ISOLATED EXPRESSION CASSETTE, ISOLATED VECTOR MOLECULE COMPRISING IT, METHOD FOR PRODUCING A TRANSGENIC PLANT, METHOD FOR CONTROLLING TARGET INSECT PESTS THAT FEED ON VEGETATIVE PLANT TISSUE, AND METHOD FOR PROTECTING THE REPRODUCTIVE TISSUES OF A PLANT

Abstract

This document refers to regulatory sequences. In particular, it refers to a nucleotide regulatory sequence, where at least part of this sequence has a transcription initiation function that directs the expression of a polynucleotide encoding a protein operatively associated with tissue other than, but not pollen or substantially not pollen. It also refers to chimeric genes and expression cassettes comprising this regulatory sequence and to transgenic plants comprising such chimeric genes and expression cassettes.

Description

“ISOLATED EXPRESSION CASSETTE, ISOLATED VECTOR MOLECULE WHICH COMPRISES METHOD FOR PRODUCING A TRANSGENIC PLANT, METHOD FOR CONTROLLING TARGET INSECT PESTS THAT FEED ON VEGETATIVE PLANT TISSUE, AND METHOD FOR PROTECTING THE REPRODUCTIVE TISSUES OF A PLANT.” REQUESTED BY: SYNGENTA PARTICIPATIONS AG ADDRESSED AT: Rosentalstrasse 67 - 4058 - Basel Switzerland PRIORITIES: 1. Country: US N°12 / 172535 Date: 07 / 14 / 2008 Divisional Record No. P180102832 FOR A TERM OF 20 YEARS _________________________________ 2588723 of 2 Santiago Ferrer Reyes - 20142227887 Digitally signed by PORTALTRAMITES - INPI Date: 2024.01.12 13:25:46 -03:00 Reason: Digitally Signed by INPI Location: Buenos Aires, Argentina 2588723 of 2 ISOLATED EXPRESSION CASSETTE, ISOLATED VECTOR MOLECULE WHICH COMPRISES IT, METHOD FOR PRODUCING A TRANSGENIC PLANT, METHOD FOR CONTROLLING TARGET INSECT PESTS THAT FEED ON VEGETATIVE PLANT TISSUE, AND METHOD FOR PROTECTING THE REPRODUCTIVE TISSUES OF A PLANT The present invention relates to the field of plant biotechnology and regulatory sequences. In particular, the invention relates to a regulatory polynucleotide sequence, where at least part of it has a transcription-initiating function that directs the expression of an operatively associated protein-encoding polynucleotide of interest to basically all plant tissues. , but which essentially excludes the expression in the tissues of the reproductive structures of the plant, in particular in the pollen and / or spike tissues so that there is no expression product in said tissues in a significant way. The invention further relates to chimeric genes and expression cassettes of plants that comprise said regulatory sequence in association with a polynucleotide encoding the expressible protein of interest and to transgenic plants that comprise said chimeric genes and expression cassettes, respectively, that express the polynucleotide encoding the protein of interest in basically all plant tissues, but they essentially exclude expression in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissues so that there is no product of expression present in said tissues in a significant way. BACKGROUND OF THE INVENTION In many agricultural crops, such as corn, devastating pests tend to feed on vegetative tissues, such as the leaf, stem and root, and reproductive tissues, such as the cob. One technique used to protect plants against pests is the application of chemical compounds. An alternative technique involves genetic recombination, where one or more genes are introduced into the plant to express protein products that participate in 2588723 106 directly or indirectly in the control of pest organisms. Current protein products, produced through genetic recombination, are expressed constitutively, that is, in the entire plant at all times and in most tissues and organs. These protein products are also specifically expressed, either in response to particular stimuli or limited to specific cells or tissues. Instead, the present invention includes expression of the protein or polynucleotide of interest in basically all plant tissues, but essentially excludes expression in the tissues of reproductive structures in the plant, particularly in pollen and / or pollen tissues. or the spike in such a way that there is no expression product present in said tissues in a significant way. Several insect control trait genes are targeted at the larval level of development. In some circumstances, these proteins also affect insects that were not intended to be affected, which are not pests of corn but which sometimes feed on corn pollen. These insects may be affected by insectidal proteins expressed in pollen tissue. This has been a problem in early BT maize events, which had high expression of the insecticidal protein in pollen. This tissue was addressed in subsequent BT maize events through the development of alternative transgene expression systems. These more recent events remained effective against target pests and accumulated less insecticidal protein in the pollen, but are still considered potentially dangerous to non-target pests because of the presence of insecticidal protein in the pollen. In some cases, genes for useful control traits can also affect the development of the plant's reproductive structures such as the spike. Thus, it is desirable to provide plants, particularly corn plants, that exclude expression of the transgene in the tissues of the reproductive structures of the plant, such as the pollen and / or spike tissues. This could be achieved within the scope of the invention by providing a sequence 2588723 of 106 nucleotide regulator, where at least part of it has a transcription initiating function that directs the expression of an operatively associated protein that encodes a polynucleotide of interest for basically all tissues of the plant, but that essentially excludes expression in the tissues of the reproductive structures of the plant, in particular in the pollen and / or spike tissues in such a way that there is no expression product in said tissues in a significant way. This nucleotide regulatory sequence can then be used to develop expression systems that allow the effective accumulation of the polypeptide or protein of interest, such as, for example, an insecticidal protein, in tissues on which the target pests normally feed, and eliminate or reduce the accumulation of the insecticidal protein in non-target tissues or organs and / or in tissues that may be affected by the polypeptide or protein of interest. SUMMARY OF THE INVENTION In one embodiment, the invention relates to a transgenic plant comprising, stably integrated into its genome, a chimeric polynucleotide construct, particularly a chimeric construct, comprising a polynucleotide of interest, in particular a polynucleotide encoding a polypeptide or protein of interest, associated with and / or under the control of a nucleotide regulatory sequence, where at least part of this has a transcription initiation function that directs the expression of said protein-encoding polynucleotide of interest to basically all tissues of said plant, particularly the tissues on which insects usually feed, but essentially excluding the pollen and / or spike tissues so that there is no expression product in said tissues in a significant way. In one embodiment, the polynucleotide of interest, particularly a polynucleotide encoding a polypeptide or protein of interest, is not significantly transcribed in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissue of the plant. transgenic plant according to the invention. Therefore, expression of the polynucleotide of interest, particularly a polynucleotide encoding 2588723 of 106 polypeptide or protein of interest, in the tissues of the reproductive structures of the male plant, particularly in the pollen and / or spike tissues, and only residual amounts of the expression product, if any, can be detected in said tissues , which is not sufficient for the expression product to fulfill its intended biological function in said tissues, particularly in pollen and / or spike tissues, and therefore does not exhibit any toxic effect in insects that feed on those tissues or reproductive structures of the plant. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein a chimeric polynucleotide construct, particularly a chimeric DNA construct, comprises a polynucleotide of interest, particularly a polynucleotide encoding protein or polypeptide of interest, operatively associated and / or under operative control of a nucleotide regulatory sequence, where at least part of this has a transcription initiation function and can be obtained from a gene that encodes an actin depolymerizing factor 3 (ABP3), said polypeptide being expressed or protein in most plant tissues, but essentially excluding pollen tissues such that no expression product is significantly present in said tissues. In one embodiment, said actin depolymerizing factor 3 (ABP3) gene can be obtained from corn. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein a chimeric polynucleotide construct, in particular a chimeric DNA construct, comprises a polynucleotide of interest, in particular a polypeptide or protein encoding polynucleotide. interest, operatively associated and / or under the operative control of a nucleotide regulatory sequence, which has at least in part a transcription-initiating function and can be obtained from a gene represented by a DNA probe, particularly a DNA probe that exhibits a DNA sequence as described in SEQ ID NOs: 47 to 56, said DNA probe exhibiting a signal pattern in tissue samples, indicating the expression of said gene 2588723 out of 106 in all tissues and non-expression or substantially non-expression in pollen. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein comprising a nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence described in herein, where at least part of it has a transcription initiation function and mediates the expression of a polynucleotide that encodes an operationally associated protein of interest in most plant tissues, but essentially excluding pollen tissues of such that there is no expression product present in said tissues in significant quantities, said regulatory sequence being able to be obtained in a PCR reaction of a genomic Zea mays DNA template using i) a first primer that has a sequence identity of at least the 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 1, particularly a first primer of SEQ ID NO: 1; or ii) a second primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 2, particularly a second primer of SEQ ID NO: 2; or iii) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 1 and a second primer as a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in the 2588723 of 106 SEQ ID NO: 2, particularly the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2. In one embodiment, the invention relates to a transgenic plant as described herein, wherein the polynucleotide sequence that provides the transcription initiation function has a sequence identity of at least 80% to 85% with a nucleotide sequence represented in SEQ ID NO: 13, also comprising all integers included in this range, particularly a sequence identity comprised at least between 85% and 90% with a nucleotide sequence represented in SEQ ID NO: 13, also comprising all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98% or 99% with a nucleotide sequence represented in SEQ ID NO: 13, or a fragment thereof, and where said nucleotide regulatory sequence or fragment thereof mediates the transcription of a molecule of operatively associated polynucleotide, particularly an operatively associated protein-encoding polynucleotide of interest such that said polynucleotide of interest is transcribed in most plant tissues, but essentially excluding pollen tissues so that there is no product of expression present in said tissues in a significant way. In one embodiment, the invention relates to a transgenic plant as described herein, where the complementary strand of the polynucleotide sequence that provides the transcription initiation function is capable of hybridizing with a nucleotide sequence that is represented in SEQ ID NO: 13, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions, and wherein said nucleotide regulatory sequence mediates the transcription of an operatively associated polynucleotide molecule, particularly of an operatively associated protein-coding polynucleotide of interest in such a way that said polynucleotide of interest is transcribed in the majority of tissues of the 2588723 from 106 plants, but essentially excluding pollen tissues so that no expression product is significantly present in said tissues. In one embodiment, the invention relates to a transgenic plant as described herein, where the polynucleotide sequence that provides the transcription initiation function is the sequence represented in SEQ ID NO: 13 or a fragment of this, which still exhibits full functionality as a transcription initiation sequence. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprises a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a chimeric polynucleotide construct comprising said regulatory sequence having at least partially a transcription termination function obtainable from a gene encoding an actin depolymerizing factor 3 (ABP3), wherein the regulatory sequence mediates the transcription of an operatively associated polynucleotide molecule, particularly of a polynucleotide molecule encoding an operatively associated protein of interest such that said polynucleotide of interest is transcribed in most plant tissues with the exception of pollen tissues but essentially including pollen tissues such that there is no expression product present in said tissues in a significant way, particularly of a gene for the actin depolymehzador factor 3 (ABP3) of maize, where i) said nucleotide regulatory sequence comprises a transcription termination sequence that has a sequence identity of at least between 80% and 85%, also including all integers included in this range, particularly a sequence identity. sequence comprised at least between 85% and 90%, this also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in 2588723 of 106 SEQ ID NO: 14; or a fragment thereof, which still exhibits the functionality of a completion sequence; or ii) the complementary strand of said nucleotide regulatory sequence hybridizes a nucleotide sequence represented in SEQ ID NO: 14, particularly under moderate hybridization conditions, more particularly under moderate-stringent hybridization conditions, particularly under hybridization conditions rigorous, and mediates the termination of transcription of a polynucleotide encoding the operatively associated protein of interest; or iii) said nucleotide regulatory sequence has the sequence represented in SEQ ID NO: 14, including its complements. In one embodiment, the invention relates to a transgenic plant according to the invention as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising said regulatory sequence, where at least part of it has a transcription initiation function and a transcription termination function, respectively, said nucleotide regulatory sequence being obtained from a gene encoding an actin depolymerization factor 3 (ABP3), which is expressed in most plant tissues but essentially excluding pollen tissues so that no expression product is present in said tissue to a significant extent, particularly the actin depolymerizing factor gene. 3 (ABP3) from maize, and wherein said nucleotide regulatory sequence comprises a transcription initiation sequence and a transcription termination sequence, respectively, having a sequence identity of at least 80% to 85%. , this also being comprised of all the integers included in this range, particularly a sequence identity comprised at least between 85% and 90%, also being included in this all the integers included in this range, particularly a sequence identity of at least 90%, 2588723 of 106 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 13 and SEQ ID NO: 14, respectively , or a fragment of it that still exhibits full functionality as a transcription initiation or termination sequence, respectively. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising said regulatory sequence, where at least part of it has a transcription initiation function and a transcription termination function, respectively, said nucleotide regulatory sequence being obtained from a gene encoding a transcription depolymerization factor. actin 3 (ABP3), which is expressed in most plant tissues but essentially excluding pollen tissues so that no expression product is present in said tissue to a significant extent, particularly the actin depolymerizing factor gene. actin 3 (ABP3) from maize, and where said nucleotide regulatory sequence comprises a transcription initiation sequence as represented in SEQ ID NO: 13 and a transcription termination sequence as represented in SEQ ID NO: 14. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising said regulatory sequence where at least part of it has a transcription initiation function and a transcription termination function, respectively, this nucleotide regulatory sequence being able to be obtained from a gene represented by a DNA probe, particularly a DNA probe exhibiting a DNA sequence as depicted in SEQ ID NOs: 47 to 56, the DNA probe exhibiting a signal pattern in tissue samples that is 2588723 of 106 indicative of expression of said gene in all tissues and no or substantial expression in pollen. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein a chimeric polynucleotide construct, particularly the chimeric DNA construct, comprises a polynucleotide of interest, particularly a polynucleotide encoding protein or polypeptide of interest, operatively associated and / or under operational control of a nucleotide regulatory sequence, where at least part of this has a transcription initiation function and can be obtained from plant genomic DNA, particularly from maize genomic DNA, said polypeptide or protein being expressed in most plant tissues, but essentially excluding the spike tissues such that no expression product is present in said tissues to a significant extent. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein the chimeric polynucleotide construct, particularly the chimeric DNA construct, comprises a polynucleotide of interest, particularly a polynucleotide encoding a polypeptide or protein of interest. , operatively associated with and / or under the operative control of a nucleotide regulatory sequence, where at least part of this has a transcription initiation function and can be obtained from a gene represented by a DNA probe, particularly a DNA probe exhibiting a DNA sequence as depicted in SEQ ID NOs: 57 to 79, the DNA probe showing a signal pattern in tissue samples that is indicative of expression of said gene in all tissues and no or no expression substantial in the tissues of the spike. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a construct chimeric polynucleotide, comprising said regulatory sequence as described herein, this being able to be obtained 2588723 of 106 regulatory sequence by PCR reaction of a genomic Zea mays DNA template using i) a first primer that has a sequence identity of at least the 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 19, particularly the primer of SEQ ID NO: 19; or ii) a second primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the reverse primer of SEQ ID NO: 20; or iii) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 19 and a second primer as a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the forward primer of SEQ ID NO: 19 and the reverse primer of SEQ ID NO: 20. In one embodiment, the invention relates to a transgenic plant as described herein, wherein the nucleotide sequence that provides the transcription initiation function has a sequence identity of at least 80% to 85% with a nucleotide sequence described in SEQ ID NO: 35, also comprising all integers included in this range, particularly a sequence identity comprised at least between 85% and 90% with a nucleotide sequence that is represented in SEQ ID NO: 35, all integers included in this interval being also included herein, particularly an identity of 11 2588723 of 106 sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence that is represented in SEQ ID NO: 35, or a fragment thereof, and wherein said polynucleotide regulatory sequence or fragment thereof mediates the transcription of an operatively associated polynucleotide molecule, particularly of a polynucleotide encoding an operatively associated protein of interest such that said polynucleotide of interest is transcribed in most plant tissues, but essentially excluding the spike tissues so that no expression product is significantly present in said tissues. In one embodiment, the invention relates to a transgenic plant as described herein, where the complementary strand of the polynucleotide sequence that provides the transcription initiation function is capable of hybridizing with a nucleotide sequence that is represented in SEQ ID NO: 35, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions and wherein said nucleotide regulatory sequence mediates transcription of an operatively associated polynucleotide molecule, particularly of an operatively associated protein-coding polynucleotide of interest such that said polynucleotide of interest is transcribed in the majority of plant tissues, but essentially excluding the spike tissues so that there is no expression product present in said tissues in a significant way. In one embodiment, the invention relates to a transgenic plant as described herein, where the nucleotide sequence that provides the transcription initiation function is the sequence represented in SEQ ID NO: 35 or a fragment of this, which still exhibits full functionality as a transcription initiation sequence. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct that 2588723 of 106 comprises said regulatory sequence where at least part of it has a transcription termination function that can be obtained from plant genomic DNA, particularly a maize genomic DNA and mediates the transcription of an operatively associated polynucleotide molecule, particularly from a polynucleotide encoding an operatively associated protein of interest such that said polynucleotide of interest is transcribed in most plant tissues but essentially excluding the head tissues so that no expression product is present in said tissues in no significant measure, where i) said nucleotide regulatory sequence comprises a transcription termination sequence that has a sequence identity of at least between 80% and 85%, also including all integers included in this range, particularly a sequence identity. sequence comprised at least between 85% and 90%, this also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 36; or a fragment of it, which still exhibits full functionality as a transcription initiation sequence; or ii) the complementary strand of said nucleotide regulatory sequence is hybridized to produce a nucleotide sequence represented in SEQ ID NO: 36, particularly under moderate hybridization conditions, more particularly under moderate-stringent hybridization conditions, particularly under stringent hybridization conditions, and mediates termination of transcription of an operatively associated protein-coding polynucleotide of interest; or iii) said regulatory sequence has a sequence represented in SEQ ID NO: 36 or a fragment thereof, which still exhibits full 2588723 of 106 functionality as a transcription initiation sequence, including its complements. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, where at least part of this regulatory sequence has a transcription initiation function and a transcription termination function, respectively, said nucleotide regulatory sequence being obtained from a genomic plant DNA, particularly from a genomic maize DNA , and is expressed in most plant tissues but essentially the spike tissues being excluded so that there is no expression product present in said tissue to a significant extent, where said nucleotide regulatory sequence comprises an initiation sequence of the transcription and a transcription termination sequence, respectively, the sequences having a sequence identity of at least between 80% and 85%, also including all integers included in this range, particularly a sequence identity comprised at least between 85% and 90%, also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 35 and SEQ ID NO: 36, respectively, or a fragment thereof that still exhibits full functionality as a sequence transcription initiation and termination sequence, respectively. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, which 2588723 of 106 comprises said regulatory sequence, where at least part of it has a transcription initiation function and a transcription termination function, respectively, said nucleotide regulatory sequence being obtained from a genomic plant DNA, particularly a genomic maize DNA, and is expressed in most plant tissues but the spike tissues are essentially excluded so that no expression product is present in said tissues to a significant extent, said nucleotide regulatory sequence comprising a transcription initiation sequence. as represented in SEQ ID NO: 35 and a transcription termination sequence as represented in SEQ ID NO: 36 respectively, including a fragment thereof, which still exhibits full functionality as a start sequence and a termination sequence. the transcription, respectively. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide of interest encodes a polypeptide product that exhibits insecticidal activity, particularly an endotoxin from Bacillus thuringiensis. In one embodiment, the concentration of the expressed polypeptide product of the protein-encoding polynucleotide of interest in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissues, is such that no insecticidal activity can be detected in an assay. standard insect feeding. In particular, the concentration of the expression product in the spike is less than a basic level of not more than 10 ng / mg soluble protein, particularly not more than 5 ng / mg soluble protein, more particularly not more than 3 ng / mg of soluble protein, but especially not greater than 2 ng / mg soluble protein or less. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide of interest encodes a Bacillus thuringiensis endotoxin having a sequence identity of at least 80 % and 85%, also including all integers included in this interval, particularly a sequence identity included 2588723 of 106 less between 85% and 90%, this also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO:15. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide of interest encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence as represented in SEQ ID NO: 15. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide of interest encodes a polypeptide product that contributes to the amplification of enhanced drought tolerance. , particularly a deregulated form of an H+-pyrophosphatase, wherein said polypeptide or protein is under the control of a regulatory sequence according to the invention where at least part of this has a transcription initiation function that mediates the expression of a polynucleotide encoding operationally associated protein of interest in most plant tissues but essentially without expression in pollen tissues and / or spike tissues so that no expression product is present in said tissues to a significant extent. In one embodiment, the transgenic plant according to the invention and as described herein is a Zea mays plant. In one embodiment, the invention relates to a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of This has a transcription initiation function that mediates the expression of an operatively associated protein that encodes a polynucleotide of interest in most plant tissues, but essentially excluding expression in the tissues of reproductive structures 16 2588723 of 106 males, particularly from the pollen and / or spike tissues so that there is no expression product present in said tissues in a significant way. In one embodiment of the invention, the nucleotide regulatory sequence can be obtained from a gene represented by a DNA probe, particularly a DNA probe exhibiting a DNA sequence as represented in SEQ ID NOs: 47 to 56, showing the DNA probe a signal pattern in tissue samples that is indicative of expression of said gene in all tissues and no or substantial expression in pollen. In one embodiment of the invention, the nucleotide regulatory sequence can be obtained from a gene encoding an actin depolymerizing factor 3, which is expressed in most plant tissues but essentially excluding pollen tissues so that no expression product is present in said tissues to a significant extent, particularly a gene for actin depolymerizing factor 3 from maize. In one embodiment of the invention, the nucleotide regulatory sequence can be obtained from a gene represented by a DNA probe, particularly a DNA probe exhibiting a DNA sequence as represented in SEQ ID NOs: 57 to 79, showing the DNA probe a signal pattern in tissue samples that is indicative of expression of said gene in all tissues and no or substantial expression in the spike tissues. In one embodiment, the invention provides a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence as described herein, wherein obtain said sequence from a genomic Zea mays DNA template using i) a first primer that has a sequence identity of at least the 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a sequence of 2588723 of 106 nucleotides as represented in SEQ ID NO: 1, particularly a first primer of SEQ ID NO: 1; or ii) a second primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 2, particularly a second primer of SEQ ID NO: 2; or iii) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 1 and a second primer as a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 2, particularly the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2. In one embodiment, the nucleotide regulatory sequence according to the invention and as described herein is modified using one or more of the oligonucleotides selected from the group of oligonucleotides represented in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8. In one embodiment, the invention relates to a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence as described herein. , said nucleotide regulatory sequence providing a transcription initiation function, wherein the nucleotide sequence that provides said function has a sequence identity of at least between 80% and 85%, all integers also being included herein. included in this range, particularly an identity 2588723 of 106 of sequence comprised at least between 85% and 90%, also including all integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 13 and where said nucleotide regulatory sequence mediates the transcription of a polynucleotide encoding a operationally associated protein of interest in most plant tissues but essentially excluding pollen tissues so that no expression product is present to any significant extent. In one embodiment, the invention relates to a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence as described herein. , said nucleotide regulatory sequence providing a transcription initiation function, wherein the complementary strand of the nucleotide sequence providing said function anneals to provide a nucleotide sequence as depicted in SEQ ID NO: 13, particularly under conditions of moderate hybridization, more particularly under stringent hybridization conditions and where said nucleotide regulatory sequence mediates the transcription of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding pollen tissues so that there is no product of expression present to a significant extent. In particular, such hybridization occurs under stringent hybridization conditions. In one embodiment of the invention, the polynucleotide sequence that provides the transcription initiation function is the sequence represented in SEQ ID NO: 13 or a fragment thereof, which still exhibits full functionality as a transcription initiation sequence. transcription, including its complements. In one embodiment, a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or 19 is provided. 2588723 of 106 a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence in accordance with the invention and as described herein, comprising approximately 1 kb of the nucleotide sequence upstream from the start site of the ZmABP3 transcription of a ZmABP3 gene, particularly upstream from the ZmABP3 transcription start site of the ZmABP3 gene as depicted in SEQ ID NO: 17. In one embodiment of the invention, said nucleotide regulatory sequence comprises in addition to the 5' untranslated ZmABP3 sequence, the first ZmABP3 exon, the first ZmABP3 intron and a portion of the second ZmABP3 exon, particularly a portion of the second ZmABP3 exon ending in the translation start codon, particularly a portion of the second ZmABP3 exon between about 10 and 20 nucleotides, particularly between about 12 and 16 nucleotides, particularly and about 14 nucleotides, of the second exon. In one embodiment, there is provided a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of it has a transcription termination function, this sequence being able to be obtained in a PCR reaction for amplification of a gDNA template, particularly a gDNA template, using a forward primer (P3 (5'tatatagagctcgcatcatgatcatgcatcatggact-3') that has a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 9 and a reverse primer (P4 (5'atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-3') having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 10. In particular, said nucleotide regulatory sequence comprises a transcription terminator and 2588723 of 106 a polyadenylation signal. In particular, a forward primer (P3 (5'tatatagagctcgcatcatgatcatgcatcatggact-3')) having a nucleotide sequence as represented in SEQ ID NO: 9 and a reverse primer (P4 (5'atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-3') are used. has a nucleotide sequence as represented in SEQ ID NO: 10. In one embodiment of the invention, there is provided a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a chimeric polynucleotide construct, comprising said regulatory sequence of a polynucleotide construct, particularly a chimeric polynucleotide construct. , comprising a transcription termination sequence obtainable from a gene encoding an actin depolymerizing factor 3 (ABP3), wherein the regulatory sequence mediates transcription of an operatively associated polynucleotide molecule, particularly of a molecule of polynucleotide encoding an operatively associated protein of interest such that said polynucleotide of interest is transcribed in most plant tissues but not, wholly or substantially, in pollen tissues such that there is no product of expression present in said tissues to a significant extent, particularly of a gene for the actin depolymerizing factor 3 (ABP3) from maize, where i) said nucleotide regulatory sequence comprises a transcription termination sequence that has a sequence identity between at least 80% and 85%, also comprising all integers included in this range, particularly at least between 85% and 90%, also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 14; or ii) the complementary strand of said nucleotide regulatory sequence is hybridized to produce a nucleotide sequence that is 2588723 of 106 represents in SEQ ID NO: 14, particularly under moderate hybridization conditions, more particularly under moderate-stringent hybridization conditions, particularly under stringent hybridization conditions, and mediates the termination of transcription of a protein-encoding polynucleotide operationally associated of interest; or iii) said nucleotide regulatory sequence has a sequence represented in SEQ ID NO: 14 or a fragment thereof, which still exhibits full functionality as a termination sequence, including its complements. In one embodiment, there is provided a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of it has a transcription initiation function and a transcription termination function, respectively, said regulatory nucleotide sequence being obtained from a gene encoding an actin depolymerization factor 3 (ABP3), which is expressed in most plant tissues. but not, in whole or substantially, in the pollen tissues such that there is no expression product present in said tissues to a significant extent, particularly of a maize actin depolymerizing factor 3 (ABP3) gene and where said The nucleotide regulatory sequence comprises a transcription initiation sequence as depicted in SEQ ID NO: 13 and a transcription termination sequence as depicted in SEQ ID NO: 14. In one embodiment of the invention, the nucleotide regulatory sequence can be obtained from maize genomic DNA, particularly from a putative gene in the maize genome, which has high expression in most plant tissues but not from totally or substantially, in the tissues of the spike so that there is no expression product present in said tissues to a significant extent. 2588723 of 106 In one embodiment, a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence is provided in accordance with the invention and as described herein, comprising approximately 2.6 kb of the 5' sequence, including approximately 2 kb of 5' untranscribed sequence, a 5' untranslated region and exon 1 and part of exon 2 and intron 1, in particular approximately 0.6 kb representing exon 1, intron 1 and about 16 bp of exon 2. In one embodiment, the invention provides a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of it has a transcription initiation function as described herein, said sequence being obtainable from a genomic Zea mays DNA template using i) a first primer that has a sequence identity of at least the 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 19, particularly the primer of SEQ ID NO: 19; or iii) a second primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the reverse primer of SEQ ID NO: 20; or iv) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 19 and a second primer as a reverse primer having a 2588723 of 106 sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 0.97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the forward primer of SEQ ID NO: 19 and the reverse primer of SEQ ID NO: 20. In one embodiment, the nucleotide regulatory sequence according to the invention and as described herein is modified using one or more of the oligonucleotides selected from the group of oligonucleotides represented in SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26. In one embodiment, the invention relates to a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence as described herein. , said nucleotide regulatory sequence providing a transcription initiation function, wherein the nucleotide sequence that provides said function has a sequence identity of at least between 80% and 85%, all integers also being included herein. included in this range, particularly a sequence identity of at least between 85% and 90%, also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 35 and where said nucleotide regulatory sequence mediates the transcription of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding the head tissues so that no expression product is present to any significant extent. In one embodiment, the invention relates to a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a construct 2588723 of 106 chimeric polynucleotides, comprising said regulatory sequence as described herein, said nucleotide regulatory sequence providing a transcription initiation function, wherein the complementary strand of the nucleotide sequence providing said function hybridizes to provide a nucleotide sequence as represented in SEQ ID NO: 35, particularly under moderate hybridization conditions, more particularly under moderately stringent hybridization conditions and wherein said nucleotide regulatory sequence mediates the transcription of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding pollen tissues so that no expression product is present in said tissues to a significant extent. In particular, such hybridization occurs under stringent hybridization conditions. In one embodiment of the invention, the polynucleotide sequence that provides the transcription initiation function is the sequence represented in SEQ ID NO: 35 or a fragment thereof, which still exhibits full functionality as a transcription initiation sequence. transcription and its complements. In one embodiment, there is provided a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of it has a transcription termination function, this sequence being able to be obtained in a PCR reaction for amplification of a gDNA template, particularly a maize gDNA template, using a direct primer that has a sequence identity of at least 90%, particularly at less 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 29 and a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as 2588723 of 106 represents in SEQ ID NO: 30. In particular, said nucleotide regulatory sequence comprises a transcription terminator and a polyadenylation signal. In particular, a forward primer having a nucleotide sequence as depicted in SEQ ID NO: 29 and a reverse primer having a nucleotide sequence as depicted in SEQ ID NO: 30 are used. In one embodiment, a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence is provided where i) said nucleotide regulatory sequence comprises a transcription termination sequence that has a sequence identity of at least between 80% and 85%, also including all integers included in this range, particularly a sequence identity. sequence comprised at least between 85% and 90%, also including all integers included in this range, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 36; or ii) the complementary strand of said nucleotide regulatory sequence hybridizes to produce a nucleotide sequence represented in SEQ ID NO: 36, particularly under moderate hybridization conditions, more particularly under moderate-stringent hybridization conditions, particularly under stringent hybridization conditions and mediates the termination of transcription of an operatively associated protein-coding polynucleotide of interest; or iii) said regulatory sequence has a sequence represented in SEQ ID NO: 36 or a fragment thereof, which still exhibits full 2588723 of 106 functionality as a completion sequence, including its plugins. In one embodiment of the invention, there is provided a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of This has a transcription initiation function and a transcription termination function, respectively, said regulatory nucleotide sequence being obtained from a maize genomic DNA, which is expressed in most plant tissues but not in a total or substantial manner, in the spike tissues such that no expression product is significantly present in said tissues, and wherein said nucleotide regulatory sequence comprises a transcription initiation sequence and a transcription termination sequence, respectively, which have a sequence identity comprised at least between 80% and 85%, also being included in this all integers included in this range, particularly a sequence identity comprised at least between 85% and 90%, also being included in is all integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 35 and SEQ ID NO:36, respectively. In one embodiment, there is provided a nucleotide regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence, where at least part of it has a transcription initiation function and a transcription termination function, respectively, said regulatory nucleotide sequence being obtained from a maize genomic DNA, which is expressed in most plant tissues but not, totally or substantially, in the tissues of the spike in such a way that there is no expression product present in said 2588723 from 106 tissues to a significant extent and where said nucleotide regulatory sequence comprises a transcription initiation sequence as represented in SEQ ID NO: 35 and a transcription termination sequence as represented in SEQ ID NO: 36. It will be evident to those skilled in the art that, based on the nucleotide sequences contained in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 35 and SEQ ID NO: 36, fragments of various lengths can be obtained. such sequences, for example to use any primer combination of interest to generate fragments that still exhibit the specific regulatory function according to the invention that drives the expression of an operatively associated polynucleotide of interest in most plant tissues except those pollen and spike tissues, respectively. Thus, the invention includes fragments derived from a full-length transcription promoter and a full-length terminator of the invention and as described herein, respectively, that function in accordance with the invention, that is, are capable of confer expression and termination of an operatively associated nucleotide sequence in most plant tissues but essentially excluding pollen tissues so that no expression product is present in said tissues to a significant extent and / or the spike. Once obtained, the function of the promoter and terminator fragments can be easily tested by fusing them with a selectable or analyzable marker gene and testing the fusion constructs for promoter-specific activity. These tests are known to those skilled in the art. In one embodiment, the invention relates to nucleotide fragments, particularly nucleotide fragments obtainable from the regulatory sequences of an actin depolymerizing factor 3 (ABP3) gene, at least the nucleotide fragments having at least about 50 bases, preferably between 400 bases and about 650 bases, more preferably between about 200 bases and about 400 bases and more preferably about 350 2588723 of 106 bases in length and still exhibit the specific regulatory function according to the invention that is driving the expression of an operatively associated polynucleotide of interest in most plant tissues but essentially excluding pollen and / or pollen tissues. spike so that there is no expression product present in said tissues to a significant extent. In one invention, the invention relates to a nucleotide fragment comprising a nucleotide sequence comprising a consecutive length of at least 50 nt, particularly between about 400 nt and about 650 nt, particularly between about 200 nt and about 400 nt, particularly about 350 nt in length of the nucleotide sequence represented in SEQ ID NO: 13 and SEQ ID NO: 35, respectively, where said nucleotide sequences still exhibit the regulatory function according to the invention that is driving the expression of an operatively associated polypeptide of interest in most plant tissues but essentially excluding pollen and / or spike tissues so that no expression product is significantly present in said tissues. It will also be clear to those skilled in the art that variant sequences can be obtained without affecting the specific properties of the regulatory sequences according to the invention by introducing mutations, that is, insertions and / or deletions and / or substitutions of one or more nucleotides, in the DNA sequences of SEQ ID NO: 13, SEQ ID NO 14, SEQ ID NO: 35 and SEQ ID NO: 36, respectively, using methods known in the art. Likewise, variations can be introduced to a modified or unmodified nucleotide sequence by disordering the sequence of the invention. To evaluate a function of DNA sequence variants in accordance with the invention, the sequence of interest is operatively linked to a selectable or analyzable tagged gene and the expression of the marker gene is evaluated in expression assays with protoplasts or in whole plant tissues. or in stably transformed plants. Those skilled in the art will know that DNA sequences capable of driving the expression of a 2588723 of 106 operatively associated nucleotide sequences are constructed in a modular manner. Consequently, the expression levels of shorter DNA fragments may differ with respect to the longer fragment and may differ with respect to each other. For example, deletion of an upstream negative regulatory element will lead to increased expression levels of the associated nucleotide sequence whereas deletion of a positive regulatory element will reduce expression levels of the associated nucleotide sequence. . In one embodiment, the invention relates to an expression cassette comprising a regulatory sequence or an expression cassette comprising said nucleotide regulatory sequence or polynucleotide construct, particularly a chimeric polynucleotide construct, comprising said regulatory sequence in accordance with the invention and as described herein. In one embodiment, the expression cassette according to the invention comprises approximately 2.3 kb of the 5' ZmABP3 sequence consisting of approximately 1.1 kb of 5' non-transcribed sequence, approximately 0.25 kb of region 5' untranslated and approximately 0.98 kb representing ZmABP3 intron 1, approximately 1.013 kb of the 3' sequence beginning just after the ABP3 translation stop codon including approximately 0.3 kb of untranslated region 3' and approximately 0.7 kb of non-transcribed sequence, with functions such as transcription terminator and polyadenylation signal. In one embodiment, an expression cassette is provided according to the invention where the natural translation start codon is silenced and moved to the second exon, in particular it is moved within 15 nucleotides of the 5' end and exon 2 of ZmABP3. In one embodiment, an expression cassette is provided in accordance with the invention where the start codon is preceded by the Kozak sequence 5'...CCACC...-3'. 2588723 of 106 In one embodiment, the expression cassette according to the invention comprises a nucleotide regulatory sequence comprising approximately 2.6 kb of 5' sequence, consisting of approximately 2 kb of 5' non-transcribed sequence, and approximately 12 bp of 5' untranslated region, approximately 0.6 kb representing exon 1, intron 1, and approximately 16 bp of exon 2; and approximately 1 kb of 3' sequence that begins just after the translational termination codon and includes approximately 0.6 kb of 3' untranslated region and approximately 0.4 kb of untranscribed sequence, and functions such as transcription terminator and polyadenylation signal. In one embodiment, an expression cassette is provided in accordance with the invention where the natural translation start codon is silenced and translocated to the second exon. In one embodiment, a nucleotide sequence encoding a polypeptide or protein encoding an endotoxin from Bacillus thuringiensis is provided, having a sequence identity of at least 80%, particularly a sequence identity of at least 85%, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO:15. In one embodiment, a polypeptide or protein encoding nucleotide encoding a Bacillus thuringiensis endotoxin is provided having the nucleotide sequence as depicted in SEQ ID NO: 15. In one embodiment, the invention relates to a transgenic plant comprising an expression cassette according to the invention and as described herein. In one embodiment, the invention provides a transgenic plant, particularly a transgenic corn plant, comprising a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention provides a transgenic plant, in particular a transgenic corn plant comprising a regulatory sequence of 2588723 of 106 in accordance with the invention and as described herein in association with a polynucleotide of interest, in particular a polynucleotide encoding a polypeptide or protein of interest. In one embodiment, the invention provides a transgenic plant, particularly a transgenic corn plant, comprising an expression cassette in accordance with the invention and as described herein. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the nucleotide sequence encoding a polypeptide or protein encoding an endotoxin from Bacillus thuringiensis, having a sequence identity of at least 80%, particularly a sequence identity of at least 85%, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% with a nucleotide sequence as represented in SEQ ID NO:15 and is under the operational control of a regulatory sequence operable in said plant. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide sequence encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence as represented in SEQ ID NO: 15 and is under the control of a regulatory sequence operable in said plant. The invention also provides methods for preparing expression cassettes comprising the regulatory sequence according to the invention comprising joining an expressible polynucleotide encoding a polypeptide or protein of interest with a regulatory sequence according to the invention and as described herein to obtain an expression construct, wherein the polynucleotide of interest is linked or operatively associated with the regulatory sequence such that the expression of the polypeptide or protein of interest is mediated by the regulatory sequence according to the invention and results in the expression of said polypeptide or protein of interest in essentially all plant tissues, but excludes 2588723 of 106 essentially the expression in the tissues of the reproductive structures of the plants, particularly in the pollen and / or spike tissues in such a way that there is no expression product present in said tissues in a significant way. In one embodiment, the invention relates to a method for producing a transgenic plant that expresses a DNA sequence of interest in tissue other than pollen but not, substantially or entirely, in pollen and / or spike tissues, which understands to. transforming an expression cassette according to the invention and as described herein into a plant cell comprising a nucleotide regulatory sequence, which at least in part has a transcription initiation function that mediates the expression of a polynucleotide coding for an operatively associated protein of interest in most plant tissues but essentially excluding pollen and / or spike tissues so that no expression product is significantly present in those tissues; and b. regenerate the plant cell transformed in step a) into a plant. In one embodiment, the invention relates to a method for controlling target insect pests that feed on vegetative plant tissue such as the leaf, stem and root and / or reproductive tissues such as the cob, but which protects the pests. that are not target that feed on pollen, which includes to. growing a plant in accordance with the invention and as described herein in an area infested by the target pest; b. expressing a polypeptide or protein that is capable of controlling said target pest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention relates to a method for protecting the reproductive tissues of a plant, particularly the pollen and / or spike tissues against damage caused by the expression in said tissues of a polypeptide or protein of interest, comprising 2588723 of 106 to. cultivating a plant in accordance with the invention and as described herein; b. expressing in said plant a polypeptide or protein of interest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the present invention relates to the use of a regulatory sequence according to the present invention and as disclosed herein to protect the reproductive tissues of a plant, in particular the pollen and / or spike tissues against damage caused by the expression in said tissues of a polypeptide or protein of interest that expresses said polypeptide or protein of interest in said plant under the control of a regulatory sequence in accordance with the invention and as described herein. BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 represents the nucleotide sequence of the forward primer P1 represents the nucleotide sequence of the reverse primer P2 represents the nucleotide sequence of the oligonucleotide Patg represents the nucleotide sequence of the oligonucleotide Pnco SEQ ID NO: 5 represents the nucleotide sequence of the oligonucleotide ADPcSEQ ID NO: 6 represents the nucleotide sequence of the oligonucleotide ADPc-2 SEQ ID NO: 7 represents the nucleotide sequence of the oligonucleotide ADPcSEQ ID NO: 8 represents the nucleotide sequence of the oligonucleotide adp3SEQ ID NO: 9 represents the nucleotide sequence of the forward primer P3 SEQ ID NO: SEQ ID NO: SEQ ID NO: represents the nucleotide sequence of the reverse primer P4 represents the nucleotide sequence of the forward primer Tnco represents the nucleotide sequence of the forward primer T2 2588723 of 106 SEQ ID NO: 13 represents the nucleotide sequence of the modified Z m ABP3 regulatory sequence including the transcription initiation sequence SEQ ID NO: 14 represents the terminal sequence nucleotide sequence of Zm ABP3 SEQ ID NO: 15 represents the nucleotide sequence of Cry1AbG6 SEQ ID NO: 16 represents the nucleotide sequence of AtAVP1D coding sequence optimized for maize SEQ ID NO: 17 represents the nucleotide sequence of the ZmABP3 gene SEQ ID NO: 18 represents the nucleotide sequence of plasmid pNOV1321 SEQ ID NO: 19 represents the nucleotide sequence of the ABT forward primer P1 forw SEQ ID NO: 20 represents the nucleotide sequence of the ABT reverse primer P2 rev SEQ ID NO: 21 represents the nucleotide sequence of the oligonucleotide pABT mut1 SEQ ID NO: 22 represents the nucleotide sequence of the pABT mut2 oligonucleotide SEQ ID NO: 23 represents the nucleotide sequence of the pABT mut3 oligonucleotide SEQ ID NO: 24 represents the nucleotide sequence of the pABT mut4 oligonucleotide SEQ ID NO: 25 represents the nucleotide sequence of the pABT mut5 oligonucleotide SEQ ID NO: 26 represents the nucleotide sequence of the pABT mut6 oligonucleotide SEQ ID NO: 27 represents the nucleotide sequence of the forward primer pABT amp1 SEQ ID NO: 28 represents the nucleotide sequence of the reverse primer pABT amp2 SEQ ID NO: 29 represents the nucleotide sequence of the ABT forward primer P4 2588723 of 106 SEQ ID NO: 30 represents the nucleotide sequence of the ABT reverse primer P5 SEQ ID NO: 31 represents the nucleotide sequence of the ABTt m1 oligonucleotide SEQ ID NO: 32 represents the nucleotide sequence of the ABTt m2 oligonucleotide SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 represents the nucleotide sequence of ZmABT1 cDNA represents the nucleotide sequence of ZmABT2 cDNA represents the nucleotide sequence of the ZmABT promoter SEQ ID NO: 36 represents the nucleotide sequence of the terminal sequence of ZmABT SEQ ID NO: 37 represents the nucleotide sequence of the ZmABP3-Cry1AbG6 assembly construct SEQ ID NO: 38 represents ZmABP3-Cry1AbG6 SEQ ID NO: 39 represents ZmABP3-Cry1AbG6 the nucleotide sequence of the binary construct the nucleotide sequence of the binary construct SEQ ID NO: 40 represents ZmABP3-AmCyan set SEQ ID NO: 41 represents ZmABP3-AmCyan nucleotide sequence of the construct nucleotide sequence of the binary construct SEQ ID NO: 42 represents the nucleotide sequence of the ZmABP3-AtAVP1 D assembly construct SEQ ID NO: 43 represents the nucleotide sequence of the binary construct ZmABP3-AtAVP1D SEQ ID NO: 44 represents the nucleotide sequence of plasmid 15772 (ZmABT set) SEQ ID NO: 45 SEQ ID NO: 46 represents the nucleotide sequence of plasmid 15773 represents the nucleotide sequence of ZmABT gDNA SEQ ID NO: 47 represents the nucleotide sequence of Ctrl_ZMU458553at SEQ ID NO: 48 represents the nucleotide sequence of AF032370_at 2588723 of 106 SEQ ID NO: 49 represents the nucleotide sequence of Zm001747_s_ at SEQ ID NO: 50 represents the nucleotide sequence of Zm005803_s_ at SEQ ID NO: 51 represents the nucleotide sequence of Zm007728_s_ at SEQ ID NO: 52 represents the nucleotide sequence of Zm009722_s_ at SEQ ID NO: 53 represents the nucleotide sequence of Zm015335_s_ at SEQ ID NO: 54 represents the nucleotide sequence of Zm021004_s_ at SEQ ID NO: 55 represents the nucleotide sequence of Zm058948_s_ at SEQ ID NO: 56 represents the sequence of nucleotides of Zm061393_s_ at SEQ ID NO: 57 represents the nucleotide sequence of Zm016864_s_ at SEQ ID NO: 58 represents the nucleotide sequence of Zm018791_at SEQ ID NO: 59 represents the nucleotide sequence of ZMMETALL_x _at SEQ ID NO: 60 represents the sequence nucleotide sequence of Zm000019_at SEQ ID NO: 61 represents the nucleotide sequence of Zm002987_at SEQ ID NO: 62 represents the nucleotide sequence of Zm002990_s_ at SEQ ID NO: 63 represents the nucleotide sequence of Zm002990_x_ at SEQ ID NO: 64 represents the sequence of nucleotides of Zm004433_at SEQ ID NO: 65 represents the nucleotide sequence of Zm005761_at SEQ ID NO: 66 represents the nucleotide sequence of Zm006285_at SEQ ID NO: 67 represents the nucleotide sequence of Zm006481_s_ at SEQ ID NO: 68 represents the sequence of nucleotides of Zm010323_s_ at SEQ ID NO: 69 represents the nucleotide sequence of Zm011554_at SEQ ID NO: 70 represents the nucleotide sequence of Zm011554_x_ at SEQ ID NO: 71 represents the nucleotide sequence of Zm021403_at SEQ ID NO: 72 represents the sequence of nucleotides of Zm028405_s_ at SEQ ID NO: 73 represents the nucleotide sequence of Zm032921_s_ at SEQ ID NO: 74 represents the nucleotide sequence of Zm033444_s_ at SEQ ID NO: 75 represents the nucleotide sequence of Zm035082_s_ at SEQ ID NO: 76 represents the nucleotide sequence of Zm040564_x_ at SEQ ID NO: 77 represents the nucleotide sequence of Zm054116_s_ at SEQ ID NO: 78 represents the nucleotide sequence of Zm066342_at SEQ ID NO: 79 represents the nucleotide sequence of Zm051284_at SEQ ID NO: 80 represents the Vector nucleotide sequence 15289 2588723 of 106 SEQ ID NO: 81 represents the nucleotide sequence of binary ZmABP-948 SEQ ID NO: 82 represents the nucleotide sequence of ZmABT-990-binary SEQ ID NO: 83 represents the nucleotide sequence of the 5' primer Bfr1 SEQ ID NO: 84 SEQ ID NO: 85 SEQ ID NO: 86 SEQ ID NO: 87 5’1Ab5XbaI SEQ ID NO: 88 SEQ ID NO: 89 SEQ ID NO: 90 SEQ ID NO: 91 represents the nucleotide sequence of the 3' primer '1Ab3d6 represents the nucleotide sequence of cy2' represents the nucleotide sequence of cy1 represents the nucleotide sequence of cy2 DETAILED DESCRIPTION OF THE INVENTION Definitions Technical terms and expressions used in the scope of this application generally have the meaning commonly corresponding to them in the relevant art of molecular biology unless otherwise indicated herein below. As used herein and the appended claims, the singular forms a, an, and the and the include their plurals unless the context clearly indicates otherwise. Thus, for example, the reference to a plant includes one or more plants and the reference to a cell includes mixtures of cells, tissues and the like. As used herein and the appended claims, the plural form “tissues” includes its singular form unless the context clearly indicates otherwise. 2588723 of 106 contrary. Thus, for example, reference to shank tissues includes one or more tissues present in the shank. As used in this specification and the accompanying claims, the term “most plant tissues” or “essentially all plant tissues” is used interchangeably and refers to the majority of tissues present in the plant with the exception of the tissues of the reproductive structures, particularly the pollen and spike tissues. In particular, “most tissues” refers to the plant tissues that insects primarily feed on, with the exception of male reproductive structures, such as stem tissues, roots, leaves, cob. , the corn pod, the silks and the developing seeds. The term "polynucleotide" is understood herein to refer to the high molecular weight polymeric molecule, which may be single or double stranded, composed of monomers (nucleotides) containing a sugar, a phosphate and a base which may be purine. or pyrimidine. A polynucleotide fragment is a fraction of a given polynucleotide molecule. In higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) participates in the transfer of information included in DNA to proteins. A genome is the total body of genetic material included in each cell of an organism, including the mitochondria and plastid genomes. Thus, the term "polynucleotide" refers to a DNA or RNA polymer that may have one or two strands, optionally containing synthetic, non-natural or altered nucleotide bases capable of being incorporated into DNA or RNA polymers. Unless otherwise indicated, a particular nucleic acid sequence of this invention also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the explicitly stated sequence. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more of the selected codons (or all) is replaced with 2588723 of 106 mixed base residue and / or deoxynosine (Batzer, et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka, et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini, et al., Mol. Cell. Probes 8:91-98 (1994). The term polynucleotide is used interchangeably with nucleic acid, nucleotide sequence and may include genes, cDNA and mRNA encoded by a gene, etc. A “nucleotide regulatory sequence where at least part of it has a transcription initiation function” is understood herein to refer to a nucleotide sequence that controls the expression of an operatively associated coding sequence providing recognition of RNA. polymerase and other factors necessary for proper transcription and is located upstream (5') of its coding sequence. “Nucleotide regulatory sequences” include 5' regulatory sequences located in the proximal and more distal elements upstream of the associated coding region, which influence transcription, RNA processing or stability, or translation of the coding sequence. associated. "Nucleotide regulatory sequences" may further include 3' sequences, including 3' untranslated and / or 3' untranscribed sequences, located downstream of the associated coding region and may include a termination site. the transcription. "Nucleotide regulatory sequences" may include enhancers, promoters, untranslated leader sequences, introns, and polyadenylation signal sequences. They also include natural and synthetic sequences which can be a combination of synthetic and natural sequences. An "enhancer" is a DNA sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level of tissue specificity of a promoter. It is capable of operating in both orientations (normal or reverse) and capable of operating even when moved upstream or downstream of the promoter. The meaning of the term “nucleotide regulatory sequences” includes “transcription initiation” or “promoter” sequence and promoter regulatory sequences.” These terms are used interchangeably herein. 2588723 of 106 For the purposes of the invention, the definition of the term “3' non-transcribed sequence” includes modifications to the nucleotide sequence of a 3' non-transcribed sequence derived from a target gene, the modified 3' non-transcribed sequence does not reduce significantly the activity of its associated 3' regulatory sequence. The 3' untranscribed sequence extends approximately 0.5 to 1.5 kb downstream of the transcription termination site. It is understood that the polynucleotide of the invention is provided in isolated form. The term "isolated" means that the polynucleotide disclosed and claimed herein is not a naturally occurring polynucleotide, if in fact it has a naturally occurring homologue. Accordingly, it is understood that the other compounds of the invention described in more detail below are isolated. If claimed in the context of a plant genome, the polynucleotide of the invention is distinguished from naturally occurring homologs by, for example, modifications introduced into a naturally occurring homologous sequence and / or the side of insertion into the genome and the flanking sequences on the insertion side. “Operably associated” and “operatively linked” are used interchangeably and refer to the association of nucleic acid sequences into a single nucleic acid fragment such that the function of one affects that of the other. For example, a promoter is associated or operatively linked with a coding sequence or functional RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under transcriptional control of the promoter). promoter). Coding sequences in sense or antisense orientation may be operationally unique to regulatory sequences. The term “significantly present” as used in the context of the present invention refers to the fact that only negligible expression occurs in pollen resulting from only minor amounts of expression product in pollen tissue, giving result in only minor amounts of expression product in pollen tissue at concentrations that may 2588723 of 106 be detected by high resolution detection methods such as HPLC, ELISA and Western assays, insect feeding assays, enzyme activity assays, etc., but remain below a certain threshold level that may be needed to effect detection. intended biological function of the expression product. For example, in the case of Cry1AbG6 endotoxin from Bacillus thuringiensis the threshold level is in the range between 5 ng / mg of soluble protein and 60 ng / mg of soluble protein, particularly in the range between 20 ng / mg of soluble protein and 50 ng / mg soluble protein. The term chimeric gene refers to any gene that contains 1) DNA sequences, including regulatory and coding sequences that are not found together in nature in that specific combination, or 2) sequences that encode parts of proteins that are not naturally linked together, or 3) parts of promoters that are not naturally joined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources or comprise regulatory sequences and coding sequences derived from the same source but are arranged differently than occurs in nature. The terms heterologous DNA sequence, exogenous DNA segment or heterologous nucleic acid, as used herein, each refer to the sequence that originates from a source foreign to the particular host cell or, if it originates from the same source , is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell, but that has been modified through, for example, the use of DNA rearrangement or mutation. The terms also include non-naturally existing multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a segment of DNA that is foreign or heterologous to the cell, or homologous to the cell but that is found at a position within the genome of the host cell in which the element is not ordinarily found. Exogenous DNA segments are expressed to produce 2588723 of 106 exogenous polypeptides. A “homologous” DNA sequence is a DNA sequence naturally associated with a host cell into which it is introduced. A transgene refers to a gene that has been introduced into the genome through transformation and is stably maintained. Transgenes may include, for example, genes that are heterologous or homologous to the genes of a particular plant that is desired to be transformed. Furthermore, transgenes may comprise native genes inserted into a non-native organism or chimeric genes. The term endogenous gene refers to a gene native to its natural location in the genome of an organism. A foreign gene refers to a gene that is not normally found in the host organism but is introduced through gene transfer. The term "expression cassette", as used herein, means a DNA sequence capable of directing the expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the protein-encoding polynucleotide of interest. which is operatively linked to a terminator. It also typically comprises the sequences necessary for correct translation of the nucleotide sequence. The coding region usually encodes a protein of interest, but may also encode a functional RNA of interest, for example antisense RNA or an untranslated RNA, in the sense or antisense direction. The expression cassette comprising the protein-encoding polynucleotide of interest may be chimeric. “Intron” refers to an intervening section of DNA that occurs almost exclusively in a eukaryotic gene, but is not translated into amino acid sequences in the gene product. Introns are removed from premature mRNA through a process called splicing, which leaves exons intact, to form an mRNA. For the purposes of the invention, the definition of the term "intron" includes modifications to the nucleotide sequence of an intron derived from a target gene, provided that the modified intron does not significantly reduce the activity of its associated 5' regulatory sequence. 2588723 of 106 The term “exon” refers to the section of DNA carrying the coding sequence for a protein or part of it. Exons are separated by intervening non-coding sequences (introns). For the purposes of the invention, the definition of the term "exon" includes modifications to the nucleotide sequence of an exon derived from a target gene, provided that the modified exon does not significantly reduce the activity of its associated 5' regulatory sequence. The terms protein, peptide and polypeptide are used interchangeably herein. “Probe” as used herein refers to a defined nucleic acid fragment (DNA or RNA) of variable length that can be used to detect in a DNA or RNA sample that contains sample nucleotide sequences that are complementary to the sequence represented by the test molecule. Probe molecules can be used in a biochip arrangement, where they are covalently linked with a chemical matrix on an inert surface, such as coated glass plates or silicon-based gene chips. Hybridization of probe molecules to a target nucleic acid usually occurs under highly stringent conditions. Generally, target-probe hybridization is detected and quantified by fluorescence-based detection of fluorophore-labeled targets to determine the relative transcriptional abundance of nucleic acid sequences in the target. DNA biochips can be used in expression profiling experiments to quantify transcript abundance for a target molecule in pollen and / or spike tissue samples, calculated based on the strength of the signal detected in the respective samples. The term hybridize as used herein refers to conventional hybridization conditions, preferably hybridization conditions in which a solution of 5xSSPE, 1% SDS, 1xDenhardts is used as a solution and / or the hybridization temperatures are between 35 °C and 70°C, preferably 65°C. After hybridization, washing is carried out 2588723 of 106 preferably first at 2xSSC, 1% SDS and subsequently with 0.2xSSC at temperatures between 35°C and 75°C, particularly between 45°C and 65°C, but especially at 59°C (with respect to definition of SSPE, SSC and Denhardts solution, see Sambrook et al. loc. High stringency hybridization conditions, such as those described in Sambrook et al, supra, are particularly preferred. Particularly preferred stringent conditions are for example present in the hybridization and washing occurs at 65°C as indicated above. Non-stringent hybridization conditions, for example with hybridization and washing carried out at 45°C, are less preferred and at 35°C are even less preferred. The terms “sequence homology or sequence identity” are used interchangeably herein. The terms identical or percent identity in the context of two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have an indicated percentage of amino acid residues or nucleotides that are the same, when compared. and aligns for maximum correspondence, as measured using one of the following comparison algorithms or by visual inspection. If two sequences to be compared respectively differ in length, sequence identity preferably refers to the percentage of nucleotide residues of shorter sequence that are identical with nucleotide residues of longer sequence. Sequence identity can be determined conventionally with the use of computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, in order to determine the segment that has the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has, for example, 95% identity to a reference sequence of the present invention, the parameters are preferably adjusted so that the percent identity is calculated for 2588723 of 106 the total length of the reference sequence and that homology gaps of up to 5% of the total number of nucleotides in the reference sequence are allowed. When using Bestfit, the so-called optional parameters are preferably left at their default values. Deviations that appear in the comparison between a given sequence and the sequences described above can be caused, for example, by addition, deletion, insertion or recombination. This reference comparison can preferably be carried out with the program “fasta20u66” (version 2.0u66, September 1998 by William R. Pearson and the University of Virginia; see also W.R. Pearson (1990), Methods in Enzymology 183, 63-98 , the attached examples and http: / / workbench.sdsc.edu / ). For this purpose, default parameter settings can be used. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The term “specifically hybridize with” refers to the binding, duplication, or hybridization of a molecule only with a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture DNA or RNA (e.g., total cellular ). “Substantially matches” refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and encompasses minor non-matches that can be accommodated by reducing the stringency of the hybridization medium to achieve the desired detection of the nucleic acid sequence. Diana. “Strong hybridization conditions” and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments, such as Southern and Northern hybridizations, are sequence dependent and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I, chapter 2 “Overview of principles of hybridization and the strategy 2588723 of 106 of nucleic acid probe assays”, Elsevier, New York. In general, highly stringent washing and hybridization conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined pH and ionic strength. Typically, under “stringent conditions” a probe will hybridize to its target subsequence, but not to other sequences. The Tm is the temperature (under defined pH and ionic strength) at which 50% of the target sequence hybridizes to obtain a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids having more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide with 1 mg heparin at 42°C, with hybridization performed during evening. An example of very stringent washing conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent wash conditions is a wash with 0.2x SSC at 65°C for 15 minutes (see Sambrook, infra, for a description of SSC buffer). Often, a high-stringency wash is preceded by a low-stringency wash to remove the antecedent probe signal. An example of a medium-stringency wash for a duplex of, for example, more than 100 nucleotides, is 0.1x SSC at 45°C for 15 minutes. An example of a low stringency wash for a duplex of, for example, more than 100 nucleotides, is 4-6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically include salt concentrations of less than about 1.0 M Na+ ion, typically a Na+ ion concentration of about 0.01 to 1.0 M (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C. Stringent conditions can also be achieved with the addition of destabilizing agents, such as formamide. In general, a signal-to-noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates the detection of a specific hybridization. Nucleic acids that do not hybridize with each other under stringent conditions remain substantially identical if the proteins 2588723 of the 106 that these encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy allowed by the genetic code. A “plant” is any plant at any stage of development, particularly a seed plant. A “plant cell” is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in the form of a single isolated cell or a culture of cells, or as a part of a more organized unit such as a plant tissue, a plant organ or an entire plant. “Plant cell culture” means cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, Zygotes and embryos at different stages of development. “Plant material” means leaves, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, tissue or cell cultures, or any other part or product of a plant. A “plant organ” is a visibly differentiated and structured part of a plant such as a root, stem, leaf, flower bud or embryo. “Plant tissue” as used herein means a group of plant cells organized into a structural and functional unit. Any tissue from a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture, and any group of plant cells organized into structural and / or functional units. Plant tissue includes differentiated or undifferentiated plants or plant tissues including, but not limited to, roots, stems, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells and cultures such as single cells, protoplasts, embryos and callus tissue. Plant tissue can be in plant organs, tissues or cell cultures. 2588723 of 106 The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as indicated above or otherwise included by this definition is not intended to be exclusive of any other type of plant tissue. The terms “corn” and “Zea mays” are used interchangeably herein and refer to plants belonging to the genus Zea, for example, different strains, races or varieties, commercial or not, of other species of Zea mays. The present invention relates to a transgenic plant comprising, stably integrated into its genome, a chimeric polynucleotide construct, particularly a chimeric DNA construct, comprising a polynucleotide encoding a protein of interest, particularly a polypeptide encoding polypeptides or protein of interest. , under the control of a nucleotide regulatory sequence, where at least part of this has a transcription initiation function that directs the expression of said polynucleotide encoding the protein of interest in essentially all tissues of the plant, except for the tissues of the male reproductive structures, in particular the pollen and / or spike tissues so that no expression product is present in said tissues to a significant extent. A nucleotide regulatory sequence according to the present invention, wherein at least part of it has a transcription initiation function that mediates the expression of an operatively associated protein-coding polynucleotide of interest in most plant tissues but not in the male reproductive structures, particularly the pollen and / or spike tissues, can be obtained in an expression profiling experiment to analyze for probes that give strong signals in all samples, but only a signal or no signal in the pollen sample and / or spike, which is indicative of expression of respective polynucleotides represented by said probes in the majority of plant tissues or no or substantial expression in the pollen and / or spike tissues. In particular, plant tissues and tissues of the reproductive structures of maize, particularly pollen and / or spike tissues, can be analyzed to identify and obtain a regulatory sequence in accordance with the present invention. 2588723 of 106 In particular, samples of all plant tissues, in particular samples of green tissues and the root of the maize plant, can be directly compared to obtain samples of male reproductive structures, in particular samples of the pollen and / or spike. Probes representing polynucleotides that do not meet the target expression profile are removed. Only probes with the strongest signal in all tissues that are either pollen or spike have no signal or have a weak signal in pollen and / or spike are selected for further analysis, i.e. probes that represent polynucleotides that have high expression in all tissue samples, but show substantially no expression in pollen and / or spike. Such probes can be aligned with cDNA cluster data sets to detect bona fide plant genes, particularly maize genes or putative maize genes. The DNA sequence representing probes on the corn chip was determined to represent genes that were highly expressed in all tissue samples but essentially not expressed in pollen, particularly the probes represented by the DNA sequence that were presented in SEQ ID NOs: 47 to 56 and those that represented genes that had high expression in all tissue samples and that essentially have no or substantial expression in spike samples, particularly probes represented by the DNA sequence that was presented in SEQ ID NOs: 57 to 79, can be easily extended to expression cassettes designed following the steps set forth in the Examples. Candidate probe sequences from expression profiling analysis for each expression category can be selected and grown into a finished binary vector with the designed expression cassette linked to a gene of interest such as a reported gene, i.e. the GUS reporter gene. In a first step, each expression cassette is flanked with one or more suitable restriction sites such as, for example, SanDI / RsrII sites and cloned into the vector molecule. Typically, the regulatory region that includes the transcription initiation function resides in a fragment of approximately 1000-1500 2588723 of 106 bp upstream of the transcription start site and extends to the second exon or the natural translation start codon when not in the first exon. It typically ends with the corn-optimized Kozak 'gtaaaccatgg' sequence. The generated translation start codon is then incorporated into a suitable restriction site such as the 'ccatgg' NcoI restriction endonuclease site. All translation initiation codons in the theoretical transcript that are upstream of the generated restriction site were removed. At least one stop codon should be present in each reading frame upstream of the generated restriction site. The regulatory region that includes the transcription initiation function is designed to be flanked by suitable restriction sites such as, for example, XhoI / SanDI sites at the 5' end and an NcoI site at the 3' end. The gene of interest (GOI) as the GUS reporter gene is provided as a suitable restriction fragment in the example provided herein as a NcoI / SacI fragment. The terminus extends from just after the translational termination codon for approximately 1 kb downstream. The terminus is designed to be flanked by suitable restriction sites such as SacI at the 5' end and RsrII / XmaI at the 3' end. The completed expression cassette is designed to be mobilized as a suitable restriction fragment, such as a SanDI / RsrII fragment, which can be ligated to the corresponding site located in the Agrobacterium binary vector such as the vector presented in SEQ ID NO: 80 . All internal restriction sites used in the cloning steps identified above are mutated using single base substitutions to silence them. Through the application of these basic steps a plant expression cassette can be designed that corresponds to the respective probe molecules, particularly probe molecules in the corn chip that was identified to have high expression in all tissue samples but essentially not was expressed in pollen, particularly probes that are represented by the DNA sequence presented in SEQ ID NOs: 47 to 56 and those that represented genes that had high expression in all samples of 2588723 from 106 tissue and which have essentially no or reduced expression in spike samples, particularly probes represented by the DNA sequence presented in SEQ ID NOs: 57-79. The latter is an expression cassette that should be transcribed in all maize tissues but not in pollen. The latter is an expression cassette that should be transcribed in all maize tissues but not transcribed, or moderately transcribed, in ears. This design strategy can be applied to all probes identified in an expression profiling experiment. In a specific embodiment of the invention, applying the above criteria results in the identification of genes that exhibit the desired expression profile. In particular, a gene encoding an actin-binding protein 3 (ABP3) is identified, particularly a maize actin-binding protein 3 (ZmABP3), which is a member of a small gene family that had been characterized previously (Lopez et al., 1996). The gene product has also been called actin depolymerizing factor 3. Through southern analysis it was found that there are two ABP3 genes in the maize genome (Lopez et al., 1996), designated here as ZmABP3-A and ZmABP3-B, respectively. The ZmABP3-A and ZmABP3-B cDNAs encode a protein of 139 amino acids that are identical to all residues except one. The expression profiling data indicate that ZmABP3-B is highly expressed in most plant tissues, but essentially excluding pollen tissues so that no expression product is significantly present in all tissues. while ZmABP3-A does not have high expression. A structural analysis of the ZmABP3-B gene reveals that the coding region of the ZmABP3-B protein is encoded in 3 exons, which are interrupted by two intervening sequences (introns) flanked by the expected border nucleotides b and GT...AG. The regulatory sequence is located in the 5' region of the ABP3 gene immediately upstream of the coding sequence. The size of the regulatory region is in the range of approximately 2 kb to 3 kb, particularly 2588723 of 106 between 2.3 kb and 2.5 kb approximately, and comprises a 5' non-transcribed sequence, in particular a 5' non-transcribed sequence comprised between approximately 0.9 kb and 1.3 kb, but especially of approximately 1.1 kb, and a 5' untranslated region, particularly between approximately 0.1 kb and 0.3 kb, but especially 0.25 kb of the 5' untranslated region and representing all or part of the ZmABP3-intron 1 nucleotide sequence, particularly a nucleotide sequence comprised between approximately 0.7 kb and 1.2 kb, but especially approximately 0.98 kb. The regulatory sequence according to the invention further comprises part of the 3' sequence starting just after the ABP3 translation termination codon that includes transcribed but untranslated sequence (untranslated region) and untranscribed sequence that functions as a terminator. transcription and polyadenylation signal. In particular, the 3' sequence is in the range between about 0.8 kb and about 1.2 kb, particularly between about 0.9 kb and about 1.1 kb, but especially about 1.013 kb. The size of the 3' untranslated region is in the range of about 0.2 kb and 0.4 kb, but especially about 0.3 kb, and that of the untranscribed sequence is in the range of 0.5 kb and 0.8 kb approximately, but specifically 0.7 kb approximately. In a specific embodiment of the invention, the regulatory sequence is modified such that the natural translation start codon is silenced in order to move it to the second exon. In another embodiment of the invention, candidate probes can be identified in a DNA chip or gene set, particularly a corn DNA chip or gene set such as, for example, the Affymetrix™ corn chip by applying the above criteria, which can be used to identify genes or putative genes in the maize genome that exhibit the desired expression profile. Two candidate probes were identified that show virtually no signal in the spike but have a high signal in other tissues. This indicates that the gene expressed in said candidate probes is not expressed in the spike, but has 2588723 of 106 a raises expression in the rest of the plant. The greatest differential expression, 60-fold higher in tissue other than the spike, was observed in a candidate probe from Zm033444_S_AT. The other candidate probe (Zm040564_X_AT) showed signal variation depending on the developmental stage of the probe plant material, i.e. a low signal in young spike that gradually increases to a high or higher signal as the plant ages. The signal power between herringbone samples and non-herringbone samples differed by less than 10-fold, but the signal power in the non-herringbone samples was approximately 10-fold higher compared to the other candidate probe. The sequence data indicate that none of the probes correspond to a characterized gene. Both pathways identify good candidate genes to develop promoters that have high expression in non-spike tissue and have no or substantial expression in the spikes. Given the high signal differential between spike and non-spike samples, a Zm033444_S_AT probe-based expression cassette was developed. Public and private databases can be searched for the word BLASTN with the candidate probe sequence Zm033444_S_AT to obtain DNA sequence evidence for both transcripts and gDNA corresponding to Zm033444_S_AT. cDNA results with precise matching to the search sequence had two similar contigs. ZmABT1 corresponds to Corn.1482.c47 and Corn.1908.c31, and ZmABT2 corresponds to Corn.1482.c32, Corn.1482.c28, Corn.1482.c53, Corn.1908.c17, Corn.1908.c20, Corn.1908.c37 and AI947567. The sequences Zm033444_S_AT, ZmABT1 and ZmABT2 can then be used to search maize genomic DNA sequence databases to identify regulatory sequences that have high expression in non-ear tissue and little or no expression in the spikes. These searches identified three entries, AZM4_12, ZmGSStuc11-12-04.4740.1, and MAGI_88845, which are gathered into a single contig. The ZmABT gDNA sequence is represented in SEQ ID NO: 46. It encodes 2588723 of 106 transcripts ZmABTI and ZmABT2, suggesting that they are alternatively spliced ​​variants of the same transcript. ZmABT1 is encoded in 5 exons and ZmABT2 is encoded in 6 exons. The additional exon is between exon 1 and exon 2 of ZmABT1. The largest open reading frame in ZmABT1 and ZmABT2 can be used to define their translational start and stop codons and further define the location of each translational start and stop codon. Through this analysis, both cDNAs use the same translation start and stop codon. In an important aspect of the present invention the regulatory sequence according to the invention can be used in the development of robust expression cassettes that express recombinant genes in most plant tissues but are not fully or substantially expressed in the tissues of the male reproductive structures, particularly the pollen and / or spike tissues so that no expression product is significantly present in said tissues. In a specific embodiment of the invention, a regulatory sequence obtainable from an ABP3 gene, more particularly a regulatory sequence obtainable from a Zea mays ABP3 gene, can be used in the development of robust expression cassettes that express genes. recombinants in most plant tissues but essentially excluding pollen tissues so that no expression product is significantly present in said tissues. The transcription start region of the regulatory sequence according to the invention, particularly of the regulatory sequence that can be obtained from an ABP3 gene, more particularly of the regulatory sequence that can be obtained from a Zea mays ABP3 can be obtained in a PCR reaction containing a pair of primers including a first primer P1 (5'atatatgcatgcggcgcgccgaaagtagcaaacaacaggttcatgtgcac-3') as depicted in SEQ ID NO: 1 and a reverse primer P2 (5'tatataccatggtgggtttgcctgcgaccacaagttca-3') as depicted in SEQ ID NO: 2 through the amplification of a gDNA pattern, particularly a gDNA pattern 2588723 of 106 corn gDNA. In a specific embodiment of the invention, a thermocycling program is applied that includes amplification at approximately 95°C for about 15 minutes, followed by about 45 cycles at about 94°C for about 1 minute, at about 64°C for 1 minute. approximately and approximately 72°C for about 5 minutes. The final extension step is carried out at approximately 72°C for about 15 minutes. The reaction product, in particular about 2.3 kb of reaction product, is purified and the DNA is extracted using a DNA extraction method known in the art. The DNA is precipitated, recovered and finally cloned into a suitable vector. The transcription start region according to the invention, in particular a transcription start region that can be obtained from an ABP3 gene, more particularly that can be obtained from a ZmABP3, can be modified in a series of reactions using at least one of the oligonucleotides selected from the group of oligonucleotides represented in -SEQ ID NO: 3 (Patg (5'-cagctcgcccgagttggtaaggccccct-3')), -SEQ ID NO: 4 ... (Pnco (5'-acagattagtccatcgcccacggt-3')), -SEQ ID NO: 5. (ADPc-1 (5'-agccctgtccatgacggcccaagcaac-3')), -SEQ ID NO: 6. (ADPc-2 (5'-agtagcaattcggtaggcacaggcac-3')), -SEQ ID NO: 7. (ADPc-4 (5'-tctatggtctgcgaggtgcggtggc-3')), and -SEQ ID NO: 8. (adp3-a (5'-gtccccttcttcgccgcgccagctcgc-3')). The terminal of the regulatory sequence according to the invention, in particular a terminal sequence that can be obtained from an ABP3 gene, more particularly a terminal sequence that can be obtained from a ZmABP3, can be amplified from a gDNA template, particularly a template of maize gDNA, in a DNA polymerase reaction using a forward primer (P3 (5'-tatatatagagctcgcatcatgatcatgcatcatggact-3')) as represented in SEQ ID NO: 9 and a reverse primer (P4 (5'atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-3 ')) having a nucleotide sequence as represented in SEQ ID NO: 10. A thermocycling program can be applied comprising a first cycle of approximately 2588723 of 106 95°C for about 5 minutes followed by about 45 cycles of about 94°C for about 30 seconds, about 50°C for about 1 minute and about 72°C for about 4 minutes. The final extension step can be carried out at approximately 72°C for about 15 minutes. Approximately 1 kb of reaction product is purified and DNA extracted using standard extraction methods. The DNA is precipitated, recovered and cloned into a suitable vector. The terminal of a regulatory sequence according to the invention, in particular a terminal sequence obtainable from an ABP3 gene, more particularly a terminal sequence obtainable from a ZmABP3, may be modified to eliminate an internal restriction site, particularly an internal Ncol restriction site using a suitable primer pair, in particular the primer pair Tnco (5'-Pgtaaaaaaaaggtcccttggctcccagaaga-3') / T2 (5'Pcaatgtgttagactgacgtg-3') as represented in SEQ ID NO: 11 and SEQ ID NO: 12, respectively, in DNA polymerase reaction. The thermocycling program used may comprise a first cycle at approximately 95°C for approximately 5 minutes followed by approximately 30 cycles at approximately 95°C for approximately 1 minute, approximately 50°C for approximately 1 minute and approximately 65°C for approximately 15 minutes. minutes. The product can then be processed and sequenced. The present invention also relates to expression cassettes that incorporate the regulatory mechanisms of a target gene of interest that displays the desired expression profile, that is, high expression in most plant tissues but no expression in the tissue. of pollen, particularly an ABP target gene, more particularly a ZmABP3 target gene, to control in plants the expression of nucleic acid molecule products of interest in a manner that simulates the expression profile of the original target gene. The present invention further includes expression cassettes incorporating regulatory sequences obtainable from the 5' region of the target gene, in particular an ABP target gene, more particularly a ZmABP3 target gene, for expressing the products of the nucleic acid molecules. of interest in plant tissues but no or substantial expression in pollen tissue. The 2588723 of 106 The present invention also relates to expression cassettes incorporating the regulatory sequences obtainable from the 5' region and the 3' region of the target gene, particularly an ABP3 target gene, more particularly of a ZmABP3 target gene. In another specific embodiment of the invention, an obtainable maize genomic DNA sequence can be used for the development of robust expression cassettes that transcribe polynucleotides in most plant tissues but essentially excluding the ear tissues so that there is no expression product present in said tissues in a significant way. An inclusive gene structure-based design can be used to construct this expression cassette. In order to incorporate the alternative method of splicing the putative maize gene identified into a method as described above into the expression cassette, the design strategy may be based on the structure of the ZmABT1 transcript as depicted in SEQ ID NO: 33. The transcription start region of the regulatory sequence according to the invention, in particular of the ZmABT promoter region, can be amplified from a maize gDNA template in a DNA polymerase reaction containing gDNA in a primer pair that includes the forward primer ABT P1 forw (5'CGACCAGCGCGACATGCATGGCA-3') as represented in SEQ ID NO: 19 and ABT P2 rev (5'- ACCCCAGGGCGTACGACAAGGCC-3') as represented in SEQ ID NO: 20. In a specific embodiment of the invention a thermocycling program is applied that includes amplification at approximately 95°C for approximately 5 minutes, followed by approximately 40 cycles at approximately 94°C for approximately 30 seconds, at approximately 67°C for approximately 30 seconds and approximately 72°C for about 2.5 minutes. The final extension step was carried out at approximately 72°C for about 10 minutes. This amplification reaction leads to an amplification product of approximately 2.6 kb, which can be purified and where the DNA can be extracted using standard DNA extraction methods. The DNA can then be cloned into a suitable vector such as, for example, the pCR-BluntII-TOPO vector. 2588723 of 106 The ZmABT promoter can be modified in a series of mutagenesis reactions to silence the endogenous translation start codon, silence a SanDI restriction site, and correct point mutations created during amplification. This can be achieved through a series of reactions using at least one of the oligonucleotides selected from the group represented in -SEQ ID NO: 21 pABT mut1 (5'-GATGGCCGGATTGGGCTCCCGGGGTGGAG3') -SEQ ID NO: 22 pABT mut2 (5'-CTGGGAGGCGCGCAAGGGGCAGTTCCTCG3') -SEQ ID NO: 23 pABT mut3 (5'-CCCACCGCCGGAGCACCGAAAGGCCCCGCG3') -SEQ ID NO: 24 pABT mut4 (5'-GTCACCCGGGAGCACTTCCCGGCGCCG-3') -SEQ ID NO: 25 pABT mut5 (5'-CATTGGGCCGAGCACGGCTTCTTCCGC-3') -SEQ ID NO: 26 pABT mut6 (5'GGGGTACGGTGTTCTTGAGTCGTGAAGCGAC-3') The modified ZmABT promoter can be amplified in another PCR reaction using the primers pABT amp1 (5'GCGTCTAGAGGGACCCCGACCAGCGCGACATGCATGGCA-3') as represented in SEQ ID NO: 27 and pABT amp2 (5'-ACCCCAGGGCGTACGACAAGGCCCCACCATGGGCGC-3') as represented in SEQ ID NO: 28. The PCR product can then be purified and the DNA extracted using a standard DNA extraction method. The DNA can then be cloned into a suitable vector such as, for example, the pCR-BluntII-TOPO vector, transformed and sequenced. The ZmABT promoter can then be excised, particularly as an XbaI / NcoI fragment, and ligated into a suitable expression vector such as, for example, pNOV6901. In one embodiment of the invention, an expression cassette is provided comprising a termination sequence obtainable from the ZmABT gene identified and described hereinabove. The ZmABT terminal can 2588723 of 106 be amplified from a maize gDNA template by a DNA polymerase reaction containing gDNA and a primer pair including the forward primer ABT P4 (5'-TATATAGAGCTCGAATCGAAGAAGCCACACTGTAAATCTGCCGGG-3') as represented in SEQ ID NO: 29 and an ABT P5 reverse primer (5'-AGCAAGGCATATGCAGCAGCTGCTGGTCGGACCGGGCCCTATATA-3') as represented in SEQ ID NO: 30 resulting in an amplification product of approximately 1 kb. This reaction product can then be purified and the DNA extracted using a standard DNA extraction method. The DNA can then be cloned into a suitable vector such as, for example, the pCR4-TOPO-Blunt vector. In one embodiment of the invention the ZmABP3 terminus is modified to eliminate the NcoI and XhoI internal restriction sites. This can be achieved through a series of reactions using at least one of the oligonucleotides selected from the group represented in -SEQ ID NO: 31 ABTt m1 (5'- GTCATGCATGGGCATGTGAAGGAGGAGCC-3') -SEQ ID NO: 32 ABTt m2 (5'- GTTGCATGCATGCTGCATGGCGTCGAGAT-3') The amplification product can then be processed and sequenced to result in a terminator sequence as depicted in SEQ ID NO: 36. In one embodiment of the invention, an expression cassette is provided that expresses recombinant genes in most plant tissues but essentially excludes the head tissues so that no expression product is significantly present in said tissues, comprising a regulatory sequence where at least part of it has a transcription initiation function and a regulatory sequence where at least part of it has a termination function, these regulatory sequences being able to be obtained from the ZmABT gene identified and described above herein . In one embodiment of the invention, this expression cassette can be obtained by cutting the ZmABT terminus and ligating it to a suitable vector that already comprises a regulatory sequence where at least one pair of this has an initiation function. 2588723 of 106 of the transcript, particularly the ZmABT promoter sequence such as, for example, the pNOV6901-prABT vector described above. In one embodiment, the expression cassette according to the invention comprises a nucleotide regulatory sequence comprising approximately 2.6 kb of 5' sequence, consisting of approximately 2 kb of 5' non-transcribed sequence, and approximately 12 bp of 5' untranslated region, approximately 0.6 kb representing exon 1, intron 1, and approximately 16 bp of exon 2; and approximately 1 kb of 3' sequence that begins just after the translational termination codon and includes approximately 0.6 kb of 3' untranslated region and approximately 0.4 kb of untranscribed sequence, and functions such as transcription terminator and polyadenylation signal. In one embodiment, an expression cassette is provided in accordance with the invention where the natural translation start codon is silenced and translocated to the second exon. The complete expression cassette can be mobilized into a vector suitable for plant transformation and expression such as, for example, an Agrobacterium binary vector, particularly the Agrobacterium 15289 binary vector. The nucleic acid segment of interest may, for example, encode a ribosomal RNA, an antisense RNA, or any other type of RNA that does not translate into protein. In another preferred embodiment of the invention, the nucleic acid segment of interest is translated into a protein product. The nucleotide sequence that directs transcription and / or the nucleic acid segment may be of homologous or heterologous origin with respect to the plant to be transformed. A useful recombinant DNA molecule for introduction into plant cells includes one derived or isolated from any source that can be subsequently characterized with respect to size and / or function structure, chemically altered, and then introduced into plants. Thus a useful nucleotide sequence, segment or fragment of interest includes fully synthetic DNA, semi-synthetic DNA, DNA isolated from biological sources, 2588723 of 106 etc. Generally, the introduced DNA is not an original resident of the plant genotype it receives in DNA, but it is within the scope of the invention to isolate a gene from a given plant genotype and subsequently introduce multiple copies of the gene into the same genotype, e.g. to increase the production of a particular gene product such as a storage protein or a protein involved in carbohydrate metabolism or any other gene of interest as represented in SEQ ID NO of the sequence listing. The introduced recombinant DNA molecule includes, but is not limited to, DNA from plant genes and genes from non-plant tissues such as those from bacteria, yeast, animals or viruses. The introduced DNA may include modified genes, portions of genes, or chimeric genes, including genes of the same or another genotype. The term “chimeric gene” or “chimeric DNA” is defined as a gene or DNA sequence or segment that comprises at least two DNA sequences or fragments from species that do not combine DNA under natural conditions, or where such DNA sequences or segments they are located or joined in a way that does not occur naturally in the native genome or the untransformed plant. The introduced recombinant DNA molecule used for transformation herein may be circular or linear, double-stranded or single-stranded. Generally, DNA is in the form of chimeric DNA, such as plasmid DNA. In one embodiment the regulatory sequences may be operatively associated with an expressible polynucleotide of interest. The expressible polynucleotide may encode a polypeptide or protein of interest. This polypeptide or protein of interest may be such that it exhibits certain biological activity such as, for example, insecticidal, herbicidal or fungicidal activity or may contribute to better performance of a crop of agricultural interest in the form of yield, quality, lodging, resistance. to biotic and abiotic stress, flowering control, etc. In one embodiment, the concentration of the expressed polypeptide product of the protein-encoding polynucleotide of interest in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissues is 2588723 of 106 such that no insecticidal activity can be detected in a standard insect feeding assay. In particular, the concentration of the expression product in tissues of the male reproductive structures, particularly in the pollen and / or spike tissues, is less than the basic level of about 10 ng / mg of soluble protein, particularly 5 ng / mg of about soluble protein, more particularly about 3 ng / mg of soluble protein, but especially about 2 ng / mg of soluble protein or less. In a specific embodiment of the invention, the polypeptide or protein of interest is a protein or polypeptide with insecticidal activity, particularly a protein or polypeptide with insecticidal activity obtainable from Bacillus thuringiensis, more particularly a Bacillus thuringiensis endotoxin such as, for example, cryIA endotoxin. (b). Other endotoxins known to occur in Bacillus thuringiensis can also be used in association with the regulatory sequence according to the invention to obtain toxin expression in most plant tissues with the exception of pollen and / or spike so that there is no expression product present in said tissues in a significant way. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding a polypeptide or protein of interest encodes an endotoxin from Bacillus thuringiensis, which has a sequence identity of at least 80%, particularly a sequence identity of at least 85%, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO:15. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide of interest encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence as represented in SEQ ID NO: 15. Once completed, the expression cassette can be transferred to a vector suitable for plant transformation such as a vector 2588723 of 106 binary, which can be mobilized to corn through a transformation mediated by Agrobacterium. Transgenic plants (or plant cells or plant explants or plant tissues) that incorporate the polynucleotides of the invention and / or express a polypeptide of interest, such as, for example, a B. thuringiensis toxin protein, can be produced in a variety of widely established techniques. After constructing an expression cassette and a vector incorporating the polynucleotide sequence in accordance with the invention and as described herein, standard techniques can be used to introduce the polynucleotide into a plant, plant cell, plant explant or plant tissue of interest. Optionally, the plant cell, explant or tissue can be regenerated to produce a transgenic plant. The plant may be a higher plant, including gymnosperms, monocots and dicots. Suitable protocols are available for Leguminosae (alfalfa, soybeans, cloves, etc.), Umbelliferae (carrot, celery, turnip), Cruciferae (cabbage, radish, rapeseed, broccoli, etc.), Curcurbitaceae (melon and cucumber), Gramineae (wheat , corn, rice, barley, millet, etc.), Solanaceae (potato, tomato, tobacco, pepper, etc.), and various other crops. See some described protocols Ammirato et al., eds., (1984) Handbook of Plant Cell Culture--Crop Species, Macmillan Publ. Co., New York, N.Y.; Shimamoto et al. (1989) Nature 338: 274 276; Fromm et al. (1990) Bio / Technol. 8:833839; and Vasil et al. (1990) Bio / Technol. 8: 429 434. Currently, the transformation and regeneration of monocotyledonous and dicotyledonous cells is a routine procedure and the expert will select the most appropriate transformation technique will be determined. The choice of method will vary depending on the type of plant you wish to transform; Those skilled in the art will recognize the suitability of particular methods for particular plant types. Suitable methods include, without limitation: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG)-mediated transformation; transformation using viruses; plant cell microinjection; bombardment of plant cells with microprojectiles; vacuum infiltration; and transformation mediated with Agrobacterium tumefaciens. 2588723 of 106 Transformations can be performed with a single DNA species or with multiple DNA molecules (i.e., co-transformation) and both of these techniques are suitable for use with the expression cassettes of the present invention. There are numerous transformation vectors available for plant transformation and the expression cassettes of this invention can be used in conjunction with any of those vectors. Vector selection will depend on the preferred transformation technique and the target species for transformation. There are a variety of techniques available to those skilled in the art to introduce constructs into a plant cell receptor. Generally, such techniques include DNA transformation using A. tumefaciens or A. rhizogenes as the transforming agent, liposomes, PEG precipitation, electroporation, DNA injection, direct DNA absorption, microprojectile bombardment, particle acceleration, and the like (see for example, EP 295959 and EP 138341) (see below). However, cells other than plants can also be transformed using the expression cassettes of the invention. General descriptions of plant expression vectors and reporter genes and of Agrobacterium and Agrobacterium-mediated gene transfer can be found in Gruber et al. (1993). Expression vectors containing the polynucleotide regulatory sequence according to the invention can be introduced into protoplasts or into intact tissue or isolated cells. Preferably, expression vectors are introduced into intact tissue. General methods for culturing plant tissues are presented, for example, in Maki et al., (1993); and by Phillips et al. (1988). Preferably, expression vectors are introduced into corn and other plant tissue using a direct gene transfer method such as microprojectile delivery, DNA injection, electroporation and the like. More preferably, expression vectors are introduced into plant tissues using microprojectile medium administration with the biolistic device. See, for example, Tomes et al. (nineteen ninety five). The vectors of the invention may not be used exclusively for gene expression. 2588723 of 106 structural, but also in exon cloning or promoter procedures to detect differential expression of genes in a variety of tissues (Lindsey et al., 1993; Auch & Reth et al.). Particularly preferred is the use of the binary vectors of Ti and Ri plasmid vectors of Agrobacterium spp. Ti-derived vectors transform a wide variety of higher plants, including monocots and dicots, such as soybean, cotton, rapeseed, tobacco and rice (Pacciotti et al., 1985: Byrne et al., 1987; Sukhapinda et al., 1987; Lorz et al., 1985; Potrykus, 1985; The use of T-DNA to transform plant cells has been the subject of extensive studies and is described in detail (EP 120516; Hoekema, 1985; Knauf, et al., 1983; and An et al., 1985). For introduction into plants, the chimeric genes of the invention can be inserted into binary vectors as described in the examples. Those skilled in the art will appreciate that the selection of the method should depend on the type of plant, that is, monocotyledonous or dicotyledonous, that is desired to be transformed. Suitable methods for transforming plant cells include, but are not limited to, microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrobacterium-mediated transformation (Hinchee et al., 1988), direct transfer of genes (Paszkowski et al., 1984) and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wis. and BioRad, Hercules, Calif. (see, for example, Sanford et al., US Patent No. 4,945,050; and McCabe et al., 1988). See also Weissinger et al., 1988; Sanford et al., 1987 (onion); Christou et al., 1988 (soybean); McCabe et al., 1988 (soybean); Datta et al., 1990 (rice); Klein et al., 1988 (corn); Klein et al., 1988 (corn); Klein et al., 1988 (corn); Fromm et al., 1990 (corn); and Gordon-Kamm et al., 1990 (maize); Svab et al., 1990 (tobacco chloroplast); Koziel et al., 1993 (corn); Shimamoto et al., 1989 (rice); Christou et al., 1991 (rice); European patent application EP 0 332 581 (dactylis and other Pooideae); Vasil et al., 1993 (wheat); Weeks et al., 1993 (wheat). In another embodiment, 2588723 of 106 the protoplast transformation method for corn is used (European patent application EP 0 292 435, US patent No. 5,350,689). In another embodiment, a nucleotide sequence of the present invention is directly transformed into the plastid genome. The plastid transformation technology is widely described in US Patent Nos. 5,451,513, 5,545,817 and 5,545,818, in PCT application no. WO 95 / 16783 and in McBride et al., 1994. After transformation, plants are preferentially selected using a dominant selectable marker incorporated into the transformation sector. Typically, such a marker will confer antibiotic or herbicide resistance to transformed plants and selection of transformers can be achieved by exposing the plants to appropriate concentrations of antibiotic or herbicide. After the transformed plants or cells are selected and grown to maturity, plants displaying the trait of interest are identified. The trait can be any of the traits described above. Additionally, to confirm that the trait of interest is due to the expression of the polynucleotide of interest introduced under the control of the regulatory nucleotide according to the invention, the expression levels or activity of the polypeptide or polynucleotide of interest can be determined by analyzing mRNA expression using Northern blot, RT-PCR or microassays, or protein expression using immunoblot or Western blot or enzyme activity assays. Thus, the invention relates to plant cells and tissues, to plants derived from these cells and tissues, respectively, to plant material, to progeny and seeds derived from those plants, and to agricultural products, including products of processed plant with better properties obtainable through, for example, any of the transformation methods described below. Once an expression cassette in accordance with the present invention and as described herein comprising a regulatory sequence in accordance with the invention in association with a polynucleotide of interest has been 2588723 of 106 transformed into a particular plant species, can be propagated in that species or migrate to other varieties of the same species, particularly including commercial varieties, using traditional genetic improvement methods. Preferred plants of the invention include gymnosperms, monocotyledons and dicotyledons, especially agriculturally important crops, such as rice, wheat, barley, rye, rapeseed, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory. , lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, zucchini, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach , nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soy, tobacco, tomato, sorghum and sugar cane. The engineered genetic properties in the described transgenic plants are transmitted by sexual reproduction or vegetative growth and in this way can be maintained and propagated in the progeny plants. Generally, maintenance and propagation make use of methods known in agriculture developed to suit specific purposes such as tillage, sowing or harvesting. Specialized processes such as hydroponics or greenhouse techniques can also be applied. The use of the advantageous genetic properties of the transgenic plants according to the invention can further be applied in the genetic improvement of plants aimed at the development of plants with better properties such as tolerance to pests, herbicides or stress, a better value nutritional, higher performance or better structure causing fewer losses due to overturning or breakage. The different stages of genetic improvement are characterized by a well-defined intervention by humans in the selection of the lines to be crossed, the direction of pollination of the parental lines or the selection of suitable progeny plants. Depending on the desired properties, different genetic improvement measures are taken. Relevant techniques are widely known in the art and include, but are not limited to, hybridization, inbreeding, cross-breeding, multi-line breeding, mixing of 2588723 of 106 varieties, interspecific hybridization, aneuploid techniques, etc. Hybridization techniques also include sterilization of plants to produce sterile male or female plants by mechanical, chemical or biochemical means. Cross-pollination of a male-sterile plant with pollen from a different line ensures that the genome of the male-sterile plant and the fertile female plant uniformly obtain the properties of both parental lines. In this way, the transgenic plants according to the invention can be used for the genetic improvement of improved plant lines that, for example, increase the effectiveness of conventional methods such as herbicide or pesticide treatment or allow these methods to be discarded thanks to their improved genetic properties. . Alternatively, new crops with improved stress tolerance can be bred that, thanks to their improved genetic characteristics, produce a higher yield than plants that could not tolerate comparable adverse developmental conditions. In one embodiment of the invention, the plant expresses and has been transformed with a nucleotide sequence encoding a polypeptide or protein a polypeptide product that encodes a polypeptide product that exhibits insecticidal activity, particularly an endotoxin from Bacillus thuringiensis in most tissues. of the plant but essentially excluding the pollen and / or spike tissues so that there is no expression product present in said tissues in a significant way, where the nucleotide sequence is not transcribed to a significant extent. Thus, essentially no expression occurs in the pollen and / or spike tissue and only residual amounts, if any, can be detected in such tissues, which is not sufficient for the expression product to fulfill its intended biological function in said tissues or exhibit any toxic effect against insects that feed on those tissues or against the plant itself. In one embodiment, the concentration of the expressed polypeptide product of the protein-encoding polynucleotide of interest in the pollen and / or spike tissues is such that no insecticidal activity can be detected in an assay. 2588723 of 106 standard insect feeding. In one embodiment of the invention, the concentration of the expression product in pollen is less than the base level of about 10 ng / mg soluble protein, particularly about 5 ng / mg soluble protein, more particularly 3 ng / mg protein. approximately soluble, but especially 2 ng / mg soluble protein or less. The invention also provides methods for preparing expression cassettes comprising the regulatory sequence according to the invention comprising joining an expressible polynucleotide encoding a polypeptide or protein of interest to the regulatory sequence according to the invention and as described herein to obtain an expression construct, wherein the polynucleotide of interest is linked or operatively associated with the regulatory sequence such that the expression of the polypeptide or protein of interest is mediated by the regulatory sequence according to the invention and results in the expression of said polypeptide or protein of interest in essentially all plant tissues, but essentially excludes expression in the tissues of the reproductive structures of plants, particularly in pollen and / or spike tissues such that there is no expression product present in said tissues in a significant way. In one embodiment, the invention relates to a method for producing a transgenic plant that expresses a DNA sequence of interest in tissue other than pollen but not, substantially or entirely, in pollen and / or spike tissues, which understands a) transforming an expression cassette according to the invention and as described herein into a plant cell comprising a nucleotide regulatory sequence, which at least in part has a transcription initiation function that mediates the expression of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding pollen and / or spike tissues so that no expression product is significantly present in those tissues; and 2588723 of 106 b) regenerating the plant cell transformed in step a) into a plant. In one embodiment, the invention relates to a method for controlling target insect pests that feed on vegetative plant tissue such as the leaf, stem and root and / or reproductive tissues such as the cob, but which protects the pests. that are not target that feed on pollen, which includes a) growing a plant in accordance with the invention and as described herein in an area infested by the target pest; b) expressing a polypeptide or protein that is capable of controlling said target pest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention relates to a method for protecting the reproductive tissues of a plant, particularly the pollen and / or spike tissues against damage caused by the expression in said tissues of a polypeptide or protein of interest, comprising a) cultivating a plant in accordance with the invention and as described herein; b) expressing a polypeptide or protein of interest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention relates to the use of a regulatory sequence in accordance with the present invention and as disclosed herein to control target insect pests that feed on vegetative plant tissue such as leaf, stem and root and / or of reproductive tissues such as the cob, but that protects non-target pests that feed on pollen, which includes a) growing a plant in accordance with the invention and as described herein in an area infested by the target pest; b) expressing a polypeptide or protein that is capable of controlling said target pest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the present invention relates to the use of a regulatory sequence in accordance with the present invention and as disclosed in 71 2588723 of 106 present to protect the reproductive tissues of a plant, in particular the pollen and / or spike tissues against damage caused by the expression in said tissues of a polypeptide or protein of interest that expresses said polypeptide or protein of low interest controlling a regulatory sequence in accordance with the invention and as described herein. 2588723 of 106 EXAMPLES The following Examples present illustrative embodiments. In light of the present description and the general level of skill in the art, those skilled in the art may appreciate that the following Examples are presented by way of example only and that numerous changes, modifications and alterations may be employed without departing from the scope of the content contained herein. claimed herein. All manipulations and techniques necessary to construct and propagate the strains described in the invention are known to those skilled in the art. Technical details are described, for example, in Ausubel et al 1995; Sambrook, J, 2001 and Miller, J.H. 1992 and in the relevant publications cited in the invention. Example 1: Expression in tissues other than pollen Example 1.1 Identification of ZmABP3 In a maize expression profiling experiment, a maize developmental array search was performed on a Zea mays Affymetrix chip (Zm80K) for probes that had strong signals in all samples, but none or substantially none in the pollen sample. . All green and root tissue samples were compared directly to pollen and probes representing polynucleotides that did not meet the target expression profile were removed. The analysis produced two sets of results. The first set contains 36 probes representing polynucleotides that had high expression in tissue samples, but very low expression in pollen. The second set contains 10 probes representing polynucleotides that had high expression in the tissue samples, but none in the pollen. Alignment of the probe sequence with the maize cDNA cluster data sets indicated that all 46 represented bona fide maize genes. The 2588723 of 106 top probes are those that have the strongest signal in all tissues other than pollen and no signal at all in pollen (see Table A). Application of additional criteria including determination of genomic DNA (gDNA) and cDNA sequence availability for each track produced Zm07728_s_at as the top candidate that met all promoter development requirements. Literature analyzes revealed that this probe represents the gene encoding actin-binding protein 3 (ZmABP3), which is a member of a small gene family that has been characterized previously (Lopez et al., 1996). The gene product has also been called actin depolymerization factor 3. Lopez et al (1996) confirms in Figure 3 that ZmABP3 has high expression in most plant tissues examined, except in pollen samples. Lopez et al (1996) also demonstrated by southern analysis that there are two ABP3 genes in the maize genome. The ZmABP3 cDNA they report is GenBank accession X97726 and corresponds to TIGR accession TC248585. This gene was designated ZmABP3-A. Both ZmABP3 genes are represented on the maize Affymetrix chip (Zm80K): ZmABP3-A corresponds to the probe Zm007595_at and ZmABP3-B corresponds to Zm07728_s_at. The sequence 'Zm07728_s_at' was used to identify TC248588 in the TIGR database, and MAIZE.974.CB1 in a maize cDNA cluster database. It also identified the gDNA sequences MAGI_93606, MAGI_93607, AZM4_39177, ZmGSStuc11-12-04.2725.1, ZmGSStuc11-12-04.2725.2 and CC463190. The ZmABP3-A and ZmABP3-B cDNAs encode proteins that are identical to all residues except one. The expression profiling data indicate that ZmABP3-B is highly expressed in most plant tissues, but essentially excluding pollen tissues such that no expression product is significantly present in all tissues. ZmABP3-A is not highly expressed. SEQ ID NO: 16 shows that the ZmABP3-B mRNA is encoded in 3 exons. The two intervening sequences (introns) are between the expected GT...AG border nucleotides. More specifically, SEQ ID NO: 16 presents the design of the ZmABP3 expression cassette. The regulatory components of ZmABP3 that are 2588723 of 106 to be included in the construct are 2.3 kb of 5' sequence (prZmABP3-01) containing 1.1 kb of 5'-untranscribed sequence, 0.25 kb of 5'-untranslated sequence and 0.98 kb representing ZmABP3-B-intron 1; and 1,013 kb of 3' sequence (tZmZBP3-01) starting just after the translational termination codon of ABP3-B. This includes about 0.3 kb of 3' untranslated region and 0.7 kb of untranscribed sequence. 2588723 of 106 Table A shows a summary of the 10 candidate probes that represent polynucleotides with a high level of expression in all maize tissues but have no expression signal in pollen. Probe name Reference gene description Pollen expression Average expression (all tissues) Zea mays Coinc. TIGR AF032370_at Profilina Zea mays, (PRO4) mRNA, cds. comp. absent 4208 TC269677 Ctrl_ZmU45855- 3_at 808 to 1307 glyceraldehyde-3phosphate dehydrogenase GAPC2 (gpc2), mRNA, cds. comp. absent 4275 TC269361 Zm001747_s_at Similar to CAA63903.1 Pennisetum glaucum; calorie shock protein 17.9; P,glaucum mRNA for heat shock protein, HSP 17.9 absent 4945 TC268849 Zm005803_s_at Similar to AAB99745.1 Triticum aestivum; HSP70; Triticum aestivum 70 kDa heat shock protein (TaHSP70d) mRNA, cds. comp.; 70 kDa heat shock protein, molecular escort absent 4091 TC247918 Zm007728_s_at Similar to SW:ADF3_MAIZE Q41764 zea mays (maize), actin depolymerizing factor 3 (adf absent 4805 TC248588 2588723 of 106 3) (zmabp3) (zmadf3), Zm009722_s_at Similar to BAC22420.1 Oryza sativa (japonica cultivar group); ; Oryza sativa (japonica cultivar group) genomic AND, chromosome 7, PAC clone:P0453E03; contains ESTs C96778(C10671),D22278(C10671) unknown protein absent 3306 TC248975 Zm015335_s_at Similar to SW:RS5A_ARATH Q9zut9 arabidopsis thaliana (Arabidopsis thaliana), 40s protein s5-1,2 / 2003 absent 3598 TC269022 1004_s_at Similar to AAD39835.1 Arabidopsis thaliana ; Ran binding protein siRanBP; Arabidopsis thaliana Ran-binding protein (siRanBP) mRNA, cds. comp.; atranbp1a homolog absent 3092 TC269986 Zm058948_s_at No description absent 4337 TC270333 Zm061393_s_a No description =sucrose synthase absent 6509 TC258905 Example 1.2 Cry1AbG6 Construction Cry1AbG6 (2814 bp) is a modified version of the full-length CrylAb gene (pNOV1321, 3546bp). The Geiser sequence (81 bp of 43984478 in pNOV1321) and the 3' terminus (651 bp of 4908-5558 in pNOV1321) were deleted. The Cry1AbG6 sequence was constructed from pNOV1321 (source vector for the full-length Cry1Ab gene) as follows: DNA was cut 2588723 of 106 pNOV1321 plasmid with BamHI / SacI. The full-length CrylAb gene (3546bp, named Michigan) was gel purified and ligated into pTrcHisB expression vector (In vitrogen life technologies, Cat# V36020), which was cut with BamHI / SacI. This construct was named Michigan-pTrcHisB. The Geiser sequence (81bp) was removed from Michigan-pTrcHisB by overlapping PCR with the following primers: 5' Bfr1 (5'-cctggtggagtgcttaagcgacgagttctgcctgg-3'), (SEQ ID NO: 83) 3' ') (SEQ ID NO: 86). PCR product A was prepared using high-fidelity PCR with MichiganpTrcHisB as template and primers 5' Bfr1 and 3' Gfix. PCR product B was prepared using high-fidelity PCR with Michigan-pTrcHisB as template and primers 5' Bfr1 and 3'Xba1. The final PCR used products A and B as templates and primers 5'Bfr1 and 3'Xba1. The final PCR band was digested with AflII / XbaI and gel purified. This fragment was ligated with Michigan-pTrcHisB that had also been digested with XbaI / AflII. The correct recombinant DNA product was identified by AflII / XbaI digestion analysis. This construct was named Cry1Ab-G. A second PCR construct was prepared by high-fidelity PCR using pNOV1321 as a template, primer 5'1Ab5XbaI (5'gcccgcctgggcaatctagagttcctggaggag-3') depicted in SEQ ID NO: 87 and reverse primer 3'1Ab3d6 (5' -gcgagctcctagatgcggccctcgagttcctcgaaga-3') which is represented in SEQ ID NO: 88. The PCR product was digested with XbaI / SacI and ligated to Cry1Ab-G which was also digested with XbaI / SacI. The correct recombinant DNA product was identified by BamHI / SacI restriction analysis. This construct was named Cry1AbG6. The Cry1AbG6 sequence was subjected to QuikChange mutagenesis to remove an internal NcoI site. The 25 pL reaction contained pL of Cry1AbG6 standard, 2.5 pL QuikChange 10X buffer, 2588723 of 106 pL of QuikChange dNTP mix, μL of cy2' (5'-Pccctgtacggcacgatgggcaacgctgca-3'; SEQ ID NO: 89) 20 μΜ, 0.75 μL of Quik solution and μL of QuikChange DNA polymerase. The thermocycling program was 95°C for 5 minutes followed by 30 cycles of 95°C for 1 minute, 55°C for 1 minute, and 65°C for 20 minutes. The product was processed as described by the manufacturer (Stratagene) and completely sequenced. The Cry1AbG6 coding sequence was amplified from a mutagenized plasmid template, above, in 50 μL of a Pfu turbo DNA polymerase reaction (Stratagene) containing μL of template, μL of 10X Pfu buffer, μL of 10 mM dNTP mix, μL of cy1 (5'-atatatccaccatggacaacaaccccaaca-3'; SEQ ID NO: 90) 20 μΜ, 1 μL of cy2 (5'-tatatagagctcctagatgcggccctcgagt-3'; SEQ ID NO: 91) 20 μΜ and μL of Pfu turbo DNA polymerase . The thermocycling program was 95°C for 2 minutes followed by 40 cycles of 95°C for 1 minute, 50°C for 1 minute, and 72°C for 7 minutes. The final extension step was 72°C for 15 minutes. The 2.8 kb reaction product was gel purified on 1% TAE agarose and DNA was extracted using the Qiaprep DNA extraction method. The recovered DNA was digested with NcoI / SacI and ligated with pNOV6901 vector which was also digested with NcoI / SacI. The operation replaced the GUS coding sequence in pNOV6901 with Cry1AbG6. The Cry1AbG6 sequence is presented in SEQ ID NO: 15. Example 1.3 Construction of the ZmABP3 expression cassette An inclusive design strategy was used to develop the ZmABP3 expression cassette. The cassette contains 2.3 kb of 5' sequence consisting of 1.1 kb of 5' untranscribed sequence, 0.25 kb of 5' untranslated region and 2588723 of 106 0.98 kb representing ZmABP3-intron 1. The natural translation start codon was silenced to move it to the second exon. The expression cassette also contains 1,013 kb of 3' sequence starting just after the ABP3 translational stop codon. This includes approximately 0.3 of 3' untranslated region and 0.7 kb of untranscribed sequence, and functions as the transcription terminator and polyadenylation signal. The ZmABP3 terminal was amplified from maize cDNA template in 50 pL of a Proofstart DNA polymerase reaction (Qiagen) containing pg of gDNA, pL of 10X Proofstart buffer, 1.5 pL of 10 mM dNTP mix, 2.5 pL of P3 (5'-tatatagagctcgcatcatgatcatgcatcatggact-3'; SEQ ID NO: 9) 20 μΜ, 2.5 μL of P4 (5'-atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-3'; SEQ ID NO: 10) 20 μΜ, μL of Quik solution and μL of Proofstart DNA polymerase. The thermocycling program was 95°C for 5 minutes followed by 45 cycles of 94°C for 30 seconds, 50°C for 1 minute, and 72°C for 4 minutes. The final extension step was 72°C for 15 minutes. The 1 kb reaction product was gel purified on 1% TAE agarose and DNA was extracted using the Qiaprep DNA extraction method. DNA was precipitated with ethanol, recovered in 4 μL of ddH2O, and cloned into the pCR4-TOPO-Blunt vector. The ZmABP3 terminus was modified to remove the Ncol internal restriction site using the Stratagene QuikChange Multi-site mutagenesis package. The 25 μL reaction contained μL of pCR4-TOPO-ZmABP3-terminal, 2.5 μL 10X QuikChange Buffer, μL QuikChange dNTP Mix, μL Tnco (5'-Pgtaaaaaaaggtcccttggctcccagaaga-3'; SEQ ID NO: 11) 20 μΜ, μL T2 (5'-Pcaatgtgttagactgacgtg-3'; SEQ ID NO: 12) 20 μΜ, 0.75 μL of Quik solution and μL of QuikChange DNA polymerase. 2588723 of 106 The thermocycling program was 95°C for 5 minutes followed by 30 cycles of 95°C for 1 minute, 50°C for 1 minute, and 65°C for 15 minutes. The product was processed as described by the manufacturer (Stratagene) and completely sequenced. The ZmABP3-terminal sequence is depicted in SEQ ID NO: 14. The ZmABP3 promoter was amplified from the maize cDNA template in 50 pL of a Proofstart DNA polymerase reaction (Qiagen) containing pg of gDNA, pL of 2X Hotstart Master Mix, 1.25 pL of P1 (5'-atatatgcatgcggcgcgccgaaagtagcaaacaacaggttcatgtgcac-3'; SEQ ID NO: 1) 20 μΜ, 1.25 μL of P2 (5'-tatataccatggtgggtttgcctgcgaccacaagttca-3'; SEQ ID NO: 2) 20 μΜ, 10.5 μL of Quik solution and μL of 25 mM MgCl2. The thermocycling program was 95°C for 15 minutes followed by 45 cycles of 94°C for 1 minute, 64°C for 1 minute, and 72°C for 5 minutes. The final extension step was 72°C for 15 minutes. The 2.3 kb reaction product was gel purified on 1% TAE agarose and DNA was extracted using the Qiaprep DNA extraction method. DNA was precipitated with ethanol, recovered in 4 μL of ddH2O, and cloned into the pCR4-TOPO vector. The ZmABP3 promoter was modified in a series of QuikChange reactions as detailed above and using the following oligonucleotides: Patg (5'-cagctcgcccgagttggtaaggccccct-3'; SEQ ID NO: 3), Pnco (5'-acagattagtccatcgcccacggt-3'; SEQ ID NO: 4), ADPc-1 (5'-agccctgtccatgacggcccaagcaac-3'; SEQ ID NO: 5), ADPc-2 (5'-agtagcaattcggtaggcacaggcac-3'; SEQ ID NO: 6), ADPc-4 (5' -tctatggtctgcgaggtgcggtggc-3'; SEQ ID NO: 7), and adp3-a (5'-gtccccttcttcgccgcgccagctcgc-3'; SEQ ID NO: 8). The ZmABP3-terminal sequence is depicted in SEQ ID NO: 13. 2588723 of 106 The terminal of ZmABP3 was ligated with the vector pNOV6901-Cry1AbG6 (from example 2) as a SacI / SpeI fragment. Subsequently, the ZmABP3 promoter was ligated to the vector as a SphI / NcoI fragment. This produced the ZmABP3Cry1AbG6 assembly, which is represented in SEQ ID NO: 37. This complete ZmABP3-Cry1AbG6 expression cassette was transferred into a binary vector, pNOV6900, as an AscI fragment. These constructs, ZmABP3-Cry1AbG6-6900 and ZmABP3Cry1AbG6-enhanced binary, are represented in SEQ ID NOS: 38 and 39, respectively. The only difference between these vectors is the presence of the CaMV-FMV dual enhancer in the enhanced ZmABP3-Cry1AbG6-binary. Both were transferred to maize by Agrobacterium-mediated transformation. 2588723 of 106 Example 1.4 Construction of ZmABP3-AmCyan The Cry1AbG6 coding sequence was excised from the ZmABP3Cry1AbG6 assembly as an NcoI / SacI fragment. It was replaced with the coding sequence of the AmCyan reporter gene that was excised from plasmid 13718 as an NcoI / SacI fragment. This produced the ZmABP3-AmCyan assembly, which is depicted in SEQ ID NO: 40. The ZmABP3-AmCyan expression cassette was transferred into a binary vector, pNOV6900, as an AscI fragment. This construct, ZmABP3-AmCyan-binary, is represented in SEQ ID NO: 41. It was transferred to corn by Agrobacterium-mediated transformation. Example 1.5 Expression of ZmABP3-AmCyan in transgenic corn Several events were produced from transgenic maize containing the ZmABP3-AmCyan expression cassette. Those containing a single copy of the transgene and no non-predicted vector sequences were analyzed. All transgenic events accumulated AmCyan transcript in leaf tissue (data not shown). Several tissues from a representative event were examined for AmCyan transcript accumulation. Total RNA was prepared using the Plant RNAeasy Total RNA Isolation System (Qiagen). Total pollen RNA was prepared using the method described by Shirzadegan et al (1991). The quality of the preparation was evaluated by UV spectrometry, 10 pg of total RNA per sample was resolved in 1% formaldehyde gel and transferred to Nytran SuPerCharge membrane following the recommended protocol (Schleicher & Schuell). The blot was hybridized to a randomly primed 32P-labeled AmCyan DNA probe using stringent conditions. The results clearly indicate that ZmABP3 promotes transcription in spike, leaf, silk, ear, and root tissue, but does not promote transcription in pollen. Example 1.6 Expression of ZmABP3-Cry1AbG6 in transgenic corn Several events were produced from transgenic maize containing the ZmABP3-Cry1AbG6 expression cassette. Those containing a single copy of the transgene and no non-predicted vector sequences were analyzed. The T0 events were evaluated to detect insecticidal activity with respect to the caterpillar of the 2588723 of 106 cob twice in the course of development. The first samples were taken in V2-V4 and the second ones were taken in V7-V9. Leaf discs were cut from the tips of the lower leaves and placed on water-moistened Whatman paper in 47 X 10 mm petri dishes. Twenty-two L1 earworm or European corn borer larvae were added to each disc and incubated for 48 hours at 28°C. Leaf discs were analyzed for damage done by insects. Samples showing no significant leaf damage and absolute mortality were scored positively and those with visible damage negatively. The data obtained indicate that several transgenic events with activity against both insects were identified. Cry1AbG6 protein accumulation in T0 plants was also measured using enzyme-linked immunosorbent assay (ELISA) with a fully truncated CrylAb standard. The first trial was carried out on seedling tissue, with samples taken between 1 and 2 weeks after transfer to soil. The second assay was performed on leaf tissue from maturing plants and samples were taken just before the transition to reproductive development. The data in Table B show the change in Cry1AbG6 protein accumulated in the plants with insecticidal activity. The data indicate that plants require almost 50 ng (or more) of Cry1AbG6 protein / mg of extractable protein to have insecticidal activity. Table B shows the insect control characteristics of greenhouse-grown plants. 2588723 of 106 Corn Cob Cassette Description Cry1AbG6 Caterpillar Activity Event Number (ng / mg extractable protein) Adult Seedling V2-V4 V7-V9 ECB Activity V7-V9 1 ABP3-Cry1Abg6 63 79 + + + 2 ABP3-Cry1Abg6 54 56 + + + 3 ABP3-Cry1Abg6 85 108 + + + 4 ABP3-Cry1Abg6 67 94 + + + 5 ABP3-Cry1Abg6 45 83 + + / - + / - 6 ABP3-Cry1Abg6 68 120 + + + 7 ABP3-Cry1Abg6 133 159 + + + 8 ABP3-Cry1Abg6 96 46 + + + 9 ABP3-Cry1Abg6 138 101 + + + 10 ABP3-Cry1Abg6 131 100 + + + 11 ABP3-Cry1Abg6 94 65 + + + 12 ABP3-Cry1Abg6 111 59 + + + 13 ABP3- Cry1Abg6 139 60 + + + 14 ABP3-Cry1Abg6 121 81 15 ABP3-Cry1Abg6 66 55 + + + 16 ABP3-Cry1Abg6 130 95 + + + Leaf tissue from T0 plants was tested for Cry1AbG6 protein by ELISA using truncated CrylAb protein as a standard. 2588723 of 106 the activity of the ear caterpillar and the activity of the European corn borer. At the top of each column is the stage of plant development when the samples were taken. Samples were taken from the oldest (lowest) leaf. For insect assays (+) indicates no visible leaf damage and complete and absolute mortality of insects. (-) represents visible damage to the blade. Example 1.7 Efficacy of ZmABP3-Cry1AbG6 events against European corn borer in the field Efficacy studies against the European corn borer were conducted in Stanton, MN (SMN) and Bloomington, IL (BIL) during the 2006 growing season. Near-isogenic hybrids comprising the ABP3-Cry1AbG6 events were evaluated. indicated in Table C, Bt11, and a non-transgenic control hybrid. The experimental design was random blocking with three repetitions at each location. One plot consisted of a 5.31 m long row containing 25 plants, with a spacing of 0.76 m between rows. 2588723 of 106 Table C shows the performance of ZmABP3-Cry1AbG6 corn in field studies. Test Place Type test MG371 BIL ECB MG331 SMN ECB Event Descr. Cassette number ECBLR ECBKN ECBSN Sheet CEBSN Maz. Stem Feeding Ped. Feed Feed Rating (cm) (cm) (cm) ECBLR ECBKN ECBSN Sheet CEBSN Maz. Food Stem Ped. Feed Feed Rating (cm) (cm) (cm) 1 ABP3- Cry1Abg6 1.0 0.00 1.42 0.00 1.1 0.00 0.00 0.30 2 ABP3- Cry1Abg6 1.0 0 .00 1.42 0.08 1.0 0.00 0.15 0.10 3 ABP3- Cry1Abg6 1.0 0.00 1.25 0.08 1.0 0.00 0.00 0.80 4 ABP3 - Cry1Abg6 1.0 0.00 1.57 0.00 1.0 0.10 0.51 1.10 5 ABP3- Cry1Abg6 1.0 0.00 1.25 0.04 1.0 0.00 0, 07 0.20 6 ABP3- Cry1Abg6 1.0 0.00 1.08 0.00 2588723 of 106 7 ABP3- Cry1Abg6 1.0 0.00 1.31 0.00 1.1 0.10 0.45 0.80 8 ABP3- Cry1Abg6 1.0 0.04 2.00 0.08 1.1 0.00 0.00 0.30 9 ABP3- Cry1Abg6 1.0 0.00 0.92 0.00 1.3 0.00 0.00 0.10 10 ABP3- Cry1Abg6 1.0 0.00 1.42 0.04 1.2 0.00 0.00 0.40 11 ABP3- Cry1Abg6 1.0 0.13 1.17 0.00 1.0 0.00 0.00 0.10 12 ABP3- Cry1Abg6 1.0 0.00 1.62 0.08 1.1 0.00 0.17 0.30 13 ABP3- Cry1Abg6 1.0 0.00 1.29 0.00 1.2 0.00 0.00 0.20 14 ABP3- Cry1Abg6 1.0 0.00 1.10 0.13 1.0 0.00 0.07 0.10 15 ABP3- Cry1Abg6 1.0 0.08 1.33 0.04 1.1 0.00 0.24 0 .20 16 ABP3- Cry1Abg6 1.0 0.00 1.33 0.21 1.0 0.00 0.00 0.10 Bt11 1.0 0.00 2.75 0.00 1.3 0.00 0 .00 0.00 Vr. negative 7.0 0.21 3.00 4.67 4.3 0.40 5.80 13.50 Rep with data 3 3 3 3 3 3 3 3 Loc with data 1 1 1 1 1 1 1 1 Design ut. RCB RCB RCB RCB RCB RCB RCB RCB LSD (5%) EE generak 0.149 0.923 0.257 0.399 0.200 1.988 0.650 2588723 of 106 LSD (5%) Negative Excl, 0.158 0.936 0.255 0.397 0.181 0.505 1.391 CV% 242.21 38.47 72.14 20.10 292.75 138.76 120.87 % probability 0.90 0.09 0.00 0 .00 4.10 0.00 0.00 Two studies were conducted in Bloomington, IL (BIL) and Stanton, MN (SMN) in 2006. Various ZmABP3-Cry1AG6 events were compared with positive and negative references represented by and Bt11 and Negative Verification, respectively. Newly hatched European corn borer larvae were produced in a laboratory colony in accordance with the principles established in Guthrie (1989) in an entomological laboratory located in Slater, IA. The eggs were incubated at approximately 28°C and a relative humidity of approximately 80%, and the hatchlings were collected from the incubation containers approximately 6 hours after each hatch. The larvae were healthy and vigorous when placed on the plants, as evidenced by their movement. Two types of European corn borer (ECB) application were carried out: ECB1 was applied at approximately the V6-V8 leaf stage and ECB2 was applied in pollen spray. Applications were made with the BioServe Davis Inoculator using 1 ml of corn cob grits per application. For ECB1 (first generation ECB infestation) a total of approximately 150 larvae were placed on the central stem of each plant, in clumps of corn cob. Two to four applications were made, with one to six days between applications. The first plant in the row was not treated and up to 10 consecutive plants were infested. For ECB2 (second generation ECB infestation) a total of approximately 200 larvae per plant were applied, which were placed at the petiole junction of the ear and the petiole junctions directly above or below the ear, in corn cob clumps. . Four applications were made, with 2588723 106 one to six days between applications. Up to 10 consecutive plants were infested at the opposite end of the ECB1-treated row. The last plant in the row was left untreated. The following observations were recorded. For ECB1, up to six consecutive infested plants were evaluated in the row for ECB foliar damage (ECBLR in Table C) at least 14 days after the first infestation. The Guthrie scale of 1-9 was used (Guthrie et al. (1960) and a score, the average of the plants evaluated, was recorded in each plot. For ECB2, about 45 days after the plants were infested, up to 8 consecutive plants infested at the opposite end of the furrow from the ECB1 evaluations were dissected to evaluate the ear stalk, ear kernel and stem feeding, measuring feeding tunnel lengths (cm). ECB2 data were subjected to analyzes of variance appropriate for a randomized complete blocking design. Replications were considered random while other effects were considered fixed. The mean separation was prepared using the least significant difference (LSD) procedure, but only if the F test for entries was significant at the usual 5% level of significance. As there was no variability between events in the ECB1 data, an analysis of variance was not performed for this trait. The data and analysis are summarized in Table D. Overall, the data indicate that ZmABP3Cry1ABG6 offers protection against ECB in a manner similar to that observed in the Bt11 material. Table D shows the amount of Cry1AbG6 protein in transgenic corn tissue. The youngest developing leaf was evaluated for Cry1AbG6 by ELISA at 5 developmental stages (V5-V6, V8, V10, R1, R3-R4) for each plant. Cry1AbG6 was also measured in pollen. Events 5, 12, 15 and 16 express the ABP3-Cry1AbG6 construct and events A-D express the enhanced ABP3-Cry1Ab construct. Data shown are mean ± SD (n=8-10). 2588723 of 106 V5-V6 V8 Development stage V10 R1 R3-R4 Pollen Event 5 39(3.8) 38(2.7) 61(8.2) 75(5.3) 60(3.5) 1.5(0 .14) Event12 61(5.2) 32(1.9) 50(6.1) 44(5.1) 49(4.4) 1.4(0.39) Event 15 45(4.5) 45(4.8) 46(4.8) 38(7.4) 55(5.4) 1.0(0.14) Event16 58(5.4) 30(2.9) 47(5.3) ) 53(7.2) 44(4.6) 1.2(0.17) Event A 260(24) 190(22) 250(18) 200(21) 150(14) 1.3(0.19 ) Event B 260(22) 227(29) 240(30) 200(23) 150(76) 1.6(0.30) Event C 310(31) 210(26) 270(26) 150(15) 160 (16) 1.9(0.31) Event D 310(30) 180(23) 240(15) 170(26) 150(18) 1.4(0.19) Example 1.8 Use of the ZmABP3 expression cassette to improve drought tolerance in maize A deregulated form of an Arabidopsis H+pyrophosphatase (AtAVP1D) has been shown to improve drought tolerance when overexpressed in several plants (Gaxiola et al., 2001; Park et al., 2005). Improved performance is made possible by elevated expression in the plant. To demonstrate the utility of AtAVP1D in improving drought tolerance in maize, a coding sequence optimized for maize was synthesized. The sequence of the synthetic AtAVP1D gene is shown in SEQ ID NO: 16. It was ligated to the ZmABP3 expression cassette as an NcoI / SacI fragment. The vector map shown in SEQ ID: 42 illustrates the ZmABP3-AtAVP1D expression cassette. The complete ZmABP3-AVP1D expression cassette was excised from the array vector as a SanDI / RsrII fragment and ligated to the RsrII site of the 2588723 of 106 Agrobacterium binary vector, 15289. A map of the construct is depicted in SEQ ID NO: 43. Example 1.9 Measurement of Cry1AbG6 in corn tissue Hybrid T1 seeds (in background ID5829 / AX5707) were produced for several ZmABP3-Cry1ABG6 events in a Syngenta field located in Bloomington, IL. Several seeds were germinated in 5 cm pots. Seedlings were evaluated for transgenic heterozygousness and only hemizygotes were retained. A minimum of 8 plants per event were transplanted into 11-liter pots and grown in a temperature-controlled greenhouse. Leaf tissue samples were taken from each plant and assayed for the Cry1AbG6 protein at the 5 developmental stages V5-V6, V8, V10, R1 and R3-R4 (Ritchie et al., 1997). Pollen was also collected and assayed for Cry1AbG6 protein. At each stage, leaf tissue samples (minus the collar, axis and sheath) were taken from the youngest expanding leaf. Duplicate samples were sprayed into 96-well blocks. The powder was suspended in 500 pL-1 mL of extraction buffer (0.1 M sodium borate, 0.5% Tween 20, 0.2% polyvinylpyrrolidone, 0.05% sodium azide and cocktail tablets of 1X protease inhibitor (Roche)). The mixture was clarified by centrifugation and soluble protein was quantified using the BCA assay. Fresh pollen was collected in 1.5 mL Eppendorf tubes. 3 mm glass beads were added to each tube and samples were frozen at −80°C. The samples were pulverized on a horizontal oscillator at 600rpm. The protein was extracted by adding 500 pL-1 mL of extraction buffer and incubating at 4°C for 30 minutes. The samples were clarified by centrifugation at 4°C and the soluble protein in each sample was quantified by BCA assay. Samples were normalized for protein content and Cry1AbG6 was quantified by ELISA using fully truncated Cry1Ab as a standard. Each data point is the average of duplicate measurements, 2588723 of 106 taken at a different dilution of total protein. Data for each event are reported as mean ± SD for all relatives. The results in Table D show that the ZmABP3-Cry1AbG6 cassette produces stable Cry1AbG6 protein in the leaf tissue throughout development. Some reduction of CryAbG6 protein is evident as the vegetative tissue begins to age (R3-R4). Also evident is the 3-5-fold increase in Cry1AbG6 accumulation in events that also have the CaMV-FMV dual-enhancer complex. Finally, the data show that there is virtually no detectable Cry1AbG6 protein in the pollen. Across all CryAbG6 events, on average, it accumulates no less than 1.5 ng / mg of total soluble protein. Furthermore, the dual-enhancer complex does not influence the accumulation of Cry1AbG6 in pollen; is identical between all events. This is consistent with our data indicating that ZmABP3 is not transcribed in pollen (Example 5). We concluded that detectable Cry1AbG6 in pollen was possibly produced in the microspore mother cells or their progenitors and delivered to the pollen through cell division. EXAMPLE 2: Expression not present in the spike Example 2.1 Identification of ZmABT 2.1.1 Expression profiling experiment: A series of experimental corn on the Zm80K Affymetrix chip were searched for probes that had strong signal in all samples and had low or no signal in spike samples. Twenty-three probes were identified representing polynucleotides that met the expression criteria. To fully represent the differential expression signal between the spike samples and other tissue samples, the mean signal ratio for the other samples and the spike were calculated for each test. This indicates the differential expression between the spike and other samples. Any signal below 50 is included in the experimental noise, meaning that the gene may not be transcribed or may be transcribed at a very low level. To understand the expression level of each gene 2588723 of 106 represented by candidate probes, a second expression profiling study was performed. In this experiment, tissues from two maize genotypes were hybridized on the Zm80K Affymetrix chip. In general, signals of more than 1,000 indicate high expression and signals of more than 10,000 indicate very high expression. 2.1.2 Identification of candidate probes: The two main candidate probes were identified. The Zm033444_S_AT probe demonstrates virtually no signal in the spike and elevated signal in other tissues. This indicates that the gene represented by Zm033444_S_AT is not expressed in the spike, but has a high expression in the rest of the plant. It also shows the greatest differential expression, 60 highest in tissue other than the spike. The Zm040564_X_AT probe has a very low signal in young ears, which gradually increases to a strong or very strong signal. The signal intensity between the herringbone and non-herringbone samples differed by less than fold. However, the signal intensity in non-spike samples is almost 10 times higher than Zm033444_S_AT. The sequence data indicate that none of the probes correspond to a characterized gene. Both pathways identify good candidate genes to develop promoters that have high expression in non-spike tissue and have no or substantial expression in the spikes. Given the high signal differential between spike and non-spike samples, a Zm033444_S_AT probe-based expression cassette was developed. Table E shows a summary of the main candidate probes that represent polynucleotides with a high level of expression in all maize tissues but have no expression signal in the ear. Probe P value Q value BH Average induction in samples other than pin V9 pin V12 pin V15 pin Zm033444_s_at 0.00 0.00 60 16.2 10.2 132 2588723 of 106 Zm002990_s_at 0.00 0.00 45 32.8 68.7 47.8 Zm006285_at 0.00 0.00 20 37.9 44.1 35.8 Zm000019_at 0.00 0.00 16 117 200 242 Zm006481_s _at 0.00 0 .00 14 26.9 32.1 31.5 Zm002987_at 0.00 0.00 14 83.7 80.8 119 Zm004433_at 0.00 0.00 12 53.8 35.3 127 Zm010323_s_at 0.00 0.00 11 45.4 63 71.5 Zm016864_s_at 0.01 0.01 11 89.5 55.6 1280 Zm018791_at 0.01 0.01 11 41.4 34.7 252 Zm028405_s_at 0.00 0.00 10 65.1 89 Zm021403_at 0.00 0.00 10 42.2 41.4 71 Zm054116_s_at 0.00 0.00 10 93.3 62.4 219 Zm002990_x_at 0.00 0.00 10 13.6 29.5 29.2 Zm005761 _at 0, 00 0.00 9.6 33.2 40 46.7 Zm035082_s_at 0.00 0.00 8.5 83 84 143 Zm066342_at 0.00 0.00 8.2 52.9 59.2 199 Zm032921_s_at 0.00 0. 00 8.1 57.5 29.8 90.5 Zm040564_x_at 0.01 0.01 7.5 277 143 3710 Zm051284_at 0.01 0.01 6.5 53.2 40 194 Zm011554_at 0.03 0.04 5. 4 72.5 64.2 895 Zmmetall_x_at 0.01 0.01 5.3 325 199 2330 Zm011554_x_at 0.04 0.04 4.9 63.5 62.6 664 Example 2.2 Development of an expression cassette DNA evidence was collected to identify cDNAs corresponding to Zm033444_S_AT. Public and private databases were searched by BLASTN with sequence of Zm033444_S_AT. cDNA results with precise matching to the search sequence 2588723 of 106 had two similar contiguous sequences. ZmABTI corresponds to Corn.1482.c47 and Corn.1908.c31, and ZmABT2 corresponds to Corn.1482.c32, Corn.1482.c28, Corn.1482.c53, Corn.1908.c17, Corn.1908.c20, Corn .1908.c37 and AI947567. The sequences Zm033444_S_AT, ZmABT1 and ZmABT2 were used to search maize genomic DNA sequence databases to identify regulatory sequences that have high expression in non-ear tissue and little or no expression in the spikes. These searches identified three entries, AZM4_12, ZmGSStuc11-12-04.4740.1, and MAGI_88845, which are brought together into a single contiguous sequence. The ZmABT gDNA sequence is represented in SEQ ID NO: 46. It encodes ZmABT1 and ZmABT2 (SEQ ID NO: 33 and 34, respectively). They are alternatively spliced ​​variants of the same transcript. ZmABT1 is encoded in 5 exons and ZmABT2 is encoded in 6 exons. The additional exon is between exon 1 and exon 2 of ZmABT1. The largest reading frame in ZmABT1 and ZmABT2 was used to define their translation start and stop codons. Both cDNAs used the same translation initiation and termination codon. This information made possible the design of a ZmABT-based expression cassette. Example 3: Construction of a ZmABT-GUS expression cassette An inclusive gene structure-based design strategy was used to construct the ZmABT expression cassette. To incorporate the known alternative of splicing this gene into the expression cassette, the design strategy was based on the structure of ZmABT1. The cassette contains 2.615 kb of 5' sequence consisting of 2.020 kb of 5' untranscribed sequence, 12 kp of 5' untranslated region, and 0.58 kb representing exon 1, intron 1, and 16 bp of exon 2. The natural translation start codon was silenced to move it to the second exon. The expression cassette also contains 1,039 kb of sequence. 2588723 of 106 3' that begins just after the translation termination codon. This includes approximately 0.603 of 3' untranslated region and 0.436 kb of untranscribed sequence and functions as the transcription terminator and polyadenylation signal. The ZmABT promoter was amplified from the maize gDNA template in 50 pL of a Proofstart DNA polymerase reaction (Qiagen) containing 10 pg of gDNA, 5 pL of 10X Proofstart buffer, 1.0 pL of 10 mM dNTP mix, 1.0 pL of ABT P1 forw (5'- CGACCAGCGCGACATGCATGGCA-3'; SEQ ID NO: 19) 20 pM, 1.0 pL of ABT P2 rev (5'- ACCCCAGGGCGTACGACAAGGCC-3'; SEQ ID NO: 20) 20 μΜ, and 10.0 pL of Q 5X solution. The thermocycling program was 95°C for 5 minutes followed by 40 cycles of 94°C for 30 seconds, 67°C for 30 seconds, and 72°C for 2.5 minutes. The final extension step was 72°C for 10 minutes. The 2.6 kb reaction product was gel purified on 1% TAE agarose and DNA was extracted using the Qiaprep DNA extraction method. The DNA was cloned into the pCR-BluntII-TOPO vector. The ZmABT promoter was modified in a series of mutagenesis reactions to silence the endogenous translation start codon, silence a SanDI restriction site, and correct point mutations created during amplification. This was achieved using the Stratagene QuikChange Multi-site mutagenesis package. The 25 pL of the reaction contained 1 pL of pCR4-TOPO-ZmABT-promoter, 2.5 pL of 10X QuikChange buffer, 1 pL of QuikChange dNTP mix, 0.75 pL of Quik solution, 1 pL of QuikChange DNA polymerase and 1 pL of 20 pM of at least one of the following oligonucleotides: pABT mut1 (5'-GATGGCCGGATTGGGCTCCCGGGGTGGAG-3') (SEQ ID NO: 21) pABT mut2 (5'-CTGGGAGGCGCGCAAGGGGCAGTTCCTCG-3') (SEQ ID NO: 22) NO: 23) pABT mut4 (5'-GTCACCCGGGAGCACTTCCCGGCGCCG-3') (SEQ ID NO: 24) 2588723 pABT mut5 (5'-CATTGGGCCGAGCACGGCTTCTTCCGC-3') (SEQ ID NO: 25) pABT mut6 (5'-GGGGTACGGTGTTCTTGAGTCGTGAAGCGAC-3') (SEQ ID NO: 26) The thermocycling program was 95°C for 1 minute followed by 35 cycles of 95°C for 1 minute, 50°C for 1 minute, and 65°C for 12 minutes. The product was processed as described by the manufacturer (Stratagene) and completely sequenced. The ZmABT promoter sequence is depicted in SEQ ID NO: 35. The corrected ZmABT promoter was PCR amplified from the TOPO vector in 50 pL Proofstart DNA polymerase reaction (Qiagen) as above using pABT amp1 primers (5'GCGTCTAGAGGGACCCCGACCAGCGCGACATGCATGGCA-3'), which is depicted in SEQ ID NO: 27 and pABT amp2 (5'-ACCCCAGGGCGTACGACAAGGCCCCACCATGGGCGC-3'), which is represented in SEQ ID NO: 28. The PCR product was gel purified on 1% TAE agarose and DNA was extracted using the Qiaprep DNA extraction method. DNA was cloned into the pCR-BluntII-TOPO vector, transformed, and sequenced. The ZmABT promoter was excised as an XbaI / NcoI fragment and ligated into pNOV6901. The ZmABT terminal was amplified from maize gDNA template in 50 pL Extender DNA Polymerase Reaction (ABgene) containing 10 pg gDNA, 5 pL 10X Extender Buffer #1, 2.0 pL 10 mM dNTP mix , 2.0 pL of ABT P4 (5'-TATATAGAGCTCGAATCGAAGAAGCCACACTGTAAATCTGCCGGG-3'; SEQ ID NO: 29) 10 mM, 2.0 pL of ABT P5 (5'-AGCAAGGCATATGCAGCAGCTGCTGGTCGGACCGGGCCCTATATA-3'; SEQ ID NO: 30) 20 mM , 10 pL of Q 5X solution, 0.5 pL of Extender DNA polymerase and 0.5 pL of Amplitaq DNA polymerase. The reactions were covered with mineral oil and the thermocycling program was 95°C for 2 minutes followed by 40 cycles of 98°C for 2 seconds, 63°C for 1 minute, and 68°C for 4 minutes. The final extension step was 68°C for 7 minutes. The 1 kb reaction product was gel purified on 1% TAE agarose and DNA was extracted using the 2588723 of 106 Qiaprep DNA extraction method. DNA was precipitated with ethanol, recovered in 4 μL of ddH2O, and cloned into the pCR4-TOPO-Blunt vector. The terminus of ZmABT was modified to remove the NcoI and XhoI internal restriction sites using the Stratagene QuikChange Multi-site mutagenesis kit, as indicated above. The 25 μL reaction contained 1 μL pCR4TOPO-ZmABT-promoter, 2.5 μL 10X QuikChange buffer, 1 μL QuikChange dNTP mix, 0.75 μL Quik solution, 1 μL QuikChange DNA polymerase, and 1 μL of 20 μΜ of at least one of the following oligonucleotides: ABTt m1 (5'- GTCATGCATGGGCATGTGAAGGAGGAGCC-3') (SEQ ID NO: 31) ABTt m2 (5'- GTTGCATGCATGCTGCATGGCGTCGAGAT-3') (SEQ ID NO: 32) The thermocycling program was 95°C for 1 minute followed by 35 cycles of 95°C for 1 minute, 50°C for 1 minute, and 65°C for 13 minutes. The product was processed as described by the manufacturer (Stratagene) and completely sequenced. The ZmABT terminator sequence is depicted in SEQ ID NO: 36. The ZmABT terminus was excised as a SacI / ApaI fragment and ligated into the pNOV6901-prABT vector (above). This produced plasmid 15772 (ZmABT Set) and a plasmid map is shown in SEQ ID NO: 44. The complete ZmABT expression cassette was moved as a SanDI / RsrlI fragment to the RsrlI site of the Agrobacterium 15289 binary vector. A map Plasmid of this construct, 15773, is shown in SEQ ID NO: 45. Example 4: Extension of DNA Probe Sequences to Designed Expression Cassettes The DNA sequence representing probes on the corn chip can be easily extended to expression cassettes designed in accordance with the steps set forth above. The DNA sequence for probes was identified to represent genes that have high expression in all 99 2588723 from 106 tissue samples and are not expressed in the pollen (Table A) and those that have high expression in all tissue samples and have reduced expression in the spike samples (Table E) are reported as SEQ ID NOs: 47-79. An additional probe candidate was selected from the expression profile analysis for each expression category to demonstrate progression from that DNA sequence to a finished binary vector where the designed expression cassette is linked to the GUS reporter gene. The method used is identical to that used for ZmABP3 and ZmABT. In summary, the stages of the process applied are the following: 1. Flank each expression cassette with SanDI / RsrII sites and report as cloned into the RsrII site of 15289 (SEQ ID NO: 80). 2. The promoter consists of 1000-1500 bp of sequence upstream of the transcription start site and extends 10 bases into the second exon or the natural translation start codon if not the first exon. It ends with the corn-optimized Kozak 'gtaaaccatgg' sequence. The generated translation start codon is now incorporated into the 'ccatgg' endonuclease restriction NcoI site. All translation initiation codons in the theoretical transcript that are upstream of the NcoI site are mutated. It is ensured that at least one stop codon is in each reading frame upstream of the generated NcoI site. The promoter is designed to be flanked by XhoI / SanDI at the 5' end and by NcoI at the 3' end. 3. The gene of interest is represented by the GUS reporter gene as an NcoI / SacI fragment. 4. The terminus extends from just after the translational termination codon for 1 kb downstream. The terminal is designed to be flanked by SacI at the 5' end and by RsrII / XmaI at the 3' end. 5. The complete expression cassette is designed to be carried as a SanDI / RsrII fragment, which can be ligated to an RsrII site located in an Agrobacterium binary vector such as 15289 (SEQ ID NO: 80). 100 2588723 100 of 106 6. All internal SanDI, RsrII, NcoI, SacI, Xhol and Xmal sites are mutated by a single base substitution to silence them. Through the application of these basic steps, a plant expression cassette (SEQ ID NO: 81) can be designed that corresponds to the Zm058948_s_at probe (SEQ ID NO: 55) and a plant expression cassette (SEQ ID NO: 82) that corresponds to the probe Zm002990_s_at (SEQ ID NO: 62). The latter is an expression cassette that should be transcribed in all maize tissues but not in pollen. The latter is an expression cassette that should be transcribed in all maize tissues and have reduced transcription in the ears. This design strategy applies to all probes identified in Tables A and E. More details on how to prepare these expression cassettes are described in US2005235311, which is incorporated herein by reference in its entirety. 101 2588723 101 of 106 References Ammirato et al., eds., (1984) Handbook of Plant Cell Culture-Crop Species, Macmillan Publ. Co., New York, N.Y. An et al., (1985) EMBO J. 4, 277 287 Auch & Reth et al. Batzer, et al., Nucleic Acid Res. 19:5081 (1991) Byrne, M. C., McDonnell, R. E., Wright, M. S. and Carnes, M. G., 1987. Strain and Cultivar Specificity in the Agrobacterium-soybean Interaction. Plant Cell Tissue and Organ Culture 8:3-15 Christou et al., Plant Physiol. 87:671-674 (1988) Christou et al., Biotechnology 9: 957-962 (1991) Crossway et al., BioTechniques 4:320-334 (1986) Datta et al., Bio / Technology 8:736-740 (1990) Fromm et al., Bio / Technology 8:833-839 (1990) Gaxiola, R.A., Li, J., Undurraga, S., Dang, L.M., Allen, G.J. Alper, S.L., Fink, G.R. (2001). Drought- and salt-tolerant plants result from over-expression of the AVP1 H+-pump. Proc. Natl. Academic Sci USA 98: 11444-11449. Gordon-Kamm et al., Plant Cell 2:603-618 (1990) Gruber, et al., Vectors for Plant Transformation, in Methods in Plant Molecular Biology & Biotechnology in Glich, et al., (Eds. pp. 89-119, CRC Press, 1993). Guthrie, W. D., F. F. Dicke, and C. R. Neiswander (1960) Leaf and sheath feeding resistance to the Eur. corn borer in eight inbred lines of dent corn. Ohio Agric. Exp. Stn. Res. Bull. 860. 102 2588723 102 of 106 Guthrie, W. D. (1989) Advances in Rearing the European Corn Borer on a Meridic Diet, In: Toward Insect Resistant Maize for the Third World; Proceedings of the International Symposium on Methodologies for Developing Host Plant Resistance to Maize Insects. Mexico, D.F.:CIMMYT Hiei et al., (1994) Plant J. 6, 271-282 Hinchee et al., Biotechnology 6:915-921 (1988) Hoekema (1985) The Binary Plant Vector System, Offsetdrukkerij Kanters B. V., Alblasserdam, Chap. V Klein et al., Proc. Natl. Academic Sci. USA, 85:4305-4309 (1988) Klein et al., Bio / Technology 6:559-563 (1988)(maize); Klein et al., Plant Physiol. 91:440-444 (1988) Knauf, et al., 1983 Koziel et al., Biotechnology 11: 194-200 (1993) Lindsey K, Wei W, Clarke MC, McArdle HF, Rooke LM, Topping JF. Tagging genomic sequences that direct transgene expression by activation of a trap promoter in plants. Transgenic Res. 1993 Jan;2(1):33-47. Lopez, I, Anthony, R.G., Maciver, S.K., Jiang, C.-J., Khan, S., Weeds, A.G., Hussey, P.J. (1996) Pollen specific expression of maize genes encoding actin depolymerizing factor-like proteins. Proc. Natl. Academic Sci. USA. 93: 7415-7420. Lorz et al. (Mol. Gen. Genet. 199, 178, (1985)) McBride, et al. (1994) Proc. Natl. Academic Sci USA 91:7301-7305 McCabe et al., Biotechnology 6:923-926 (1988) Ohtsuka, et al., J. Biol. Chem. 260:2605-2608 (1985) Pacciotti et al. (1985) Bio / Technology 3:241 Park et al., 1985 Park, S., Li, J., Pittman, J.K., Berkowitz, G.A., Yang, H., Undurrago, S., Morris, J., Hirschi, K.D., Gaxiola, R.A. (2005). Up-regulation of a H+-pyrophosphatase (H+ 103 2588723 103 of 106 PPase) as a strategy to engineer drought-resistant crop plants. Proc. Natl. Academic Sci USA 102: 18830-18835. Paszkowski et al., EMBO J. 3:2717-2722 (1984) Pearson, W.R. (1990), Methods in Enzymology 183, 63-98 Potrykus, I., Paszkowski, J.P., Saul, M.W., Petruska, P. and Shillito, R.D. 1985. Molecular and general genetics of a hybrid foreign gene introduced into tobacco by direct gene transfer. Mol. Gen. Genet. 199:169-177. Ritchie, S.W., Hanway, J.J., Benson, G.O. (1997). How a corn plant develops: Special Report No. 48. Iowa State University of Science and Technology Cooperative Extension service: Ames, Iowa. Riggs et al., Proc. Natl. Academic Sci. USA 83:5602-5606 (1986) Rossolini, et al., Mol. Cell. Probes 8:91-98 (1994) Sambrook et al. supra; Molecular Cloning, a Laboratory Manual, Maniatis et al. (eds) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982); Advanced Bacterial Genetics, Davis et al. (eds.) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1980) Sanford et al., Particulate Science and Technology 5:27-37 (1987) Shimamoto et al., Nature 338: 274-277 (1989) Shirzadegan, M., Christie, P., Seemann, J. (1991) An efficient method for isolation of RNA from tissue-cultured plant cells. Nucleic Acids Res. 19(21): 6055. Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489 Sukhapinda et al., Plant Mol. Biol., vol. 8:209-216, 1987 Svab et al., Proc. Natl. Academic Sci. USA 87: 8526-8530 (1990) Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular BiologyHybridization with Nucleic Acid Probes part I chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays Elsevier, New York. , Vasil et al., Biotechnology 11: 1553-1558 (1993) 104 2588723 104 of 106 Weeks et al., Plant Physiol. 102: 1077-1084 (1993) Weissinger et al., Annual Rev. Genet. 22:421-477 (1988) Patent bibliography EP 0 332 581 EP 0 292 435 EP 0 295959 EP 0 138341 EP 0 120516 US Pat No. 5,451,513 US Pat No. 5,545,817 US Pat No. 5,545,818 US Pat No. 5,350,689 US Pat No. 5,451,513 US Pat No. 4,945,050 WO 95 / 16783 105 2588723 105 of 106 Santiago Ferrer Reyes - 20142227887 Digitally signed by PORTALTRAMITES - INPI Date: 2024.01.12 13:25:48 -03:00 Reason: Digitally Signed by INPI Location: Buenos Aires, Argentina 2588723 106 of 106

Claims

1. An isolated expression cassette operatively linked to a promoter sequence not natively associated, characterized in that it comprises an isolated regulatory nucleotide sequence comprising a promoter, thereby providing a transcription initiation function, and further comprises a nucleotide sequence comprising SEQ ID NO: 36, thereby providing a transcription termination function. Four claims follow.