delivery to the liver, e.g., a GalNAc ligand, as described herein. A lipophilic ligand can be included in any of the positions provided in the instant application. The skilled person is well aware that dsRNAs having a duplex structure of about 20 to 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226) . In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of an HTT gene by not more than 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence using the in vitro assay with Cos7 and a 10 nM concentration of the RNA agent and the PCR assay as provided in the examples herein, are contemplated to be within the scope of the present disclosure. In addition, the RNAs described herein identify a site(s) in an HTT transcript that is susceptible to RISC-mediated cleavage. As such, the present disclosure further features RNAi agents that target within this site(s). As used herein, an RNAi agent is said to target within a particular site of an RNA transcript if the RNAi agent promotes cleavage of the transcript anywhere within that particular site. Such an RNAi agent will generally include at least about 15 contiguous nucleotides, preferably at least 19 nucleotides, from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in an HTT gene. III. Modified RNAi Agents of the DisclosureIn one embodiment, the RNA of the RNAi agent of the disclosuree.g., a dsRNA, is un-modified,and does not comprise, e.g., chemical modifications or conjugations known in the art and described herein. In preferred embodiments, the RNA of an RNAi agent of the disclosure, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the disclosure, substantially all of the nucleotides of an RNAi agent of the disclosure are modified. In other embodiments of the disclosure, all of the nucleotides of an RNAi agent of the disclosure are modified. RNAi agents of the disclosure in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or unmodified nucleotides. In still other embodiments of the disclosure, RNAi agents of the disclosure can include not more than 5, 4, 3, 2 or 1 modified nucleotides. The nucleic acids featured in the disclosure can be synthesized or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5’-end modifications (phosphorylation, conjugation, inverted linkages) or 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or 4’-position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNAi agents useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified RNAi agent will have a phosphorus atom in its internucleoside backbone. Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. In some embodiments of the invention, the dsRNA agents of the invention are in a free acid form. In other embodiments of the invention, the dsRNA agents of the invention are in a salt form. In one embodiment, the dsRNA agents of the invention are in a sodium salt form. In certain embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and / or phosphorothiotate groups present in the agent. Agents in which substantially all of the phosphodiester and / or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate linkages without a sodium counterion. In some embodiments, when the dsRNA agents of the invention are in the sodium salt form, sodium ions are present in the agent as counterions for all of the phosphodiester and / or phosphorothiotate groups present in the agent.Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and US Pat RE39464, the entire contents of each of which are hereby incorporated herein by reference.Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference. In other embodiments, suitable RNA mimetics are contemplated for use in RNAi agents, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the RNAi agents of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500. Some embodiments featured in the disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2--[known as a methylene (methylimino) or MMI backbone], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2-- and --N(CH3)--CH2--CH2--[wherein the native phosphodiester backbone is represented as --O--P--O--CH2--] of the above-referenced U.S. Patent No. 5,489,677, and the amide backbones of the above-referenced U.S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced US5,034,506. Modified RNAs can also contain one or more substituted sugar moieties. The RNAi agents, e.g., dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO] mCH3, O(CH2).nOCH3, O(CH2)nNH2, O(CH2) nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an RNAi agent, or a group for improving the pharmacodynamic properties of an RNAi agent, and other substituents having similar properties. In some embodiments, the modification includes a 2'methoxyethoxy (2'-O--CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2. Further exemplary modifications include : 5’-Me-2’-F nucleotides, 5’-Me-2’-OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N-methylacetamide).Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2’-O-hexadecyl, and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an RNAi agent, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. RNAi agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference. An RNAi agent of the disclosure can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Patent Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference. In some embodiments, an RNAi agent of the disclosure can also be modified to include one or more bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by a ring formed by the bridging of two carbons, whether adjacent or non-adjacent. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a ring formed by bridging two carbons, whether adjacent or non-adjacent, of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring, optionally, via the 2’-acyclic oxygen atom. Thus, in some embodiments an agent of the invention may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. A locked nucleoside can be represented by the structure (omitting stereochemistry), wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2’-carbon to the 4’-carbon of the ribose ring. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to 4′-(CH2)—O-2′ (LNA); 4′-(CH2)—S-2′; 4′-(CH2)2—O-2′ (ENA); 4′-CH(CH3)—O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH2OCH3)—O-2′ (and analogs thereof; see, e.g., U.S. Patent No. 7,399,845); 4′-C(CH3)(CH3)—O-2′ (and analogs thereof; see e.g., U.S. Patent No. 8,278,283); 4′-CH2—N(OCH3)-2′ (and analogs thereof; see e.g., U.S. Patent No. 8,278,425); 4′-CH2—O—N(CH3)-2′ (see, e.g., U.S. Patent Publication No. 2004 / 0171570); 4′-CH2—N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g., U.S. Patent No. 7,427,672); 4′-CH2—C(H)(CH3)-2′ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2—C(═CH2)-2′ (and analogs thereof; see, e.g., U.S. Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133;7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference. Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see WO 99 / 14226). The RNA of an iRNA can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2' bridge (i.e., L in the preceding structure). In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.” An iRNA of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5′ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering. Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, U.S. Patent Publication No. 2013 / 0190383; and PCT publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference. In some embodiments, an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between C1'-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1' and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference). Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent No. 8,314,227; and U.S. Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference. Potentially stabilizing modifications to the ends of RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3’- phosphate, inverted 2’-deoxy-modified ribonucleotide, such as inverted dT(idT), inverted dA (idA), and inverted abasic 2’-deoxyribonucleotide (iAb) and others. Disclosure of this modification can be found in WO 2011 / 005861. In one example, the 3’ or 5’ terminal end of a oligonucleotide is linked to an inverted 2’-deoxy-modified ribonucleotide, such as inverted dT(idT), inverted dA (idA), or a inverted abasic 2’-deoxyribonucleotide (iAb). In one particular example, the inverted 2’-deoxy-modified ribonucleotide is linked to the 3’end of an oligonucleotide, such as the 3’-end of a sense strand described herein, where the linking is via a 3’-3’ phosphodiester linkage or a 3’-3’-phosphorothioate linkage. In another example, the 3’-end of a sense strand is linked via a 3’-3’-phosphorothioate linkage to an inverted abasic ribonucleotide (iAb). In another example, the 3’-end of a sense strand is linked via a 3’-3’-phosphorothioate linkage to an inverted dA (idA). In one particular example, the inverted 2’-deoxy-modified ribonucleotide is linked to the 3’end of an oligonucleotide, such as the 3’-end of a sense strand described herein, where the linking is via a 3’-3’ phosphodiester linkage or a 3’-3’-phosphorothioate linkage. In another example, the 3’-terminal nucleotides of a sense strand is an inverted dA (idA) and is linked to the preceding nucleotide via a 3’-3’- linkage (e.g., 3’-3’-phosphorothioate linkage). Other modifications of the nucleotides of an iRNA of the invention include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’-terminal phosphate or phosphate mimic on the antisense strand of an iRNA. Suitable phosphate mimics are disclosed in, for example U.S. Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference. A. Modified RNAi agents Comprising Motifs of the DisclosureIn certain aspects of the disclosure, the double-stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013 / 075035, the entire contents of which are incorporated herein by reference. As shown herein and in WO 2013 / 075035, a superior result may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into a sense strand or antisense strand of an RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense or antisense strand. The RNAi agent may be optionally conjugated with a lipophilic ligand, e.g., a C16 ligand, for instance on the sense strand. The RNAi agent may be optionally modified with a (S)-glycol nucleic acid (GNA) modification, for instance on one or more residues of the antisense strand. The resulting RNAi agents present superior gene silencing activity. Accordingly, the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., an HTT gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may be 15-30 nucleotides in length. For example, each strand may be 16-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 2123 nucleotides in length. In certain embodiments, each strand is 19-23 nucleotides in length. The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 15-30 nucleotide pairs in length. For example, the duplex region can be 16-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length. In preferred embodiments, the duplex region is 19-21 nucleotide pairs in length.In one embodiment, the RNAi agent may contain one or more overhang regions or capping groups at the 3’-end, 5’-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 26 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. In preferred embodiments, the nucleotide overhang region is 2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers. In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2’-sugar modified, such as, 2-F, 2’-O-methyl, thymidine (T), and any combinations thereof.For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.The 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3’-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3’-overhang is present in the antisense strand. In one embodiment, this 3’-overhang is present in the sense strand.The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5’-end of the antisense strand (or the 3’-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3’-end, and the 5’-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5’-end of the antisense strand and 3’-end overhang of the antisense strand favor the guide strand loading into RISC process. In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end. In another embodiment, the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end. In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end. In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide overhang is at the 3’-end of the antisense strand. When the 2 nucleotide overhang is at the 3’-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and at the 5’-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2’-O-methyl or 3’-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (e.g., a lipophilic ligand, optionally a C16 ligand). In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at or near the cleavage site. In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3’ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand. In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’end. Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1st nucleotide from the 5’end of the antisense strand, or, the count starting from the 1st paired nucleotide within the duplex region from the 5’- end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5’-end. The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif. Like the sense strand, the antisense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand. In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3’-end, 5’-end or both ends of the strand. In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3’-end, 5’-end or both ends of the strand. When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides. When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two, or three nucleotides in the duplex region.In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mistmatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex.In one embodiment, the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. In another embodiment, the nucleotide at the 3’-end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3’-end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, for example, two dT nucleotides on the 3’-end of the sense or antisense strand.In one embodiment, the sense strand sequence may be represented by formula (I): 5' np-Na-(X X X )i-Nb-Y Y Y -Nb-(Z Z Z )j-Na-nq 3' (I)wherein: i and j are each independently 0 or 1; p and q are each independently 0-6; each Na independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each np and nq independently represent an overhang nucleotide; wherein Nb and Y do not have the same modification; andXXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2’-F modified nucleotides.In one embodiment, the Na or Nb comprise modifications of alternating pattern.In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11,12 or 11, 12, 13) of - the sense strand, the count starting from the 1st nucleotide, from the 5’end; or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5’- end. In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:5' np-Na-YYY-Nb-ZZZ-Na-nq 3' (Ib);5' np-Na-XXX-Nb-YYY-Na-nq 3' (Ic); or5' np-Na-XXX-Nb-YYY-Nb-ZZZ-Na-nq 3' (Id).When the sense strand is represented by formula (Ib), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.Each Na independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.When the sense strand is represented as formula (Ic), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.When the sense strand is represented as formula (Id), each Nb independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6. Each Na can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of X, Y and Z may be the same or different from each other. In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:5' np-Na-YYY- Na-nq 3' (Ia).When the sense strand is represented by formula (Ia), each Na independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II): 5' nq’-Na′-(Z’Z′Z′)k-Nb′-Y′Y′Y′-Nb′-(X′X′X′)l-N′a-np′ 3' (II)wherein: k and l are each independently 0 or 1; p’ and q’ are each independently 0-6; each Na′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;each np′ and nq′ independently represent an overhang nucleotide; wherein Nb’ and Y’ do not have the same modification;andX′X′X′, Y′Y′Y′ and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides. In one embodiment, the Na’ or Nb’ comprise modifications of alternating pattern.The Y′Y′Y′ motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotide in length, the Y′Y′Y′ motif can occur at positions 9, 10, 11;10, 11, 12; 11, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count starting from the 1st nucleotide, from the 5’end; or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5’- end. Preferably, the Y′Y′Y′ motif occurs at positions 11, 12, 13.In one embodiment, Y′Y′Y′ motif is all 2’-OMe modified nucleotides.In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1. The antisense strand can therefore be represented by the following formulas:5' nq’-Na′-Z′Z′Z′-Nb′-Y′Y′Y′-Na′-np’ 3' (IIb);5' nq’-Na′-Y′Y′Y′-Nb′-X′X′X′-np’ 3' (IIc); or5' nq’-Na′- Z′Z′Z′-Nb′-Y′Y′Y′-Nb′- X′X′X′-Na′-np’ 3' (IId).When the antisense strand is represented by formula (IIb), Nb’ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.When the antisense strand is represented as formula (IIc), Nb’ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.When the antisense strand is represented as formula (IId), each Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6. In other embodiments, k is 0 and l is 0 and the antisense strand may be represented by the formula:5' np’-Na’-Y’Y’Y’- Na’-nq’ 3' (Ia).When the antisense strand is represented as formula (IIa), each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.Each of X′, Y′ and Z′ may be the same or different from each other. Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-hydroxyl, or 2’-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. Each X, Y, Z, X′, Y′ and Z′, in particular, may represent a 2’-O-methyl modification or a 2’-fluoro modification.In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1st nucleotide from the 5’end, or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5’- end; and Y represents 2’-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’-OMe modification or 2’-F modification.In one embodiment the antisense strand may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1st nucleotide from the 5’end, or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5’- end; and Y′ represents 2’-O-methyl modification. The antisense strand may additionally contain X′X′X′ motif or Z′Z′Z′ motifs as wing modifications at the opposite end of the duplex region; and X′X′X′ and Z′Z′Z′ each independently represents a 2’-OMe modification or 2’-F modification.The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.Accordingly, the RNAi agents for use in the methods of the disclosure may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III): sense: 5' np -Na-(X X X)i -Nb- Y Y Y -Nb -(Z Z Z)j-Na-nq 3' antisense: 3' np’-Na’-(X’X′X′)k-Nb’-Y′Y′Y′-Nb’-(Z′Z′Z′)l-Na’-nq’ 5'(III)wherein: i, j, k, and l are each independently 0 or 1; p, p′, q, and q′ are each independently 0-6; each Na and Na’ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each Nb and Nb’ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; wherein each np’, np, nq’, and nq, each of which may or may not be present, independently represents an overhang nucleotide; andXXX, YYY, ZZZ, X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.Exemplary combinations of the sense strand and antisense strand forming an RNAi duplex include the formulas below: 5' np - Na -Y Y Y -Na-nq 3' 3' np’-Na’-Y′Y′Y′ -Na’nq’ 5' (IIIa)5' np -Na -Y Y Y -Nb -Z Z Z -Na-nq 3' 3' np’-Na’-Y′Y′Y′-Nb’-Z′Z′Z′-Na’nq’ 5' (IIIb)5' np-Na- X X X -Nb -Y Y Y - Na-nq 3' 3' np’-Na’-X′X′X′-Nb’-Y′Y′Y′-Na’-nq’ 5'(IIIc)5' np -Na -X X X -Nb-Y Y Y -Nb- Z Z Z -Na-nq 3' 3' np’-Na’-X′X′X′-Nb’-Y′Y′Y′-Nb’-Z′Z′Z′-Na-nq’ 5' (IIId)When the RNAi agent is represented by formula (IIIa), each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. When the RNAi agent is represented by formula (IIIb), each Nb independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.When the RNAi agent is represented as formula (IIIc), each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.When the RNAi agent is represented as formula (IIId), each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na, Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of Na, Na’, Nb and Nb’ independently comprises modifications of alternating pattern.In one embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2′-O-methyl or 2′-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2′-O-methyl or 2′-fluoro modifications and np′ >0 and at least one np′ is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2′-O-methyl or 2′-fluoro modifications , np′ >0 and at least one np′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more C16 (or related) moieties attached through a bivalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), the Na modifications are 2′-O-methyl or 2′-fluoro modifications , np′ >0 and at least one np′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties, optionally attached through a bivalent or trivalent branched linker. In one embodiment, when the RNAi agent is represented by formula (IIIa), the Na modifications are 2′-O-methyl or 2′-fluoro modifications , np′ >0 and at least one np′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties attached through a bivalent or trivalent branched linker.In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5’ end, and one or both of the 3’ ends and are optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.Various publications describe multimeric RNAi agents that can be used in the methods of the disclosure. Such publications include WO2007 / 091269, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887, and WO2011 / 031520; and US 7858769, the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, the compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, a 5’ vinyl phosphonate modified nucleotide of the disclosure has the structure:wherein X is O or S;R is hydrogen, hydroxy, fluoro, or C1-20alkoxy (e.g., methoxy or n-hexadecyloxy); R5’ is =C(H)-P(O)(OH)2 and the doublebond between the C5’ carbon and R5’ is in the E or Z orientation (e.g., E orientation); andB is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.In one embodiment, R5’ is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In another embodiment, R is methoxy and R5’ is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In another embodiment, X is S, R is methoxy, and R5’ is =C(H)-P(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E orientation.A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5’ end of the antisense strand of the dsRNA. Vinyl phosphate modifications are also contemplated for the compositions and methods of the instant disclosure. An exemplary vinyl phosphate structure includes the preceding structure, where R5’ is =C(H)-OP(O)(OH)2 and the double bond between the C5’ carbon and R5’ is in the E or Z orientation (e.g., E orientation). i. Thermally Destabilizing ModificationsIn certain embodiments, a dsRNA molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand (i.e., at positions 2-9 of the 5’-end of the antisense strand) to reduce or inhibit off-target gene silencing. It has been discovered that dsRNAs with an antisense strand comprising at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’ end, of the antisense strand have reduced off-target gene silencing activity. Accordingly, in some embodiments, the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5’ region of the antisense strand. In some embodiments, one or more thermally destabilizing modification(s) of the duplex is / are located in positions 2-9, or preferably positions 4-8, from the 5’-end of the antisense strand. In some further embodiments, the thermally destabilizing modification(s) of the duplex is / are located at position 6, 7 or 8 from the 5’-end of the antisense strand. In still some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5’-end of the antisense strand. The term “thermally destabilizing modification(s)” includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) (preferably a Tm with one, two, three or four degrees lower than the Tm of the dsRNA without having such modification(s). In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5’-end of the antisense strand.The thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2’-deoxy modification, acyclic nucleotide, e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA); and 2’-5’-linked ribonucleotides (“3’-RNA”). Exemplified abasic modifications include, but are not limited to the following:Wherein R = H, Me, Et or OMe; R’ = H, Me, Et or OMe; R” = H, Me, Et or OMewherein B is a modified or unmodified nucleobase.Exemplified sugar modifications include, but are not limited to the following:wherein B is a modified or unmodified nucleobase.In some embodiments the thermally destabilizing modification of the duplex is selected from the group consisting of: and wherein B is a modified or unmodified nucleobase and the asterisk on each structure represents either R, S or racemic.In some embodiments the thermally destabilizing modification of the duplex is selected from the group consisting of: and wherein B is a modified or unmodified nucleobase and the asterisk represents either R, S or racemic (e.g., S).The term "acyclic nucleotide" refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g., C1’-C2’, C2’-C3’, C3’-C4’, C4’-O4’, or C1’-O4’) is absent or at least one of ribose carbons or oxygen (e.g., C1’, C2’, C3’, C4’ or O4’) are independently or in combination absent from the nucleotide. In some embodiments, acyclic nucleotide is, , , or , wherein B is a modified or unmodified nucleobase, R1 and R2 independently are H, halogen, OR3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar). The term “UNA” refers to unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomers with bonds between C1'-C4' being removed (i.e. the covalent carbon-oxygen-carbon bond between the C1' and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar is removed (see Mikhailov et. al., Tetrahedron Letters, 26 (17): 2059 (1985); and Fluiter et al., Mol. Biosyst., 10: 1039 (2009), which are hereby incorporated by reference in their entirety). The acyclic derivative provides greater backbone flexibility without affecting the Watson-Crick pairings. The acyclic nucleotide can be linked via 2’-5’ or 3’-5’ linkage.The term ‘GNA’ refers to glycol nucleic acid which is a polymer similar to DNA or RNA but differing in the composition of its “backbone” in that is composed of repeating glycerol units linked by phosphodiester bonds:The thermally destabilizing modification of the duplex can be mismatches (i.e., noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex. Exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or a combination thereof. Other mismatch base pairings known in the art are also amenable to the present invention. A mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, i.e., the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the modifications on the ribose sugars of the nucleotides. In certain embodiments, the dsRNA molecule contains at least one nucleobase in the mismatch pairing that is a 2’-deoxy nucleobase; e.g., the 2’-deoxy nucleobase is in the sense strand. In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired W-C H-bonding to complementary base on the target mRNA, such as: .More examples of abasic nucleotide, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications have been described in detail in WO 2011 / 133876, which is herein incorporated by reference in its entirety. The thermally destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications. In some embodiments, the thermally destabilizing modification of the duplex includes nucleotides with non-canonical bases such as, but not limited to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand. These nucleobase modifications have been evaluated for destabilization of the central region of the dsRNA duplex as described in WO 2010 / 0011895, which is herein incorporated by reference in its entirety. Exemplary nucleobase modifications are:In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes one or more α-nucleotide complementary to the base on the target mRNA, such as:wherein R is H, OH, OCH3, F, NH2, NHMe, NMe2 or O-alkyl.Exemplary phosphate modifications known to decrease the thermal stability of dsRNA duplexes compared to natural phosphodiester linkages are:The alkyl for the R group can be a C1-C6alkyl. Specific alkyls for the R group include, but are not limited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.As the skilled artisan will recognize, in view of the functional role of nucleobases is defining specificity of an RNAi agent of the disclosure, while nucleobase modifications can be performed in the various manners as described herein, e.g., to introduce destabilizing modifications into an RNAi agent of the disclosure, e.g., for purpose of enhancing on-target effect relative to off-target effect, the range of modifications available and, in general, present upon RNAi agents of the disclosure tends to be much greater for non-nucleobase modifications, e.g., modifications to sugar groups or phosphate backbones of polyribonucleotides. Such modifications are described in greater detail in other sections of the instant disclosure and are expressly contemplated for RNAi agents of the disclosure, either possessing native nucleobases or modified nucleobases as described above or elsewhere herein.In addition to the antisense strand comprising a thermally destabilizing modification, the dsRNA can also comprise one or more stabilizing modifications. For example, the dsRNA can comprise at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, the stabilizing modifications all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two stabilizing modifications. The stabilizing modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the stabilizing modification can occur on every nucleotide on the sense strand or antisense strand; each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both stabilizing modification in an alternating pattern. The alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand. In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, 14, and 16 from the 5’-end. In some other embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 14, and 16 from the 5’-end. In still some other embodiments, the antisense comprises stabilizing modifications at positions 2, 14, and 16 from the 5’-end. In some embodiments, the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification. For example, the stabilizing modification can be the nucleotide at the 5’-end or the 3’-end of the destabilizing modification, i.e., at position -1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a stabilizing modification at each of the 5’-end and the 3’-end of the destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises at least two stabilizing modifications at the 3’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the sense strand can be present at any positions. In some embodiments, the sense strand comprises stabilizing modifications at positions 7, 10, and 11 from the 5’-end. In some other embodiments, the sense strand comprises stabilizing modifications at positions 7, 9, 10, and 11 from the 5’-end. In some embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some other embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three, or four stabilizing modifications. In some embodiments, the sense strand does not comprise a stabilizing modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.Exemplary thermally stabilizing modifications include, but are not limited to, 2’-fluoro modifications. Other thermally stabilizing modifications include, but are not limited to, LNA.In some embodiments, the dsRNA of the disclosure comprises at least four (e.g., four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides. Without limitations, the 2’-fluoro nucleotides all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two 2’-fluoro nucleotides. The 2’-fluoro modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the 2’-fluoro modification can occur on every nucleotide on the sense strand or antisense strand; each 2’-fluoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2’-fluoro modifications in an alternating pattern. The alternating pattern of the 2’-fluoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2’-fluoro modifications on the sense strand can have a shift relative to the alternating pattern of the 2’-fluoro modifications on the antisense strand. In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides. Without limitations, a 2’-fluoro modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises 2’-fluoro nucleotides at positions 2, 6, 8, 9, 14, and 16 from the 5’-end. In some other embodiments, the antisense comprises 2’-fluoro nucleotides at positions 2, 6, 14, and 16 from the 5’-end. In still some other embodiments, the antisense comprises 2’-fluoro nucleotides at positions 2, 14, and 16 from the 5’-end. In some embodiments, the antisense strand comprises at least one 2’-fluoro nucleotide adjacent to the destabilizing modification. For example, the 2’-fluoro nucleotide can be the nucleotide at the 5’-end or the 3’-end of the destabilizing modification, i.e., at position -1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a 2’-fluoro nucleotide at each of the 5’-end and the 3’-end of the destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises at least two 2’-fluoro nucleotides at the 3’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) 2’-fluoro nucleotides. Without limitations, a 2’-fluoro modification in the sense strand can be present at any positions. In some embodiments, the antisense comprises 2’-fluoro nucleotides at positions 7, 10, and 11 from the 5’-end. In some other embodiments, the sense strand comprises 2’-fluoro nucleotides at positions 7, 9, 10, and 11 from the 5’-end. In some embodiments, the sense strand comprises 2’-fluoro nucleotides at positions opposite or complimentary to positions 11, 12, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some other embodiments, the sense strand comprises 2’-fluoro nucleotides at positions opposite or complimentary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four 2’-fluoro nucleotides. In some embodiments, the sense strand does not comprise a 2’-fluoro nucleotide in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.In some embodiments, the dsRNA molecule of the disclosure comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA comprises a blunt end at 5’-end of the antisense strand. Preferably, the 2 nt overhang is at the 3’-end of the antisense. In some embodiments, the dsRNA molecule of the disclosure comprise a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when said double stranded nucleic acid is introduced into a mammalian cell; and wherein the antisense strand contains at least one thermally destabilizing nucleotide, where at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. at position 2-9 of the 5’-end of the antisense strand). For example, the thermally destabilizing nucleotide occurs between positions opposite or complimentary to positions 14-17 of the 5’-end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12-30 nucleotide pairs in length. In some embodiments, the dsRNA molecule of the disclosure comprises a sense and antisense strands, wherein said dsRNA molecule comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5’end, wherein the 3’ end of said sense strand and the 5’ end of said antisense strand form a blunt end and said antisense strand is 1-4 nucleotides longer at its 3’ end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA molecule is introduced into a mammalian cell, and wherein dicer cleavage of said dsRNA preferentially results in an siRNA comprising said 3’ end of said antisense strand, thereby reducing expression of the target gene in the mammal, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length. In some embodiments, every nucleotide in the sense strand and antisense strand of the dsRNA molecule may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2′ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases, the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of an RNA or may only occur in a single strand region of an RNA. E.g., a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5’ end or ends can be phosphorylated.It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. E.g., it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’-deoxy-2’-fluoro (2’-F) or 2’-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.In some embodiments, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, or 2’-fluoro. The strands can contain more than one modification. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2’-deoxy, 2’- O-methyl or 2’-fluoro modifications, acyclic nucleotides or others. In some embodiments, the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2’-O-methyl or 2’-deoxy. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2'-O-methyl nucleotide, 2’-deoxy nucleotide, 2´-deoxy-2’-fluoro nucleotide, 2'-O-N-methylacetamido (2'-O-NMA) nucleotide, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleotide, 2'-O-aminopropyl (2'-O-AP) nucleotide, or 2'-ara-F nucleotide. Again, it is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.In some embodiments, the dsRNA molecule of the disclosure comprises modifications of an alternating pattern, particular in the B1, B2, B3, B1’, B2’, B3’, B4’ regions. The term “alternating motif” or “alternative pattern” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “ABABABABABAB…,” “AABBAABBAABB…,” “AABAABAABAAB…,” “AAABAAABAAAB…,” “AAABBBAAABBB…,” or “ABCABCABCABC…,” etc. The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB…”, “ACACAC…” “BDBDBD…” or “CDCDCD…,” etc. In some embodiments, the dsRNA molecule of the disclosure comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5’3’ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 3’-5’of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5’3’ of the strand and the alternating motif in the antisense strand may start with “BBAABBAA” from 3’-5’of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand. In one particular example, the alternating motif in the sense strand is “ABABAB” from 5’3’ of the strand, where each A is an unmodified ribonucleotide and each B is a 2’-Omethyl modified nucleotide.In one particular example, the alternating motif in the sense strand is “ABABAB” from 5’3’ of the strand, where each A is an 2’-deoxy-2’-fluoro modified nucleotide and each B is a 2’-Omethyl modified nucleotide.In another particular example, the alternating motif in the antisense strand is “BABABA” from 3’-5’of the strand, where each A is a 2’-deoxy-2’-fluoro modified nucleotide and each B is a 2’-Omethyl modified nucleotide.In one particular example, the alternating motif in the sense strand is “ABABAB” from 5’3’ of the strand and the alternating motif in the antisense strand is “BABABA” from 3’-5’of the strand, where each A is an unmodified ribonucleotide and each B is a 2’-Omethyl modified nucleotide.In one particular example, the alternating motif in the sense strand is “ABABAB” from 5’3’ of the strand and the alternating motif in the antisense strand is “BABABA” from 3’-5’of the strand, where each A is a 2’-deoxy-2’-fluoro modified nucleotide and each B is a 2’-Omethyl modified nucleotide.The dsRNA molecule of the disclosure may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand. In some embodiments, the dsRNA molecule comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. Preferably, these terminal three nucleotides may be at the 3’-end of the antisense strand. In some embodiments, the sense strand of the dsRNA molecule comprises 1-10 blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of six phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, or 8 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, or 6 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, or 4 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s) of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage at one end or both ends of the sense or antisense strand.In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the internal region of the duplex of each of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate methylphosphonate internucleotide linkage at position 8-16 of the duplex region counting from the 5’-end of the sense strand; the dsRNA molecule can optionally further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s).In some embodiments, the dsRNA molecule of the disclosure further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 1-5 and one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 18-23 of the sense strand (counting from the 5’-end), and one to five phosphorothioate or methylphosphonate internucleotide linkage modification at positions 1 and 2 and one to five within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate or methylphosphonate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one within position 18-23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 (counting from the 5’-end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 (counting from the 5’-end) of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one within position 18-23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one at position 21 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 21 and 22 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5’-end).In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 23 and 23 of the antisense strand (counting from the 5’-end).In some embodiments, compound of the disclosure comprises a pattern of backbone chiral centers. In some embodiments, a common pattern of backbone chiral centers comprises at least 5 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 6 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 7 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 8 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 9 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 16 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 17 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 18 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 19 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages which are not chiral (as a non-limiting example, a phosphodiester). In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration, and no more than 8 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration, and no more than 7 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration, and no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration, and no more than 4 internucleotidic linkages which are not chiral. In some embodiments, the internucleotidic linkages in the Sp configuration are optionally contiguous or not contiguous. In some embodiments, the internucleotidic linkages in the Rp configuration are optionally contiguous or not contiguous. In some embodiments, the internucleotidic linkages which are not chiral are optionally contiguous or not contiguous.In some embodiments, compound of the disclosure comprises a block is a stereochemistry block. In some embodiments, a block is an Rp block in that each internucleotidic linkage of the block is Rp. In some embodiments, a 5’-block is an Rp block. In some embodiments, a 3’-block is an Rp block. In some embodiments, a block is an Sp block in that each internucleotidic linkage of the block is Sp. In some embodiments, a 5’-block is an Sp block. In some embodiments, a 3’-block is an Sp block. In some embodiments, provided oligonucleotides comprise both Rp and Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Rp but no Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Sp but no Rp blocks. In some embodiments, provided oligonucleotides comprise one or more PO blocks wherein each internucleotidic linkage in a natural phosphate linkage.In some embodiments, compound of the disclosure comprises a 5’-block is an Sp block wherein each sugar moiety comprises a 2’-F modification. In some embodiments, a 5’-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 5’-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 5’-block comprises 4 or more nucleoside units. In some embodiments, a 5’-block comprises 5 or more nucleoside units. In some embodiments, a 5’-block comprises 6 or more nucleoside units. In some embodiments, a 5’-block comprises 7 or more nucleoside units. In some embodiments, a 3’-block is an Sp block wherein each sugar moiety comprises a 2’-F modification. In some embodiments, a 3’-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 3’-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 3’-block comprises 4 or more nucleoside units. In some embodiments, a 3’-block comprises 5 or more nucleoside units. In some embodiments, a 3’-block comprises 6 or more nucleoside units. In some embodiments, a 3’-block comprises 7 or more nucleoside units.In some embodiments, compound of the disclosure comprises a type of nucleoside in a region or an oligonucleotide is followed by a specific type of internucleotidic linkage, e.g., natural phosphate linkage, modified internucleotidic linkage, Rp chiral internucleotidic linkage, Sp chiral internucleotidic linkage, etc. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by natural phosphate linkage (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by natural phosphate linkage (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by natural phosphate linkage (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by natural phosphate linkage (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by natural phosphate linkage (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp.In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the antisense comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’-end of the antisense strand.In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (iv) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2’-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’-end of the antisense strand.In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (v) the sense strand comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’-end of the antisense strand.In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (iv) the sense strand comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2’-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at 5’-end of the antisense strand.In some embodiments, the dsRNA molecule of the disclosure comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch can occur in the overhang region or the duplex region. The base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.In some embodiments, the dsRNA molecule of the disclosure comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex.In some embodiments, the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. It was found that introducing 4’-modified or 5’-modified nucleotide to the 3’-end of a phosphodiester (PO), phosphorothioate (PS), or phosphorodithioate (PS2) linkage of a dinucleotide at any position of single stranded or double stranded oligonucleotide can exert steric effect to the internucleotide linkage and, hence, protecting or stabilizing it against nucleases.In some embodiments, 5’-modified nucleoside is introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 5’-alkylated nucleoside may be introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 5’ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 5’-alkylated nucleoside is 5’-methyl nucleoside. The 5’-methyl can be either racemic or chirally pure R or S isomer. In some embodiments, 4’-modified nucleoside is introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 4’-alkylated nucleoside may be introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 4’ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4’-alkylated nucleoside is 4’-methyl nucleoside. The 4’-methyl can be either racemic or chirally pure R or S isomer. Alternatively, a 4’-O-alkylated nucleoside may be introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA. The 4’-O-alkyl of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4’-O-alkylated nucleoside is 4’-O-methyl nucleoside. The 4’-O-methyl can be either racemic or chirally pure R or S isomer. In some embodiments, 5’-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5’-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 5’-alkylated nucleoside is 5’-methyl nucleoside. The 5’-methyl can be either racemic or chirally pure R or S isomer. In some embodiments, 4’-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 4’-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4’-alkylated nucleoside is 4’-methyl nucleoside. The 4’-methyl can be either racemic or chirally pure R or S isomer. In some embodiments, 4’-O-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5’-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4’-O-alkylated nucleoside is 4’-O-methyl nucleoside. The 4’-O-methyl can be either racemic or chirally pure R or S isomer. In some embodiments, the dsRNA molecule of the disclosure can comprise 2’-5’ linkages (with 2’-H, 2’-OH and 2’-OMe and with P=O or P=S). For example, the 2’-5’ linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.In another embodiment, the dsRNA molecule of the disclosure can comprise L sugars (e.g., L ribose, L-arabinose with 2’-H, 2’-OH and 2’-OMe). For example, these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.Various publications describe multimeric siRNA which can all be used with the dsRNA of the disclosure. Such publications include WO2007 / 091269, US 7858769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887, and WO2011 / 031520 which are hereby incorporated by their entirely.As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to an RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.In certain specific embodiments, the RNAi agent for use in the methods of the disclosure is an agent selected from the group of agents listed in any one of Tables 2-5. These agents may further comprise a ligand. IV.iRNAs Conjugated to LigandsAnother modification of the RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA, e.g., into a cell. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937). In certain embodiments, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take part in duplex pairing in a duplexed nucleic acid. Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly Laspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an α helical peptide.Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine.Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB. The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto. The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems® (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives. In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks. When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis. A.Lipid ConjugatesIn certain embodiments, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can typically bind a serum protein, such as human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.A lipid-based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.In certain embodiments, the lipid-based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.In certain embodiments, the lipid-based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid-based ligand.In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).B.Cell Permeation AgentsIn another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In certain embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an α-helical agent and can have a lipophilic and a lipophobic phase.The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 11). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 12)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 13)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 14)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing αVß3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α -defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003). C.Carbohydrate ConjugatesIn some embodiments of the compositions and methods of the invention, an iRNA further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and tri-saccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8). In certain embodiments, a carbohydrate conjugate comprises a monosaccharide. In certain embodiments, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates, which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in US 8,106,022, the entire content of which is hereby incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3’ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3’ end of the sense strand) via a linker, e.g., a linker as described herein. In some embodiments the GalNAc conjugate is conjugated to the 5’ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 5’ end of the sense strand) via a linker, e.g., a linker as described herein.In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker. In other embodiments of the invent...
Claims
1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Huntingtin (HTT) in a cell, wherein the dsRNA comprises a sense strand and an antisense strand forming a double stranded region, a) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- gscsuau(Uhd)CfaUfAfAfucacauucsgsa -3’ (SEQ ID NO:17) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusCfsgaaUfgUfGfauuaUfgAfauagcsasu -3’ (SEQ ID NO:18),wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Ahd) is 2'-O-hexadecyl-adenosine-3'-phosphate; Tgn is thymidine-glycol nucleic acid (GNA) S-isomer; and VP is 5’-vinyl phosphonate;b) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- cscsggu(Chd)AfgGfUfUfcugcuuuusasa -3’ (SEQ ID NO:72) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusUfsaadAadGcagaacCfudGaccggscsc -3’ (SEQ ID NO:85),wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Chd) is 2'-O-hexadecyl-cytosine-3'-phosphate; and VP is 5’-vinyl phosphonate;c) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- csusucg(Ahd)GfuCfCfCfucaaguccsusa -3’ (SEQ ID NO:70) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusAfsggac(Tgn)ugagggAfcUfcgaagsgsc -3’ (SEQ ID NO:83),wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; and VP is 5’-vinyl phosphonate;d) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- gscsugg(Uhd)GfaAfUfCfggauuccusgsa -3’ (SEQ ID NO:21) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusCfsaggAfaUfCfcgauUfcAfccagcsusc -3’ (SEQ ID NO:22),wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Uhd) is 2'-O-hexadecyl-uridine-3'-phosphate; and VP is 5’-vinyl phosphonate;e) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- uscsaua(Ahd)UfcAfCfAfuucguuugsusa -3’ (SEQ ID NO:19) and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 4 nucleotides from the nucleotide sequence 5’- VPusAfscaaAfcGfAfauguGfaUfuaugasasu -3’ (SEQ ID NO:20),wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; s is a phosphorothioate linkage; Af, Cf, Gf, Uf are 2′-fluoro A, C, G, and U; (Uhd) is 2'-O-hexadecyl-adenosine-3'-phosphate; and VP is 5’-vinyl phosphonate;f) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 26-77, 142-202, 27-49, 147-169, or 173-195 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:6; g) wherein the antisense strand comprises a region of complementarity to an mRNA encoding HTT, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-5, except for duplexes AD-1019465 and AD-1019476; orh) wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 4391-4669, 6009-6037, 4398-4420; 4403-4425; or 6512-6534 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:
6.
2. The dsRNA agent of claim 1, wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand is conjugated to one or more lipophilic moieties.
3. The dsRNA agent of claim 2, wherein the lipophilic moiety is conjugated to one or more internal positions in the double stranded region of the dsRNA agent.
4. The dsRNA agent of claim 2 or 3, wherein the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5’-end of each strand.
5. The dsRNA agent of any one of claims 2-4, wherein the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound.
6. The dsRNA agent of claim 5, wherein the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain.
7. The dsRNA agent of any one of claims 1-6, wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification.
8. The dsRNA agent of claim 7, wherein at least one of the nucleotide modifications is selected from the group a deoxy-nucleotide modification, a 3’-terminal deoxy-thymine (dT) nucleotide modification, a 2'-O-methyl nucleotide modification, a 2'-fluoro nucleotide modification, a 2'-deoxy- nucleotide modification, a 2’-5’-linked ribonucleotide (3’-RNA) modification, a locked nucleotide modification, an unlocked nucleotide modification, a conformationally restricted nucleotide modification, a constrained ethyl nucleotide modification, an abasic nucleotide modification, a 2’-amino- nucleotide modification, a 2’-O-allyl- nucleotide modification, 2’-C-alkyl- nucleotide modification, 2’-hydroxly- nucleotide modification, a 2’-methoxyethyl nucleotide modification, a 2’-O-alkyl- nucleotide modification, a morpholino nucleotide modification, a phosphoramidate modification, a non-natural base comprising nucleotide modification, a tetrahydropyran nucleotide modification, a 1,5-anhydrohexitol nucleotide modification, a cyclohexenyl nucleotide modification, a nucleotide comprising a 5'-phosphorothioate group modification, a nucleotide comprising a 5'-methylphosphonate group modification, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic modification, a nucleotide comprising vinyl phosphonate modification, a nucleotide comprising adenosine-glycol nucleic acid (GNA) modification, a nucleotide comprising thymidine-glycol nucleic acid (GNA) S-Isomer modification, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate modification, a nucleotide comprising 2’-deoxythymidine-3’phosphate modification, a nucleotide comprising 2’-deoxyguanosine-3’-phosphate modification, and a terminal nucleotide linked to a cholesteryl derivative modification, a dodecanoic acid bisdecylamide group modification; a cytidine 2`-phosphate modification, a guanosine-2`-phosphate modification, a uridine-2`-phosphate modification, a adenosine-2`-phosphate modification, a 2'-O-hexadecyl-adenosine-3'-phosphate modification, a 2'-O-hexadecyl-cytidine-3'-phosphate modification, a 2'-O-hexadecyl-guanosine-3'-phosphate modification, and a 2'-O-hexadecyl-uridine-3'-phosphate modification, and combinations thereof.
9. The dsRNA agent of any one of claims 1-8, further comprising at least one phosphorothioate internucleotide linkage. 10. The dsRNA agent of any one of claims 1-9, wherein each strand is no more than 30 nucleotides in length.
11. The dsRNA agent of any one of claims 1-10, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide.
12. The dsRNA agent of any one of claims 1-11, wherein the double stranded region is 15-30 nucleotide pairs in length.
13. The dsRNA agent of any one of claims 1-12, further comprising a phosphate or phosphate mimic at the 5’-end of the antisense strand.
14. A cell containing the dsRNA agent of any one of claims 1-13.
15. A pharmaceutical composition for inhibiting expression of a gene encoding HTT, comprising the dsRNA agent of any one of claims 1-13.
16. A composition comprising two or more dsRNA agents for inhibiting expression of Huntingtin (HTT) in a cell, wherein each dsRNA agent independently comprises a sense strand and an antisense strand forming a double stranded region,wherein each of the antisense strands independently comprises a region of complementarity to an mRNA encoding HTT, and wherein the each of the regions of complementarity independently comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-5.
17. An in vitro method of inhibiting expression of a huntingtin (HTT) gene in a cell, the method comprising:(a) contacting the cell with the dsRNA agent of any one of claims 1-13, or the composition of claim 16, or the pharmaceutical composition of claim 15; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the HTT gene, thereby inhibiting expression of the HTT gene in the cell.
18. The dsRNA agent of any one of claims 1-13, or the pharmaceutical composition of claim 15 or the composition of claim 16 for use in treating a subject diagnosed with an HTT-associated disease, the use comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-13, or the composition of claim 16, or the pharmaceutical composition of claim 15.
19. The dsRNA agent or the composition or the pharmaceutical composition for use of claim 18, wherein the HTT-associated disease is Huntington’s disease.
20. The dsRNA agent or the composition or the pharmaceutical composition for use of claim 18 or 19, wherein the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 50 mg / kg.
21. The dsRNA agent or the composition or the pharmaceutical composition for use of any one of claims 18-20, wherein the dsRNA agent is administered intrathecally.
22. The dsRNA agent or the composition or the pharmaceutical composition for use of any one of claims 18-21, wherein the use further comprises administering to the subject an additional agent suitable for treatment or prevention of an HTT-associated disorder.
23. A kit, a vial, or a syringe comprising the dsRNA agent of any one of claims 1-13, or the composition of claim 16, or the pharmaceutical composition of claim 15.