Improved globin and other lentiviral vectors for gene therapy
Patent Information
- Application Number
- AE202602340
- Authority / Receiving Office
- AE · AE
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-15
- Filing Date
- 2025-01-10
Smart Images

Figure ABST_ABST
Abstract
Description
Improved Globin and OtherLentiviral Vectors for Gene Therapy FIELD OF THE DISCLOSURE
[0001] The present subject matter relates to recombinant lentiviral transfer plasmids for producing lentiviral vectors with increased vector titer and performance. These transfer plasmids are constructed so that a central polypurine tract (cPPT) is centered between the lentiviral long terminal repeats (LTRs) and include a 6x stop codon sequence block downstream of the 3’ LTR and woodchuck post-transcriptional regulatory element (WPRE). When the transfer plasmids comprise a globin expression cassette, the lentiviral vectors produced therefrom are useful for treating hemoglobinopathies by gene therapy. Transduced cells, pharmaceutical compositions and methods of treating or ameliorating hemoglobinopathies with these lentiviral vectors are also provided. Additional transfer plasmids, cells, and compositions are provided that are useful for delivering any gene of interest to a cell, as well as plasmids for production of lentiviral vectors for treating other erythroid-specific diseases or disorders such as anemia and cancer. BACKGROUND
[0002] The severe hemoglobin disorders are prevalent genetic diseases transmitted through autosomal recessive mode of inheritance [1]. In patients with sickle cell anemia (SCA), the β-chain of hemoglobin S (HbS;α2,βS2) contains a substitution of valine for glutamic acid at the sixth coding amino acid [1]. This substitution results in a change in surface charge that predisposes deoxygenated HbS to polymerize, causing red blood cells to assume rigid ‘sickled’ shapes. From earliest childhood, these sickled cells lead to clogging of small blood vessels, painful crises, organ damage and create the risk for devastating strokes [1]. Alternatively, β-thalassemia results from inadequate production of β-globin due to various mutations in the β-globin gene or its promoter, which leads to the accumulation of unpaired, insoluble α-chains which cause ineffective erythropoiesis, accelerated red blood cell destruction, and severe anemia [2].
[0003] Depending upon the severity of the disease, a routine blood transfusion may be required to properly control the anemia by providing a renewed source of red blood cells. In the absence of this prophylactic treatment, affected individuals may exhibit tissue ischemia, organ damage and early mortality. Throughout the world, approximately 2% of individuals are considered to be carriers of β-globin defects [2]. Depending on ethnicity and geography in the world, the incidence of SCA and β-thalassemia can be markedly more prevalent. For SCA, incidence is higher in Africa where carriers are protected from malaria [2] while β-thalassemia is more prevalent in the Mediterranean (i.e., Italy and Greece), Middle East and Southern part of Asia [2]. In the United States approximately 100,000 people have SCA [1], worldwide the burden is greater with an estimated 300,000 infants born each year with the disease [1,2]. β-thalassemia is less common in the US with the exception of California where incidence has been shown to be around 1:55,000 individuals [3].
[0004] To date, gene therapy for β-globin deficiency has become possible using replicative-defective simple or complex retroviral vectors in an ex vivo application. Early work using simple retroviruses based on murine Moloney leukemia virus (MMLV) resulted in poor results [4, 5], due in large part to the inability to appropriately transfer fully intact β-globin expression cassettes containing various erythroid-specific regulatory elements [6]. More problematically, the simple retroviruses based on MMLV were causative agents that integrated into the host genome and promoted leukemogenesis [7]. Efforts to remove promoter activity or other cis-acting elements in the MMLV genome were largely fruitless as vector production titers were drastically reduced compared to vectors with fully intact LTRs [8]. In the mid-to-late 1990’s, a modified complex retroviral vector system based on human immunodeficiency virus type I (HIV-1) was designed and developed by Naldini et al. [9], which demonstrated a considerably more effective system to transduce terminally differentiated, non-proliferating somatic cells in vitro and in vivo. Prior work by Miller et al.
[10] demonstrated that simple retroviruses require active proliferation and nuclear membrane dissolution for efficient vector integration, which was somewhat obviated through the use of the HIV-1 based vectors. To further reduce ectopic expression of the integrated lentiviral vectors, subsequent investigators designed new lentiviral vector genome sequences that debilitated the 3’ LTR promoter activity [11, 12]. Even with these changes, the replication-defective lentiviral vector system does have inherent limitations with low mitotic cell transduction as prior work by Park et al. [13, 14] showed that active cell proliferation does benefit the transduction efficiency and gene expression from the integrated transferred vectors [13, 14]. Even with this limitation, lentiviral vectors are the only integrating vector system that is available and is a requirement for effective ex vivo gene delivery methodologies. All other currently available viral vector systems are largely episomal and do not integrate. Therefore, proliferating target cells will lose vector genomes over time and result in a loss of the therapeutic gene and its effect.
[0005] Another major benefit of the lentiviral vector system is a more expansive packaging capacity compared to the predecessor MMLV-based vector system. This enables the incorporation of larger gene expression cassettes, such as the inclusion of the β-globin genomic sequences and enhancer regions as previously described [15, 16]. Vector titers with less sophisticated gene expression cassettes compared to β-globin generally have superior titers with some published literature suggesting that the larger size can be an issue with vector performance [17, 18]. Further modifications of the lentiviral transfer plasmid to modify various portions of the regulatory elements have been designed and tested over the years with varying degrees of success using ex vivo transplantation mouse model testing [15, 16, 19-23]. In 2019, bluebird bio received approval of Zynteglo in Europe, which was subsequently approved by the FDA in 2022. In their studies, β-thalassemia patients treated with their lentiviral vector formulation exhibited an increased level of β-globin with a concomitant reduction in the need to obtain blood transfusions.
[0006] Regardless of the de novo production of functional β-globin in the ex vivo transduced cells, the design of the lentiviral vectors remains a priority to increase vector titer. Changes in the size and number of globin regulatory elements have not necessarily proven to exhibit any beneficial effect on titer or β-globin production [18 and US 2022 / 0136007]. Reversing the orientation of the β-globin expression cassette into the sense direction has not demonstrated a positive impact on vector titer
[24] . In the present disclosure, evidence is provided that inclusion of the central polypurine tract sequence (cPPT) and the re-positioning within the lentiviral vector genome enhances the vector performance. Early work by Zennou et al.
[25] showed that the cPPT sequence obtained from the HIV-1 polymerase (pol) gene could markedly enhance vector transduction into mitotically inactive cells. This work was subsequently confirmed by Follenzi et al.
[26] and Park and Kay
[27] . In the latter work, Park and Kay
[27] showed that actively proliferating cells in culture were not markedly impacted by the number and location of the cPPT, but that in vivo transduction was considerably improved by 50% following administration into mouse livers. To date, no other study in the β-globin field has re-positioned the cPPT to demonstrate the effectiveness of this sequence in an alternate location. All other vectors have designed their cPPT-containing lentiviral vectors using the pre-existing location either 5’ or 3’ to the rev-responsive element (RRE) and 5’ to any of the expression cassettes. The newly configured design, with the repositioned cPPT and with the stop codons in all reading frames following the 3’ LTR, and external WPRE has a positive impact on gene transfer and vector-encoded β-globin production. SUMMARY OF THE DISCLOSURE
[0007] The present disclosure provides recombinant lentiviral vectors for gene therapy based on new and improved recombinant lentiviral transfer plasmids.
[0008] In one aspect, the recombinant lentiviral transfer plasmids comprise(a) a globin expression cassette which comprises sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a globin gene functional to ameliorate a hemoglobinopathy, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the globin expression cassette to enable expression of the globin gene in a mammal when present in a cell;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the globin expression cassette, a 3’ LTR, and posttranscriptional regulatory elements,wherein the globin expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette,wherein the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette, andwherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(c) a plasmid backbone.
[0009] In some embodiments of any of the foregoing or following subject matter, the cPPT sequence is positioned no more than about 250 nucleotides upstream or downstream of the midpoint of the lentiviral vector cassette.
[0010] In embodiments of any of the foregoing or following subject matter, the midpoint of the cPPT sequence is positioned from about 10% to about 20% upstream or downstream of the midpoint between the first nucleotide of the 5’ LTR and the last nucleotide of the 3’ LTR.
[0011] In embodiments of any of the foregoing or following subject matter, the LCR is no larger than about 4 kb.
[0012] In embodiments of any of the foregoing or following subject matter, the LCR comprises HS2, HS3 and HS4. In embodiments of any of the foregoing or following subject matter, the said LCR consists essentially of HS2, HS3 and HS4.
[0013] In embodiments of any of the foregoing or following subject matter, the first promoter is a β-globin promoter.
[0014] In embodiments of any of the foregoing or following subject matter, the globin gene is selected from the group consisting of a β-globin gene, a γ-globin gene, and a δ-globin gene. In some of these embodiments, the globin gene is human β-globin gene. In some of these embodiments, human β-globin gene is a wild- type human β-globin gene or a mutant human β-globin gene. In some of these embodiments, the mutant human β-globin gene is the human β-globin gene T87Q mutant.
[0015] In embodiments of any of the foregoing or following subject matter, the 6x stop codon sequence block comprises the nucleotide sequence of GGATAAGACAGGACCTGGATGAGCAAGGCAATAGGATAGGCAAGGCATAGGATAAGACAGGCTATGGATAAGACAGGCCAGGATGAGACAGG (SEQ ID NO: 14).
[0016] In embodiments of any of the foregoing or following subject matter, the 3’ LTR comprises an insulator.
[0017] In embodiments of any of the foregoing or following subject matter, the lentiviral vector expression cassette is TAT-independent and self-inactivating (SIN).
[0018] In embodiments of any of the foregoing or following subject matter, the plasmid is SRT1, SRT2, SRT3, SRT4, SRT5, SRT8 or SRT11. In some embodiments, the globin transfer plasmid is SRT9.
[0019] Another aspect of the disclosure provides isolated lentiviral particles comprising the lentiviral vector encoded in any of the lentiviral transfer plasmids of the disclosure, as well as pharmaceutical compositions for transducing cells comprising an effective amount of the lentiviral particles of the disclosure in admixture with a pharmaceutically acceptable carrier.
[0020] A further aspect of the disclosure relates to hematopoietic cells transduced ex vivo with the lentiviral particles of the disclosure or a pharmaceutical composition of the disclosure.
[0021] In embodiments of any of the foregoing or following subject matter, the cells are selected from the group consisting of hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, and hemogenic endothelium cells. In embodiments of any of the foregoing or following subject matter, the hematopoietic stem cells are CD34+ hematopoietic stem cells. In embodiments of any of the foregoing or following subject matter, the transduce cells are provided as a pharmaceutical composition for treating a hemoglobinopathy which comprises an effective amount of these cells and a pharmaceutically acceptable carrier.
[0022] In one aspect, the disclosure provides methods of treating or ameliorating a hemoglobinopathy in a subject which comprise administering an effective amount of the transduced cells of the disclosure or a pharmaceutical composition comprising those cells to the subject to thereby treat or ameliorate said hemoglobinopathy. In embodiments of any of the foregoing or following subject matter, the cells are autologous, allogeneic, syngeneic or xenogeneic.
[0023] In another aspect, the disclosure provides methods of treating or ameliorating a hemoglobinopathy, in a subject which comprise transducing hematopoietic cells harvested from said subject with the lentiviral particles of the disclosure to produce transduced cells; and administering the transduced cells, or cells derived therefrom, into a subject, wherein the cells, or derivatives therefrom, express a globin gene. In embodiments of any of the foregoing or following subject matter, the hematopoietic cells are obtained from bone marrow of a subject.
[0024] In embodiments of any of the foregoing or following subject matter, the methods further comprise (a) harvesting bone marrow cells from a subject; (b) selecting CD34+ cells from said bone marrow cells; and (c) expanding and / or conditioning said CD34+ cells to thereby produce the said hematopoietic cells.
[0025] In embodiments of any of the foregoing or following subject matter, the hemoglobinopathy is selected from the group consisting of hemoglobin C disease, hemoglobin sickle cell disease (SCD), sickle cell anemia, hereditary anemia, thalassemia, β-thalassemia, thalassemia major, thalassemia intermedia, α-thalassemia, and hemoglobin H disease.
[0026] In embodiments of any of the foregoing or following subject matter, the globin gene is selected from the group consisting of a β-globin gene, a γ-globin gene, and a δ-globin gene. In some of these embodiments, the globin gene is human β-globin gene. In some of these embodiments, human β-globin gene is a wild- type human β-globin gene or a mutant human β-globin gene. In some of these embodiments, the mutant human β-globin gene is thehuman β-globin gene T87Q mutant.
[0027] In embodiments of any of the foregoing or following subject matter, treating or ameliorating a hemoglobinopathy comprises increasing the subject’s hemoglobin levels in an amount sufficient to treat or ameliorate the hemoglobinopathy, restoring the subject’s ability to produce red blood cells containing normal / functional hemoglobin, or a combination thereof.
[0028] In embodiments of any of the foregoing or following subject matter, the plasmids, particles, pharmaceutical composition, hematopoietic cells or methods of the disclosure have an artificial LCR which comprises an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
[0029] In one aspect, the recombinant lentiviral transfer plasmids express genes in an erythroid-specific manner and thus comprise(a) an erythroid-specific expression cassette which comprises sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a heterologous gene, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the erythroid-specific cassette to enable expression of the heterologous gene in a mammal when present in a cell;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the erythroid-specific expression cassette, a 3’ LTR, and posttranscriptional regulatory elements,wherein the erythroid-specific expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette,wherein the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette, andwherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(c) a plasmid backbone.
[0030] In embodiments of any of the foregoing or following subject matter, the heterologous gene encodes a transcription factor such as GATA1, KLF1, RUNX1, GATA2, HOXB2 or TAL1; a chromatin remodeler such as ATRX; a histone methyltransferase such as ASH1L; a chromatin assembly protein such as codanin1; a protein involved in vesicle formation such as SEC23B; a heme biosynthetic pathway enzyme such as ALAS-E, porphobilinogen deaminase, delta aminolevulinate dehydratase, ferrochelatase or CPO; or another enzyme such as PKLR, glutathione peroxidase, 15-lipoxygenase or carbonic anhydrase I. In embodiments of any of the foregoing or following subject matter, heterologous gene encodes an siRNA, a shRNA or other RNA that controls or regulates expression of any gene specific to an erythroid cell.
[0031] In one aspect, the recombinant lentiviral transfer plasmids are cPPT-centered vectors and express any gene of interest. Such transfer plasmids comprise:(a) a gene expression cassette which comprises sequences for, in 5’ to 3’ order, (i) a central polypurine tract (cPPT) and a promoter or (ii) a promoter and a cPPT, and a gene of interest, said sequences operably linked for expression of said gene of interest to enable expression in a mammal when present in a cell;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the gene expression cassette, a 3’ LTR, and posttranscriptional regulatory elements,wherein the gene expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette,wherein the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette, andwherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(c) a plasmid backbone.
[0032] In embodiments of any of the foregoing or following subject matter, the gene of interest is selected from the group consisting of coagulation factors VIII and IX, and alpha-1-antitrypsin.
[0033] In still further aspects, the disclosure provides isolated lentiviral particles comprising the lentiviral vector encoded in the erythroid-specific lentiviral transfer plasmids or the cPPT-centered lentiviral transfer plasmids of the disclosure as well as pharmaceutical compositions for transducing cells with those particles, hematopoietic cells transduced ex vivo with those lentiviral particles or pharmaceutical compositions.
[0034] In embodiments of any of the foregoing or following subject matter, the cells are selected from the group consisting of hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, and hemogenic endothelium cells. In embodiments of any of the foregoing or following subject matter, the hematopoietic stem cell is a CD34+ hematopoietic stem cell.
[0035] In a further aspect, the disclosure provides a pharmaceutical composition for treating anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells comprising an effective amount of the cells comprising the lentiviral vector encoded by the erythroid-specific lentiviral transfer plasmids, as well as methods of treating or ameliorating anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells in a subject which comprises administering an effective amount of transduced cells or a pharmaceutical composition (derived from the erythroid-specific lentiviral transfer plasmids) to the subject to thereby treat or ameliorate said anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells.
[0036] In embodiments of any of the foregoing or following subject matter, the cells are autologous, allogeneic, syngeneic or xenogeneic.
[0037] In other aspects, the disclosure provides an artificial β-globin locus control region (LCR) comprising an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 or an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5. These LCRs can be incorporated into any of the transfer plasmids of the disclosure.
[0038] In embodiments of any of the foregoing or following subject matter, these LCRs comprise(a) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(b) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(c) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.In a preferred embodiment, the LCR comprises an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
[0039] In embodiments of any of the foregoing or following subject matter, any of these LCRS are present in an expression cassette operably linked to an erythroid-specific promoter and a heterologous gene, wherein said artificial LCR comprises an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 or an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5. In some embodiments, the LCR of the expression cassette comprises(a) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(b) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(c) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.In a preferred embodiment, the LCR of the expression cassette comprises an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
[0040] In embodiments of any of the foregoing or following subject matter, the erythroid-specific promoter of the expression cassette is a β-globin promoter.
[0041] In embodiments of any of the foregoing or following subject matter, the expression cassette further comprises a 3’-erythroid-specific enhancer operably linked to the heterologous gene.
[0042] In a related aspect, any of these LCRs are incorporated into a globin expression cassette comprising the artificial β-globin locus control region (LCR) operably linked to a promoter and a globin gene functional to ameliorate a hemoglobinopathy. In some embodiments, the artificial LCR of the globin expression cassette comprises an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 or an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5. In some embodiments, the artificial LCR of the globin expression cassette comprises(a) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(b) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(c) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.In some embodiments, the artificial LCR of the globin expression cassette comprises an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
[0043] In embodiments of any of the foregoing or following subject matter, the erythroid-specific promoter of the globin expression cassette is a β-globin promoter.
[0044] In embodiments of any of the foregoing or following subject matter, the globin expression cassette further comprises a 3’-erythroid-specific enhancer operably linked to the heterologous gene.
[0045] In a further related aspect, any of these LCRs can be incorporated into a recombinant lentiviral transfer plasmid comprising:(a) the any of the foregoing expression cassettes or any of the globin expression cassettes;(b) a central polypurine tract (cPPT);(c) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, a 3’ LTR, and posttranscriptional regulatory elements,wherein the expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette,wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(d) a plasmid backbone.
[0046] In some embodiments of these recombinant lentiviral transfer plasmids, the cPPT sequence is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] Figure 1. Schematic Diagram of SRT Lentiviral Globin-Specific Transfer Plasmids.This diagram schematically illustrates the overall sequence elements in the constructs TNS9.3.55 and SRT plasmid series from 1 through 5 (SRT1-SRT5). The numbers above a specific DNA region in the diagram indicate its nucleotide length. Abbreviations are: CMV, cytomegalovirus enhancer / promoter; Ψ, HIV packaging sequences; Δgag, HIV partial gag sequence; RRE, rev-responsive element; black oval, central polypurine tract; 3’-En, 3’ erythroid-specific enhancer; WT, wild type; β-T87Q-globin, the T87Q mutant β-globin gene; “*”, the approximate position of the T87Q substitution in βglobin exon 2; βp; βglobin promoter; WPRE, woodchuck post-transcriptional regulatory element; 3’LTR, self-inactivating (400 bp deleted) 3’ LTR; A1, A1 insulator sequence; pA, bovine growth hormone poly(adenylation) signal; black rectangle, 6x stop codon block sequence; pUC19, pUC57-Kan-Brick, and pUC57-Kan are the plasmid backbones; and Nano, Nanoplasmid backbone from Aldevron.
[0048] Figure 2.Schematic Diagram of Lentiviral cPPT-centered Transfer Plasmids. This diagram schematically illustrates representative sequence elements in a globin-specific transfer plasmid, an erythroid-specific transfer plasmid and a cPPT-centered generic transfer plasmid, with or without the presence of the A1 insulator. The abbreviations are the same as in Fig. 1 with additional abbreviations: MCS, multi-cloning site; KanR-ori, plasmid backbone with kanamycin resistance gene and a bacterial replication origin
[0049] Figure 3.Bar Graph Illustrating Functional Titers of Lentiviral Vector. Lentiviral vector stocks for SRT1 (n=4), SRT2 (n=5) and SRT5 (n=1) were used to transduce 5×105 human T cells (subT1) as described in Example 2. Functional titers of viral products were determined by quantitative PCR (qPCR) detection of lentiviral GAG sequences in genomic DNA isolated from transduced cells and are reported as transducing units (TU / mL). * P<0.05 significant difference in viral titer between SRT2 versus SRT1.
[0050] Figure 4. Transduction of Human Erythroleukemia K562 Cells with Lentiviral Vectors Encoding for Erythroid-specific Expression of Green Fluorescence Protein (GFP). (A) D432-GFP lentiviral vector (top) and K562 cells (1x105 per well of a 12-well plate) were transduced with D432-GFP control lentiviral vector at 0, 10, 30 and 100, microliters in a total volume of 2 mL complete growth medium supplemented with 100 µg / mL F108. The D432-GFP lentivirus used here had an estimated titer of 1x106 / mL (bottom). (B) Flow cytometry histograms (top) demonstrating GFP expression and calculated titer based on average GFP+ cells for 10 and 30 microliter doses (bottom). (C) Percentage GFP+ cells as a function of vector copy number (VCN). Genomic DNA isolated from cell line (GA8) harboring a single copy lentiviral vector was serially diluted from 100 ng to 0.1 ng and qPCR performed using primer-probe sets to lentiviral vector Psi sequence or the cellular control gene RNaseP to establish standard curves for VCN calculations. (D) VCN as a function of virus particles added to K562 cells (1x105 per well of a 12-well plate) where D432-GFP control virus titer was 9.2x105 TU / mL based on flow cytometry results in panel B.
[0051] Figure5. Titration of β-globin Lentiviral VectorsBased on Volume. (A) K562 cells (1x105 per well of a 12-well plate) were transduced with 10, 30 or 100 microliters of SRT1 or SRT2 virus in a total volume of 2 mL growth medium supplemented with 100 µg / mL F108. Cultures were grown for 7 days for total RNA isolation, 10 days for genomic DNA isolation, or 14 days for flow cytometry analysis of intercellular β-globin protein (clone 37-8; AlexaFluor 488; Santa Cruz Biotechnology; 1:500 dilution). (B) Transcript levels of β-globin as a percentage of the cellular control RNaseP for cells transduced with SRT1 (left) or SRT2 (right) at the indicated volumes . (C) Intracellular β-globin protein expression cells transduced with SRT1 (left) or SRT2 (right) at the indicated volumes. Average VCN for each condition is reported below the graph; VCN for SRT1 at 100 microliter volume was not determined (nd).
[0052] Figure 6. Titration of β-globin Lentiviral Vectors Based on Multiplicity of Infection (MOI). (A) K562 cells (1x105 per well of a 12-well plate) were transduced with SRT1 or SRT2 β-globin encoding lentivirus vector at equivalent MOI of 0.3, 1, 3, and 10 in a total volume of 2 mL complete growth medium supplemented with 100 µg / mL F108. Cultures were grown for 7 days for total RNA isolation, 10 days for genomic DNA isolation, or 14 days for flow cytometry analysis of intercellular β-globin protein (clone 37-8; AlexaFluor 488; Santa Cruz Biotechnology; 1:500 dilution). (B) Transcript levels of β-globin as a percentage of the cellular control RNaseP for cells transduced with SRT1 (left) or SRT2 (right) at the indicated MOI. (C) Intracellular β-globin protein expression for cells transduced with SRT1 (left) or SRT2 (right) at the indicated MOI. Average VCN for each condition is reported below the graph. Results presented are the averages from two independent experiments.
[0053] Figure 7.β-globin Production as Function of Vector Copy Number. Using the data from Fig. 6, the log of the percentage of intracellular β-globin protein expression is plotted as a function of the log of the vector copy number for cells transduced with SRT1 (●) or SRT2 (■).
[0054] Figure 8.Schematic Diagram of SRT Lentiviral Globin-Specific Transfer Plasmids. This diagram schematically illustrates the overall sequence elements in the constructs SRT1, SRT2, SRT8, SRT9, and SRT11. The numbers above a specific DNA region in the diagram indicate its nucleotide length. Abbreviations are the same as in Fig. 1.
[0055] Figure 9.Bar Graph Illustrating Functional Titers Obtained with Lentiviral Vectors. Lentiviral vector stocks for SRT1, SRT2, SRT8, SRT9, and SRT11 were used to transduce SupT1 cells as described in Example 8 and graphed as the functional titers by droplet digital PCR (ddPCR) detection of lentiviral GAG sequences in genomic DNA isolated from transduced cells. The data is reported as transducing units (TU / mL).
[0056] Figure 10. GMP Titers. GMP grade SRT8 titers were determined by droplet digital PCR (ddPCR) detection of lentiviral GAG sequences in genomic DNA isolated from transduced cells. The data is plotted relative to a GMP grade TNS9.3.55 titer and reported as transducing units (TU / mL).
[0057] Figure 11. Titration of β-globin Lentiviral Vectors Based on Multiplicity of Infection (MOI). (A) Schematic overview showing K562 cells (1x105 per well of a 12-well plate) were transduced with SRT1, SRT2, SRT8, SRT11 and SRT-CA β-globin encoding lentivirus vector at equivalent MOI of 3 and 10 in a total volume of 2 mL complete growth medium supplemented with 100 µg / mL F108. Cultures were grown for 7 days for total RNA isolation, 10 days for genomic DNA isolation, or 14 days for flow cytometry analysis of intercellular β-globin protein (clone 37-8; AlexaFluor 488; Santa Cruz Biotechnology; 1:500 dilution). (B) Transcript levels of β-globin as a percentage of the cellular control RNaseP normalized to vector copy number at the indicated MOI. (C) Intracellular β-globin protein expression per vector copy number for cells at the indicated MOI.
[0058] Figure 12.Percentage of β-globin positive cells after transduction with various lentiviral vectors. Flow cytometry density plots of β-globin protein expression in SRT1, SRT2, SRT8, SRT11, and SRT-CA at MOI=3 or 10. Note the increased mean fluorescence intensity (MFI) for SRT8 compared to the other vectors.
[0059] Figure 13.Multi-lineage colony forming potential of transduced CD34+ cells.This bar graph provides the total colony-forming units (CFU) of erythroid and nonerythroid cells from CD34+ cells transduced with TNS9.3.55, SRT8 and SRT9.
[0060] Figure 14.GFP positive cell in undifferentiated and fully differentiated CD34+ cells. This bar graph shows the % GFP positive cells for undifferentiated CD34+ cells transduced with SRT9 (left panel) or full differentiated CD34+ cells transduces with SRT9 (right panel).
[0061] Figure 15.Vector copy number calculated from differentiated human CD34+ cells. This bar graph shows the VCN for after differentiation of CD34+ cells transduced with vehicle (mock) TNS9.3.55, SRT8 or SRT9 lentiviral vectors.
[0062] Figure 16.Total β-globin transcript levels from differentiated human CD34+ cells. This bar graph shows the β-globin transcript levels as a function of total β-globin and α-globin transcript levels after differentiation of CD34+ cells transduced with vehicle (mock) TNS9.3.55, SRT8 or SRT9 lentiviral vectors.
[0063] Figure 17.Variant specific expression of T87Q globin. This bar graph shows VCN of the β-globin transcript levels as a function of VCN for the T87Q mutant β-globin after differentiation of CD34+ cells transduced with vehicle (mock) TNS9.3.55, SRT8 or SRT9 lentiviral vectors.
[0064] Figure 18.Table of selected elements in SRT vectors and TNS9.3.55. This table illustrates some of the differences between the SRT transfer plasmids relative to TNS9.3.55, including the vector length (which is the size of the integrated vector from the beginning of the 5’LTR to the end of the 3’ LTR), the length of the β-globin promoter, the lengths of the individual HS2, HS3, HS4 elements and the overall LCR length; all values are in base pairs. For the cPPT element, the location is given relative to position 1 of the 5’ LTR. The positions of HS2, HS3 and HS4 elements are the location of those sequences in GenBank sequence NG_052895.1. DETAILED DESCRIPTION OF THE DISCLOSURE
[0065] In order that the present disclosure may be more readily understood, certain terms are defined below. Additional definitions may be found within the detailed description of the disclosure. Definitions
[0066] Throughout this specification, the word “comprise” or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated integer (or components) or group of integers (or components), but not the exclusion of any other integer (or components) or group of integers (or components).
[0067] The singular forms “a,” “an,” and “the” include the plurals unless the context clearly dictates otherwise.
[0068] The term “including” is used to mean “including but not limited to.” “Including” and “including but not limited to” are used interchangeably.
[0069] As used herein, the term “nucleic acid molecule” or “nucleic acid” is intended to include DNA molecules, RNA molecules (e.g., mRNA, shRNA, siRNA, microRNA), analogs of the DNA or RNA generated using nucleotide analogs, and derivatives, fragments and homologs thereof. The nucleic acid molecules of the disclosure may be single-, double-, or triple-stranded. A nucleic acid molecule of the present disclosure may be isolated using sequence information provided herein and well known molecular biological techniques (e.g., as described in Sambrook et al., Eds., MOLECULAR CLONING: A LABORATORY MANUAL 2ND ED., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Ausubel, et al., Eds., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1993).
[0070] A “vector” refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide or nucleic acid, and which can be used to mediate delivery of the polynucleotide or nucleic acid to a cell, either in vitro or in vivo, illustrative vectors include, for example, plasmids, viral vectors, liposomes and other gene delivery vehicles, such as viruses. The polynucleotide or nucleic acid to be delivered, sometimes referred to as a “target polynucleotide” or “transgene,” may comprise a coding sequence of interest in gene therapy (such as a gene encoding a protein of therapeutic interest). Vector thus includes a biological entity, such as a lentivirus or other virus, used for the delivery of genes into an organism or introduction of foreign genes into cells.
[0071] “Transfection” or “transduction” as used herein, are terms referring to a process for the introduction of an exogenous polynucleotide, nucleic acid or vector into a host cell leading to expression of the polynucleotide, e.g., the transgene in the cell, and includes the use of recombinant nucleic acids or virus, respectively, to introduce the exogenous polynucleotide to the host cell. Transfer of a polynucleotide into a cell may be determined by methods well known to the art including, but not limited to, protein expression (including steady state levels), e.g., by ELISA, flow cytometry and Western blot; and measurement of DNA and RNA by heterologous hybridization assays, e.g., Northern blots, Southern blots and gel shift mobility assays. Methods used for the introduction of the exogenous polynucleotide include well-known techniques such as direct viral infection or non-viral plasmid transfection using methods such as lipids, electroporation, as well as other non-viral gene delivery applications into eukaryotic cells. The introduced polynucleotide may be stably or transiently maintained in the host cell.
[0072] “Gene delivery” or “gene transfer” refers to the introduction of an exogenous polynucleotide into a cell for gene therapy, and may encompass targeting, binding, uptake, transport, localization, gene modification, replicon integration and expression.
[0073] The term “polynucleotide” refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated or capped nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components, if present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of the disclosure described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
[0074] An “isolated” as used herein, e.g., for a polynucleotide, virus, polypeptide or other substance, refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Isolated nucleic acid, peptide or polypeptide is present in a form or setting that is different from that in which it is found in nature. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments are envisioned, for example, a 2-fold enrichment, 10-fold enrichment, 100-fold enrichment, or a 1000-fold enrichment.
[0075] A “transcriptional regulatory sequence” refers to a genomic region that controls the transcription of a gene or coding sequence to which it is operably linked. Transcriptional regulatory sequences of use generally include at least one transcriptional promoter and may also include one or more enhancers and / or terminators of transcription.
[0076] “Operably linked” refers to an arrangement of two or more components, wherein the components so described are in a relationship permitting them to function in a coordinated manner. By way of illustration, a transcriptional regulatory sequence or a promoter is operably linked to a coding sequence if those sequences or the promoter promotes transcription of the coding sequence. Operably linked sequences or promoters are generally joined in cis with the coding sequence, but it is not necessarily directly adjacent to it.
[0077] “Heterologous” means derived from a genotypically distinct entity or location from the entity to which it is compared. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). By way of another example, a polynucleotide or protein coding sequence removed from its native location in a genome, and which is operably linked to (or otherwise associated with) at least one sequence element with which it is not normally associated (e.g., when cloned into a plasmid or vector), is a heterologous gene or coding sequence with respect to those sequence elements. Similarly, any sequence element, such as a promoter or a protein coding sequence, that is removed from its native sequence location and linked to a different, non-native sequence location is a heterologous element.
[0078] “Host cells,” “cell lines,” “cell cultures,” “packaging cell line” and other such terms denote eukaryotic cells, such as mammalian cells including human cells, useful in the present disclosure, e.g., to produce recombinant virus. These cells include the progeny of the original cell that was transduced. It is understood that the progeny of a single cell may not necessarily be completely identical (in morphology or in genomic complement) to the original parent cell.
[0079] “Recombinant,” as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction and / or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.
[0080] A “control element” or “control sequence” is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3′ direction) from the promoter.
[0081] An “expression vector” is a vector comprising a region which encodes a gene product of interest and is used for effecting the expression of the gene product in an intended target cell. An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the protein in the target.
[0082] The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, acetylation, phosphorylation, lipidation, or conjugation with a labeling component.
[0083] The term “exogenous,” when used in relation to a protein, gene, nucleic acid, or polynucleotide in a cell or organism refers to a protein, gene, nucleic acid, or polynucleotide which has been introduced into the cell or organism by artificial or natural means. An exogenous nucleic acid may be from a different organism or cell, or it may be one or more additional copies of a nucleic acid which occurs naturally within the organism or cell. By way of a non-limiting example, an exogenous nucleic acid is in a chromosomal location different from that of natural cells or is otherwise flanked by a different nucleic acid sequence than that found in nature, e.g., an expression cassette which links a promoter from one gene to an open reading frame for a gene product from a different gene.
[0084] “Transgenic” is used herein to include any host cell or cell line, which has been altered or augmented by the presence of at least one recombinant DNA sequence. The host cells are typically produced by transfection with a DNA sequence in a plasmid expression vector, as an isolated linear DNA sequence, or infection with a recombinant viral vector.
[0085] As used herein, the term “expression cassette” refers to a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements, which permit transcription of a particular nucleic acid in a target cell. The expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus or nucleic acid region. The expression cassette portion can include a gene to be transcribed and elements that control the expression of the gene (e.g., a promoter, enhancer polyadenylation sequences and the like).
[0086] As used herein a “lentiviral vector,” “LV vector,” “LVV” or “lentivirus” refers, in context, to either the nucleic acid packaged within a lentiviral particle or to the particle itself. Lentiviral vector, LV vector and LVV are also used interchangeably herein with “lentiviral particle” or “lentiviral vector particle.”
[0087] The “β-globin locus control region” or “LCR” was identified over 20 years ago and is a long-range, cis-acting regulatory region required for expression of globin genes in erythroid cells. The β-globin LCR has five DNase I hypersensitive sites (HS): HS1, HS2, HS3, HS4 and HS5. The sequences / structures of many LCRs of the β-globin genes have been published, e.g., human [36, 37], mouse
[38] , rabbit
[39] and goat
[40] . The LCRs used in the present disclosure are artificial LCRs derived from the native LCRs. The β-globin LCRs in the present disclosure confer erythroid specific enhancer activity of gene expression.
[0088] As used herein, the term “recombinant” includes reference to a cell or a vector that has been modified by the introduction of a heterologous nucleic acid or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all as a result of deliberate human intervention or may have reduced or eliminated expression of a native gene.
[0089] As used herein, the term “globin” refers to a family of heme-containing proteins that are involved in the binding and transport of oxygen. Subunits of vertebrate and invertebrate hemoglobins, vertebrate and invertebrate myoglobins or mutants thereof are included by the term globin, whether wild type or mutant.
[0090] As used herein, the term “wild-type” refers to the normal gene, virus, or organism found in nature, including allelic variations, without any mutation or modification.
[0091] The terms “patient,” “subject,” and “individual” may be used interchangeably and refer to either a human or a non-human animal. These terms include mammals such as humans, primates, livestock animals (e.g., cows, pigs), companion animals (e.g., dogs, cats) and rodents (e.g., mice and rats).
[0092] The term “non-human mammal” means a mammal which is not a human and includes, but is not limited to, a mouse, rat, rabbit, pig, cow, sheep, goat, dog, primate, or other non-human mammals typically used in research. As used herein, “mammals” includes the foregoing non-human mammals and humans.
[0093] As used herein, “treating” or “treatment” and grammatical variants thereof refer to an approach for obtaining beneficial or desired clinical results. The term may refer to slowing the onset or rate of development of a condition, disorder or disease, reducing or alleviating symptoms associated with it, generating a complete or partial regression of the condition, or some combination of any of the above. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, reduction or alleviation of symptoms, diminishment of extent of disease, stabilization (i.e., not worsening) of state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival relative to expected survival time if not receiving treatment. A subject (e.g., a human) in need of treatment may thus be a subject already afflicted with the disease or disorder in question. The term “treatment” includes inhibition or reduction of an increase in severity of a pathological state or symptoms relative to the absence of treatment and is not necessarily meant to imply complete cessation of the relevant disease, disorder or condition.
[0094] As used herein, the terms "preventing" and grammatical variants thereof refer to an approach for preventing the development of, or altering the pathology of, a condition, disease or disorder. Accordingly, "prevention" may refer to prophylactic or preventive measures. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, prevention or slowing of symptoms, progression or development of a disease, whether detectable or undetectable. A subject (e.g., a human) in need of prevention may thus be a subject not yet afflicted with the disease or disorder in question. The term “prevention” includes slowing the onset of disease relative to the absence of treatment and is not necessarily meant to imply permanent prevention of the relevant disease, disorder or condition. Thus “preventing” or “prevention” of a condition may in certain contexts refer to reducing the risk of developing the condition or preventing or delaying the development of symptoms associated with the condition.
[0095] As used herein, an “effective amount,” “therapeutically-effective amount” or “effective dose” is an amount of a composition (e.g., a therapeutic composition or agent) that produces at least one desired therapeutic effect in a subject, such as preventing or treating a target condition or beneficially alleviating a symptom associated with the condition. Artificial Locus Control Regions (LCRs)
[0096] As further discussed below, the LCRs used in the transfer plasmids of the present disclosure are artificial β-globin LCRs (artificial LCRs are also referred to herein as modified LCRs; these terms are used interchangeably). Many suitable artificial β-globin LCRs are known in the art and are described below under the section entitled “Lentiviral Transfer Plasmids,” part A.1.a. In addition, this disclosure provides a series of new artificial LCRs based on modification of the HS3 and HS4 elements. The new LCRs of the disclosure (as described in this section) can be used in any of the transfer plasmids of the disclosure as well as other plasmids, viral vectors or non-viral vectors for which erythroid-specific gene expression may be desired. These new LCRs are safe and efficacious for gene therapy.
[0097] Example 7 describes the design and construction of a new artificial LCR used in lentiviral transfer plasmids SRT8 and SRT11. For those plasmids, the HS3 and HS4 elements are reduced in size to 999 and 539 bp, respectively, and the HS2 element is unchanged in size. In contrast, the LCR in TNS9.3.55 has a length of 859 bp for HS2 whereas SRT1-5 has an HS2 of 853 bp, an HS3 of 1301 bp and an HS4 of 1063 bp. The sequence for each of these HS2, HS3, and HS4 elements from the various transfer plasmids is provided in Table 1. Table 1. Select HS Element SequencesSeq NoPlasmidHS#HS size(bp)Sequence 1SRT1-52853TGTATATATATATATATATATTCAGGAAATAATATATTCTAGAATATGTCACATTCTGTCTCAGGCATCCATTTTCTTTATGATGCCGTTTGAGGTGGAGTTTTAGTCAGGTGGTCAGCTTCTCCTTTTTTTTGCCATCTGCCCTGTAAGCATCCTGCTGGGGACCCAGATAGGAGTCATCACTCTAGGCTGAGAACATCTGGGCACACACCCTAAGCCTCAGCATGACTCATCATGACTCAGCATTGCTGTGCTTGAGCCAGAAGGTTTGCTTAGAAGGTTACACAGAACCAGAAGGCGGGGGTGGGGCACTGACCCCGACAGGGGCCTGGCCAGAACTGCTCATGCTTGGACTATGGGAGGTCACTAATGGAGACACACAGAAATGTAACAGGAACTAAGGAAAAACTGAAGCTTATTTAATCAGAGATGAGATGCTGGAAGGGATAGAGGGAGCTGAGCTTGTAAAAAGTATAGTAATCATTCAGCAAATGGTTTTGAAGCACCTGCTGGATGCTAAACACTATTTTCAGTGCTTGAATCATAAATAAGAATAAAACATGTATCTTATTCCCCACAAGAGTCCAAGTAAAAAATAACAGTTAATTATAATGTGCTCTGTCCCCCAGGCTGGAGTGCAGTGGCACGATCTCAGCTCACTGCAACCTCCGCCTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCCACCCTAATAGCTGGGATTACAGGTGCACACCACCATGCCAGGCTAATTTTTGTACTTTTTGTAGAGGCAGGGTATCACCATGTTGTCCAAGATGGTCTTGAACTCCTGAGCTCCAAGCAGTCCACCCACCTCAGCCTCCCAAAGTGCT2SRT1-531301AAGCTTTCATTAAAAAAAGTCTAACCAGCTGCATTCGACTTTGACTGCAGCAGCTGGTTAGAAGGTTCTACTGGAGGAGGGTCCCAGCCCATTGCTAAATTAACATCAGGCTCTGAGACTGGCAGTATATCTCTAACAGTGGTTGATGCTATCTTCTGGAACTTGCCTGCTACATTGAGACCACTGACCCATACATAGGAAGCCCATAGCTCTGTCCTGAACTGTTAGGCCACTGGTCCAGAGAGTGTGCATCTCCTTTGATCCTCATAATAACCCTATGAGATAGACACAATTATTACTCTTACTTTATAGATGATGATCCTGAAAACATAGGAGTCAAGGCACTTGCCCCTAGCTGGGGGTATAGGGGAGCAGTCCCATGTAGTAGTAGAATGAAAAATGCTGCTATGCTGTGCCTCCCCCACCTTTCCCATGTCTGCCCTCTACTCATGGTCTATCTCTCCTGGCTCCTGGGAGTCATGGACTCCACCCAGCACCACCAACCTGACCTAACCACCTATCTGAGCCTGCCAGCCTATAACCCATCTGGGCCCTGATAGCTGGTGGCCAGCCCTGACCCCACCCCACCCTCCCTGGAACCTCTGATAGACACATCTGGCACACCAGCTCGCAAAGTCACCGTGAGGGTCTTGTGTTTGCTGAGTCAAAATTCCTTGAAATCCAAGTCCTTAGAGACTCCTGCTCCCAAATTTACAGTCATAGACTTCTTCATGGCTGTCTCCTTTATCCACAGAATGATTCCTTTGCTTCATTGCCCCATCCATCTGATCCTCCTCATCAGTGCAGCACAGGGCCCATGAGCAGTAGCTGCAGAGTCTCACATAGGTCTGGCACTGCCTCTGACATGTCCGACCTTAGGCAAATGCTTGACTCTTCTGAGCTCAGTCTTGTCATGGCAAAATAAAGATAATAATAGTGTTTTTTTATGGAGTTAGCGTGAGGATGGAAAACAATAGCAAAATTGATTAGACTATAAAAGGTCTCAACAAATAGTAGTAGATTTTATCATCCATTAATCCTTCCCTCTCCTCTCTTACTCATCCCATCACGTATGCCTCTTAATTTTCCCTTACCTATAATAAGAGTTATTCCTCTTATTATATTCTTCTTATAGTGATTCTGGATATTAAAGTGGGAATGAGGGGCAGGCCACTAACGAAGAAGATGTTTCTCAAAGAAGCCATTCTCCCCACATAGATCATCTCAGCAGGGTTCAGGAAGATAAAGGAGGATCAAGGTCGAAGGTAGGAACTAAGGAAGAACACTGGGCAAGTGGATCC3SRT1-541063TGAGCCCCTTTTCCTCTAACTGAAAGAAGGAAAAAAAAATGGAACCCAAAATATTCTACATAGTTTCCATGTCACAGCCAGGGCTGGGCAGTCTCCTGTTATTTCTTTTAAAATAAATATATCATTTAAATGCATAAATAAGCAAACCCTGCTCGGGAATGGGAGGGAGAGTCTCTGGAGTCCACCCCTTCTCGGCCCTGGCTCTGCAGATAGTGCTATCAAAGCCCTGACAGAGCCCTGCCCATTGCTGGGCCTTGGAGTGAGTCAGCCTAGTAGAGAGGCAGGGCAAGCCATCTCATAGCTGCTGAGTGGGAGAGAGAAAAGGGCTCATTGTCTATAAACTCAGGTCATGGCTATTCTTATTCTCACACTAAGAAAAAGAATGAGATGTCTACATATACCCTGCGTCCCCTCTTGTGTACTGGGGCCCCCAAGAGCTCTCTAAAAGTGATGGCAAAGTCATTGCGCTAGATGCCATCCCATCTATTATAAACCTGCATTTGTCTCCACACACCAGTCATGGACAATAACCCTCCTCCCAGGTCCACGTGCTTGTCTTTGTATAATACTCAAGTAATTTCGGAAAATGTATTCTTTCAATCTTGTTCTGTTATTCCTGTTTCAATGGCTTAGTAGAAAAAGTACATACTTGTTTTCCCATAAATTGACAATAGACAATTTCACATCAATGTCTATATGGGTCGTTGTGTTTGCTGTGTTTGCAAAAACTCACAATAACTTTATATTGTTACTACTCTAAGAAAGTTACAACATGGTGAATACAAGAGAAAGCTATTACAAGTCCAGAAAATAAAAGTTATCATCTTGAGGCTCAGCTTTCTAGGAATAATATCAATATTACAAAATTTAATCTAACAATTATGAACAGCAATGAGATAATATGTACAAAGTACCCAGACCTATGTGGTAGAGCATCAAGGAAGCGCATTGCGGAGCAGTTTTTTGTTTGTTTGTTTTTGTATTCTGTTTCGTGAGGCAAGGTTTCACTCTGCTGTCCAGGCTGGAGTGCAGTGGCAAGATCATGTCTCACTGCAGCCTTGAC1SRT8, 9 & SRT112853TGTATATATATATATATATATTCAGGAAATAATATATTCTAGAATATGTCACATTCTGTCTCAGGCATCCATTTTCTTTATGATGCCGTTTGAGGTGGAGTTTTAGTCAGGTGGTCAGCTTCTCCTTTTTTTTGCCATCTGCCCTGTAAGCATCCTGCTGGGGACCCAGATAGGAGTCATCACTCTAGGCTGAGAACATCTGGGCACACACCCTAAGCCTCAGCATGACTCATCATGACTCAGCATTGCTGTGCTTGAGCCAGAAGGTTTGCTTAGAAGGTTACACAGAACCAGAAGGCGGGGGTGGGGCACTGACCCCGACAGGGGCCTGGCCAGAACTGCTCATGCTTGGACTATGGGAGGTCACTAATGGAGACACACAGAAATGTAACAGGAACTAAGGAAAAACTGAAGCTTATTTAATCAGAGATGAGATGCTGGAAGGGATAGAGGGAGCTGAGCTTGTAAAAAGTATAGTAATCATTCAGCAAATGGTTTTGAAGCACCTGCTGGATGCTAAACACTATTTTCAGTGCTTGAATCATAAATAAGAATAAAACATGTATCTTATTCCCCACAAGAGTCCAAGTAAAAAATAACAGTTAATTATAATGTGCTCTGTCCCCCAGGCTGGAGTGCAGTGGCACGATCTCAGCTCACTGCAACCTCCGCCTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCCACCCTAATAGCTGGGATTACAGGTGCACACCACCATGCCAGGCTAATTTTTGTACTTTTTGTAGAGGCAGGGTATCACCATGTTGTCCAAGATGGTCTTGAACTCCTGAGCTCCAAGCAGTCCACCCACCTCAGCCTCCCAAAGTGCT4SRT8, 9 & SRT113999AAGCTTTCATTAAAAAAAGTCTAACCAGCTGCATTCGACTTTGACTGCAGCAGCTGGTTAGAAGGTTCTACTGGAGGAGGGTCCCAGCCCATTGCTAAATTAACATCAGGCTCTGAGACTGGCAGTATATCTCTAACAGTGGTTGATGCTATCTTCTGGAACTTGCCTGCTACATTGAGACCACTGACCCATACATAGGAAGCCCATAGCTCTGTCCTGAACTGTTAGGCCACTGGTCCAGAGAGTGTGCATCTCCTTTGATCCTCATAATAACCCTATGAGATAGACACAATTATTACTCTTACTTTATAGATGATGATCCTGAAAACATAGGAGTCAAGGCACTTGCCCCTAGCTGGGGGTATAGGGGAGCAGTCCCATGTAGTAGTAGAATGAAAAATGCTGCTATGCTGTGCCTCCCCCACCTTTCCCATGTCTGCCCTCTACTCATGGTCTATCTCTCCTGGCTCCTGGGAGTCATGGACTCCACCCAGCACCACCAACCTGACCTAACCACCTATCTGAGCCTGCCAGCCTATAACCCATCTGGGCCCTGATAGCTGGTGGCCAGCCCTGACCCCACCCCACCCTCCCTGGAACCTCTGATAGACACATCTGGCACACCAGCTCGCAAAGTCACCGTGAGGGTCTTGTGTTTGCTGAGTCAAAATTCCTTGAAATCCAAGTCCTTAGAGACTCCTGCTCCCAAATTTACAGTCATAGACTTCTTCATGGCTGTCTCCTTTATCCACAGAATGATTCCTTTGCTTCATTGCCCCATCCATCTGATCCTCCTCATCAGTGCAGCACAGGGCCCATGAGCAGTAGCTGCAGAGTCTCACATAGGTCTGGCACTGCCTCTGACATGTCCGACCTTAGGCAAATGCTTGACTCTTCTGAGCTCAGTCTTGTCATGGCAAAATAAAGATAATAATAGTGTTTTTTTATGGAGTTAGCGTGAGGATGGAAAACAATAGCAAAATTGATTAGACTATAAAA5SRT8, 9 & SRT114539CATTGTCTATAAACTCAGGTCATGGCTATTCTTATTCTCACACTAAGAAAAAGAATGAGATGTCTACATATACCCTGCGTCCCCTCTTGTGTACTGGGGCCCCCAAGAGCTCTCTAAAAGTGATGGCAAAGTCATTGCGCTAGATGCCATCCCATCTATTATAAACCTGCATTTGTCTCCACACACCAGTCATGGACAATAACCCTCCTCCCAGGTCCACGTGCTTGTCTTTGTATAATACTCAAGTAATTTCGGAAAATGTATTCTTTCAATCTTGTTCTGTTATTCCTGTTTCAATGGCTTAGTAGAAAAAGTACATACTTGTTTTCCCATAAATTGACAATAGACAATTTCACATCAATGTCTATATGGGTCGTTGTGTTTGCTGTGTTTGCAAAAACTCACAATAACTTTATATTGTTACTACTCTAAGAAAGTTACAACATGGTGAATACAAGAGAAAGCTATTACAAGTCCAGAAAATAAAAGTTATCATCTTGAGGCCTCAGCTTTCTAGGAATAATATCAATATTACAAAA
[0098] Accordingly, the disclosure relates to an expression cassette comprising an artificial β-globin locus control region (LCR) operably linked to an erythroid-specific promoter and a heterologous gene, wherein the artificial LCR comprises an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 or an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5. In any of the embodiments, the LCR can comprise(a) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(b) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(c) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
[0099] In a preferred embodiment, the LCR comprises an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
[00100] These new artificial LCRs can be used in plasmids and vectors with any combination of sequence elements such as promoters, enhancers and heterologous genes, as describe herein or as known to those of skill in the art. For example, in some embodiments, these LCRs are operably linked with a β-globin promoter and a 3’-erythroid-specific enhancer. In some embodiments, the heterologous gene is a globin gene functional to ameliorate a hemoglobinopathy. In some embodiments, any of these new LCRs can be part of recombinant lentiviral transfer plasmids comprising (a) an expression cassette or a the globin expression cassette; (b) a central polypurine tract (cPPT); (c) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, a 3’ LTR, and posttranscriptional regulatory elements, wherein the expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette, and wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and (d) a plasmid backbone. In some of those embodiments, the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette.
[00101] Any of the above contemplated LCRs are contemplated for use with any of the transfer plasmids, lentiviral vectors and particles, pharmaceutical compositions, hematopoietic cells and methods of the disclosure, as appropriate. Lentiviral Transfer Plasmids
[00102] In one aspect, the disclosure relates to improved recombinant lentiviral transfer plasmids used to produce lentiviral vectors (or LVVs) which are useful for gene therapy. The transfer plasmids of the disclosure comprise a lentiviral vector cassette having a gene expression cassette inserted therein in the antisense directions (relative to transcription of the lentiviral vector cassette) and are an improvement over previous transfer plasmids for at least two reasons. First, the lentiviral vector cassette in the transfer plasmids of the disclosure have a cPPT sequence positioned approximately midway between the 5’ and 3’ LTRs in the cassette and, second, the lentiviral vector cassette also includes a 6x stop codon sequence immediately following the 3’ LTR, external WPRE and poly(a) signal of the lentiviral vector cassette. Without wishing to be bound by a mechanism, the presence of a cPPT sequence in lentiviral vector constructs is known to enhance transduction efficiency, reportedly by facilitating the nuclear import of the cDNA due to the formation of a central DNA flap conformation.
[00103] As used herein, a “lentiviral vector expression cassette” comprises a promoter to control transcription of the lentiviral vector, the 5’ and 3’ LTRs for integration, packaging sequences, posttranscriptional regulatory elements and an antisense-facing (relative to the transcription direction of the lentiviral vector cassette) gene expression cassette located between the LTRs, with the cPPT sequence positioned in the central region of the lentiviral vector in a manner that does not disrupt the function of the other elements in the cassette (in other words, the cPPT sequence could be placed upstream or downstream of the promoter in the gene expression cassette provided it remains approximately centered between the LTRs). This lentiviral vector expression cassette is joined with a plasmid backbone to form a lentiviral transfer plasmid. Specific lentiviral vector expression cassettes of the disclosure are described more fully below.
[00104] In some embodiments, the lentiviral transfer plasmid is a globin-specific transfer plasmid. In some embodiments, the lentiviral transfer plasmid is an erythroid-specific transfer plasmid. In some embodiments, the lentiviral transfer plasmid with a cPPT element centered in accordance with the disclosure and is constructed to provide for the expression of any desired gene product, including a protein, a peptide and or a nucleic acid, such as an siRNA or antisense RNA, or combinations thereof. Exemplary lentiviral transfer plasmids are shown in Figs. 1, 2 and 8. A. Globin-specific transfer plasmids
[00105] In accordance with the disclosure, certain embodiments relate to globin-specific transfer plasmids. These recombinant lentiviral transfer plasmids comprise(a) a globin expression cassette which comprises sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a globin gene functional to ameliorate a hemoglobinopathy, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the globin expression cassette to enable expression of the globin gene in a mammal when present in a cell;
[00106] (b) a lentiviral vector expression cassette which comprises, in 5’ to 3’ order,a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the globin expression cassette, a 3’ LTR, and posttranscriptional regulatory elements,wherein the globin expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette,wherein the cPPT is positioned approximately midway between the 5’ and 3’LTRs of the lentiviral vector expression cassette, andwherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(c) a plasmid backbone.
[00107] These globin-specific transfer plasmids, including but not limited to those designated as SRT1-5, SRT8 and SRT11, when packaged into a lentiviral vector, can transduce erythroid cells and express the encoded globin gene in the transduced cells at therapeutic levels, and hence are useful for treating hemoglobinopathies.1. Globin Expression Cassette
[00108] In some embodiments, the globin expression cassettes of the disclosure comprise sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a globin gene functional to ameliorate a hemoglobinopathy, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the globin expression cassette to enable expression of the globin gene in a mammal when present in a cell. Other elements, including a poly(A) signal may be present. In some embodiments, the globin expression cassette further comprises a marker gene downstream of the globin gene but also under control of the β-globin promoter. If the marker gene is green fluorescent protein (GFP), it provides a simple method to assess viral vector transduction.a. β-globin LCR
[00109] The β-globin LCR in the globin expression cassettes of the disclosure along with suitable promoters and enhancers determine erythroid specificity of the lentiviral transfer plasmid, and when the transgene is a globin gene, the transfer plasmid is a globin-specific transfer plasmid.
[00110] The presently disclosed subject matter provides globin expression cassettes which comprise sequences for an artificial β-globin LCR, a cPPT, a first promoter, a globin gene functional to ameliorate a hemoglobinopathy, and a 3’ erythroid-specific enhancer, wherein these sequences (also termed herein sequence elements) are operably linked within the globin expression cassette to enable expression of the globin gene in a mammal when present in a cell. In some embodiments, these sequence elements are present in 5’ to 3’order (for a sense strand) of the β-globin LCR, cPPT, promoter, globin gene and the 3’ erythroid-specific enhancer. In some embodiments, these sequence elements are present in 5’ to 3’order (for a sense strand) of the β-globin LCR, promoter, cPPT, globin gene and the 3’ erythroid-specific enhancer. In certain embodiments, the cPPT sequence is within the HS2 region of the LCR.
[00111] Many suitable β-globin LCRs for use in the lentiviral transfer plasmids of the present disclosure are known in the art. It is noted that natural LCRs are about 20kb and are too large for packaging in the lentiviral vectors of the disclosure. Hence, the LCRs used herein are artificial LCRs and comprise nucleic acid sequences which range in overall size from about 800 bp to about 4 kb and include one or more DNase I hypersensitive sites, and preferably at least one of HS2, HS3, and HS4. The size of the LCR (or the individual HS elements) can be varied by a few bases to as many as a few hundred bases.
[00112] Examples of β-globin LCRs that are known in the art and can be used (or modified for use) in the present transfer plasmids of the disclosure include, but are not limited to, those described in U.S. Pat. Nos. 7,541,179 (Sadelain), 11,717,579 (Sadelain), 11,753,654 (Sadelain), and 6,797,494 (Antoniou); in U.S. Pat. Appln. Pub. Nos. 2009 / 0156534 (Lisowski), US 2017 / 0173185 (Sadelain), 2020 / 0109416 (Kohn); and US 2022 / 0136007 (Kohn) and in the literature, e.g., Refs. 15, 16, 19, 20, 28, and 31-33. As an example, the LCR in TNS9
[16] , has been analyzed to determine the HS elements (singly and in various combinations) that direct high-level globin expression as well as provide safety and efficacy for gene therapy
[28] .
[00113] In some embodiments, the β-globin LCR comprises or consists essentially of a fragment of an HS2-spanning region, an HS3-spanning region and an HS4-spanning region and with the overall LCR ranging in size from about 800 bp to about 4 kb (in the context of sequences “about” means + / - 10%). By “fragment” is meant a portion of the indicated HS-spanning region. That portion can be a restriction fragment, a PCR fragment or any contiguous sequence that encompasses the particular HS site.
[00114] In some embodiments, the LCR comprises the HS sites from TNS9, which has the BstXI and SnaBI HS2-spanning nucleotide fragment, the BamHI and HindIII HS3-spanning nucleotide fragment and the BamHI and BanII HS4-spanning nucleotide fragment (see U.S. Patent No. 7,541,179).
[00115] In some embodiments, the LCR comprises the HS sites of TNS9.3.55 (which is 6 bp longer than those cloned into SRT1-5 for HS2). Otherwise HS3 is 1301 bp and HS4 is 1063 bp (Table 1), which is equivalent in TNS9.3.55 to those in SRT1-5. In some embodiments, including but not limited to, SRT8, SRT9 and SRT11, the LCR comprises the HS sites where HS2 consists of 853 bp sequence, HS3 consists of 999 bp sequence and HS4 consists of 539 bp sequence, each of which is set forth in Table 1.
[00116] In any of the embodiments hereof, the LCR can include one or more GATA-1 binding sites at the junction between HS3 and HS4.b. cPPT
[00117] In accordance with the present disclosure, the lentiviral transfer plasmids of the disclosure, as part of the globin expression cassette, comprise a central polypurine tract (cPPT) which is positioned at approximately the midpoint between the 5’ and 3’LTRs of the lentiviral vector. Furthermore, the cPPT sequence is positioned in a manner that does not disrupt the function of the other elements in the cassette (in other words, the cPPT sequence could be placed upstream or downstream of the promoter in the gene expression cassette provided it remains approximately centered between the LTRs). Likewise, the cPPT sequence can be positioned in the LCR or overlap with the LCR without disrupting function.
[00118] As used herein, “approximately the midpoint between the 5’ and 3’LTRs”, “approximately centered between the LTRs, “in the central region,” and the like, means that the midpoint of the cPPT sequence is positioned within the about 1% to about 30% of the midpoint between the first nucleotide of the 5’ LTR and the last nucleotide of the 3’ LTR. In some embodiments, the midpoint of the cPPT sequence lies within about 1%, 2%, 3%, 5%, 8%, 10% , 15%, 20%, 25% or 30% of the middle of the sequence between the two LTRs (either upstream or downstream of the midpoint). Since the length of the sequence (i.e., number of base pairs) from end to end of the LTRs is known, which length is the integrated vector genome length, and the the cPPT sequence is known, the placement of the overall cPPT in the any of the plasmids and vectors of the disclosure can be calculated and, if needed, adjusted to avoid disruption of other nearby sequence elements. For the avoidance of doubt, the middle of the sequence between the two LTRs corresponds to the midpoint of the integrated genome length.
[00119] The location of the cPPT sequence for TNS9.3.55 and various SRT vectors is provided in Table 2. Vector genome length is the integrated vector genome length; the cPPT position is given relative to position 1 of the 5’ LTR; and all lengths are given in bp. TABLE 2VectorcPPT positionvector genome lengthLength relative to TNS9.3.55Center of vectorcPPT midpointVector center - cPPT midpoint% from middleTNS9.3.551635-17528066100.040331694233958.00SRT14740-48578681107.643414799-458-10.55SRT24435-45528071100.140364494-458-11.35SRT34740-48578681107.643414799-458-10.55SRT44435-45528071100.140364494-458-11.35SRT54435-45528071100.140364494-458-11.35SRT84081-4198686885.134344140-706-20.56SRT94861-4978764894.838244920-1096-28.66SRT114386-4503747892.737394445-706-18.88
[00120] In preferred embodiments, the midpoint of the cPPT sequence is positioned from about 10% to about 20% upstream or downstream of the midpoint between the first nucleotide of the 5’ LTR and the last nucleotide of the 3’ LTR. For cPPT position, “about” means, ± 1%.
[00121] Sequences of cPPTs are well known in the art and typically range from about 115 to about 118 nucleotides [27 and 41-57]. In some embodiments, the cPPT is 118 nucleotides. In some embodiments, the sequence of the cPPT is as follows: TTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTT (SEQ ID NO: 15).c. β-globin promoter
[00122] In accordance with the present disclosure, the globin expression cassette further comprises a β-globin promoter. In certain embodiments, the β-globin promoter is positioned between the globin gene or functional portion thereof and the β-globin LCR. The length and the sequence of the β-globin promoter can vary. In certain embodiments, the β-globin promoter is from about 100 bp to about 1600 bp in length, e.g., from about 200 bp to about 700 bp, from about 100 bp to about 200 bp, from about 200 bp to about 300 bp, from about 300 bp to about 400 bp, from about 400 bp to about 500 bp, from about 500 bp to about 600 bp, from about 600 bp to about 700 bp, from about 700 bp to about 800 bp, from about 800 bp to about 900 bp, from about 900 bp to about 1000 bp, from about 1000 bp to about 1100 bp, from about 1100 bp to about 1200 bp, from about 1200 bp to about 1300 bp, from about 1300 bp to about 1400 bp, from about 1400 bp to about 1500 bp, or from about 1500 bp to about 1600 bp in length. In certain embodiments, the β-globin promoter is a human β-globin promoter that is about 130 bp, about 613 bp, about 663 bp, about 265 bp, about 316 bp or about 1555 bp, in length. In certain embodiments, the β-globin promoter is a human β-globin promoter that is about 663 bp in length. In certain embodiments, the β-globin promoter is a human β-globin promoter that is about 316 bp in length.d. Globin Genes
[00123] In accordance with the present disclosure, the globin expression cassette comprises a globin gene functional to ameliorate a hemoglobinopathy. The globin gene can be a β-globin gene, a γ-globin gene, or a δ-globin gene in wild type form or a mutant form, provided it retains functionality to ameliorate a hemoglobinopathy. In certain embodiments, the globin gene is a human β-globin gene. In some embodiments, the human β-globin gene can be a wild-type human β-globin gene, a deleted human β-globin gene comprising one or more deletions of intron sequences, or a mutated human β-globin gene encoding at least one anti-sickling amino acid residue. A wild-type human β-globin gene comprises three exons (exon 1, exon 2, and exon 3). In certain embodiments, the globin gene comprises a non-wild-type (mutated or modified) human β-globin gene. In certain embodiments, the human β-globin gene comprises a human β-globin gene with a deletion in intron 2 (IVS2). In certain embodiments, the deletion in IVS2 is about 370 bp. The deletion in IVS2 can eliminate AT-rich (ATR) sequences that comprise a cryptic polyadenylation site responsible for premature termination of the transcription. In certain embodiments, the human β-globin gene comprises a human β-globin gene encoding a threonine to glutamine mutation at codon 87 (βT87Q). The glutamine residue at position 87 in the gamma-globin chain augments the anti-sickling activity of the gamma chain relative to the beta chain, while preserving adult oxygen-binding characteristics of the beta chain
[29] . In certain embodiments, a functional portion of a globin gene has at least about 80%, at least about 90%, at least about 95%, at least about 99% or at least about 100% identity to a corresponding wild-type reference polynucleotide sequence.
[00124] In certain embodiments, the human β-globin gene is a human β-globin gene encoding a threonine to glutamine mutation at codon 87 (βT87Q). In certain embodiments, the human β-globin gene encoding a threonine to glutamine mutation at codon 87 (βT87Q) further comprises a deletion in intron 2 (e.g., an about 370 bp deletion).
[00125] In certain embodiments, the human β-globin gene is a non-wild-type human β-globin gene selected from a human β-globin gene comprising one or more deletions of intron sequences, a human β-globin gene encoding at least one anti-sickling amino acid residue, and a human β-globin gene comprising one or more deletions of intron sequences and encoding at least one anti-sickling amino acid residue.
[00126] In certain embodiments, the human β-globin gene encoding at least one anti-sickling amino acid residue is selected from the group consisting of a human β-globin gene encoding a threonine to glutamine mutation at codon 87 (βT87Q), a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 (βE22A), a human β-globin gene encoding an asparagine to lysine mutation at codon 80 (βN80K), a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 and an asparagine to lysine mutation at codon 80, and a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 and a threonine to glutamine mutation at codon 87.e. Additional elements in globin expression cassette
[00127] The globin expression cassettes of the disclosure may optionally further comprise a 3’ erythroid-specific enhancers and poly(A) signal sequences operably linked with the LCR, promoter and globin gene to control or regulate expression of the globin gene in a mammal. Additional sequence elements which enhance expression or regulate erythroid-specificity may also be present in the globin expression cassettes of the disclosure.
[00128] In any of the embodiments, the 3’erythroid-sepecific enhancer is a human β-globin 3’ enhancer and is positioned downstream of the globin gene. In some embodiments, the human β-globin 3’ enhancer has the nucleotide sequence as found at nucleotides 2270. . . 2885 of SRT2 (Table 7) –in its form as the complement.
[00129] Polyadenylation (poly(A)) signal sequences ensure proper mRNA transport, processing, and stability and are generally included in the globin expression cassettes of the disclosure. Poly(A) signals are well known in the art and any poly(A) signal can be used. 2. Lentiviral Vector Expression Cassette
[00130] All the transfer plasmids of the disclosure comprise a lentiviral vector expression cassette which comprises at least a second promoter (to control expression of the lentiviral vector expression cassette), a 5’ LTR, lentiviral vector packaging sequences, the globin expression cassette, a 3’ LTR, and posttranscriptional regulatory elements, wherein the globin expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector cassette, wherein the cPPT is positioned approximately midway between the 5’ and 3’LTRs of the lentiviral vector cassette, and wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order.
[00131] Other sequence elements can be included in the lentiviral expression cassettes of the disclosure, including but not limited to, a deleted gag gene (Δgag), RRE and insulators.
[00132] Useful promoters, packaging signals (Ψ), LTRs, packaging signals, Δgag, and RRE are all known in the art. In any of the embodiments, the promoter is a strong promoter such as a CMV promoter. In any of the embodiments, the LTRs are self-inactivating. In any of the embodiments, the LTRs are TAT-independent. In any of the embodiments, the 3’ LTR comprises an insulator. In some embodiments the insulator is the A1 insulator. Examples of insulators for use in the lentiviral vector expression cassettes can be found in U.S. Pat. Nos. 11,717,579 and 11,753,654 (Sadelain)
[00133] In accordance with the present disclosure, the lentiviral vector expression cassettes hereof comprise posttranscriptional regulatory elements that are adjacent to and downstream from the 3’ LTR. These elements are, in 5’ to 3’ order, a woodchuck post-transcriptional regulatory element (WPRE; or an equivalent such element), a poly(A) signal and a sequence block encoding stop codons in all six reading frames (referred to interchangeably herein as “6x stop codons” or “a 6x stop codon sequence block”). Moreover, these three sequence elements need not be contiguous with each other but should be within a few to about 50 bps. In contrast to other vectors, repositioning the WPRE outside of the lentiviral vector and / or adding the 6x stop codons improves vector titers. Without wishing to be bound, these elements ensure efficient termination and transport of the lentiviral nucleic acid to be packaged into the lentiviral vector that in turn will deliver the globin gene.
[00134] The WPRE and other equivalent sequences are well known in the art as are poly(A) signals that are useful with the lentiviral vector expression cassettes. In a preferred embodiment, the poly(A) signal is the bovine growth hormone poly(adenylation) signal.
[00135] The 6x stop codons can comprise any short sequence of DNA that provides stop codons, i.e., TAA, TAG and TGA, in all possible reading frames. One example of a 6x stop codon element is GGATAAGACAGGACCTGGATGAGCAAGGCAATAGGATAGGCAAGGCATAGGATAAGACAGGCTATGGATAAGACAGGCCAGGATGAGACAGG (SEQ ID NO: 14). 3. Plasmid backbone
[00136] The plasmid backbone can be from any plasmid suitable for replication in bacteria, yeast or other organism, and may, optionally, provide antibiotic resistance genes or gene sequences suitable for use as selectable markers. Plasmid backbones and how to use them to construct the transfer plasmids of the disclosure are well known in the art. Examples of such plasmid backbones include but are not limited to, pUC19, Nanoplasmid® (Aldevron), pUC57-Kan (GenScript) and pUC57-Brick-Kan (GenScript).B. Erythroid-Specific Transfer Plasmids
[00137] Another aspect of the disclosure relates to erythroid-specific transfer plasmids. These plasmids are similar to the globin-specific transfer plasmids except that the globin gene is replaced by a different gene desired for expression in erythroid cells. Other than expressing a different gene product, i.e., that of the heterologous gene, the remaining sequence elements of the erythroid-specific transfer plasmids of the disclosure are the same as those found in the globin-specific transfer plasmids of the disclosure. Any of the above contemplated combination of sequence elements, lentiviral vector expression cassettes and plasmid backbones are contemplated for use with the erythroid-specific transfer plasmids of the disclosure.
[00138] Accordingly, erythroid-specific transfer plasmids of the disclosure are recombinant lentiviral transfer plasmids comprising:(a) an erythroid-specific expression cassette which comprises sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a heterologous gene, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the erythroid-specific expression cassette to enable expression of the heterologous gene in a mammal when present in a cell;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the erythroid-specific expression cassette, a 3’ LTR, and posttranscriptional regulatory elements,wherein the erythroid-specific expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector cassette,wherein the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector cassette, andwherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(c) a plasmid backbone. 1. Erythroid-Specific Expression Cassette
[00139] In the embodiments of the disclosure, the erythroid-specific expression cassettes comprise sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a heterologous gene, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the globin expression cassette to enable expression of the heterologous gene. Other sequence elements including a poly(A) signal may be present. In some embodiments, the heterologous gene is expressed at therapeutic levels to ameliorate a disease or condition for which delivery of the gene leads to a therapeutic benefit. Except for the heterologous gene, any of the sequence elements described herein for the globin gene expression cassette are useful in the erythroid-specific cassettes of the disclosure. For the avoidance of doubt, the cPPT sequence is also positioned as described herein.
[00140] The heterologous genes present in the erythroid-specific expression cassette can be any gene whose product is desired for expression in an erythroid cell. In some embodiments, the heterologous gene is expressed at a level to provide therapeutic benefit. In some embodiments, the heterologous gene is for treatment of a hematological disease or disorder, including anemia, cancer, blood clotting disorders, and the like.
[00141] As used herein, “heterologous gene” encodes a gene product that is a peptide, protein, oligonucleotide or polynucleotide. The coding sequence may be present as encoded in the native form of the gene product, e.g., with exons and introns or as a spliced form (as found in cDNA), or in some smaller form of the gene (e.g., missing introns, as a splice variant or having smaller introns) provided a functional gene product is produced.
[00142] Heterologous genes for use herein, include but are not limited to, the following proteins:Transcription factors such as GATA1, KLF1, RUNX1, GATA2, HOXB2, TAL1, GFI1, GFI1b;Chromatin Remodeler such as ATRX;Histone methyltransferases such as ASH1L;Chromatin assembly proteins such as codanin1;mRNA-binding proteins such as IGF2BP1;Proteins involved in vesicle formation such as SEC23B;Heme Biosynthetic Pathway Enzymes such as ALAS-E, porphobilinogen deaminase, delta aminolevulinate dehydratase, ferrochelatase, CPO; and Other enzymes such as PKLR, glutathione peroxidase, 15-lipoxygenase, carbonic anhydrase I.
[00143] Heterologous genes for use herein, include but are not limited to, the following oligonucleotides and polynucleotides:An siRNA, shRNA or other RNA that controls or regulates expression of any gene specific to an erythroid cell. 2. Lentiviral Vector Expression Cassette
[00144] The lentiviral vector expression cassette for the erythroid-specific-transfer plasmids are as described above in Section A.2. Accordingly, these expression cassettes comprise at least the following sequence elements: a second promoter (to control expression of the lentiviral vector expression cassette), a 5’ LTR, lentiviral vector packaging sequences, the erythroid-specific expression cassette, a 3’ LTR, and posttranscriptional regulatory elements, wherein the erythroid-specific expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector cassette, wherein the cPPT is positioned approximately midway between the 5’ and 3’LTRs of the lentiviral vector cassette, and wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order. 3. Plasmid backbone
[00145] The plasmid backbone for the erythroid-specific-transfer plasmids are as described above in Section A.3. Hence, the plasmid backbone can be from any plasmid suitable for replication in bacteria, yeast or other organism, and may, optionally, provide antibiotic resistance genes or gene sequences suitable for use as selectable markers. C. cPPT-centeredTransfer Plasmids
[00146] Another aspect of the disclosure relates to cPPT-centered transfer plasmids. These plasmids, while similar to the globin-specific and erythroid-specific transfer plasmids described in Sections A and B, are designed for more general gene therapy use with a lentiviral vector. As such, the LCRs are removed, and the promoters and enhancers for controlling gene expression are tailored as needed based on the gene to be expressed and the tissue-specificity or desired spatial or timing of expression. As above, in the cPPT-centered transfer plasmids of the disclosure, the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette- without disrupting other elements present in the gene expression cassette. Any of the above contemplated combination of the remaining sequence elements, lentiviral vector expression cassettes and plasmid backbones are contemplated for use with the cPPT-centered transfer plasmids of the disclosure.
[00147] Accordingly, cPPT-centered transfer plasmids of the disclosure are recombinant lentiviral transfer plasmids comprising:(a) a gene expression cassette which comprises sequences for, in 5’ to 3’ order, (i) a central polypurine tract (cPPT) and a promoter or (ii) a promoter and a cPPT, and a gene of interest, said sequences operably linked for expression of said gene of interest;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the gene expression cassette, a 3’ LTR, and posttranscriptional regulatory elements,wherein the gene expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette,wherein the cPPT is positioned approximately midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette, andwherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and(c) a plasmid backbone. 1. Gene Expression Cassette
[00148] In the embodiments of the disclosure, the gene expression cassettes comprise sequences for a central polypurine tract (cPPT), a first promoter, a gene desired for expression, and, optionally, a 3’ enhancer, with these sequences being operably linked within the gene expression cassette to enable expression of the gene desired for expression. Other sequence elements including a poly(A) signal may be present. In some embodiments, the gene is expressed at therapeutic levels to ameliorate a disease or condition for which delivery of the gene leads to a therapeutic benefit. Any of the relevant sequence elements described herein for the globin gene expression cassette are useful in the gene expression cassettes of the disclosure. For the avoidance of doubt, the cPPT sequence is also positioned as described herein.
[00149] The genes present in the gene expression cassette can be any gene whose product is desired for expression by a lentiviral vector, i.e., a gene of interest. In some embodiments, the gene product is expressed at a level to provide therapeutic benefit. In some embodiments, the gene of interest is for treatment of a hematological disease or disorder, including anemia, cancer, blood clotting disorders, and the like. In some embodiments the gene of interest is any of the heterologous genes listed above as well as coagulation factors VIII and IX, and alpha-1-antitrypsin.
[00150] As used herein, in the context of the cPPT-centered transfer plasmids, a “gene” encodes a gene product that is a peptide, protein, oligonucleotide or polynucleotide. The coding sequence may be present as encoded in the native form of the gene product, e.g., with exons and introns, as a spliced form (as found in cDNA), or in some smaller form of the gene (e.g., missing introns, as a splice variant or having smaller introns) provided a functional gene product is produced. 2. Lentiviral Vector Expression Cassette
[00151] The lentiviral vector expression cassette for the cPPT-centered transfer plasmids are as described above in Section A.2. Accordingly, these expression cassettes comprise at least the following sequence elements: a second promoter (to control expression of the lentiviral vector expression cassette), a 5’ LTR, lentiviral vector packaging sequences, the gene expression cassette, a 3’ LTR, and posttranscriptional regulatory elements, wherein the gene expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector cassette, wherein the cPPT is positioned approximately midway between the 5’ and 3’LTRs of the lentiviral vector cassette, and wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order. 3. Plasmid backbone
[00152] The plasmid backbone for the cPPT-centered transfer plasmids are as described above in Section A.3. Hence, the plasmid backbone can be from any plasmid suitable for replication in bacteria, yeast or other organism, and may, optionally, provide antibiotic resistance genes or gene sequences suitable for use as selectable markers. Lentiviral Particles and Production Thereof
[00153] Another aspect of the disclosure relates to lentiviral vectors (LVVs) produced from the lentiviral transfer plasmids of the disclosure. The LVVs comprise the lentivirus genome encoded in a lentiviral transfer plasmid of the disclosure which has been encapsulated by envelope glycoproteins. The envelope glycoproteins are supplied in trans by either helper plasmids or by a packaging cell line. The glycoproteins can be from HIV or other lentivirus or can be pseudotyped by using a glycoprotein from another virus such a vesicular stomatitis virus (VSV-G), lymphocytic choriomeningitis virus (LCMV), measles viral (MV), hepatitis C virus (HCV) and the like. In any of the embodiments, the envelope glycoprotein is VSVG.
[00154] In one method to produce lentiviral vectors, transient transfection systems are used with one or more helper plasmids and a lentiviral transfer plasmid of the disclosure. Such transfection systems are well known in the art and include, but are not limited to, triple and quadruple transfection systems. The triple transfection system uses a transfer plasmid with two helper plasmids. One such example is the helper plasmids (pCMVΔR8.9, pCMVΔR8.74, or similar constructs) and pMD.G (envelope protein-expression) for transfection into 293T cells as described in [9 and 11-14]. The quadruple transfection system uses three helper plasmids. One such example is the helper plasmids pALD-Rev-K, pALD-Gagpol-K, and pALD-VSV-G-K as supplied from the pALD-Lenti System (Aldevron) for transfection into 293T cells.
[00155] Methods for transfection are well known by those of skill in the art. After cotransfection of the packaging vectors and the transfer plasmid to the packaging cell line, the recombinant virus is recovered from the culture media and titered by standard methods. Hence, the various plasmids can be introduced into human cell lines by calcium phosphate transfection, lipofection or electroporation, generally followed by selection in the presence of the appropriate drug (or compound) and isolation of clones.
[00156] Stable cell lines, wherein the packaging functions are configured to be expressed by a suitable packaging cell are also known (see, e.g., U.S. Pat. No. 5,686,279, which describes packaging cells). In general, for the production of virus particles, one may employ any cell line that is compatible with the expression of lentiviral Gag and Pol genes, or any cell that can be engineered to support such expression. For example, cells such as 293T, 293, HT1080 HeLa and PERC.6 cells may be used. Hematopoietic cells and Transduction Thereof
[00157] One aspect of the disclosure provides methods of cell transduction using the LVVs of the disclosure and the transduced cells. In some embodiments, the method comprises contacting cells with an LVV of the disclosure and selecting for transduced cells. In various embodiments, the cell can be autologous to the subject (i.e., from the subject) or it can be non-autologous (i.e., allogeneic or xenogeneic) to the subject. Moreover, because the LVVs described herein are capable of being delivered to both dividing and non-dividing cells, the cells can be from a wide variety of sources, including, for example, bone marrow cells, mesenchymal stem cells (e.g., obtained from adipose tissue), and other primary cells derived from human and animal sources.
[00158] The LVVs of the disclosure which express a globin gene or other gene in an erythroid-specific manner are particularly useful in the transduction of human hematopoietic progenitor cells or hematopoietic stem cells, obtained either from the bone marrow, the peripheral blood or the umbilical cord blood, as well as in the transduction of a CD4+ T cell, a peripheral blood B or T lymphocyte cell, and the like. In certain embodiments, preferred targets are CD34+ cells.
[00159] In still other embodiments, the present disclosure is directed to a method for transducing a human hematopoietic stem cell comprising contacting a population of human cells that include hematopoietic stem cells with one of the foregoing lentiviral vectors under conditions to affect the transduction of a human hematopoietic progenitor cell in said population by the vector. The stem cells may be transduced in vivo or in vitro, depending on the ultimate application. Even in the context of human gene therapy, such as gene therapy of human stem cells, one may transduce the stem cell in vivo or, alternatively, transduce in vitro followed by infusion of the transduced stem cell into a human subject. In one aspect of this embodiment, the human stem cell can be removed from a human, e.g., a human patient, using methods well known to those of skill in the art and transduced as described above. The transduced stem cells are then reintroduced into the same or a different human.
[00160] When cells, for instance CD34+ cells, dendritic cells, peripheral blood cells or tumor cells are transduced ex vivo, the vector particles are incubated with the cells using a dose generally in the order of between 1 to 50 multiplicities of infection (MOI) which also corresponds to 1×105 to 50×105 transducing units of the viral vector per 105 cells. This can include amounts of vector corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, and 50 MOI. Typically, the amount of vector may be expressed in terms of transducing units (TU).
[00161] In certain embodiments the methods involve isolating cell populations, e.g., stem cells or bone marrow cells, from a subject, optionally expanding the cells in tissue culture, and transducing those cells with a lentiviral vector whose presence results in production of a globin gene in the cells. The transduced cells are then returned back to the subject, where, for example, they may provide a population of red blood cells that produce the globin in therapeutically effective levels.
[00162] In some embodiments of the disclosure, a population of cells, which may be cells from a cell line or from an individual other than the subject, can be used. Methods of isolating stem cells, immune system cells, etc., from a subject and returning them to the subject are well known in the art. Such methods are used, e.g., for bone marrow transplant, peripheral blood stem cell transplant, etc., in patients undergoing chemotherapy.
[00163] Where stem cells are to be used, it will be recognized that such cells can be derived from a number of sources including bone marrow (BM), cord blood (CB) CB, mobilized peripheral blood stem cells (mPBSC), and the like. In certain embodiments the use of induced pluripotent stem cells (IPSCs) is contemplated. Methods of isolating hematopoietic stem cells (HSCs), transducing such cells and introducing them into a mammalian subject are well known to those of skill in the art. Methods of Treatment
[00164] A hemoglobinopathy is an inherited disease or disorder in which there is aberrant production of hemoglobin, an abnormal structure of hemoglobin or a combination thereof. Treating such genetic diseases and disorders by gene therapy with a lentiviral vector requires vector stocks with high titers and expression of a globin at therapeutic levels. For example, with the LVVs of the disclosure, one can reduce production costs of the vectors, and enable treatment of hemoglobinopathies. Accordingly, one aspect of the present disclosure relates to various methods of treating or ameliorating a hemoglobinopathy in a subject with the present LVVs or hematopoietic cells transduced with the present LVVs to stably produce a globin.
[00165] In some embodiments, the method for treating or ameliorating a hemoglobinopathy in a subject comprises administering an effective amount of transduced cells of the disclosure or a pharmaceutical composition comprising such cells to a subject. Such treatments, for example, may increase the subject’s hemoglobin levels in an amount sufficient to treat or ameliorate the hemoglobinopathy. In other instances, such treatments may restore the subject’s ability to produce red blood cells containing normal / functional hemoglobin to and thereby treat or ameliorate the hemoglobinopathy.
[00166] In any of the embodiments hereof the transduced cells can be autologous cells, allogeneic cells, syngeneic cells or xenogeneic cells. Selection of the appropriate cells for a subject and methods for harvesting and transducing those cells are known in the art. In any of the embodiments of any of the methods hereof, the hematopoietic cells are obtained from bone marrow of a subject.
[00167] In some embodiments, the method for treating or ameliorating a hemoglobinopathy, in a subject comprises (a) transducing hematopoietic cells harvested from the subject with the lentiviral particles of the disclosure to produce transduced cells; and (b) administering those cells, or cells derived therefrom, to the subject to thereby transplant those cells in the subject. In some embodiments, this method further comprises (a) harvesting bone marrow cells from a subject; (b) selecting CD34+ cells from said bone marrow cells; and (c)expanding and / or conditioning said CD34+ cells to thereby said hematopoietic cells. Methods for harvesting bone marrow cells, selecting CD34+ cells, conditioning and / or expanding such cells are known in the art.
[00168] In any of the embodiments of any of the methods hereof, the hemoglobinopathy for treatment of amelioration is selected from the group consisting of hemoglobin C disease, hemoglobin sickle cell disease (SCD), sickle cell anemia, hereditary anemia, thalassemia, β-thalassemia, thalassemia major, thalassemia intermedia, α-thalassemia, and hemoglobin H disease.
[00169] In any of the embodiments of any of the methods hereof, the globin gene is selected from the group consisting of a β-globin gene, a γ-globin gene, and a δ-globin gene.
[00170] In any of the embodiments of any of the methods hereof, the globin gene is human β-globin gene. In some embodiments, the human β-globin gene is a wild- type human β-globin gene. In some embodiments, the human β-globin gene is a mutant human β-globin gene.
[00171] In any of the embodiments of any of the methods hereof, mutant human β-globin genes include, but are not limited to, a human β-globin gene comprising one or more deletions of intron sequences, a human β-globin gene encoding at least one anti-sickling amino acid residue, and a human β-globin gene comprising one or more deletions of intron sequences and encoding at least one anti-sickling amino acid residue.
[00172] In any of the embodiments of any of the methods hereof, human β-globin gene encoding at least one anti-sickling amino acid residue is selected from the group consisting of a human β-globin gene encoding a threonine to glutamine mutation at codon 87 (βT87Q), a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 (βE22A), a human β-globin gene encoding an asparagine to lysine mutation at codon 80 (βN80K), a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 and an asparagine to lysine mutation at codon 80, and a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 and a threonine to glutamine mutation at codon 87.
[00173] In any of the embodiments of any of the methods, the hemoglobinopathies that can be treated in accordance with the disclosure, include but are not limited to, hemoglobin C disease, hemoglobin sickle cell disease (SCD), sickle cell anemia, hereditary anemia, thalassemia, β-thalassemia, thalassemia major, thalassemia intermedia, α-thalassemia, and hemoglobin H disease.
[00174] In certain embodiments, the presently disclosed subject matter is for use in gene therapy methods to treat, prevent, or ameliorate a hemoglobinopathy that is selected from the group consisting of: hemoglobin C disease, hemoglobin sickle cell disease (SCD), sickle cell anemia, hereditary anemia, thalassemia, β-thalassemia, thalassemia major, thalassemia intermedia, α-thalassemia, and hemoglobin H disease. In an embodiment, the hemoglobinopathy is β-thalassemia. In another embodiment, the hemoglobinopathy is sickle cell anemia.
[00175] In another aspect, the methods of the disclosure provide a method of treating or ameliorating anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells in a subject by comprises administering an effective amount of cells transduced with any of the LVVs to a subject to thereby treat or ameliorate the anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells.
[00176] In some embodiments, the cells are autologous, allogeneic, syngeneic or xenogeneic cells.Pharmaceutical Compositions, Administration and Dosing
[00177] The present disclosure further provides pharmaceutical compositions comprising a LV vector of the disclosure, together with a pharmaceutically acceptable carrier, excipient or vehicle.
[00178] An LV vector of the disclosure may be formulated as pharmaceutical compositions prepared for storage or administration, which typically comprise a therapeutically effective amount of the vector in a pharmaceutically acceptable carrier.
[00179] The therapeutically-effective amount of the LV vector of the disclosure will depend on the route of administration, the type of mammal being treated, and the physical characteristics of the specific mammal under consideration. These factors and their relationship to determining this amount are well known to skilled practitioners in the medical arts. This amount and the method of administration can be tailored to achieve optimal efficacy, and may depend on such factors as weight, diet, concurrent medication and other factors, well known to those skilled in the medical arts. The dosage sizes and dosing regimen most appropriate for human use may be guided by the results obtained by the present disclosure and may be confirmed in properly designed clinical trials.
[00180] An effective dosage and treatment protocol may be determined by conventional means, starting with a low dose in laboratory animals and then increasing the dosage while monitoring the effects, and systematically varying the dosage regimen as well. Numerous factors may be taken into consideration by a clinician when determining an optimal dosage for a given subject. Such considerations are known to the skilled person. The term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers. Pharmaceutically acceptable carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). For example, sterile saline and phosphate- buffered saline at slightly acidic or physiological pH may be used. pH buffering agents may be phosphate, citrate, acetate, tris(hydroxymethyl)aminomethane (TRIS), N-Tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid (TAPS), ammonium bicarbonate, diethanolamine, histidine, which is a preferred buffer, arginine, lysine, or acetate or mixtures thereof. The term further encompasses any agents listed in the US Pharmacopeia for use in animals, including humans.
[00181] The term “pharmaceutically-acceptable salt” refers to the salt of the compounds. As used herein a pharmaceutically-acceptable salt retains qualitatively a desired biological activity of the parent compound without imparting any undesired effects relative to the compound. Salts include pharmaceutically acceptable salts such as acid addition salts and basic salts. Acid addition salts include salts derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphorous, phosphoric, sulfuric, hydrobromic, hydroiodic and the like, or from nontoxic organic acids such as aliphatic mono- and di-carboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like. Examples of basic salts include salts where the cation is selected from alkali metals, such as sodium and potassium, alkaline earth metals such as calcium and magnesium, and ammonium ions +N(R3)3(R4), where R3 and R4 independently designate optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted aryl, or optionally substituted heteroaryl, and more specifically, the organic amines, such as N, N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.Other examples of pharmaceutically acceptable salts are described in "Remington's Pharmaceutical Sciences", 17th edition. Ed. Alfonso R. Gennaro (Ed.), Mark Publishing Company, Easton, PA, U.S.A., 1985 and more recent editions, and in the Encyclopaedia of Pharmaceutical Technology.
[00182] The pharmaceutical compositions can be in unit dosage form. In such form, the composition is divided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of the preparations, for example, packeted tablets, capsules, and powders in vials or ampoules. The unit dosage form can also be a capsule, cachet, or tablet itself, or it can be the appropriate number of any of these packaged forms. It may be provided in single dose injectable form, for example in the form of a pen. Compositions may be formulated for any suitable route and means of administration.
[00183] Pharmaceutically-acceptable carriers or diluents include those used in formulations suitable for oral, rectal, nasal or parenteral (including subcutaneous, intramuscular, intravenous, intradermal, and transdermal) administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Subcutaneous or transdermal modes of administration may be particularly suitable for the compounds described herein.
[00184] An acceptable route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, enteral, nasal, ophthalmic, oral, parenteral, rectal, vaginal, or transdermal (e.g., topical administration of a cream, gel or ointment, or by means of a transdermal patch). "Parenteral administration” is typically associated with injection at or in communication with the intended site of action, including infraorbital, intraarterial, intracapsular, intracardiac, intracerebroventricular, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal administration.
[00185] Pharmaceutical compositions of the disclosure may be administered alone or in combination with one or more other therapeutic agents. A combination therapy may include an LV vector of the disclosure combined with at least one other therapeutic agent selected based on the particular patient, disease or condition to be treated. Examples of other such agents include, inter alia, a psychoactive drug, anti-inflammatory or anti-proliferative agent, growth factors, cytokines, an analgesic, a therapeutically-active small molecule or polypeptide, a single chain antibody, a classical antibody or fragment thereof, or a nucleic acid molecule which modulates expression of one or more genes, one or more modifiers of signaling pathways and similar modulating therapeutics which may complement or otherwise be beneficial in a therapeutic or prophylactic treatment regimen.
[00186] As used herein, "pharmaceutically acceptable carrier" includes any and all physiologically acceptable, i.e., compatible, solvents, dispersion media, coatings, antimicrobial agents, isotonic and absorption delaying agents, and the like. In certain embodiments, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on selected route of administration, the LV vector may be coated in a material or materials intended to protect it from the action of acids and other natural inactivating conditions to which the LV vector may encounter when administered to a subject by a particular route of administration.
[00187] A pharmaceutical composition of the disclosure also optionally includes a pharmaceutically acceptable antioxidant. Exemplary pharmaceutically acceptable antioxidants are water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
[00188] Examples of suitable aqueous and nonaqueous carriers that may be employed in the pharmaceutical compositions of the disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
[00189] Compositions of the disclosure may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. Isotonic agents, such as sugars, sodium chloride, and the like into the compositions, may also be desirable. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as, aluminum monostearate and gelatin.
[00190] Exemplary pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. Such media and reagents for pharmaceutically active substances are known in the art. The pharmaceutical compositions of the disclosure may include any conventional media or agent unless any is incompatible with the LV vectors of the disclosure. Supplementary active compounds may further be incorporated into the compositions.
[00191] Therapeutic compositions are typically sterile and stable under the conditions of manufacture and storage. The composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration. The carrier may be a solvent or dispersion medium containing, for example, water, alcohol such as ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), or any suitable mixtures. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by use of surfactants according to formulation chemistry well known in the art. In certain embodiments, isotonic agents, e.g., sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride may be desirable in the composition. Prolonged absorption of injectable compositions may be brought about by including in the composition an agent that delays absorption for example, monostearate salts and gelatin.
[00192] Solutions or suspensions used for intradermal or subcutaneous application typically include one or more of: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates; and tonicity adjusting agents such as, e.g., sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide, or buffers with citrate, phosphate, acetate and the like. Such preparations may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[00193] Sterile injectable solutions may be prepared by incorporating an LV vector in the required amount in an appropriate solvent with one or a combination of ingredients described above, as required, followed by sterilization microfiltration. Dispersions may be prepared by incorporating the active compound into a sterile vehicle that contains dispersion medium and other ingredients, such as those described above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient in addition to any additional desired ingredient from a sterile-filtered solution thereof.
[00194] When a therapeutically effective amount of an LV vector of the disclosure is administered by, e.g., intravenous, cutaneous or subcutaneous injection, the binding agent will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. Methods for preparing parenterally acceptable protein solutions, taking into consideration appropriate pH, isotonicity, stability, and the like, are within the skill in the art. A preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection will contain, in addition to binding agents, an isotonic vehicle such as sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection, or other vehicle as known in the art. A pharmaceutical composition of the present disclosure may also contain stabilizers, preservatives, buffers, antioxidants, or other additives well known to those of skill in the art.
[00195] The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending on a variety of factors, including the subject being treated, and the particular mode of administration. In general, it will be an amount of the composition that produces an appropriate therapeutic effect under the particular circumstances. Generally, out of one hundred percent, this amount will range from about 0.01 percent to about ninety-nine percent of active ingredient, from about 0.1 percent to about 70 percent, or from about 1 percent to about 30 percent of active ingredient in combination with a pharmaceutically acceptable carrier.
[00196] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the particular circumstances of the therapeutic situation, on a case-by-case basis. It is especially advantageous to formulate parenteral compositions in dosage unit forms for ease of administration and uniformity of dosage when administered to the subject or patient. As used herein, a dosage unit form refers to physically discrete units suitable as unitary dosages for the subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce a desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure depends on the specific characteristics of the active compound and the particular therapeutic effect(s) to be achieved, taking into consideration the treatment and sensitivity of any individual patient.
[00197] For administration of transduced cells, the dosage range will generally be from about 1 x 106 transduced cells to 1 x 108 transduced cells per host body weight (in kg). Exemplary doses are greater than or equal to about 9 x 106 transduced cells per kg. Dosages may be selected and readjusted as required to maximize therapeutic benefit for a particular subject.
[00198] Transduced cells of the disclosure or the LV vectors of the disclosure may be administered one or more times. Intervals between single dosages can be, for example, yearly or longer, including 1 year, 2 years, 5 years, or 10 years.
[00199] In certain embodiments, two or more LV vectors may be administered simultaneously or sequentially, in which case the dosage of each administered compound may be adjusted to fall within the ranges described herein.
[00200] Actual dosage levels of transduced cells of the disclosure or the LV vectors of the disclosure, alone or in combination with one or more other active ingredients in the pharmaceutical compositions of the present disclosure, may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without causing deleterious side effects to the subject or patient.A selected dosage level will depend upon a variety of factors, such as pharmacokinetic factors, including the activity of the particular transduced cells of the disclosure or the LV vectors of the disclosure employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and / or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the subject or patient being treated, and similar factors well known in the medical arts.
[00201] Administration of a "therapeutically effective dosage" of transduced cells of the disclosure or the LV vectors of the disclosure may result in a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention or lessening of impairment or disability due to the disease affliction.
[00202] The transduced cells of the disclosure or the LV vectors of the disclosure or composition of the present disclosure may be administered via one or more routes of administration, using one or more of a variety of methods known in the art. As will be appreciated by the skilled worker, the route and / or mode of administration will vary depending upon the desired results. Routes of administration for transduced cells of the disclosure or the LV vectors of the disclosure and compositions containing such vectors include, e.g., intracerebroventricular, intravenous, intraperitoneal, subcutaneous, spinal or other parenteral routes of administration, for example by injection or infusion. The phrase "parenteral administration" as used herein refers to modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intraperitoneal, subcuticular, intraarticular, subcapsular, subarachnoid, epidural and intracisternal magna injection and infusion.
[00203] While some embodiments of the disclosure have been described by way of illustration, it will be apparent that the disclosure can be put into practice with many modifications, variations and adaptations, and with the use of numerous equivalents or alternative solutions that are within the scope of persons skilled in the art, without departing from the spirit of the disclosure or exceeding the scope of the claims.
[00204] All publications, patents, and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. EXAMPLES
[00205] The examples presented herein represent certain embodiments of the present disclosure. However, it is to be understood that these examples are for illustration purposes only and do not intend, nor should any be construed, to be wholly definitive as to conditions and scope of this disclosure. The examples were carried out using standard techniques, which are known and routine to those of skill in the art, except where otherwise described in detail. Example 1. Design and Synthesis of Lentiviral Transfer PlasmidsSRT1-SRT5
[00206] A series of lentiviral transfer plasmids for expressing globin genes was designed by modifying TNS9.3.55. In TNS9.3.55 and the constructs described herein, the globin expression cassette is oriented in the antisense direction relative to the transcription of the lentiviral vector genome. The changes made relative to TNS9.3.55, as depicted schematically in Fig. 1, include(a) incorporation of an A1 insulator
[30] in the 3’LTR;(b) repositioning the cPPT sequence
[25] to be approximately centered between the 5’ and 3’ LTRs;(c) use of the β-globin T87Q variant;(d) addition of 6 stop codons (2 x 3 different frameshifts) at the end of the bovine growth hormone poly(A) sequence; and / or(e) use of alternative backbones, including a Nanoplasmid® (Aldevron), pUC57-Kan (GenScript) and pUC57-Brick-Kan (GenScript).
[00207] The modifications were made by brick nucleotide design and synthesis, and incorporated into yeast for construct building. Individual clones were identified and sequenced for confirmation of final constructs, which were cloned from LTR to LTR into pUC57-Brick-Kan or pUC57-Kan. For comparison, the lentiviral expression vector construct was subcloned into the Nanoplasmid® vector backbone. Five resulting transfer plasmids, SRT1-SRT5, are schematically depicted in Fig. 1. Three additional transfer plasmids, SRT8, SRT9 and SRT11 (see Example 7), are schematically depicted in Fig. 8. The differences among these plasmids are summarized in Table3A. The size of each transfer plasmid and its SEQ ID NO: is provided in in Table 3B, with the nucleotide sequence for each plasmid provided in the accompanying Sequence Listing. Table 8, following Example 14,provides the sequence location for the various sequence elements in SRT2. Table3A. SRT Transfer Plasmid ElementsTransferPlasmidcPPTA1 insulatorβ-globin6x stopBackboneTNS9.3.55Adjacent to RRE–wild type–pUC19SRT1Center+T87Q variant+pUC57-Brick-KanSRT2Center–T87Q variant+pUC57-Brick-KanSRT3Center+T87Q variant+pUC57-KanSRT4Center–T87Q variant+pUC57-KanSRT5Center+T87Q variant+NanoplasmidSRT8Center–T87Q variant+pUC57-KanSRT9Center–T87Q variant+pUC57-KanSRT11Center+T87Q variant+pUC57-Kan Table 3B. SRT Transfer Plasmid SizesTransfer PlasmidSize (bp)SEQ ID NO:SRT115,1096SRT214,8047SRT312,4058SRT412,1099SRT510,29810SRT810,90611SRT911,56212SRT1111,21113 Example 2. Erythroid-Specific and cPPT-Centered Lentiviral Transfer Plasmids
[00208] Two additional lentiviral transfer plasmids were designed. One plasmid is for erythroid-specific expression of a heterologous gene (erythroid-cPPT plasmid, or SRT-MCS; Fig. 2, middle line), so that a gene of interest can be cloned into the vector downstream of the β-globin promoter using a multi-cloning site or by direct synthesis) and with the cPPT sequence remaining generally centered between the LTRs. The second plasmid (generic cPPT plasmid, or SRT-dual MCS; Fig. 2, bottom line) is for general lentiviral-based gene expression, again so that a gene of interest, and any necessary promoters or expression control sequences can be cloned into the vector in a manner which preserves the cPPT in a central position between the LTRs. Example 3. Vector Production
[00209] A four-plasmid transfection system was employed to generate lentiviral vector preparations with the β-globin expression system. The helper packaging plasmids were supplied from the pALD-Lenti System (Aldevron) to express in trans the accessory and structural proteins, pALD-Rev-K, pALD-Gagpol-K and envelope protein, pALD-VSV-G-K.
[00210] For plasmid transfections, human embryonic kidney 293T (HEK 293T) were seeded onto 10-cm plates (Corning) with 5×106 cells in DMEM:Penicillin / Streptomycin / Glutamine + 2% FBS about 16-24 hours prior to transfection. Two hours prior to transfection, the media was replaced to enable the cells to undergo growth. For the transfection step, the TransIT lentiviral vector system (Mirus, Madison, WI) was used with a total of 21 μg total plasmid per 10-cm dish and 2.5 µL per μg DNA of the TransIT transfection solution as follows: 2.5 μg pALD-VSV-G-K plasmid, 2.5 μg pALD-Rev-K plasmid, 6 μg pALD-Gag-pol plasmid, and 10 μg transfer plasmid. The plates were placed into an incubator at 5% CO2:95% O2 for 60-72 hours. The media was then harvested, cleared by syringe filtration through 0.45-μm pore-size cellulose filters, aliquoted and stored at -80°C.
[00211] To determine the titer of the lentiviral vector stocks, a serial dilution of unconcentrated media was used to transduce 5×105 SupT1 cells in a 6-well plate in the presence of polybrene (8 μg / ml). Functional titer of viral products was determined by quantitative PCR (qPCR) detection of lentiviral GAG sequences in genomic DNA isolated from transduced cells (Table 4) and are reported as transducing units (TU / mL). The vector titers for SRT1, SRT2 and SRT5 are also shown graphically in Fig. 3.
[00212] HIV p24 Gag antigen concentration was determined by ELISA (Zeptometrix) for concentrated vector preparations to establish structural titer (Table 4). Table 4. SRT Viral Vector Titers p24 ELISA titer(ng / mL)FunctionalTiter (TU / mL)GAG ddPCRVectorBackboneUnconcentratedUnconcentratedSRT1Kan-Brick334 ± 18 (n=3)1.9 ± 0.5 x 10E7 (n=4)SRT2Kan-Brick405 ± 34 (n=5)3.5 ± 0.4 x 10E7 (n=5)SRT5NanoN / D1.08 x 10E6 Example 4. Volumetric Vector Testing
[00213] Lentiviral vector preparations of SRT1 and SRT2 were tested for expression and integration by transduction of the adult human erythroleukemia cell line K562. These cells were selected because they permit expression of genes under transcriptional control of erythroid-specific promoter / enhancer elements and predominantly express fetal γ-globin instead of adult β-globin. For this experiment, lentiviral particles were added by volume. A. Erythroid-Specific Expression of GFP
[00214] K562 cells were seeded at 1x105 per well in a 12-well plate and transduced with D432-GFP control lentiviral vector at 0, 10, 30, and 100 microliters in a total volume (2 mL) of complete growth medium supplemented with 100 µg / mL F108 (Fig. 4A). The D432-GFP virus had an estimated titer of 1x106 TU / mL. Cultures were grown for 7 days after transduction for cytometric analysis or for 10 days for genomic DNA isolation. The genomic DNA was analyzed for vector copy number (VCN). Genomic DNA isolated from cell line (GA8) harboring a single copy lentiviral vector was serially diluted from 100 ng to 0.1 ng and quantitative PCR performed using primer-probe sets to lentiviral vector Ψ sequence or the cellular control gene RNaseP to establish standard curves for VCN calculations. The D432-GFP control virus titer was 9.2x105 TU / mL based on flow cytometry.
[00215] The flow cytometry histograms demonstrating GFP expression are shown in Fig. 4B with the percentage of GFP+ cells plotted as a function of VCN shown in Fig. 4C. Fig. 4D shows the VCN as a function of viral particles added to the K562 cells. B. β-globin Expression
[00216] K562 cells were seeded at 1x105 per well in a 12-well plate and transduced with 10, 30 or 100 microliters of SRT1 or SRT2 lentiviral vector in a total volume (2 mL) of complete growth medium supplemented with 100 µg / mL F108 (Fig. 5A). Cultures were grown for 7 days for total RNA isolation, 10 days for genomic DNA isolation, or 14 days for flow cytometry analysis of intercellular β-globin protein using clone 37-8; AlexaFluor 488 (Santa Cruz Biotechnology) at 1:500 dilution according to manufacturer’s instructions. The RNA transcript levels are shown in Fig. 5B and the intracellular β-globin protein expression is shown in Fig. 5C for all the transduced cell populations for SRT1 (left panels) and SRT2 (right panels). The average VCN for each transduction is reported below the X-axis with the exception for SRT1 at 100 microliter volume which was not determined (nd). Example 5. MOI Vector TestingA. β-globin Expression
[00217] K562 cells were seeded at 1x105 per well in a 12-well plate and transduced with SRT1 or SRT2 lentiviral vector at equivalent MOI (multiplicity of infection) of 0.3, 1, 3, and 10 in a total volume of 2 mL of complete growth medium supplemented with 100 µg / mL F108 (Fig. 6A). Cultures were grown for 7 days for total RNA isolation, 10 days for genomic DNA isolation, or 14 days for flow cytometry analysis of intercellular β-globin protein using clone 37-8; AlexaFluor 488 (Santa Cruz Biotechnology) at 1:500 dilution according to manufacturer’s instructions. The RNA transcript levels are shown in Fig. 6B and the intracellular β-globin protein expression is shown in Fig. 6C for all the transduced cell populations for SRT1 (left panels) and SRT2 (right panels). The average VCN for each transduction is reported below the X-axis.
[00218] The log of the percentage of intracellular β-globin protein expression obtained in Fig. 6 is plotted as a function of the log of the vector copy number for cells transduced with SRT1 (●) or SRT2 (■) (Fig. 7). Two independent experiments were conducted, and the average of that data is presented in Fig. 6andFig. 7.
[00219] Overall, the collective findings of Examples 4 and 5 demonstrate that 1) SRT2 can produce high titers above 10E7 TU / mL without vector concentration; 2) the A1 insulator present in SRT1 is retained during production of virus particles and is retained upon genomic integration; 3) the reduction in titer for SRT1 is consistent with published reports using similar insulator elements (FB, chicken β-globin HS4, etc.) and 4) the MOI-controlled transductions shows that both SRT1 and SRT2 is functionally active, but that SRT2 is considerably more functionally effective than SRT1. In contrast, TNS9.3.55 titers have been reported as about 5 x 105 TU / mL
[28] , about 2.1 x106 TU / mL
[34] and for clinical grade vector as 3.5x108 and GLP grade vector as 6.6 x108 TU / mL
[35] . Example 6. LTR integrity
[00220] LTR integrity PCR assay. Lentiviral vector preparations for SRT1 and SRT2 were tested on K562 cells to determine stability of vector integration. Viral particles were normalized based on the functional titer and applied to cells at equivalent MOI. Genomic DNA was extracted and used for PCR analysis. PCR primers were obtained from Integrated DNA Technologies (IDT) for the sense: U3(+) 5’- GGAAGGGCTAATTCACTCCC-3’ (SEQ ID NO: 16); and antisense direction: R(-) 5’- GGGTTCCCTAGTTAGCCAGAG-3’ (SEQ ID NO: 17); and U5(-) 5’- CTCTAGTTACCAGAGTCACAC-3’(SEQ ID NO: 18). The primers were used at a concentration of 1 mM, with the genomic DNA and the Platinum Blue PCR supermix (Invitrogen). The samples were denatured at 94°C for 3 min, and then 35 cycles were performed at 94°C for 30 sec, 58°C for 30 sec, and 72°C for 15 sec, before a final extension of 7 min at 72°C. The PCR products were run on a 1.2% agarose gel and detected by ethidium bromide intensity using a UV transilluminator.
[00221] No loss of the A1 insulator was identified, indicating that vectors which include the A1 insulator in the 3’LTR during vector production and cell transduction, will remain stable throughout their life cycle. Example 7.Design of Lentiviral Transfer Plasmids SRT8, SRT9 and SRT11
[00222] Beginning with the SRT4 plasmid, three additional lentiviral transfer plasmids were designed and synthesized, SRT8, SRT9 and SRT11. For SRT8, (1) the HS3 and HS4 LCR regions were reduced in size to 999 and 539 bp, respectively, and (2) the β-globin promoter was shortened to 316 bp. SRT9 is the same as SRT8 except that the GFP gene was incorporated in frame with the globin gene to enable transduced cells to be readily marked by the detection of GFP fluorescence. SRT11 is the same as SRT8 except that the A1 insulator was incorporated into the 3’ LTR region as in the plasmid constructs of Example 1. Each of the SRT8, SRT9 and SRT11 plasmids have the pUC57-Kan backbone and are schematically depicted in Fig. 8; their various elements are also summarized in Table 3A. The sizes of these three transfer plasmids and their SEQ ID NO: is provided in in Table 3B, with the nucleotide sequence for each plasmid provided in the accompanying Sequence Listing. The sizes of each HS region in the modified LCRs in all plasmid constructs and the size of the β-globin promoter are provided in Table 5. Table 5. Transfer Plasmid LCR and Promoter SizesPlasmidA1 insulatorβ-globinHS2-HS3-HS4 LCRSize (bp)β-globin promoter(Size bp)TNS9.3.55–wild type859-1301-1063663SRT1+T87Q variant853-1301-1063663SRT2–T87Q variant853-1301-1063663SRT3+T87Q variant853-1301-1063663SRT4–T87Q variant853-1301-1063663SRT5+T87Q variant853-1301-1063663SRT8–T87Q variant853-999-539316SRT9–T87Q variant853-999-539316SRT11+T87Q variant853-999-539316 Example 8. Further Vector Production
[00223] The backbones of the transfer plasmids SRT1, SRT2, SRT8 and SRT11 were replaced with a proprietary backbone and the plasmids were used to produce vectors as generally described in Example 3 using a four-plasmid transfection system. The helper packaging plasmids were supplied from the pALD-Lenti System (Aldevron) to express in trans the accessory and structural proteins, pALD-Rev-K, pALD-Gagpol-K and envelope protein, pALD-VSV-G-K.
[00224] To determine the titer of the lentiviral vector stocks, a serial dilution of conditioned media was used to transduce 5×105 SupT1 cells in a 6-well plate in the presence of polybrene (8 μg / ml). Functional titer of viral products was determined by ddPCR detection of lentiviral GAG sequences in genomic DNA isolated from transduced cells are reported as transducing units (TU / mL) and shown graphically in Fig.9.
[00225] The vector size of SRT8 was ~1200-bp smaller than TNS9.3.55, which led to the improved GMP large scale vector titer for SRT8 (1.24 x 10e9 TU / mL) compared to an original GMP preparation for TNS9.3.55 (3.34 x 10e8 TU / mL) as shown in Fig. 10. Example 9.Additional MOI Vector Testing
[00226] K562 cells were seeded at 1x105 per well in a 12-well plate and transduced with SRT1, SRT2, SRT8, SRT11 or SRT-CA lentiviral vectors at MOIs of 3 and 10 in a total volume of 2 mL of complete growth medium supplemented with 100 µg / mL F108 (Fig. 11A). SRT-CA is a control vector which is biosimilar to BB305 in terms of the location of the cPPT sequence. Cultures were grown for 7 days for total RNA isolation, 10 days for genomic DNA isolation, or 14 days for flow cytometry analysis of intercellular β-globin protein using clone 37-8; AlexaFluor 488 (Santa Cruz Biotechnology) at 1:500 dilution according to manufacturer’s instructions.
[00227] The RNA transcript levels per vector copy number are shown in Fig. 11B and the intracellular β-globin protein expression normalized to vector copy number is shown in Fig. 11C for all the transduced cell populations at each MOI. These data are also summarized in Table6 without normalizing to vector copy number between SRT-CA and the SRT series. Table 6. SRT Vectorβ-globinExpressionVectorMOI% RNasePFold Change% β-globin+% ChangeSRT-CA31.5112.9 SRT139.0615.6+21SRT2374.549.632.1+149SRT8331.420.922.7+76SRT1135.53.78.8-32SRT-CA1011.5145.1 SRT11040.03.535.5-21SRT21017014.853.9+20SRT81012010.449.1+9SRT111021.81.922.2-51
[00228] Fig. 12 shows flow cytometry density plots of β-globin protein expression in SRT1, SRT2, SRT8 and SRT-CA at MOIs of 3 or 10, as indicated. Note the increased mean fluorescence intensity (MFI) and % positive cells for SRT8 relative to the other vectors.
[00229] Overall, the collective findings demonstrate that SRT8 can be produced at extremely high viral titers with the improved functional capabilities in terms of β-globin gene expression and transduction efficiency as determined by the β-globin-positive cells relative to SRT-CA, which is a lentiviral vector with a cPPT positioned in a 5’ site similar to biosimilar vector BB305. Example 10. CD34+ Differentiation and Transduction Efficiency
[00230] Mobilized peripheral blood CD34+ cells from a healthy adult donor were pre-stimulated and transduced with the SRT8, SRT9 or TNS9.3.55 lentiviral vectors at an MOI of 100. Transduced cells (300 – 400) were mixed with semi-solid methylcellulose and cultured for 14 days. Formed colonies were visually inspected using an inverted light microscope and characterized as non-erythroid or erythroid and counted to yield colony-forming units (CFU). Fig. 13 shows total CFU by cell type. Colony-forming potential was similar for all transduced populations with nearly equal fractions of non-erythroid and erythroid colonies being observed.
[00231] To assess transduction frequency, in differentiated and undifferentiated cells, human CD34+ cells were pre-stimulated and transduced with SRT9 at an MOI of 100. SRT9 is identical to SRT8 but includes a GFP marker downstream of the β-globin coding sequence. The majority of the transduced cells were maintained for 5 days in liquid growth medium that does not support differentiation. In addition, about 300-400 cells were mixed with semi-solid methylcellulose, formation of erythroid and non-erythroid colonies were scored after 14 days. Cells in liquid culture were evaluated by flow cytometry for expression of GFP (Fig. 14, left panel). Erythroid colonies formed in methylcellulose were visually inspected using a fluorescence microscope to define those that were GFP positive (Fig. 14, right panel). In the undifferentiated state, only 4% of the CD34+ cells were positive for GFP. In comparison, 69% of erythroid colonies were GFP positive. Following erythroid differentiation, the β-globin promoter became active to produce GFP (and by proxy β-globin expression) from the SRT9 vector.
[00232] In another experiment, mobilized peripheral blood CD34+ cells from a healthy adult donor were pre-stimulated and transduced with either vehicle (mock) or lentiviral vectors at MOI 100 (TNS9.3.55, SRT8 or SRT9). Transduced cells were mixed with semi-solid methylcellulose and cultured for 14 days to promote differentiation into non-erythroid and erythroid cells. Genomic DNA was isolated from differentiated cells and quantitative PCR performed to assess average VCN calculated from a standard curve established from a cell line harboring a single lentivirus vector integrant. No vector copies were detected in the genomic DNA from the mock treated cells. VCN for the differentiated cells transduced with TNS9.3.55, SRT8, and SRT9 was 2.0, 3.6, and 1.0, respectively (Fig. 15). Example 11. Hemoglobin Transcript Levels in Differentiated CD34+ CellsMobilized peripheral blood CD34+ cells from a healthy adult donor were pre-stimulated and transduced with either vehicle (mock) or lentiviral vectors at MOI 100 (TNS9.3.55, SRT8 or SRT9). Transduced cells were mixed with semi-solid methylcellulose and cultured for 14 days to promote differentiation into non-erythroid and erythroid cells. Total RNA was isolated from differentiated cells and quantitative RT-PCR performed using TaqMan primer-probe sets to detect β-globin (Hbb levels) or α-globin (Hba) relative to the cellular gene RNaseP. Levels of Hbb over total (Hbb + Hba) are reported with mock (vehicle) treated cells set equal to 1.0. Relative changes in the transcript levels from the lentiviral vector-transduced cells were compared against the mock value. Cells transduced with TNS9.3.55 had 70% higher levels of Hbb, which was similar to SRT9 (60% higher). SRT8 showed a dramatically higher level of Hbb of 180% compared to the mock-treated cells, which was also ~65% higher than TNS9.3.55 (Fig. 16).Example 12. Variant specific expression of T87Q globin
[00233] Mobilized peripheral blood CD34+ cells from a healthy adult donor were pre-stimulated and transduced with either vehicle (mock) or lentiviral vectors at MOI 100 (TNS9.3.55, SRT8 or SRT9). Transduced cells were mixed with semi-solid methylcellulose and cultured for 14 days to promote differentiation into non-erythroid and erythroid cells. Total RNA was isolated from differentiated cells and quantitative RT-PCR performed to using PCR primers specific to the lentiviral vector-encoded T87Q β-globin variant as described in provisional application U.S. Ser. No. 63 / 729,416, filed December 8, 2024. The primer pair for detecting the T87Q β-globin consisted of a forward primer comprising the sequence of TCAAGGGCACCTTTGCCCAG (T87Q sense) (SEQ ID NO: 19) and a reverse primer comprising the sequence of CAGCCCCACTTTCTGATAGGCAC (B1 antisense) (SEQ ID NO: 20). The primer pair for detecting the wild-type β-globin consisted of a forward primer comprising the sequence of TCAAGGGCACCTTTGCCACA (WT sense) (SEQ ID NO: 21) and a reverse primer comprising the sequence of CAGCCCCACTTTCTGATAGGCAC (B1 antisense) (SEQ ID NO: 20).
[00234] The results are shown in Fig. 17. Transcript levels were calculated as percentage of the cellular control RPL13A and the values were normalized to VCN. Minimally detectable amplification was measured in the mock (0.003) and TNS9.3.55 (0.005) transduced CD34+ cells. TNS9.3.55 expresses only the wild-type Hbb transcript. For SRT8 and SRT9, there was 0.73 and 0.42, respectively, transcript levels per VCN. Example 13. Integration Site Analysis in Human CD34+ cells
[00235] PCR amplification and sequencing of the integrated sites for human CD34+ cells transduced with TNS9.3.55 or SRT8 was performed by Azenta Life Sciences. In terms of the location of the integration events, Table 7, bottom section, shows that TNS9.3.55 was found to be inserted at 11.1% of the intergenic regions (inter) within the genomic DNA compared to 8.3% for SRT8. The additional 2.8% integration (or >20% more relative to TNS9.3.55) into intragenic regions (intra) for SRT8 suggests a higher probability to have active promoter activity compared to integrations within the intergenic regions.
[00236] Lentiviral vector integrations near cancer-causing genes were further analyzed. In cases where 1% or a higher number of integration events were detected, no significant difference was found between TNS9.3.55 versus SRT8 integrations at known cancer-causing genes. However, at sites where the lentiviral vector was detected at 10% or a higher number of integration events, there was a nearly 40% lower probability for SRT8 integration into a “hot spot“ relative to TNS9.3.55 (Table 7, top two panels). Table 7. SRT Integration Sites Cancer (>0.1) - 10% or higher number of integrationsVectorYESNOTotal% of totalTNS9.3.55168510115.8 SRT8547529.6 Cancer (>0.01) - 1% or higher number of integrationsVectorYESNOTotal% of totalTNS9.3.55453536458177.8 SRT8201245326547.6 Integration location (>0.01) of 1% or more sitesVectorInterIntraTotal% Inter of totalTNS9.3.556475170581711.1 SRT8220243426548.3 Example 14. Comparison of SRT Vector Series and BB305 Vector
[00237] Fig. 18 provides a table highlighting the major differences between the SRT series of transfer plasmids versus TNS9.3.55. The table includes the vector genome lengths of SRT2 and SRT8 as well as sizes of the β-globin promoter and individual HS2, HS3, HS4 regions (plus the overall LCR length in each of those plasmids). All values are in base pairs. Additionally, the table provides the location (and span) of the cPPT element from the beginning position of the integrated vector genome, which for this purpose is arbitrarily designated as the first base of the 5’-LTR. The positions of HS2, HS3 and HS4 are the location of those sequences as found in GenBank sequence NG_052895.1.Table8: SRTTransfer Plasmid Sequence ElementsBy Location Note: Nucleotide locations marked with * are on the complement of the sense strand, i.e., the given element as usually presented is 5’ to 3’ on the antisense strand. Sequence ElementNucleotide Location in SRT2Nucleotide Location in SRT8CMV enhancer1. . .5581. . .558CMV promoter559. . .674559. . .674R-U5 region LTR675. . .885675. . .885RRE1374. . .18971374. . .1897 β-globin enhancer*2270. . . 2885*2270. . . 2885human β-globin pA signal*2886. . .3280*2886. . .3280β-globin Exon 3*3281. . .3409*3281. . .3409β-globin intron B*3410. . .3885*3410. . .3885β-globin Exon 2*3886. . .4108*3886. . .4108β-globin intron A*4109. . .4238*4109. . .4238β-globin Exon 1 *4239. . .4330*4239. . .4330β-globin promoter*4331. . .4993*4331. . .4646cPPT5044. . .51614690. . .4807HS25001. . .5039, 5164. . .59774647. . .4685, 4810. . .5623 HS36013. . .73135659. . .6657HS47314. . .83786658. . .7195SIN-3’ LTR8435. . .85977232. . .7394WPRE8602. . .91987399. . .7995polyA_signalBGHpA9215. . .94198012. . .82166x stop codons9420..95118217. . .8308 LCR5164. . .81804647. . .4685, 4810. . .7195β-globin expression cassette*2270. . .8180*2270. . .4646LV cassette676. . .85971. . .7394SRT2 (whole)1. . .148041. . .10906 REFERENCES
[00238] The following references are referred to:1. Taher, A.T., K.M. Musallam, and M.D. Cappellini, beta-Thalassemias. N Engl J Med, 2021. 384(8): p. 727-743.2. Colah, R., A. Gorakshakar, and A. Nadkarni, Global burden, distribution and prevention of beta-thalassemias and hemoglobin E disorders. Expert Rev Hematol, 2010. 3(1): p. 103-17.3. Michlitsch, J., et al., Newborn screening for hemoglobinopathies in California. Pediatr Blood Cancer, 2009. 52(4): p. 486-90.4. Gelinas, R.E., M.A. Bender, and A.D. Miller, Regulated expression of the human beta-globin gene after retroviral transfer into murine and human hematopoietic cells. Prog Clin Biol Res, 1989. 316B: p. 235-49.5. Gelinas, R.E., et al., Long-term expression of the human beta-globin gene after retroviral transfer into pluripotent hematopoietic stem cells of the mouse. Adv Exp Med Biol, 1989. 271: p. 135-48.6. Lisowski, L. and M. Sadelain, Current status of globin gene therapy for the treatment of beta-thalassaemia. Br J Haematol, 2008. 141(3): p. 335-45.7. McCormack, M.P. and T.H. Rabbitts, Activation of the T-cell oncogene LMO2 after gene therapy for X-linked severe combined immunodeficiency. N Engl J Med, 2004. 350(9): p. 913-22.8. Kim, S.H., et al., Construction of retroviral vectors with improved safety, gene expression, and versatility. J Virol, 1998. 72(2): p. 994-1004.9. Naldini, L., et al., In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science, 1996. 272(5259): p. 263-7.10. Miller, D.G., M.A. Adam, and A.D. Miller, Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection. Mol Cell Biol, 1990. 10(8): p. 4239-42.11. Zufferey, R., et al., Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol, 1998. 72(12): p. 9873-80.12. Dull, T., et al., A third-generation lentivirus vector with a conditional packaging system. J Virol, 1998. 72(11): p. 8463-71.13. Park, F., K. Ohashi, and M.A. Kay, Therapeutic levels of human factor VIII and IX using HIV-1-based lentiviral vectors in mouse liver. Blood, 2000. 96(3): p. 1173-6.14. Park, F., et al., Efficient lentiviral transduction of liver requires cell cycling in vivo. Nat Genet, 2000. 24(1): p. 49-52.15. Pawliuk, R., et al., Correction of sickle cell disease in transgenic mouse models by gene therapy. Science, 2001. 294(5550): p. 2368-71.16. May, C., et al., Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing lentivirus-encoded human beta-globin. Nature, 2000. 406(6791): p. 82-6.17. Kumar, M., et al., Systematic determination of the packaging limit of lentiviral vectors. Hum Gene Ther, 2001. 12(15): p. 1893-905.18. Morgan, R.A., et al., Improved Titer and Gene Transfer by Lentiviral Vectors Using Novel, Small beta-Globin Locus Control Region Elements. Mol Ther, 2020. 28(1): p. 328-340.19. Hanawa, H., et al., Extended beta-globin locus control region elements promote consistent therapeutic expression of a gamma-globin lentiviral vector in murine beta-thalassemia. Blood, 2004. 104(8): p. 2281-90.20. Levasseur, D.N., et al., Correction of a mouse model of sickle cell disease: lentiviral / antisickling beta-globin gene transduction of unmobilized, purified hematopoietic stem cells. Blood, 2003. 102(13): p. 4312-9.21. Miccio, A., et al., In vivo selection of genetically modified erythroblastic progenitors leads to long-term correction of beta-thalassemia. Proc Natl Acad Sci U S A, 2008. 105(30): p. 10547-52.22. Pestina, T.I., et al., Correction of murine sickle cell disease using gamma-globin lentiviral vectors to mediate high-level expression of fetal hemoglobin. Mol Ther, 2009. 17(2): p. 245-52.23. Puthenveetil, G., et al., Successful correction of the human beta-thalassemia major phenotype using a lentiviral vector. Blood, 2004. 104(12): p. 3445-53.24. Uchida, N., et al., Development of a forward-oriented therapeutic lentiviral vector for hemoglobin disorders. Nat Commun, 2019. 10(1): p. 4479.25. Zennou, V., et al., HIV-1 genome nuclear import is mediated by a central DNA flap. Cell, 2000. 101(2): p. 173-85.26. Follenzi, A., et al., Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat Genet, 2000. 25(2): p. 217-22.27. Park, F. and M.A. Kay, Modified HIV-1 based lentiviral vectors have an effect on viral transduction efficiency and gene expression in vitro and in vivo. Mol Ther, 2001. 4(3): p. 164-73.28. Cabriolu, A., et al., Globin vector regulatory elements are active in early hematopoietic progenitor cells. Mol Ther, 2022. 30(6): p. 2199-2209.29. Nagel, R.L., et al., Structural bases of the inhibitory effects of hemoglobin F and hemoglobin A2 on the polymerization of hemoglobin S. Proc Natl Acad Sci U S A, 1979. 76(2): p. 670-2.30. Liu, M., et al., Genomic discovery of potent chromatin insulators for human gene therapy. Nat Biotechnol, 2015. 33(2): p. 198-203.31. Persons, D.A., et al., The degree of phenotypic correction of murine b-thalassemia intermedia following lentiviral-mediated transfer of a human g-globin gene is influenced by chromosomal position effects and vector copy number. Blood, 2003. 101: p. 2175–2183.32. Romero, Z., et al., B-globin gene transfer to human bone marrow for sickle cell disease. J. Clin. Invest, 2013. 123: p. 3317–3330.33. Urbinati, F., et al., Potentially therapeutic levels of anti-sickling globin gene expression following lentivirus-mediated gene transfer in sickle cell disease bone marrow CD34+ cells. Exp Hematol, 2015. 43: p. 346-35134. Sadelain, M., et al., Strategy for a multicenter phase I clinical trial to evaluate globin gene transfer in β-thalassemia. Ann. N.Y. Acad. Sci., 2010. 1202, p. 52–58. 35. Boulad, F., et al., Safe mobilization of CD34+ cells in adults with β-thalassemia and validation of effective globin gene transfer for clinical investigation. Blood, 2014. 123(10): p. 1483–1486.36. Li Q., et al., Nucleotide sequence of 16-kilobase pairs of DNA 5' to the human epsilon-globin gene. J. Biol. Chem., 1985. 260: p.14901-14910. 37. Li Q., et al., β-Globin Locus Activation Regions: Conservation of Organization, Structure, and Function. Proc. Natl. Acad. Sci., 1990. 87:8207. 38. Shehee W.R., et al., Nucleotide sequence of the BALB / c mouse β-globin complex. J. Mol. Biol., 1989. 205: p. 41-62. 39. Margot, J.B., et al., Complete nucleotide sequence of the rabbit β-like globin gene cluster: Analysis of intergenic sequences and comparison with the human β-like globin gene cluster. J. Mol. Biol., 1989. 205: p. 15-40. 40. Li, Q., et al., Primary structure of the goat β-globin locus control region. Genomics, 1991. 9: p. 488-499.41. Kroning, K.E., et al., A Modular Fluorescent Sensor Motif Used to Detect Opioids, Protein–Protein Interactions, and Protease Activity. ACS Chem Biol, 2022. 17(8): p. 2212-2242. pOTTC155 (Addgene plasmid # 50949 ; http: / / n2t.net / addgene:50949 ; RRID:Addgene_50949).43. Ford, K.M., et al., Peptide-tiling screens of cancer drivers reveal oncogenic protein domains and associated peptide inhibitors. Cell Syst., 2021. 12(7): p. 716-732.e7. doi: 10.1016 / j.cels.2021.05.002. Epub 2021 May 28.44. Iaffaldano, B.J., et al., CRISPR library screening to develop HEK293-derived cell lines with improved lentiviral vector titers. Front Genome Ed., 2023. 5:1218328. doi: 10.3389 / fgeed.2023.1218328. eCollection 2023.45. Zhang, K., et al., The C9orf72 repeat expansion disrupts nucleocytoplasmic transport. Nature, 2015. 525(7567): p.56-61.46. Wan, Y., et al., Dynamic imaging of nascent RNA reveals general principles of transcription dynamics and stochastic splice site selection. Cell, 2021. 184(11): p. 2878-2895.47. pLenti Lifeact-mRuby2 PuroR (Addgene plasmid # 84386 ; http: / / n2t.net / addgene:84386 ; RRID:Addgene_84386)48. Mock, U., et al., Novel lentiviral vectors with mutated reverse transcriptase for mRNA delivery of TALE nucleases. Sci Rep, 2014. 4: p. 6409. doi: 10.1038 / srep06409.49. Gossan, N., et al., The circadian clock in murine chondrocytes regulates genes controlling key aspects of cartilage homeostasis. Arthritis Rheum, 2013. 65(9): p. 2334-45. doi: 10.1002 / art.38035.50. Martell, J.D., et al., A split horseradish peroxidase for the detection of intercellular protein–protein interactions and sensitive visualization of synapses. Nat Biotechnol, 2016. 34: p. 774-780. doi: 10.1038 / nbt.3563.51. pLenti-EGFP-P4M-SidMx2 (Addgene plasmid # 136997 ; http: / / n2t.net / addgene:136997 ; RRID:Addgene_136997)52. Phage-PGK-GFP-T(WT) (Addgene plasmid # 181736 ; http: / / n2t.net / addgene:181736 ; RRID:Addgene_181736)53. pWPT-nlsLacZ (Addgene plasmid # 12261 ; http: / / n2t.net / addgene:12261 ; RRID:Addgene_12261)54. pSUSL002R:pTRE3G-dCas9-2xKRAB-p2a-TurboRFP (Addgene plasmid # 209299 ; http: / / n2t.net / addgene:209299 ; RRID:Addgene_209299)55. pLenti HsATP10B_WT-T2A-His-flag-TMEM30A variant1 (Addgene plasmid # 191675 ; http: / / n2t.net / addgene:191675 ; RRID:Addgene_191675)56. p2151 pHAGE-hSPC-TFEB-TagBFP-W (Addgene plasmid # 188722 ; http: / / n2t.net / addgene:188722 ; RRID:Addgene_188722)57. Koblan, L.W., et al., In vivo base editing rescues Hutchinson–Gilford progeria syndrome in mice. Nature, 2021. 589(7843): p. 608-614.
Claims
1. A recombinant lentiviral transfer plasmid comprising: (a) a globin expression cassette which comprises sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a globin gene functional to ameliorate a hemoglobinopathy, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the globin expression cassette to enable expression of the globin gene in a mammal when present in a cell;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the globin expression cassette, a 3’ LTR, and posttranscriptional regulatory elements, wherein the globin expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette, wherein the cPPT is positioned midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette, and wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and (c) a plasmid backbone.
2. The plasmid of claim 1, wherein the midpoint of said cPPT sequence is positioned 10 to 20% upstream or downstream of the midpoint of the distance between the beginning of the 5’ LTR and the end of the 3’ LTR.
3. The plasmid of claim 1, wherein said LCR is no larger than 4 kb and comprises or consists essentially of HS2, HS3 and HS4.
4. The plasmid of claim 3, wherein said LCR comprises: (a) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4; (b) an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5: (c) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(e) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or (f) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
5. The plasmid of claim 1, wherein said first promoter is a β-globin promoter.
6. The plasmid of claim 1, wherein said globin gene is selected from the group consisting of a β-globin gene, a γ-globin gene, and a δ-globin gene.
7. The plasmid of claim 6, wherein the globin gene is a wild- type human β-globin gene or a mutant human β-globin gene.
8. The plasmid of claim 7, wherein said mutant human β-globin gene is selected from a human β-globin gene comprising one or more deletions of intron sequences, a human β-globin gene encoding at least one anti-sickling amino acid residue, and a human β-globin gene comprising one or more deletions of intron sequences and encoding at least one anti-sickling amino acid residue, and, wherein said human β-globin gene encoding at least one anti-sickling amino acid residue is selected from the group consisting of a human β-globin gene encoding a threonine to glutamine mutation at codon 87 (βT87 Q), a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 (βE22A), a human β-globin gene encoding an asparagine to lysine mutation at codon 80 (βN80K), a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 and an asparagine to lysine mutation at codon 80, and a human β-globin gene encoding a glutamic acid to alanine mutation at codon 22 and a threonine to glutamine mutation at codon 87.
9. The plasmid of claim 1, wherein said 6x stop codon sequence block comprises the nucleotide sequence of GGATAAGACAGGACCTGGATGAGCAAGGCAATAGGATAGGCAAGGCATAGGATAAGACAGGCTATGGATAAGACAGGCCAGGATGAGACAGG.
10. The plasmid of claim 1, wherein said plasmid is SRT1,.SRT2, SRT3, SRT4, SRT5, SRT8 or SRT11.
11. The plasmid of claim 1, wherein said plasmid is SRT8.
12. Isolated lentiviral particles comprising the lentiviral vector encoded in the lentiviral transfer plasmid of claim 1.
13. A pharmaceutical composition for transducing cells comprising an effective amount of the lentiviral particles of claim 12 and a pharmaceutically acceptable carrier.
14. Hematopoietic cells transduced ex vivo with the lentiviral particles of claim 12.
15. The cells of claim 14, wherein said cells are selected from the group consisting of hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, and hemogenic endothelium cells, 16. A pharmaceutical composition for treating a hemoglobinopathy comprising an effective amount of the cells of claim 14 and a pharmaceutically acceptable carrier.
17. Use of the pharmaceutical composition of claim 16 in the preparation of a medicament for treating or ameliorating hemoglobinopathy in a subject. 18. The use of claim 17, wherein the hemoglobinopathy is selected from the group consisting of hemoglobin C disease, hemoglobin sickle cell disease (SCD), sickle cell anemia, hereditary anemia, thalassemia, β-thalassemia, thalassemia major, thalassemia intermedia, α-thalassemia, and hemoglobin H disease.
19. Use of the lentiviral particles of claim 12 in preparation of a product for treating or ameliorating a hemoglobinopathy in a subject, wherein the product is formulated by transducing hematopoietic cells harvested from said subject with the lentiviral particles to produce transduced cells; and wherein said transduced cells or cells derived therefrom are formulated for administration into said subject, wherein said cells or cells derived therefrom express a globin gene,.
20. Isolated lentiviral particles comprising the lentiviral vector encoded in the lentiviral transfer plasmid of claim 11.
21. A pharmaceutical composition for transducing cells comprising an effective amount of the lentiviral particles of claim 20 and a pharmaceutically acceptable carrier.
22. Hematopoietic cells transduced ex vivo with the lentiviral particles of claim 11.
23. The cells of claim 22, wherein said cells are selected from the group consisting of hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, and hemogenic endothelium cells.
24. A pharmaceutical composition for treating a hemoglobinopathy comprising an effective amount of the cells of claim 22 and a pharmaceutically acceptable carrier.
25. Use of the pharmaceutical composition of claim 24 in the preparation of a medicament for treating or ameliorating a hemoglobinopathy in a subject.
26. The use of claim 25, wherein the hemoglobinopathy is selected from the group consisting of hemoglobin C disease, hemoglobin sickle cell disease (SCD), sickle cell anemia, hereditary anemia, thalassemia, β-thalassemia, thalassemia major, thalassemia intermedia, α-thalassemia, and hemoglobin H disease.
27. Use of the lentiviral particles of claim 11 in the preparation of a product for treating or ameliorating a hemoglobinopathy in a subject, wherein the product is formulated by transducing hematopoietic cells harvested from said subject with the lentiviral particles to produce transduced cells; and wherein said transduced cells or cells derived therefrom are formulated for administration into said subject, wherein said cells or cells derived therefrom express a globin gene,.
28. A recombinant lentiviral transfer plasmid comprising: (a) an erythroid-specific expression cassette which comprises sequences for an artificial β-globin locus control region (LCR), a central polypurine tract (cPPT), a first promoter, a heterologous gene, and a 3’ erythroid-specific enhancer, with these sequences being operably linked within the erythroid-specific cassette to enable expression of the heterologous gene in a mammal when present in a cell;(b) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, the erythroid-specific expression cassette, a 3’ LTR, and posttranscriptional regulatory elements, wherein the erythroid-specific expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette, wherein the cPPT is positioned midway between the 5’ and 3’ LTRs of the lentiviral vector expression cassette, and wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and (c) a plasmid backbone.
29. The plasmid of claim 28, wherein said heterologous gene encodes a transcription factor such as GATA1, KLF1, RUNX1, GATA2, HOXB2 or TAL1; a chromatin remodeler such as ATRX; a histone methyltransferase such as ASH1L; a chromatin assembly protein such as codanin1; a protein involved in vesicle formation such as SEC23B; a heme biosynthetic pathway enzyme such as ALAS-E, porphobilinogen deaminase, delta aminolevulinate dehydratase, ferrochelatase or CPO; or another enzyme such as PKLR, glutathione peroxidase, 15-lipoxygenase or carbonic anhydrase I.
30. The plasmid of claim 28, wherein said heterologous gene encodes an siRNA, a shRNA or other RNA that controls or regulates expression of any gene specific to an erythroid cell.
31. The plasmid of claim 28, wherein the midpoint of said cPPT sequence is positioned 10 to about 20% upstream or downstream of the midpoint of the distance between the beginning of the 5’ LTR and the end of the 3’ LTR.
32. The plasmid of claim 28, wherein said LCR is no larger than 4 kb and comprises or consists essentially of HS2, HS3 and HS4.
33. The plasmid of claim 32, wherein said LCR comprises: (a) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4; (b) an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5: (c) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(e) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or (f) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
34. The plasmid of claim 28, wherein said first promoter is a β-globin promoter.
35. The plasmid of claim 28, wherein said 6x stop codon sequence block comprises the nucleotide sequence of GGATAAGACAGGACCTGGATGAGCAAGGCAATAGGATAGGCAAGGCATAGGATAAGACAGGCTATGGATAAGACAGGCCAGGATGAGACAGG.
36. Isolated lentiviral particles comprising the lentiviral vector encoded in the lentiviral transfer plasmid of claim 28.
37. A pharmaceutical composition for transducing cells comprising an effective amount of the lentiviral particles of claim 36 and a pharmaceutically acceptable carrier.
38. Hematopoietic cells transduced ex vivo with the lentiviral particles of claim 36 or the pharmaceutical composition of claim 37.
39. The cells of claim 38, wherein said cells are selected from the group consisting of hematopoietic stem cells, embryonic stem cells, induced pluripotent stem cells, and hemogenic endothelium cells.
40. A pharmaceutical composition for treating anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells comprising an effective amount of the cells of claim 38 and a pharmaceutically acceptable carrier. 41. Use of the pharmaceutical composition of claim 40 in the preparation of a medicament for treating or ameliorating anemia, cancer, a blood clotting disorder or other disease or disorder associated with erythroid cells in a subject.
42. An artificial β-globin locus control region (LCR) comprising (a) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4; (b) an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5: (c) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4;(d) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5;(e) an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5; or (f) an HS2 region consisting of the 853 nucleotides of SEQ ID NO: 1, an HS3 region consisting of the 999 nucleotides of SEQ ID NO: 4 and an HS4 region consisting of the 539 nucleotides of SEQ ID NO: 5.
43. An expression cassette comprising the artificial β-globin LCR of claim 42 operably linked to an erythroid-specific promoter and a heterologous gene.
44. The expression cassette of claim 43, wherein said promoter is a β-globin promoter.
45. The expression cassette of claim 43, which further comprises a 3’-erythroid-specific enhancer operably linked to said heterologous gene.
46. The expression cassette claim 43, wherein said heterologous gene is a globin gene functional to ameliorate a hemoglobinopathy. 47. The expression cassette of claim 46, wherein said globin gene is selected from the group consisting of a β-globin gene, a γ-globin gene, and a δ-globin gene.
48. A recombinant lentiviral transfer plasmid comprising: (a) the expression cassette of claim 46;(b) a central polypurine tract (cPPT);(c) a lentiviral vector expression cassette which comprises a second promoter, a 5’ LTR, lentiviral vector packaging sequences, a 3’ LTR, and posttranscriptional regulatory elements, wherein the expression cassette is oriented in an antisense direction on the sense strand of the lentiviral vector expression cassette, wherein the post transcriptional regulatory elements are adjacent to and downstream of the 3’ LTR and comprise a woodchuck post-transcriptional regulatory element, a polyadenylation signal and a 6x stop codon sequence block, in that order; and (d) a plasmid backbone.
49. The plasmid of claim 48, wherein said 6x stop codon sequence block comprises the nucleotide sequence of GGATAAGACAGGACCTGGATGAGCAAGGCAATAGGATAGGCAAGGCATAGGATAAGACAGGCTATGGATAAGACAGGCCAGGATGAGACAGG.