INNOVATIVE INTEGRATION SITES IN CHO AND THEIR USES

Abstract

Nucleotide sequences for enhancing expression in eukaryotic expression systems are provided, enabling the improved and stable expression of recombinant proteins in eukaryotic cells. Genomic integration sites that provide enhanced expression, along with methods for using these sites to express a gene of interest in a eukaryotic cell, are also provided. Chromosomal sites, sequences, and vectors for the enhanced and stable expression of genes in eukaryotic cells are also provided.

Description

NOVEL INTEGRATION SITES IN CHO AND THEIR PREVIOUS USES Cross-reference to Related Applications This application claims the benefit of priority of U.S. Provisional Application No. 62 / 067.774 filed on October 23, 2014, the entire contents of which are incorporated herein by reference. Incorporation by Reference of Sequence List The Sequence Listing in an ASCII text file, named 32353_T0045US01_SequenceListing.txt of 28 KB, created on October 20, 2015, and filed with the United States Patent and Trademark Office by means of EFS-Web, is incorporated herein by reference. Field of Invention The invention provides for the stable integration and / or expression of recombinant proteins in eukaryotic cells. In particular, the invention includes methods and compositions for the enhanced expression of proteins in eukaryotic cells, particularly Chinese hamster (Cricetulus griseus) cell lines, employing nucleotide sequences that increase expression. The invention includes polynucleotides and modified cells that facilitate recombination-mediated cassette exchange (RMCE). The methods of the invention integrate exogenous nucleic acids into specific chromosomal sites in the Chinese hamster cell genome to facilitate the increased and stable expression of recombinant proteins by the modified cells. Description of Related Technique Cell expression systems aim to provide a reliable and efficient source for the manufacture of a given protein, whether for research or therapeutic use. Recombinant protein expression in mammalian cells is a preferred method for manufacturing therapeutic proteins due to, for example, the ability of mammalian expression systems to appropriately post-translational modify recombinant proteins. Various cellular systems are available for protein expression, each containing diverse combinations of cis- and, in some cases, frans-regulatory elements to achieve high levels of recombinant protein with short incubation times. Despite the availability of numerous systems, the challenge of efficient gene transfer and the stability of the integrated gene for recombinant protein expression remains. Multiple local genetic factors will determine not only when the target gene of interest should be expressed, but also whether the cell can functionally drive gene transcription toward a productive output, or whether expression will even be sustained long-term. Chromosomal integration sites, for example...Chinese hamster ovary (CHO) cell integration sites and locus control regions within or adjacent to specific genes have been characterized using this technique (WO2012 / 138887A1; Li, Q. et al., 2002 Blood. 100:3077-3086). As such, the regulatory regions sought as targets are typically identified in a region encoding endogenous proteins. However, for long-term expression of a target transgene, a key consideration is minimizing disruption of cellular genes to avoid changes in the cell line phenotype. Modifying stable cell lines through genetic engineering to accommodate additional genes for expression, such as extra antibody chains as in multispecific antibodies, is particularly challenging. Wide variations in the expression levels of the integrated genes can occur. The integration of these additional genes can lead to greater variation in expression and instability due to the local genetic environment (i.e., positional effects). Therefore, there is a need in this technique to provide improved expression systems in mammals. BRIEF SUMMARY In one aspect, the invention provides a cell comprising an exogenous nucleic acid sequence integrated into a specific site within a locus, wherein the locus comprises a nucleotide sequence that is at least 90% identical to SEC ID NO:1 or SEC ID NO:4. In some embodiments, the locus comprises a nucleotide sequence that is at least 90% identical to SEC ID NO:1. In some embodiments, the locus comprises a nucleotide sequence that is at least 90% identical to SEC ID NO:4. In another aspect, the invention provides a polynucleotide comprising a first nucleic acid sequence integrated into a specific site within a second nucleic acid sequence (e.g., a locus of the invention). In one embodiment, the second nucleic acid sequence comprises the nucleotide sequence SEC ID NO:1. In another embodiment, the second nucleic acid sequence comprises the nucleotide sequence SEC ID NO:4. In one embodiment, the second nucleic acid sequence is an expression-enhancing sequence selected from a nucleotide sequence that has at least 90% nucleic acid identity with SEC ID NO:1, oo with its expression-enhancing fragment. In one embodiment, the second nucleic acid sequence is an expression-enhancing sequence selected from a nucleotide sequence having at least 90% nucleic acid identity with SEC ID NO:4, oo with its expression-enhancing fragment. In another embodiment, the expression-enhancing sequence is capable of increasing the expression of a protein encoded by an exogenous nucleic acid sequence. In another embodiment, the expression-enhancing sequence is capable of increasing the expression of a protein encoded by an exogenous nucleic acid sequence by at least approximately 1.5-fold to at least approximately 3-fold the expression increase compared to the expression typically observed by random integration into a genome. In another embodiment, the exogenous nucleic acid sequence is integrated into a specific site at any position within SEC ID NO.Ί or SEC ID NO:4. In some implementations, the specific site in a position within SEC ID NO:1 or adjacent to a position within SEC ID NO:1 is selected from the group consisting of positions spanning nucleotides numbered 104,000; 100-3,900; 200-3,800; 300-3,700; 400-3,600; 500-3,500; 600-3,400; 700-3,300; 800-3,200; 900-3,100; 1,000-3,000; 1,100-2,900; 1,200-2,800; 1,300-2,700; 1,200-2,600; 1,300-2,500; 1,400-2,400; 1,500-2,300; 1,600-2,200; 1,700-2,100; 1,800-2050; 1850-2050, 1,900-2040; 1950-2025, 1990-2021, 2002-2021 and 2,010-2,015 of SEC ID NO:1. In certain embodiments, the specific site at a position within or adjacent to a position within SEC ID NO:1 is selected from the group consisting of positions spanning nucleotides numbered 1990-1991, 1991-1992, 1992-1993, 1993-1994, 1996, 1996-1997, 1997-1998, 1999-2000, 2001-2002, 2002-2003, 2003-2004, 2004-2005, 2005-2006, 2006-2007, 2007-2008, 2008-2009, 2009-2010, 2010-2011, 2011-2012, 2012-2013, 2013-2014, 2014-2015, 2015-2016, 2016-2017, 2017-2018, 2018-2019, 2019-2020, and 2020-2021 of SEC ID NO:1. In another embodiment, the specific site in a position within SEC ID NO:1 or adjacent to a position within SEC ID NO:1 is selected from the group consisting of positions spanning nucleotides numbered 10-500; 500-1000; 500-2100; 1000-1500; 1000-2100; 1500-2000; 1500-2500; 2000-2500; 2500-3000; 2500-3500; 3000-3500; 3000-4000; and 3500-4000 of SEC ID NO:1. In certain embodiments, the exogenous nucleic acid sequence is integrated into, within, or near any one or more of the specified sites described above. In another embodiment, the exogenous nucleic acid sequence comprises a recognition site positioned within an expression-enhancing sequence as described above, provided that the expression-enhancing sequence comprises a sequence that is at least approximately 90% identical, at least approximately 91% identical, at least approximately 92% identical, at least approximately 93% identical, at least approximately 94% identical, at least approximately 95% identical, at least approximately 96% identical, at least approximately 97% identical, at least approximately 98% identical, or at least approximately 99% identical to the expression-enhancing sequence of SEC ID NO:1 or SEC ID NO:4, or with its expression augmentation fragment. In one embodiment, the exogenous nucleic acid sequence comprises a recombinase recognition site. In some embodiments, the exogenous nucleic acid sequence further comprises at least one recombinase recognition site comprising a sequence independently selected from a LoxP site, a Lox511 site, a Lox2212 site, Lox2372, Lox5171, Loxm2, Lox71, Lox66, IoxFas, and a frt site. In one embodiment, the recombinase recognition site is integrated within the expression-enhancing sequence. In another embodiment, the recombinase recognition site is immediately adjacent in the 5' direction to the 5' end nucleotide of a gene cassette, or immediately adjacent in the 3' direction to the 3' end nucleotide of a gene cassette. In some embodiments, at least one recombinase recognition site and gene cassette are integrated within the expression-enhancing sequence. In one embodiment, at least two recombinase recognition sites are present within the expression-enhancing sequence. In another embodiment, two recombinase recognition sites of opposite orientation are integrated within the expression-enhancing sequence. In another embodiment, three recombinase recognition sites are integrated within the expression-enhancing sequence. In one aspect, an isolated Chinese hamster ovary (CHO) cell is provided comprising a genetically engineered expression-enhancing sequence of SEC ID NO:1 or its expression-enhancing fragment. In one embodiment, the expression-enhancing sequence comprising the nucleotide sequence of SEC ID NO:1 or SEC ID NO:4, or its stable variant, is constructed to integrate an exogenous nucleic acid sequence as previously described. In other embodiments, the invention provides an isolated CHO cell comprising an exogenous nucleic acid sequence inserted at a locus comprising an expression-enhancing sequence of SEC ID NO:1, or SEC ID NO:4, or its stable variant. In one embodiment, the CHO cell further comprises at least one recombinase recognition sequence within the expression-enhancing sequence. In another embodiment, at least one recombinase recognition sequence is independently selected from a LoxP site, a φ site Lox511, a Lox2272 site, Lox2372, Lox5171, Loxm2, Lox71, Lox66, LoxFas, and a frt site. In another embodiment, the recombinase recognition site is immediately adjacent in the 5' direction to the 5' end nucleotide of a gene cassette, or immediately adjacent in the 3' direction to the 3' end nucleotide of a gene cassette. In some embodiments, at least one recombinase recognition site and gene cassette are integrated within the expression-enhancing sequence of the CHO cell genome described in this invention. In another embodiment, at least one recombination recognition site is positioned as described above, provided that the gene cassette comprises an expression-enhancing sequence comprising at least 90% identity, at least approximately 91% identity, at least approximately 92% identity, at least approximately 93% identity, at least approximately 94% identity, at least approximately 95% identity, at least approximately 96% identity, at least approximately 97% identity, at least approximately 98% identity, or at least approximately 99% identity with nucleotides 1001 to 2001 of SEC ID NO:1 (SEC ID NO:2) or with its expression-enhancing fragment.In another embodiment, the at least one recombination recognition site is positioned as described above, provided that the gene cassette comprises an expression-enhancing sequence comprising at least 90% identity, at least approximately 91% identity, at least approximately 92% identity, at least approximately 93% identity, at least approximately 94% identity, at least approximately 95% identity, at least approximately 96% identity, at least. approximately 97% identity, at least approximately 98% identity, or at least approximately 99% identity with nucleotides 2022 to 3022 of SEC ID NO:1 (SEC ID NO:3) or with its expression-enhancing fragment. In yet another embodiment, at least one recombinase recognition site is inserted into the CHO cell genome at or within nucleotides 1990-1991, 1991-1992, 1992-1993, 1993-1994, 1995-1996, 1996-1997, 1997-1998, 1999-2000, 2001-2002, 2002-2003, 2003-2004, 2004-2005, 2005-2006, 2006-2007, 2007-2008, 2008-2009, 2009-2010, 2010-2011, 201 1IO 2012, 2012-2013, 2013-2014, 2014-2015, 2015-2016, 2016-2017, 2017-2018, 2018-2019, 2019-2020, 2020-2021 or 2021-2022 SEC ID NO:1. In another embodiment, the exogenous nucleic acid is inserted into the CHO genome at or within the nucleotides 1990-1991, 1991-1992, 1992-1993, 1993-1994, 1995-1996, 1996-1997, 1997-1998, 1999-2000, 2001-2002, 2002-2003, 2003-2004, 2004-2005, 2005-2006, 2006-2007, 2007-2008, 2008-2009, 2009-2010, 2010-2011, 2011-2012, 2012-2013, 2013-2014, 2014-2015, 2015-2016, 2016-2017, 2017-2018, 2018-2019, 2019-2020, 2020-2021 or 2021-2022 of SEC ID NO:1. In another embodiment, the exogenous nucleic acid is inserted into the CHO genome at or within nucleotides 2001–2022 of SEC ID NO:1. In some embodiments, the exogenous nucleic acid is inserted at or within nucleotides 2001–2002 or nucleotides 2021–2022 of SEC ID NO:1, and nucleotides 2002–2021 of SEC ID NO:1 are deleted as a result of the insertion. Similarly, the exogenous nucleic acid is inserted into the CHO genome at or within nucleotides 9302–9321 of SEC ID NO:4. In some embodiments, the exogenous nucleic acid is inserted at or within nucleotides 9301–9302 or nucleotides 9321–9322 of SEC ID NO:4 and nucleotides 9302–9321 of SEC ID NO:4. ID N0:4 are deleted as a result of the insertion. In some embodiments, the exogenous nucleic acid sequence integrated into a specific site within a locus, such as the nucleotide sequence SEC ID NO:1 or SEC ID NO:4, comprises a gene of interest (GDI) (e.g., a nucleotide sequence encoding a protein of interest, or PDI). In certain embodiments, the exogenous nucleic acid sequence comprises one or more genes of interest. In some embodiments, the one or more genes of interest are selected from the group consisting of a first GDI, a second GDI, and a third GDI. In some embodiments, the exogenous nucleic acid sequence integrated into a specific site within a locus, such as the nucleotide sequence of SEC ID NO:1 or SEC ID NO:4, comprises a GDI and at least one recombinase recognition site. In one embodiment, a GDI primer is inserted within the expression-enhancing sequence of SEC ID NO:1 or SEC ID NO:4, or the expression-enhancing sequence having at least 90% nucleotide identity with SEC ID NO:1 or SEC ID NO:4, or its expression-enhancing fragment, as described above, and the first GDI is optionally operationally linked to a promoter, wherein the promoter-linked GDI (or the GDI) is flanked 5' by a first recombinase recognition site and 3' by a second recombinase recognition site. In another embodiment, a second GDI is inserted 3' from the second recombinase recognition site, and the second GDI is flanked 3' by a third recombinase recognition site. In yet another embodiment, the GDI is operationally linked to a promoter capable of driving GDI expression, where the promoter comprises a eukaryotic promoter that can be regulated by an activator or inhibitor. In other embodiments, the eukaryotic promoter is operationally linked to a prokaryotic operator, and the eukaryotic cell also optionally comprises a prokaryotic repressor protein. In another embodiment, one or more selectable markers are included between the first and second and / or the second and third recombinase recognition sites. In some embodiments, the first and / or second gene of interest and / or the one or more selectable markers are operatively linked to a promoter, which may be the same or different. In another embodiment, the promoter comprises a eukaryotic promoter (such as, for example, a CMV promoter or a late SV40 promoter), optionally controlled by a prokaryotic operator (such as, for example, a tet operator). In other embodiments, the cell further comprises a gene encoding a prokaryotic repressor (such as, for example, a tet repressor). In another embodiment, the cell further comprises a gene capable of expressing a recombinase. In some embodiments, the recombinase is a recombinase Cre. In one aspect, a CHO host cell is provided, comprising an expression-enhancing sequence selected from either SEC ID NO:1 or SEC ID NO:4, or an expression-enhancing sequence having at least 90% nucleotide identity with SEC ID NO:1 or SEC ID NO:4, or with its expression-enhancing fragment, comprising a first recombinase recognition site followed by a first eukaryotic promoter, a first selectable marker gene, a second eukaryotic promoter, a second selectable marker gene, and a second recombinase recognition site. In further embodiments, the CHO host cell further provides a third eukaryotic promoter, a third marker gene, and a third recombinase recognition site. In one embodiment, the expression-enhancing sequence is within SEC ID NO:1 or SEC ID NO:4 as described above. In one embodiment, the first, second, and third recombinase recognition sites are different from each other. In some embodiments, the recombinase recognition sites are selected from a LoxP site, a site Lox511, a Lox22T2 site, Lox2372, Lox5W, Loxm2, Lox71, Lox66, LoxFas and a frt site. In one embodiment, the first selectable marker gene is a drug resistance gene. In another embodiment, the drug resistance gene is either a neomycin resistance gene or a hygromycin resistance gene. In yet another embodiment, the second and third selectable marker genes encode two different fluorescent proteins. In one embodiment, the two different fluorescent proteins are selected from the group consisting of coral discosome (DsRed), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), enhanced cyan fluorescent protein (eCFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), and far-red fluorescent protein (e.g., mKate, mKate2, mPlum, mRaspberry, or E2-crimson). In one embodiment, the first, second, and third promoters are the same. In another embodiment, the first, second, and third promoters are different from each other. In yet another embodiment, the first promoter is different from the second and third promoters, and the second and third promoters are the same. In further embodiments, the first promoter is an SV40 late promoter, and the second and third promoters are each a human CMV promoter. In other embodiments, the first and second promoters are operationally linked to a prokaryotic operator. In one embodiment, the host cell line has an exogenously added gene encoding a recombinase integrated into its genome, operatively linked to a promoter. In another embodiment, the recombinase is Cre recombinase. In another embodiment, the host cell has a gene encoding a regulatory protein integrated into its genome, operatively linked to a promoter. In further embodiments, the regulatory protein is a tet repressor protein. In one embodiment, the first GDI and the second GDI encode a light chain, or a fragment thereof, of an antibody or a heavy chain, or a fragment thereof, of an antibody. In another embodiment, the first GDI encodes a light chain of an antibody and the second GDI encodes a heavy chain of an antibody. In certain embodiments, the first, second, and third GDIs encode a polypeptide selected from the group consisting of a first light chain, or a fragment thereof, a second light chain, or a fragment thereof, and a heavy chain, or a fragment thereof. In yet another embodiment, the first, second, and third GDIs encode a polypeptide selected from the group consisting of a light chain, or a fragment thereof, a first heavy chain, or a fragment thereof, and a second heavy chain, or a fragment thereof. In one aspect, a method is provided for preparing a protein of interest, comprising (a) introducing a gene of interest (GDI) into a CHO host cell, wherein the GDI is integrated at a specific locus comprising a nucleotide sequence that is at least 90% identical to SEC ID NO:1 or SEC ID NO:4; (b) culturing the cell from (a) under conditions permitting expression of the GDI; and (c) recovering the protein of interest. In one embodiment, the protein of interest is selected from the pool consisting of an immunoglobulin subunit, or a fragment thereof, and a receptor, or its ligand-binding fragment. In certain embodiments, the protein of interest is selected from the pool consisting of an antibody light chain, or its antigen-binding fragment thereof, and an antibody heavy chain, or its antigen-binding fragment thereof. In some embodiments, the GDI is introduced into the cell using a recombinase-mediated cassette exchange (RMCE) targeting vector, and the CHO host cell genome comprises at least one exogenous recognition sequence within the specific locus. In other embodiments, the CHO host cell genome comprises at least one exogenous recognition sequence and a selectable marker, operationally linked to a promoter, IRES, and / or polyadenylation sequence (poiyA), within the specific locus. In certain embodiments, the CHO host cell genome comprises one or more recombinase recognition sites as previously described, and GDI is introduced into the specific locus through the action of a recombinase that recognizes the recombinase recognition site. In another embodiment, the GDI is introduced into the cell using a targeting vector for homologous recombination, wherein the targeting vector comprises a 5' homology arm homologous to a sequence present at the specific locus, a GDI, and a 3' homology arm homologous to a sequence present at the specific locus. In another embodiment, the targeting vector further comprises two, three, four, or five or more genes of interest. In another embodiment, one or more of the genes of interest are operatively linked to a promoter. In another aspect, a targeting vector is provided where the targeting vector comprises a 5' homology arm homologous to a sequence present at a locus comprising a nucleotide sequence that is at least 90% identical to SEC ID NO:1 or SEC ID NO:4, a GDI, and a 3' homology arm homologous to a sequence present at a locus comprising a nucleotide sequence that is at least 90% identical to SEC ID NO:1 or SEC ID NO:4. In another embodiment, the targeting vector further comprises two, three, four, or five or more genes of interest. In another aspect, a method is provided for modifying a CHO cell genome to integrate an exogenous nucleic acid sequence, comprising the step of introducing into the cell a vehicle that includes a vector, wherein the vector comprises an exogenous nucleic acid sequence where the exogenous nucleic acid is integrated within a locus of the genome comprising a nucleotide sequence at least 90% identical to SEC ID NO: 1 or SEC ID NO: 4. In some embodiments, the vector comprises a 5' homology arm homologous to a sequence present at a genome locus comprising a nucleotide sequence at least 90% identical to SEC ID NO: 1 or SEC ID NO: 4, an exogenous nucleic acid sequence, and a 3' homology arm homologous to a sequence present at a genome locus comprising a nucleotide sequence at least 90% identical to SEC ID NO: 1 or SEC ID NO: 4. In some embodiments, the exogenous nucleic acid sequence in the vector comprises one or more recognition sequences. In other embodiments, the exogenous nucleic acid comprises one or more GDIs, such as a selectable marker or a nucleic acid encoding a PDI. In still other embodiments, the exogenous nucleic acid comprises one or more GDIs and one or more recognition sequences. In one embodiment, the vehicle comprises at least one additional vector or mRNA. In another embodiment, the additional vector is selected from the group consisting of an adenovirus, a lentivirus, a retrovirus, an adeno-associated virus, an integrating phage vector, a nonviral vector, a transposon and / or transposase, an integrase substrate, and a plasmid. In some embodiments, the additional vector comprises a nucleotide sequence encoding a site-specific nuclease for integrating the exogenous nucleic acid sequence. In certain embodiments, the site-specific nuclease comprises a zinc finger nuclease (ZFN), a ZFN dimer, a transcription activator-type effector nuclease (TALEN), a TAL effector domain fusion protein, or an RNA-guided DNA endonuclease. In another aspect, a vehicle is provided for modifying a CHO cell genome to integrate an exogenous nucleic acid sequence, wherein the vehicle includes a vector, wherein the vector comprises a 5' homology arm homologous to a sequence present at a genome locus comprising a nucleotide sequence at least 90% identical to SEC ID NO: 1 or SEC ID NO: 4, an exogenous nucleic acid sequence, and a 3' homology arm homologous to a sequence present at a genome locus comprising a nucleotide sequence at least 90% identical to SEC ID NO: 1 or SEC ID NO: 4. In some embodiments, the exogenous nucleic acid sequence comprises one or more recognition sequences. In other embodiments, the exogenous nucleic acid comprises one or more GDIs, such as a selectable marker or a nucleic acid encoding a PDI. In still other embodiments, the exogenous nucleic acid comprises one or more GDIs and one or more recognition sequences. In yet another aspect, a method is provided for modifying a CHO cell genome to express a therapeutic agent comprising a vehicle for introducing into the genome an exogenous nucleic acid comprising a sequence for the expression of the therapeutic agent, wherein the vehicle comprises a 5' homology arm homologous to a sequence present in the nucleotide sequence of SEC ID NO.1, a nucleic acid encoding the therapeutic agent, and a 3' homology arm homologous to a sequence present in the nucleotide sequence of SEC ID NO:1 or SEC ID NO:4. In one further aspect, the invention provides a modified CHO host cell comprising a modified CHO genome where the CHO genome is modified by insertion of an exogenous recognition sequence within a genome locus having a nucleotide sequence of at least 90% identical to SEC ID NO: 1. In another aspect, the invention provides a modified eukaryotic host cell comprising a modified eukaryotic genome wherein the eukaryotic genome is modified at a target integration site in a non-coding region of the genome to insert an exogenous nucleic acid. In some embodiments, the exogenous nucleic acid is a recognition sequence. In other embodiments, the host cell is a mammalian host cell, such as a CHO cell. In other embodiments, the target integration site comprises an expression-enhancing sequence such as SEC ID NO:1, provided that the sequence does not encode any endogenous protein. The invention further provides methods for preparing such a modified eukaryotic host cell. In any of the aspects and realizations described above, the expression increment sequence can be placed in the orientation indicated as in SEC ID NO:1, or in the reverse orientation of SEC ID NO:1. Any aspect or embodiment of the invention may be used in conjunction with any other aspect or embodiment of the invention, unless otherwise specified or evident from the context. Other objectives and advantages will become clear from a review of the 25 detailed description that follows. BRIEF DESCRIPTION OF THE FIGURES Figures 1A and 1B. Figure 1A: Schematic diagram of an operable construct that uses random introduction of a nucleic acid molecule expressing a GDI (e.g., a multi-stranded antibody) and multiple copies of a selection marker into a cellular genome, e.g., a CHO genome, to identify a target locus. The exemplified construct includes: Heavy Chain (HC); First copy selection marker, such as: hygromycin resistance gene (Hyg); Light Chain First Copy (LC); Second copy selection marker (e.g., Hyg); Light Chain Second Copy (LC); Third copy selection marker (e.g., Hyg). Figure 1B: Exemplary donor vector for integration by homologous recombination at the native locus identified as SEC ID NO:1. The 5' and 3' homology arms are derived from SEC ID NO:1. Figures 2A to 2C illustrate that the SEC ID NO:1 locus (LOCUS 1), operatively linked to a gene of interest (GDI), exhibits increased GDI mRNA expression compared to the same GDI not operatively linked to LOCUS 1, instead of being linked to a control locus. Figure 2A: Equivalent number of gene copies exhibited for cells encoding an antibody gene of interest, i.e., one heavy chain (HC) and two light chains (LC), operatively linked to the control locus vs. LOCUS 1. Figure 2B: mRNA levels are higher for GDI expressed at LOCUS 1 compared to the mRNA from the control locus. Figure 2C: The protein titer is 3-fold higher for cells expressing GDI at LOCUS 1 compared to the protein titer produced by cells expressing the same GDI at the control locus. Figures 3A and 3B illustrate an exemplary cassette comprising a fluorescent marker and a GDI integrated into LOCUS 1 (e.g., mKate flanked by lox sites to be exchanged with eYFP and a GDI) compared to the same cassette integrated into a control locus (exchanged with a different fluorescent marker, e.g., dsRed2, flanked by lox sites), where such integration employs Cre recombinase and recombinase-mediated cassette exchange (RMCE). Such cassettes were used in experiments to measure the recombination and transcription efficiency of the GDI. Figure 4 shows a higher mRNA level of a gene of interest (GDI) as measured in a group of CHO cells expressing GDI at LOCUS 1 (SEC ID NO:1) compared to mRNA from a group of CHO cells expressing the same GDI, under the same regulatory conditions, but integrated within the control locus, i.e., EESYR. DETAILED DESCRIPTION Before describing the present methods, it should be understood that this invention is not limited to the particular methods and experimental conditions described, as these methods and conditions may vary. It should also be understood that the terminology used herein is intended to describe particular embodiments only and is not intended to limit the scope of the present invention, since the scope of the present invention is limited only by the appended claims. As used in this specification and in the accompanying claims, the singular forms “a”, “an”, “the”, and “the” include plural references unless the context clearly indicates otherwise. Thus, for example, a reference to “a method” includes one or more methods and / or steps of the type described herein and / or which will be evident to those skilled in the art after reading this specification. Unless otherwise defined or specified, all technical and scientific terms employed in this invention have the same meaning commonly understood by a person skilled in the art to which this invention pertains. Although any method and material similar or equivalent to those described herein may be used in the practice or testing of the present invention, particular methods and materials are described below. All publications mentioned in the present invention are incorporated herein by reference in their entirety. Definitions DNA regions are operationally linked when they are functionally related to one another. For example, a promoter is operationally linked to a coding sequence if the promoter is capable of participating in the transcription of that sequence; a ribosome binding site is operationally linked to a coding sequence if it is positioned to allow translation. In general, operational linkage may include, but does not necessarily include, contiguity. In the case of sequences such as secretory leaders, contiguity and appropriate placement within a reading frame are typical characteristics. A locus-of-interest expression-enhancing sequence is operationally linked to a gene of interest (GDI) where it is functionally related to the GDI, for example, where its presence results in increased expression and / or stable integration of the GDI. The term “augmented,” when used to describe increased expression, includes an increase of at least approximately 1.5 times to at least approximately 3 times the increase in expression compared to that typically observed by random integration of an exogenous sequence into a genome or by integration at a different locus, for example, compared to a group of random single-copy members of the same expression construct. The times increase in expression observed using the sequences of the invention is compared to a level of expression of the same gene. measured under substantially the same conditions, in the absence of a sequence of the invention, for example, compared to integration at another locus in the same genome of the species. Increased recombination efficiency includes an increased capacity of a locus to recombine (for example, by employing recombinase recognition sites). Increased refers to a recombination efficiency over random recombination, for example, without the use of recombinase recognition sites or the like, which is typically 0.1%. A preferred increased recombination efficiency is approximately 10-fold compared to random recombination, or approximately 1%. Unless otherwise specified, the claimed invention is not limited to a specific recombination efficiency. When the phrase “exogenously added gene” or “exogenously added nucleic acid” is used with reference to a locus of interest, the phrase refers to any DNA sequence or gene that is not present within the locus of interest as the locus is found in nature. For example, an “exogenously added gene” within a CHO locus (e.g., a locus comprising a sequence SEC ID NO:1) could be a hamster gene not found within the particular CHO locus in nature (i.e., a hamster gene from another locus in the hamster genome), a gene from any other species (e.g., a human gene), a chimeric gene (e.g., human / mouse), or any other gene not found in nature existing within the CHO locus of interest. The Percent Identity, when describing a locus of interest, such as SEC ID NO:1 or SEC ID NO:4, or its fragment, is intended to include homologous sequences that exhibit the mentioned identity throughout the contiguous homology regions, but the presence of gaps, deletions, or insertions that have no homolog in the compared sequence are not taken into account for the calculation of the Percent Identity. In the present context, a determination of the “percentage of identity” between, for example, SEC ID NO:1, or its fragment, and a species homologue would not include a sequence comparison where the species homologue has no homologous sequence to compare in an alignment (i.e., SEC ID NO:1 or its fragment has an insertion at that point, or the species homologue has a gap or deletion, as the case may be). Therefore, “percentage of identity” does not include penalties for gaps, deletions, and insertions. A homologous sequence in the context of nucleic acid sequences refers to a sequence that is substantially homologous to a reference nucleic acid sequence. In some embodiments, two sequences are considered substantially homologous if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of their corresponding nucleotides are identical with respect to a relevant residue segment. In some embodiments, the relevant segment is an entire (i.e., complete) sequence. “Targeted insertion” refers to gene-directing methods used to direct the insertion or integration of a gene or nucleic acid sequence to a specific location in the genome—that is, to direct DNA to a specific site between two nucleotides in a contiguous polynucleotide chain. Targeted insertion can also be performed for a particular gene cassette, which includes multiple genes, regulatory elements, and / or nucleic acid sequences. “Insertion” and “integration” are used interchangeably. It is understood that the insertion of a gene or nucleic acid sequence (e.g., a nucleic acid sequence comprising an expression cassette) may result in (or be genetically engineered to result in) the replacement or deletion of one or more nucleic acids, depending on the gene-editing technique used. A “recognition site” or “recognition sequence” is a specific DNA sequence recognized by a nuclease or other enzyme that binds to and directs the site-specific dissociation of the DNA structure. Endonucleases dissociate DNA within a DNA molecule. Recognition sites are also referred to technically as recognition target sites. “A recombinase recognition site is the specific DNA sequence recognized by a recombinase, such as Cre recombinase (Cre) or flppase (flp). Site-specific recombinases can perform DNA rearrangements, including deletions, inversions, and translocations, when one or more of their target recognition sequences are strategically placed in an organism’s genome. For example, Cre is specifically involved in recombination events at its target DNA recognition site loxP, which is composed of two 13-bp inverted repeats separated by an 8-bp spacer. More than one recombinase recognition site can be employed, for example, to facilitate recombination-mediated DNA exchange. Variants or mutants of recombinase recognition sites, such as lox sites, can also be used (Araki, N. et al., 2002, Nucleic Acids Research, 30:19). e103). “Recombinase-mediated cassette swapping” refers to a process for precisely replacing a genomic target cassette with a donor cassette. The molecular compositions typically provided to carry out this process include: 1) a genomic target cassette flanked at both the 5' and 3' ends by recognition target sites specific to a particular recombinase, 2) a donor cassette flanked by matching recognition target sites, and 3) the site-specific recombinase. Recombinase proteins are well-known in this technique (Turan, S. and Bode J., 2011, FASEB J„ 25, pp. 4088-4107) and allow the precise dissociation of DNA within a specific recognition target site (DNA sequence) without gaining or losing nucleotides. Common recombinase / site combinations include, but are not limited to, Crellox and Flp / frf. A "vehicle" is a composition consisting of any polynucleotide or set of polynucleotides that carries an exogenous nucleic acid for introduction into a cell. Vehicles include vectors, plasmids, and mRNA molecules that are delivered to the cell by well-known transfection methods. For example, an mRNA introduced into cells may be transient and not integrate into the genome; however, the mRNA may carry the exogenous nucleic acid necessary for integration to occur. General Description The invention is based at least in part on the discovery of unique sequences, i.e., sites, in a genome that exhibit more efficient recombination, insertion stability, and expression at higher levels than other regions or sequences in the genome. The invention is also based at least in part on the discovery that when such expression-boosting sequences are identified, a suitable gene or construct can be exogenously added to or near the sequences, and that the exogenously added gene can be advantageously expressed or used for subsequent genomic modifications. Such sequences, called expression-boosting sequences, are considered stable and are not located within a coding region of the genome. These stable and expression-boosting regions can be modified by genetic engineering for future cloning or genome editing.Therefore, a reliable expression system is built into the genomic structure of the cell. The invention is also based on the specific targeting of an exogenous gene to the integration site. The methods of the invention allow for the efficient "conversion" of the cellular genome into a useful cloning cassette, for example, by employing recombinase-mediated cassette exchange (RMCE). To this end, the methods of the invention utilize recombinase recognition sites in the cellular genome for the placement of genes of interest to create highly productive cell lines for the production of recombinant proteins. The compositions of the invention can also be incorporated into expression constructs, for example, expression vectors for cloning and genetically engineering new cell lines. Expression vectors comprising the polynucleotides of the invention can be used to transiently express proteins or can be integrated into a genome by random or directed recombination, such as homologous recombination or recombination mediated by recombinases that recognize specific recombination sites (e.g., Cre-lox-mediated recombination). Expression vectors comprising the polynucleotides of the invention can also be used to evaluate the efficacy of other DNA sequences, for example, cis-acting regulatory sequences. Integration sites are typically identified by random integration or retroviral integration event analysis. The CHO integration site described in detail in this invention was identified by random integration of DNA encoding a multi-stranded antibody, and the expressed protein was found to exhibit increased expression. The exemplary multichain antibody comprising one heavy chain (HC) and two copies of one light chain (LC) was randomly integrated into the genome in an expression cassette containing alternating hygromycin resistance genes (see, e.g., three identical Hyg genes as illustrated in Figure 1A). A high and stable expression clone was the result of integrating the expression cassette within the sites identified as SEC ID NO; 1. Compared to integration into another region of the CHO genome (control integration site), the exemplary multi-chain antibody exhibits higher levels of expression when integrated within the SEC ID NO:1 locus. Interestingly, the number of gene copies is comparable for antibody-expressing polynucleotides integrated within SEC ID NO:1 versus the control integration site; however, protein titers are 3 times higher for antibody-expressing polynucleotides integrated within SEC ID NO:1. Directed recombination methods were used to convert the CHO cell genome into a cloning construct containing recombinase recognition sites (see, e.g., Figures 3A-B). Essentially, after identification of the SEC ID NO:1 integration site, recombinase recognition sites (e.g., lox sites) were employed at the locus to introduce expression cassettes comprising an expressible GDI, such as a selectable marker (see, e.g., Figures 3A-B), together with any of the other desirable elements such as, e.g., promoters, enhancers, markers, operators, ribosome binding sites (e.g., internal ribosome entry sites), etc. An illustration of an exemplary donor construct to be used for targeted integration of lox sites within SEC ID NO;1 is shown in Figure 1B. The donor construct comprises an expression cassette driven by a neomycin resistance gene (neo) and an internal ribosome entry site (IRES), wherein the cassette comprises a fluorescent marker (mKate) and is flanked at the 5' and 3' ends by recombinase recognition sites and 5' and 3' homology arms (homologs to SEC ID NO.1). The insertion within the SEC ID NO.1 locus is shown, where the insertion results in the neo / mKate donor construct replacing the expression cassette comprising the hygromycin resistance marker, wherein the expression cassette within the SEC ID NO.1 locus is flanked at its 5' and 3' ends by recombinase recognition sites connected to 5' and 3' homology arms (homologs to SEC ID NO.1) (see Figure 1B). Compositions and methods are provided for stably integrating a nucleic acid sequence into a eukaryotic cell, where the nucleic acid sequence is capable of enhanced expression by virtue of being integrated into SEC ID NO:1 or its expression-enhancing fragment. Cells containing a recombinase recognition sequence within SEC ID NO:1 suitable for inserting a GDI to achieve expression of a protein of interest from the GDI are provided. Compositions and methods are also provided for targeting integration sites in relation to expression constructs, e.g., expression vectors, and for adding one or more exogenous nucleic acids into a CHO cell of interest. Physical and Functional Characterization of an Integration Site in CHO The nucleic acid sequence of SEC ID NO:1 (and the broader nucleic acid sequence of SEC ID NO:4) was empirically identified by upstream and downstream sequences of the integration site of a nucleic acid construct (comprising an expression cassette) from a cell line expressing a protein at a high level. The nucleic acid sequences of the invention provide sequences with a novel functionality associated with the enhanced expression and stability of a nucleic acid (e.g., an exogenous nucleic acid comprising a GDI) and, without being limited by any theory, may function in the same or different ways than previously described for cis-acting elements such as promoters, enhancers, locus control regions, scaffold-binding regions, or matrix-binding regions.SEC ID NO:1 does not appear to have any open reading frames (ORFs), making it unlikely that the locus encodes novel frans-activating proteins. A putative zinc finger protein has been identified at the 3' (downstream) genomic locus of SEC ID NO:4. The activity of enhancing expression was identified with respect to the integration of an expression cassette comprising a first hygromycin (Hyg) gene, a first GDI, a second Hyg gene, a second GDI, a third Hyg gene, and a third GDI-coding sequence within a single site of a non-coding region of CHO genomic DNA. Expression vectors comprising, for example, a 1 kb isolated 5' region and a 1 kb isolated 3' region identified from the non-coding region of CHO genomic DNA with respect to an expression cassette expressing a GDI were able to confer high levels of recombinant protein expression in transfected CHO cells. The invention encompasses expression vectors comprising fragments of SEC ID NO:1 or reverse-oriented fragments of SEC ID NO:4. Other combinations of the fragments described herein may also be developed. Examples of other combinations of the fragments described herein that may also be developed include sequences that include multiple copies of the expression-enhancing sequences described herein, or sequences derived by combining the described SEC ID NO:1 or SEC ID NO:4 fragments with other nucleotide sequences to achieve optimal combinations of regulatory elements. Such combinations may be linked or arranged contiguously to provide optimal spacing of the SEC ID NO:1 or SEC ID NO:4 fragments (e.g., by introducing spacer nucleotides between the fragments).The regulating elements can also be arranged to provide optimal spacing of a SEC ID NO:1 fragment with respect to the regulating elements. The sequences SEC ID NO:1 and SEC ID NO:4 described herein were isolated from CHO cells. Other mammalian species (such as humans or mice) have been found to have limited homology with the identified region of increased expression; however, homologous sequences can be found in cell lines derived from other tissue types of Cricetulus griseus, or other homologous species, and can be isolated using well-established techniques. For example, other homologous sequences can be identified by cross-species hybridization or PCR-based techniques. Furthermore, changes can be made to the exposed nucleotide sequence in SEC ID NO:1, SEC ID NO:4, or their fragments, using well-established site-directed or random mutagenesis techniques.The resulting sequence variants can then be tested to determine expression-enhancing activity as described in this invention. DNA sequences that are at least approximately 90% identical in nucleic acid identity to SEC ID NO:1, SEC ID NO:4, or their fragments, and that have expression-enhancing activity, are isolated by routine experimentation and are expected to exhibit expression-enhancing activity. For the fragments of SEC ID NO:1 or SEC ID NO:4, percentage identity refers to that portion of the native reference sequence found in the fragment of SEC ID NO:1 or in the fragment of SEC ID NO:4. Therefore, homologs of SEC ID NO:1, SEC ID NO:4, or their fragments, and their variants, are also encompassed by the embodiments of the invention. In certain embodiments, the fragment of SEC ID NO:1 is selected from the group consisting of nucleotides spanning positions numbered 104,000; 100-3,900; 200-3,800; 300-3,700; 400-3,600; 500-3,500; 600-3,400; 700-3,300; 800-3,200; 900-3,100; 1,000-3,000; 1,100-2,900; 1,200-2,800; 1,300-2,700; 1,200-2,600; 1,300-2,500; 1,400-2,400; 1,500-2,300; 1,600-2,200; 1,700-2,100; 1,800-2,050; 1,850-2,050; 1,900-2,040; 1,950-2,025; 1,990-2,021; 2,002-2,021; and 2,010-2,015 of SEC ID NO:1. In another embodiment, the fragment of SEC ID NO:1 is selected from the group consisting of nucleotides spanning positions numbered 10-500; 500-1,000; 500-2,100; 1,000-1,500; 1,000-2,100; 1,500-2,000; 1,500-2,500; 2,000-2,500; 2,500-3,000; 2,500-3,500; 3,000-3,500; 3,000-4,000; and 3,500-4,000 of SEC ID NO:1. In certain embodiments, the exogenous nucleic acid sequence is integrated into or near specific sites within the fragment described above. In another embodiment, the exogenous nucleic acid sequence is positioned within SEC ID NO:1 or its fragments as described above, or within a sequence that is at least approximately 90% identical, at least approximately 91% identical, at least approximately 92% identical, at least approximately 93% identical, at least approximately 94% identical, at least approximately 95% identical, at least approximately 96% identical, at least approximately 97% identical, at least approximately 98% identical, or at least approximately 99% identical to the expression-enhancing sequence of SEC ID NO:1 or its expression-enhancing fragment. Cell populations expressing increased levels of a protein of interest can be developed using the methods provided in the present invention. The absolute level of expression will vary with the specific protein, depending on how efficiently the protein is processed by the cell. Cell groups developed with exogenous sequence(s) integrated within the expression-enhancing sequences of the invention are stable over time and can be treated as stable cell lines for most purposes. Recombination steps can also be delayed until later in the cell line development process of the invention. Locus of Increased Expression in CHO and Fragments of the Same The invention encompasses an expression-enhancing fragment of a nucleotide sequence that is at least approximately 90% identical, at least approximately 91% identical, at least approximately 92% identical, at least approximately 93% identical, at least approximately 94% identical, at least approximately 95% identical, at least approximately 96% identical, at least approximately 97% identical, at least approximately 98% identical, or at least approximately 99% identical to the nucleotide sequence of SEC ID NO:1 or SEC ID NO:4.The invention includes vectors comprising a fragment, including for transient or stable transfection, encompassing positions numbered 10-4,000; 100-3,900; 200-3,800; 300-3,700; 400-3,600; 500-3,500; 600-3,400; 700-3,300; 800-3,200; 900-3,100; 1,000-3,000; 1,100-2,900; 1,200-2,800; 1,300-2,700; 1,200-2,600; 1,300-2,500; 1,400-2,400; 1,500-2,300; 1,600-2,200; 1,700-2100; 1,800-2050; 1850-2050, 1,900-2040; 1950-2,025, 1990-2021, 2002-2021 and 2,010-2,015 of SEC ID NO:1. The invention further includes a eukaryotic cell comprising such a fragment type wherein the fragment is exogenous to the cell and is integrated into the cell's genome, and cells comprising such a fragment type having at least one recombinase recognition site that is within, immediately 5', or immediately 3' to the fragment. In one embodiment, the augmenting fragment of the expression SEC ID NO:1 is located in a position within SEC ID NO:1 and spans positions numbered 10-500; 500-1,000; 500-2,100; 1,000-1,500; 1,000-2,100; 1,500-2,000; 1,500-2,500; 2,000-2,500; 2,500-3,000; 2,500-3,500; 3,000-3,500; 3,000-4,000; or 3,500-4,000 of SEQ ID NO:1. Where stable integration and / or enhanced transcription of an integrated polynucleotide is supported, the exact location of the locus insertion site (i.e., integration) with respect to the exemplified sites is not essential. Rather, the integration site may be at any position within or adjacent to SEC ID NO:1 or a fragment of SEC ID NO:1, or SEC ID NO:4 or a fragment of SEC ID NO:4, as described in this invention. Whether a specific chromosomal location within or adjacent to the locus of interest supports stable integration and efficient transcription of an integrated exogenous gene can be determined in accordance with conventional procedures well known in the art or according to the methods exemplified in this invention. The integration sites considered in this invention are located within a locus comprising the nucleotide sequence SEC ID NO:1 or SEC ID NO:4, or in close proximity to the locus of interest, e.g., less than approximately 1 kb, 500 base pairs (bp), 250 bp, 100 bp, 50 bp, 25 bp, 10 bp, or less than approximately 5 bp upstream (5') or downstream (3') with respect to the location of SEC ID NO:1 in the chromosomal DNA. In still other embodiments, the integration site employed is located approximately 1000, 2500, 5000 or more base pairs upstream (5') or downstream (3') with respect to the location of SEC ID NO:1 or SEC ID NO:4 in chromosomal DNA. It is understood in the field that large genomic regions, such as scaffold / matrix-binding regions, are employed for the efficient replication and transcription of chromosomal DNA. A scaffold / matrix-binding region (S / MAR), also known as a scaffold-binding region (SAR), matrix-binding region, or matrix-associated region (MAR), is a region of eukaryotic genomic DNA where it binds to the nuclear matrix. Not constrained by any particular theory, S / MARs typically map to non-coding regions, separate a given transcriptional region (e.g., a chromatin domain) from its neighbors, and also provide platforms for the machinery and / or binding of factors that enable transcription, such as recognition sites for DNases or polymerases. Some S / MARs have been characterized at lengths of approximately 14–20 kb (Klar et al., 2005, Gene 364:79–89).As such, the integration of genes into LOCUS 1 (within or near SEC ID NO:1 or SEC ID NO:4) is expected to confer increased expression. Experts in the technique will recognize that various elements can be optimized for high transcriptional activity at the target locus, resulting in high expression of an inserted gene encoding a protein of interest. Elements to consider include a strong promoter to drive transcription, adequate transcriptional machinery, and DNA with an open and accessible configuration. Insertion at the target locus can be optimized, within the scope of the individual's skill, by targeting a selected integration site within either SEC ID NO:1 or SEC ID NO:4. In one embodiment, the expression-enhancing sequence SEC ID NO:1 is used to increase the expression of a GDI. Figure 2A shows the results of a GDI operatively linked to SEC ID NO:1 (LOCUS 1) compared to the same GDI integrated into a different locus in the CHO cell genome (control locus). The number of gene copies measured for each cell line is equivalent; however, the experiments show that the mRNA level and protein titer of cells expressing the GDI are 3 times higher for GDI operatively linked to LOCUS 1. In various embodiments, the expression of a GDI can be augmented by placing the GDI within SEC ID NO. 1 or SEC ID NO: 4. In various embodiments, the augmentation of the expression is from at least approximately 1.5 times to approximately 3 times or more. Genetic Modification of the Target Locus Methods for genetically modifying a cellular genome at a particular location (i.e., target locus) can be achieved in various ways. Gene editing techniques have been used to stably integrate a nucleic acid sequence into a eukaryotic cell, where the nucleic acid sequence is an exogenous sequence not normally found in such cells. Clonal expansion is necessary to ensure that the cell progeny share the identical genotypic and phenotypic characteristics of the genetically engineered cell line. In some examples, native cells are modified using a homologous recombination technique to integrate an exogenous nucleic acid sequence within SEC ID NO:1 or SEC ID NO:4.In other examples, cells containing at least one recombinase recognition sequence within SEC ID NO:1 or SEC ID NO:4 are provided, convenient for integrating an exogenous nucleic acid sequence or gene of interest. In some examples, cells are provided containing a first recombinase recognition sequence and a second recombinase recognition sequence, where each of the first and second recombinase recognition sequences is selected from the group comprising LoxP, Lox511, Lox5171, Lox2272, Lox2372, Loxm2, Lox-FAS, Lox71, Lox66, and mutants thereof. In this case, where recombinase-mediated cassette exchange (RMCE) is desired, the site-specific recombinase is Cre recombinase or a derivative thereof. In other examples, each of the first and second recombinase recognition sequences is selected from the group comprising FRT, F3, F5, FRT mutant-10, FRT mutant+10 and mutants thereof, and in this case, when RCME is desired, the site-specific recombinase is Flp recombinase or its derivative.In another additional example, each of said first and second recombinase recognition sequences is selected from the group comprising attB, attP and mutants thereof, and in this case where the RMCE is desired, the site-specific recombinase is integrase phiC31 or its derivative. In one respect, the methods and compositions for stably integrating a nucleic acid sequence within SEC ID NO:1 or SEC ID NO:4, or its expression-enhancing fragment, are through homologous recombination. A nucleic acid molecule, i.e., a gene or polynucleotide of interest, can be inserted into the desired locus (i.e., SEC ID NO:1) by homologous recombination or using site-specific nuclease methods that target sequences specifically at the integration sites. For homologous recombination, homologous polynucleotide molecules (i.e., homologous arms) are aligned and exchange a portion of their sequences. A transgene can be introduced during this exchange if it is flanked by homologous genomic sequences. For example, a recombinase recognition site can be introduced into the host cell genome at the integration sites. Homologous recombination in eukaryotic cells can be facilitated by introducing a fragment into chromosomal DNA at the integration site. Model systems have shown that the frequency of homologous recombination during genetic targeting increases if a double-strand break is introduced within the chromosomal target sequence. This can be achieved by directing certain nucleases to the specific integration site. DNA-binding proteins that recognize DNA sequences at the target locus are known in this technique. Genetic targeting vectors are also employed to facilitate homologous recombination.In the absence of a genetic targeting vector for homology-directed repair, cells frequently close double-strand breaks by nonhomologous end-joining (NHEJ), which can lead to the deletion or insertion of multiple nucleotides at the break site. In the case of insertions or deletions (InDels), a small number of nucleotides are randomly inserted or deleted at the break site, and these InDels can disrupt or divert any open reading frame (ORF) of a gene within the target locus. The locus identified as SEC ID NO:1 (or SEC ID NO:4) is understood not to be a genetic coding region; therefore, no alteration of endogenous gene transcription is anticipated through insertion and / or deletion at this locus. Homology-directed repair (or homology-directed recombination) (HDR) is particularly useful for inserting or integrating genes into the target locus. A donor construct comprises homologous arms derived from SEC ID NO. 1 or SEC ID NO. 4 as described in this invention. The construction of genetic targeting vectors and selection of nucleases are within the knowledge of the expert in the technique to which the present invention belongs. In some examples, zinc finger nucleases (ZFNs), which have a modular structure and contain individual zinc finger domains, recognize a particular 3-nucleotide sequence in the target sequence (e.g., the integration site being targeted). Some implementations may use ZFNs with a combination of individual zinc finger domains that target multiple sequences. Transcription activator-type (TAL) effector nucleases (TALENs) can also be used for site-specific genome editing. The DNA-binding domain of the TAL effector protein is typically used in combination with a non-specific dissociation domain of a restriction nuclease, such as Fokl. In some embodiments, a fusion protein comprising a DNA-binding domain of the TAL effector protein and a restriction nuclease dissociation domain is used to recognize and dissociate DNA at a target sequence within the locus of the invention (Boch J et al., 2009 Science 326:150920 1512). RNA-guided endonucleases (RGENs) are programmable genome engineering tools that were developed from bacterial adaptive immune machinery. In this system, clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated immune response (Cas)—the Cas9 protein forms a sequence-specific endonuclease when it forms a complex with two RNAs, one which guides target selection. RGENs consist of components (Cas9 and tracrRNA) and a target-specific CRISPR RNA (crRNA). Both the target DNA dissociation efficiency and the location of the dissociation sites vary based on the position of an adjacent protospacer motif (PAM), an additional requirement for target recognition (Chen, H. et al, J. Biol. Chem. published online March 14, 2014, as Manuscript M113.539726). Strategies for identifying unique sequences for the specific targeting locus of SEC ID NO:1 are known in the technique; however, alignment of many of these sequences to the CHO genome reveals potential off-target sites with a 16-17 base pair match. An example of a 20 bp guide RNA encoded by the sequence exposed in SEC ID NO:5 (corresponding to nucleotides 1990-2001 of SEC ID NO:1) is useful for CRISPR / Cas RNA-guided gene editing of SEC ID NO:1 or SEC ID NO:4. A plasmid comprising a promoter that drives the expression of A small guided RNA and a tracrRNA (e.g., SEC ID NO:6), as well as carrying a suitable Cas9 enzyme under the control of a promoter, can be co-transfected with a donor vector (carrying the gene of interest flanked by 5' and 3' homology arms) to employ the integration sought by this method. Various modifications and variants of RNA molecules, in addition to those described above in this invention, are obvious to those skilled in the art and are intended to fall within the scope of the invention. In some embodiments, the vehicle for introducing an exogenous nucleic acid into the genome, comprising a sequence encoding the gene of interest, recognition sequence, or gene cassette, as the case may be, comprises a vector carrying the exogenous nucleic acid and one or more additional vectors or mRNAs. In one embodiment, the one or more additional vectors or mRNAs comprise a nucleotide sequence encoding a site-specific nuclease, including, but not limited to, a zinc finger nuclease (ZFN), a ZFN dimer, a transcription activator-type effector nuclease (TALEN), a TAL effector domain fusion protein, and an RNA-guided DNA endonuclease. In certain embodiments, the one or more vectors or mRNAs comprise a first vector comprising a guide RNA, a tracrRNA, and a nucleotide sequence encoding a Cas enzyme, and a second vector comprising a donor (exogenous) nucleotide sequence.The donor sequence comprises a nucleotide sequence encoding the gene of interest, or the recognition sequence, the gene cassette comprising any of these exogenous elements intended for the desired insertion. When mRNA is used, it can be transfected into the cell by common transfection methods known to experts and may encode an enzyme, such as a transposase or endonuclease. While an mRNA introduced into cells may be transient and not integrate into the genome, it may contain an exogenous nucleic acid necessary or beneficial for integration to occur. In some cases, mRNA is chosen to eliminate any risk of long-lasting side effects from an accessory polynucleotide, where only short-term expression is required to achieve the desired GDI integration. Other homologous recombination methods are available to the expert, such as BuD-derived nucleases (BuDNs) with precise DNA-binding specificities (Stella, S. et al. Acta Cryst. 2014, D70, 2042-2052). Precise genome modification methods are chosen based on available tools compatible with unique target sequences within SEC ID NO:1, thus avoiding alteration of the cellular phenotype. Genetic Targeting Constructs The polynucleotide sequence to be integrated into the host genome can be any industrially useful DNA sequence, such as a recognition sequence, for generating cell expression systems. The polynucleotide sequence to be integrated into the host genome can encode any therapeutically or industrially useful protein or proteins as described in this invention. Identifying the target sequence within the target locus for integrating the exogenous nucleic acid sequence depends on several factors. Depending on the homologous recombination method used, the person skilled in the art will be able to select sequences homologous to SEC ID NO: 1 or SEC ID NO: 4. Site-specific nuclease vectors, when employed, require additional components (sequence compositions) that recognize the specific site intended for DNA dissociation. As such, a genetic targeting construct typically incorporates such nucleotide sequences that facilitate the targeted integration of an exogenous nucleic acid sequence into the locus of interest. In some embodiments, the construct comprises a first homologous arm and a second homologous arm. In other embodiments, the construct (e.g., a genetic cassette) comprises homologous arms derived from either sequence ID NO:1 or sequence ID NO:4. In some embodiments, the homology arms comprise a nucleotide sequence homologous to a nucleotide sequence present in either sequence ID NO:1 or sequence ID NO:4. In specific embodiments, the construct comprises a 5' homology arm having the nucleotide sequence of SEC ID NO: 2 (corresponding to nucleotides 1001-2001 of SEC ID NO: 1), and a 3' homology arm having the nucleotide sequence of SEC ID NO: 3 (corresponding to nucleotides 2022-2001 of SEC ID NO: 1).Homologous arms, for example, a first homologous arm (also called the 5' homology arm) and a second homologous arm (also called the 3' homology arm), are homologous to a targeted sequence within the locus. The 5' to 3' homologous arms can expand a targeted region or sequence within the locus comprising at least 1 kb, or at least approximately 2 kb, or at least approximately 3 kb, or at least approximately 4 kb, or at least 5 kb, or at least approximately 10 kb. In other embodiments, the total number of nucleotides in a selected target sequence for a first and second homologous arm comprises at least 1 kb, or at least approximately 2 kb, or at least approximately 3 kb, or at least approximately 4 kb, or at least 5 kb, or at least approximately 10 kb.In some instances, the distance between the homology arm at 5' and the homology arm at 3' (homologous to the target sequence) comprises at least 5 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, or at least 1 kb, or at least approximately 2 kb, or at least approximately 3 kb, or at least approximately 4 kb, or at least 5 kb, or at least approximately 10 kb. In instances where SEC ID NO: 2 and SEC ID NO: 3 are chosen as homology arms at 5' and 3', the distance between the two homology arms can be 20 nucleotides (corresponding to nucleotides 2002-2021 of SEC ID NO: 1); and said homology arms can be involved in the integration of an exogenous nucleic acid sequence within a locus comprising SEC ID NO: 1, e.g., within nucleotides 1990-2021 or 2002-2021 of SEC ID NO: 1, and a simultaneous deletion of nucleotides 2002-2021 of SEC ID NO: 1. In other embodiments, the construct comprises a first homologous arm and a second homologous arm, where the combined first and second homologous arms comprise a target sequence that replaces an endogenous sequence within the locus. In still other embodiments, the first and second homologous arms comprise a target sequence that is integrated or inserted within an endogenous sequence within the locus. The modified cell lines were created by integrating one or more recombinase recognition sites into a location within SEC ID NO:1. These modified cell lines may also include additional exogenous genes for negative or positive selection of the expressed gene of interest. The invention provides methods for modifying a cell genome CHO comprising introducing one or more vehicles into the cell, wherein the one or more vehicles comprise an exogenous nucleic acid comprising a sequence for integration, a 5' homology arm homologous to a sequence present in the nucleotide sequence of SEC ID NO:1, and a 3' homology arm homologous to a sequence present in the nucleotide sequence of SEC ID NO:1. In some embodiments, the methods further provide one or more vehicles comprising a nuclease and compositions for site-specific DNA dissociation at the integration site. Modified cell lines can be used as convenient and stable expression systems for recombinase-mediated cassette exchange (RMCE). A nucleic acid sequence encoding a protein of interest can be conveniently integrated into the modified cell comprising SEC ID NO:1 or its expression-enhancing fragment, which has at least one recombinase recognition site, for example, through an RMCE process. Recombinant expression vectors may comprise cDNA-derived or synthetic DNA fragments encoding a protein, operationally linked to a φ-derived transcriptional and / or translational regulatory element of mammalian, viral, or insect genes. These regulatory elements include transcriptional promoters, enhancers, sequences encoding suitable mRNA ribosomal binding sites, and sequences controlling transcription and translation termination, as described in detail later. Mammalian expression vectors may also include non-transcribed elements such as an origin of replication, other non-transcribed sequences flanking the 5' or 3' ends, and non-translated sequences at the 5' or 3' ends, such as splicing donor and acceptor sites. A selectable marker gene to facilitate transfectant recognition may also be incorporated. Fluorescent markers are selectable marker genes suitable for recognizing gene cassettes that have been successfully or unsuccessfully inserted and / or replaced, as the case may be. Examples of fluorescent markers are well known in the field, including, but not limited to, coral discosome (DsRed), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), enhanced cyan fluorescent protein (eCFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), and far-red fluorescent protein (e.g., mKate, mKate2, mPlum, mRaspberry, or E2-crimson). See also, e.g., Nagai, T., et al. 2002 Nature Biotechnology 20:87-90; Heim, R. et al. February 23, 1995 Nature 373:663-664; and Strack, R.L. et al. 2009 Biochemistry 48:8279-81. Transcriptional and translational control sequences in expression vectors useful for transfecting vertebrate cells can be provided by viral sources. For example, commonly useful promoters and enhancers are derived from viruses such as polyomavirus, adenovirus 2, simian virus 40 (SV40), and human cytomegalovirus (CMV). Viral genomic promoters, control sequences, and / or signal sequences can be used to drive expression. provided that these control sequences are compatible with the chosen host cell. Non-viral cellular promoters (e.g., β-globin promoters and EF-1a promoters) can also be used, depending on the cell type in which the recombinant protein is to be expressed. DNA sequences derived from the SV40 viral genome, such as the SV40 origin, early and late promoters, enhancer, splicing sites, and polyadenylation sites, can be used to provide other genetic elements useful for the expression of a heterologous DNA sequence. The early and late promoters are particularly useful since they are readily obtained from the SV40 virus as a fragment that also comprises the SV40 viral origin of replication (Fiers et al., Nature 273:113, 1978). Smaller or larger SV40 fragments can also be used. Generally, the approximately 250 bp sequence extending from the Hind III site to the Bgll site located at the SV40 origin of replication is included. Bistronic expression vectors used for the expression of multiple transcripts have been previously described (Kim SK and Wold BJ, Cell 42:129, 1985) and can be used in combination with an expression-enhancing sequence of the invention, e.g., SEC ID NO:1, or a fragment thereof. Other types of expression vectors will also be useful, e.g., those described in U.S. Patent No. 4,634,665 (Axel et al.) and U.S. Patent No. 4,656,134 (Ringold et al.). Proteins of interest Any protein of interest suitable for expression in eukaryotic cells may be used. For example, a protein of interest includes, but is not limited to, an antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a ScFv or its fragment, an Fe fusion protein or its fragment, a growth factor or its fragment, a cytokine or its fragment, or an extracellular domain of a cell-surface receptor or its fragment. Proteins of interest may be simple polypeptides consisting of a single subunit, or complex multisubunit proteins comprising two or more subunits. Host Cells and Transfection The host cells used in the methods of the invention are mammalian host cells, including, for example, Chinese hamster ovary (CHO) cells and mouse cells. In a preferred embodiment, the invention provides a nucleic acid sequence fragment from SEC ID NO:1 that encodes an expression-enhancing sequence in a CHO cell. An integration site may be located within SEC ID NO:1, or any fragment of SEC ID NO:1. An integration site, for example, may be a recombinase recognition site located within SEC ID NO:1, or any fragment of SEC ID NO:1. An example of a suitable integration site is a LoxP site. Another example of a suitable integration site is two recombinase recognition sites, for example, selected from the group consisting of a LoxP site, a Lox511 site, a Lox2272 site, a Lox2372 site, a Loxm2 site, a Lox71 site, a Lox66 site, and a Lox5171 site.In other embodiments, the integration site is located at a position within a sequence or adjacent to a position within a selected sequence from the group consisting of nucleotides spanning positions numbered 104,000; 100-3,900; 200-3,800; 300-3,700; 400-3,600; 500-3,500; 600-3,400; 700-3,300; 800-3,200; 900-3,100; 1,000-3,000; 1,100-2,900; 1,200-2,800; 1,300-2,700;. 1,200-2,600; 1,300-2,500; 1,400-2,400; 1,500-2,300; 1,600-2,200; 1,700-2,100; 1,800-2,050; 1,850-2,050; 1,900-2,040; 1,950-2,025; 1,990-2,021; 2,002-2,021; and 2,010-45 2015 of SEC ID NO:1. In certain embodiments, the integration site at a position within or adjacent to a position within SEC ID NO:1 is selected from the group consisting of nucleotides spanning positions numbered 1990-1991, 1991-1992, 1992-1993, 1993-1994, 1995-1996, 1996-1997, 1997-1998, 1999-2000, 2001-2002, 2002-2003, 2003-2004, 2004-2005, 2005-2006, 2006-2007, 2007-2008, 2008-2009, 2009-2010, 2010-2011, 2011-2012, 2012-2013, 2013-2014, 2014-2015, 2015-2016, 2016-2017, 2017-2018, 2018-2019, 2019-2020, and 2020-2021 of SEC ID NO:1. The invention includes a mammalian host cell transfected with an expression vector or an mRNA of the invention. While any mammalian cell may be used, in one particular embodiment the host cell is a CHO cell. The transfected host cells include cells that have been transfected with expression vectors or mRNA molecules comprising a sequence encoding a protein or polypeptide. The expressed proteins may be secreted into the culture medium, depending on the selected nucleic acid sequence, but they may be retained within the cell or deposited in the cell membrane. Various mammalian cell culture systems may be employed to express recombinant proteins. Other cell lines developed for specific selection or amplification schemes will also be useful with the methods and compositions provided in this invention, provided that a target locus having at least 80% homology with SEC ID NO:1 has been identified. One realized cell line is the CHO cell line designated K1.To achieve high-volume production of recombinant proteins, the host cell line can be pre-adapted to bioreactor medium where appropriate. Various transfection protocols are known in the technique, and are or Reviewed in Kaufman (1988) Meth. Enzymology 185:537. The transfection protocol chosen will depend on the host cell type and the nature of the GDI, and can be selected based on routine experimentation. The basic requirements of any of these protocols are, first, to introduce DNA encoding the protein of interest into a suitable host cell, and then to identify and isolate host cells that have incorporated the heterologous DNA in a relatively stable, expressible form. The mRNA molecules encoding proteins useful for integration into the host cell genome or other functions may be transient and therefore time-limited. Transfection protocols, as well as protocols for introducing polypeptides or polynucleotide sequences into cells, can vary. Non-limiting transfection methods include chemical-based transfection methods, such as the use of liposomes, nanoparticles, and calcium phosphate (Graham et al. (1973). Virology 52 (2): 456-67, Bacchetti et al. (1977) Proc Nati Acad Sci USA 74 (4): 1590-4 and, Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company. pp. 96-97); dendrimers; or cationic polymers such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation; sonoporation; and optical transfection. Particle-based transfection includes the use of a gene gun and magnet-assisted transfection (Bertram, J. (2006) Current Pharmaceutical Biotechnology 7, 277-28). Viral methods can also be used for transfection. mRNA delivery includes methods using TransMessenger™ and TransIT® (Bire et al. BMC Biotechnology 2013, 13:75). A commonly used method for introducing heterologous DNA into a cell is precipitation with calcium phosphate, for example, as described by Wigler et al. (Proc. Nati. Acad. Sci. USA 77:3567, 1980). DNA introduced into a host cell by this method frequently undergoes rearrangement, making this procedure useful for cotransfection of independent genes. Polyethylene-induced fusion of bacterial protoplasts with mammalian cells (Schaffner et al., (1980) Proc. Nati. Acad. Sci. USA 77:2163) is another useful method for introducing heterologous DNA. Protoplast fusion protocols frequently provide multiple copies of the plasmid DNA integrated into the mammalian host cell genome, and this technique requires that the selection and amplification marker be on the same plasmid as the GDI. Electroporation can also be used to introduce DNA directly into the cytoplasm of a host cell, for example, as described by Potter et al. (Proc. Nati. Acad. Sci. USA 81:7161, 1988) or Shigekawa et al. (BioTechniques 6:742, 1988). Unlike protoplast fusion, electroporation does not require the selection marker and the GDI to be on the same plasmid. Other reagents useful for introducing heterologous DNA into a mammalian cell have been described, such as Lipofectin™ Reagent and Lipofectin™ Reagent (Gibco BRL, Gaithersburg, MD). Both of these commercially available reagents are used to form lipid-nucleic acid complexes (or liposomes) which, when applied to cultured cells, facilitate nucleic acid uptake. In one embodiment, the introduction of one or more of the polynucleotides into a cell is mediated by electroporation, by intracytoplasmic injection, by viral infection, by an adenovirus, by a lentivirus, by a retrovirus, by transfection, by lipid-mediated transfection, or is mediated by Nucleofection™. A method for amplifying GDI is also desirable for recombinant protein expression, and typically involves the use of a marker of € Selection (reviewed in Kaufman supra). Resistance to cytotoxic drugs is the most frequently used characteristic as a selection marker, and it can result from either a dominant trait (e.g., it can be used regardless of the host cell type) or a recessive trait (e.g., useful in particular host cell types that are deficient in whatever activity is being selected). Several amplifiable markers are suitable for use in the expression vectors of the invention (e.g., as described in Sambrook, Molecular Biology: A Laboratory Manual, Coid Spring Harbor Laboratory, NY, 1989; pp. 16.9–16.14). Selectable markers useful for genetic amplification in drug-resistant mammalian cells are shown in Table 1 of Kaufman, RJ, supra, and include resistance to DHFR-MTX, resistance to P-glycoprotein and multiple drug (MDR)-various lipophilic cytotoxic agents (e.g., doxorubicin, colchicine, vincristine), and adenosine deaminase (ADA)-Xyl-A or adenosine and 2'-deoxyformycin. Other selectable dominant markers include microbially derived antibiotic resistance genes, for example, resistance to neomycin, kanamycin, or hygromycin. However, these selection markers have not been shown to be amplifiable (Kaufman, RJ, supra). Several selection systems are suitable for mammalian hosts (Sambork supra, pp. 16.9–16.15). Cotransfection protocols using two dominant selectable markers have also been described (Okayama and Berg, Mol. Cell Biol 5:1136, 1985). Useful regulatory elements, whether previously described or known in the technique, can also be incorporated into the nucleic acid constructs used to transfect mammalian cells. The chosen transfection protocol and the elements selected for use will depend on the type of host cell employed. Experts in the technique are familiar with numerous different protocols and host cells and can select an appropriate system for the expression of a desired protein based on the requirements of the cell culture system used. Other features of the invention will become evident in the course of the following descriptions of exemplary embodiments, which are provided to illustrate the invention and are not intended to limit them. EXAMPLES The following examples are presented to provide those skilled in the art with a manner for preparing and using the methods and compositions described in this invention, and are not intended to limit the scope of the invention. Every effort has been made to ensure accuracy with respect to the numbers employed (e.g., quantity, temperature, etc.), but it should be noted that some experimental error and deviation may exist. Unless otherwise stated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees Celsius, and pressure is atmospheric or near atmospheric. Example 1. Identification of Locus of Interest and Characterization of Integration Sites K1 cells from CHO were transfected with two plasmids containing selectable antibody sequences and antibiotic resistance genes as markers. Stable transfectants were selected by expanding cells in the presence of antibiotics. Single-cell clones expressing high levels of antibodies were isolated using FASTR® sorting technology (see U.S. Patent No. 8673589B2). Several clones exhibiting the highest levels of antibody expression were identified. The genomic DNA of these clones was fragmented using Covaris Adaptive Focused Acoustics (AFA)™ technology (Fisher, S. et al. 2011, Genome Biology 12.R1). DNA libraries (Agilent SureSelectXT #G9612A) were generated and incubated with custom-made biotinylated RNA baits (Agilent SureSelectXT #5190-4811) designed against whole plasmid sequences introduced into CHO cells. Genomic DNA fragments containing plasmid sequences were enriched with magnetic streptavidin beads and subjected to Illumina MiSeq sequencing to identify plasmid integration sites. Fusion sequences containing both plasmid and CHO genome sequences were analyzed and aligned to the CHO genome. A single integration site was confirmed by Southern blot analysis and PCR followed by sequencing. The integration site having the nucleotide sequence SEC ID NO:1 was identified as an expression access point (see also GenBank Locus ID No. AFTD01150902.1, nt35529:39558).The integration sites were analyzed to determine their suitability for subsequent generation of cell lines. It was desirable that the integration sites be located in a non-coding region that does not alter the cell's normal genomic machinery, e.g., protein translation, or that does not alter the cell's phenotype. Based on the Blat research alignment (Kent WJ., BLAT - the BLAST-like alignment tool. Genome Res. 2002 April; 12(4):656-64), SEC ID NO:1 shares very low homology with mouse and human genome sequences. A sequence blast of SEC ID NO:1 against CHO-1[ATCC]_refseq_transcript (www.chogenome.org) revealed that the identified locus sequence does not contain any £ region coding for none of the known genes. The larger SED ID NO:4 sequence, which spans SEC ID NO.1, was also identified as a suitable locus for target integration. The integration site sequences were determined to be located 5 in non-coding regions of the mouse and CHO genomes, and were further used in the experiments described below. Example 2. Exogenous DNA Effectively Incorporated into Host Cell Integration Sites Targeted insertion of exogenous genes into the specific CHO genome locus identified as SEC ID NO:1 was performed using a TALE nuclease (TALEN). The construct containing antibody heavy and light chain sequences randomly integrated into the cell genome, as in Example 1, was targeted by TALEN. TALEN was targeted to locations within the three identical Hyg genes of the antibody expression construct (see Figure 1A). The TALEN target dissociation site for the Hyg sequence was based on ZiFit.partners.org (ZiFit Targeter Version 4.2). TALENs were designed based on known methods (Boch J et al., 2009 Science 326:1509-1512). A donor mKate vector (see Figure 1B) and a TALEN-coding vector were transfected into CHO host cells using a conventional Lipofectin protocol (LIPOFECTAMINE, Life Technologies, Gaithersburg, MD). Cells were cultured, and stable clones with desirable characteristics were isolated and sorted by FACS. Single integration into the desired locus was confirmed by Southern blot and PCR. Example 3. Recombination Target of Cells Modified by c Genetic Engineering at the Locus of Interest using RMCE A CHO cell line expressing high levels of a fluorescent gene, e.g., mKate, where the gene is flanked by lox sites within the locus of interest, was selected for isolation. A second cell line of CHO expressing a second fluorescent gene, dsRed, where the gene is flanked by lox sites is located within a control locus, i.e. EESYR (U.S. Patent No. 8389239B2, granted March 5, 2013). Transfected CHO cells were adapted to grow in suspension in serum-free production medium. The cells were then transfected into a 10-cm plate with a donor expression vector and a plasmid encoding Cre recombinase. The donor expression vector contains a gene of interest encoding an Fe fusion protein flanked by Lox sites (see Figures 3A or 3B). The cells were cultured in medium containing 400 pg / ml hygromycin for two weeks post-transfection, and cells expressing eYFP but not mKate (or dsRed in the case of EESYR locus integration) were isolated using flow cytometry. eYFP-expressing cells were expanded in suspension cultures in serum-free production medium, and mRNA levels were determined by qRT-PCR using conventional procedures for each cell group encoding the Fe fusion protein (see Figure 4). The recombination exchange efficiency (percentage of surviving cell population expressing the donor cassette marker, i.e., eYFP, as exchanged with the red marker, i.e., mKate or dsRed) was compared between cell groups (Table 1). High recombination exchange efficiency was observed at each locus. TABLE 1: Recombination Efficiency Red Marker Exchange Efficiency (%) (Red Marker + / eYFP-) Random Integration (%) (Red Marker + / eYFP+) LOCUS1 mKate 72 27 (SEC ID NO: 1) Locus Control dsRed 92 7 (EESYR) Transcription was observed at a higher proportion (1.5 times higher) in the cell group that had a genetically engineered LOCUS1 compared to the control Locus (Figure 4). The present invention is not limited in scope by the specific embodiments described herein. In fact, various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the preceding description and the accompanying figures. These modifications are intended to fall within the scope of the appended claims. LIST OF SEQUENCES <110> Regeneron Pharmaceuticals, Inc. <120> NOVEL INTEGRATIONS SITES IN CHO AND THEIR USE <130> 32353 (T0045US01) <150> 62 / 067,774 <151> 10 / 23 / 2014 <160> 6 <170> Patent version 3.5 <210> 1 <211> 4001 <212> DNA <213> Chrysebulus chryseus <400> 1 ccaagatgcc tattcagttt acaaccattc gtggatctac ttggtaacaa ttttttagga atggttagag atagaaaa agctcagatg catcctgaac ataaaattc agcaggtgag gaccagaaa tgaacaata ggggtatttc ctacacacag accacagattgagtggag cctataagtt aaatgctatg gatccatat caatgggaga ctgcagtaat atggcatta tctagagct gggaaggggg aagaaagaga cagagaga catcaactga ttagaaaa cccattatat taatctttg cagcacatgg gataattggag aaggcattat agcattgta aggacagcactacct aaactcccca ttattcaaaaaaataaaa ctacatagag taagatcata gttctcaac gtacactacc acataaaaa ggagcaacaa ctagaatagt tcctaatatt aagttagtat aagcagcccc aggaacaa CAagacctcc ctaggataaa tagaggatag tagagagtag tatacatagatg t gaggcataga gaggaggt gaacttccct atatgaaa agatggga atgaatgttgaagtgta tcagagccca aacagagcca cactacaatg acttagtaa cacaattatt ttgctaaga tggaaacttc agtgtagaa ttagcctgat gctattttct tatagggatc attgttctac gttgctcaac acaagattta gaggacccta aaagctaatt cactacaattagaatagaga ttgaaagtcc tttattgaac gatcattca aaggattaaa aactaccact atattggtg tattaactac gcatttactt tcagcaaca agaatgtagc taccctctg taactgaagg gggtgggggg ctgaatgga gtatttaat aaccacatat atgctttcct aaccataatcat aaaatgaaaa tctcacaaga tatcataccg agagagacat gggagcatgg ggaggacaag gatactag tgtacattc gtaatggat aaaatcatat tacccatgga ggaagattag tgaggttact taggctt tatagttactt ttttatcac tggcttacag ggagagactcagtagta agcaatcctc ttgacttatt taccctttat tgaatcagg cccagcattc aatcttatca caccagaaga taatcctatt ggcttgattg taactccta gaagttttgt atctctcat acatgtccc gggagggag gatgagaagg taggaggc agtgtaatgat gatcatttag tagatgaat tgaaaaagac tacaccaag tgtgataaaa ttctaacggg tggcctgaga aactgcaaatccagaaattc gagactacta caagtaggca tgaattactt gatcttacaa gaacatggtg atgttgctgg agatgtggat atattcacat ctacaagaga gtcataggcc tgacttgttg cttacaataa ggcctatgca cctggagaag agggagttag aagatctagt cttgtatgtt taaatagaaa actggcacta gggaattgtc caagatcca caagtccaa ctaataatct aagcaatagt cgagaggcta ccttaaaagc ctttctctga taatgagat gatgactacc ttatatacca tcctagagcc ttcatccagt agctgatgga agcagacagca gcagtagtcattacta ggagtgatga gcaagtcaa gaccaggctg gagaaacaca cagaaacagc agacctgaaa aaaatgttgc acatggaccc cagactgata gctgggagtc cagcatagga cttttctaga aaccctgaat gaggatatca gtttggaggt ctggttaatc tatttttgagctgg atggattca att atttgggtac ccattccaca tggaggaatt ctctgtcagc ctagacacat gggggaggtt ctaggtctg ctccaaataa tgtgttagac ttgagaac tccttgaga agactcaccc tccctgggga gcagaaaggg gatgggatga gggttggtgggagg agggagggaggag caagtaaatg atgcttgttt ctaatttaaa tgataaagg aaagtaaaa gagaaaaga aaacaggcca aagacagag gtggtgggtg actataaaga aacactatta tctaataa aacatgtcag aagcacacat gaactatag tgttagatatactacaacata agtagtag atatcatctt tcagtgatga aggtgattt atttctccca gattaaagc caagaccta atgaaagtaa ttatcttchaaaggttgaaa atacatactt tgcaatacac agatctgcct agaaatctca tgttcacaat acacatgatg ctcaattgaa ttccattcaa tgttacagtt tagataaaca gtttgtagat aaactcacaa tgtatcattt ctttttattt tttgaccaaa cagcttctca tctatagttac cccaattggg ggaaggggag aatttgaaga aaacctagac cacatacata tttgccattg ggaaacaaag tctaaaatga tgttgttcac atcttctcta ctagtcctct ccccgtccca aagaaccttg gtatatgtgc ctcattttac agagagagga aagcaccc t aaaatttgca tcattgctca gctctgccct tctcatatga cagttacaag tcaaggcttc caaagtccct ctgtcatgtt tggtgtcaat agtttataca gatgacttca tgtcttcata tctaatgtct tatatagatt aatattaaac aatgttattt ctctaaccac attttaataa gt aatgcagaca gagtgctgag acacaatata agcctgatga tctgaatttg aaactcacac ccaccacatg gagaatcaac ttccaaaaat tttcctatta cttccacact tacaccattg tacaaacaca ataataatga acaaaatgaa atgaaataaa aaattaagtc tctgtagggta atgcgtacttactactactac tgctttatgg ttacacttta ccatcttcca ttaattataa ggacttcaat catggcagaa ctatgctgttattgtctcag tgtaacctaa ccaggtgttc cagatgttct taatgtggac acctaaacta tttgatattt gggttaagat ctttccctct ttcagaagaa acctcaggac agaggggaatc ttgtctttta atttgagtc tgtagacttt ttccatttca aatatacatg aaacaagagat tgaaaaaat gtgggaattg caatgatatt aggttcaata ttaagcttca atattatcat ggaatcgcct gttatacact gagtgtttgg caataaggga tttttagaag aaggagtttt tattctcaac aggttcctta agtttagctc aaataaatct aagcaatcca ctctagaatt aatagtttc c <210> 2 <211> 1001 <212> DNA <213> Artificial sequence <220> <223> Polynucle · ido syndic <400> 2 taccctttat gatcttacaa aacttgacag taagatcata tgctaaga aaccacatat tgaatcagg gaacatgtg atatctagtt gttctcaac tggaaacttc atgctttg cccagcattc atgttgctg aaagagcat gtacactacc agtgtattcagacatagtaccat acataaaaa ttagcctgat aagatatccc caccagaga atattcacat aaatgctatg ggagcacaa gctattttct aaattagctt taatcctatt ctacaagaga gatccatat ctagaatagt tatagggatc aagacccat ggctgattg gtcataggcc caatggtaacttaacttactacga t tgacttgttg ctgcagtaat aagttagtat gttgctcaac tctcacaga gaagttgt cttacataa atggcaatta aagcagcccc acagattta tatcataccg atctcctcat ggcctatgca tctagagct aggaacaa gaggacccta aggagacacct ctaccaggga accagggt aaagctaatt gggagcatgg gggagggag agggagttag agagaagaga agggattaaa aggagggaga ggaggacaag aggagaagg aagatctagt aggaggaag aggaggag aggaaag gatcatag taggaggc cttgtagtt taaatagaa actggcatagt gccagatcattgcgagaggcta ccttaaaagc ctttctctga taatgagat gatgactacc ttatatacca tcctagagcc ttcatccagt agctgatgga agcagaagca gatactaca gctaacact gagctagttg c <210> 3 <211> 1001 <212> DNA <213> Artificial Sequence <220> <223> Polynucle ido synSphic <400> 3 caaagtcaag accaggctgg agaacacac agaaacagca gacctgaaaa aaatgttgca catggaccc agactgatg ctgggagtcc agcataggac tttctagaa accctgaatg agatcag ttggaggtc tggttaatct atgggacaccac tggattac tggattac tggattac tttgggtacc cattccacat ggaggaattc tctgtcagcc tagacacatg ggggaggttc taggtcctgc tccaaataat gtgttagact ttgagaact cccttgagaa gactcaccct ccctgggag cagaaagggg atgggatgag ggttggtgag tggagggaggt ggagggaggg aagtaaatga tgcttgtttc taatttaaat gataaagga aaagtaaag aagaaaagaa aacaggccaa aagattataa aagacagagg tggtggtga ctataaagaa acactattat ctaataaaa atatgtcaga agcacacatg aacttatagt gtttatgaaa taatttaacaactaacaata tatcatcttt cagtgatgaa gtgattta tttctcccag aattaagcc aaagacctaa tgaaagtaattatctcaaa aggttgaaa tacatacttt gcaatacaca gatctgccta gaaatctcat gttcacaata cacatgatgc tcattgaat tccattcaat gttacagttt agataacag tttgtattt ttgaccagat gattacatac attactgactct gatatccatc ccaattgggg gaaggggaga atttgagaa aacctagacc actacatat tgccattgg gaacaagt ctaaaatgat gttgttcaca tcttctctac t <210> 4 j <211> 14931 l <212> DNA <213> Gray Rhinoceros <220> <221> misc_feature 10 <222> (2176)..(2239) <223> η is ia, c, g, t: o missing nucleus 15 <400> 4 catgtacact tatgcaagta tgatatggcc caacacagta ttttacacca atttttatct 60 120 aataaata catgtacatc aaaatatatt attaataata acatcattat tctttctttc caagtaataa acacatacac tgaaattttg gttcttgtgg ataattttaa tga 180 tatcttagca tgtttacttc actttctttg catagataac cagtaatcac 240 attgatggat catgtagtga aatgtatttt taggtatcta aggaattttg gcttcgtttt 300 25 gtgcttgttg acactgaatt ctattcctaa caacagtctctg g36 taagatccagtctt atttgtccat ttgcattttc tttattattc atggctgctg ttctagaaag 420 tggaaggtag tgtgtcaagt ctgtttaaca tgtttccctg atgatcagtg tcttaacacc 480 30 tctctgagta catgttggcc aatgtcgttt ctagacccat ctagaccct ttgctgctgtctagct40 cctgccaaga aatttctcct catcctttct gtctcttcac tgatttactt 600 35 gatgtgtgga tttcacattg atcatatgga aatagaagat acaatttct ttattcacag 660 tttggaagac tttcaatctc atagatcatc attatttttt gctactgttc cctat gcattgaat 72 gcattgaatt aattgcttaa acaattaaca agaaagaatc tatttttact 780 40 tgcaataacttccatttcag aacatttac acactgttac tatatccaaa aactagtttt 840 atatatcatg tgagaaatga ctaattcata atttggccat gatattttt tcagaacag 900 45 aaaaagtgac caatacatac acatgctat aaatacaag0 tattataatcag6 attcatttat tatgttttat tttaaaaca 1020 gtggtatcac taaatattaa gttagatgtg tttagtgct taatgaattt atattttaga 1080 50 atgttataag ttgtatag tcaatatgt ataaatttttttttcatttgtttttaattgtg1 tccctttcc agagctgactc tagctcatga tgagttgaca 1200 55 taaaaaactaa acagtacaa atgtacattg cattcagtat tgcacttgat ctttgcactg 1260 aagtttgagt cagttcatac atttagtac att3agttgagtaac 1200 tctggcaaaa tgctcgataa gataagagtc tattgtggaa agccatggca gcaggaaagt 1380 60 aagactgctg atgatgttta atccatagtc aagacgcaga aggagatgaa tgctgtcattaattagtagctactctctt 1500 65 ttcaaatgc gtccccttca gttgttcaac ttttctgta atatccttc aggcatgtct 1560 agagattgt ttcgcaata cttctcaatc cattcaagtt gatgtgcag atatcact 1620gcagaataaa agcctgtaac ttggctcacg tgccaaggaa tatgcacact cctgacacat 1680 70 caataagtaa atcaaagtgt agcttttgcc tttaacattg ccagacttat gtaatgttct 1740 gcacgttctt cctccatcac tttttattct aatggtgttt ccttgacatt gaatcacgct 1800 75 gtggaagctg cttagaatta acattgaaat ctactgatat atttatgatg cagcaattta 1860 gatttactat tttacttaga attttttata attgagagaa tataatattt tcacagttat 1920 ctatctgctg taaatagagg attttaaaaa aaatctctat aacttttttt tacaacacac 1980 80 agtaaaatta agttaaaatt taataaagtc actatgttga tttcaaagtg tgctacgccc 2040 acggtggtca gggtctgcgc atgcccgatg nnnnnnnnnn tagaagaatt tgggtcctga agaactctta caattatgct ttccctgatc catattcaac ttgagcctttt aaagtgtata taaataaaca ttttgttatt aataataatt tatctattta aaagcaccta tcatgcacta agataattaattatgttatattatttattta ttaatataaa tttaattgtc ttttatatgt tattgaggta ttttattcat aatgtcagga tatgtgggtg ctgagtaatc tataaatgac ttcacctgtc cttactattt tccatgaatg catgtgaggg catctagaaa cagcarcttc gctggctctg ctgcctcact ttatatgtta tcacctgacgta tcacctgac agccannnnn nnnnnnnnc ttattaggct gaatcaggaa gatcatgggc gttctttttc ccccttgcca tacattgagt tcccttgttc aatgttctaa tgaaaatttaa agaattcaaa tcaataaaaa tttaactaca agtaattggt ggaggtattg atttctaatcttacgtt catcattatgttgt caagaatact actaattcta ataaaatag attttgtttg gaaggtatga ctgagaatta cattcatccc cagaaaaatt taaatcagta ctaaagctgt catttatatc gataaacaag aaaaaaacct tccctactta ctctatgcct ctctgccttc cattctcata tgg gcaccagcg tgaccag nnnnnnnnnn tgggtgactt tattttacag atgggtagag aatgaccgca tttctgttgt agttccctgagtgtctgtct tccctcggtc aacatttgaa aatatattag atcacattag aagtttcccc catatatagc gtctattata caaatgttaa tttcctataa aaatattctc tttgtttgca tgtgtttgta aaaagatatt ttttcttcta tgtaccaaaa tccatcatgaatgaatgct aagccataggtt tcatagc aatgtattat acactctctc ccaatggggg ttaggaaaaa gaagcacaga ctcaggaaaa attctagatc ccccatgtca ttctctgctt acacatgata gcaagtggcc ccactaaggt gcggttccct nnnnnnnnn tatggaaaga gagactaaga acgtggttga atctgatgct atgatgcttgttcatt ggtggtctcc ctctaaaaca ctgctaaaag ttggatttaa atgatagtag atttgtttca tttatgaagc accttttttg gtagaatgat tatttcacta ccactattct tcttaaatat gaattatttt ttttaggact tatgttaa actttaaaat tatacatcac aattggaata atctttcagatta taattagatac taatttaact ccagtcccca ttcttatcta tgctttctga tctctcttgc ttttctcta cttttctttg ctcacatggc tgtcacatag ttgcatgtag gggctaaggc ggcaatcagc nnnnnnnnnn atttgataga ccctgggacc tggtatgaga tagaatagat gatgtagccc atataccc atatacc tcgaaggc ttaaacaata tttgaacatt aaaataataa actaaaataa caatagtttc aaacagatatgataattaat gagaagaatg atatccctca ggcactaaaa atgttgatag gatcagaccc tctcatgaat taaaatatg atgtgtgcct agagataata atagccagca cagtaaatat attcatctca gattttctaa gtcagcaccc tgtagtattt tagaaacttt tctcctcct tgcctcct cggtatcctcct tttctctcag ctctaagttg cgatgggttg tgcgatcatg nnnnnnnnn tttcatgatg taaagatatc cagattttag catctataaa ccttgccaag tgcttgagag tgatttctcc gtccgtggca aaaattaaaa ctatatata gcattctttc catatgtatc atgaatc atgaatc atattaaatg gcagtttaaa ttagaataat gaaaatatct aggactaata tctgtctcaa attaattaat ggtgactgtg tttgagatgt tactatacca atttctaaac tgtgacacac gtgcatgaca agtgagataa agaacatttt ctctttaatt atgctctatt ctgctgcccttagct gttagct gtgatggttc agtagccatt ctctggcctt aggcaaccac tgtaaaagga atcaaaatta caccaagtat tagggaggca aaccccatgg ccaacaaatt ccctctgcat tactcagcat tatttcttcc atcttatgac gtgaagatga ttttgtttta acaataaatc ttactcaaat tggccatcaattctc tagagattat aggtgtgagt attgaaacaa gtaatgttat attattcttc tcatttaatagatatccaca aagccactta tgacattca gatcagtaa ccaaaggatg cataggtcta cagagctcat gaaatactca actaaaaca gaaggagtat atacaaga ttcaattgg acacaaaat aaagttctta ccagacagct tttctcaaa tgtctctttag agtttcagtttctt tattttg at tccagtcaat gagtaggact agtcccattg ttaaacagcc gatgaattcc cccttacta accaaacat ggcggactta tataaaggg ggtcacacat atattgagg ccaagtgga gttatatgac aatttggctt catggatgct aaacatgaca taacattacattgctt gagaaataat tcaatctcag tgtctatgg aactgcagct gtgtgcacta atcattacat tttccaagca caatgaata gatattt gagaaatcag ctataatctc aacatcagtc tatctagaaa gactacatga tggttgaaat gaatagtaa atagattcatgcttagct tagtgct tagcagtggt ctttgccact cagagggtca aattccacaa aaacaggtat tacaatagtg ttatatcatt aaaatagaaa tttcttagca ttcagaac atattagact gtgaaatgtc aaagcagtca tgactgtct aaatggcttc gctccagcagg ttcaattt attattatta gagtgctgtg attattct ttgctttt aagacatgt ctaaacttac tactaatgct tttgttgc taatttacct ctactatta tgcatacaagatgggagtgg tctactaagc aaagatattt tagaaaacgg actaatgaaa gtagtacatg atgaaatga tttgaatttg gaatgtaaa cttctgacta tgtggaaaa gttacagcaa caatatgtt gctggttgtc tttacactga tgcatagtcattcattagattagattagataga tgaattaaaa tagacatgaa atgttcata ttacaagtaa agtggtgtta aaggaaggga agctttggct taatatttta tactagaagc ttcctataga agaatccta haaggaaag aaacattcta atgaattgt gtagcacaga cagactcatgt ccctatgtagtaactacataccattactaccagt aaacattgtc aatgtctggt taaaaagaat gaacttttt ttgaggttgg aaaaacacct cagggcctgc atcagcctga ataatcatc accaaagggc acctgaggaa tggaggtacc atttttaat tggaagctt gatttattc gaactgattaa tacatacca tcagatattc actgggcaaa taaggaatt aaagcttata atacacaaa accacacatga agagaattg agaaattata gataggcatg aaaatagtat caagttcaca atacattaca taattcttag attgaaacat gacgtacagt atacattaaa cacgacactc tttgaaatc tagatgagc tgatgattgact aaaaaacatg ttactagga taaactttaa caatatctt aagactgaat cgacctgtat ctctgaagtt atatcctagcttcatagtca atcgccataa caaccagtca tggctttgcc actgctgaac ttgccaatca tacattacta atcatactac caaactattg aaaaagaaaa gaggtttata tattaaagaa aagtaggtt cagtgtgtaa cagatgcttg ataaaactgt atgagcatgt cttattacag agctggggac aaaaatagga aatgacaatg gttcattaaa cacttacgat ttgttatatc aagttatata taaagaacat tggcaacagt ccctttgttc cttttgtgtc tctggttcat atagcacatg atgaatttta tgtaattaaa attcaagtga agatggttat aatacaatga tcttaaaagt ttaatatcaa taaccatcat ggaaattcaa atttaaaacta tttacatatt acccctgaaa 7020 7080 taatacta tacccataa aaatatata aacaaaaat ggcaatgcat gccatcatgg 5 atttgggaga gagaatgttc attgcagccattc ct tggatggaattc atctctgtat aggtccttcc aaaagctgaa atagacata tcacagacc tgccacacat 7200 10 tttcaagca atacccaa ggactctacc tgactgcaga gabacttct cataaaata 7260 tattgttgat ctattcataa tatctggaaa 3caaccagatacttacag aaaattat tgtacatttc agtgtatatat tattcagtttt ttaagaaaaa 7380 15 tgaaattatg taatagcat gtaaatggat atatcttgaa acaaccattc cccattatat 7440 tacctaaca ttgaagcttcc aaaatcatat0 gatctttta20 tatctttac2 gt ctatatgtat tttattgaac tacccatgga tgtgagataa ttggtaacaa cagcacatgg 7560 7620 gagagcatgg gatcattca ggaagattag agagaatgca ttttttagga gatatggag gagcaaraga aaggattaa tgaggctttact gatgactgat 25gaggagg80 taggccttt tgaaaaagac atagagaaaa tactattgta 7740 gaaacttcct atattggtg tatagttata tacaccaaag agctcagatggagttaccct 7800 30 ataatggaaa tattaactac tttttatcac tgtgataaaa catcctgaac agagcaacat 7860 agattgggaa gcatttactt tggcttacag ttctaacggg ataaaaattc atgatgaaag 7920 aatgaatatg tcagcaaaca gcagtagcaa tggcctgaga agcaggtgag agctcacatc 7980 35 ttgaagtgta agaatgtagc agagaagaaca aactgcaaat gaccagaaaa tgcttttgga 8040 tcagagccca tacccctctg actgacttct ccagaaattc tgaacaaata aaactcccca 8100 40 aacagagcca taactgaagg tccagtgtct gagactacta ggggtatttc ttatcaaac 8160 cactacaatg ggggtggcaaggggg agcaatcctctaggca ctacacacag acaaataaaaa 8220 actctagtaa ctggaatgga ttgacttat tgaattactt gccagtggag ctacatagag 8280 45 cacaattatt gtatttaaat taccctttat gatcttacaa aacttgacag taagatcata 8340 ttgctaaaga aaccacatat ttgaatcagg gaacatggtg atatctagtt gttcttcaac 8400 50 tggaaacttc atgctttctg cccagcattc atgttgctgg aaagagcaat gtacactacc 8460 agtgtagaaa ttaaatcatc aatcttatca agatgtggat cctataagtt acaataaaaa 8520 ttagcctgat aagatatccc caccagaaga atattcacat aaatgctatg ggagcaacaa 8580 55 gctatttct aaattagctt taatcctat ctacaagagagatccatat ctagaatagt 8640 tatagggatc aagaacccat ggcttgattg gtcataggcc caatgggaga tcctaatatt 8700 60 attgttctac aaaatgaaaa taactctaa tgacttgttg ctgcagtaat aagttagttt gactcagtac 87cagttaac 87cagttaac atggcaatta aagcagcccc 8820 acaagattta tatcataccg atctcctcat ggcctatgca tctagagct aggaacaa 8880 65 gaggacccta agagagacat acatggtccc cctggagaag gggaaggggg caagacctcc 8940 agggaggagg aaggagtaggtactacc aggggataaa 9000 70 aggagggaga ggaggacaag agagagaagg aagatctagt caaggagaga tagaggag 9060 aagaaaga gataccatag taggaggagc cttgtatgtt taaatagaa actggcacta 9120 gggaattgtc aaccaaggacacacacacaggta 9180 75 ccttaaaagc ctttctctga taatgagatt gatgactacc ttatatacca tcctagagcc 9240 ttcatccagt agctgatgga agcagaagca gatctaca gctaacact gagctagttg 9300 80 cagacaggga gaccagagg cagcagtgag cagaaacagc 9360 agacctgaaa aaatgttgc acatggaccc cagactgata gctgggagtc cagcatagga 9420 cttttctaga ctggtagtgg tggaggaatt tgtgttagac gatgggatga caagtaaatg aaacaggcca tctaataaaataactacat atttctccca atacatactt ctcaattgaa tgtatcattt ctcgatggca cacatacata ctagtcctct aagcaccgactat gttagtagctag aaactcacac tacaccattg tctgtagta ttacacttta attgtctcag tttgatattt ttgtcttta tgagaaaat atattatcat aaggagtttt cttagaatt aattgttc ttagatgtca ccattctc cacagcttgc gagggccattac attactttattag aaccctgaat atcaatattt ctctgtcagc tttgagaac gggttggtga atgcttgttt aagattata aatgtcag attccaagc gattaagc tgcaatacac ttccattca ctttttatt ggatatcat ttgccattg ccccgtccca tgatacattcatgaattccc ccaccacatg tacaacaca atgctactgt ccatcttcca tgtaccta gggttaagat attttgagtc taatcaaag ggaatcgcct tattctcaac aaatagttc accattatg attcaagtg agaaaaatct tattataat aggtagaca aaatacaacaact gagct atcctagtt ctagacacat tcccttgaga gggacaggag ctaatttaaa aagacagag agcacacat caaaaaaacaaagaccta agatctgcct tgttacagtt ttgaccaaa cccaattggg ggaacaag aagaaccttg ttacttgcca cagttacaag gatgacttca ctctaccac gagtgctgag gagaatcaac atataatga gcagcaaag ttattattaa ccaggtccctctttc gttatacact aggttcctta ctaagggcac tcattccagt atagttcat ggcctgaagt cctagttgattttt gatgatgat gttagttccc tattcatg cctgagaact gtttggaggt catgactgga gggggactt agactcaccc aggatataggt ggattaagtg atcattaggtg atgaaagtaa agaaatctca tagataaca cagctctca ggaagggag tctaaatga gtatatgtgc tcctcaaccc tcaggctc tgtcttcata atttaatt acacaata tccaaaat acaaatga caaaaatggc ggacttcaatttcattcagagattca gagtgtttgg agtttagctc ttcattagt ctcctttt tctgtctgga tttaagatt gatcttcat aatgtactt tatcataat tactagagaa ggtccaacct ctggttaatc atttgggtac ctaggtcctg tcctagggatt ac aatagagagggagaga tcagtgatga ttatctcacaat gtttgtagat tctgttattc aatttgaga tgttgttcac ctcattttac aaaatttgca caaagtcccttctaatgtct aatttaaaaa agcctgatga tttcctatta atgaaataaa agcttaagct catggcagaa taatgtggac acctcaggac aatatacatg aggttcaata caataaggga aataaatct agagctcaat acaaggaaaa aatatatatc acttcaacat catgtctggt tgtgaagatt tgtacagttc gataggtgat ttattttaaa taggcaggtg tatggggaca ccattccaca ctccaaata gcagaaaggg ctgggattga gagaaaaga aacactatta agtatgtata aggtgattt aaggtttgaaa acacatgatg aaactcacaa agaataattc aaacctagac atcttctcta agagagag tcattgctca ctgtcatgtt tatatagatt tccattaatt tctgaattt cttccacact aaattaagtc tgctttatgg ctatgctgtt acctaaacta agagggaatc aaacaagtga ttaagcttca ttttagaag aagcaatcca ttacatataa tacaaaatat acctaaatca gaaaaatatg gtctgactca tttaatgatt atagacgctg aagtgtatgt catgaaaaga aatgccagga gcaacgtttt ttccttttt tcttctacag aggatgcttt gctgccaagc aacctggttg ttgctccaca tgtggaatg tatttcagg 11940 { 12000} aatcaagttt aaagggtctt catcatgctg 5 ttagatgactttg taccaccag gtgtg ttcatagtat tctttcaata 12060 actaacaact aaacttttcg ataaaaaga attggaattt caatttaaa gcctgagtaa 12120 Ί Π aattcttgtg atcaggata ttcattattt agtcttatct tttaaaagt tattttattt 121180 ! 1U tttaaaaaat tataatatac tttcaatatt tcctccttc acttttctt acaacactt 12240 { ctatagatca ccatgtgttt ttttttac atttatggcc tctttctgtt cattgttatt 12300 15 acatacaaat agatcatcattacttaccct 12360 1 caaccttaa aacctacaa ctattgaat tactgaaag actatactta tagatgtaaa 12420 20 gatatgtg tgtgcacata tatagataca ggattttaa ttttagatt 12480 1 tagacatcaa aattattac attatgagcacga 12540 tcacaccgt gattttagat attgtcacaa tgacagaaaa ttttcttata gaaaatttta 12600 ¡ 25 agttttgtga ttgctctg cacttagtga agtctcacag aaaaagaatc atagtaattt 1 i taaaattttatataattaa aatggttggc acaaaacaac atttgagcat 12720 ¡ 30 ttttcctatt tactatcaag tagtatcatt ttgaaataat aatttgacta gtttcaaaaa 12780 1 tgaaaacaaa attaaacta aatgcctaat ctagcctgat aacatgat tttagaat40 tttacaatgaat 12720 tgttatcaat taggggccca aaacttttcc taaaataaaa cttttaattt 12900 35 ttttccatttt ttatttaaat tagaaacaaa attgttttac atgtaaatca gagtttcctc 12960 accctcccct tctccctgtc cctcactaac accctacct tctcactg 10301010 ccagggaggg tgaggccttc catggggaaa cttcagagtc tgtctatcct ttcggatagg 13080 1 gcctaggccc tcacccattt gtctaggcta aggctcacaa agtttactcc tatgctagtg 13140 I í ataagtactg atctactca agagattcttact accactcac 13200 fc 45 atgttcatgg ggtctggaac aatcatatgc tagtttccta ggtatcagtc tggggaccat 13260 Ϊ i gagctccccc ttgttcaggt caactgtttc tgtgggttc accaccctgg tcttgactgc 13320 fccct 5cctctctc tctctactc gggttccagt acaattccgt gtttagctgt 13380 1 gggtgtctac ttctactttc atcagcttct gggatggagc ctctaggata gcatacaatt 13440 £ agtcatcatc tcattatcag ggaagggcat ttaaagtagcctctccattg ttgcttggat 13500 55 tgttagttgg tgtcatcttt gtagatctct ggacatttcc ctagtgccag atactcttt 13560 í aaacctacaa gactacctct attatggtat ctcttttctt gctctcgtct attcttccag 13520 acactctct cctcct tatattttcc tctcccctcc tcttctcccc ttctcattct 13680 Ϊ- cctagatcca tcttcccttc ccccatgctc ccaagagaga tgttgctcag gagatcttgt 13740 tccttaaccc ttttcttggg gatctgtctc tcttagggtt gccctgtct 13650 'ctctgtct ctggaagtgt ggattgtaag ctggtaatca tttgctccat gtctaaaatc catatatgag 13860 tgatgtttgt ctttttgtga ctgggttacc tcactcaaaa tggtttcttc catatgtctg 13920 70 tggatttcaa tagcacaac actcactactactactac aaacaagtga 13980 aagaccagta tagcaagaac tttgagttta aagaaagaaa ttaaagaaga taccagaaaa 14040 í tggaaagatc tcccatgctc tttgataggc agaatcaaca tagtaaaaat ggcaatcttg 14100 75 ccaaaatgaatcaatcaatcaatc accagcacac ttcttcacag 14160 acctgaaaga ataatactta actttatatg gagaaacaaa agacccagga taggccaaac 14220 80 aaccctgtac aatgaaggca cttccagagg catccccatc cctgacttca agctctatta 14280tagagtaata atcctgaaaa cagcttggta atggcacaaa aatagacagg tagaccaatg 14340

Claims

1. An isolated, recombinant CHO cell incapable of regenerating into a complete organism, comprising an exogenous nucleic acid sequence integrated within a locus of the cell's genome, characterized in that the locus comprises a nucleotide sequence that is (a) SEQ ID NO: 1 or SEQ ID NO: 4, and (b) capable of increasing the expression of a protein encoded by an exogenous nucleic acid sequence by 1.5 times or more compared to the expression typically observed by random integration within the genome. Sixteen claims follow.