Anti-obesity agent containing intestinal bacteria as active ingredient

Abstract

     An anti-obesity agent contains L. plantarum or a membrane vesicle (MV) thereof as an active ingredient.

Description

DESCRIPTIONTitle of Invention:ANTI-OBESITY AGENT CONTAINING INTESTINAL BACTERIA AS ACTIVE INGREDIENT Technical Field

[0001] The present invention relates to an anti-obesity agent containing intestinal bacteria as an active ingredient.Background Art

[0002] Obesity refers to a condition in which the body is abnormally obese due to excessive lipid deposition, and is one of the diseases with a large number of patients worldwide. Obesity also has a risk of promoting diabetes, hyperlipidemia, hypertension, and the like, and is a disease to be treated immediately.

[0003] Recent development of DNA analysis and establishment of intestinal microbiology have revealed that changes in the intestinal environment are closely related to maintenance of host’s homeostasis. For example, Akkermansia muciniphila (hereinafter referred to as “Am”), an intestinal bacterium using mucin as a single nutrient source, has been reported to be associated with obesity (Non Patent Literature 1). Citation ListNon Patent Literature

[0004] Non Patent Literature 1: Gut, Vol. 65, p. 426-436, 2016 Summary of InventionTechnical Problem

[0005] However, findings relating intestinal bacteria other than Am to obesity have not yet been obtained , leaving room for further research and development.

[0006] Therefore, an object of the present invention is to elucidate the mechanism of action of intestinal bacteria having an anti-obesity effect and to provide a novel anti-obesity agent based on the mechanism of action. Solution to Problem

[0007] As a result of intensive studies, the present inventors have unexpectedly discovered that Lactiplantibacillus plantarum (hereinafter referred to as “L. plantarum” or “Lp”) or a membrane vesicle thereof (hereinafter referred to as “MV”) serves as an active ingredient of an anti-obesity agent, and have elucidated the mechanism of action thereof. That is, the characteristics of the anti-obesity agent of the present invention are as follows.

[0008] [1] An anti-obesity agent including a membrane vesicle (MV) of L. plantarum as an active ingredient. [2] The anti-obesity agent according to [1], which is an adipocyte differentiation inhibitor, a lipid accumulation inhibitor, or an agent for reducing accumulated lipid. [3] A beiging inducer for an adipocyte, including L. plantarum or membrane vesicles of L. plantarum as an active ingredient. [4] The beiging inducer according to [3], which has at least one efficacy selected from lipid accumulation suppression in an adipocyte, increase in basal body temperature, and prevention and / or treatment of diabetes. [5] The beiging inducer according to [3], including L. plantarum or membrane vesicles of the L. plantarum as an active ingredient, wherein the beiging inducer is labeled as having at least one effect selected from “making a body less likely to gain weight”, “increasing basal body temperature”, and “preventing and / or treating diabetes”, or bearing an indication for use in obtaining the effect. Advantageous Effects of Invention

[0009] According to the present invention, it is possible to provide an anti-obesity agent containing L. plantarum or a membrane vesicle (MV) thereof as an active ingredient. Brief Description of Drawings

[0010] [Fig. 1] Fig. 1 is a schematic diagram of adipocyte differentiation. [Fig. 2] Fig. 2 is a schematic diagram of the action of membrane vesicles (MVs). [Fig. 3] Fig. 3 is a diagram illustrating a time schedule when an anti-obesity effect is tested. [Fig. 4A] Fig. 4(A) shows the effect of sLpMV in suppressing the differentiation of 3T3-L1 adipocytes. [Fig. 4B] Fig. 4(B) shows the effect of sLpMV in suppressing the differentiation of 3T3-L1 adipocytes. [Fig. 4C] Fig. 4(C) shows the effect of sLpMV in suppressing the differentiation of 3T3-L1 adipocytes. [Fig. 5A] Fig. 5(A) shows the effect of sLpMV in suppressing lipid accumulation in 3T3-L1 adipocytes. [Fig. 5B] Fig. 5(B) shows the effect of sLpMV in suppressing lipid accumulation in 3T3-L1 adipocytes. [Fig. 6A] Fig. 6(A) shows the effect of sLpMV in reducing lipid in enlarged 3T3-L1 adipocytes. [Fig. 6B] Fig. 6(B) shows the effect of sLpMV in reducing lipid in enlarged 3T3-L1 adipocytes. [Fig. 7A] Fig. 7(A) shows the effect of dLpMV in suppressing the differentiation of 3T3-L1 adipocytes. [Fig. 7B] Fig. 7(B) shows the effect of dLpMV in suppressing lipid accumulation in 3T3-L1 adipocytes. [Fig. 7C] Fig. 7(C) shows the effect of dLpMV in reducing lipid in enlarged 3T3-L1 adipocytes. [Fig. 8] Fig. 8 is a bar graph showing time course of each gene expression in 3T3-L1 treated with sLpMV immediately after differentiation. [Fig. 9] Fig. 9 is a bar graph showing time course of each gene expression in 3T3-L1 treated with sLpMV after lipid enlargement. [Fig. 10] Fig. 10 is a schematic diagram illustrating the mechanism of action of LpMV for a lipid accumulation suppressing effect. [Fig. 11] Fig. 11 is a schematic diagram illustrating the mechanism of action of LpMV for a lipid reducing effect. Description of Embodiments

[0011] Hereinafter, the anti-obesity agent containing intestinal bacteria of the present invention as an active ingredient will be described in detail. The description of the constituent elements described below is an example as an embodiment of the present invention, and is not limited to these contents.

[0012] The present inventors have unexpectedly discovered that L. plantarum or membrane vesicles (MV) of the L. plantarum serves as an active ingredient of an anti-obesity agent, and have further elucidated the mechanism of action thereof. When used as an anti-obesity agent, L. plantarum may be in the form of viable bacteria, in the form of dead bacteria such as heat-killed bacteria (hereinafter referred to as “HKB”), or in the form of membrane vesicles (MVs). From the viewpoint of size, L. plantarum in the form of membrane vesicles is more preferred.

[0013] In addition, the present inventors have revealed that L. plantarum or membrane vesicles thereof has, unlike other intestinal bacteria, a suppressing effect on differentiation of progenitor cells into adipocytes, a lipid accumulation suppressing effect on adipocytes, and an effect of reducing accumulated lipid in enlarged adipocytes. In addition, the present inventors have demonstrated that L. plantarum or a membrane vesicle thereof has an effect of promoting beiging of adipocytes.

[0014] (1. Anti-obesity agent) In the present application, the anti-obesity agent refers to an agent having a differentiation suppressing effect, a lipid accumulation suppressing effect, or a lipid reducing effect on adipocytes after being absorbed into the body. The anti-obesity agent of the present application contains L. plantarum or membrane vesicles (MV) thereof as an active ingredient.

[0015] The anti-obesity agent may contain a component other than L. plantarum bacteria to such an extent that the effect of the present invention is not impaired. Examples of the component other than the L. plantarum include medium components, solvents such as water, carbohydrates, proteins, lipids, vitamins, minerals, biologically essential trace metals (manganese sulfate, zinc sulfate, magnesium chloride, potassium carbonate, etc.), bacteria and probiotics other than the L. plantarum bacteria, and pharmaceutically acceptable carriers.

[0016] When the anti-obesity agent is an oral preparation, the anti-obesity agent can be in the form of a solid preparation such as a tablet, a powder, a fine granule, a granule, a capsule, a pill, or a sustained release preparation, or a liquid preparation such as a solution, a suspension, or an emulsion.

[0017] In the present invention, the anti-obesity agent may be a pharmaceutical composition. In the case of formulation of a pharmaceutical composition, an acceptable additive may be used in combination. Examples of the additive include an excipient, a stabilizer, an antiseptic, a wetting agent, an emulsifier, a lubricant, a sweetener, a coloring agent, a flavoring agent, a buffering agent, an antioxidant, and a pH adjusting agent.

[0018] The intake amount of the anti-obesity agent is not particularly limited as long as the effect of the present invention is exhibited. In addition, the intake amount can be appropriately adjusted according to the age, health condition, weight, and the like of the intake person.

[0019] For example, it is desirable to ingest 1 × 102 or more, more preferably 1 × 106 or more of the active ingredient L. plantarum per day as a lower limit. In addition, it is desirable to ingest 1 × 1015 or less, more preferably 1×1011 or less per day as an upper limit.

[0020] When the daily intake is less than the lower limit, the effect of an anti-obesity agent may be reduced. In addition, when the daily intake exceeds the upper limit, the effect of an anti-obesity agent reaches a certain level, and the intended effect per intake may not be apparent.

[0021] Ideally, the anti-obesity agent is intended to be administered continuously over a long period until obesity is resolved. To maximize the effect, the lower limit of the intake period is preferably continuous ingestion for four weeks or more, and more preferably continuous ingestion for several months to several years or more. When the intake period is shorter than the lower limit, the effect of an anti-obesity agent may be reduced.

[0022] When the anti-obesity agent is continuously ingested for a long period of time, there may be a case where the user neglects to ingest the anti-obesity agent due to unavoidable circumstances such as travel and work. In such a case, the frequency of intake may be appropriately adjusted, for example, the anti-obesity agent is ingested 1 to 3 times a week, or 2 or 3 times a day after several days apart.

[0023] The subject of the anti-obesity agent of the present invention is not particularly limited, and examples thereof include a person suffering from obesity, diabetes, hyperlipidemia, hypertension, lifestyle diseases, or the like, or a person who needs to prevent these diseases.

[0024] The anti-obesity agent has not only an effect of treating the diseases but also an effect of alleviating or ameliorating the deterioration of symptoms and an effect of preventing the diseases.

[0025] (2. L. plantarum) L. plantarum, an active ingredient of an anti-obesity agent, is a Gram-positive bifidobacterium, a type of human intestinal bacteria belonging to the genus Lactiplantibacillus, and is used in many fermented foods. Among Lactiplantibacillus plantarum as the active ingredient, Lactiplantibacillus plantarum YIT 0132 (FERM BP-11349) is particularly preferred. Lactiplantibacillus plantarum YIT 0132 (old classification: Lactobacillus plantarum YIT 0132) has been internationally deposited as Lactobacillus plantarum YIT 0132 (Accession No. FERM BP-11349) at National Institute of Technology and Evaluation, Patent Microorganisms Depositary (NITE-NPMD) (Room 122, 2-5 -8 Kazusakamatari, Kisarazu, Chiba, 292-0818 Japan) on February 24, 2010. In recent years, lactic acid bacteria belonging to the genus Lactobacillus have been reclassified. That is, lactic acid bacteria conventionally belonging to the genus Lactobacillus have been subdivided into smaller genera, and the genus names have been changed in some of the bacterial species.

[0026] (Reclassification of lactic acid bacteria) · Zheng et al., A taxonomic note on the genus Lactobacillus : Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020 Apr; 70(4):2782-2858DOI 10.1099 / ijsem.0.004107 Therefore, in the present specification, lactic acid bacteria will be indicated by the notation of the new classification after the reclassification. In addition, for example, among lactic acid bacteria classified as Lactobacillus plantarum in the old classification, lactic acid bacteria that can be newly classified as Lactiplantibacillus plantarum are included in the Lactiplantibacillus plantarum of the present application.

[0027] When used as an anti-obesity agent, L. plantarum may be in the form of viable bacteria, in the form of dead bacteria such as heat-killed bacteria (HKB), or in the form of membrane vesicles (MVs). From the viewpoint of size, L. plantarum is preferably in the form of membrane vesicles. The membrane vesicles will be described later in a separate section.

[0028] Heat-killed bacteria (HKB) are bacteria that have been rendered non‑viable by subjecting viable bacteria to heat treatment for a predetermined time. The viable bacteria and dead bacteria may be subjected to treatment such as concentration / dilution, freezing, drying, powdering, or crushing. The heat treatment is not particularly limited as long as the effect of the present invention is exhibited, and is performed under conditions usually used for sterilizing viable bacteria. The heat treatment is an example of a method for killing bacteria, and the method for killing bacteria is not limited to the heat treatment.

[0029] (3. Adipocyte) Differentiation of adipocytes will be described with reference to Fig. 1. The adipocytes include small adipocytes 103 and enlarged adipocytes 104, the enlarged adipocytes 104 being derived from small adipocytes 103 that have increased in size as a result of excessive accumulation of lipid droplets due to excessive intake of calories or lack of exercise. All the adipocytes are generated by differentiation of progenitor cells 102 derived from mesodermal stem cells 101.

[0030] When the adipose tissue volume increases due to an increase in the number and size of adipocytes, symptoms of obesity appear. In addition, the enlarged adipocytes 104 produce bad adipocytokines to cause insulin resistance in the body, and as a result, diabetes, hyperlipidemia, hypertension, and the like are promoted.

[0031] Therefore, when a substance suppresses the process of differentiation of the progenitor cells 102 into the small adipocytes 103, the substance can be regarded as an active ingredient of an anti-obesity agent that acts as an adipocyte differentiation inhibitor.

[0032] When a substance suppresses the process in which the small adipocytes 103 excessively accumulate lipid droplets to form the enlarged adipocytes 104, the substance can be regarded as an active ingredient of an anti-obesity agent that acts as a lipid accumulation inhibitor.

[0033] Furthermore, when a specific substance has an effect of reducing lipid droplets already accumulated in the enlarged adipocytes 104, the substance can be regarded as an active ingredient of an anti-obesity agent that acts as a reducing agent for accumulated lipid.

[0034] (3.1 Beiging) Mammals including humans roughly include two types of adipocytes: white adipocytes that play a role of accumulating and releasing lipid as an energy source, and brown adipocytes that play a role of decomposing lipid to generate energy.

[0035] In recent years, it has been reported that the expression of certain genes induces the beiging (browning) of white adipocytes, thereby promoting the breakdown of lipids and suppressing lipid accumulation in a manner similar to brown adipocytes, but many aspects remain unclear regarding the factors that induce the expression of such genes.

[0036] As a result of intensive studies, the present inventors have elucidated the mechanism of action in which L. plantarum or membrane vesicles (MV) of the L. plantarum become one of the factors and promote beiging.

[0037] In addition, the promotion of the beiging of white adipocytes provides effects such as suppression of lipid accumulation in adipocytes, increase in basal body temperature, and prevention and / or treatment of obesity and diabetes.

[0038] Therefore, in the case of carrying out the present invention, it is possible to display functions and effects such as “making the body less likely to gain weight”, “increasing basal body temperature”, and “preventing and / or treating obesity / diabetes” on a product.

[0039] (4. Membrane vesicle) The membrane vesicles (MVs) will be described with reference to Fig. 2. MV202 is a vesicle produced by live intestinal bacteria 201. The average particle size of MV is generally around 100 nm.

[0040] The MV202 may be artificially produced as long as it exhibits the effect of MV disclosed in the present invention. In the present application, MV isolated from a culture supernatant of L. plantarum is defined as sLpMV, and MV artificially produced from L. plantarum using a reagent such as deoxycholic acid (DOC) is defined as dLpMV.

[0041] When made from intestinal bacteria 201, MV202 is formed from the membrane of intestinal bacteria 201. Since the intestinal bacteria 201 generally have a size of about 1 μm, the intestinal bacteria themselves do not pass through the intercellular space of the intestinal epithelium 203. Instead, MV202 or a membrane component thereof passes through the intercellular space, thereby acting on the progenitor cells 102 of adipocytes (present in a distant place), the small adipocytes 103, the enlarged adipocytes 104, and the like via the blood vessels 204 and the like. The intestinal bacteria 201 also function in intestinal homeostasis, such as acting on T cells 206 and the like via a dendritic cell 205.

[0042] When used as an anti-obesity agent or a beiging inducer, L. plantarum may be in the form of viable cells, dead bacteria such as heat-killed bacteria (HKB), or membrane vesicles (MVs). As a method for producing an anti-obesity agent, an anti-obesity agent or a beiging inducer can be produced by first passing through step a of culturing L. plantarum and then obtaining bacterial cells from the culture solution cultured in step a (step b1), or centrifuging the culture solution cultured in step a and filtering the supernatant to obtain an MV (step b2).

[0043] Instead of step b2, an anti-obesity agent may be produced by centrifuging the culture solution, removing the supernatant, treating the resulting mixture with a deoxycholic acid (DOC) solution, filtering the supernatant again after centrifugation to obtain an MV (step b3). The MV produced through step b2 is sLpMV, and the MV produced through step b3 is dLpMV.Examples

[0044] (Examples) The present invention will be specifically described based on the following examples, but the present invention is not limited to these examples.

[0045] (Example 1) <Intestinal bacteria> As L. plantarum, L. plantarum YIT 0132 (FERM BP-11349) (hereinafter, referred to as “Lp0132”) was used. Lp0132 that had been cryopreserved was used, passaged at 37°C with an MRS medium, and subjected to static culture (hereinafter, referred to as a cell culture solution of Lp0132).

[0046] (Example 2) <Cell> A cryopreserved mouse fibroblast cell line 3T3-L1 (hereinafter, referred to as “3T3-L1”) was used. Note that 3T3-L1 is widely used as a cell model system of lipid metabolism because 3T3-L1 has a characteristic of accumulating lipid droplets in cells by being induced to differentiate into adipocytes.

[0047] 3T3-L1 was subcultured at 37°C in an environment of 5% CO2 using a DMEM medium (10% FBS / DMEM) containing 10% FBS and 100 μg / mL streptomycin.

[0048] (Example 3) <Isolation of MV (sLpMV)> The cell culture solution of Lp0132 was centrifuged (8,000 × g, 20 min, 4°C) to remove bacterial cells, and a culture supernatant was recovered.

[0049] The recovered culture supernatant was passed through a PES syringe filter (Millipore) having a pore size of 0.45 μm, and then the culture supernatant containing MVs was concentrated to about 1 mL by ultrafiltration (Millipore) with a molecular weight cutoff of 100 kDa. OptiPrep (60% iodixanol, Sigma-Aldrich) was used to prepare a density gradient.

[0050] An OptiPrep solution was diluted with MQ water, 2 mL each of 25% to 40% iodixanol solution was layered at 5% intervals, and 1 mL of the concentrated solution of the supernatant was layered on the uppermost layer. Ultracentrifugation (P40ST rotor, 200,000 × g, 3 h, 4°C) was carried out to recover 1 mL of the supernatant containing the band of interest with a pipette, thereby obtaining MV (sLpMV) solution of Lp0132 isolated from the culture supernatant.

[0051] (Example 4) <Production of heat-killed bacteria> The bacterial cells removed from the cell culture solution of Lp0132 by centrifugation were suspended in MQ water and then centrifuged (10,000 × g, 10 min, 4°C) to wash the bacterial cells. This operation was repeated 3 times, and then a tube containing bacterial cells suspended in MQ water was placed and heated in boiled hot water at 100°C for 10 minutes. The heated bacterial cells were freeze-dried to obtain a powder, thereby producing heat-killed bacteria (LpHKB).

[0052] (Example 5) <Production of MV (dLpMV) with deoxycholic acid (DOC)> The cell culture solution of Lp0132 was adjusted to pH 7.0 at 8 hours after the start of culture, and the cell culture solution for 48 hours was centrifuged (8,000 × g, 20 min, 4°C) to remove the culture supernatant. The recovered bacterial cells were washed with PBS and suspended in First Buffer {0.1 M Tris-HCl, 0.01 M EDTA (pH8.9) solution}.

[0053] After the precipitation of bacteria completely disappeared, Second Buffer (10% DOC solution) was added, and the mixture was stirred at room temperature for 30 minutes using a stirrer. The solution after the DOC treatment was centrifuged (12,000 × g, 30 min, 4°C) to recover the supernatant. The recovered supernatant was passed through a PES syringe filter (Millipore) having a pore size of 0.45 μm, and concentrated to about 1 mL by ultrafiltration (Millipore) with a molecular weight cutoff of 100 kDa.

[0054] OptiPrep (60% iodixanol, Sigma-Aldrich) was used to prepare a density gradient. An OptiPrep solution was diluted with MQ water, 1 mL each of 10% to 40% iodixanol solution was layered at 5% intervals, and 1 mL of the concentrated solution of the supernatant was layered on the uppermost layer. Ultracentrifugation (P40ST rotor, 200,000 × g, 3h, 4°C) was performed, and 1mL containing the band of interest was collected with a pipette to obtain a DOC-prepared MV (dLpMV) solution of Lp0132.

[0055] MV proteins were quantified by a predetermined method using Pierce(TM) BCA Protein Assay Kit (Thermo), and the amount of MV was converted into the amount of protein.

[0056] (Example 6) <Anti-obesity effect of sLpMV> Fig. 3 illustrates a time schedule of Example 6. The horizontal axis represents the course from the start of culture, and each schematic diagram on the horizontal axis represents the course of change in 3T3-L1 during culture. A predetermined amount of each of a differentiation inducing agent, Insulin, and MV was appropriately added to 3T3-L1, and after the start of culture, lipid droplets on day 3, day 10 (point A), day 24 (point B), and day 34 (point C) were stained with Oil red O and observed. Details are as follows.

[0057] (Example 6.1) <Differentiation suppressing effect> To examine whether sLpMV had a differentiation suppressing effect on adipocytes, sLpMV was added to 3T3-L1 at 5 μg / mL or 10 μg / mL simultaneously with differentiation inducing agents dexamethasone, 3-isobutyl-1-methylxanthine, and insulin, and the 3T3-L1 was cultured for 2 days.

[0058] Furthermore, the medium was further replaced with insulin-containing 10% FBS / DMEM supplemented with sLpMV and cultured for 2 days, followed by replacement with normal insulin-containing 10% FBS / DMEM medium (without MV or HKB), and on day 3, the cells were subjected to analysis of the amount of intracellular lipid droplets and the expression level of adipocyte-related genes.

[0059] (Example 6.1.1) <Measurement of amount of intracellular lipid droplet using Oil red O> The culture supernatant of 3T3-L1 cultured in a 24 well plate was removed, the cells were washed once with PBS, and fixed with 10% neutral buffered formalin at 4°C overnight. Thereafter, the cells were washed with MQ water three times, a lipid assay kit Oil Red O stain (Cosmo Bio) was added thereto, and the cells were stained at room temperature for 1 hour.

[0060] After staining, washing with MQ water was repeated several times until the color of the Oil red O stain disappeared from the washing solution. After washing, the cells were dried at 37°C, and cell staining images were photographed with a microscope. The extract of the lipid assay kit (Cosmo Bio) was added to the stained 3T3-L1 and left for 30 minutes to extract Oil red O. After extraction, the absorbance (505 nm) of the extract was measured with a plate reader to quantify the amount of intracellular lipid droplets of 3T3-L1. When the amount of intracellular lipid droplet is measured with Oil red O in other Examples, the measurement is performed in the same manner as in Example 6.1.1.

[0061] (Example 6.1.2) <Gene expression analysis by real-time PCR> 3T3-L1 cultured in a 24 well plate by the above-described culture method was collected, and total RNA was purified by a predetermined method using illustra RNAspin kit (Cytiva). The purified RNA was reverse transcribed by GoScript (TM) Reverse Transcriptase (Promega), and real-time PCR was performed using GoTaq(R) qPCR Master Mix (Promega) and QuantStudio (TM) 12K Flex Real-Time PCR System (Applied Biosystems) according to the attached operating procedures.

[0062] Primers used were designed from known mRNA base sequences using Primer Express Software Version 3.0 (Applied Biosystems) (see Table 1). Gene expression analysis by real-time PCR in other Examples was also performed in the same manner as in Example 6.1.2, and all the used primers are described in Table 1.

[0063] [Table 1] Forward primerReverse primerPpar-gGGGCGATCTTGACAGGAAAGCCCATCATTAAGGAATTCATGTCATAdiponectinATGGCAGAGATGGCACTCCTCCTTCAGCTCCTGTCATTCCAAtglAACACCAGCATCCAGTTCAAGGTTCAGTAGGCCATTCCTCHslCCTACTGCTGGGCTGTCAACCATCTGGCACCCTCACTUcp-1CCCTGCCATTTACTGTCAGCTCGGTCCTTCCTTGGTGTACPgc-1αCATTTGATGCACTGACAGATGGAGTCAGGCATGGAGGAAGGACCgi-58GGCAGCATTGACTCCCTTTAACTTAACCCAAAAGGTCCTGCAA 

[0064] The characteristics of genes related to the primers shown in Table 1 are briefly described as follows. PPAR-γ (peroxisome proliferator-activated receptor gamma) is a master regulator of adipocyte differentiation. Adiponectin is secreted from differentiated adipocytes. Adipose triglyceride lipase (ATGL) activates the degradation of lipid droplets. Hormone-sensitive lipase (HSL) activates the degradation of lipid droplets. Uncoupling protein 1 (UCP-1) promotes heat generation in mitochondria. Peroxisome proliferator-activated receptor-γ co-activator-1α (PGC-1α) acts on the enhancement of mitochondrial biosynthesis and the increase in expression of UCP-1. Comparative gene identification-58 (CGI-58) functions as a cofactor of ATGL.

[0065] Figs. 4(A) to 4(C) show the effect of sLpMV in suppressing differentiation on 3T3-L1 progenitor cells. Fig. 4(A) shows a stained image of 3T3-L1 by Oil red O (corresponding to point A in Fig. 3) cultured for 7 days after induction of differentiation for 2 days with addition of sLpMV at each concentration. From left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. As compared with the control, in the cells to which sLpMV is added, staining by Oil red O is weak, and it can be confirmed that the cells have an action of suppressing differentiation in a concentration-dependent manner.

[0066] Fig. 4(B) is a bar graph in which Oil red O is extracted from the stained cells shown in Fig. 4 (A), and the amount of lipid droplets is quantified by absorbance. The horizontal axis represents from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. The vertical axis represents the amount of intracellular lipid droplet (%Control).

[0067] The p values represent *:p < 0.05, **:p < 0.01, ***:p < 0.001, respectively. The description of the p value is similar in each of the following graphs.

[0068] From Fig. 4(B), it was confirmed that the quantified amount of intracellular lipid droplets was significantly lower in the cells treated with sLpMV.

[0069] Fig. 4 (C left) shows the expression level of PPAR-γ mRNA. The horizontal axis represents from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. The vertical axis represents the expression level of PPAR-γ mRNA. The mRNA expression level of PPAR-γ in each cell is normalized to β-actin as an internal control gene.

[0070] Here, PPAR-γ is a protein belonging to the nuclear receptor superfamily and is a master regulator expressed when differentiated into adipocytes. By measuring the expression level of PPAR-γ mRNA, the degree of differentiation of 3T3-L1 can be confirmed.

[0071] From Fig. 4 (C left), it was confirmed that the addition of sLpMV decreased the expression level, and sLpMV suppressed differentiation into adipocytes.

[0072] Fig. 4 (C right) shows the expression level of adiponectin mRNA. The horizontal axis represents from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. The vertical axis represents the expression level of adiponectin mRNA. The mRNA level of adiponectin in each cell is normalized to β-actin as an internal control gene.

[0073] Here, adiponectin is a kind of adipocytokine, and is a physiologically active protein secreted from differentiated adipocytes. By measuring the expression level of adiponectin mRNA, the degree of differentiation of 3T3-L1 can be confirmed.

[0074] Also from Fig. 4 (C right), it was confirmed that the expression level was reduced by addition of sLpMV, and sLpMV suppressed differentiation into adipocytes.

[0075] (Example 6.2) <Lipid accumulation suppressing effect> Next, for 21 days immediately after differentiation, adipocytes were continuously treated with sLpMV, and the influence of sLpMV on the process of turning into enlarged adipocytes was examined. Figs. 5(A) to 5(B) are diagrams showing the effect of sLpMV in suppressing lipid accumulation on 3T3-L1 adipocytes.

[0076] Fig. 5(A) is a stained image by Oil red O (corresponding to point B in Fig. 3) of cells cultured by continuously treating sLpMV for 21 days after induction of differentiation and untreated cells. From left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. As compared with the control, it can be confirmed that in the cells to which sLpMV is added, staining by Oil red O is weak, and the cells have an action of suppressing lipid accumulation in a concentration-dependent manner.

[0077] Fig. 5(B) is a bar graph in which Oil red O is extracted from the stained cells shown in Fig. 5(A), and the amount of lipid droplets is quantified by absorbance. The horizontal axis represents from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. The vertical axis represents the amount of intracellular lipid droplet (%Control).

[0078] From Fig. 5(B), it was confirmed that the adipocytes continuously treated with sLpMV had a significantly smaller intracellular lipid droplet amount of 30 to 40% than that of the untreated control, and lipid accumulation was suppressed.

[0079] (Example 6.3) <Effect of reducing lipid on enlarged adipocytes> Next, the cells were cultured for 21 days after differentiation into adipocytes, and the effect of sLpMV on enlarged adipocytes was examined. After enlargement, the cells were further cultured in a medium with or without sLpMV for 10 days, and the amount of lipid droplets contained in the enlarged adipocytes was measured. Fig. 6 (A) to 6 (B) shows the effect of sLpMV in reducing lipids on enlarged adipocytes in 3T3-L1 adipocytes.

[0080] Fig. 6(A) shows a stained image by Oil red O (corresponding to point C in Fig. 3) when the cells were cultured for 21 days after induction of differentiation and enlarged cells were treated with sLpMV for 10 days. From left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. Compared with the control, enlarged adipocytes treated with sLpMV exhibited weaker red staining by Oil Red O, confirming that sLpMV possesses a lipid reducing effect.

[0081] Fig. 6(B) is a bar graph in which Oil red O is extracted from the stained cells shown in Fig. 6(A), and the amount of lipid droplets is quantified by absorbance. The horizontal axis represents from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV. The vertical axis represents the amount of intracellular lipid droplet (%Control).

[0082] From Figure 6(B), the enlarged adipocytes treated with sLpMV exhibited a reduction of approximately 10 to 20% in lipid content, confirming the lipid reducing effect of sLpMV on accumulated lipids in the enlarged adipocytes.

[0083] (Example 7) <Anti-obesity effect of dLpMV> The study on the anti-obesity effect shown in Example 6 used MV (sLpMV) prepared from the culture supernatant of Lp0132 in Example 3. Therefore, even in the case of using artificially produced dLpMV in Example 4, it was examined in comparison with sLpMV whether or not the dLpMV exhibits similar anti-obesity effects on 3T3-L1.

[0084] In Example 7, the anti-obesity effect was examined by the same operation as in Example 6, except that sLpMV was replaced with dLpMV (produced in Example 5) or LpHKB (produced in Example 4).

[0085] Fig. 7(A) to 7(C) show the differentiation suppressing effect (Fig. 7(A)), the lipid accumulation suppressing effect (Fig. 7(B)) of dLpMV on 3T3-L1 adipocytes, and the lipid reducing effect (Fig. 7(C)) on enlarged adipocytes. Here, Fig. 7(A) corresponds to the test result of Fig. 4(B), Fig. 7(B) corresponds to the test result of Fig. 5(B), and Fig. 7(C) corresponds to the test result of Fig. 6(B).

[0086] In Fig. 7(A) to 7(C), the horizontal axis represents, from left to right, the untreated control, dLpMV5μg / mL, dLpMV10μg / mL and LpHKB10μg / mL. The vertical axis represents the amount of intracellular lipid droplet (%Control).

[0087] From Fig. 7(A) to 7(C), similarly to sLpMV, a differentiation suppressing effect on adipocytes (Fig. 7(A)), a lipid accumulation suppressing effect (Fig. 7(B)), and a lipid reducing effect on enlarged adipocytes (Fig. 7(C)) were also observed in dLpMV, and it was revealed that the extent of the effects was similar.

[0088] In addition, although LpHKB also exhibited a differentiation suppressing effect on adipocytes and lipid accumulation suppressing effect, LpMV was found to exert stronger effects. Since HKB is much larger in size than MV, it is suggested to be due to the difference in contact surface area with adipocytes.

[0089] (Example 8) <Investigation of mechanism of anti-obesity effect by LpMV> From the results so far, it was confirmed that LpMV has an anti-obesity effect. Therefore, in Example 8, using sLpMV, a study was made on the mechanism of action by which the lipid accumulation suppressing effect of LpMV and the lipid reducing effect on enlarged adipocytes are exerted.

[0090] First, in order to examine the mechanism of accumulation suppression, each cell was collected on days 7, 14, and 21 of treatment with sLpMV, and the expression levels of mRNA of PPAR-γ and adiponectin in adipocytes and mRNA of lipid metabolism-related genes ATGL, HSL, CGI-58, UCP-1, and PGC-1α in adipocytes were examined.

[0091] Fig. 8 is a bar graph showing the time course of each gene in 3T3-L1 treated with sLpMV immediately after differentiation. Each graph shows the mRNA expression changes of adipocyte-related genes PPAR-γ, adiponectin, and lipid metabolism-related genes ATGL, HSL, CGI-58, UCP-1, and PGC-1α in order from the upper left to the lower right. The horizontal axis represents time (day 7, day 14, day 21), and the vertical axis represents the mRNA expression level of each gene. The mRNA level of each gene is normalized by the mRNA expression level of β-actin as an internal control gene. The bar graphs for each group also show, from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV.

[0092] From Fig. 8, it could be confirmed that the expression levels of mRNA of PPAR-γ and adiponectin hardly varied, whereas the expression of mRNA ofATGL and CGI-58 increased on day 21 in the cells treated with sLpMV. In addition, the mRNA expression levels of UCP-1 and PGC-1α increased from day 7 of sLpMV treatment compared with the control, suggesting activation of lipid metabolic pathways in adipocytes.

[0093] Next, in order to examine the mechanism of the lipid decreasing action of sLpMV on the enlarged adipocytes, the adipocytes were enlarged by culture for 21 days after differentiation, and then each enlarged adipocyte treated with sLpMV for 5 and 10 days was collected, and the expression level of mRNA of PPAR-γ, adiponectin gene, and lipid metabolism-related genes ATGL, HSL, CGI-58, UCP-1, and PGC-1α in the cell was examined.

[0094] Fig. 9 is a bar graph showing time course of each gene in 3T3-L1 treated with sLpMV after lipid enlargement. Each graph shows the mRNA expression changes of adipocyte-related gene PPAR-γ, adiponectin gene, and lipid metabolism-related genes ATGL, HSL, CGI-58, UCP-1, and PGC-1α in order from the upper left to the lower right. The horizontal axis represents time (day 5, day 10), and the vertical axis represents the mRNA expression level of each gene. The mRNA level of each gene is normalized by the mRNA expression level of β-actin as an internal control gene. The bar graphs for each group also show, from left to right, untreated control, 5 μg / mL of sLpMV and 10 μg / mL of sLpMV.

[0095] From Fig. 9, a tendency to increase the expression of the adiponectin gene and the mRNA of PPAR-γ on day 5 after treatment was observed, and a significant increase in the expression of the mRNA of PPAR-γ on day 10 was observed. In addition, while a significant increase was observed in the mRNA of lipid metabolism-related genes ATGL, HSL, and CGI-58, an increase in the mRNA of UCP-1 and PGC-1α was not observed in the adipocytes after being enlarged, and it was suggested that the lipid accumulation suppressing effect on adipocytes and the lipid reducing effect on enlarged adipocytes are actions exhibited by different mechanisms.

[0096] < Mechanism underlying lipid accumulation suppression by LpMV> Summarizing the results of suppression of lipid accumulation in Example 8, there was almost no change in the expression levels of mRNA of PPAR-γ and adiponectin in cells when sLpMV was treated (Fig. 8).

[0097] The mRNA expression of ATGL and CGI-58, which are genes for degrading lipid droplets, was increased on day 21 in the cells treated with sLpMV, whereas the mRNA expression level of UCP-1 and PGC-1α was greatly increased in the early stage on day 7 after sLpMV treatment (Fig. 8).

[0098] Here, PGC-1α is a molecule identified as a transcriptional coactivator that binds to PPAR-γ, but PGC-1α alone controls the expression of many genes involved in energy production and heat consumption.

[0099] It is known that when PGC-1α is introduced into white adipocytes, enhancement of mitochondrial biogenesis, increase in expression of UCP-1, and the like occur regardless of PPAR-γ gene, and the white adipocytes become beige adipocytes which actively burn lipid.

[0100] That is, in the adipocytes treated with sLpMV, the mRNA of PPAR-γ did not change, but the expression of the mRNA of UCP-1 and PGC-1α was high, and the accumulation of lipid was suppressed even in the culture with high glucose, suggesting that sLpMV has an action of promoting the change of adipocytes to beige adipocyte-like phenotype through the expression induction of PGC-1α and UCP-1 genes.

[0101] Note that the inventors have confirmed that MVs of Alistipes indistinctus (hereinafter referred to as “AiMV”), an intestinal bacterium different from L. plantarum, exhibit a lipid accumulation suppressing effect similar to that of L. plantarum. However, the lipid accumulation suppressing effect of AiMV suggested that degradation of lipids occurs through increased expression of the PPAR‑γ gene, accompanied by elevated expression of UCP‑1 and of ATGL and HSL genes for degrading lipid droplets.

[0102] That is, it was revealed that LpMV has an action mechanism of suppressing lipid accumulation different from that of AiMV. Fig. 10 is a diagram schematically showing the mechanism of action of LpMV on the lipid accumulation suppressing effect.

[0103] <Mechanism underlying lipid reducing effect of LpMV> Next, summarizing the results of the lipid reducing effect of Example 8, when the cells were treated with sLpMV after induction into enlarged adipocytes, no change was observed in the mRNA levels of UCP-1 and PGC-1α, while the mRNA level of PPAR-γ increased, accompanied by increases in the mRNA levels of ATGL, HSL, and CGI-58.

[0104] That is, it was revealed that lipids in enlarged adipocytes were reduced by promoting degradation of the lipids as in the case of AiMV.

[0105] From the above, it became clear that the action of LpMV on adipocytes is different from the action on enlarged adipocytes. Fig. 11 is a diagram schematically showing the mechanism of action on the lipid decreasing action of LpMV described above.

[0106] From the above results, it was revealed that membrane vesicles (MV) of L. plantarum are an active ingredient as an anti-obesity agent. In addition, the membrane vesicles (MV) of L. plantarum are effective as adipocyte differentiation inhibitors, adipocyte accumulation inhibitors, or agents for decreasing accumulated lipids, and the mechanism of action thereof (for example, a mechanism of action that promotes beiging of adipocytes) has been newly discovered. In addition, it was confirmed that L. plantarum sufficiently acts as an anti-obesity agent even when added not only as a membrane vesicle but also as a bacterial cell such as HKB. Reference Signs List

[0107] 101 stem cell102 progenitor cell103 small adipocyte104 enlarged adipocyte201 intestinal bacteria202 membrane vesicle (MV)CLAIMS[claim 1] An anti-obesity agent comprising a membrane vesicle (MV) of L. plantarum as an active ingredient.[claim 2] The anti-obesity agent according to claim 1, which is an adipocyte differentiation inhibitor, a lipid accumulation inhibitor, or an agent for reducing accumulated lipid.[claim 3] A beiging inducer for an adipocyte, comprising L. plantarum or a membrane vesicle of L. plantarum as an active ingredient.[claim 4] The beiging inducer according to claim 3, which has at least one efficacy selected from lipid accumulation suppression in an adipocyte, increase in basal body temperature, and prevention and / or treatment of diabetes.[claim 5] The beiging inducer according to claim 3, comprising L. plantarum or a membrane vesicle of L. plantarum as an active ingredient, wherein the beiging inducer is labeled as having at least one effect selected from “making a body less likely to gain weight”, “increasing basal body temperature”, and “preventing and / or treating diabetes”, or bearing an indication for use in obtaining the effect.ABSTRACT An anti-obesity agent contains L. plantarum or a membrane vesicle (MV) thereof as an active ingredient. 

Claims

1. An anti-obesity agent comprising a membrane vesicle (MV) of L. plantarum as an active ingredient. 

2. The anti-obesity agent according to claim 1, which is an adipocyte differentiation inhibitor, a lipid accumulation inhibitor, or an agent for reducing accumulated lipid. 

3. A beiging inducer for an adipocyte, comprising L. plantarum or a membrane vesicle of L. plantarum as an active ingredient. 

4. The beiging inducer according to claim 3, which has at least one efficacy selected from lipid accumulation suppression in an adipocyte, increase in basal body temperature, and prevention and / or treatment of diabetes. 

5. The beiging inducer according to claim 3, comprising L. plantarum or a membrane vesicle of L. plantarum as an active ingredient, wherein the beiging inducer is labeled as having at least one effect selected from “making a body less likely to gain weight”, “increasing basal body temperature”, and “preventing and / or treating diabetes”, or bearing an indication for use in obtaining the effect. 

Images