Title - ISOLATED PLANT CELL, INCAPABLE OF GENERATING A COMPLETE INDIVIDUAL, COMPRISING A POLYPEPTIDE OF CHROMOBACTERIUM SUBTSUGAE

Abstract

Nucleotide sequences of the genes of Chromobacterium subtsugae. Amino acid sequences of proteins encoded by the genes of C. subtsugae. Nucleic acids, vectors, and polypeptides comprising the aforementioned sequences. Homologs, functional fragments, and conservative variants of the aforementioned sequences. Compositions having pesticidal, bioremediation, and plant growth-promoting activities comprising genes and proteins of C. subtsugae, and methods for the use of these compositions.

Description

Nucleotide sequences of Chromobacterlum subtsugae genes. Amino acid sequences of proteins encoded by the genes of C. subtsugae. Nucleic acids, vectors and polypeptides comprising the aforementioned sequences. Homologs, functional fragments and conservative variants of the aforementioned sequences. Compositions having pesticidal, bioremedial, and plant growth promoting activities comprising genes and proteins from C. subtsugae, and methods for using these compositions. In case of being M? Ρ-106.804 jatoria indicate the No. of Record INP1 PAIR / NATION exp. 20150102827 Procedure: 15154417 PATEN Date / Time: 09 / 04 / 2015 9:39:16.43 Agent: MESSERER, GERARDO EN Amount: $2570.311000 $2,070 500 NATIONAL INSTITUTE OF INDUSTRIAL PROPERTY NATIONAL ADMINISTRATION OF PATENTS REQUEST FOR PATENT OF INVENTION ✓ REQUEST FOR UTILITY MODEL ARGENTINE REPUBLIC sheet of 1 1. APPLICANT(S) NUMBER OF APPLICANTS MARRONE BIO INNOVATIONS, INC. C.U.I.T. / C.U.I.L. / C.D.I. : Consign Name and Surname or Company Name (of one of them the rest in ANNEX) D.N.I. Individuals: Marital Status: Marriage Name and surname of the spouse: DNI 1540 DREWAVENUE Real Address: Caite: N°: Piso v Doto. City: DAVIS Zip Code N° 95618 Country of Residence: US Av. DEL LIBERTADOR 5954 PISO 7 CIUDAD AUTÓNOMA DE BUENOS AIRES C1428 ARP Legal Address - Street - N° - City - Province Zip Code E-mall address: ma¡l@moellerip .com Telephone: 4788-7777 II. OBJECT Title of the invention GENES DE CHROMOBACTERIUM SUBTSUGAE Nature of the Patent / lunrnrururMTr INDEPENDENT Utility Model Additional to: Patent Application Divisional N° Application N° PRIORITY (LAW 17.011) DEPOSIT OF MICROORGANISMS COUNTRY NUMBER DATE DEPOSIT DATE US 62046672 09-05-2014 ACCESS N° TO THE DEPOSIT Name of the Institution Depository Address of the Institution Country Arlminif't fNPI CC «-Uswíi i*us / »vt»cyT ntrol -AQM SIÓN Data of the Depositor INTIfy ACIÓN íy^Ni ) □ YES Origin of Biological and Genetic Material Continue on attached sheet: III. s SOCIE DECU OCIEDADES REPRESENTED BY ' GERARDO MESSERER AND / OR MOELLER & CO. S.A. WHO WHO IS UNDER OATH INVESTING THE CHARACTER OF ATTORNEY MANDATE IS IN FORCE AND THE COMPANY IS REGISTERED IN • K. 4 Registration Data in R.P.C. / I.G.J. ' * Date: Number N° Folio Volume: IV. MANDATE Power registered in the I.N.P.I. under the number: 71,295 and 25,000 THIS ACT IS AUTHORIZED TO: (Surname and Name and ID Number: For all those mere formalities such as making breakdowns, withdrawing testimonies, certificates, titles, copies and notifications in the file. Answer hearings, desist application, make requests (only when the Authorized is an Industrial Property Agent) ACCOMPANYING POWER OF AGENCY 734 V. PRIOR DISCLOSURE STATEMENT For the purposes of what is indicated in Art. 5 of Law 24,481, states that the present invention has been disclosed previously: IN0 I (YES / NO) If yes, on date: || VI.COMPANYING ORIGINAL TEXT IN ENGLISH LISTING OF SEQUENCES ON CD-ROM PRIORITY CERTIFICATE ON CD-ROM It is recorded that the The data provided in this form are in the nature of a sworn statement, and any falsity inserted in it will lead to the corresponding legal consequences.NOTE: The payment of the corresponding fee must be specified at the time of filing or during the first two business hours of the following business day. If the payment does not occur within said period, by full right the presentation will be deemed not made, which will not produce any effect. p.p. MOELLER & Co. S.A. p GABRIELA HANAK MATR. 1274 Signature of the authorized person(s) Signature of the applicant or his agent or legal representative · INTERNAL USE ’ '5* THE PRESENTATION CONSISTS OF | | CHANGE OF ADDRESS / EMAIL / TELEPHONE SHEETS: DATE - - Real Address-Calle , S. -i N° City: | Zip Code N° Country of Residence: · -v* - Legal Address - Street - N° - City - Province · * Postal Code E-mail address: Telephone: CHANGE OF REPRESENTATIVE / AUTHORIZED: DATE New Representative or Authorized: TRANSFER 0 CHANGE ITEM: J Ρ-106.804 / SBH DESCRIPTIVE MEMORY OF THE INVENTION PATENT for a term of TWENTY YEARS on CHROMOBACTERIUM SUBTSUGAE GENES applied for by: MARRONE BIO INNOVATIONS, INC. DAVIS USA. DESCRIPTIVE MEMORY Sequence listing addition This application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. This ASCII copy is named MBI-203-0005PCT_seq_ST25.txt and is 13,798 bytes in size. Countryside The present disclosure is within the field of biopesticides; in particular bacterial pesticides, their genes, gene products, and methods of using them. Background Chromobacterium subtsugae In 2000, a violet-pigmented bacterium (PRAA4-1) was isolated from forest soil in Maryland (Martin et al., 2004). In initial screenings, this bacterium was found to be toxic to the Colorado potato beetle and other insect pests (Martin et al., 2007a). Further work with the isolate revealed activity against mites, worms, various beetle species, aphids, and plant parasitic nematodes, among other plant pests (Martin et al., 2007b, US Patent Application Publication No. 2012 / 0100236 Al). Some studies of the PRAA4-1 protein exist in the art regarding proteins active against insects. Proteases and insect control Proteases have the ability to target potential proteins and insect tissues and destroy them. Plants have naturally evolved to express proteases to protect themselves against insects. Insect predators also produce protease in their venom, which contributes to mortality. Proteases have been identified as important insecticidal agents for the control of insects in agriculture. Proteases with insecticidal activity fall into three general categories: cysteine ​​proteases, metalloproteases, and serine proteases. Proteases in these classes target the midgut, cuticle, and hemocoel. The peritrophic matrix of the small intestine is an ideal target for insect control because it lines and protects the epithelium of the midgut from food particles, digestive enzymes, and pathogens; in addition to acting as a biochemical barrier (Hegedus et al., 2009). Enhancins are baculovirus-expressed zinc metalloproteases that facilitate nucleopolyhedrovirus infections in lepidopterans (Lepore et al., 1996). These proteases promote infection of lepidopteran larvae by digestion of the invertebrate gut protein mucin from the peritrophic matrix, which in turn promotes infection of the midgut epithelium (Wang and Granados, 1997). Homologs of enhancin genes found in baculoviruses have been identified in the genomes of Yersinia pestis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus (Galloway et al., 2005; Hajaij-Ellouze et al., 2006). Plant cysteine ​​proteases also demonstrate activity against lepidopteran larvae. Cysteine ​​proteases in the latex of papaya and wild fig trees are essential in the defense against different lepidopteran larvae. Larval toxicity was lost when the latex was washed or when the leaves were treated with a cysteine ​​protease inhibitor, indicating that the defense may be due to the elevated concentration of cysteine ​​proteases in the latex (Konno et al., 2004). Cuticle directed proteases are also important in insect control. The cuticle covers the entire exterior of the insect as well as some invaginations of the internal structures. The cuticle is composed of a waxy epicuticle, an exocuticle, and an endocuticle consisting of proteins, lipids, and chitin (Harrison and Bonning 2010). Fungal infection of insects by Metarhizium anisopliae and Beauveria bassiana occurs when fungal spores germinate on the cuticle, forming structures for cuticle penetration by a variety of enzymes, including proteases (Freimoser and col., 2003; Cho et al., 2006). A notable serine protease produced by M. anisopliae, PR1A, digests the cuticle and plays an essential role in penetration (St. Leger et al. 1987). A clone of M. anisopliae was engineered to contain additional copies of the prla gene and showed 25% more tobacco hornworm killing than wild-type (St Leger et al., 1996). A B. basianna was also engineered to express the M. anisopliae protease PR1A and demonstrated increased toxicity to larvae of the Masson pine caterpillar, Dendrolimus punctatus, and the wax moth, Galleria mellonella (Lu et al., 2008). . The basement membrane of insects consists of proteins that surround the tissue and contribute to a variety of functions from structural support to barriers against viruses. Three potential basement membrane degrading proteins were evaluated using Autographa cali fornica multiple nucleopolyhedrovirus (AcMNPVj). This baculovirus was engineered to express two vertebrate metalloproteases, rat stromelysin and human gelatinase A, as well as housefly cathepsin L. fruit, ScathL The protease ScathL demonstrated the best baculovirus activity The median survival time of infected tobacco budworm larvae was reduced by 50% compared to wild-type infected larvae (Harrison and Bonning, 2001).These data support the idea that Virus-expressed proteases have the ability to access the basement membrane of insects, which generally functions as a barrier against viruses. A previous report identified two basement membrane proteins from fruit fly larval imaginal discs that are susceptible to hydrolysis by cathepsin L (Homma and Natori, 1996). Purified ScathL protease was also toxic to a variety of insect pests when injected into the hemocoel. The purified protease demonstrated similar melanization, mortality, and hemolymph activity in lepidopteran larvae as seen in ScathL-expressing baculovirus infections (Li et al., 2008). Basement membrane damage is caused by purified ScathL protease in vivo and in vitro (Tang et al., 2007; Philip et al. 2007). Arthropod predators have also been shown to contain proteases that cleave the basement membrane in their venom. An example is the parasitic wasp, Eulophus pennicornis, in which 3 metalloproteinases (EpMPl-3) were identified in the venom glands. Recombinant EpMP3 was injected into the hemocoel of Lacanobia oleracea larvae and resulted in significant mortality, or impaired growth and development in surviving larvae (Price et al., 2009). Social aphid soldier nymphs produce a toxic protease cathepsin B (cysterna protease) in their intestines. The protease is I excreted orally to enemies and demonstrates insecticidal activity (Kutsukake et al., 2008). It has been shown that a protease isolated from the bacterium, Xenorhabdus nematophilia, suppresses the antibacterial peptides involved in the immune response, making the insect susceptible to the pathogenic process (Caldas et al., 2002). The Enterobacteriaceae, Photorhabdus luminscense, has been shown to be pathogenic for a broad spectrum of insects. The genome sequence of this bacterium identified genes related to toxicity, including proteases (Duchaud et al., 2003). The use of proteases as insecticides has been of interest for plant modifications as well. Basement membrane degrading proteases have been characterized and designed for transgenic insecticide protocols, with the goal of developing transgenic plants that are resistant to insect pests (US Patent No. 6,673,340, Harrison and Bonning, 2004) . Proteases in the insect gut have been shown to affect the impact of Cry insecticidal proteins from Bacillus thuringiensis. Some proteases activate Cry proteins by processing them from a protoxin to a toxic form. Insect toxins have been modified to contain proteolytic activation sites with the aim of incorporating this modification into transformed plants, plant cells and seeds. Cleavage of these sites by insect gut protease produces an insect toxin active in the gut of the pest (US Patent No. 7,473,821, Abad et al., 2009). Insecticidal activity of chitinases Chitinases facilitate insecticidal activity by piercing the insect midgut lining and by degrading the insect cuticle. The degradation of these membranes exposes insects to pathogens, other insecticidal compounds, and / or plant defenses. Chitinases hydrolyze the structural polysaccharide chitin, a linear homopolymer of 2-acetamido-2-deoxy-D-glucopyranoside, linked by β-1~>4 linkages, which is a component of the exoskeleton and lining of the insect intestine. Chitinases are classified as family 18 or family 19 glycosyl hydrolases. Family 18 chitinases are widely distributed, found in bacteria, plants, and animals; while family 19 chitinases are found mainly in plants (Henrissat and Bairoch, 1993). In insects, chitinases play a role in molting (Samuels and Reynolds, 1993, Merzendorfer and Zimoch, 2003). Chitinases alone show some insecticidal activity. Chitinase from Serretia marcenscens was found to be toxic to seventh instar larvae of Galleria mellonella (Lysenk, 1976). Transgenic plants expressing insect chitinases have been shown to have increased resistance against insect pests. Tobacco plants were transformed with cDNA encoding a Manduca sexta chitinase. The leaves of these transgenic plants were infested with Heliothis virescens larvae. After 3 weeks chitinase-positive leaves were found to have less larval biomass and feeding damage than chitinase-negative leaves. It is possible that the activity of chitinases makes insects more susceptible to plant defenses (Ding, et al., 1997). Insect cuticles provide a physical barrier to protect the insect from pathogens or other environmental damage, and are composed primarily of chitin (Kramer, et al., 1995). The entomopathogenic fungi Metarhizium anisopliae, Beauvaria bassiana, Beauvaria amorpha, Verticillium lecanii, and Aspergillus flavus secrete chitinases to break the cuticle and enter the insect host (St Leger, et al., 1986, 1992, Campos, et al. 2005). According to Kim, et al., supernatants containing chitinase from Beauveria bassiana were toxic to adult Aphis gossypii. However, when these supernatants were treated with excess chitin to inhibit fungal chitinase activity, this mortality was reduced. significantly, suggesting that chitinase plays an integral role in breaking the cuticle and facilitating infection (Kim, et al. 2010). Chitinases have also been isolated from the venom of the endoparasitic wasp Chelonus sp., where they possibly assist the venom in penetrating the defenses of the chitin-protected victim (Krishnan, et al., 1994). The peritrophic membrane, which lines the insect's midgut, is another barrier composed primarily of chitin that protects insects from pathogens. Any enzyme that can perforate this membrane has potential as a bioinsecticide (Wang and Granados, 2001). Hubner, et al. demonstrated that malaria parasites excrete chitinases to penetrate the peritrophic membrane in mosquitoes (Hubner, et al., 1991), and Shahabuddin, et al. confirmed that allosamidine inhibition of chitinase is sufficient to prevent the malaria parasite Plasmodium gallinaceum from crossing the peritrophic membrane of Anopheles freeborni. Furthermore, the addition of exogenous chitinase from Streptomyces griseus during the development of the midgut of Anopheles freeborni prevented the formation of the peritrophic membrane (Shahabuddin, et al., 1993). This demonstrates that chitinases can rupture the peritrophic membrane. Regev, et al. used E. coli to express ChiA endochitinase from Serratia marcescens and confirmed by electron microscopy that Spodoptera littoralis larvae exposed to endochitinase exhibited perforations in the peritrophic membrane (Regev, et al., nineteen ninety six). Due to the ability of chitinase to perforate the peritrophic membrane, endochitinases have also been shown to increase the insecticidal activity of Bacillus thuringiensis (Bt). Choristoneura fumiferana larvae reared on Agies balsamea treated with a mixture of a diluted commercial formulation of Bt and chitinase died more rapidly than larvae reared on foliage treated with Bt alone (Smirnoff, 1973). A low-concentration mixture of Bt and S. marcenscens chitinase also produced higher mortality of Spodoptera littoralis larvae than Bt alone (Sheh et al., 1983). This synergistic effect is believed to be due to perforation of the peritrophic lining of the insect gut by chitinase, facilitating the penetration of Bt spores into the insect. (Smirnoff, 1973). Yen-Tc, an ABC-type protein that is necessary and sufficient for the entomopathogenicity of Yersinia entomophaga in the insect Costlytra zealandica, contains two family 18 chitinases, making them the first identified insecticidal toxin complex incorporating chitinases. It is hypothesized that chitinases are responsible for the rupture of the peritrophic membrane and for exposing the epithelial cells of the midgut to the toxin. However, chitinases may be active only in regions of the midgut with a relatively neutral pH (Busby, 2012). Chitinases are also integral to the activity of some insect viruses. Hatwin, et al. created mutants of Autographa cali fornica nucleopolyhedrovirus (AcMNPV) that lack the chitinase gene. Usually, this virus causes the liquefaction of the host's larvae, facilitating the spread of the virus. This liquefaction did not occur when Trichoplusia ni larvae were infected with chitinase-negative virus. It was also confirmed that AcMNPV chitinase is active under alkaline conditions in the insect midgut (Hatwin, et al. 1997). A recombinant version of the same Autographa cali fornica nucleopolyhedrovirus expressing a Haemaphysalis longicornis chitinase was found to have bioacaricidal activity against Haemaphysalis longicornis nymphs (Assegna, et al. 2006). Khs-like genes that code for insecticidal toxins The rhs (major rearrangement point) gene family was first identified in E. coli. These genes confer chromosomal rearrangements by exchange homologue (Lin et al., 1984). They are between 2 and 12 kb in size and exhibit a long core with a short end. Core sequences are GC-rich and highly conserved, but end sequences are GC-poor and highly variable. They code for proteins that have a large core domain and a short C-terminal domain. The core domain of the protein is hydrophilic and contains YD repeats (Jackson et al., 2009). Rhs proteins have the ability to interact with bacterial cell surfaces and to bind with specific ligands (Wang et al., 1998). Although the function of the Rhs proteins remains unknown (Hill et al., 1994), the structure is important because the YD repeats and highly conserved sequences resemble the rhs and rhs-like genes that code for insecticidal toxins produced by Rhs. bacteria. Photorhabdus luminescens is a mutualistic symbiont of nematodes of the Heterorhabditae family. The nematode infects the insect and injects the bacteria into the insect's hemocoel. The bacteria then secrete toxins that kill the insect (Frost et al., 1997). Bowen et al. (1998), purified a high molecular weight protein associated with oral and injectable insecticidal toxicity targeting insects. In another study, Bowen et al. (1998) used high performance liquid chromatography to separate this protein into four toxin (te) complexes designated Tea, Tcb, Tcc and Tcd encoded by the te loci (Bowen et al., 1998). Waterfield et al. (2001) analyzed the recombinant expression of te genes in E. coli to understand the oral toxicity of Te proteins. They found that without the tccC-like homologues, they could not recover oral toxicity in E. coli. These authors concluded that TccC is involved in the activation of toxin secretion. Additionally, amino acid sequence analysis revealed that TccC and TccC-like proteins have a highly conserved core and highly variable extension. This structure bears a resemblance to rhs-like elements (Waterfield NR, Bowen DJ, Fetherston JD, Perry RD and ffrench-Constant, RH, 2001). This similarity suggests that TccC and Rhs-like proteins share an ancient role in toxin mobility and activation for the family Enterobacteriaceae (ffrench-Constant, R et al, 2003). Another microbe, Serratia entomophila, has insecticidal activity directed against the New Zealand turfgrass larvae, Costlytra zealandica, causing amber disease (Grimont et al., 1988). The virulence of S. entomophila is linked to a large plasmid called the amber disease-associated plasmid (pADAP) (Glare et al., 1993). Hurst et al. analyzed the mutagenesis and nucleotide sequence of pADAP to understand how it confers pathogenicity to turfgrass larvae. They found that pADAP codes for three genes responsible for the symptoms of amber disease, sepA, sepB and sepC. All three genes are required for pathogenicity because a mutation in these genes abolishes amber disease. They illustrated that the proteins encoded by the sep genes are similar to the proteins encoded by the insecticidal toxin complexes of P. luminescens. For example, the first 680 amino acids of SepC and TccC show great similarity. Additionally, this region resembles the rhs elements of E. coli. The sepC gene is smaller than the Rhs elements, but encodes a hydrophilic core protein with nine Rhs peptide variants. Based on the similarity between the sep and tc genes, Hurst et al. conclude that these products are part of a new group of insecticidal toxins (Hurst et al., 2000). Harada et al. found that Pantoea stewartii ssp. DC283 is an aggressive pathogen that infects aphids (Harada et al., 1996). The bacteria are ingested by the aphid and DC283 has the ability to aggregate in the gut and kill the aphid. Stavrinides et al. performed a mutagenesis screen and found that the ucpl (you cannot pass) locus is responsible for the virulence of DC283. Sequence analysis of the ucpl gene revealed similarities to the Rhs protein family. The ucpl gene is more I is smaller than the genes encoding the RHS / YD proteins and does not have a ligand-binding YD repeat, but has conserved 5' cores, non-homologous 3' ends, and is a membrane-bound protein. These structural similarities suggest that enteric plant colonizers have the genetic ability to colonize insect hosts. Additionally, the similarities between the ucpl and rhs genes suggest that rhs-like genes have potential insecticidal activity (Stavrinides et al., 2010). Despite these known proteins, it is possible that insects could develop resistance to plants that express these known genes. Consequently, there is a need to find novel proteins having insecticidal activities. Synthesis In one aspect, the present disclosure provides the nucleotide sequence of insecticidal proteins from the bacterium Chromobacterium subtsugae. Isolation and partial characterization of this bacterium is described, for example, in US Patent No. 7,244,607. Also provided are amino acid sequences of polypeptides encoded by the insecticidal proteins of Chromobacterium subtsugae. In another aspect, the present disclosure provides isolated nucleic acids (eg, DNA, RNA, acid analogs). nucleic acid) comprising C. subtsugae insecticidal protein sequences, gene sequences, fragments and / or mutated variants thereof. Nucleic acid vectors (eg, plasmid vectors, viral vectors), including expression vectors, comprising nucleic acids having C. subtsugae gene sequences, and / or fragments thereof, are also provided. Examples of bacterial vectors include, but are not limited to, Agrobacterium turnefaciens, Rhizobium sp. NGR234, Sinorhizobium meliloti, and Mesorhizobium loti. Examples of viral vectors include, but are not limited to cauliflower mosaic virus (CaMV), pea early browning virus (PEBV), broad bean pod spot virus (BPMV), cucumber mosaic virus (CMV) , apple latent spherical virus (ALSV), tobacco mosaic virus (TMV), potato virus X, bromine mosaic virus (BMV), and barley streak mosaic virus (BSMV). Cells transected with the above nucleic acids or vectors are also provided. Such cells may be plant cells, insect cells, mammalian cells, bacterial cells, or fungal (eg yeast) cells. Also provided are plants comprising cells (plant or otherwise) that have been transfected with the above nucleic acids or vectors, seeds of said plants, and the progeny of said plants. Transected bacterial cells can include Agrobacteria (eg, Agrobacterium tumefaciens), Rhizobium, Sinorhizobium meliloti, and Mesorhizobium loti. Insect vectors (eg, Homalodisca vitripennis, the glassy-winged manakin) are also provided which comprise nucleic acid vectors which in turn comprise sequences from C. subtsugae. In additional embodiments, polypeptides encoded by the genes of C. subtsugae are provided. Functional fragments of C. subtsugae polypeptides, and conservatively substituted variants of C. subtsugae polypeptides, are also provided. In other embodiments, plants comprising one or more isolated nucleic acids comprising C. subtsugae gene sequences and / or fragments thereof are provided. These isolated nucleic acids may be present externally to the plant or internally within or between cells. In further embodiments, plants comprising one or more nucleic acid vectors are provided, wherein said vector(s) comprise C. subtsugae gene sequences and / or fragments thereof. Such vectors may be present outside the plant, or internally. In yet other embodiments, plants comprising one or more C. subtsugae polypeptides are provided. Said C. subtsugae polypeptides may be present externally to the plant or internally. Plants comprising one or more functional fragments and / or one or more conservatively substituted variants of a C. subtsugae polypeptide(s) are also provided. Said conservatively substituted fragments and / or variants may be present externally to the plant or internally. The progeny of the aforementioned plants are also provided. In addition, seeds of the aforementioned plants, and their progeny, are provided. Also disclosed herein are methods of controlling pests; for example, methods for modulating pest infestation in a plant. Said pests can be, for example, insects, fungi, nematodes, mites, moths or aphids. The methods include applying a nucleic acid comprising a C. subtsugae gene sequence or a fragment thereof to a plant, either internally or externally. Additional methods include applying a C. subtsugae polypeptide, or fragment thereof, or conservatively substituted variant thereof, to a plant, either internally or externally. Pesticidal (eg, insecticidal) compositions comprising nucleic acids and / or polypeptides encoded by the genes of C. subtsugae are also provided. Such compositions may optionally include other insecticides or pesticides, whether naturally occurring or man-made. Disclosed herein, inter alia, are the following embodiments: 1. A cell comprising a recombinant vector having a heterologous promoter operably linked to a nucleotide encoding a polypeptide with 95% identity to SEQ ID NOs: 1-3. 2. A plant or plant parts comprising one or more cells according to embodiment 1 or progeny or seed thereof. 3. The plant or plant parts of embodiment 2, wherein said plant part is selected from the group consisting of pollen tissue, ovule, flower, bud, root, stem, fiber, tassel, ear, and leaf . 5. An antibody that binds to the polypeptide of embodiment 1. 6. The cell of embodiment 1, wherein said cell is a bacterial, mammalian, or fungal cell. 7. A method for producing an insect resistant plant comprising the step of transforming the recombinant vector of embodiment 1 into a plant cell. 8. Anti-counterfeit ground seed having, as an indication of origin, a plant cell of embodiment 1. 9. A pesticidal composition comprising (a) one or more nucleic acids and / or polypeptides having a sequence as set forth in SEQ ID NOS: 1-6 and (b) a carrier. 10. The pesticidal composition of embodiment 9, wherein the composition is an insecticide. 11. The pesticidal composition of embodiment 10, further comprising a second pesticide. 12. The pesticidal composition of embodiment 11, wherein the second pesticide is an insecticide. 13. A method for modulating pest infestation in a plant, wherein the method comprises contacting a plant or plant part with an amount of the pesticidal composition according to embodiment 9 effective to modulate said pest infestation . 14. The method of embodiment 13, wherein the pest is selected from the group consisting of insects, fungi, nematodes, bacteria, and mites. 15. The method of embodiment 14, wherein the insects comprise cabbage bollworm, beet moth caterpillar, Lygus, or diamondback moth. 16. A seed coating material comprising the polypeptide of embodiment 1, and one or more than one carrier, diluent, or adjuvant. DETAILED DESCRIPTION Unless otherwise indicated, conventional methods and procedures in the fields of agriculture, plant molecular biology, entomology, cell biology, molecular biology, biochemistry, and science are employed in the practice of this disclosure. DNA recombination, among other related fields, which are known to those skilled in the art. These procedures are described in the literature and are available. See, eg, Alberts, B., et al., Molecular Biology of the Cell, 5th Edition, Garland Science, New York, NY, 2008; Voet, D., et al., Fundamentals of Biochemistry: Life at the Molecular Level, 3rd edition, John Wiley & Sons, Hoboken, NJ, 2008; Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, 2001; Ausubel, F., et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987, and periodic updates thereto; Glover, DNA Cloning: A Practical Approach, Volumes I and II, IRL Press (1985), Volume III, IRL Press (1987); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons (1984); the Genetic Engineering series, edited by Rigby (Academic Press); the Genetic Engineering: Principles and Methods series, edited by Setlow and Hollaender, Plenum Press; Oligonucleotide Synthesis: A Practical Approach, edited by Gait, IRL Press (1984, 1985); Oligonucleotides and Analogues: A Practical Approach, edited by Eckstein, IRL Press (1991); Hames and Higgins, Nucleic Acid Hybridization: A Practical Approach, IRL Press (1985); Hames and Higgins, Transcription and Translation: A Practical Approach, IRL Press (1984); Biochemistry and Molecular Biology of Plants, edited by B. Buchanan, W. Gruissem, and R. Jones, Wiley (2002), and Methods in Enzymology series, Academic Press, San Diego, CA. The descriptions of all cited references are incorporated by reference in their entirety, for the purpose of describing the methods and compositions in the relevant fields. When ranges of values ​​are provided, it must be understood that within the scope of the invention all intermediate values ​​must be included, up to the tenth of the unit of the lower limit, unless the context clearly shows otherwise, between the upper limit and lower of each range, as well as any other value indicated or intermediate in the mentioned range. The smaller ranges are also included. The upper and lower limits of these smaller ranges must also be included, subject to the specific exclusion of any of them. Unless otherwise indicated, all technical and scientific terms used herein have the same meanings ordinarily given to them by those skilled in the art to which the present invention pertains. Although methods and materials similar or equivalent to those described herein may be used in practice or testing of the present invention, preferred methods and materials will now be described. It should be noted that, as used herein and in the appended claims, the singular determinatives one and -the encompass plural references. unless the context arises clearly the opposite. As used herein, the term "construct" refers to any recombinant polynucleotide molecule such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular single-stranded or double-stranded RNA or DNA polynucleotide molecule. , derived from any source, capable of genomic integration or autonomous replication, comprising a polynucleotide molecule in which one or more polynucleotide molecules have been linked in a functionally operative manner, that is, operatively linked. As used herein, the term "operably linked" refers to a first molecule bound to a second molecule, wherein the molecules are arranged such that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent. For example, a promoter is operably linked to a transcribable polynucleotide molecule if the promoter modulates transcription of the transcribable polynucleotide molecule of interest in a cell. Constructs can include any promoter or leader known in the art. For example, a promoter may be operably linked to a heterologous 5' untranslated leader such as one derived from a heat shock protein gene (see, eg, US Patent No. 5,659,122 and US Patent No. 5,362,865). Alternatively, a leader may be operably linked to a heterologous promoter such as the cauliflower mosaic virus 35S transcript promoter (see Table 1). US Patent No. 5,352,605). As used herein, the term "transcribable polynucleotide molecule" refers to any ί DNA molecule capable of being transcribed into an RNA molecule, including, but not limited to, those that have sequences that code for proteins (SEQ ID NOs: 4-6) and those that have sequences useful for the suppression of genes. A transgene refers to a transcribable polynucleotide molecule heterologous with a host cell and / or a transcribable polynucleotide molecule artificially incorporated into the genome of a host cell. A promoter may be operably linked to a transcribable polynucleotide molecule that is heterologous to a promoter molecule. As used herein, the term "heterologous" refers to the combination of two or more polynucleotide molecules when such a combination is not normally found in nature. For example, the two molecules may be derived from different species and / or the two molecules may be derived from different genes, eg different genes from the same species or the same genes from different species. Thus a promoter is heterologous to an operably linked transcribable polynucleotide molecule if such a combination is not normally found in nature, that is, that transcribable polynucleotide molecule is not naturally operably linked in combination with that promoter molecule. The transcribable polynucleotide molecule can generally be any DNA molecule from which expression of an RNA transcript is desired. Such expression of an RNA transcript may result in translation of the resulting mRNA molecule and thus protein expression. Alternatively, a transcribable polynucleotide molecule can be designed to ultimately generate decreased expression of a specific gene or protein that can enhance expression of proteins of SEQ ID NOs: 1-3. This can be achieved with the use of a transcribable polynucleotide molecule that is oriented in the antisense direction. A person of ordinary skill in the art is familiar with the use of such antisense technology. Briefly, as the transcribable antisense polynucleotide molecule is transcribed, the RNA product hybridizes to and sequesters a complementary RNA molecule within the cell. This duplex RNA molecule cannot be translated into a protein by the cell's translational machinery and is degraded in the cell. Any gene can be downregulated in this way. Polynucleotides and oligonucleotides A polynucleotide is a polymer of nucleotides, and the term is intended to encompass smaller polynucleotides (fragments) generated from polynucleotides. bigger. The terms polynucleotide and nucleic acid encompass RNA and DNA, as well as single-stranded and double-stranded polynucleotides and nucleic acids. Polynucleotides also include modified polynucleotides and nucleic acids, which contain such modifications of the base, sugar or phosphate groups as are known in the art. An oligonucleotide is a short nucleic acid, usually DNA and usually single-stranded. Generally, an oligonucleotide will be shorter than 200 nucleotides, more particularly shorter than 100 nucleotides, more particularly 50 nucleotides or shorter. Modified bases and base analogs, eg, those capable of forming Hoogsteen and reverse Hoogsteen base pairs with naturally occurring bases, are known in the art. Examples include, but are not limited to, 8-oxo-adenosine, pseudoisocytidine, 5-methyl cytidine, inosine, 2-aminopurine, and various pyrrolo and pyrazolopyrimidine derivatives. Similarly, modified sugar residues or analogs, for example 2'-O-methylribose or peptide nucleic acid backbones, can also form a component of a modified base or base analog. See, for example, Sun and Helene (1993) Curr. opinion Struct. Biol. 3:345-356. Non-nucleotide macromolecules capable of any type of sequence-specific interaction with a polynucleotide are useful in the methods and compositions disclosed herein. Examples include, but are not limited to, peptide nucleic acids, minor groove binding agents, and antibiotics. Novel modified bases, base analogs, modified sugars, sugar analogs, modified phosphates, and phosphate analogs that are capable of participating in duplex or triplex formation are available in the art and are useful in the methods and compositions disclosed. at the moment. Homology and identity of nucleic acids and polypeptides Homology or identity or similarity as used herein in the context of nucleic acids and polypeptides refer to the relationship between two polypeptides or two nucleic acid molecules based on the alignment of amino acid sequences or nucleic acid sequences, respectively. . Homology and identity can be determined in each case by comparing a position in each sequence that aligns for comparison purposes. For example, a reference sequence can be compared to a test sequence. When a position in the reference sequence is occupied by the same base or amino acid at an equivalent position in the test sequence, then the molecules are identical at that position; when the equivalent position is occupied by a similar amino acid residue (eg, sterically and / or electronically similar), then the molecules may be referred to as homologous (similar) at that position. The relationship between the two sequences, when expressed as a percentage of homology / similarity or identity, is a function of the number of identical or similar amino acids at positions shared by the sequences being compared. When two sequences are compared, the absence of residues (amino acids or nucleic acids) or the presence of extra residues, in one sequence compared to the other, also decreases identity and homology / similarity. As used herein, the term "identity" refers to the percentage of identical nucleotide or amino acid residues at corresponding positions in two or more sequences, when the sequences are aligned to maximize sequence matching, that is, taking into account mismatches and inserts. Identity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Human Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods for determining identity are designed to give the highest degree of agreement between the sequences tested. Furthermore, the methods for determining identity are encoded in publicly available computer programs. Computer software methods for determining identity between two sequences include, but are not limited to, the GCG software package (Devereux et al. (1984) Nucleic Acids Research 12:387), BLASTP, BLASTN, and FASTA (Altschul et al. (1990) J. Molec. Biol. 215:403-410; Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The BLAST X program is publicly available from NCBI and other sources. See, eg, BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul et al. (1990) J. Mol. Biol. 215:403-410. The well known SmithWaterman algorithm can also be used to determine identity. For sequence comparison, typically an r i sequence acts as a reference sequence, against which one or more test sequences are compared. In general, sequences align for maximum correspondence in a designated region, eg, a region of at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more amino acids or nucleotides from length, and the region may be as long as the full length of the reference amino acid sequence or the reference nucleotide sequence. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer program, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on designated program parameters. Examples of algorithms that are suitable for determining percent sequence identity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215:403-410 and Altschul et al. (1977) Nucleic Acids Res. 25:3389-3402, respectively. The program for performing BLAST analyzes is publicly available through the National Center for Biotechnology Information at www.ncbi.nlm.nih.gov. Others examples of algorithms include ClustalW (Higgins et al. (1994) Nuciere Acids Res. 22:4673-4680), available at www.ebi.ac.uk / Tools / clustalconindex.html. In one embodiment, the sequence identity between two nucleic acids can also be described in terms of the alignment, annealing, or hybridization of two polynucleotides to each other, mediated by base pairing. Hybridization between polynucleotides proceeds according to known base pairing properties recognized in the art, such as adenine base pairing with •thymine or uracil, and guanine base pairing with cytosine. The property of a nucleotide that allows it to form base pairs with a second nucleotide is called complementarity. Therefore, adenine is complementary to both thymine and uracil, and vice versa; Similarly, guanine is complementary to cytosine and vice versa. An oligonucleotide or polynucleotide that is complementary along its full length to a target sequence is said to be perfectly complementary, perfectly matching, or completely complementary to the target sequence, and vice versa. Two polynucleotides can have related sequences, where most of the bases in the two sequences are complementary, but one or more bases are non-complementary, or mismatched. In that case, the sequences themselves are sequences that can be called substantially complementary to each other. If two polynucleotides are such that they are complementary at all but one nucleotide position, the sequences have a single nucleotide mismatch with respect to each other. The term "substantially identical" refers to identity between a first amino acid sequence that contains a sufficient or minimal number of amino acid residues that are i) identical to, or ii) conservative substitutions of, aligned amino acid residues in a second amino acid sequence of such that the first and second amino acid sequences share a common structural domain and / or common functional activity. For example, amino acid sequences that contain a common structural domain with at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99, 5% identity to an amino acid sequence as disclosed herein (ie, SEQ ID NOs: 1-3) are referred to as substantially identical. In the context of nucleotide sequence, the term "substantially identical" is used herein to mean a first nucleic acid sequence that contains a sufficient or minimal number of nucleotides that are identical to the aligned nucleotides in a second nucleic acid sequence, such that the first and second nucleotide sequences code for a polypeptide having a common structural or functional activity, or code for a common structural polypeptide domain or a common functional polypeptide activity. In one embodiment, the term "homology" describes a mathematically based comparison of sequence similarities that is used to identify genes or proteins with similar functions or motifs. A reference nucleotide or amino acid sequence (eg, a sequence as disclosed herein) is used as an interrogation sequence to perform a search against public databases, for example, to identify other members of the family, related sequences or homologues. Such searches can be carried out using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to a reference nucleotide sequence. BLAST amino acid searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to a reference amino acid sequence. To get alignments with mismatches for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. When using the BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and BLAST) can be used (see online at: ncbi.nlm.nih.gov). Nucleic acids and polynucleotides of the present disclosure encompass those having a nucleotide sequence that is at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, for at least 99%, at least 99.5%, or 100% identical to any of SEQ ID NOs:4-6. Nucleotide analogs and amino acid analogs are known in the art. Accordingly, nucleic acids (ie SEQ ID NOs:4-6) comprising nucleotide analogs and polypeptides (ie SEQ ID NOs:1-3) comprising amino acid analogs are also encompassed by the present disclosure. Transcribable polynucleotide molecules may be genes of agronomic interest. As used herein, the term "gene of agronomic interest" refers to a transcribable polynucleotide molecule that when expressed in a particular plant tissue, cell, or cell type provides a desirable characteristic. associated with plant morphology, physiology, growth, development, yield, product, nutritional profile, disease or insect / pest resistance, and / or environmental or chemical tolerance. Genes of agronomic interest include, but are not limited to, insect control genes encoded by SEQ ID NOs: 4-6 or their associated proteins SEQ ID NOs: 1-3, which encode for a yield protein , a stress resistance protein, a developmental control protein, a tissue differentiation protein, a meristem protein, an environmental response protein, a senescence protein, a hormone response protein, an abscission protein , a source protein, a sink protein, a flowering control protein, a seed protein, a herbicide resistance protein, a disease resistance protein, a fatty acid biosynthetic enzyme, tocopherol biosynthetic enzyme, an enzyme amino acid biosynthetic protein, a pesticidal protein, or any other agent such as an antisense or RNAi molecule against a particular gene for suppression to increase p expressions rothetics of SEQ ID NOs: 1-3. The product of a gene of agronomic interest may act within the plant with the aim of causing an effect on plant physiology or metabolism, or it may act as a pesticidal agent in the diet of a pest that feeds on the plant. As used herein, "control plant" refers to a plant that does not contain the recombinant DNA that expresses a protein that imparts an improved trait. A control plant is to identify and select a plant that has an improved trait. An appropriate control plant may be a non-transgenic plant from the parental line that is used to generate a transgenic plant, eg, devoid of recombinant DNA. A suitable control plant in some cases may be a progeny of a hemizygous transgenic plant line that does not contain the recombinant RNA, known as a negative segregant. As used herein, an improved trait refers to a characteristic of a transgenic plant including, but not limited to, an improved agronomic trait characterized by increased insect resistance, improved plant morphology, physiology, growth and development. , yield, nutritional improvement, disease or pest resistance, or environmental or chemical tolerance. In more specific aspects of this invention, the improved trait is selected from the group of improved traits consisting of better water use efficiency, better cold tolerance, increased yield, higher nitrogen use efficiency, better seed protein and better seed oil. In one aspect of the invention the improved feature is increased performance including increased performance under non-stress conditions and increased performance under environmental stress conditions. Stress conditions may include, for example, drought, drought, fungal disease, viral disease, bacterial disease, insect infestation, nematode infestation, cold temperature exposure, heat exposure, osmotic stress, reduced nitrogen nutrient availability, reduced availability of phosphorous nutrients and high plant density. Yield can be affected by many properties including, but not limited to, plant weight, number of pods, position of pod on plant, number of internodes, incidence of pod breakage, grain size, nodulation efficiency and nitrogen fixation, nutrient assimilation efficiency, biotic and abiotic stress resistance, carbon assimilation, plant architecture, environmental resistance, seed germination percentage, seedling vigor, and juvenile traits. Yield may also be affected by germination efficiency (including germination under stress conditions), growth rate (including growth rate under stress conditions), number of ears, number of ears per plant, seed size, composition of seed (starch, oil, protein) and seed filler characteristics. The highest yield of a plant can be measured in a number of ways, including test weight, number of seeds per plant, weight of seed, number of seeds per unit area (for example, seeds, or weight of seeds, per acre), bushels per acre, metric ton per acre, tons per acre, kilos per hectare. For example, corn yield can be measured as the production of husked corn kernels per unit of production area in bushels per acre or metric tons per hectare, often reported on a moisture adjusted basis of approximately 15.5 percent moisture. humidity. Increased yield can result from better utilization of key biochemical compounds such as nitrogen, phosphorus, and carbohydrate, or from better responses to environmental stresses, such as cold, heat, drought, salt, and attack by pests or pathogens. Conservative substitutions and functional fragments In amino acid sequence comparison, residue positions that are not identical may differ by conservative amino acid substitutions. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, one group of amino acids that have aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; one group of amino acids having hydroxylaliphatic side chains is serine and threonine; one group of amino acids having amide-containing side chains is asparagine and glutamine; one group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; one group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine ​​and methionine. With respect to the reference polypeptide sequence, a test polypeptide sequence that differs only by conservative substitutions is designated a conservatively substituted variant of the reference sequence. A functional fragment of a protein, polypeptide, or nucleic acid is a protein, polypeptide, or nucleic acid whose sequence is not identical to the full-length protein, polypeptide, or nucleic acid, but still retains the same function as the protein, polypeptide, or nucleic acid. full length nucleic. A functional fragment may possess more, fewer, or the same number of residues as the corresponding native molecule, and / or may contain one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (eg, coding function, ability to hybridize with another nucleic acid) are known in the art. Similarly, methods for determining protein function are known. For example, the DNA-binding function of a polypeptide can be determined, for example, by DNA-binding assays. filter, electrophoretic mobility delay, or immunoprecipitation. See Ausubel et al., supra. The ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, two-hybrid assays, or complementation, either genetic or biochemical. See, for example, Fields et al. (1989) Nature 340:245-246; patent of US No. 5,585,245 and PCT WO 98 / 44350. Typically, a functional fragment retains at least 50% of the activity or function of the polypeptide. In some embodiments, a functional fragment retains at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85 %, at least 90%, at least 95%, at least 99% or 100% of the activity or function of the polypeptide. A functional fragment of a polypeptide may include conservative amino acid substitutions (with respect to the native polypeptide sequence) that do not substantially alter the activity or function of the polypeptide. The term "conservative amino acid substitution" refers to the grouping of amino acids based on certain common structures and / or properties. Regarding the structures Common amino acids can be grouped into those with nonpolar side chains (glycine, alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan), those with uncharged polar side chains (serine, threonine, asparagine, glutamine, tyrosine and cysteine) and those with charged polar side chains (lysine, arginine, aspartic acid, glutamic acid, and histidine). A group of amino acids that contain aromatic side chains includes phenylalanine, tryptophan, and tyrosine. Heterocyclic side chains are present in proline, tryptophan, and histidine. Within the group of amino acids containing non-polar side chains, those with short hydrocarbon side chains (glycine, alanine, valine, leucine, isoleucine) can be distinguished from those with longer non-hydrocarbon side chains (methionine, proline, phenylalanine, tryptophan). . Within the group of amino acids with charged polar side chains, acidic amino acids (aspartic acid, glutamic acid) can be distinguished from those with basic side chains (lysine, arginine, and histidine). A functional method for defining common properties of individual amino acids is the analysis of normalized frequencies of amino acid changes between corresponding proteins from homologous organisms (Schulz, G. E., and R. H. Schirmer, Principles of Protein Structure, Springer Verlag, 1979). According to such analyses, groups of amino acids can be defined in which the amino acids within a group are preferentially substituted for one another in homologous proteins, and thus have a similar impact on the overall structure of the protein (Schulz, G. E. and R. H. Schirmer, supra). According to this type of analysis, conservative amino acid substitution refers to a substitution of one amino acid residue for another that shares chemical and physical properties of the amino acid side chain (eg, charge, size, hydrophobicity / hydrophilicity). The following are examples of amino acid residues that share certain chemical and / or physical properties: (i) amino acids containing a charged group, consisting of Glu, Asp, Lys, Arg, and His, (ii) amino acids containing a positively charged group, consisting of Lys, Arg, and His, (iii) amino acids containing a negatively charged group, consisting of Glu and Asp, (iv) amino acids containing an aromatic group, consisting of Phe, Tyr and Trp, (v) amino acids containing a nitrogen ring group, consisting of His and Trp, ( vi) amino acids containing a long aliphatic non-polar group, consisting of Val, Leu and Lie, (vii) amino acids containing a slightly polar group, consisting of Met and Cys, (viii) amino acids containing a small residue group , consisting of Ser, Thr, Asp, Asn, Gly, Ala, Glu, Gln, and Pro, (ix) amino acids containing an aliphatic group consisting of Val, Leu, lie, Met, and Cys, and (x) amino acids containing contain a hydroxyl group consisting of Ser and Thr. Certain conservative substitutions may include substitution within the following groups of amino acid residues: gly, ala; val, ile, leu; asp, glu; asn, gln; be, thr; lys, arg; and phe, tyr. Therefore, as exemplified previously, conservative amino acid substitutions are known to those of skill in the art and can generally be made without altering the biological activity or function of the resulting molecule. Those skilled in the art also recognize that single amino acid substitutions in non-essential regions of a polypeptide do not, in general, substantially alter biological activity. See, eg, Watson, et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub. Co., Menlo Park, CA, p. 224. Polypeptides of the present disclosure encompass those having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acid substitutions compared to an amino acid sequence as set forth in SEQ ID NOs: l-3, eg, conservative amino acid substitutions. Substitutable amino acid residues may be located at residue positions that are not highly conserved. Those skilled in the art will appreciate, based on the location of active sites and / or related protein homology, that a protein will tolerate substitutions, deletions, and / or insertions at certain amino acid residues, without a significant change in amino acid residues. its overall physical and chemical properties. The polypeptides of the present disclosure encompass those having an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97% %, at least 98%, at least 99%, at least 99.5%, or 100% identical to any of the polypeptides shown in SEQ ID NOs:l-3. RNA suppression Small RNAs that regulate protein expression include a miRNA and ta-piRNA. A miRNA is a small RNA (typically about 21 nucleotides) that has the ability to modulate the expression of a target gene by binding to messenger RNA for the target protein leading to destabilization of the target protein messenger RNA or translational inhibition of the target protein. Target protein messenger RNA, ultimately resulting in a reduction in the amount of target protein. The design and construction of ta-siRNA constructs and their use in protein modulation in transgenic plant cells is reported in Alien and Carrington in the US Patent Application Publication 2006 / 0174380 Which is incorporated herein by reference. The expression or suppression of such small RNAs are aspects of the invention that are conveniently illustrated with reference to the use of miRNAs. Recombinant DNA constructs can be used to modify the activity of native miRNAs in a variety of ways. By increasing the expression of a miRNA, for example temporally or spatially, the modulation of the expression of a native target gene can be increased. An alternative gene suppression strategy to suppress expression of a target protein may include the use of a recombinant DNA construct that produces a synthetic miRNA that is engineered to bind to a native or synthetic miRNA recognition site on messenger RNA for expression. white protein. By reducing the expression of a miRNA, the modulation of a native target gene can be decreased resulting in increased expression of the target protein, such as SEQ ID NOs: 1-3. More specifically, expression of a target protein can be increased by suppressing the activity of miRNA that binds to a recognition site on messenger RNA that is transcribed from the native gene for the target protein. Various types of recombinant DNA constructs can be designed to suppress the activity of a miRNA. For example, a recombinant DNA construct that produces an abundance of miRNA recognition site RNA can be used as a decoy for native miRNA that allows endogenous miRNA recognition site messenger RNA to be translated into protein. target without interference from native miRNA. A recombinant DNA construct that produces RNA with a modified miRNA recognition site, for example with nucleotides at positions 10 and / or 11 of a 21-membered miRNA recognition site that are mismatched with respect to native miRNA, can be used. to sequester natively expressed miRNA thereby mediating the diversion reduction that normally occurs when miRNA binds to the recognition site. Mispaired nucleotides can be produced for example through additional nucleotides between positions 10 and 11 or through substitutions of the nucleotides at positions 10 and 11. In addition, a recombinant DNA construct can be created that produces RNA that can be processed in plants to synthetic small RNA (miRNA-like) that can bind to endogenous miRNA recognition sites but is unable to induce mRNA diversion due to that the small RNA is modified, for example by having a modified nucleotide at positions 10 and / or 11 or a deletion that results in a mismatch between positions 10 and 11 when the small RNA pairs with the miRNA recognition site. The resulting synthetic small RNA, a cleavage blocker, can reduce endogenous miRNA binding and thereby block cleavage of a protected miRNA target site by increasing expression of a target protein. A recombinant DNA construct designed to produce a modified messenger RNA for protein, in which the native miRNA recognition site is modified to be resistant to binding of the corresponding miRNA that regulates the native gene, can also be used to express a protein. from heterologous messenger RNA that is no longer modulated by native miRNA. The activity of a miRNA that decreases the expression of an endogenous protein is increased by increasing the expression of the miRNA or by increasing the ability of the miRNA to bind to an RNA encoding the target protein. A recombinant DNA encoding miRNA-encoding RNA or miRNA-responsive messenger RNA encoding protein, in which a miRNA-binding site is added, is designed to increase the activity of the miRNA resulting in an increase in the suppression of the target mRNA and the corresponding protein. Recombinant DNA encoding an RNA encoding a miRNA, or a miRNA-responsive RNA are designed using the methods disclosed in US Patent Application Publication USA US 2009 / 0070898 Al. Some, if not many, miRNAs modulate the expression of multiple proteins or biochemical pathways. Plants with improved traits can be provided not so much by suppressing or increasing expression of a particular protein, but more by changing enzymatic activity in a pathway by modulating the level of a miRNA. Therefore, aspects of this invention are achieved by the increased activity of a miRNA that results from the use, in plant cells, of recombinant DNA constructs that produce an increased level of a miRNA. Other aspects of this invention are achieved by reduced miRNA activity resulting from the use, in transgenic plant cells, of recombinant DNA constructs that produce a lower level or activity of a miRNA. Nucleic acids of C. sübtsugae Also provided are nucleotide sequences encoding C. subtsugae genes and nucleotide sequences of functional RNA molecules (eg, rRNA, tRNA) (SEQ ID NOs:4-6). Nucleic acids comprising these sequences are also provided. Fragments of gene sequences from C. subtsugae are also provided. Such fragments are 10 or more, 25 or more, 50 or more, 75 or more, 100 or more, 200 or more, 500 or more, or 1,000 or more nucleotides in length. Also provided are nucleic acids having a sequence that is 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical to the aforementioned sequences. The nucleic acids disclosed herein may be either DNA or RNA, and may be single-stranded or double-stranded. Nucleic acids comprising nucleotide sequences that are complementary to the aforementioned sequences are also provided, as are nucleic acids that hybridize with the aforementioned nucleic acids under stringent conditions. The present disclosure also provides polynucleotides comprising a nucleotide sequence that encodes any of the polypeptide sequences disclosed herein. Such polynucleotides have a nucleotide sequence that is at least 70% (eg, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, or 100%) identical to a contiguous sequence of a nucleic acid encoding any of the polypeptides disclosed herein. Percent identity is based on the shortest of the compared sequences. Known programs such as BLASTN (2.0.8) (Altschul et al. (1997) Nucí. Acids. Res. 25:3389-3402) using default parameters and no filters to do a sequence comparison. Nucleic acid sequence identity (eg between two different polynucleotides encoding identical amino acid sequences) may be less than percent amino acid sequence identity due to degeneracy of the genetic code. Examples of nucleic acid sequences of a polynucleotide encoding a polypeptide of the present disclosure can be found within SEQ ID NOs:46. These nucleic acid sequences can also be provided in an expression vector (see below). Polypeptides and proteins from C. subtsugae The present disclosure provides the amino acid sequences of proteins encoded by the genome of C. subtsugae, as well as polypeptides comprising said amino acid sequences (ie, SEQ ID NOs: 1-3). Functional fragments and conservatively substituted variants of said polypeptides are also provided. In addition, fragments of the polypeptides disclosed herein that do not retain function and that are useful, for example, as epitopes for antibody production, are also provided. Such fragments are 4 or more, 10 or more, 25 or more, 50 or more, 75 or more, 100 or more, 200 or more, 500 or more, or 1,000 or more amino acids in length. The present disclosure also provides a polypeptide comprising an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% , 97%, 98%, 98.5%, 99%, 99.5%, or 99.9% identical to a contiguous sequence of a polypeptide as disclosed herein. Percent identity is based on the shortest of the compared sequences. Methods for determining the degree of polypeptide sequence identity are known in the art. The present polypeptides may include amino acid sequences derived from any of SEQ ID NOs: 1-3 which further comprise heterologous amino acid sequences. Such polypeptides may be fusion proteins, such as a fusion protein containing epitope tags, purification tags, and / or detectable labels. A fusion protein may optionally include a linker sequence between the heterologous sequences and the sequence of amino acids from C. subtsugae. Methods for producing fusion proteins are known in the art. Other heterologous elements and examples of fusion proteins are described in more detail below. Examples of polypeptides containing heterologous elements may include myc and / or His6 tags and may optionally include flanking linker sequences. Polypeptides of the present disclosure further encompass those that are bound to a reporter polypeptide, eg, a fluorescent protein, and / or conjugated to a molecule. The molecule conjugated to the polypeptide can be a carrier molecule or a moiety that facilitates its administration and / or increases the half-life of the polypeptide of interest. The polypeptides of the present disclosure can be produced by any suitable method, including recombinant and non-recombinant methods (eg, chemical synthesis). The polypeptide of interest can be prepared by solid phase synthetic methods known in the art (eg, Fmoc or t-Boc chemistry), such as those described in Merrifield (1963) J. Am. Chem. Soc. 85:2149 and Methods in Molecular Biology, Vol 35: Peptide Synthesis. Protocols. It is to be noted that the polypeptides of the present disclosure may also contain additional elements, such as a detectable label, for example, a radioactive label, a fluorescent label, a biotin label, an immunologically detectable label (for example, a hemagglutinin (HA) label, a poly- Histidine) and the like. Additional elements may be provided (eg, in the form of fusion polypeptides) to facilitate expression (eg N-terminal methionine and / or a heterologous signal sequence to facilitate expression in host cells), and / or the isolation (eg, biotin label, immunologically detectable label) of the polypeptides of the disclosure by various methods. Polypeptides can also optionally be immobilized on a support via covalent or non-covalent attachment. Isolation and purification of the present polypeptides can be carried out according to methods known in the art. The term "isolated" designates a compound (eg polypeptide or polynucleotide) that is separated from all or some of the components that accompany it in nature. Isolated also refers to the state of a compound separated from all or some of its accompanying components during manufacture (eg, chemical synthesis, recombinant expression, culture medium, and the like). For example, a polypeptide according to the present disclosure can be isolated from a cell used that has been genetically modified to express the polypeptide of interest, from a cell culture medium, or from a synthetic reaction mixture. . Further isolation can be achieved by immunoaffinity purification, which generally involves contacting a sample with an antibody (optionally immobilized) that specifically binds to an epitope of the polypeptide, washing to remove non-specifically bound material, and eluting the specifically bound polypeptide. . The isolated polypeptide can be further purified by dialysis and other methods normally employed in protein purification, for example metal chelate chromatography, ion exchange, and size exclusion. counterparts In yet another embodiment, the present disclosure provides methods for obtaining homologues of the C. subtsugae gene fragments disclosed herein, and homologues of the proteins encoded by the ORFs disclosed herein. Specifically, by using the nucleotide and amino acid sequences disclosed herein as probes or as primers, and techniques such as PCR cloning and colony / plate hybridization, one skilled in the art can obtain such homologues. Said homologues can be obtained from any organism; for example, other Chromobacterium species or other bacteria. In one embodiment, homologues can be identified by amino acid sequence comparison, for example manually or by use of a computer tool using known homology-based search algorithms such as those commonly known and used. referred to as BLAST, FASTA, and SmithWaterman. A local sequence alignment program, for example BLAST, can be used to search a sequence database for similar sequences, and the summed Expectation value (E-value) used to measure similarity on a sequence basis. Because a protein finding with the best E value for a particular organism may not necessarily be an ortholog, i.e., have the same function, or be the only ortholog, a reciprocal query is used to filter out findings from sequences with E values. significant for ortholog identification. Reciprocal interrogation allows the search for significant findings against a database of base organism amino acid sequences that are similar to the protein sequence of question. A finding can be identified as an ortholog, when the best finding from the reciprocal interrogation is the interrogating protein itself or a protein encoded by a duplicated gene after speciation. Another aspect of useful DNA-encoded orthologs in the transgenic plants of the invention are those proteins that differ from a disclosed protein as a result of a deletion or insertion of one or more amino acids in a native sequence. Antibodies, Detection Methods, Component Sets Also provided are antibodies that selectively bind to a protein or polypeptide fragment encoded by C. subtsugae genes such as SEQ ID NOs:1-3. Such antibodies may further comprise a detectable label and / or may be bound to a solid support. Such antibodies include both monoclonal and polyclonal antibodies. Hybridomas producing the monoclonal antibodies previously described are also provided. In additional embodiments, the present disclosure provides methods for identifying test samples that are derived from cells that express one or more of the ORFs disclosed herein, or homologues thereof. Said methods comprise incubating a test sample with one or more of the antibodies of the present disclosure, or one or more fragments of the genes of C. subtsugae, under conditions that allow a person skilled in the art to determine if the sample contains the ORF (or portion thereof) or product produced therefrom. In additional embodiments, component kits containing the reagents necessary to perform the assays previously described are provided. Specifically, there is provided herein a compartmentalized kit of components designed to receive, in confinement, one or more containers comprising: (a) a first container comprising one of the antibodies, or one of the C. subtsugae gene fragments of this disclosure; and (b) one or more containers comprising one or more of the following: wash reagents, reagents capable of detecting the presence of bound antibodies, or reagents capable of detecting the presence of hybridized nucleic acids. Using the isolated proteins disclosed herein, the present disclosure further provides methods for obtaining and identifying agents capable of binding to a protein encoded by an ORF of C. subtsugae. Specifically, such agents include antibodies (previously described), peptides, carbohydrates, agents pharmaceuticals and the like. Such methods comprise the steps of: (a) contacting an agent with an isolated protein encoded by one of the ORFs disclosed herein; and (b) determining if the agent binds to said protein. Methods for detecting protein-protein binding are known in the art and include, for example, filter binding, immunoprecipitation, two-hybrid assays, gel retardation, and reporter subunit complementation. See, for example, US Patents 5,503,977 and 5,585,245; Fields et al. (1989) Nature 340:245-247; Bai et al. (1996) Meth. Enzymol. 273:331-347 and Luo et al. (1997) BioTechniques 22:350-352. Vectors For embodiments where a polypeptide is produced using recombinant techniques, the methods may involve any suitable construct and any suitable host cell, which may be a prokaryotic cell or a eukaryotic cell (for example a bacterial host cell, a yeast host cell , a plant host cell, an insect host cell, or a mammalian host cell in culture). Methods for introducing genetic material into host cells are known in the art and include, for example, biolistics, transformation, electroporation, lipofection, conjugation, calcium phosphate precipitation, and the like. The method for transfer can be selected to provide stable expression of the nucleic acid encoding the introduced polypeptide. The polypeptide-encoding nucleic acid may be provided as an episomal heritable element (eg, plasmid) or may be genomically integrated. Viral vectors can also be used to clone and express the nucleic acids disclosed herein. Examples of plant viral vectors include cauliflower mosaic virus (CaMV), pea early browning virus (PEBV), broad bean pod spot virus (BPMV), cucumber mosaic virus (CMV), apple latent spherical virus (ALSV), tobacco mosaic virus (TMV), potato virus X, bromine mosaic virus (BMV), and barley stripe mosaic virus (BSMV). Additional vectors can be used for expression of C. subtsugae polypeptide sequences in non-plant organisms. These include prokaryotic cloning vectors (eg pBR322, pUC, bacteriophage lambda), fungal vectors (eg yeast 2 micron plasmid), insect cloning vectors (eg baculovirus) and mammalian vectors (eg , SV40). Vectors suitable for transferring a polypeptide-encoding nucleic acid may vary in composition. Integrating vectors can replicate conditionally or be suicide plasmids, bacteriophages, and Similar. Constructs may include various elements, including, for example, promoters, selectable genetic markers (eg, genes that confer resistance to antibiotics, eg, neomycin, G418, methotraxate, ampicillin, kanamycin, erythromycin, chloramphenicol, or gentamicin), origins of replication (to promote replication in a host cell, eg, a bacterial host cell), and the like. The choice of vector depends on a variety of factors such as the type of cell propagated and the purpose of the propagation. Certain vectors are useful for amplifying and processing large quantities of the desired DNA sequence. Other vectors are suitable for expression of proteins in cells. Still other vectors are suitable for transfer and expression in cells in a whole animal or plant. Choosing the proper vector is well within the skill of the art. Many such vectors are commercially available. The vector that is used can be an expression vector based on episomal plasmids containing drug resistance markers for selection and elements that provide autonomic replication in different host cells. Vectors are fully described in numerous publications well known to those skilled in the art, including, for example, Short Protocols in Molecular Biology, (1999) F. Ausubel, et al., eds., Wiley & Sons. Vectors may provide expression of the nucleic acids encoding the polypeptide of interest, may provide propagation of the nucleic acids of interest, or both. Constructs can be prepared by, for example, inserting a polynucleotide of interest into the backbone of a construct, typically via DNA ligase ligation to an olive restriction enzyme site in the vector. Alternatively, the desired nucleotide sequence can be inserted by homologous recombination or site-specific recombination, or by one or more amplification methods (eg, PCR). Typically, homologous recombination is accomplished by linking regions of homology to the vector on the flanks of a desired nucleotide sequence, whereas site-specific recombination can be accomplished through the use of sequences that facilitate specific recombination. site (eg cre-lox, att, etc. sites) . Nucleic acid containing such sequences can be added by, for example, oligonucleotide ligation, or by polymerase chain reaction using primers that comprise both the region of homology and a portion of the desired nucleotide sequence. For expression of the polypeptide of interest, an expression cassette may be employed. Therefore, the present disclosure provides a recombinant expression vector comprising a nucleic acid of interest. The expression vector may provide transcriptional and translational regulatory sequences, and may also provide inducible or constitutive expression, wherein the coding region is placed operatively under the transcriptional control of a transcriptional initiation region (eg, a promoter, enhancer), and transcription and translation termination regions. These control regions may be native to the C. subtsugae genome, or may be derived from exogenous sources. As such, control regions from exogenous sources can be considered heterologous elements that are operably linked to nucleic acid encoding the polypeptide of interest. In general, transcriptional and translational regulation sequences may include, but are not limited to, promoter sequences, operator sequences, ribosome binding sites, transcription start and stop sequences, translation start and stop sequences , polyadenylation sites, and activator or enhancer sequences. Promoters can be constitutive or inducible, and can be a strong constitutive promoter (eg, T7 promoter, SP6 promoter, and the like). Examples of plant regulatory sequences, which can be used in the recombinant constructs disclosed herein, include constitutive promoters such as the CaMV 19S and 35S promoters and those of genes encoding actin or ubiquitin. Alternatively, regulated promoters such as chemically regulated promoters (eg, tetracycline regulated) and wound-inducible promoters (which are expressed at wound sites and sites of phytopathological infection) may also be used. In additional embodiments, promoters can be tissue-specific (eg, specifying expression in roots, leaves, flowers, inflorescences) and / or temporally regulated (eg, specifying expression in seedlings). Additional promoters have been described for use in plant cells. See, for example, Stanford et al. (1989) Mol. Gen. Genet. 215: 200-208; Xu et al. (1993) Plant Molec. Biol. 22: 573-588; Logemann et al. (1989) Plant Cell 1: 151-158; Rohrmeier & Lehle (1993) Plant Molec. Biol. 22: 783-792; Firek et al. (1993) Plant Molec. Biol. 22: 129-142 and Warner et al. (1993) Plant J. 3: 191-201. Consensus sequences for plant translation initiation (ie, ribosome binding sites) have been described in Joshi (1987) Nucleic Acids Res. 15:6643-6653 and in Clontech Catalog 1993 / 1994, page 210. Expression vectors generally have convenient restriction sites that are located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding proteins of interest. An operable selection marker may be present in the expression host to facilitate selection of cells containing the vector. In addition, the expression construct may include additional elements. For example, the expression vector may have one or two replication systems, thereby allowing it to be maintained, for example, in plant or insect cells for expression, and in a prokaryotic host for cloning and amplification. In addition, the expression construct may contain a selection marker gene to allow selection of transformed host cells. Selection genes are known in the art and vary depending on the host cell used. The expression vectors provided herein contain the previously mentioned nucleic acids and / or polynucleotides. Said expression vectors may contain promoters (for example, T7 promoter, T3 promoter, SP6 promoter, E. coli RNA polymerase promoter, lac promoter and its derivatives, tac promoter, trp promoter, the arabinose-inducible PBAD promoter, the promoter inducible by L-rhamnose rhaPBñD, the bacteriophage lambda promoters (eg, PL), CMV promoter, SV4 0 promoter, PGK promoter, EF-lalpha promoter), operators, transcription termination signals (eg, SV40 termination signal), 'splice sites (eg, SV40 splice sites, beta-globin splice site), ribosome binding sites, signal sequences (eg, signal sequence immunoglobulin kappa), tag epitopes (eg, myc, FLAG), tags for purification (eg, His6), origins of replication, and markers for drug selection. Linker sequences, encoding amino acid linkers and / or comprising recognition sites for restriction enzymes, or any other type of linker sequence, may also be operatively linked to the nucleic acid encoding the polypeptide of interest present in the disclosed vectors. at the moment. Cosmid libraries can be prepared by methods known in the art. See, for example, Maniatis et al. Molecular Cloning: A Laboratory Manual. cold spring or Harbor Press, 2nd edition, 1989 and Sambrook et al., 2001. Such a library can be used for sequence-based screening and for any type of functional screening of cells, or of supernatants, whole cell broths, Used cell-free, or cell-derived extracts. High-throughput biological assays for screening herbicides, enzyme activities, anti-cancer activity, etc. they are known in the art and described in the literature. See also Examples 7 to 11 herein. host cells The present disclosure further contemplates recombinant host cells containing an exogenous polynucleotide. Said polynucleotide may comprise one or more fragments of the C. subtsugae genes as disclosed herein, or may encode one or more of the polypeptides of the present disclosure. Host cells can be prokaryotic (eg, bacterial) or eukaryotic (eg, yeast, insect, mammalian). The host can also be a synthetic cell. In certain embodiments, the host cell is a microorganism. Suitable microorganisms are those capable of colonizing plant tissue (eg roots, stems, leaves, flowers, internally or on the surface), or the rhizosphere, in such a way that they come into contact with insect pests. Some of the host microorganisms may also be capable of colonizing the intestine of an insect pest, and may be capable of being transmitted from one insect to another. The Host microorganisms can also colonize the gut and body surface of a plant pest. The host cell can also be used as a microbial factory for the production of C. subtsugae proteins, or for the production of one or more compounds produced by the activity of C. subtsugae proteins such as, for example, peptides, lipids, lipopeptides, glycoproteins, secondary metabolites, antibiotics, and small organic compounds. Gram-negative microorganisms suitable for heterologous expression include: Escherichia coli (eg, E. coli K12, E. coli BL21), Pseudomonas sp. (eg Pseudomonas fluorescens, Pseudomonas putida, Psuedomonas aurantiaca, Psuedomonas aureofaciens, Psuedomonas protegens), Enterobacter sp. (eg Enterobacter cloacae), and the strains Serratia sp. Examples of E. coli include E. coli BL21 and E. coli K12 for routine experimentation. Other E. coli strains, for more specialized purposes, are those that show protease deficiency (BL21-B838) and those that overexpress membrane proteins such as the BL21 derivative DE3, C41 (DE3) and C43 (DE3). Methods for high-level expression of heterologous proteins in E. coli are known and include (a) IPTG induction methods, (b) auto-induction methods, and (c) IPTG induction methods for high cell density. See, for example, Sivashanmugam et al. (2009). Gram-positive microorganisms suitable for heterologous expression include Bacillus sp. (eg Bacillus megaterium, Bacillus subtilis, Bacillus cereus), and Streptomyces sp. An advantage of using Bacillus as an expression host is that members of this genus produce spores, which provide formulations with better stability and longer shelf life. Expression systems based on Bacillus megaterium and Bacillus subtilis are commercially available from MoBiTec (Menania). Nucleotide sequences of interest can be expressed in Bacillus megaterium under the control of the xylose operon promoter. Fungal microorganisms suitable for heterologous expression include Trichoderma sp., Gliocadium, Saccharomyces cerevisiae, and Pichia pastoris. Heterologous DNA can be introduced into filamentous fungi by protoplast-mediated transformation using polyethylene glycol (PEG) or by electroporation-based methods. Particle bombardment is another method that has been used successfully to transform fungal cells. Methods and compositions for transformation of Saccharomyces cerevisiae are known in the art. By For example, a nucleic acid can be cloned into a suitable vector (eg, YES vectors (Invitrogen, Carlsbad, CA), under the control of an inducible promoter such as GALl, at the CYC1 terminator, and expressed in Saccharomyces cerevisiae. The resulting cells can be tested for desired activity, or protein expression. Heterologous expression can also be carried out in other yeast species (Jeffríes et al., 2010), such as Pichia pastoras, Hansenula polimorpha, Arxula adenivorans and Yarrowia lipolitica. Transformation of Pichia pastoras can be achieved using a commercial set of components, such as the PichiaPink Expression System (Invitrogen, Carlsbad, CA), the Pichia Classic Protein Expression System, or the Pichia GlycoSwitch (for glycosylated proteins) (Research Corporation Technologies, Tucson, AZ). For the transformation of Pichia pastoras or Hansenula yeasts. polimorpha, electroporation can also be used. In certain embodiments, non-pathogenic symbiotic bacteria are used, which are capable of living and replicating within plant tissues (ie, endophytes), or non-pathogenic symbiotic bacteria, which are capable of colonizing the phyllosphere or rhizosphere (or be epiphytes). Such bacteria include bacteria of the genera Agrobacterium, Alcaligenes, Azospirillum, Azotobacter, Bacillus, Clavibacter, Enterobacter, Erwinia, Flavobacter, Klebsiella, Pseudomonas, Rhizobium, Serratia, Streptomyces and Xanthomonas. Symbiotic fungi, such as Trichoderma and Gliocladium, can also be used as hosts for the propagation and / or expression of the sequences disclosed herein. Pesticide formulations and compositions The present disclosure provides pesticidal (eg, insecticidal) compositions and formulations comprising the nucleic acids and polypeptides disclosed herein. A pest is an organism (prokaryote, eukaryote, or Archael) that results in increased plant mortality and / or causes retardation, depletion, or other disturbance in plant growth. Pests include, without limitation, nematodes, insects, fungi, bacteria, and viruses. A pesticide, as defined herein, is a substance derived from a biological product, or a chemical, that results in increased mortality of plant pests and / or inhibits their ability to thrive. Pesticides include, without limitation, nematicides, insecticides, herbicides, plant-based fungicides, plant-based bactericides and plant-based viricides. A biological pesticide as defined herein is a microorganism with pesticidal properties. A pesticidal composition is a formulation comprising a pesticide and optionally comprising one or more additional components. Additional ingredients include, without limitation, solvents (such as amyl acetate, carbon tetrachloride, ethylene dichloride, kerosene, xylene, pine oil, or other solvents listed in Lists 4a and 4b of the EPA, among others), vehicles (such as organic flour, walnut shell flour or wood bark), powdered minerals (such as sulfur, diatomite, tripolite, lime, gypsum, talc or pyrophyllite), clays (such as bentonite, attapulgite, kaolin, volcanic ash, or other EPA List 4A and 4B clays), stabilizers, emulsifiers (such as alkaline soaps , organic amines, long-chain alcohol sulfates or materials such as alginates, gums derived from carbohydrates, lipids or proteins, as well as other emulsifiers listed in EPA lists 4A and 4B), agents surfactants (for example, those listed in lists 4A and 4B of the EPA), antioxidants, sunscreens, additional pesticides, which can be chemical or biological (such as insecticides, nematicides, acaricides, algaecides, fungicides or bactericides), herbicides and antibiotics. A carrier, as defined herein, is an inert organic or inorganic material with which the active ingredient is mixed or formulated to facilitate its application to a plant or other object to be treated, or storage, transportation and / or handling. The pesticidal compositions described herein are useful for modulating pest infestations in plants. The term modular, as defined herein, denotes altering the magnitude of pest infestations or the rate at which pest infestations spread. In general, these alterations are a reduction in the severity, speed and / or magnitude of the infestations. The term pest infestation, as defined herein, refers to the presence of a pest in a quantity that results in a deleterious effect, which may take the form of disease or infection, in a population. host, or that manifests itself as the appearance of an undesirable weed in a crop. Pests include, but are not limited to, mites (for example, Tetranychus urticae (the spider mite)), fruit flies (for example, Drosophila suzukii or Drosophila melanogaster), houseflies (for example, Musca domestica), arachnids (for example, belonging to the subclass Acari), rootworms (belonging to the family Anthomyiidae, for example, cabbage rootworms), aphids (for example, Myzus persicae (the green peach aphid)), members of the family Triozidae (for example, the potato psyllid (Bactericera cockerelli)), beetles of the family Tenebrionidae (for example, the dung beetle (Alphitobius diaperinus) ), larvae in general (for example, white bollworm (Cyclocephala lurida), southern masked beetle larvae (Rhizotrogus majalis), Japanese beetle larvae (Popillia japonica), black vine weevil larvae (Otiorhyncus sulcatus ), the s larvae of the oriental beetle (Anomala orientalis), or the larvae of common beetles, such as members of the family Scarabaeidae), nematodes (for example, the knot-forming nematode (Meloidogyne sp.)), fungi, bacteria and a variety of viruses that attack plants, such as tobacco mosaic virus, tomato wilt virus, yellow leaf curl virus, tomato leaf virus, cucumber mosaic virus, potato virus Y, cauliflower mosaic virus, African cassava mosaic virus, plumpox virus, brome virus, potato virus X, grapefruit sadness virus, barley yellow dwarf virus, potato curl virus, or tomato bush dwarf virus. The pesticidal compositions described herein can be used for prophylactic or modulatory purposes. When used for prophylactic purposes, the compositions are applied before any symptoms of an infestation appear. Prophylactic administration of the compositions is useful in preventing, attenuating, or delaying the onset of any further infection or infestation. When used for modulatory purposes, the compositions are applied at (or shortly after) an indication of an infection or infestation. The administration of one or more modulating compounds may be useful in attenuating the pathological symptoms of an infection or infestation and in increasing the speed of recovery. Other methods can be used to control the duration of action. Controlled release can be obtained by the use of appropriate polymers to absorb or complex with one or more of the components of the composition. A controlled release can be the result of selecting the appropriate macromolecules (such as polyesters, polyamino acids, polyvinyl, pyrrolidone, ethylene vinyl acetate, methylcellulose, carboxymethylcellulose or protamine sulfate) and its concentration, as well as the use of appropriate incorporation methods to control the release. Another possible method of controlling the duration of action using controlled release preparations may comprise incorporating compositions as described herein into particles of a polymeric material, such as a polyester, a polyamino acid, a hydrogel, the poly(lactic acid) or a copolymer of ethylene and vinyl acetate. As an alternative, instead of incorporating the compositions in polymeric particles, they can be captured in microcapsules, which can be prepared, for example, with coacervation or interfacial polymerization processes, as is the case with hydroxymethylcellulose, gelatin or cellulose microcapsules. poly(methyl methacrylate), can be placed in colloidal delivery systems, such as liposomes, albumin microspheres, microemulsions, nanoparticles, or nanocapsules, or used in the form of macroemulsions. These procedures are known in the art. Pesticidal compositions as disclosed herein, (eg, pesticidal toxins) can be produced by expression of selected gene sequences from Chromobacterium subtsugae in heterologous hosts suitable for laboratory scale, pilot scale, and manufacturing scale fermentation (eg, E. coli, Psuedomonas sp., yeasts, etc.). The toxins can be produced by fermentation procedures known in the art using the directly formulated heterologous host, or after extraction and purification of the toxin from the fermentation broth. The formulation may include living cells or non-living cells. The pesticidal compositions described herein may be formulated in any manner. Non-limiting examples of formulations include emulsifiable concentrates (EC), wettable powders (WP), soluble liquids (SL), aerosols, ultra low volume concentrate solutions (ULV), soluble powders (SP), microencapsulates, granules dispersed in water, fluids (FL), microemulsions (ME) and nanoemulsions (NE), among others. In any of the formulations described herein, the percentage of the active ingredient is in the range of between 0.01% and 99.99%. Detailed descriptions of pesticide formulations can be found in Kirk-Othmer Encyclopedia of Chemical Technology; Knowles, A. 2005, New Developments in Crop Protection Product Formulation, Agrow Reports, London, UK; Pesticide Formulation, edited by Valkenburg, W van (ed.) 1973, Marcel Dekker, New York, USA; o Chemistry and Technology of Agrochemical Formulations, edited by Knowles, D. A. (1998), Kluwer Academic Publishers, Dordrecht, The Netherlands. Formulations in the form of powders or powders These are individual formulations that usually contain between 0.1 and 25% of the active ingredient. However, higher concentrations of the active ingredient may be used, depending on its potency and the particular application. The pesticidal toxin is mixed with a solid carrier, preferably composed of small particle size. Solid vehicles include silicate clays (such as attapulgite, bentonite, volcanic ash, montmorillonite, kaolin, talc or diatoms, among others), carbonates (such as calcite or dolomite, among others ), synthetic vehicles (such as precipitated silica or fumed silica, among others), ground botanicals (such as corn cob grits, rice husks, or coconut husks, among others), organic flours (such as walnut shell or wood bark flour, among others) or ! pulverized minerals (such as sulfur, diatomite, tripolite, lime, talc, gypsum or pyrophyllite, among others). Inert ingredients used in powder formulations may also come from those listed on the EPA Inert Ingredients List 4a (www.epa.gov / opprd001 / inerts / inerts_list4Acas.pdf), in the case for conventional formulations, and 4b (www.epa.gov / opprd001 / inerts / inerts_list4Bname.pdf) for organic formulations. Particles with a small size can be obtained by combining the active ingredient with the carrier and pulverizing them in a mill. Dusts are defined as having a particle size of less than 100 microns, and toxicity increases with decreasing particle size. In the selection of a formulation in powder form, its compatibility, its fineness, its bulk density, its fluidity, its abrasiveness, its absorption capacity, its specific gravity and its cost must be taken into consideration. Examples of various powder formulations are provided in Table 1. Table 1 components of the Formulation A Formulation B. Formulation C Formulation D formulation Active Ingredient 0.65 5 10 25 Talc 50 90 Kaolin or 49.35 95 75 other clays A formulation in powder form can also be prepared from a concentrated powder (comprising 40% active ingredient, 5% a stabilizer, 20% silica and 35% magnesium carbonate), which can be combined in a 1-10% ratio with a 1:1 mixture of an organic filler and talc. A formulation in powder form is used against crawling insects in the form of contact powder (CP) or tracking powder (TP). A formulation in powder form with high fluidity can be applied in greenhouses with pneumatic equipment. Formulations in the form of granules or pellets Pesticide toxin is applied in liquid form onto coarse particles of porous material (such as clay, walnut shells, vermiculite, diatomaceous earth, corn cobs, attapulgite, montmorilloinite, kaolin, talc , the diatomites, the calcite, dolomite, silica, rice husk or coconut shell, among others). Granules or pellets may be dispersed in water and may be formed by means of an extrusion process (in the case of pesticide active substances with low water solubility), agglomeration or spray-drying. The granules can also be impregnated or coated with a solution of the pesticide toxin in a solvent. Carrier particles can be selected from those listed on EPA's Inert Ingredients List 4a (www.epa.gov / opprd001 / inerts / inerts_list4Acas.pdf), for conventional formulations, and 4b (www.epa. .gov / opprd001 / inerts / inerts_list4Bname.pdf), for organic formulations. The active ingredient can be absorbed by the support material or can be applied as a coating on the surface of the granules. The diameter of the particles can vary between 250 and 1250 microns (between 0.25 mm and 2.38 mm). The formulations usually contain a concentration of the toxicant between 2 and 10 percent. The granules are applied in water, on the whorls of the plant or on the ground, at a rate of 10 kg / ha. When applied to the soil, granular formulations of systemic insecticides are useful for controlling sucking pests and soil-borne pests. An application on the whorls can be useful to control boring pests in crops such as sorghum, corn or sugar cane, among others. Formulations of this type are useful in reducing drift and allow slower release of pesticidal compositions. Granular pesticides are most commonly used for applying chemicals to the soil to control weeds, nematodes, fire ants, or other soil-dwelling insects, or to be absorbed by plants. plants through the roots. Occasionally, granular formulations are applied by aircraft or helicopter in such a way as to minimize drift or enable penetration into dense vegetation. Once the granules are applied, the active ingredients are slowly released. In some cases, the soil needs to be moist for the active ingredients to be released from the granules. Granular formulations are also useful for controlling mosquito larvae or other aquatic pests. The granules may be useful in agricultural, structural, ornamental, aquatic, or turf-related, right-of-way, or public health (in the case of biting insects) pest control operations. The use of granular formulations is common for pre-emergent herbicides and for insecticides that are applied on the ground, since it allows direct application, followed by incorporation into the soil or other solid substrates where the plants grow. Granules or pellets can also be applied in the furrows. The granules are also often used over water, for example in flooded rice fields. A typical formulation in the form of granules comprises (in percentages by weight) 1-40% of the active ingredient, 1-2% of a stabilizer, 0-10% of a resin or a polymer, 0-5% of a surface-active agent. and 0-5% of a binder, and the remaining proportion up to 100% is made up with a carrier material. Formulations in the form of wettable powders Wettable powders are powder formulations that result in fairly stable suspensions when diluted with water. They are formulated by mixing the pesticidal agent with diluents such as attapulgite, a surface-active agent, and auxiliary materials such as sodium salts of sulfo acids. Optionally, adhesives can be added to improve retention on soles or other surfaces. Wettable powders can be prepared by mixing the pesticidal toxin (10-95%) with a solid carrier, with the addition of 1-2% surface-active agent to improve suspendability. The general composition of the formulation includes the active ingredient in solid form (between 5.0 and 75%), an anionic dispersant, and an anionic or nonionic wetting agent. A typical example of a wettable powder formulation includes between 10 and 80% of the active ingredient, between 1 and 2% of wetting agents (for example, benzene sulfonates, naphthalene sulfonates, aliphatic sulfosuccinates or aliphatic alcohol ethoxylates, among others). others), between 2 and 5% of dispersing agents (for example, lignosulfonates or naphthalene sulfonate-formaldehyde condensates, among others) and between 0.1 and 1% of antifoaming agents (for example, Isopar M (from Exxon / Mobil)), where the remaining proportion up to 100% is completed with a filler or an inert vehicle (such as diatomaceous earth or silica, among others). Formulations in the form of emulsifiable concentrates (CE) These are concentrated pesticide formulations that contain an organic solvent and a surface-active agent to facilitate emulsification with water. When formulations in EC form are sprayed on plant parts, the solvent rapidly evaporates, resulting in a reservoir of the toxin from which water also evaporates. Examples of emulsifying agents for insecticide formulations include alkaline soaps, organic amines, long chain alcohol sulfates, and materials such as alginates, gums, carbohydrates, lipids, or proteins. Emulsifying agents can be selected from those listed in the EPA Inert Ingredients List 4a (www.epa.gov / opprd001 / inerts / inerts_list4Acas.pdf), for conventional formulations, and 4b (www.epa. .gov / opprd001 / inerts / inerts_list4Bname.pdf), in the case of organic formulations. Formulations in the form of solutions A formulation in solution form is a concentrated liquid pesticide formulation that can be used directly or requires dilution, in the case of a soluble concentrate. Soluble concentrates and solutions are mixtures based on water or other solvents that can be completely mixed with water. A typical example of a formulation in the form of a concentrated solution includes 20-70% of the active ingredient, 5-15% of a wetting agent and 5-10% of an antifreeze agent, where the remaining proportion up to 100% is made up with water. or with a solvent miscible with water. Depending on the nature and stability of the 5» Pesticide toxin, a formulation in solution form may optionally include thickeners, preservatives, defoamers, pH buffers, UV protectors or other components. Formulations in the form of aerosols or fumigants In an insecticide spray, the toxin is suspended in the air, as a fog or mist, in the form of tiny particles, which range in size from 0.1 to 50 microns. This is achieved by burning the toxin, or it can be evaporated with heat. Dissolved toxin in liquefied gas, if released through a small hole, can cause toxic particles to float in the air with rapid evaporation of the released gas. A chemical compound that is volatile at room temperature and sufficiently toxic is known as a fumigant. Fumigants generally enter insects through the tracheal system. Fumigants are used to control insect pests in storage containers or buildings, and certain insects or nematodes in the soil. Most fumigants are liquid, kept in cans or tanks, and frequently comprise mixtures of two or more gases. Alternatively, phosphine or gaseous hydrogen phosphide can be generated from a tablet composed of aluminum phosphide and ammonium carbonate, in the presence of moisture. The The advantage of using a fumigant is that with them you can access places that are not usually easily accessible for other chemicals, due to the ability of the gas to penetrate and disperse. Commonly used fumigants include EDCT, methyl bromide, aluminum phosphide, and hydrocyanic acid. Formulation in fertilizer mixtures A fertilizer mix can be made by combining an insecticidal composition such as those described herein with a chemical fertilizer, or by diffusing the composition directly into the fertilizer. Fertilizer mixtures are applied with normal fertilization schedules and are useful both for providing nutrients to plants and for controlling soil insects. In one example of a fertilizer formulation, urea (in a 2% solution) is mixed with an insecticide composition and the product is sprayed to provide nitrogen to the plant and to obtain effective pest control. Formulation as poison baits. Poison baits are composed of a base or carrier material that is attractive to pest species and a toxic chemical in relatively small amounts. Poison baits are used to control fruit flies, biting insects, wireworms, white worms in the soil, household pests, field rats, or slugs. These formulations are useful for situations where spray application is difficult. A base that is often used in dry baits is wheat bran moistened with water and molasses. To control fruit-sucking moths, solutions of fermented sugars or molasses with toxins are often used. Formulations for seed treatments Seed treatments include the application of a pesticidal composition, optionally in combination with another antagonistic or symbiotic bioactive agent, to the surface of the seeds, prior to sowing. The toxins, proteins and / or compounds described herein may be formulated to treat seeds in any of the following forms: dry powders, powders that can be suspended in water, liquid solutions, concentrates or fluid emulsion, emulsions of other types , microcapsules, gels or granules dispersible in water. As an alternative, they can be applied to the seeds by spraying, before sowing. In the case of a dry powder, the active ingredient is formulated in a manner similar to that which would be used in a wettable powder, but with the addition of a bonding agent, such as mineral oil, instead of a binding agent. moisturizer By way of example, one kg of purified talcum powder (sterilized for 12 hours), 15 g of calcium carbonate and 10 g of carboxymethyl cellulose are mixed under aseptic conditions, according to the method of Nandakumar et al. (2001). The suspensions of protein, nucleic acids or the organisms where these are expressed, are mixed in a ratio of 1:2.5 (between the suspension and the dry mixture), and the product is dried in the shade to reduce the moisture content. up to 20-35%. The compositions can take the form of liquids, gels or solids. A solid composition can be prepared by suspending a solid carrier in a solution of one or more active ingredients and drying the suspension under mild conditions, for example, by evaporation at room temperature or under vacuum at a temperature of 65°C or less. . In the case of liquid compositions, the active ingredient may be dissolved in an appropriate vehicle or solvent. A composition may comprise one or more active ingredients encapsulated in a gel. Gel-encapsulated materials can be prepared by mixing gel-forming agents (such as gelatin, cellulose, or lignin) with a composition comprising one or more nucleic acids and / or polypeptides as described herein, optionally with a additional pesticide or herbicide, and then induce the formation of a gel from the agent. The composition may also comprise a surface active agent, which may be useful for a purpose related to emulsification, dispersion, wetting, spreading, integration or stabilization of the active ingredients, with the control of their disintegration, and with the improvement of the fluidity or with the inhibition of oxidation. In a particular embodiment, the surface active agent is a nonionic surface active agent that is not phytotoxic, which preferably belongs to the EPA list 4B. In another particular embodiment, the nonionic surfactant is polyoxyethylene (20) monolaurate. The concentration of the surfactant may vary between 0.1% and 35% of the total formulation, for example between 5% and 25%. The selection of dispersing agents and emulsifying agents, such as nonionic, anionic, amphoteric or cationic dispersing agents and emulsifying agents, and the determination of the amount in which they are used, is made according to the nature of the composition and the ability of the agents to facilitate the dispersion of the composition. Formulations comprising microorganisms The pesticide compositions that were described with Lecanicillium sp. Streptomyces sp. above can be combined with a microorganism. The microorganism may be a plant growth promoter. Suitable microorganisms include, without limitation, Bacillus sp. (eg Bacillus firmus, Bacillus thuringiensis, Bacillus pumilus, Bacillus licheniformis, Bacillus amyloliquefaciens or Bacillus subtilis), Paecilomyces sp. (P. lilacinus), Pasteuria sp. (P. penetrans), Pseudomonas sp., Brevabacillus sp., Ampelomyces sp., Pseudozyma sp., (S. bikiniensis, S. costaricanus, S. avermitilis), Burkholderia sp., Trichoderma sp., Gliocladium sp., Avermectin, Myrothecium sp., Paecilomyces sp., Sphingobacterium sp., Arthrobotrys sp., Chlorosplenium sp., Neobulgaria sp., Daldinia sp., Aspergillus sp., Chaetomium sp., Lysobacter sp., Lachnum papyraceum, Verticillium suchlasporium, Arthrobotrys oligospora, Verticillium chlamydosporium, Hirsutella rhossiliensis, Pochonia chlamydosporia, Pleurotus ostreatus, Omphalotus olearius, Lampteromyces japonica, Brevudimonas sp., Muscodor sp., Photorhabdus sp. and Burkholderia sp. Agents derived from or derived from such microorganisms may also be used in combination with the pesticidal nucleic acids and polypeptides described herein. Formulations comprising additional pesticides The pesticide compositions that were described with above may be combined with additional pesticides (eg nematicides, fungicides, insecticides, algaecides, acaricides or bactericides). These agents can be natural oils or oil products with fungicidal, bactericidal, nematicidal, acaricidal and / or insecticidal activity (such as paraffinic oils, tea tree oil, lemongrass oil, clove oil, cinnamon oil, grapefruit oil, rosemary oil or pyrethrum). In addition, the pesticide may be a single-site antifungal agent, including but not limited to benzimidazole, demethylation inhibitors (DMIs) (such as imidazole, piperazine, pyrimidine, or triazole) , morpholine, hydroxypyrimidine, anilinopyrimidine, phosphorothiolate, inhibitors of external quinones, quinoline, dicarboximide, carboximide, phenylamide, anilinopyrimidine, phenylpyrrole, aromatic hydrocarbons, cinnamic acid, hydroxyanilide, antibiotics, polyoxin, acylamine, phthalimide, and benzenoids (xylylalanines), where the demethylation inhibitors may be selected from the group consisting of imidazole, piperazine, pyrimidine, and triazole (for example, bitertanol, myclobutanil, penconazole, propiconazole, triadimefon, bromuconazole, cyproconazole, diniconazole, fenbuconazole, hexaconazole, tebuconazole, or tetraconazole), my Clobutanil, anthranilic diamides (eg, chlorantranilipol), and inhibitors of external quinones can take the form of strobilurins. A strobilurin may be, without limitation, kresoxim methyl or triploxystrobin. In yet another particular embodiment, the antifungal agent is a quinone, such as quinoxyfen (5,7-dichloro-4-quinolyl 4-fluorophenyl ether). The antifungal agent may also be derived from an extract of Reynoutria. The fungicide may also be a non-inorganic multi-site chemical fungicide which may be selected from the group consisting of chloronitrile, quinoxaline, sulfamide, phosphonate, phosphite, dithiocarbamate, chloralkylthiol, phenylpyridinamine and cyanoacetamide oxime. As noted above, the composition may also comprise an insecticide. The insecticide may include, without limitation, an avermectin, Bt (eg, Bacillus thuringiensis var. Kurstaki), neem oil, a spinosad, a Burkholderia sp. (for example, as described in WO2011 / 106491), an entomopathogenic fungus, such as Beauveria bassiana, or a chemical insecticide, for example and without limitation, an organochlorine compound, an organophosphorus compound, a carbamate, a pyrethroid compound, a pyrethrin or a neonicotinoid. As noted above, the composition may also comprise a nematicide. The nematicide may include, without limitation, an avermectin-type microbial product, such as Biome (Bacillus firmus), Pasteuria sp. or organic products, such as saponins. Methods to modulate pest infestation Therefore, according to the present disclosure, methods for modulating pest infestation in a plant are provided. The methods comprise applying to a plant, or to the soil or substrate in which the plant grows, a pesticidal composition comprising a nucleic acid as disclosed herein; that is, any of SEQ ID NOs:4-6. Additional methods for modulating pest infestation in a plant comprise applying, to a plant, or to the soil or substrate in which the plant is growing, a pesticidal composition comprising a polypeptide as disclosed herein; that is, any of SEQ ID NOs:1-3. When used as biological insect control agents, the insecticidal toxins encoded by the C. subtsugae genome can be produced by expression of a C. subtsugae nucleotide sequence in a heterologous host cell capable of expressing the nucleotide sequences. In one embodiment, one or more C. subtsugae nucleotide sequences are inserted into an appropriate expression cassette comprising, for example, a promoter and a transcription termination signal. Expression of the nucleotide sequence(s) may be constitutive or inducible, depending on the promoter and / or external stimuli. In certain embodiments, the cell in which the toxin is expressed is a microorganism, such as a virus, bacteria, or fungus. In certain embodiments, a virus, such as a baculovirus, is engineered to contain a C. subtsugae nucleotide sequence in its genome. Said recombinant virus can express large amounts of, for example, an insecticidal toxin after infection of appropriate eukaryotic cells that are suitable for virus replication and expression of the nucleotide sequence. The insecticidal toxin thus produced is used as an insecticidal agent. Alternatively, baculoviruses engineered to include the nucleotide sequence are used to infect insects in vivo and to kill them, either by insecticidal toxin expression or by a combination of viral infection and insecticidal toxin expression. Accordingly, the previously established compositions comprising nucleic acids and polypeptides from C. subtsugae can be used as pesticides. In particular, the compositions as set forth above may be used as, for example, insecticides and nematicides, alone or in combination with one or more second pesticidal substances as set forth herein. Specifically, nematodes that can be controlled using the method set forth above include, but are not limited to, parasitic nematodes such as root-knot, cyst, and lesion nematodes, including, but not limited to, root-knot nematodes. (Afrina wevelli), Agristis nematodes (Anguina agrostis), Shoot-knot nematodes (Anguina spp.), Seed-knot nematodes (Anguina spp., A. amsinckiae, A. balsamophila; A. tritici), fescue leaf galls (A. graminis), ear cochlea (or wheat gall) nematodes (Anguina tritici), shoot and leaf (or foliar) nematodes (Aphelenchoides spp., A. subtenuis), begonia leaf (or fern nematodes, or spring curling, or strawberry leaf, or strawberry summer stunt) (A. fragariae), fern nematodes (A. olesistus), rice nematodes (A. oryzae), currant nematodes (A. ribes), blackcurrant (or chrysanthemum) nematodes (A. ritzemabosi), chrysanthemum leaf or foliar nematodes (A. ritzemabosi), rice whitetip (or spring stunt, or strawberry shoot nematodes) (A. besseyi), edible fungal nematodes composticola), Atalodera (mushroom) (Aphelenchoides spp. (Atalodera lonlcerae, Atalodera ucri), spine nematodes (Bakernema variabile), sting nematodes (Belonolaimus spp., B. gracilis, B. longicaudatus), pine wood nematodes (Bursaphalenchus spp., B. xylophilus, B. mucronatus), sessile nematodes (Cacopaurus spp., C. epacris, C. pestis), amaranth cyst nematodes ( Cactodera amaranthi), birch cyst nematodes (C. betulae), cactus cyst nematodes (C.cacti), Estonian cyst nematodes (C. estonica), Thorne's cyst nematodes (C. thornei), weedy cyst (C. weissi), ring nematodes (Criconema spp.), spine nematodes (Criconema spp., C. civellae, C. decalineatum, C. spinalineatum), ring nematodes (Criconemella axeste, C. curvata, C. macrodora, C. parva), ring nematodes (Criconemoides spp., C. citri, C. simile), spine nematodes (Crossonema fimbriatum), eucalyptus cystoid nematodes (Cryphodera eucalypti), shoot nematodes, stem and bulb (Ditylenchus spp., D. angustus, D. dipsaci, D. destructor, D. intermedius), mushroom crop nematodes (D. punch nematodes (Dolichodorus spp., D. myceliophagus), heterocephalus, d heterocephalous), spear nematodes (Dorylaimus spp.), malforming nematodes (Geocenamus superbus), cyst nematodes (Globodera spp.), yarrow cyst nematodes (G. achilleae), yarrow cyst nematodes (G. millefolii), apple cyst nematodes ( G. mali), potato white cyst nematodes (G. pallida), golden nematodes (G. rostochiensis), tobacco cyst nematodes (G. tabacum), Osborne cyst nematodes (G. tabacum solanacearum), cyst of (G. Solanum tabacum virginiae), pin nematodes (Gracilacus spp., G. idalimus), spiral nematodes (Helicotylenchus spp., H. africanus, H. digonicus, H. dihystera, H. erythrinae, H. multicinctus, H. paragirus, H. pseudorobustus, H. solani, H. spicaudatus), pseudosheath nematodes (Hemicriconemoides spp., H. biformis, H. californianus, H. chitwoodi, H. floridensis, H. wessoni), sheath nematodes (Hemicycliophora spp., H. arenaria, H. biosphaera, H. megalodiscus, H. parvana, H. poranga, H. sheri, H. similis, H. striatula), cyst nematodes (Heterodera spp.), almond cyst nematodes (H. amygdali) , oat (or cereal) cyst nematodes (Jí. avenae), Cajanus (or little pea) cyst nematodes (H. cajani), common grass (or heart-shaped, or Valentina) cyst nematodes (H. cardiolata), carrot cyst nematodes (H. carotae), cabbage cyst nematodes or brassica root eelworm (H. cruciferae), Chive (or sedge) cyst nematodes (H. cyperi), Japanese cyst nematodes (H. elachista), Fig (or ficus, or gum tree) cyst nematodes (#. fici), Galeopsis cyst nematodes (H. galeopsidis), soybean cyst nematodes (H. wisteria), alfalfa root (or pea cyst) nematodes (H. goettingiana), buckwheat cyst nematodes (H. graduni), barley cyst nematodes (A hordecalis), hop cyst nematodes (JA humuli), Mediterranean cereal (or wheat) cyst nematodes (JA latipons), hespedeza cyst nematodes (H. lespedezae), Kansas cyst nematodes (H. longicolla ), cereal root eelworm or oat cyst nematodes (JA major), grass cyst nematodes (JA mani), alfalfa cyst nematodes (H. medicaginis), Cyperus (or Motha) cyst nematodes ( Heterodera mothi), rice cyst nematodes (JA oryzae), AmuDarya (or camel thorn cyst) nematodes (JA oxiana), nem Sorrel cyst nematodes (JA rosii), Rumex cyst nematodes (H. rumicis), beet cyst nematodes (H. schachtii), willow cyst nematodes (H. salixophila), Scleranthus cyst nematodes (H. scleranthii), lettuce cyst nematodes of hares (H. sonchophila), tadzhik cyst nematodes (H. tadshikistanica), Turkmen cyst nematodes (H. Turkmanica), trefoil cyst nematodes (H. trifolii), 100 cystoid nettle cyst nematodes (H. urticae), ustinov cyst nematodes (H. ustinovi), pinto pea cyst nematodes (H. vigni), corn cyst nematodes (H. zeae), root nematodes rice (Hirschmanniella spp., H. belli, H. caudacrena, H. gracilis, H.oryzae), spear nematodes {Koplolaimus spp.), Columbra nematodes (H. columbus), Cobb spear nematodes (H. galeatus), crown-headed lance nematodes (II. tylenchiformis), pseudo root-knot nematodes ^hypsoperine graminis), needle nematodes (Longidorus spp., L. africanus, L. sylphus), ring nematodes (Macroposthonia ( =Mesocriconema) xenoplax), nematodes (Meloidodera spp.), pine cystoid nematodes (M. floridensis), tadzhik cystoid nematodes (M. tadshikistanica), cystoid body nematodes (Meloidoderita spp.), stunting nematodes (Merlinius spp., M. brevidens, M. conicus, M. granáis, M. microdorus), root-knot nematodes (Meloidogyne spp., M. acronea, M. arenaria, M. artiellia, M. brevicauda, ​​M. camelliae, M. carolinensis, M. chitwoodi, M. exigua, M. graminicola, M. hapla, M. hispánica, M. incognita, M. incognita acrita, M. indica , M. inornata, M. javanica, M. kikuyuensis, M. konaensis, M. malí, M. microtyla, M. naasi, M. ovalis, M. platani, M. querciana, M. sasseri, M. tadshikistanica, M. . thamesi), Centaurea nematodes (Mesoanguina picridis), 101 Douglas-fir nematodes (Nacobbodera chitwoodi} , false root-knot nematodes (Nacobbus aberrans, N. batatiformis, N. dorsalis}, sour paste nematodes (Panagrellus redivivus} , beer nematodes (P. silusiae), needle nematodes (Paralongidorus microlaimus), spiral nematodes (Pararotylenchus spp.), stubby root nematodes (Paratrichodorus allius , P. minor, P. porosus, P. renifer), pin nematodes (Paratylenchus spp., P. baldaccii, P. bukowinensis, P. curvitatus, P. dianthus, P. elachistus, P. hamatus, P. holdemani, P. italiensis, P. lepidus, P. nanus, P. neoamplycephalus, P. similis), lesion (or prairie) nematodes (Pratylenchus spp., P. alleni, P. brachyurus, P. coffeae, P. convallariae, P. crenatus, P. flakkensis, P. goodeyí, P. hexincisus, P. leiocephalus, P. minyus, P. musicola, P. neglectus, P. penetrans, P. pratensis , P. scribneri, P. thornei, P. vulnus, P. zeae), stem-knot nematodes (Pterotylenchus cecidogenus), grass cyst nematodes (Punctodera punctate), stunting nematodes (Quinisulcius acutus, Q. capitatus), nematodes burrowers (Radopholus spp.}, banana root nematodes (R. similis}, rice root nematodes (R. oryzae), red ring (or coconut, or coconut) nematodes (Rhadinaphelenchus cocophilus), reniform nematodes (Rotylenchulus spp., R. reniformis, R. parvus), spiral nematodes (Rotylenchus spp., R. 102 buxophilus, R. christiei, R. robustus}, Thorne's spear nematodes (J?. un i forráis} , Sarisodera hydrophylla, spiral nematodes (Scutellonema spp., S. blaberum, S. brachyurum, S. bradys, S clathricaudatum, S. christiei, S. conicephalum}, grass root-knot nematodes (Subanquina radicicola), round cystoid nematodes (Thecavermi cu la tus andinus), stubby root nematodes (Trichodorus spp., T. christiei, T. kurumeensis, T. pachydermis, T. primitivus), vinegar eels (or nematodes) (Turbatrix aceti), stunting (or stylet) nematodes (Tylenchorhynchus spp., T. agri, T. annulatus, T. aspericutis, T. claytoni , T. ebriensis, T. elegans, T. golden, T. graciliformis, T. martini, T. mashhoodi, T. microconus, T. nudus, T. oleraceae, T. penniseti, T. punensis), citrus nematodes ( Tylenchulus semipenetrans), and dagger nematodes (Xiphinema spp., X. americanum, X. bakeri, X. brasiliense, X. brevicolle, X. chambersi, X. coxi, X. diversicaudatum X. Index, X. insigne, X. nigeriense, X. radicicola, X. setariae, X. vulgarae, X. vuittenezi). Phytopathogenic insects controlled by the methods described herein include, without limitation, the larvae of non-culicidae insects of the orders (a) Lepidoptera, for example, Acleris sp., Adoxophyes sp., Aegeria sp., Agrotis sp. ., Alabama argillaceae, Amylois sp., Anticarsia gemmatalis, Archips 103 sp., Argyrotaenia sp., Autographa sp., Busseola fusca, Cadra cautella, Carposina nipponensis, Chilo sp., Choristoneura sp., Clysia ambiguella, Cnaphalocrocis sp., Cnephasia sp., Cochylis sp., Coleophora sp., Crocidolomia binotalis , Cryptophlebia leucotreta, Cydia sp., Diatraea sp., Diparopsis castanea, Earias sp., Ephestia sp., Eucosma sp., Eupoecilia ambiguella, Euproctis sp., Euxoa sp., Grapholita sp., Hedya nubiferana, Heliothis sp., Hellula undalis, Hyphantria cunea, Keiferia lycopersicella, Leucoptera scitella, Lithocollethis sp., Lobesia botrana, Lymantria sp., Lyonetia sp., Malacosoma sp., Mamestra brassicae, Manduca sexta, Operophtera sp., Ostrinia nubilalis, Pammene sp., Pandemis sp. , Panolis flammea, Pectinophora gossypiella, Phthorimaea operculella, Pieris rapae, Pieris sp., Plutella xylostella, Prays sp., Scirpophaga sp., Sesamia sp., Sparganothis sp., Spodoptera sp., Synanthedon sp., Thaumetopoea sp., Tortrix sp. . , Trichoplusia ni or Yponomeuta sp.; (b) Coleoptera, eg Agriotes sp., Anthonomus sp., Atomaria linearis, Chaetocnema tibialis, Cosmopolites sp., Curculio sp., Dermestes sp., Diabrotica sp., Epilachna sp., Eremnus sp., Leptinotarsa ​​decemlineata, Lissorhoptrus sp., Melolontha sp., Orycaephilus sp., Otiorhynchus sp., Phlyctinus sp., Popillia sp., Psylliodes sp., Rhizopertha spp-, Scarabeidae, Sitophilus sp., Sitotroga sp., Tenebrio sp., Tribolium sp. or Trogoderma sp.; 104 (c) Orthoptera, for example, Blatta sp., Blattella sp., Gryllotalpa sp. Periplaneta sp. , Leucophaea Maderae, Locusta sp., or Schistocerca sp.; (d) Isoptera, eg Reticulitermes sp.; (e) Psocoptera, eg Liposcelis sp.; (f) Anoplura, eg Haematopinus sp., Linognathus sp., Pediculus sp., Pemphigus sp. or Phylloxera sp.; (g) Mallophaga, eg Damalinea sp. or Trichodectes sp.; (h) Thysanoptera, for example Franklíniella sp., Hercinotnrips sp., Taeniothrips sp., Thrips palmi, Thrips tabaci or Scirtothrips aurantii; (i) Heteroptera, eg Cimex sp., Distantiella theobroma, Dysdercus sp., Euchistus sp., Eurygaster sp., Leptocorisa sp., Nezara sp., Piesma sp., Rhodnius sp., Sahlbergella singularis, Scotinophara sp. or Tniatoma sp.; (j) Homoptera, eg Aleurothrixus floccosus, Aleyrodes brassicae, Aonidiella sp., Aphididae, Aphis sp., Aspidiotus sp., Bemisia tabaci, Ceroplaster sp., Chrysomphalus aonidium, Chrysomphalus dictyospermi, Coccus hesperidum, Empoasca sp., Eriosoma larigerum , Erythroneura sp., Gascardia sp., Laodelphax sp., Lecanium corni, Lepidosaphes sp., Macrosiphus sp., Myzus sp., Nephotettix sp., Nilaparvata sp., Paratoria sp., Pemphigus sp., Planococcus sp., Pseudaulacaspis sp. ., Pseudococcus sp., Psyila sp., Pulvinaria aethiopica, Quadraspidiotus sp., Rhopalosiphum sp., Saissetia sp., Scaphoideus sp., Schizaphis sp., 105 Sitobion sp., Trialeurodes vaporariorum, Trioza erytreae or Unaspis citri; (k) Hymenoptera, eg Acromyrmex, Atta sp., Cephus sp., Diprion sp., Diprionidae, Gilpinia polytoma, Hoplocampa sp., Lasius sp., Monomorium pharaonis, Neodiprion sp., Solenopsis sp. or Vespa sp.; (1) Diptera, for example, Aedes sp., Antherigona soccata, Bibio hortulanus, Calliphora erythrocephala, Ceratitis sp., Chrysomyia sp., Culex sp., Cuterebra sp., Dacus sp., Drosophila melanogaster, Fannia sp., Gastrophilus sp. ., Glossina sp., Hypoderma sp., Hyppobosca sp., Liriomyza sp., Lucilia sp., Melanagromyza sp., Musca sp., Oestrus sp., Orseolia sp., Oscinella frit, Pegomyia hyoscyamí, Phorbia sp., Rhagoletis pomonella , Solara sp., Stomoxys sp., Tabanus sp., Tannia sp. or Tipula sp.; (m) Siphonaptera, eg Ceratophyllus sp. or Xenopsylla cheopis; or (n) Thysanura, eg Lepisma saccharina. The pesticidal compositions disclosed herein can further be used to control cruciferous flea beetles (Phyllotreta spp.), rootworms {Delia spp.), cabbage seed pod weevil (Ceutorhynchus spp.), and aphids in oilseed crops such as canola (rapeseed), mustard seed, and hybrids thereof, and also rice and maize. In a particular embodiment, the insect is a member of Spodoptera, more particularly Spodoptera exigua, Myzus 106 persicae, Plutella xylostella or Euschistus sp. Application of a pest-controlling effective amount of a pesticidal composition as described herein is provided. In other words, this pesticidal composition is applied, alone or in combination with another pesticidal substance, in an effective amount to control pests or to obtain a pesticidal effect. An effective amount is defined as an amount of a pesticidal composition, alone or in combination with another pesticidal substance, that is sufficient to prevent or modulate a pest infestation. The amount and rate that are effective may be affected by the pest species present, their stage of growth, the density of the populations they constitute, or environmental factors such as temperature, wind speed, rain, time of day or season. The amount that is within an effective range for a particular case can be determined with laboratory or field analysis. Application methods When used in methods of modulating pest infestations, the pesticidal compositions described herein can be applied using methods known in the art. Specifically, these compositions can be applied by spraying, for 107 immersion, on the growing medium around the plants (for example, the soil), in the root zone, submerging the roots before sowing, by irrigation, in the case of grass or similar plants, or in granular form on the ground. In the context of the present invention, plants encompass all plants and plant populations, such as wild plants, wanted or unwanted, or crop plants (including naturally occurring crop plants). Crop plants can be plants obtained using conventional breeding and breeding methods, biotechnological or genetic engineering methods, or combinations of these methods, including transgenic plants and plant varieties protected or not protected by human rights. growers. Plant parts encompass all plant parts and organs found above or below ground, such as shoots, leaves, flowers or roots, among which may be mentioned by way of particular examples are leaves, needles, stems, stems, flowers, fruit bodies, fruits, seeds, roots, tubers and rhizomes. Plant parts also include harvested material, vegetative material, and generative propagating material, for example, cuttings, tubers, 108 rhizomes, the shoots or the seeds. Application can be external (for example, by spraying, misting, or brush application) or internal (for example, by injection, through transfection, or by use of an insect vector). ). When an internal application is made, the compositions can be intracellular or extracellular (for example, present in the vascular system of plants, or present in the extracellular space). The treatment of the plants or parts of them with the compositions as previously established can be carried out directly or by allowing the compositions to act on the environment, the habitat or the space where the plants are stored, for example, by means of of a process of immersion, spraying, evaporation, nebulization, spreading, application with a brush, injection. When the compositions are applied to seeds, the application can be made in one or more layers prior to sowing of the seed, according to methods known in the art. The pesticidal compositions described herein can also be applied to seeds, for example as a coating. Various tackifiers (adhesives) can be used in making the 109 coatings for the seeds, such as methylcellulose, alginate, carrageenan or polyvinyl alcohol. The adherent is dissolved in water at a percentage between 1 and 10% and stored at room temperature before applying it to the seeds. The seeds are soaked in the adherent solution (at a rate of 3 ml / 100 seeds) for 15 minutes, then they are extracted, mixed with the organic matter (at a rate of 1.5 g / 100 seeds) in plastic bags and shake vigorously. This process can also be automated using a seed coating machine. To prime seeds with compositions such as those described herein, they are soaked in twice the volume of a sterile distilled water-based suspension containing bacterial / protein / nucleic acid suspensions, or in a formulation based on talc (a dry formulation), at a rate of between 4 and 10 g / kg of seeds, depending on the size of the seeds, and incubate them at 25°C + 2°C for 12-24 hours. The suspension is drained off and the seeds are dried in the shade for 30 minutes and used for sowing. The compositions may also be used as soil modifying agents, for example, in combination with an appropriate carrier, such as a talc-based formulation. Soil amendment formulations also 110 may include clays, emulsifiers, surface active agents or stabilizers, which are known in the art. To prepare the talc-based formulations, one kg of purified talc powder (sterilized for 12 hours), 15 g of calcium carbonate and 10 g of carboxymethyl cellulose are mixed under aseptic conditions, according to the method of Nandakumar et al. . (2001). The suspensions of protein and nucleic acid or the organisms that express them are mixed in a ratio of 1:2.5 (between the suspension and the dry mixture) and the product is dried in the shade to reduce the moisture content to between 20 and 35%. When used as soil amendment agents, formulations (eg talc-based formulations) can be applied at rates between 2.5 and 10 kg per hectare, at planting time and / or at times different after emergence, depending on the crops. The compositions described herein can also be applied to the ground according to methods known in the art. See, for example, the USDA website, naldc.nal.usda.gov / download / 43874 / pdf, dated February 20, 2013. These methods include, but are not limited to, fumigation, drip irrigation, chemical irrigation, 111 application of granules, application of sprays, incorporation into the soil (for example, by application of granules), drenching of the soil, treatment of seeds, coating of seeds or soaking of bare roots. plant transformation The nucleic acids disclosed herein can be introduced into, and optionally expressed in, plants using any of a number of plant transformation techniques. Plant transformation can be carried out with a single DNA species or with multiple DNA species (ie, co-transformation). In certain embodiments, C. subtsugae protein or polypeptide (eg, a toxin) is expressed in a plant and provides protection to the plant against insect pests. For example, a nucleotide sequence as disclosed herein can be inserted into an expression cassette, which can optionally be stably integrated into a plant chromosome. In certain embodiments, the nucleotide sequence is included in a nonpathogenic, self-replicating virus. Plants transformed in accordance with the present disclosure may be monocotyledonous or dicotyledonous and include but are not limited to corn, wheat, barley, rye, sweet potato, broad bean, pea, radicchio, lettuce, cabbage, cauliflower, 112 broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, pumpkin, pumpkin, hemp, courgette, apple, pear, quince, melon, plum, cherry, apricot, strawberry, papaya, avocado, mango, banana , alfalfa, rice, potato, eggplant, peach, cotton, carrot, tobacco, sorghum, nectarine, beet, sugarcane, sunflower, soybean, tomato, pineapple, grape, raspberry, blackberry, cucumber, Arabidopsis, and woody plants such such as conifers and deciduous trees. Once the desired nucleotide sequence has been introduced into a particular species of plant, it can be propagated in that species, or transferred to other varieties of the same species, particularly including commercial varieties, using traditional breeding techniques. . DNA can be introduced into plant cells through the use of a number of art-recognized methods. Those skilled in the art will appreciate that the choice of methods may depend on the type of plant targeted for transformation. Suitable methods for transforming plant cells are as follows. Agrobacterium-mediated transformation An important method of DNA transfer in plants is Agrobacterium-mediated transformation. The naturally occurring soil bacterium Agrobacterium tumefaciens is capable of 113 of infecting a wide range of plant species, causing crown gall diseases. When A. tumefaciens infects a cell, it transfers a copy of its T-DNA, which is a small section of DNA carried on its Ti (Tumor Inducer) plasmid. T-DNA is flanked by two 25 base pair (imperfect) repeats. Any DNA contained within these borders will be transferred to the host cell. Zupan and Zambriski, 1995. The T-DNA section in the Ti plasmid can be replaced by a transgene linked to one or more appropriate regulatory sequences. Recombinant A. tumeficiens containing a Ti plasmid comprising exogenous nucleotide sequences can then be used to infect cell cultures or regenerating protoplasts (ie, spherical plant cells without wall). Gene markers such as those coding for antibiotic resistance can be included in the Ti plasmid construct so that it is possible to select for cells that have been transformed with the bacterium. Cell-to-plant regeneration is carried out on selected cells by standard methods. See, for example, Zupan and Zambriski (1995) and Jones et al. (2005) Plant Methods. Agrobacterium tumefaciens can be used to transform many species of dicotyledonous plants with relative ease. Hinchee et al., Biotechnology 6:915-921 114 (1988). See also Ishida et al., Nature Biotechnology 14:745-750 (June 1996) for a description of maize transformation. biolistic administration This method, also known as particle bombardment, involves directly shooting a DNA molecule into recipient plant tissue, using a gene gun. Tungsten or gold spheres (which are smaller than the plant cells themselves) are coated with the DNA of interest and fired through a stop screen, accelerated with Helium, into the plant tissue. The particles pass through the plant cells, leaving the DNA inside. This method can be used successfully on both monocot and dicot species. Transformed tissue can be selected using marker genes such as those that code for antibiotic resistance. Whole plants, containing one copy of the transgene in all cells, can be regenerated from transformed totipotent cells in culture (Nottingham, 1998), using devices available from Agracetus, Inc. (Madison, WI) and Dupont, Inc. ( Wilmington, OF) . Methods for biolistic transformation of plants are known in the art. See, eg, Sanford et al., US Patent No. 4,945,050; McCabe et al., 115 Biotechnology 6923-926 (1988); Weissinger et al., Annual Rev Genet. 22-421-477 (1988); Sanford et al., Particulate Science and Technology 5.27-37 (1987) (onion); Svab et al., Proc. Nati. Acad. Sci. USA 87-8526-8530 (1990) (tobacco chloroplast); Christou et al., Plant Physiol 87,671-674 (1988)(soy); McCabe et al., BioTechnology 6,923,926 (1988)(soy); Klein et al., Proc. Nati. Acad. Sci. USA, 85:4305-4309 (1988) (corn); Klein et al., BioTechnology 6,559-563 (1988) (corn); Klein et al., Plant Physiol. 91,440-444 (1988) (corn); Fromm et al., BioTechnology 8:833839 (1990); Gordon-Kamm et al., Plant Cell 2: 603-618 (1990) (corn); Koziel et al., Biotechnology 11: 194-200 (1993) (corn); Shimamoto et al., Nature 338: 274-277 (1989) (rice); Christou et al., Biotechnology 9: 957-962 (1991) (rice); Datta et al., BioTechnology 8736-740 (1990) (rice); European Patent Application EP 0 332 581 (dactylis and other Pooideae); Vasil et al., Biotechnology 11: 1553-1558 (1993) (wheat); Weeks et al., Plant Physiol. 102:1077-1084 (1993) (wheat); Wan et al., Plant Physiol. 104:37-48 (1994) (barley); Jahne et al., Theor. App. Genet. 89:525-533 (1994)(barley); Umbeck et al., BioTechnology 5:263-266 (1987) (cotton); Casas et al., Proc. Nati. Acad. Sci. USA 90:11212-11216 (December 1993) (sorghum); Somers et al., BioTechnology 10:1589-1594 (December 1992) (oats); Torbert et al., Plant Cell Reports 14:635-640 (1995) 116 (oats); Weeks et al., Plant Physiol. 102:1077-1084 (1993) (wheat); Chang et al., WO 94 / 13822 (wheat) and Nehra et al., The Plant Journal 5:285-297 (1994) (wheat). Methods for the introduction of recombinant DNA molecules into maize by microprojectile bombardment can be found in Koziel et al., Biotechnology 11:194200(1993), Hill et al., Euphytica 85:119-123 (1995) and Koziel et al. ., Annals of the New York Academy of Sciences 792:164-171 (1996). Protoplast transformation and other methods Another method for introducing nucleic acid molecules into plants is the protoplast transformation method for maize as disclosed in EP 0 292 435. Other delivery systems for gene transfer to plants include electroporation (Riggs et al., Proc. Nati. Acad, Sci. USA 83:5602-5606 (1986), microinjection (Crossway et al., BioTechniques 4:320-334 (1986), transfer silicon carbide-mediated DNA transfer, direct gene transfer (Paszkowski et al., EMBO J. 3:2717-2722 (1984); Hayashimoto et al., Plant Physiol 93,857-863 (1990) (rice). Plastid transformation In one embodiment, a nucleotide sequence as disclosed herein is directly transformed into the genome of a plastid (eg, chloroplast). The Advantages of plastid transformation include the ability of plastids to express bacterial genes without substantial modification of bacterial sequences, and the ability of plastids to express multiple open reading frames under the control of a single promoter. Plastid transformation technology is described in US Patent Nos. 5,451,513; 5,545,817 and 5,545,818; in PCT Application No. WO 95 / 16783, and in McBride et al. (1994) Proc. Nati. Acad. Sci. USA 91.7301-7305. The basic technique for chloroplast transformation involves the introduction of regions of cloned plastid DNA surrounding a selectable marker, along with the gene of interest, into a suitable soft tissue using, for example, biolistic or protoplast transformation (eg, mediated by calcium chloride or PEG). Surrounding regions of between 1 and 1.5 kb, called targeting sequences, facilitate homologous recombination with the plastid genome and thus allow replacement or modification of specific regions of the plastid genome. Initially, point mutations in the chloroplast 16S rRNA and rpsl2 genes that confer resistance to spectinomycin and / or streptomycin were used as selection markers for transformation (Svab, Z. et al. (1990) Proc. Nati. Acad. Sci. USA 87, 8526-8530; Staub, J. M., and 118 Maliga, P. (1992) Plant Cell 4, 39-45); resulting in the production of stable homoplasmic transformants at a frequency of approximately one per 100 bombardments of target sheets. The presence of cloning sites between these markers allowed the creation of a plastid targeting vector for the introduction of foreign genes. Staub, J.M., and Maliga, P. (1993) EMBO J. 12: 601-606. Substantial increases in transformation frequency were obtained by replacing recessive rRNA or antibiotic resistance protein genes with a dominant selection marker, the bacterial AADA gene encoding the detoxifying enzyme spectinomycin aminoglycoside-3' adenyltransferase. Svab, Z., and Maliga, P. (1993) Proc. Nati. Acad. Sci. USA 90:913917. Previously, this marker had been used successfully for high-frequency transformation of the plastid genome of the green alga Chlamydomonas reinhardtii. Goldschmidt-Clermont, M. (1991) Nuci. Acids Res. 19: 40834089. Other useful selectable markers for plastid transformation are known in the art and are encompassed within the scope of this disclosure. Typically, approximately 15 to 20 cycles of cell division are required after transformation to reach a homoplastidic state. The expression of 119 plastids, in which genes insert by homologous recombination into all of the several thousand copies of the circular plastid genome present in each plant cell, take advantage of the enormous number of copies, compared to nuclear genes, to achieve expression levels that they can easily exceed 10% of the total soluble protein. Accordingly, in certain embodiments, a nucleotide sequence as disclosed herein is inserted into a plastid targeting vector and transformed into a plastid genome of a desired plant host. Homoplastic plants are obtained for plastid genomes containing a nucleotide sequence of interest, and these are capable of expressing a high level of the nucleotide sequence. magnification Magnification is a transient expression process that relies on the expression of viral RNA replicons that are delivered to plant cells systemically using Agrobacterium. This method allows the production of recombinant proteins in yields of up to 5 g per kg of fresh leaf biomass, which is close to the biological limits for protein expression. Such high levels are possible due to the transient nature of the process, which allows the use of very potent amplicons derived from RNA viruses such as mosaic viruses. 120 tobacco (TMV) or potato virus X, without limiting the accumulation of biomass, which takes place before infection. See, for example, Marillonnet et al. (2005) Nature Biotechnol.. 23(6):718-723. A further disclosure of methods and compositions for the genetic modification of plants is provided in Bircher, JA (ed.) Plant Chromosome Engineering: Methods and protocols. Methods in Molecular Biology, vol.701, Springer Science + Business Media, 2011. Transgenic plants and seeds Transgenic plants that are derived from plant cells can be grown to generate transgenic plants that have an improved trait compared to a control plant and produce transgenic seeds and haploid pollen of this invention. Such plants with improved traits are identified by selection for the improved trait in the transformed plants and the progeny seeds. For efficiency reasons, a screening method is designed to evaluate multiple transgenic plants (events) including the recombinant DNA, eg multiple plants with between 2 and 20 or more transgenic events. Transgenic plants grown from the transgenic seeds provided herein demonstrate improved agronomic traits that contribute to increased yields or other traits that provide increased plant value, including, for example, 121 better quality of seed. Of particular interest are plants that have better water use efficiency, better cold tolerance, higher yield, better nitrogen use efficiency, better seed protein and better seed oil. Transgenic plants include, but are not limited to, corn, soybeans, cotton, canola, alfalfa, wheat, rice, sugar cane, beet seed, millet, barley, peanuts, snow peas, sorghum, vegetables (including a, a non-exhaustive enunciative title, broccoli, cauliflower, cabbage, radish, Chinese cabbage, melon, watermelon, cucumber, pumpkin, squash, pepper, tomato, eggplant, onion, carrot, garden beans, sweet corn, peas, dry beans, okra, spinach, leek, lettuce, and fennel), grapes, berries (including blueberry, blackberry, raspberry, blackberry, blackberry, etc.), cherry and related fruit trees (including, but not limited to, plum, peach , apricot, kiwi, pomegranate, mango, fig), fruit trees (including, without limitation, orange, lemon, lime, red orange, grapes, and the like), shell fruit trees (including, without limitation, non-exhaustive, coconut, walnut (English and black), pecan, almond, hazelnut a, Brazil nut, American walnut, acorn, and the like), sunflower, other oil seed-producing plants, or any combination thereof. 122 Plant growth promotion The compositions disclosed herein, in particular, nucleic acids and polypeptides from C. subtsugae, can be used to modulate or more particularly to promote the growth of plants, for example crops such as fruits (eg strawberries), vegetables (for example, tomato, squash, pepper, eggplant), grain crops (for example, soybeans, wheat, rice, corn), trees, flowers, ornamentals, shrubs (for example, cotton, roses), bulbous plants (eg, onion, garlic) grapevine (eg, grapes), and grass (eg, Bermuda grass, Kentucky grass, fescue). The compositions can also be used to modulate the germination of one or more seeds in one or more plants. The C. subtsugae nucleic acids and polypeptides, or a formulated product thereof, may be used alone or in combination with one or more other components as described below, such as growth promoting agents and / or anti-phytopathogenic agents. in a tank mix or on a schedule (sequential application called rotation) with predetermined order and application interval throughout the growing season. When used in combination with the aforementioned products, at a concentration less than that recommended on the product label, the combined efficacy of the two or 123 plus products (one of which is the composition disclosed herein) is, in certain embodiments, greater than the sum of each individual component effect. Therefore, the effect is increased by the synergism between these two (or more) products, and the risk of development of pesticide resistance among pathogenic strains of plants is reduced. The composition can be applied by root immersion at the time of transplanting, specifically by treating a fruit or vegetable with the composition by immersing roots of the fruit or vegetable in a suspension of said composition (between about 0.25 and about 1.5% and more particularly between about 0.5% and about 1.0% by volume) before transplanting the fruit or vegetable to the ground. Alternatively, the composition can be applied by drip or other irrigation system. Specifically, the composition can be injected into a drip irrigation system. In a particular embodiment, the composition is applied in a solution having a concentration of 1x108 CFU / mL at a rate of between about 11 and about 4 quarts per acre. In yet another embodiment, the composition may be added as a furrow application. Specifically, the 124 composition can be added as an in-furrow spray at planting using nozzles calibrated to deliver a total output of between 2 and 6 gallons / acre. The nozzles can be attached to a furrow opener on the planter so that the application of pesticide and the falling of the seed into the furrow are simultaneous. Mixtures of the disclosed compositions with, for example, a solid or liquid adjuvant are prepared in a manner known in the art. For example, blends can be prepared by homogeneously blending and / or milling the active ingredients with extenders such as solvents, solid carriers and, where appropriate, surface active compounds (surfactants). The compositions may also contain additional ingredients such as stabilizers, viscosity regulators, binders, adjuvants as well as fertilizers or other active ingredients in order to obtain additional desired effects. Combinations with plant growth promoting agents The compositions disclosed herein can be used in combination with other growth promoting agents such as synthetic or organic fertilizers (eg, diammonium phosphate, in granular or liquid form), compost tea, extracts of algae 125 marine, plant growth hormones such as IAA (indoleacetic acid) used in a rooting hormone treatment for transplants alone or in combination with plant growth regulators such as IBA (indolebutyric acid) and NAA (naphthaleneacetic acid), and promoter microbes such as, for example, methylotrophs, PPFM (pink-pigmented facultative methylotrophs), Bacillus spp., Pseudomonads, Rhizobia, and Trichoderma. Seed treatment / coating agents The compositions disclosed herein can also be used in combination with seed coating agents. Such seed coating agents include, but are not limited to, ethylene glycol, polyethylene glycol, chitosan, carboxymethyl chitosan, peat moss, resins and waxes, or chemical fungicides or bactericides with a single-site, multi-site, or unknown mode of action. . The seed treatment methods described herein can be used in connection with any plant species and / or the seeds thereof. In various embodiments, however, the methods are used in connection with seeds of plant species that are agronomically important, in particular, the seeds may be corn, peanuts, canola / rapeseed, soybeans, cucurbits, 126 cruciferous crops, cotton, beets, rice, sorghum, sweet beets, wheat, barley, rye, sunflower, tomato, sugar cane, tobacco, oats, as well as other vegetables and leafy crops. In some embodiments, the seed is corn, soybean, or cottonseed. The seed may be a transgenic seed from which a transgenic plant can be grown that incorporates a transgenic event that confers, for example, tolerance to a particular herbicide or combination of herbicides, increased disease resistance, increased stress tolerance, and / or higher performance. Transgenic seeds include, but are not limited to, corn, soybean and cotton seeds. Antiphytopathogenic agents The compositions disclosed herein can also be used in combination with other antiphytopathogenic agents, such as plant extracts, biopesticides, inorganic crop protectants (such as copper), surfactants (such as rhamnolipids; Gandhi et al., 2007) or natural oils such as paraffin oil and tea tree oil which possess chemical pesticidal or fungicidal or bactericidal properties with single-site, multi-site or unknown mode of action. As defined herein, an antiphytopathogenic agent is an agent that modulates the growth 127 of a plant pathogen, in particular a pathogen that causes soil-borne disease in a plant, or alternatively prevents infection of a plant by a plant pathogen. Plant pathogens include but are not limited to fungi, bacteria, actinomycetes and viruses. An antiphytopathogenic agent may be a single site antifungal agent which may include, but is not limited to, benzimidazole, a demethylation inhibitor (DMI) (eg, imidazole, piperazine, pyrimidine, triazole), morpholine, hydroxypyrimidine, anilinopyrimidine, phosphorothiolate , quinone external inhibitor, quinoline, dicarboximide, carboximide, phenylamide, anilinopyrimidine, phenylpyrrole, aromatic hydrocarbon, cinnamic acid, hydroxyanilide, antibiotic, polyoxine, acylamine, phthalimide, benzenoid (xylylalanine). In a more particular embodiment, the antifungal agent is a demethylation inhibitor selected from the group consisting of imidazole, piperazine, pyrimidine, and triazole (for example, bitertanol, myclobutanil, penconazole, propiconazole, triadimefon, bromuconazole, cyproconazole, diniconazole , fenbuconazole, hexaconazole, tebuconazole, tetraconazole). In a more particular embodiment, the antifungal agent is myclobutanil. In yet another particular embodiment, the antifungal agent is a 128 external quinone inhibitor (eg, strobilurin). Strobilurin may include but is not limited to azoxystrobin, cresoxym-methyl, or trifloxystrobin. In yet another particular embodiment, the antifungal agent is a quinone, for example, quinoxyphene (5,7-dichloro-4-quinolyl 4-fluorophenyl ether). In yet another embodiment, the fungicide is a non-inorganic multi-site chemical fungicide, which is selected from the group consisting of chloronitrile, quinoxaline, sulfamide, phosphonate, phosphite, dithiocarbamate, chloralkylethies, phenylpyridine-amine, and cyano-acetamide oxime. . In yet another embodiment, the antiphytopathogenic agent can be streptomycin, tetracycline, oxytetracycline, copper, or kasugamycin. bioremediation The C. subtsugae genome encodes genes involved in the metabolism of, inter alia, phosphorus, iron, and aromatic compounds. See, for example, Table 6 supra. Said genes and their gene products can be used in bioremediation methods. For example, genes and sequences related to metal transport, metal accumulation, organic compound degradation, and other metabolite transformations can be modified in plants for the purpose of applying the transformed plant for bioremediation of soils, sediment, water, and others polluted substrates. The protocols for 129 processing Indian mustard (Brassica juncea), sunflower (Helianthus annus), tomato, and yellow poplar (Liriodendron tulipifera) are known. See, for example, Eapen and D'Souza (2005); Mello-Farias and Chavez (2008). Plants can be transformed with genes encoding cytochrome P450 to increase their resistance to particular contaminants, both organic and inorganic. Transformation with nucleic acids encoding enzymes involved in glutathione conjugation (eg, glutathione S-transferases) can increase xenobiotic detoxification rates. Plants expressing bacterial nitroreductases can be used for the detoxification of organic nitrate compounds, such as explosives. Uses of transgenic plants for phytoremediation applications have been described, for example, in Abhilash et al. (2009); Van Aken et al. (2010); Doty (2008) and Macek et al. (2008). Table 2 below gives additional information to the present disclosure on Chromobacterium substague proteins. Table 2 MW Function Name Nucleotide sequences Sequences Apparent protein amino acid homology Soottl 130 (SDSPAGE) ~20kDa >f±g|6666666.22288.peg.22 23[MBI-203 sp.] [proteina hipotética] atgtctttgactaccgattttctgg agaacccgcaggctttcatgcgttc tcaggcgatattgattccggcgcag gttccgcccggcaacggcaaatacc agttcgcggcgcagggcgcgcacgc ggcggtgctgcagtccaccgccgcc agcccgaacatccccggtttttacg cgcatccggtggccaacaacatcaa tctgttcgtgctgcccacccagcag ccggcaaggtattacatgttcaccg acggcatgaacggctgccagtttct ggcctacgggccggacaggcagcac atcaccgtcgagcacaacaacttca tcggcgacccgacgcgctacgcggc gcggctggcggaggtggtggcgctg aagccggcctatctgctgcatatca gcccgtcgggggtcaataacatccc ggccggccaatacaacagccagcag ggggtgaacatcgtcggcgaatacg MSLTTDFLENQAFMRSQ AILIPAQVPPGNGKYQFA AQGAHAAVLQSTAAS PNI PGFYAHPVANNINFVLP TQQPARYYMFTDGMNGCQ FLAYGPDRQHITVEHNNF IGDPTRYAARLAEVVALK PAYLLHI SPSGVNNIPAG QYNSQQGVNIVGEYGQAN GWRFWVRDRVDQNQGTVY GPL (SEQ ID NO:1) extracellular, Secreted. gccaggccaacggctggcgcttctg Scott2 Protease ~20 kDa 131 ggtgcgggacagggtggaccagaac cagggcacggtgtacgggccgctgt aa (SEQ ID NO:4) >fig|6666666.22288.peg.35 [MBI-203 sp.] [probable precursor de proteasa] atggacaagagattgccagccgtgg ccgcggctttgctgttggcggcttc cgccgctcacgccggcgacctgcag gtcagcctggggcagccggtggtca gcgcgggtcaggacgttgacgtcgc tttgacttaccgcaataccggcaag gagaccttgcacgtgtaccgctggt tcgtgcccggcaaggaactgcagga gcagtttctggcggtgaatgtgaac ggcaagccggccgagtacctgggcc cgcgctacaagcgcgtggtgccgtc gctgcgcgacaccgtggcgctggcg cccggcgccacgctgaacgccaagg tgagggtgtccgagtattacgacct gtccaagccgggccagctgagcgtc cgttttgaaagcagcagcaacaagg tgctcaaccgcagcctgccggccgg MDKRL PAVAAALLLAAS A AHAGDLQVSLGQPVVSAG QDVDVALTYRNTGKETLH VYRWFVPGKELQEQFLAV NVNGKPAEYLGPRYKRVV PSLRDTVALAPGATLNAK VRVSEYYDLSKPGQLSVR FESSSNKVLNRSLPAGVN AKQAAAPQADEAISSNVV GAYSAGSVSPLLTKSKAA KQEWQVLSRSAVSGVSYA GNCSVSQQSQSRDGVLAA SAMASETAAYLAGTPSGT PRFTTWFGKYSQANWTTA KSHYVNIKDALDSKPIKL DCSCTDGGTYAYVYPGQP YTVYLCGAFWTAPTKGTD SKGTLVHELSHFTVVAG TQDHVYGQAGAKSLAKSN PAQALDNADNHEYFAENT PQQ (SEQ ID NO:2) protease BLASTp C. violaceum domain of peptidase M35, metalloendopeptidase specific for Lysine, Zn-binding domain. 132 cgtcaatgccaagcaggcggccgcg ccgcaggccgacgaggccatttcct ccaatgtggtgggcgcctacagcgc cggcagcgtcagccccttgctgacc aagtccaaggcggccaagcaggagt ggcaggtgctcagccgcagcgcggt cagcggcgtcagctacgccggcaat tgctcggtcagccagcagtcgcaat cgcgcgacggcgtgctggccgccag cgccatggccagcgaaacggcggcc tacctggccggcacgccgtccggca cgccgcgcttcaccacttggttcgg caagtacagccaggccaactggacc accgccaagtcgcattacgtcaaca tcaaggatgcgctggacagcaagcc gatcaagctggattgcagctgcacc gacggcggcacttatgcctacgtct atccggggcagccgtacaccgtcta tctgtgcggcgctttctggaccgcg ccgaccaagggcaccgactccaagg gcggcaccctggtgcatgagttgtc gcacttcaccgtggtggcgggcacc caggaccatgtctatggccaggccg gcgccaagagcctggccaagagcaa cccggcccaggccttggacaatgcc 133 gacaaccatgaatacttcgccgaga acaccccggcgcagcagtaa (SEQ Scott3 Metalloprotease kDa ID N0:5) >fig|6666666.22288.peg.17 [MBI-203 sp.] [Vibriolysin, extracellular zn protease (EC 3.4.24.25) @ Pseudolysin, extracellular zinc protease (EC 3.4.24.26) ] atgagaaaacagcaattgatgttgc gtggtttggtcctgtccgccctggc tgtgttcagctcggcggcgctggcg gccgagcgtatcgacctggaaaagc tgggcaagatccaggccaacggcgc ggtggcgttcaccggcgtgaaccag gctgatctgaagcccctgcgcagca cccaattcgccaccggcaaagtggt gacccgcttccagcagtactaccag ggcgtgccggtatggggcgaagccg tggtcgaggaaaaacaggccggcgc cgtggccaagaccagcggcaaacta tccggccaatacatcgccggcatcc agtccgacctggcttccgccaagcc MRKQQLMLRGLVLSALAV FSSAALAAERIDLEKLGK IQANGAVAFTGVNQADLK PLRSTQFATGKVVTRFQQ YYQGVPVWGEAVVEEKQA GAVAKT SGKLSGQYIAGI QSDLASAKPTLSSAQALS QAKSLKANGNPTYNEKAD LVVRLNERNTAQLVYLVS FVVDGKEPSRPHLIDAN NGQVLKQWEGLNHAEANG PGGNAKTGKYVYGTDYGP LIVTSDCKMDSGNVATVN LNGGTSGTTPYKFACPTN TYKAINGAYSPLNDAHYF GNVVFNLYKDWFNLKPIN QKLLMKVHYSRNYENAFW DGTAMTFGDGASTFYPLV SLDVSAHEVSHGFTEQNS GLVYDGQSGGINEAFSDM AGEAAEYYMKGKNDFLVG AEIFKKTGALRYFADPTK Class IV metalloprotease; vibriolysin, pseudolysin Extracellular, zinc protease 134 gacgttgagcagcgcccaggcgttg agccaggccaaatcgctgaaggcca acggcaatcccacctacaacgagaa agccgacctagtggtgcgcctgaac gagcgcaacaccgcccagctggtct acctagtgtccttcgtggtcgacgg caaggagcccagccgcccgcacctg atcatcgacgccaacaacggccagg tgctgaagcagtgggaaggcctgaa ccacgccgaagccaacggccccggc ggcaacgccaagaccggcaagtatg tctacggcaccgactacggtccgct gatcgtcaccagcgattgcaagatg gatagcggcaacgtcgccaccgtca acctcaacggcggcaccagcggcac caccccgtacaagttcgcctgcccg accaacacctacaaagcgatcaacg gcgcttactcgccgctgaacgacgc gcactacttcggcaacgtggtgttc aacctgtacaaggactggttcaacc tgaagccgatcaaccagaagctgct gatgaaggtgcactacagccgcaac tacgaaaacgcgttctgggacggca ccgcgatgaccttcggcgacggcgc DGQSIGNAKDYYDGLDVH YSSGVYNKAFYLIATSPN WNTRKAFEVFVDANRLYW TANATYNSAACGVVKAAD ARGYNSADVTKAFTAVGV TCK (SEQ ID NO:3) cagcaccttctacccgctggtgtcg 135 ctggacgtgtccgcgcatgaagtca gccacggcttcaccgagcagaactc cggcctggtctacgacggccagtcc ggcggcatcaacgaggcattctccg acatggccggcgaagccgccgagta ctacatgaagggcaagaacgacttc ctggtgggcgcggaaatcttcaaga agaccggcgcgctgcgctacttcgc cgatccgaccaaggacggccaatcg atcggcaacgccaaggactactacg acggcctggacgtgcactattccag . cggcgtgtacaacaaggccttttac ctgatcgccaccagcccgaactgga acacccgcaaggcgtttgaagtgtt cgtcgacgccaaccggctgtactgg accgccaacgccacctacaacagcg ccgcttgcggcgtggtcaaggcggc cgacgcccgcggctacaacagcgcc • gacgtcaccaaggccttcaccQQcag act (tcggcaagtag) ID NO:6) As used in this specification and in the claims(s), the words comprising (and any 136 form that includes, such as include and understand), that has (and any form that has, such as they have and has), that includes (and any form that includes, such as includes and include) or that contains ( and any forms of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional elements or method steps not mentioned. The term or combinations thereof as used herein refers to all permutations and combinations of the items listed preceding the term. For example, A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if the order is important in a particular context, also BA , CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, combinations containing repetitions of one or more points or terms, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, etc., are expressly included. Those experienced in the art will understand that there is typically no limit to the number of points or terms in any combination, unless it is somehow apparent from the context. All compositions and / 'or methods disclosed and claimed herein may be made and performed without 137 too much experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations may apply to the compositions and / or methods and to the steps or methods involved. the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All similar substitutions and modifications apparent to those skilled in the art are considered to be within the spirit, scope and concept of the invention as defined in the appended claims. EXAMPLES Example 1: Cell Growth and AON Extraction Chromobacterium subtsugae PRAA-1 was grown in 200 ml of LB broth in IL flasks at 26°C with rotation at 150 rpm for 24-48 hours. The biomass of the culture was collected by centrifugation. Genomic DNA was extracted using the MoBio Power Microbial Maxi-DNA Extraction Kit (MoBio Catalog No. 122223-25). DNA was eluted in 1.5 ml of elution buffer (included in the kit of components). To evaluate the quality and quantity of DNA, an aliquot of 10 pL was seeded on a 1.5% agarose gel and electrophoresis was carried out for 30 minutes at 100 V. The 138 DNA with a UV transilluminator using the seed marker EZ-Vision. More than 100 pg of DNA was recovered. Example 2: DNA Sequencing and Assembly DNA sequences were determined using a HiSeq 2000 (Illumina, San Diego, CA), with 100 bp sequence reads, end-paired, aiming for 40x minimum coverage. The final data consisted of two sets of paired-end samples in FASTQ format, providing approximately 200x coverage of the genome. All four FASTAQ files were used for the assembly. FASTAQ sequences were quality controlled using FASTQC, and the average distance between pairs was calculated by comparing the first 10,000 pairs from both groups with the initial assembled contigs using BWA. Li & Durbin (2009) Bioinformatics 25(14):17541760. TrimGalore (Babraham Bioinformatics, Cambridge, UK) was then used to generate two high-quality paired-end pools and four individual read files for those sequences whose companion read was below the quality threshold by at least 50 nucleotides after trimming in . Q2. Sequence reads were assembled using Ray assembler v2.0.0. Boisvert et al. (2010) J Comput Biol. 17(11):1519-1533. A size titration was carried out 139 in kmeros with a kmero range between 19 and 63; resulting in successful assemblies at 19, 21, 31, 41, 47, 49 and 63. Additional scaffolding was carried out using SSPACE vi. 1 using all available readings on the scaffolds produced by Ray's analysis. Boetzer et al. (2011) Bioinformatics 27(4):578-579. Mismatches were plugged using the GapFiller, with a maximum iteration of twenty steps. Boetzer & Pirovano (2012) Genome Biol. 13(6):R56. The resulting scaffolds were mapped against the Chromobacterium violaceum ATCC reference genome. 12742, using the CONTIGuator with an e-value of le-10. Galardini et al. (2011) Source Code Biol. Med. 6:11. To confirm the orders of the contigs and scaffolds, the alignments were manually inspected using ACT. Carver et al. (2008) Bioinformatics 24(23):26722676. The original data sets were back mapped to the Chromobacterium subtsugae sequence using the BWA (Li & Durbin, supra) with an origin length of 19. This process yielded a high-quality genome of 4,690,330 bases with a total of 145,992 bases in contigs not matched to the reference genome (Chromobacterium violaceum) and 4,264 undefined nucleotides (N's) in 42 mismatches. Subsequent filling in of the mismatches in the pseudocontigs closed 8 of the 42 mismatches and extended the pseudocontigs to 140 4,704,820 bases, where most of the mismatches are individual 'Ν' positions with only 2 remaining mismatches at positions 2,153,178 - 2,153,283 (105 bases) and 2,474,439 - 2,474,486 ( 47 bases). Example 3: Screening of proteins for insecticidal activity against cabbage worms Scott proteins 1-3 (Seq ID Nos: 46, respectively) were fractionated by standard FPLC procedure. Diet plates were stored in a covered container in the bioassay refrigerator (4°C). All efficacy tests were performed with a minimum of six dilutions and two dilution replicates (wells) per plate and a minimum of 40 total wells for each dilution. Deionized water was used as a negative control. All candidate proteins and the standard were serially diluted to a minimum of six dilutions (i.e. 16%, 8%, 4%, 2%, 1% and 0.05%). Starting with the lowest dilution, 100 pL of each dilution treatment was pipetted into each well. The plate was placed in a fume hood with a small ambient fan. The fan was turned on and pointed at the plate at an angle that the liquid in the wells was affected by the airflow. The wells were dried enough so that the neonate larva could be placed in each well without drowning. were used only 141 Cabbage Caterpillars between first instar and early second instar for 96-well plates. Using a fine brush, the small individual larva was moved from its breeding area to a well. Infestation was continued until all wells had larvae in them. A small hole was made in the lid over each well for ventilation, using a dental or other small pointed tool. The plate was placed in a controlled temperature chamber at 26 °C, and mortality was quantified between 3 and 4 days after the addition of the insects. Insect mortality was determined by examining the larvae in each well. The average mortality was then determined for each dilution. Tables 3 to 6 show the cabbage worm mortality achieved by the amount of Scott 13 (SEQ ID Nos:4-6). Table 3 (Scottl; SEQ ID No: 1 or 4) Sample Description Captured Scott Fraction, 0.22 mg / mL Mortality % fraction Day 3 Day 4 15.00 25.00 5.00 5.00 % mortality corrected Day 3 Day 4 12,821 23,077 2,564 2,564 142 scottl captured, 0.11mg / mL Scott Fraction 5, 00 captured, 0.06mg / mL scott fraction 5.00 captured, 0.03mg / mL Negative control 2.50 (water) scott fraction 9.17 captured, 0.224mg / mL scott fraction 16, 67 captured, 0.448mg / mL scottl fraction 41.25 captured, 5.00 2.564 2.564 5.00 2.564 2.564 2.50 8.33 9.167 8.333 20.83 16.667 20.833 65.42 41.250 65.417 143 0.896mg / mL Negative control 0.00 (water) partially scottl 31.67 purified, 2.9 mg / mL scottl partially 46, 67 purified, 5.7 mg / mL scottl partially 48.33 purified, 11.5mg / mL Negative control 4.17 (water) 0.00 53.70 28.696 94.44 44.348 88.89 46.087 4.17 Table 4 (scott2; SEQ ID No:2 or 5) Sample Description Protease % mortality Day 3 Day 4 of 33.33 33.33% corrected Day 3 30.43 51,691 94,203 88,406 mortality Day 4 30.43 144 20k partially purified 0.5 mg / mL protease Partially purified 20k 55.56 0.5 mg / mL with 10 mM Zn and Ca Negative control 4.17 (water) Partially purified kDa protease 71.33 0.5 mg / mL with 10 mM Zn and Ca Negative control 0.00 (water) of 22.22 protease 72.22 53, 62 71.01 4.17 83, 00 71.33 82.11 5.00 22.22 21.13 20.00 145 Partially purified 20 kDa 0.5 mg / mL Negative control (water) Partially purified 20 kDa protease 0.5 mg / mL Negative control 1.39 3.13 2.78 22.22 19.71 17.65 5.56 Table 5 (scott3, SEQ ID No:3 or 6¡ Description of the sample Day 3 Partially purified 7.41 kDa protease, 0.25mg / mL Protease mortality 18.52 Day 4 7.41% corrected Day 3 mortality Day 4 3.38 3.38 24.07 14.98 20, 77 146 kDa partially purified, 0.25 mg / mL with 10 mM Zn and Ca Negative control 4.17 (water) Partially purified 0.00 kDa protease, 0.125mg / mL Partially purified kDa protease, 4.00 0.125 mg / mL with 10 mM Zn and Ca Negative control 0.00 (water) of 74.07 protease 4.17 0, 00 0, 00 -5.26 6, 67 4.00 1.75 5.00 74.07 73.71 73.33 147 Partially purified 35 kDa 0.5 mg / mL Negative control (water) Partially purified 35 kDa protease 0.5 mg / mL Negative control (water) 2.78 57.41 5, 56 50.30 54.90 Example 4: Transformation of tomato (Solanum lycopersicum) with Agrobacterium The following procedure is adapted from Sharma, M.K. and col. 2009. A simple and efficient Agrobacterium-mediated procedure for transformation of tomato. Journal of Biosciences 34:423-433. Media and solutions The composition of the various media is described in Table 6. The media components, except agar, are 148 are combined according to Table 6 and adjusted to pH 5.8 using KOH IN, before adding plant tissue culture grade agar. Stock solutions of BAP (6-benzylmaino purine) and zeatin are prepared in dimethyl sulfoxide (DMSO). Antibiotic stock solutions are prepared in deionized water and filter sterilized. Agrobacterium strain AGL1 is grown on YEM broth or agar containing 100 mg / l rifampin and 50 mg / l kanamycin. Agrobacterium preparation Agrobacterium turnefaciens, transformed with the gene(s) of interest, (for example, any of the genes disclosed in SEQ ID NOs: 1-6) is grown in YEM medium with rifampin and kanamycin, in shaken culture for 72 h at 28 h. °C and 200 rpm. Cells are pelleted by centrifugation, washed and resuspended in WS medium. Bacterial density is determined by DOgoo measurement and the final cell concentration is adjusted to ~108 cells / mL by dilution with WS medium. plant transformation Half pieces (0.7 x 1.0 cm) of 10-day-old cotyledons are collected by cutting at the tip and base. Sections are precultured for 48 hours at 28°C in MI medium, with the adaxial surface in direct contact with the medium. Healthy explants are selected and incubated in 149 Agrobacterium suspension for 30 minutes, with inversion every 10 minutes. Explants are transferred to sterile tissue paper and returned to MI agar (50-80 explants per plate) for another 72 hours. Explants are then washed 4-5 times in WS medium, transferred to sterile tissue and transferred to SM containing Img / L trans-zeatin for regeneration (20-25 explants per regeneration plate). Regeneration plates are incubated at 28°C under a 16 / 8 light / dark cycle. Regeneration is evidenced by the development of a callus. Regenerated explants are selected and transferred to fresh SM medium every 15 days. Regenerated shoots can be excised from the calli and transferred to RM medium. Seedlings that are at least 2 inches tall and have strong roots are selected for transfer to pots. The substrate for planting consists of 1:1 potting soil mix with 1:1:1 vermiculite: perlite: sphagnum. Table 6 ME M2 W.S. YE MR Salts MS (Murashige and 0.5x Skoog, 1962) Vitamins B5 0.5x lx lx lx lx lx lx lx 150 Gamborg Sucrose (g / L) 15 30 30 30 30 Agar (% conv) 0.8 0.8 0 0.8 0.8 BAP (mg / L) 0 2 0 0 0 Kanamycin (mg / L) 0 0 0 100 100 Cefotaxime (mg / L) 0 0 0 500 500 Example 5: Creation of transgenic soybean plants that comprise an insecticidal gene from Chr ornaba c teri uin substugae Ripe glycine max seeds are surface sterilized with chlorine gas inside a hood container under a fume hood. The seeds are kept in 100x20 mm Petri dishes with gaseous chlorine produced by adding 100 ml of 4% sodium hypochlorite in a beaker and adding 5 ml of 12 N hydrochloric acid. After sterilization, the seeds are placed seeds in germination medium (GM; MS basal salts with vitamins, 3% sucrose, 0.8% plant agar, and 1 mg / L BAP, optimized for regeneration experiment, pH 5.8). Murashige and Skoog, 1962. Seeds are germinated under fluorescent light or in the dark at 24±1°C for 5-7 days to compare the frequency of transformation. 151 The method described herein is a modification of that described by Zhang et al. (1999) Plant Cell, Tissue and Organ Culture 56:37-46. Two cotyledon explants are obtained by cutting a horizontal slice through the hypocotyl with a No. 11 surgical blade. The hypocotyl is subsequently removed and ten wounds are made on the surface of the nodule regions of the cotyledon. The explants are immersed for 30 min in a suspension of A. tumefaciens that has been modified to contain the gene of interest, eg, a gene encoding an insecticidal protein, or a protein involved in the synthesis of an insecticidal compound. See Table 2 above for a listing of exemplary genes of interest. After immersion, ten explants are randomly placed on sterile filter paper placed on solid co-culture medium (CM; Gamborg B5 basal salts with vitamins, 3% sucrose, 20 mM MES, 3.3 mM L-cysteine, 1mM dithiothreitol, 0.1mM acetosyringone, 0.8% plant agar, pH 5.4) (Gamborg et al., 1968) into 100><20mm Petri dishes, and incubate at 24±1° C for 5 days under dark conditions. After 5 days of co-culture, explants are washed briefly in liquid shoot induction medium (SIM; Gamborg B5 basal salts with vitamins, 3% sucrose, 3mM MES, 1.67mg / L BAP, 250mg / L cefotaxime, pH 5.7) 152 to remove excess A. tumefaciens from the explants. Explants are then transferred to solidified SIM without PPT to stimulate shoot induction for the first 14 days, after which explants are subcultured in fresh SIM with 5 mg / L PPT for selection of transformed shoots. Organogenic shoots from explants are trimmed and then transferred to shoot elongation medium (SEM; MS basal salts with vitamins, 3% sucrose, 3 mM MES, 0.5 mg / L gibberellic acid, 50 mg / L asparagine, 1 mg / L zeatin, 0.1 mg / L indole-3-acetic acid, 250 mg / L cefotaxime, 50 mg / L vancomycin, 0.8% plant agar, 5 mg / L L PPT, pH 5.7). Explants are transferred to fresh SEM medium every 14 days, and surviving shoots are planted in root induction medium (RIM; MS basal salts with vitamins, 3% sucrose, 1 mg / L naphthaleneacetic acid, 0.8 % plant agar, pH 5.7) and grown to root development. After acclimatization, the transgenic plants are transplanted into potting soil and kept in a greenhouse. Selection is carried out by PCR. See also Lee, et al. (2011) J. of Korean Soc. Appl. Biol. Chem. 54: 37-45. Example 6: Screening of Proteins for Insecticidal Activity Against Cabbage Caterpillars (Trichoplusia ni) (CL), Lygus (Lygus hesperus), Beet Moth Worm 153 (Spodoptera exigua) (BAW), and diamondback moth (Plutella xylostella) (DBM) Proteins were partially purified by strong cation exchange and hydrophobic interaction chromatography. Protein concentration was estimated using the Invitrogen Quant-iT or Qubit assay calibrated with BSA. Unless otherwise noted, scottl (SEQ ID NO:1 or 4) was submitted to the bioassay at 5 mg / mL, scott2 (SEQ ID NO:2 or 5) at 1 mg / mL, and scott3 ( SEQ ID NO: 3 or 6) at 1 mg / mL of total protein quantity. Proteins were buffered at pH 6 in 20 mM MES or pH 7.5 with 20 mM Tris. Scott2 received added up to 5 mM ZnCl2 and CaCl2. Activity against cabbage worms (repeated compared to example 3), beet moth worm and diamondback moth was tested in bioassays on diet layer. The appropriate artificial insect diet was dispensed into each well of a standard 96-well plate and allowed to dry. Once the diet solidified, 100 pL of treatment was pipetted into the appropriate number of wells and allowed to dry. An individual 1st instar larva was administered to each well of a 96-well plate. Mortality was quantified 4 days after treatment. Activity against lygus was tested in an artificial diet bioassay as follows: diet packets were prepared 154 by combining the appropriate amount of artificial diet for lygus and stock treatment solution. The mixtures were vortexed and evenly distributed among the diet packets. Between 10 and 12 2nd or 3rd instar lygus nymphs were placed in a Petri dish, covered with a mesh lid and sealed with Parafilm. Mortality was quantified 4 days after exposure to the treatment diet. Efficacy is expressed as percent mortality at 4 days after treatment. Results (in duplicate) for % mortality are shown in Table 7. Scottl was prepared at 4.9 mg / mL for the first run with lygus. Scott3 was prepared at 0.42 mg / mL for the first lygus trial and 0.82 mg / mL for the first cabbage caterpillar trial. Table 7 CL % of Mortality Lygus BAW DBM Scottl 90, 91 100 21, 98 12.5 8.33 0 95.83 77.08 Scott2 100 92.86 22.88 19, 3 25 33.33 58.33 95.83 Scott3 63, 64 100 7.54 15, 21 29, 17 33.33 95, 83 70, 83 The inventions described and claimed herein are not to be limited in scope by the that are disclosed herein, because 155 these aspects are for illustrative purposes only. Any equivalent aspect is contemplated within the scope of the disclosure. Indeed, various modifications, methods, and compositions shown and described herein will be apparent to those skilled in the art from the previous description. Such modifications are also contemplated within the scope of the appended claims. In the event of a conflict, this disclosure, including definitions, shall control. SEQUENCE LISTING <110> Marrone Bio Innovations, Inc. Burman, Scott Wilk, Debora Cordova, Ana Lucia <120> CHROMOBACTERIUM SUBTSUGAE GENES 1 <130> MBI-206-0005-US-PR1 <160> 6 <170> Patentln version 3.5 <210> 1 <211> 183 <212> PRT <213> chromobacterium subtsugae <400> 1 Met Ser : Leu Thr Thr Asp Phe Leu Glu Asn Pro Gln Ala Phe Met Arg 1 5 10 15 Ser Gln Ala lie Leu lie Pro Ala Gln Val Pro Pro Gly Asn Gly Lys 20 25 30 Tyr Gln Phe Ala Ala Gln Gly Ala His Wing Wing Val Leu Gln Ser Thr 35 40 45 Wing Wing Ser Pro Asn lie Pro Gly Phe Tyr Wing His Pro Val Wing Asn 55 60 156 Asn lie Asn Leu Phe Val Leu Pro Thr Gln Gln Pro Ala Arg Tyr Tyr 65 70 75 80 Met Phe Thr Asp Gly Met Asn Gly Cys Gln Phe Leu Ala Tyr Gly Pro 85 90 95 Asp Arg Gln His lie Thr Val Glu His Asn Asn Phe lie Gly Asp Pro 100 105 110 Thr Arg Tyr Ala Ala Arg Leu Ala Glu Val Val Ala Leu Lys Pro Ala 115 120 125 Tyr Leu Leu His lie Ser Pro Ser Gly Val Asn Asn lie Pro Wing Gly 130 135 140 Gln Tyr Asn Ser Gln Gln Gly Val Asn lie Val Gly Glu Tyr Gly Gln 145 150 155 160 Wing Asn Gly Trp Arg Phe Trp Val Arg Asp Arg Val Asp Gln Asn Gln 165 170 175

Claims

1. An isolated plant cell, wherein said cell is incapable of generating a complete individual, characterized in that it comprises a polypeptide having the amino acid sequence established in SEQ ID NOs: 1 or 2. 2 Claims follow