ENANTIOMERIC ANTIVIRAL COMPOUND

Abstract

Claim 1: Compounds according to formulas (1) and / or (2), wherein X is selected from the residues of the group of formulas (3), or of the group of formulas (4), respectively; R¹ is selected from H, halogen, C₁₋₆ alkyl, C₁₋₆ haloalkyl, C₁₋₆ hydroxyalkyl, C₃₋₆ cycloalkyl, C₃₋₆ halocycloalkyl, -O-C₁₋₆ alkyl, -O-C₁₋₆ haloalkyl- and -NH-C₁₋₆ alkyl-; R² is selected from H, -CN, -NO₂, C₁₋₁₀ alkyl, C₂₋₁₀ alkenyl, C₂₋₁₀ alkynyl, C₀₋₁₀ alkylene-C₃₋₁₀ cycloalkyl, C₀₋₁₀ alkylene-C₃₋₁₀ heterocycloalkyl, C₀₋₁₀ alkylene-(5- to 10-membered heteroaryl), C₀₋₁₀ alkylene-(6- to 10-membered aryl), C₀₋₁₀ alkylene-C₀₋₁₀ alkylene-(6- to 10-membered heteroaryl), alkylene-C₀₋₁₀-OR¹¹, alkylene-C₀₋₁₀-CO₂R¹¹, alkylene-C₀₋₁₀-C(=O)NR¹¹R¹², alkylene-C₀₋₁₀-C(=S)NR¹¹R¹², alkylene-C₀₋₁₀-C(=O)NR¹¹SO₂R¹³, alkylene-C₀₋₁₀-C(=S)NR¹¹SO₂R¹¹, alkylene-C₀₋₁₀-C(=O)R¹¹, alkylene-C₀₋₁₀-C(=S)R¹¹, alkylene-C₀₋₁₀-SR¹¹, alkylene-C₀₋₁₀-SOˣR¹³, alkylene-C₀₋₁₀-SO₃R¹¹, alkylene-C₀₋₁₀-SO₂NR¹¹R¹²,alkylene-C₀₋₁₀-NR¹¹C(=O)R¹¹, alkylene-C₀₋₁₀-NR¹¹C(=S)R¹¹, alkylene-C₀₋₁₀-NR¹¹SO₂R¹³, alkylene-C₀₋₁₀-NR¹¹C(=O)NR¹¹R¹², alkylene-C₀₋₁₀-NR¹¹C(=S)NR¹¹R¹², alkylene-C₀₋₁₀-NR¹¹SO₂NR¹¹R¹², alkylene-C₀₋₁₀-NR¹¹R¹², wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are unsubstituted or are substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, -NO₂, OR¹¹, O-alkylene-C₂₋₆-OR¹¹, alkyl-C₁₋₆, halo-alkyl-C₁₋₆, halogen, CO₂R¹¹, C(=O)NR¹¹R¹², C(=O)NR¹¹SO₂R¹¹, C(=O)R¹¹, SR¹¹, SOˣR¹¹, SO₃R¹¹, P(=O)(OR¹¹)₂, SO₂NR¹¹R¹², NR¹¹C(=O)R¹¹, NR¹¹SO₂R¹³, NR¹¹C(=O)NR¹¹R¹², NR¹¹SO₂NR¹¹R¹², cycloalkyl-C₃₋₁₀, O-cycloalkyl-C₃₋₁₀, heterocycloalkyl-C₃₋₁₀, O-heterocycloalkyl-C₃₋₁₀ and NR¹¹R¹²; R³ is selected from H, C₁₋₆ alkyl, C₁₋₆ haloalkyl, -O-C₁₋₆ alkyl, -O-C₁₋₆ haloalkyl, C₃₋₆ cycloalkyl and C₃₋₆ heterocycloalkyl, where alkyl,cycloalkyl and heterocycloalkyl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, OH, oxo, C₁₋₃ alkyl, C₁₋₃ haloalkyl, C₁₋₃ O-alkyl, C₁₋₃ O-haloalkyl, SO₂-C₁₋₃ alkyl, CO₂H; or R² and R³ when taken together with the nitrogen to which they are attached complete a ring of 3 to 8 members containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO₂, OH, oxo, C₁₋₃ alkyl, C₁₋₃ halo-alkyl, O-C₁₋₃ alkyl, O-C₁₋₃ halo-alkyl, SO₂-C₁₋₃ alkyl, CO₂H; R⁴ is selected from H, C₁₋₆ alkyl, C₁₋₆ acyl, C₂₋₆ alkenyl, C₃₋₈ cycloalkyl and C₃₋₈ heterocycloalkyl, where alkyl, acyl, alkenyl,cycloalkyl and heterocycloalkyl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, OH, oxo, C₁₋₃ alkyl, C₁₋₃ haloalkyl, O-C₁₋₃ alkyl, O-C₁₋₃ haloalkyl; R⁵ and R⁶ and R⁵' and R⁶' are independently selected from H, halogen, C₁₋₆ alkyl, NH₂, C₁₋₆ NH-alkyl, N(C₁₋₆ alkyl)₂, C₀₋₆ alkylene-C(=O)NH₂; or R⁵ and R⁶ and R⁵' and R⁶' when taken together with the carbon to which they are attached complete a ring of 3 to 8 members containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO₂, OH, oxo, C₁₋₃ alkyl, C₁₋₃ haloalkyl, O-C₁₋₃ alkyl, O-C₁₋₃ haloalkyl, SO₂-C₁₋₃ alkyl, CO₂H; or R⁵ and R⁵' and R⁶ and R⁶' independently,when taken together with the two adjacent carbon atoms to which they are attached, they complete a ring of 3 to 8 members containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO₂, OH, oxo, C₁₋₃ alkyl, C₁₋₃ halo-alkyl, O-C₁₋₃ alkyl, O-C₁₋₃ halo-alkyl, SO₂-C₁₋₃ alkyl, CO₂H; R⁷ is selected from a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl are optionally substituted with 1 to 4 substituents independently selected from halogen, -CN, -NO₂, OH, C₁₋₆ alkyl, O-C₁₋₆ alkyl, C₃₋₆ cycloalkyl, O-C₃₋₆ cycloalkyl, C₃₋₆ heterocycloalkyl, O-C₃₋₆ heterocycloalkyl, SOʸ-C₁₋₆ alkyl, CO₂H, C(=O)O-C₁₋₆ alkyl, 6- to 10-membered aryl, 5- or 10-membered heteroaryl,O-(6- to 10-membered aryl) and O-(5- or 10-membered heteroaryl), wherein alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, -NO₂, OH, R¹³, OR¹³, CO₂R¹¹, NR¹¹R¹², C(=O)R¹¹, C(=S)R¹¹, C(=O)NR¹¹R¹², NR¹¹C(=O)NR¹¹R¹², NR¹¹C(=O)OR¹³, OC(=O)NR¹¹R¹², C(=S)NR¹¹R¹², NR¹¹C(=S)NR¹¹R¹², NR¹¹C(=S)OR¹³, OC(=S)NR¹¹R¹²; SOʸ-C₁₋₆-alkyl, SOʸ-halo-C₁₋₆-alkyl, SR¹¹, SOˣR¹³, SO₃R¹¹, SO₂NR¹¹R¹², NR¹¹SO₂R¹³, NR¹¹SO₂NR¹¹R¹²; R⁸ is selected from H, -CN, -NO₂, C₁₋₁₀ alkyl, C₂₋₁₀ alkenyl, C₂₋₁₀ alkynyl, C₀₋₁₀ alkylene-C₃₋₁₀ cycloalkyl, C₀₋₁₀ alkylene-C₃₋₁₀ heterocycloalkyl, C₀₋₁₀ alkylene-(5- to 10-membered heteroaryl), C₀₋₁₀ alkylene-(6- to 10-membered aryl), C₀₋₁₀ alkylene-C₀₋₁₀ alkylene-(6- to 10-membered heteroaryl), alkylene-C₀₋₁₀-OR¹¹, alkylene-C₀₋₁₀-CO₂R¹¹, alkylene-C₀₋₁₀-C(=O)NR¹¹R¹², alkylene-C₀₋₁₀-C(=S)NR¹¹R¹², alkylene-C₀₋₁₀-C(=O)NR¹¹SO₂R¹³,alkylene-C₀₋₁₀-C(=S)NR¹¹SO₂R¹¹, alkylene-C₀₋₁₀-C(=O)R¹¹, alkylene-C₀₋₁₀-C(=S)R¹¹, alkylene-C₀₋₁₀-SR¹¹, alkylene-C₀₋₁₀-SOˣ-R¹³, alkylene-C₀₋₁₀-SO₃R¹¹, alkylene-C₀₋₁₀-SO₂NR¹¹R¹², alkylene-C₀₋₁₀-NR¹¹C(=O)R¹¹, alkyl-C₀₋₁₀-NR¹¹C(=S)R¹¹, alkyl-C₀₋₁₀-NR¹¹SO₂R¹¹, alkyl-C₀₋₁₀-NR¹¹C(=O)NR¹¹R¹², alkyl-C₀₋₁₀-NR¹¹C(=S)NR¹¹R¹², alkyl-C₀₋₁₀-NR¹¹-SO₂-NR¹¹R¹², alkyl-C₀₋₁₀-NR¹¹R¹², wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are unsubstituted or are substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, -NO₂, OR¹¹, O-alkylene-C₂₋₆-OR¹¹, alkyl-C₁₋₆, halo-alkyl-C₁₋₆, halogen, CO₂R¹¹, CONR¹¹R¹², CONR¹¹SO₂R¹¹, COR¹¹, SOˣR¹¹, SO₃H, PO(OH)₂, SO₂NR¹¹R¹², NR¹¹COR¹¹, NR¹¹SO₂R¹¹, NR¹¹-CO-NR¹¹R¹², NR11-SO2-NR11R12, cycloalkyl-C3-10, O-cycloalkyl-C3-10, heterocycloalkyl-C3-10, O-heterocycloalkyl-C3-10 and NR11R12; R9 is selected from alkyl-C3-10, alkenyl-C3-10,alkynyl-C₂₋₁₀, alkylene-C₀₋₁₀-cycloalkyl-C₃₋₁₀, alkylene-C₀₋₁₀-heterocycloalkyl-C₃₋₁₀, alkylene-C₀₋₁₀-(5- to 10-membered heteroaryl), alkylene-C₀₋₁₀-(6- to 10-membered aryl), alkylene-C₀₋₁₀-(6- to 10-membered heteroaryl), alkylene-C₀₋₁₀-OR¹¹, alkylene-C₀₋₁₀-CO₂R¹¹, alkylene-C₀₋₁₀-C(=O)NR¹¹R¹², alkylene-C₀₋₁₀-C(=S)NR¹¹R¹², alkylene-C₀₋₁₀-C(=O)NR¹¹SO₂R¹³, alkylene-C₀₋₁₀-C(=S)NR¹¹SO₂R¹¹, alkylene-C₀₋₁₀-C(=O)R¹¹, alkylene-C₀₋₁₀-C(=S)R¹¹, alkylene-C₀₋₁₀-SR¹¹, alkylene-C₀₋₁₀-SOˣR¹³, alkylene-C₀₋₁₀-SO₃R¹¹, alkylene-C₀₋₁₀-SO₂NR¹¹R¹², alkylene-C₀₋₁₀-NR¹¹C(=O)R¹¹, alkylene-C₀₋₁₀-NR¹¹C(=S)R¹¹, alkylene-C₀₋₁₀-NR¹¹SO₂R¹³, alkylene-C₀₋₁₀-NR¹¹C(=O)NR¹¹R¹², alkylen-C₀₋₁₀-NR¹¹C(=S)NR¹¹R¹², alkylen-C₀₋₁₀-NR¹¹SO₂NR¹¹R¹², alkylen-C₀₋₁₀-NR¹¹R¹², wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are unsubstituted or substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, -NO₂,OR¹¹, O-alkylene-C₂₋₆-OR¹¹, alkyl-C₁₋₆, halo-alkyl-C₁₋₆, halogen, CO₂R¹¹, C(=O)NR¹¹R¹², C(=O)NR¹¹SO₂R¹¹, C(=O)R¹¹, SR¹¹, SOˣR¹¹, SO₃R¹¹, P(=O)(OR¹¹)₂, SO₂NR¹¹R¹², NR¹¹C(=O)R¹¹, NR¹¹SO₂R¹¹, NR¹¹C(=O)NR¹¹R¹², NR¹¹SO₂NR¹¹R¹², cycloalkyl-C₃₋₁₀, O-cycloalkyl-C₃₋₁₀, heterocycloalkyl-C₃₋₁₀, O-heterocycloalkyl-C₃₋₁₀ and NR¹¹R¹²; R¹¹ is independently selected from H, C₁₋₆ alkyl, C₀₋₆ alkylene-cycloalkyl-C₃₋₁₀ and C₀₋₆ alkylene-heterocycloalkyl-C₃₋₁₀, wherein alkyl, alkylene, cycloalkyl and heterocycloalkyl are either unsubstituted or substituted with 1 to 6 substituents independently selected from the group consisting of halogen, -CN, OH, oxo, C₁₋₃ alkyl, C₁₋₃ haloalkyl, O-C₁₋₃ alkyl, O-C₁₋₃ haloalkyl, NH₂, NH(C₁₋₃ alkyl), N(alkyl-C₁₋₃)₂, heterocycloalkyl-C₃₋₆, cycloalkyl-C₃₋₆, SO₂-NH-alkyl-C₁₋₃, SO₂-N(alkyl-C₁₋₃)₂ and SO₂-alkyl-C₁₋₃,wherein cycloalkyl and heterocycloalkyl are either unsubstituted or substituted with 1 to 3 substituents independently selected from the group consisting of F, OH, oxo, CH₃, CHF₂ and CF₃; R¹² is independently selected from H, C₁₋₆ alkyl, C₁₋₆ haloalkyl and C₃₋₆ cycloalkyl; or R¹¹ and R¹² when taken together with the nitrogen to which they are attached complete a 3- to 8-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO₂, OH, oxo, C₁₋₃ alkyl, C₁₋₃ halo-alkyl, O-C₁₋₃ alkyl, O-C₁₋₃ halo-alkyl, SO₂-C₁₋₃ alkyl, CO₂H; R¹³ is independently selected from C₁₋₆ alkyl, C₀₋₆ alkylene-cycloalkyl-C₃₋₁₀ and C₀₋₆ alkylene-heterocycloalkyl-C₃₋₁₀, where alkyl, alkylene,cycloalkyl and heterocycloalkyl are either unsubstituted or substituted with 1 to 6 substituents selected independently from the group consisting of halogen, -CN, OH, oxo, C₁₋₃ alkyl, C₁₋₃ haloalkyl, C₁₋₃ O-alkyl, C₁₋₃ O-haloalkyl, NH₂, NH(C₁₋₃ alkyl), N(C₁₋₃ alkyl)₂, C₃₋₆ heterocycloalkyl, C₃₋₆ cycloalkyl, SO₂-NH-C₁₋₃ alkyl, SO₂-N(C₁₋₃ alkyl)₂ and SO₂-C₁₋₃ alkyl, wherein the cycloalkyl and heterocycloalkyl groups are either unsubstituted or substituted with 1 to 3 substituents selected independently from the group consisting of F, OH, oxo, CH₃, CHF₂, and CF₃; n is selected from 0 to 1; x is selected independently from 1 to 2; y is selected independently from 0, 1, and 2; and wherein optionally R¹ is connected to a residue selected from R², R³, R⁸, R⁹, R¹⁰, or R¹² to form a 5- to 8-membered heterocycle,which is optionally substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO₂, OH, oxo, C₁₋₃ alkyl, C₁₋₃ haloalkyl, C₁₋₃ O-alkyl, C₁₋₃ O-haloalkyl, C₁₋₃ SO₂-alkyl, CO₂H.,

Description

New enantiomers of a series of antiviral compounds SUMMARY OF THE INVENTION The present invention relates to novel antiviral compounds with specific stereoconfiguration, especially to specific novel enantiomers, to a process for their preparation and to their use as medicaments, in particular as antiviral medicaments. INTRODUCTION Viral pandemics have plagued humanity since antiquity, causing mucocutaneous infections such as cold sores and genital herpes. The symptoms of these diseases often interfere with daily activities, and occasionally HSV infections cause encephalopathy (encephalitis) or eye diseases (keratitis), especially in newborns, the elderly, and immunocompromised patients such as transplant recipients, cancer patients, or patients with inherited immunodeficiency syndromes or diseases. After infection, alphaherpesviridae viruses persist for life in the host's neurons in a latent form, reactivating periodically and often causing significant psychosocial distress for the patient. Currently, there is no cure available. To date, vaccines, intereukins, interferons, therapeutic proteins, antibodies, immunomodulators, and small molecule drugs with specific or non-specific modes of action lacked the efficacy or safety profile required to replace drugs. PABLO SCHMUKLER - 20117733352 ' Digitally signed by PORTALTRAMITES - INPI Date: 2018.10.19 11:30:55 -03:00 Reason: Digitally Signed by the INPI Location: Buenos Aires, Argentina. Nucleoside drugs acyclovir, valacyclovir, and famciclovir are the first-line treatment. The known thiazolamides are the most potent drugs currently under development. These antiviral agents act through a novel mechanism of action and exhibit low rates of resistance in vitro and superior efficacy in animal models compared to nucleoside drugs; however, their development is hampered by off-target carbonic anhydrase activity and an unusual pharmacokinetic profile. This patent application describes novel antiviral compounds that lack (or at least have a significant reduction in) carbonic anhydrase activity, exhibiting improved solubility and a pharmacokinetic profile suitable for use as a drug. PREVIOUS TECHNIQUE 2-Aminothiazol-5-sulfonamides are known from the publication C. Ziegler et al., J. Org. Chem. 1960: 25,1454. In addition, German patent application 2101640 describes N-thiazol-2-yl-amides and ureas that have herbicidal action. Document WO97 / 24343 refers to phenylthiazole derivatives that have properties against the herpes virus. Document WO99 / 42455 also refers to phenylthiazole derivatives that have properties against the herpes virus. Document WO99 / 47507 refers to 1,3,4-thiadiazole derivatives that have properties against the herpes virus. Document WO0147904 (A1) and the corresponding document US2004 / 0006076 refer to thiazolylamides that have properties against the herpes virus. Document W02003 / 000259 refers to the topical application of thiazolamides. Document W02004060860 (A2) refers to a method for inhibiting the replication of the herpes virus. Document W00220014 (A1) refers to non-competitive inhibitors of helicase-primase. Document WO0212211 (A1) refers to reverse thiazolylamide derivatives. W00053591 (A1) refers to thiazolyl urea derivatives and their use as antiviral agents. Document W003000260 (A1) refers to thiazolylamides and their use as antiviral drugs. Documents WO0196874 (A1) and EP1319185 (A1) refer to a method for identifying compounds with anti-herpes activity. Document W02004015416 refers to methods for the identification of agents with antimicrobial action. Document W003007946 refers to 1,3-thiazoI-5-yl sulfonamide derivatives and their use as antiviral agents. Document W00076966 refers to indolinylamide derivatives. Document DE19959958 refers to new 2-ureido-thiazol-5-suiphonic acid amide derivatives useful as antiviral agents, especially against herpes simplex infections. Document DE10210319 refers to new thiazole-5sulfonamide derivatives, useful for the treatment of viral infections in humans and animals, especially herpes simplex or human cytomegalovirus infections. Document DE10129717 refers to a combination preparation containing a nucleoside compound and a 5-sulfonyl-2-phenylacetamido-thiazole derivative, useful as an effective antiviral agent against herpes viruses, especially herpes simplex. Document DE10129716 refers to a combination preparation useful as an effective antiviral agent against herpes viruses, especially herpes simplex, containing acetylsalicylic acid and a 5-sulfonyl-2-phenylacetamidothiazole derivative. Document DE10044358 refers to new thiazoI-5sulfonamide derivatives useful as antiviral agents, especially for the control of herpes simplex infections. Document DE10044328 refers to new thiazole-5sulfonamide derivatives useful as antiviral agents, especially for the control of herpes simplex infections. DE10039265 refers to new derivatives of 2-acylamino-5-aminosulfonyl-1,3-thiazo!, useful as antiviral agents, especially for the treatment or prophylaxis of herpes simplex virus infections. Document HRP20140352 refers to N-[5-aminosulfonyl)-4-methyl-1,3thiazol-2-II]- / \ / -methyl-2-[4-(2-pyridinyl)phenyl]acetamide mesylate monohydrate. Documents W02006103011 and EP1865921 refer to a pharmaceutical preparation of N-[5-[aminosulfonyl)-4-methyl-1,3-thiazol-2-II]- / Vmethyl-2-[4-(2-pyridinyl)phenyl]acetamide. Document W02005075435 refers to compounds that are modulators of the ATP-binding cassette transporter useful in the treatment of, among others, cystic fibrosis and Alzheimer's disease. Documents WO2018095576, W02018096170 and WO2018096177 describe topical pharmaceutical formulations of pritelivir salts or free bases and novel pritelivir polymorphs (e.g., free base hemihydrate or maleate salt). Document WO2018127207 refers to other thiazol-5sulfonamide derivatives. However, none of these prior art documents cover aminosulfonimidoyl, methylsulfonimidoyl, cyclopropylsulfonimidoyl or N-cyano-S-methyl-sulfonimidoyl derivatives of the thiazolylacetamide series. The unpublished international application PCT / EP2017 / 058077 describes novel antiviral compounds of the general formula (I) R, where X can have the meaning of Nr8Nr8°',nr0qx / NR8 X NRRrX R , X NRRfX R(with the definitions of substituents provided therein, however without revealing any specific stereoisomer or a specific stereoconfiguration of any specific compound disclosed therein. The present invention now discloses novel antiviral compounds with specific stereoconfiguration according to Formula (1a) and (1b) as described herein, novel specific enantiomers, as well as strikingly superior characteristics thereof, and further provides a process for preparing them from a mixture of stereoisomers of the general Formula (1)(1) as described herein. Furthermore, similar to the mixture comprising the stereoisomers of the compounds of the present invention, likewise the novel isolated enantiomers show absence of off-target carbonic anhydrase activity or at least significantly reduced activity at increased solubility and have been found to act more actively in treating viral infections, such as, in particular, herpes simplex virus. Even more surprisingly, enantiomers with a specific counterclockwise, levorotatory, or negative optical rotation in a polarimeter or CD spectra that elute first from a defined chiral HPLC column are at least a factor of 2 more potent in vitro than the respective enantiomers that show a clockwise, dextrorotatory, or positive optical rotation in a polarimeter that elute last from a defined chiral HPLC column. Surprisingly, enantiomers with a specific negative rotation show higher exposures in the pharmacokinetic profile compared to the respective mixture of stereoisomers or the racemate or the respective enantiomer with a specific positive rotation. The optimized pharmacokinetic profile of selected stereoisomers leads to profound antiviral activity in treated mammals, suitable for clinical development in humans and use as a drug. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to antiviral compounds with a specific stereoconfiguration according to the formula (Ib) an enantiomer, diastereomer, tautomer, N-oxide, solvate, formulation and a pharmaceutically acceptable salt thereof, wherein in Formula (a) and (Ib) X is selected from NR8NR8OKzNRe O'ZzNR8 VS''NR2R3( VS', / / R9i VS,'NR2R3y Y^'R9, or NR8NR8O^NR8O',NR8η sC-S' , , <. ..If X NR2R\ X R9, X NR2R3y X R9, respectively; R1 selects between H, halogeno, alquÍlo-Ci-6, halo-aIquilo-Ci-6, hidroxialquilo-Ci-6, cycloalquilo C^, halo-cicloalquilo C>e, -O-alquilo-Ci-6, -Ohalo-aIquilo-Ci-6- and -NH-alquilo-Ci^-; R2 is selected from H, -CN, -NO2, alkyl-Ci-w, C2-10 alkenyl, C2-10 alkynyl, alkylene-Co.io-cycloalkyl-C3-io, alkylene-Co-io-heterocycloalkyl-Cs10, alkylene-Co-io-(5- to 10-membered heteroaryl), alkylene-Co-io-(to 10-membered aryl), alkylene-Co-io-(6- to 10-membered heteroaryl), alkylene-Co-10-OR1, alkylene-Co-io-C02R11, alkylene-Co-io-C(=O)N R11R12, alkylene-Co-io-C(=S)NR11R12, alkylene <WC(=O)NR11SO2R13t alquilen-Co10-C(=S)NR11SO2R11, alquilen-Co-icrC(=0)R11, alquilen-Co.io-C(=S)R1\ alquilen-Co-10-SR11, aIquilen-Co-10-SOxR13, alquilen-Co-io-SOsR11, alquilenCo-io-S02NR11R12, alquilen-Co.io-NR11C(=0)R11, alquilen-Co-10NR11C(=S)R11, alquilen-Co.io-NR11S02R13, alquilen-Co-10NR11C(=O)NRnR12, alquilen-Co-io-NR11C(=S)NR11R12, alquilen-Co-io NR11SO2NR11R12, a!qu¡len-Co-io-NR11R12, wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are unsubstituted or are substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, NO2t ORn, O-alkylene-C2^-OR11, alkyl-Ci.fi, halo-alkyl-Ci^, halogen, CO2R11. C(=O)NR11R12, C(=O)NR11SO2R11, C(=O)R11, SR11, SOxRn, SO3R11, P(=O)(OR11)2, SO2NR11R12, NR11C(=O)R11, nr11so2r13, NR11C(=O)NR11R12, NR11SO2NR11R12, C3-10 cycloalkyl, O-cycloalkyl-Caio, heterocycloalkyl ¢3-10, O-heterocycloalkyl-Cs-io and NR11R12; R3 is selected from H, alkyl-Ci^, halo-alkyl-Ci^, -O-alkyl-Ci^, -Ohalo-alkyl-Ci-6, cycloalkyl-C^- and heterocycloalkyl-C^, wherein alkyl, cycloalkyl and heterocycloalkyl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, OH, oxo, alkyl-Ci-3, halo-alkyl-Ci-3, O-alkyl C1-3, Ohalo-alkyl-Ci-3, SO^alkyl-Ci^, CO2H; or R2 and R3 when taken together with the nitrogen to which they are attached complete a 3- to 8-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is either unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO2, OH, oxo, alkyl-Ci <j, halo-alquilo-C^, O-alquilo C1.3, O-halo-alquilo-Ci-3, SOralquilo-Ci^, CO2H; R4 is selected from H, alkyl-Ci^, acyl-Ci^, C2-6 alkenyl, Ca-e-cycloalkyl and C^s heterocycloalkyl, wherein alkyl, acyl, alkenyl, cycloalkyl and heterocycloalkyl are optionally substituted with 1 i 5 independently selected substituents from halogen, -CN, OH, oxo, alkyl-Ci-3, halo-alkyl-C^, Oa!quÍ!o Ci-3, O-halo-alkyl-Ci-3: R5 and R6 and R5' and R6' are independently selected from H, halogen, alkyl-Ci-6, NH2, NH-alkyl-Ci-e, N(aIquilo-Ci-e)2, alkylen-Co6-C(=O)NH2; or R5 and R6 and R5' and R6t when taken together with the carbon a! to which they are attached complete a ring of 3 to 8 members containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or is substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO2, OH, oxo, alkyl-C^, halo-alkyl-Ci^, O-alkyl C1.3, O-halo-alkyl-Ci-3, SO2-alkyl-Ci-3, CO2H; or R5 and R5* and R6 and R6' independently, when taken together with the two adjacent carbon atoms to which they are attached, complete a 3- to 8-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S, or N, wherein the ring is either unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO2, OH, oxo, alkyl-Ci-3, halo-alkyl-Ci^, O-alkyl Cv3, O-haIo-alkyl-Ci-3, SO2-alkyl-Ci <j, CO2H; R7 is selected from a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl groups are optionally substituted with 1 to 4 substituents independently selected from halogen, -CN, -NO2, OH, C^ alkyl, C^ O-alkyl, C3-6 cycloalkyl, C^ O-cycloalkyl, C^ heterocycloalkyl, C^ O-heterocycloalkyl, C^ SOyalkyl, C^tCO2H, C(=O)O-alkyl, 6- to 10-membered aryl, 5- or 10-membered heteroaryl, O-(6- to 10-membered aryl) and O(5- or 10-membered heteroaryl), wherein the alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl groups are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, -NO2, OH, R13, OR13, CO2R11, NR11R12C(=O)R11, C(=S)R11, C(=O)NR11R12, NR11C(=O)NR11R12, NR11C(=O)OR13, OC(=O)NR11R12, C(=S)NR11R12, NR11C(=S)NR11R12, NR11C(=S)OR13, OC(=S)NR11R12; SOy-C^alkyl, SOy-halo-C^alkyl, SR11, SOXR13, SO3R11, SO2NR11R12, NR11SO2R13, NR11SO2NR11R12; R9 is selected from H, -CN, -NO2, alkyl-Ci-w, C2.10 alkenyl» C2-10 alkynyl, αIkylen-C0.10-cycloalkyl-C3.10t alkylen-C0-w-heterocycloalkyl-Csw, alkylen-C0-io-(5- to 10-membered heteroaryl), alkylen-C0-ir(6- to 10-membered aryl), alkylen-C0-io-(6- to 10-membered heteroaryl), alkylen-C0-10-OR11, αIkylen-C0-io-C02R11, alkylen-C0.wC(=0)NR11R12, alkylen-C0-io-C(=S)NR11R12, alkylen-C0.io-C(=0)NR11S02R13l alkylen-C0. io-C(=S)NR11S02R11, alkylene-Co.io-C(=0)R11, a!kylene-Co.1o-C(=S)R11, alkylene-Co-10-SR11, alkylene-Co-10-SOx-R13, alkylene-Co-w-SOsR11, alkyleneCmo-S02NR11R12. alkylene-Co.io-NRC(=0)R11, alkylene-Co-ioNR11C(=S)R11, alkylene-Co.io-NR11S02R11, alkylen-Co-wNR11C(=O)NR11R12, alkylen-Co-io-NR1'C(=S)NR11R12, alkylen-Co-10-NR11SOrNR^R12, a!kylen-Co-io-NR11R12, wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are unsubstituted or substituted with 1 to 7 substituents independently selected from the group consisting of oxo, CN, NO2, OR11, O-alkylen-C2-6-OR11, alkyl-C^, halo-alkyl-Ci-β, halogen. CO2R11, CONR11R12, CONR11SO2R11, COR11, SOxR11, SO3H, PO(OH)2i SO2NR11R12, NR11COR11, NR11SO2R11, NR11-CO-NR11R12, NR11-SOrNR11R12, Ca-io cycloalkyl, O-cycloalkyl-Ca-w, heterocycloalkyl Ca-io, OheterocicIoalkyl-Cs-io and NR11R12; R9 is selected from alkyl Cm o, alkenyl C2.io, alkyn-C2.io, alkylen-C3.io-cycloalkyl, alkyl n-C3.io-heterocycloalkyl, alkylen-C3.io-(5- to 10-membered heteroaryl), alkylen-C3.io-(6- to 10-membered anyl), alkylen-C3.io-(6- to 10-membered heteroaryl), alkylen-C3.io ... alkylen-Co-io-C(=O)R11, alkylen-Co-io-C(=S)R11, alkylen-Co-io-SR11, alkylen-Co-io-SOxR13, alkyl n-Co-w-SOaR11, alkylen-Co-io-S02NR11R12, alkylen-Co-io-NR11C(=O)R11, alkylen-Co-10NR11C(=S)R11, alkylen-Co-io-NR11S02R13, alkylen-Co-10NR11C(=O)NR11R12, alkylen-Co-io-NR11C(=S)NR11R12, alkylen-Co-ioNR11SO2NR11R12, alkylen-Co-io-NR11R12, wherein alkyl,'alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl,aryl and heteroaryl are unsubstituted or substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, NO2, OR11, O-alkylene-C2^-OR11, alkyl-C^, halo-alkyl-Ci-6, halogen, CO2R11, C(=O)NR11R12, C(=O)NR11SO2R11, C(=O)R11, SR”, SOxR11. SO3R11, PfOXOR11)^ SO2NR11R12, NR11C(=O)R11, nr11so2r13, NR11C(=O)NR11R12, NR11SO2NR11R12, cycloalkyl C3.W, O-cycloalkyl-Cj. 10, heterocycloalkyl C3.10. O-heterocycloalkyl-Ca-ium and NR11R12;, R11 is independently selected from H, alkyl-C^, alkylen-CM cicIoalkyl-Cj-w and alkylen-C^-heterocycloalkyl-Ca-io. wherein alkyl, alkylene, cycloalkyl and heterocycloalkyl are unsubstituted or substituted with 1 to 6 substituents selected independently from the group consisting of halogen, -CN, OH, oxo, alkyl-C1-3, haloalkyl-C1-3, O-alkyl C1-f, O-haloalkyl-C1-3, NH2, NH(C1-3 alkyl), N(C1-3 alkyl)2, heterocycloalkyl C3-6, cycloalkyl C1-e, SOz-NH-C1-3 alkyl, SOrN(C1-3 alkyl)2 and SOz-C1-3 alkyl, wherein cycloalkyl and heterocycloalkyl are unsubstituted or substituted with 1 to 3 substituents selected independently from the group consisting of F, OH, oxo, CH3, CHF2 and CF3: R12 is independently selected from H, alkyl-C^, halo-alkyl-Ci-a and cycloalkyl-C^; or R11 and R12 when taken together with the nitrogen to which they are attached complete a ring of 3 to 8 members containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO2, OH, oxo, alkyl-C1-3, halo-alkyl-C1-3, O-alkyl-C1-3, O-halo-alkyl-C1-3, SO2-alkyl-C1-3, CO2H; R13 is independently selected from alkyl Ci^, alkylene-Co-6cycloalkyl-C^io and alkyl n-Co-e-heterocycloalkyl-Cs-w, wherein alkyl, alkylene, cycloalkyl and heterocycloalkyl are either unsubstituted or substituted with 1 to 6 substituents independently selected from the group consisting of halogen, -CN, OH, oxo, alkyl-Ci <j, haloalquilo-Ci-3, O-alquilo Ci-3, O-halo-alquilo-Ci-3, NH2, NH(alquilo C1.3), N(alkyl-C1.3)2, heterocycloalkyl C^, cycloalkyl C^, SO2-NH-alkyl Cm, SO2-N(alkyl C1-3)2 and SO^alkyl Cm. wherein cycloalkyl and heterocycloalkyl are unsubstituted or substituted with 1 to 3 substituents selected independently from the group consisting of F, OH, oxo, CH3, CHF2 and CF3: n is selected between 0 and 1; x is selected independently between 1 and 2; and is selected independently between 0, 1 and 2; and wherein optionally R1- is connected to a residue selected from R2, R3, R8, R9 or R12 to form a 5- to 8-membered heterocycle, which is optionally substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO2, OH, oxo, alkyl-Ci-3, halo-alkyl-Ci <j, O-alquilo Cm. O-halo-alquilo-Ci-3. SO2alquilo-Ci-3, CO2H. In the context of the present invention, alkyl Cmo means a saturated alkyl chain having from 1 to 10 carbon atoms, which may be linear or branched. Examples include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, nonyl, and decyl. Alkyl Cm is preferred, and the most preferred is alkyl Cm. The term halo-alkyl.C1.10 or halo-alkyl-CM, respectively, means that one or more hydrogen atoms in the alkyl chain are replaced by a halogen, as defined below. A preferred example of this is the formation of a -CF3 group. The term C1-6 hydroxy-alkyl means that one or more hydrogen atoms in the alkyl chain, as defined above, are replaced by a hydroxyl group (-OH). Examples include hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2-dihydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 1-hydroxypropyl, 1-hydroxypropan-2-yl, 2-hydroxypropan-2-yl, 2,3-dihydroxypropyl, 1,3-dihydroxypropan-2-yl, 3-hydroxy-2-methylpropyl, 2-hydroxy-2-methylpropyl, 1-hydroxy-2-methylpropyl, etc. A preferred example is hydroxymethyl (-CH2OH). C2-10 alkenyl means an alkyl chain having 1 to 10 carbon atoms, which may be linear or branched, containing at least one carbon-carbon double bond. Examples include ethenyl, propenyl, decenyl, 2-methylenehexyl, and (2E,4E)-hexa-2,4-dienyl. C2-e alkenyl is preferred. C2-10 alkynyl means an alkyl chain having 1 to 10 carbon atoms, which may be linear or branched, and which contains at least one carbon-carbon triple bond. Examples include ethynyl, propynyl, and decinyl. C2-alkynyl is preferred. An alkylene C0-10 signifies that the respective group is divalent and connects the attached residue to the remaining part of the molecule. Furthermore, in the context of the present invention, Cow alkylene signifies that it represents a bond. Co-e alkylene is preferred. A C3-10 cycloalkyl group or C3-10 carbocycle means a saturated or partially unsaturated monocyclic, bicyclic, spiro, or multicyclic ring system comprising 3 to 10 carbon atoms. Examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, bicyclo(2.2.2)octyl, bicyclo[2.2.1]heptyl, adamantyl, and pentacyclo[4.2.0.02,5.03,8.04,7]octyl. A C3-6 cycloalkyl group is preferred. A cyclopropyl group is more preferred. A C3.10 heterocycloalkyl group means a saturated or partially unsaturated monocyclic, bicyclic, spiro, or multicyclic ring of 3 to 10 members in which 1, 2, or 3 carbon atoms are substituted by 1, 2, or 3 heteroatoms, respectively, the heteroatoms being independently selected from N, O, S, SO, and SO2. Examples include epoxidyl, oxethanyl, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, piperazinyl tetrahydropyranyl, 1,4-dioxanyl, morpholinyl, 4-quinuclidinyl, 1,4-dihydropyridinyl, and 3,6-dihydro-2H-thiopyranyl. The C3.10 heterocycloalkyl group may be connected through a carbon or nitrogen atom. A C^ heterocycloalkyl group is preferred. A 5- to 10-membered monocyclic or bicyclic heteroaromatic ring system (also referred to as heteroaryl in the application) containing up to 5 heteroatoms means a monocyclic heteroaromatic ring such as pyrrolyl, imidazolyl, furanyl, thiophenyl, pyridinyl, pyrimidineyl, pyrazinyl, pyrazolyl, oxazolyl, isoxazolyl, triazolyl, oxadiazolyl, and thiadiazolyl. 5- to 6-membered monocyclic heteroaromatic rings are preferred. It further means a bicyclic ring system in which the heteroatom or heteroatoms may be present in one or both rings, including bridgehead atoms. Examples include quinolinyl, isoquinolinyl, quinoxalinyl, benzoimidazolyl, benzoisoxazolyl, benzodioxanyl, benzofuranyl, benzoxazolyl, indolyl, indolizinyl, and pyrazolo[1,5-a]pyrimidineyl. The nitrogen or sulfur atom of the heteroaryl system may also be optionally oxidized to the corresponding N-oxide, S-oxide, or S,S-dioxide.Unless otherwise stated, the heteroaryl system can be connected through a carbon or nitrogen atom. Examples of N-linked heterocycles are: A 6- to 10-membered monocyclic or bicyclic aromatic ring system (also referred to as aryl in this application) means an aromatic carbon ring, such as phenyl or naphthalenyl. 5- to 6-membered aromatic rings (aryl), such as phenyl, are preferred. The term N-oxide indicates compounds in which the nitrogen in the heteroaromatic system (preferably pyridinyl) is oxidized. Such compounds can be obtained in a known manner by reacting a compound of the present invention (such as in a pyridinyl group) with H₂O₂ or a peracid in an inert solvent. The halogen is selected from fluorine, chlorine, bromine, and iodine; fluorine and chlorine are preferred. Additionally, the compounds of the present invention are partially subject to tautomerism. For example, if a heteroaromatic group containing a nitrogen atom in the ring is substituted with a hydroxyl group on the carbon atom adjacent to the nitrogen atom, the following tautomerism may occur: A C3-10 cycloalkyl or Cs.10 heterocycloalkyl group can be connected linearly or spirocyclically; for example, when cyclohexane is substituted with the heterocycloalkyl group oxethane, the following structures are possible: The expert will appreciate that when lists of alternative substituents include members that, due to their valency requirements or other reasons, cannot be used to substitute for a particular group, the list should be read with the expert's knowledge to include only those members of the list that are suitable to substitute for the particular group. Optical rotation (represented as (-) or (+) in the text) used in the compound name and Example number refers to the value measured at 365 nm, unless otherwise stated. The compounds used or prepared in the present invention may be in the form of a pharmaceutically acceptable salt or solvate. The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable, non-toxic bases or acids, including inorganic and organic bases or acids. If the compounds of the present invention contain one or more acidic or basic groups, the invention also comprises their corresponding pharmaceutically or toxicologically acceptable salts, particularly their pharmaceutically usable salts. Therefore, the compounds of the present invention containing acidic groups may be used according to the invention, for example, as alkali metal salts, alkaline earth metal salts, or ammonium salts.More precise examples of such salts include sodium salts, potassium salts, calcium salts, magnesium salts, or salts with ammonia or organic amines such as, for example, ethylamine, ethanolamine, triethanolamine, or amino acids. The compounds of the present invention containing one or more basic groups, i.e., groups that can be protonated, can be used according to the invention in the form of their addition salts with inorganic or organic acids.Examples of suitable acids include hydrogen chloride, hydrogen bromide, phosphoric acid, sulfuric acid, nitric acid, methanesulfonic acid, ptoluenesulfonic acid, naphthalenedisulfonic acids, oxalic acid, acetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, formic acid, propionic acid, pivalic acid, diethylacetic acid, malonic acid, succinic acid, pimelic acid, fumaric acid, maleic acid, malic acid, sulfaminic acid, phenylpropionic acid, gluconic acid, ascorbic acid, isonicotinic acid, citric acid, adipic acid, and other acids known to persons skilled in the art. If the compounds of the present invention simultaneously contain acidic and basic groups in the molecule, the invention also includes, in addition to the aforementioned salt forms, internal salts or betaines (zwitterions).The respective salts can be obtained by conventional methods known to persons skilled in the art, such as by contacting them with an organic or inorganic acid or base in a solvent or dispersant, or by anion exchange or cation exchange with other salts. The present invention also includes all salts of the compounds of the present invention which, due to their low physiological compatibility, are not directly suitable for use in pharmaceutical products, but which can be used, for example, as intermediates for chemical reactions or for the preparation of pharmaceutically acceptable salts. Depending on the substitution pattern, the specific compounds according to the invention may exist in stereoisomeric forms that behave as mirror images (enantiomers) or that do not behave as mirror images (diastereomers). The invention relates to both enantiomers and diastereomers, as well as to their respective mixtures. Like diastereomers, the racemic forms can be separated into the stereoisomerically uniform components in a known manner. The scope of the invention includes those compounds that only become the actual active compounds of Formulas (la), (Ib), (lia) and (Ilb) once inside the body (the so-called prodrugs). The invention relates in particular to the following embodiments: A particularly preferred embodiment of the invention relates to compounds of the above Formula (1a) and / or (1b), wherein X is selected from °Xznr8°x,nr8ox,nr8ox,nr8 Y *'nr2r3y Y ''r\ or * nr2r3y ϊ R9, respectively; and in which R1, R2R3, R4, R5, R6, R5', R6', R7R8, R9R11, R12, R13, n, xey have the meaning defined in any of the embodiments described herein. Another particularly preferred embodiment of the invention relates to compounds of the above Formulas (a) and / or (b), wherein X is selected from oS / nr8OX,NR8 And ''R9y Y ^R91respectively; and in which R1, R2, R3, R4, R5, R6, R5', R6', R7R8, R9R11, R12, R13, n, xey have the meaning defined in any of the embodiments described herein. In an alternative preferred embodiment in combination with any of the preceding or following embodiments R1 is selected from H, halogen, alkyl-Ci^, halo-alkyl-Ci-6, hydroxyalkyl-Ci-6, cycloalkyl C^, halo-cycloalkyl C3-6, -O-alkyl-C^, -Ohalo-alkyl-Ci-6-and-NH-alkyl-Ci-e. In a further preferred embodiment in combination with any of the preceding or following embodiments R1 is selected from H, halogen, alkyl-Ci-e, halo-alkyl-Ci-6, cycloalkyl C3-6, halo-cycloalkyl C^e, -O-alkyl-Ci-6, -O-halo-alkyl-C^- and -NHaIquilo-Ci-6. In a further more preferred embodiment in combination with any of the above or below embodiments, R1 is C3-6 alkyl or cycloalkyl. In a further more preferred embodiment in combination with any of the above or following embodiments, R1 is methyl or cyclopropyl. In an alternative preferred embodiment in combination with any of the preceding or following embodiments R2 is selected from H, -CN, -NO2, alkyl-C-Mo. C2-10 alkenyl, C2-10 alkynyl» alkylen-Co-io-cycloalkyl-C3.io, alkylen-Co-io-heterocycloalkyl-Ca10, alkylen-Co-io-(5- to 10-membered heteroaryl), alkylen-Co-io-(6- to 10-membered aryl), alkylen-Co-io-(6- to 10-membered heteroaryl), alkylen-Co-10-OR11, alkylen-Co-io-CC^R11, alkylen-Co-io-C(=0)NR11R12, alkylen-Co-io-C(=S)NR11R12, alkylen-Co-io-C(=0)NR11S02R13, alkylen-Co-io-C(=S)NR11S02R11, alkylene-Co-io-C(=0)R11, alkylene-Co.1o-C(=S)R11, alkylene-Co-10-SR11, alkylene-Co-io-SOxR13, alkylene-Codo-SOaR11, alkyleneCo_io-S02NR11R12, NR11C(=S)R11, NR11C(=O)NR11R12, alkylene-Co-io-NR11C(=O)R11, alkylene-Co-io-NR11SO2R13, alkylene-Co-io-NR11C(=S)NR11R12, alkylene-Co-io-alkyne-Co-10-alkylene-Co-ioNR11SO2NR11R12, alkylene-Co-io-NR11R12, wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, allyl and heteroaryl are unsubstituted or substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, NO2, OR11, O-alkylene-C2-6-OR11, alkyl-C^, halo-alkyl-C^, halogen, CO2R11, C(=O)NR11R12, C(=O)NR11SO2R11, C(=O)R11, SR11, SOxR11, SO3R11, P(=O)(OR11)2i SO2NR11R12, NR”C(=O)R11, nr11so2r13, NR11C(=O)NR11R12, NR11SO2NR”R12, C3.10 cycloalkyl, O-cycloalkyl-Cj. 10, C3-10 heterocycloalkyl. O-heterocycloalkyl-Cj-io and NR11R12; R3 is selected from H, alkyl-C^, halo-alkyl-Ct-e, -O-alkyl-Ci-β, -Ohalo-alkyl-Ci-6, cycloalkyl-C^- and heterocycloalkyl-C^, wherein alkyl, cycloalkyl and heterocycloalkyl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, OH, oxo, alkyl-Ci-3, halo-alkyl-C^, O-alkyl C^rOhalo-alkyl-Ci-3, SOralkyl-C^, CO2H; or R2 and R3 when taken together with the nitrogen to which they are attached complete a 3- to 8-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, NO2, OH, oxo, alkyl-Ci-3, halo-alkyl-Ci-3, O-alkyl C1.3, O-halo-alkyl-Ci-3, SO2-alkyl-Ci-3, CO2H; and R11, R12, R13 and x have the meaning as defined in any of the embodiments described herein. In a further preferred embodiment in combination with any of the preceding or following embodiments R2 and R3 are independently selected from H and alkyl-Ci.3, or R2 and R3 when taken together with the nitrogen to which they are attached form a complete ring of 3 to 8 members. In a more preferred embodiment in combination with any of the preceding or following embodiments R2 and R3 are H. In an alternative preferred embodiment in combination with any of the preceding or following embodiments R8 is selected from H, -CN, -NO2, alkyl-Ci-w, C2-10 alkenyl, C2.10 alkynyl. alkylene-Ca.10-cycloalkyl-C3.10, alkylene-Co-ium-heterocycloalkyl-C310, alkylene-Co-ium-(5- to 10-membered heteroaryl), alkylene-Co-ium-(6- to 10-membered aryl), alkylene-Co-ium-(6- to 10-membered heteroaryl), alkylene-Co.ium-OR11, alkylene-Co-ium-CO2R11, alkylene-Co-ium-C(=0)NR11R12, alkylene-Co-ium-C(=S)NR11R12, alkylene-Co-ium-C(=0)NR11SO2R13, alkylene-Cow-C(=S)NR11SO2R11, alkylene-Co.ium-C(=0)R11, alkylene-Co.1o-C(=S)R11, alkylene-Co-10-SR11, alkylene-Co-w-SOx-R13, alkylene-Co-io-SOaR11, alkyleneCo-w-S02NR11R12, alkylene-Co-io-NR11C(=0)R11, alkylene-Co-10NR11C(=S)R11, alkylene-Co-10-N R1'SC^R11, alkylene-Co-10 NR11C(=O)NR11R12, alkylen-Co-io-NR11C(=S)NR11R12, alkylen-Co-io-NR11· SO2-NR11R12a!quilen-Co-io-NR11R12, wherein alkyl, alkenyl, alkynyl, alkylene, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are unsubstituted or substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, NO2, OR11, O-alkyl-C2-6'OR1\ alkyl-C1.6, halo-alkyl-Cve. halogen, CO2R1\ CONR11R12, CONR11SO2R11, COR11, SOXR11, SO3H, PO(OH)2, SO2NR11R12, NR11COR11, NR11SO2R11, NR11-CO-NR11R12, NR11-SO2NR11R12, C3.10 cycloalkyl, O-cycloalkyl-C^io. C3.10 heterocycloalkyl, Oheterocycloalkyl-Cs-w and NR11R12; and R11, R12, R13 and x have the meaning as defined in any of the embodiments described herein. In a more preferred embodiment in combination with any of the preceding or following embodiments R8 is selected from H, -CN, -NO2, alkyl-Ci <j, -C(=O)R11o -C(=O)-O-R11siendo R11alquilo CM (lineal o ramificado). In a more preferred embodiment in combination with any of the above or below embodiments, R8 is selected from H. In an alternative preferred embodiment in combination with any of the preceding or following embodiments R9 is selected from Cmo alkyl, C2-10 alkenyl, C2-ium alkynyl, C0.10 alkyl-cycloalkyl-C3.10 alkyl-Co-ium-heterocycloalkyl-C3-ium alkyl-Co-ium-(5- to 10-membered heteroaryl), Co-ium-(6- to 10-membered aryl), Co-ium-(6- to 10-membered heteroaryl), Co-10OR11 alkyl-Co-ium-C02R11 and Co-ium-C(=0)NR11R12 alkyl-Co-1024 C(=S)NR11R12, alkylene-Co.io-C(=0)NR11SO2R13, alkylene-Co-ioC(=S)NR11SO2R11. alkylene-Co-io-C(=0)R11, alkylene <WC(=S)R11, alquilen-Co-10-SR11, alquilen-Co-w-SCxR13, alquilen-Co-w-SOaR11, alquilenCo-io-S02NR11R12, a!quilen-CG.io-NR11C(=0)R11, alquilen-Co-ioNR11C(=S)R11, alquilen-Co-io-NR11S02R13, alquile n-Co-ioNR11C(=O)NR11R12, alquilen-Co.io-NR1lC(=S)NR11R12alquilen-Co-10NR11SO2NR11R12t a!quilen-Co-io*NR11R12, en el que alquilo, alquenilo, alquinilo, alquileno, cicloalquilo, heterocicloalquilo, arilo y heleroarilo no están sustituidos o están sustituidos con de 1 a 7 sustituyeles seleccionados independientemente del grupo que consiste en oxo, CN, NO2, OR11, O-alquilen-C2^-OR11, alquilo-Ci^, halo-alquilo-Ci-c, halógeno, CO2R11, C(=O)NR11R12, C(=O)NR11SO2R11, C(=O)R11, sr11, soxr11, SO3R11, P(=O)(OR11)2, SO2NR11R12, NR11C(=O)R11, nr11so2r13, NR11C(=O)NR11R12, NR11SO2NR11R12, cicloalquilo C3.10. O-cicloalquilo-Cj. 10, heterocicloalquilo C3-10. O-heterocicloalquilo-Cj-io y NR11R12; y R11, R12, R13 and x have the meaning as defined in any of the embodiments described herein. In a more preferred embodiment in combination with any of the preceding or following embodiments R9 is selected from Cmq alkyl, alkylene-Co-ium-cycloalkyl-Ca-ium, alkylene-Co-ium-heterocycloalkyl-C3-ium, wherein alkyl, alkylene, cycloalkyl and heterocycloalkyl are unsubstituted or are substituted with 1 to 7 substituents selected independently from the group consisting of oxo, CN, -NO2, OR11, O-alkylene-C2^-OR11, alkyl-Ci-β, halo-alkyl-Ci, and halogen; and R11 has the meaning as defined in any of the embodiments described herein. In an even more preferred embodiment in combination with any of the preceding or following embodiments R9 is selected from alkyl Cm and cycloalkyl C^, wherein the alkyl and cycloalkyl groups are either unsubstituted or substituted with 1 to 3 substituents selected independently from the group consisting of fluorine or methyl. In an even more preferred embodiment in combination with any of the above or below embodiments, R9 is selected from methyl, ethyl, isopropyl, and cyclopropyl. In a more preferred embodiment in combination with any of the above or below embodiments, R9 is selected from methyl and cyclopropyl. A further embodiment of the invention relates to compounds of Formulas (a) and / or (b) above in combination with any of the preceding or following embodiments, wherein R4 is selected from Cm alkyl, Ci-e acyl, QM-cycloalkyl and Cs-8 heterocycloalkyl, wherein alkyl, acyl, alkenyl, cycloalkyl and heterocycloalkyl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, OH, oxo, Ci-3 alkyl, Cv3tO-Cm haloalkyl, O-Cm haloalkyl R5 and R® and R5' and R6 are independently selected from H and -alkyl Cm: or Rs and R6 and R5' and R6' when taken together with the carbon to which they are attached complete a 3- to 8-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents independently selected from the group consisting of halogen, OH, oxo, Me (-CH3), OMe (-O-CH3). CHF2, CF3, OCHF2, OCF3; or R5 and R5, and R6 and R6' independently, when taken together with the two adjacent carbon atoms to which they are attached complete a 3- to 6-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is either unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, OH, oxo, Me (-CH3), OMe (-O-CH3), CHF2, CF3, OCHF2, OCF3: R7 is selected from a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl groups are optionally substituted with 1 to 3 substituents independently selected from halogen, OH, Me(-CH3), OMe(-O-CH3), CHF2, CF3, OCHF2, OCF3, and substituted with a 6-membered aryl and a 5- or 6-membered heteroaryl group, wherein the aryl and heteroaryl groups are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, NO2, OH, R13, OR13, CO2R11, NR11R12, C(=O)R11, C(=S)R11, C(=O)NR11R12, NR11C(=O)NR11R12, NR11C(=O)OR13, OC(=O)NR11R12, C(=S)NR11R12, NR”C(=S)NR11R12, NR11C(=S)OR13, OC(=S)NR11R12; SOy-alkyl Ci-e, SOy-halo-alkyl Ci-e, SR11, SOXR13, SO3R11, SO2NR11R12, NR11SO2R13, NR11SO2NR11R12; . and in which the remaining substitutes have the meaning defined in any of the embodiments described herein. In a further preferred embodiment in combination with any of the above or following embodiments, R4 is selected from Ci-β alkyl, 5 acyl-Ci-6, cycloalkyl-C^a- and heterocycloalkyl-Cs-e, wherein alkyl, acyl, alkenyl, cycloalkyl and heterocycloalkyl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, OH, oxo, alkyl-Ci-3, halo-alkyl-Ci^, O-alkyl Ci.3)O-halo-alkyl-Ci .3. In a further preferred embodiment in combination with any of the 10 preceding or following embodiments, R4 is selected from Ci^ alkyl and C1.3 haloalkyl. In an even more preferred embodiment in combination with any of the above or below embodiments, R4 is selected from Me (-CH3). In an alternative preferred embodiment in combination with any 15 of the preceding or following embodiments R5 and R8 and R5' and R6 are selected independently of H, halogen, alkyl-C^, NH2, NH-alkyl-C^, N(alkyl-Ci-6)2,3^υϋβη-0(μ6-0(=0)NH2; or R5 and R6 and R5' and R6' when taken together with the carbon to which they are attached. They complete a ring of 3 to 8 members containing carbon atoms and optionally contain 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, NO2, OH, oxo, Ci-3-alkyl, halo-alkyl-Ci <j, O-alquilo Ci^, O-halo-alquiIo-Ci-3, SO2-alquilo-Ci-3, CO2H; -25 or R5 and R5 and R8 and R8' independently, when taken together with the two adjacent carbon atoms to which they are attached, complete a 3- to 8-membered ring containing carbon atoms and optionally containing 1 or 2 heteroatoms selected from O, S or N, wherein the ring is unsubstituted or substituted with 1 to 4 substituents selected independently from the group consisting of halogen, -CN, -NO2, OH, oxo, alkyl-Ci-3, halo-alkyl-Ci^, O-alkyl C1.3, O-halo-alkyl-Ci^; SO2-alkyl-Ci3, CO2H. - In a more preferred embodiment in combination with any of the above or below embodiments, R5 and R6 and R5' and R6 are independently selected from H, C1-3 alkyl and C1-3 haloalkyl. In an even more preferred embodiment in combination with any of the above or below embodiments, R5 and R6* are hydrogens. In an alternative preferred embodiment in combination with any of the above or below embodiments, n is selected between 0 and 1. In an even more preferred embodiment in combination with any of the above or below embodiments, n is 0. In yet another alternative preferred embodiment in combination with any of the preceding or following embodiments, R7 is selected from a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl groups are optionally substituted with 1 to 4 substituents independently selected from halogen, -CN, -NO2, OH, Ci6 alkyl, Ci-e O-alkyl, C^ cycloalkyl, O-C^ cycloalkyl, Ca-e heterocycloalkyl, Ca^ O-alkyl heteroacid, SOy-C1,6 alkyl, CO2H, C(=O)O-C1-6 alkyl, 6- to 10-membered aryl, 5- or 10-membered heteroaryl, O-(6- to 10-membered aryl), and O-(5- or 10-membered heteroaryl), wherein the alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl groups are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, -NO2, OH, R13, OR13, CO2R”, NR11R12, C(=O)R11, C(=S)R11, C(=O)NR1,R12, NR11C(=O)NR11R12, NR11C(=O)OR13, OC(=O)NR11R12, C(=S)NR11R12, NR11C(=S)NR11R12, NR11C(=S)OR13, OC(=S)NR11R12; SOy-Ο,-β alkyl. SOr halo-alkyl C^t SR11, SO,R13, SO3R11', ' SO2NR11R12, NR11SO2R13, NR1'SO2NR1'R12: and R11, R12, R13, xey have the meaning defined in any of the embodiments described in this document. In a more preferred embodiment in combination with any of the preceding or following embodiments, R7 is selected from a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl are optionally substituted with 1 to 3 substituents independently selected from halogen, OH, Me(-CH3), OMe(-O-CH3), CHF2, CF3, OCHF2, OCF3, and substituted with a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl are optionally substituted with 1 to 5 substituents independently selected from halogen, -CN, NO2, OH, R13, OR13, CO2R11, NR11R12, C(=O)R11, C(=S)R11, C(=O)NR11R12, NR11C(=O)NR11R12, NR11C(=O)OR13, OC(=O)NR11R12, ' C(=S)NR11R12, NR11C(=S)NR11R12, NR11C(=S)OR13, OC(=S)NR11R12; SOy-alkyl C^, SOyhalo-alkyl Cw, SR11, SOXR13, SO3R11, SO2NR11R12, NR11SO2R13, NR11SO2NR11R12; and R11, R12, R13, xey have the meaning defined in any of the embodiments described in this document. In a further preferred embodiment in combination with any of the preceding or following embodiments, R7 is selected from a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl are optionally substituted with 1 to 3 substituents independently selected from halogen, OH, Me(-CH3), OMe(-O-CH3), CHF2, CF3, OCHF2, OCF3, and substituted with a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl are optionally substituted with 1 to 5 substituents independently selected from halogen, OH, Me(-CH3), OMe(-O-CH3), CHF2, CF3, OCHF2, and OCF3. A further embodiment of the invention relates to compounds of Formulas (a) and / or (ib) above in combination with any of the preceding or following embodiments, wherein R7 is phenyl, optionally substituted with 1 to 4 substituents (Rx), which independently have the meaning as defined in any of the embodiments described herein for possible substituents of R7, and which are represented by Formulas (a) and (i)b: R1R1 In a further preferred embodiment in combination with any of the above or below embodiments, R7 is selected from a phenyl, which is optionally substituted with 1 to 3 substituents selected independently from F, Cl, OH, Me(-CH3), OMe(-O-CH3), CHF2, CF3, OCHF2, OCF3 and substituted with a 6-membered aryl and a 5- or 6-membered heteroaryl, wherein the aryl and heteroaryl are optionally substituted with 1 to 5 substituents selected independently from F, Cl, OH, Me(CH3), OMe(-O-CH3), CHF2, CF3, OCHF2, OCF3. In a further preferred embodiment in combination with any of the above or following embodiments, R7 is selected from an unsubstituted phenyl, which is substituted with phenyl or pyridyl, wherein phenyl or pyridyl are optionally substituted with 1 to 5 substituents selected independently from F, Cl, OH, Me (-CH3), OMe (-O-CH3), CHF21CF3, OCHF2(ocf3. In a more preferred embodiment in combination with any of the above or below embodiments, R7 is selected from an unsubstituted phenyl, which is substituted with phenyl or pyridyl, wherein phenyl or pyridyl are optionally substituted with 1 to 3 substituents selected from F, Me (-CH3), OMe (-O-CH3), CHF2, CF3, OCHF2, OCF3. A further preferred embodiment of the invention relates to compounds of Formulas (a) and / or (ib) and / or (iia) and / or (iib) above in combination with any of the preceding or following embodiments, wherein R7 is selected from the group consisting of -Another alternative preferred embodiment of the invention relates to compounds of the above Formulas (a) and / or (b) in combination with any of the preceding or following realizations, in which the group ηβ d5 i R in Formulas (a) and / or (b) is selected from the group consisting of In yet another alternative, the preferred realization of Formulas (a) and / or (b) is selected from in which R20 is selected from alkyl-Ci-4 and cycloalkyl-CM» wherein the alkyl and cycloalkyl groups are either unsubstituted or substituted with 1 to 3 substituents selected independently from the group consisting of F or Me; R21 is selected from F, CI, OH, Me, OMe, CHF2, CFs, OCHF2, OCF3; and Y is selected from nitrogen or carbon. In a more preferred embodiment, Formula (a) or (Ib) is selected from in which · R20 is selected from methyl, ethyl, isopropyl and acidopropyl; R21 is selected from F, CI, methyl, CHF2, CF3; and And the choice is between nitrogen or carbon. In yet another alternative preferred embodiment, the compounds according An additional aspect of the present invention relates to the compounds according to Formula (a), which are selected from the group consisting of A further aspect of the present invention relates to the compounds according to Formula (Ib), which are selected from the group consisting of F F In another alternative preferred embodiment, the compounds according to Formula (a) and / or (b) are selected from (-)-A / -Methyl- / V-(4-methyl-5-(S-methylsulfonimidoyl)thiazol-2-yl)-2-{4-(pyridin-2-yl)phenyl)acetamide, (-XS^-iZ^'-difluoro-Il.T-biphenin^-ylJ-AZ-methyl-W^-methyl-S-fSmethylsulfonimidoilO)thiazol-2-yl)acetamide, (-)- / V-(5-(cyclopropanesulfonimidoyl)-4-methylIltyazo-2-yl)- / \ / -methyl-2-(4-(pyridin-2-yl)phenyl)acetamide, and (-)- / V-(5-(cycIopropanesulfonimidoyl)-4-methylthiazol-2-yl}-2-(2,,5,-difluoro-[1,rbiphenyl]-4-íl)-W-methylacetamide. In another alternative preferred embodiment, the compounds according to Formula (a) and / or (b) are selected from (-)- / V-Met¡lA / ¿4-methyl-5-(S-methylsulfonimidoyl)thiazol-2-yl) -2-(4-(pyridin-2-yl)phenyl)acetamide. In another alternative preferred embodiment, the compounds according to Formula (a) and / or (b) are selected from (-)-(S)-2-(2,,5'-difluoro-[1IT-biphenII]-4-1l)-N-methyl- / V-(4-methyl-5-(SmethiIsulfonimidoyl)thiazo-2-1I)acetamide. In another alternative preferred embodiment, the compounds according to Formula (a) and / or (b) are selected from (-)- / \ / -(5-(cyclopropanesulfonimidoyl)-4-methylazol-2-yl) -A / -methyl-2-(4-(pyridin-2-yl)phenyl)acetamide. In another alternative preferred embodiment, the compounds according to Formula (a) and / or (ib) are selected from (-)-N-(5-(cyclopropanesulfonimidoyl)-4-methylthiazol-2-yl)-2-(2,,5,-difluoro-[1,r biphenyl]-4-yl)-Af-methylacetamide. Preparation of enantiomers The enantiomers according to the present invention can be prepared by separating and isolating the respective stereoselective compounds from the products resulting from non-stereoselective synthesis routes, thus comprising a mixture of the respective enantiomers, by preparative HPLC on a chiral column, as, for example, described in Examples 7, 7a, 7b and 7c below. Furthermore, it is possible to prepare the enantiomers as described herein by stereoselective synthesis and, if necessary, subsequent preparative HPLC on a chiral column or precipitation with chiral compounds, etc. Furthermore, the enantiomers can be prepared as described herein via stereoselective synthetic routes. The most common chiral tetracoordinate sulfur compounds are sulfoximines, which formally arise from asymmetric sulfones by replacing one of the two oxygen atoms with an imino nitrogen. Consequently, substituting both oxygen atoms in asymmetric sulfones with different imino groups leads to other chiral, tetracoordinate structures, namely sulfodiimides. Of interest is the fact that optically active chiral sulfonimidoyl chlorides have also been obtained. Due to the presence of a good leaving group, these chlorides are excellent substrates for the nucleophilic substitution reaction and provide the corresponding esters and amides in a highly stereoselective manner. It is also possible to synthesize optically active sulfoximines from optically active sulfoxides. The review Chem. Lett. 2004:33.482 summarizes the routes for the synthesis of sulfoximines. A recent publication in Angew. Chem. Int. Ed. 2016: 55,7203 summarizes the state of the art of sulfoximine synthesis. The chiral synthesis of sulfoximines can be carried out by oxidation of readily available chiral sulfoxides (e.g., Org. Lett. 2006:8,2349) or by chiral resolution of an intermediate or final racemic compound via tartrate (e.g., WO2012038411) or with camphorsulfonic acid (e.g., Tetrahedron: Asymm. 2001:12,1255). Therefore, in a further aspect, the present invention also relates to a process for preparing the compounds according to Formula (a) and / or (ib) above, such as, in particular, the compounds according to any of the embodiments described above, the process comprising the steps a) providing a mixture comprising the compounds of formulas (a) and (ib), said mixture being represented by the general formula (b): b) separate and isolate the compounds of Formula (a) and / or (b) using HPLC on a chiral column; in which in Formula (I), the substituents have the meaning defined in the embodiments described above. It is clear to the expert that in the process of the present invention, the substituents of Formula (I) have the specific meaning, corresponding to the meaning of any specific embodiment as defined above. In a more preferred embodiment, Formula (a) and / or (Ib) is selected from and in step b), separation in a chiral column provides pure (-) enantiomer. In a further aspect, the present invention relates to a process for preparing the compounds according to Formula (1a) and / or (1b) above, such as, in particular, the compounds according to any of the embodiments described above by stereoselective synthesis and, optionally, preparative HPLC on a chiral column or precipitation with chiral compounds. Accordingly, in an additional aspect, the present invention relates to compounds obtainable by any of the processes as described herein. An additional aspect of the present invention relates to the compounds of any of the embodiments described above, as well as the compounds obtainable by any of the processes of the present invention for use as a medicament. In particular, the invention relates to the compounds described in the present invention for use in the treatment or prophylaxis of a disease or disorder associated with viral infections. More specifically, the invention relates to the compounds described in 5 of the present invention for use in the treatment and prophylaxis of a disease or disorder associated with viral infections caused by wild-type or genetically modified viruses encoding a helicase and / or primase, by inhibiting the helicase and / or primase enzymes. More specifically, the invention relates to the compounds described in 10 of the present invention for use in the treatment and prophylaxis of a disease or disorder associated with viral infections caused by wild-type or genetically modified viruses whose nucleic acid encodes a helicase and / or a primase and the related enzymes can be inhibited by said compounds at concentrations below 100 pM in vitro. 15. More particularly, the invention relates to the compounds described in the present invention for use in the treatment or prophylaxis of a disease or disorder, which are associated with viral infections caused by herpes viruses, such as, in particular, by herpes simplex virus or, more particularly, HHV1, also called HSV-1 and / or HHV2, also called HSV-2. In an additional aspect, the Invention relates to the compounds described in the present invention for use in the treatment or prophylaxis of neurodegenerative diseases caused by viruses, such as, in particular, Alzheimer's disease. In a further aspect, the invention relates to the compounds described herein for use in the treatment or prophylaxis of herpes infections, particularly herpes simplex infections in patients with herpetic disease, such as cold sores, genital herpes and herpes-related keratitis, Alzheimer's disease, encephalitis, pneumonia, hepatitis or dissemination of the virus are a risk of transmission; in patients with a suppressed immune system, such as patients with AIDS, cancer patients, patients with a genetic or hereditary immunodeficiency, transplant patients; in newborn children and infants; in herpes-positive patients, particularly herpes simplex-positive patients, to suppress recurrence or eliminate the virus (suppression therapy);patients, particularly patients with herpes positivity, particularly patients with herpes simplex positivity, who are resistant to nucleoside antiviral treatment such as acyclovir, penciclovir, famciclovir, ganciclovir, valacyclovir or resistant to foscamet or cidofovir.; In a further aspect, the invention relates to the described compounds of the present invention, which are characterized by an IC50 (VHS1 / Vero) value in an in vitro VHS-1 activity selectivity assay in Vero cells as described in the Examples of the present invention of, preferably, IC50 below 100 pM, more preferably, IC50 below 10 pM and, particularly, IC50 below 1 pM. In a further aspect, the invention relates to the described compounds of the present invention, which are characterized by an ED50 value in an in vivo animal model as described in the Examples of the present invention, preferably an ED50 of less than 10 mg / kg for HSV-1, more preferably less than 5 mg / kg for HSV-1, and, most preferably, less than 2 mg / kg for HSV-1. In a further aspect, the invention relates to the described compounds, which are characterized by exhibiting non-reduced or reduced inhibition of carbonic anhydrase, such as, in particular, the inhibition of carbonic anhydrase I and / or carbonic anhydrase II. Within the meaning of the present invention, non-reduced or reduced inhibition of carbonic anhydrase is defined particularly by IC50 (inhibitory concentration) values ​​in a carbonic anhydrase II activity assay according to R. Iyer et al. J. Biomol. Screen. 2006: 11782 and / or in a carbonic anhydrase I activity assay according to AR Katritzky et al. J. Med. Chem. 1987:30,2058 of IC50 > 2.0 μM, preferably > 3.0 μM, more preferably > 5.0 μM.Even more preferably, zero or reduced carbonic anhydrase inhibition in the sense of the present invention is defined particularly by IC50* (inhibitory concentration) values ​​in a human carbonic anhydrase activity assay II as described in detail in the Examples of the present invention of IC50 > 2.0 μM, preferably 3.0 μM, more preferably > 5.0 μM and more preferably > 10 μM. The compounds of the present invention are considered for use in the prophylaxis and treatment of the respective disorders and diseases in humans as well as in animals. Therefore, the invention relates to the use of the compounds of the present invention as described herein for the preparation of a medicament. Furthermore, the invention relates to a method for treating a disease or disorder associated with viral infections, such as a disease or disorder associated with viral infections caused by herpes viruses, particularly herpes simplex virus, as well as a method for treating neurodegenerative diseases caused by viruses, particularly Alzheimer's disease, said methods comprising administering to a human or animal in need an effective amount of a compound of the present invention or a composition comprising said compounds of the present invention as described herein. In practical use, the compounds used in the present invention can be combined as the active ingredient in an intimate mixture with a pharmaceutical vehicle according to conventional pharmaceutical compounding techniques. The vehicle can take a wide variety of forms depending on the desired form of administration, for example, oral or parenteral (including intravenous). In the preparation of compositions for oral dosage forms, any of the usual pharmaceutical media can be used, such as, for example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, and the like in the case of liquid oral preparations, such as, for example, suspensions, elixirs, and solutions; or vehicles such as...starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of solid oral preparations such as, for example, powders, hard and soft capsules and tablets, solid oral preparations being preferred over liquid preparations. Due to their ease of administration, tablets and capsules represent the most advantageous single-dose oral form, in which case solid pharmaceutical vehicles are obviously used. If desired, tablets can be coated using standard aqueous or non-aqueous techniques. Such compositions and preparations must contain at least 0.1 percent of the active compound. The percentage of active compound in these compositions can, of course, be varied and can conveniently range from approximately 2 percent to approximately 60 percent of the unit weight. The amount of active compound in such therapeutically useful compositions is such that an effective dosage will be achieved. Active compounds can also be administered intranasally, for example, as liquid drops or sprays, or as eye drops. Tablets, pills, capsules, and the like may also contain a binder such as tragacanth gum, gum arabic, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, or alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When a dosage form is a capsule, it may contain, in addition to the materials of the type described above, a liquid vehicle such as a fatty oil. Various other materials may be present, such as coatings or substances used to modify the physical shape of the dosage unit. For example, tablets may be coated with shellac, sugar, or both. A syrup or elixir may contain, in addition to the active ingredient, sucrose as a sweetener, methyl and propylparabens as preservatives, a coloring agent, and a flavoring agent such as cherry or orange. The compounds used in the present invention can also be administered parenterally. Solutions or suspensions of these active compounds can be prepared in water suitably mixed with a surfactant, such as hydroxypropyl cellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof, and in oils. Under normal storage and use conditions, these preparations contain a preservative to prevent the growth of microorganisms. Suitable dosage forms for injection include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the dosage form must be sterile and fluid to the extent that it allows for easy injection. It must be stable under manufacturing and storage conditions and protected from contamination by microorganisms such as bacteria and fungi. The vehicle may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Any suitable route of administration may be used to provide a mammal, especially a human, with an effective dose of a compound of the present invention. For example, oral, rectal, topical, parenteral (including intravenous), ocular, pulmonary, nasal, and similar routes may be used. Dosage forms include tablets, lozenges, dispersions, suspensions, solutions, capsules, creams, ointments, sprays, and the like. Preferably, the compounds of the present invention are administered orally or as eye drops; more preferably, the compounds of the present invention are administered orally. The effective dosage of the active ingredient used can vary depending on the specific compound, the method of administration, the condition being treated, and its severity. An expert in the technique can easily determine this dosage. The compounds of the present invention may also be present in combination with other active ingredients, in particular with one or more active ingredients that exhibit advantageous effects in the treatment of any of the disorders or diseases described herein. Most particularly, the compounds of the present invention are present in a composition in combination with at least one additional active principle that is effective in the treatment of a disease or disorder associated with viral infections (antiviral active compounds), preferably a disease or disorder associated with viral infections caused by herpes viruses, such as, in particular, by herpes simplex viruses, and are therefore related to a combination therapy so named.The at least one additional active ingredient that is effective in the treatment of a disease or disorder associated with viral infections (antiviral active compounds) is preferably selected from the group consisting of nucleoside drugs such as acyclovir, valacyclovir, penciclovir, ganciclovir, famciclovir and trifluridine, as well as compounds such as foscamet and cidofovir or its ester cidofovir [(S)-HPMPC] with a hexaethylene glycol residue. Accordingly, the present invention further relates to a pharmaceutical composition comprising one or more of the novel compounds of the present invention as described herein and at least one pharmaceutically acceptable vehicle and / or excipient and / or at least one additional active ingredient that is effective in treating a disease or disorder associated with viral infections (antiviral active compounds). EXPERIMENTAL PART The mixtures comprising the compounds of the present invention 10 according to Formula (a) and (Ib) and as described in any of the prior embodiments, used in step a) of the process of the present invention as described above, can be prepared by a combination of methods known in the art including the procedures described in Schemes I to III of International Application No. 15 published PCT / EP2017 / 058077 and comprising additional details as set forth below. The synthesis of the acid building block R7(CR5,R6')nCR5R6COOH can be carried out as described in WO2001 / 47904 and coupled to the appropriate thiazole building block. Coupling the acid building block R7(CR5'Re')nCR5R6COOH with a 5-sulfonic acid-substituted thiazole can provide the intermediate lia (Scheme II), which can be converted to sulfonyl chloride llb by treatment with oxalyl chloride. Reaction of this intermediate with NHR2R3 and triphenylphosphine gives the target compound lie, which can then be oxidized, for example, with tert-butyl hypochlorite in the presence of NH2R8 to give the target compound lid. An alternative route to lid derivatives using readily available sulfonimides is described in Y. Chen et al. (RSC Advances 2015:5,4171) using nucleophilic substitution of sulfonimidoyl chloride formed in situ with different amines. Additional routes for lid derivatives are described in Angew. Chem. Int. Ed. 2013:52,9399 and ChemMedChem 2013:8,1067. Scheme II The coupling of the acid building block R7(CR5,R6')nCR5R6COOH with a 5-alkylthio-substituted thiazole can provide intermediate IIa (Scheme III), which can be oxidized to the alkylsulfinyl derivative IIb. Likewise, oxidation of intermediate IIa with the azide derivative N3R8 and FeCl2 can provide the sulfinimidoyl derivative IIe, which can be further oxidized, for example with Na2O3 to provide the sulfonimidoyl derivative IId. In the case where R8 represents a cyano moiety, an alternative route can also be used as outlined in SJ Park et al. (ChemMedChem 2013:8,217) (H2NCN, Phl(OAc)2, then mefaCPBA). Yo Scheme III In all cases, R2R3o R8 can serve as a protecting group and can be deprotected in a manner similar to that described in, for example, 5 Greene's Protective Groups in Organic Synthesis (ISBN: 978-1-118-05748-3). The compounds of the invention have a chiral sulfur atom attached to the thiazole ring, giving rise to two enantiomers, which have either an R or S configuration at the sulfur atom and which are the subject of the present invention. In particular, this is the case for the S-substituted sulfoximines as represented in Scheme IV: the Ib Illa lllb S-enantiomer R-enantiomer Scheme IV The general fragment structures Ia and Ib are pairs of enantiomers. In the case of R9, it is an alkyl group, for example, methyl, and R8 is a proton, as represented in fragment structures Illa and lllb. Illa has the S configuration, and lllb has the R configuration. The homochiral compounds of the invention can be prepared by separating the racemic mixture by chromatography on a chiral stationary phase, for example, using HPLC or SCF technology with an appropriate chiral stationary phase (chiral column material) and appropriate mobile phases, under appropriate conditions such as flow rate, pressure, and temperature. Alternatively, the homochiral compounds of the present invention can be prepared by classical resolution, using the formation of an appropriate diastereomeric salt, subsequent recrystallization, and final release of the free base. Furthermore, a racemic mixture of chiral sulfoximines can be resolved into its enantiomers by organocatalytic kinetic resolution as described in J. Am. Chem. Soc. 2016:138,2166. Alternatively, the homochiral compounds of the present invention can be prepared by stereoselective synthesis, resulting in enantho-enriched final compounds that can be recrystallized to provide enantiopure homochiral compounds. It is also possible to synthesize optically active sulfoximines from optically active sulfoxides. The review in Chem. Lett. 2004:33.482 summarizes routes for the synthesis of sulfoximines. A recent publication in Angew. Chem. Int. Ed. 2016:55,7203 summarizes the state of the art for the synthesis of sulfoximines. In the reaction schemes, the remaining substituents may have the meaning defined in the present invention. Abbreviations ACN acetonitrile aqueous acid DCM dichloromethane DMF dimethylformamide DMSO dimethyl sulfoxide EA ethyl acetate h hour or hours HPMC hydroxypropylmethylcellulose IPA isopropyl alcohol THF tetrahydrofuran PE petroleum ether at room temperature (23°C ± 2°C) sat. ' saturated / a (aqueous / a) In particular, the following starting compounds can be prepared as follows, which can be obtained in each case as mixtures (or racemates) comprising the respective specific stereoisomers / enantiomers that can be obtained by the process of the present invention. Experimental section Example 4: 2-(2*,5,-d¡fluoro-[1,r-bÍphenyl]-4-yl)-N-methyl-N-(4-methi!-5(methylsulfinyl)thiazol-2-i!)acetamide Ί F Step 1: A / ,4-dimethyl-5-(methylthio)thiazol-2-amine (P4a) I · HN S-# P4a s A solution of 5-bromo- / V,4-dimethylthiazol-2-amine (2.06 g, 9.95 mmol) in MeOH (20 mL) was slowly added, with ice cooling, to a solution of NaSMe (1.74 g, 24.9 mmol) in MeOH (15 mL). The mixture was heated to 60°C and stirred for 2 hours, evaporated, and resuspended in MeCN. After centrifugation, the supernatant was separated and evaporated. The resulting solid was resuspended with Et2O and centrifuged to give the intermediate P4a. Step 2: 2-(2,,5-Difluoro-ri,T-biphenin-4-yl)-A / -methyl- / \ / -(4-methyl-5-(methylthio)thiazol-2¡Dacetamide (P4b) F A solution of amine P4a (994 mg; 5.71 mmol) and DIPEA (1.89 ml, 11.4 mmol) in DMF (3 ml) was cooled to -20 *C, then a cooled solution of 2-(2',5*-difluoro-[1,T-biphenyl]-4-II)acetic acid (1.56 g, 6.28 mmol; document WO 2003 / 000259) and 1-[b / s(dimethylamino)methylene]-1H-1t2,3-triazolo[4,5bjpyridinium 3-oxide hexafluorophosphate (2.39 g, 6.28 mmol) in DMF (5 ml) was added and the mixture was stirred at room temperature overnight, poured into water and extracted with EtOAc (2 x). The combined organic layer was washed with brine (2x) and a saturated solution of NaHCOa, dried over Na2SO4, evaporated and purified by column chromatography (PE / DCM = 1:0 to 1:1) to provide Intermediate P4b (625 mg, 27%). Step 3;2-(2*,5-Difluoro-f1,r-biphenyl1-4-yl)-A / -methyl-A / -(4-methyl-5(methylsulf¡niDthiazoÍ-2-yl)acetamide (4) A solution of the intermediate P4b (1.4 g, 3.46 mmol) in MeOH (35 mL) was cooled to 0 °C, then potassium peroxymonosulfate (1.09 g, 1.77 mmol) in water (18 mL) was added and the solution was stirred for 20 min at 0 °C, inactivated with a saturated solution of Na2S2O3 and extracted with EtOAc (2x). The combined organic layer was washed with water (2x) and brine, dried over Na2SO4, evaporated and purified by column chromatography PE / DCM / MeOH (1:0:0 to 1:1:0 to 0:19:1) to give Example 4 (419 mg, 29%). 1H NMR (CDCI3, 250 MHz) δ: 7.57-7.53 (m, 2H), 7.37 (d, 2H), 7.17-6.98 (m, 3H), 4.09 (s, 2H), 3.75 (s, 3H), 2.96 (s, 3H), 2.51 (s, 3H). MS found: 421.3 [M+H]*, 841.5 [2M+H]*· The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Example 5: 242,,5'-Difluoro-[1,T-blphen¡l]-4-n)-W-metn-W-(4-methyl-5-(S-methylN-((1,1-dimethylethoxy)carbonll)sulfinimidoyl)thiazol-2-ll)acetamIde EITHER EITHER A solution of compound P4b (197 mg, 390 pmol) and tert-butyl azidoformate (277 mg, 1.95 mmol) in dry degassed DCM (1.5 mL) was cooled to -20 °C in argon. Then, anhydrous FeCl2 (49 mg, 390 pmol) was added, and the solution was allowed to reach boiling point and stirred for 4 hours. It was diluted with water and extracted with EtOAc (2x). The combined organic layer was washed with water and brine, dried over Na2SO4, and evaporated to provide the sample. Example 5. MS found: 520.4 [M+Hj*. The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Example 6: 2-(2,,5'-DifIuoro-[1ir-biphenyl]-4-ll)-N-methyl-W-(4-methyl-5-{S-methylN-((1,1-dimethylethoxy)carbonyl)su!fonimidoll)thiazol-2-yl)acetamide A solution of compound 5 (100 mg, 193 pmol) in THF (10 mL) was mixed with a solution of NaCl (206 mg, 963 pmol) in water (3 mL) and ruthenium(III) chloride hydrate in water (330 mL). After 5 minutes, the mixture was diluted with water and EtOAc and extracted with EtOAc (3x). The combined organic layer was washed with water and brine, dried over Na₂SO₄, evaporated, and purified by HPLC to provide Example 6. The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Example 7: 2-(2',5,-Difluoro-[1,T-biphenyl]-4-yl)-N-methyl-N-(4-methyl-5-(S-methylsulfonimidoyl)azo-2-1)acetamide A solution of compound 6 in DCM was mixed with 50% aqueous trifluoroacetic acid at -20 °C and the mixture was stirred for 1 hour at room temperature, evaporated and lyophilized in tert-BuOH / H2O (4:1) to obtain Example 7. 'H NMR (CDCI 3,400 MHz) δ: 7.56-7.53 (m, 2H), 7.36 (d, 2H), 7.18-6.95 (m, 3H), 4.08 (s, 2H), 3.75 (s, 3H), 2.95 (s, 3H), 2.51 (s, 3H). MS found: 436.3 [M+H]*. The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Yo Preparation of enantiomers from example 7: Example 7(-) F 7(-) The title compound was prepared and further characterized by separation of the racemic mixture 7 by chiral SFC chromatography, using Chíralcel OJ-H as the stationary phase and 70 / 30% by volume CO2 / MeOH as the mobile phase. The following conditions were applied: Injection break 10 injection break Bora Injection will Cosolvent Column Sample Position of our column temperature of the column CO2 flow rate Cosolvent flow 1 Cosolvent total flow Front pressure Retropression Pressure rest Wavelength of PDA start Wavelength of PDA end 24 / 6 / 2017 2:52100 PM 5 MeOH OJ-H (4.6»100*5ua) 2FX-43S-M Pl: ID 39.3 3 .· 1>2 30 4 157 120 37 214 339 Example 7(-) is the first enantiomer to elute (retention time: 2.4 min, Figure 1a and 1b). Assignment to the (S) configuration was performed via X-ray analysis of Example 8. This enantiomer is further characterized by a specific negative optical rotation of [a]20Hg365 nm -19° (c = 1 g / 100 ml, CHCl3). 1H NMR (DMSO-d6, 500 MHz) δ: 7.56-7.58 (m, 2H), 7.45-7.36 (m, 4H), 7.29-7.25 (m, 1H), 4.69 (s, 1H), 4.23 (s, 2H), 3.72 (s, 3H), 3.14 (d, J = 0.5 Hz, 3H), 2.52 (s, 3H). MS found: 436.3 [M+H]*. Alternative enantiomeric separation for Example 7(-): The title compound was prepared and further characterized by separation of the racemic mixture 7 by chiral SFC chromatography, using OJ 20 × 250 mm, 10 pm (Daicel) as the stationary phase and CO2 / IPA:ACN= 55 / 45 as the mobile phase and the following additional data: Instrument: FC-80 (Thar, Waters) Column temperature: 35 °C. Flow rate: 80 g / min Back pressure: 100 bar Detection wavelength: 254 nm Cycle time: 4 min Sample solution: 60 g dissolved in 2000 ml of IPA Injection volume: 4.5 ml Example 7(-) is the first enantiomer to elute (retention time: 3.1 min). It has a specific positive optical rotation of [a]20539nm + 3.4° (c = 0.9644 g / 100 ml, ACN). Example 7(+): (+)-(R)-2-(2',5'-Difluoro-[1,1,-biphenyl-4-yl)-W-methyl-N-(4-methyl-5-(S-methylsulfonimidoyl)thiazo-2-11)acetyl The title compound was prepared and further characterized by separation from the parsernic mixture 7, resulting from Example 7, by chiral SFC chromatography, using Chíralcel OJ-H as the stationary phase and 70 / 30% by volume COs / MeOH as the mobile phase. The following conditions were applied: Injection time injection date Boza 24 / 4 / 2017 2:52:00 PM Injection volume 9 Co-solvent MeOH Column OJ-H (4.6«100*5ua) Sample ZFX-435-M Sample size Pit ID Column density 3J.3 CO2 flow rate a.a Solvent flow rate 1.2 t Co-solvent 30 Total flow 4 Front pressure i 57 Petroproslonro 120 Pressure drop 37 FOX start wavelength 214 PCX end wavelength 35» Example 7(+) is the second enantiomer that elutes (retention time: 3.2 min, Figure 1a and 1c). The assignment to the (R) configuration was performed via X-ray analysis of Example 8. This enantiomer is further characterized by a specific positive optical rotation of [a]20Hg365 nm +20* (c = 1 g / 100 mi, CHCI3). 1H NMR (DMSO-de, 500 MHz) δ: 7.56-7.58 (m, 2H), 7.45-7.36 (m, 4H), 15 7.29-7.25 (m, 1H), 4.69 (s, 1H), 4.23 (s, 2H), 3.72 (s, 3H), 3.14 (d, J = 0.5 Hz, 3H), 2.52 (s, 3H). MS found: 436.3 [M+H]+. Example 7a: N-[5-(ClcIoproplIsulfonimldoll)-4-methyl-tlazol-2-ll]-2-[4-(2,5άΐΑυοΓθ{6ηί1)ίΘηίΙ]-Ν-ΓηΘ1ΙΙ-3αθ13ΠΊ1ά3 Stage 1: Cyclopropanethiol (P7aa) HSp'“t> Sulfur (2.56 g, 80 mmol) was added to a solution of magnesium cyclopropyl bromide (80 mL, 80 mmol) in THF (20 mL), and the mixture was stirred at reflux temperature for 1 hour. After cooling to 0 °C, LiAlHU (0.76 g, 80 mmol) was added, and the mixture was stirred at reflux for 1 hour, then cooled to 0 °C. 25% H₂SO₄ was added slowly, and the mixture was extracted with Et₂O. The organic phase was washed with water, saturated NaHCO₃, and brine, and dried over Na₂SO₄. The crude product P7aa was used directly in the next stage without purification. Stage 2:5-(Cyclopropylthio)- / \ / ,4-dimethylthiazol-2-amine (P7ab) A solution of 5-bromo- / V,4-dimethylthiazol-2-amine in DMF (20 mL) (2.5 g, 12.1 mmol) was mixed with a solution of the crude product P7aa from Step 1 (80 mmol, th.) and K₂CO₃ (3.3 g, 24.2 mmol), and the mixture was stirred at 60 °C for 16 hours. The mixture was filtered through Celite, water was added, and the mixture was extracted with EtOAc. The organic phase was washed with water and brine, dried over Na₂SO₄, filtered, and concentrated. The residue was purified by column chromatography on silica gel to yield the title compound (0.60 g, 25%) as a solid. N-[5-{Clclopropnsu!fonlmidoll)-4-methi!-thiazo!-2-ll]-2-[4-(2,5difIuorophenyl)phenyl]-N-methi!-acetamide (7a) Example 7a was prepared using a method similar to that described for Example 7, using compound P7ab as the starting material. NMR *Η (CDCb, 400 MHz) δ: 7.56-7.54 (m, 2H), 7.35 (d, J = 8.4 Hz, 2H), 7.14-7.07 (m, 2H), 7.02-6.97 (m, 1H), 4.07 (s, 2H), 3.73 (s, 3H), 3.22-2.84 (s, a, 1H), 2.702t66 (m, 1H), 1.41-1.34 (m, 1H), 1.30-1.21 (m, 1H), 1.10-1.01 (m, 1H), 1,000.91 (m, 1H). MS found: 461.1 [M+H]*. The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Preparation of enantlomers of the compound in example 7a: Example 7a (.): (-)-N-(5-(ClclopropanesulfonlmÍdoyl)-4-methylthiazol-2-ll)-2(2,15'-difluoro-[1,Γ-blphenyl]-4-H)-N-methyl!acetamide unknown absolute configuration Stage a) The racemic mixture 7a resulting from Example 7a was provided, comprising a mixture of the respective enantiomers / stereoisomers. Stage b) The title compound was prepared by separation of the racemic mixture 5 7a by chiral SFC chromatography, using Chiralcel OD-3 as the stationary phase and 65 / 35% by volume of CCVíEtOH / ACN as the mobile phase). The following conditions were applied: . Column: CHIRALCEL D0-3 (4.6 x 100 mm, 3 µm) Co-solvent: EtOH / ACN Column temperature: 35°C Co-solvent: 35 Reprint: 2000 ps Flow rate: -2 ml / min Descr. ChnLProc^ PDA start wavelength: PDA 280 µn nm (210 µn) nm 200 nm PDA end wavelength: 400 nm Example 7a (-) is the enantiomer that elutes first (retention time: 1.8 min, Figure 2a and 2b). This enantiomer is further characterized by a specific negative optical rotation of [aj^Hgses nm] -84* (o = 0.5 g / 100 ml, CHCl3), [a]20NaM9nm-22· (c = 1 g / 100 ml, CHCh). 1H NMR (CDCI3, 400 MHz) δ: 7.54 (d, J = 8.0 Hz, 2H), 7.35 (d, J = 8.0 15 Hz, 2H), 7.15-7.08 (m, 2H), 7.02-6.98 (m, 1H), 4.08 (s, 2H), 3.74 (s, 3H), 3.06 (s, 1H), 2.71-2.67 (m, 1H), 1.41-1.36 (m, 1H), 1.31-1.26 (m, 1H), 1.08-1.05 (m, 1H), 0.98-0.94-0.91 (m, 1H). MS found: 461.0 [M+HJ*. Example 7a (+) Stage a) The racemic mixture 7a resulting from Example 7a was provided, comprising a mixture of the respective enantiomers / stereoisomers. Stage b) The title compound was prepared by separation of the racemic mixture • 7a by chiral SFC chromatography, using Chiralcel OD-3 as the stationary phase and 65 / 35% by volume CO2 / (EtOH / ACN) as the mobile phase. The following conditions were applied: Column: CHIRALCEL D0-3 (4.6 x 100 mm, 3 µm) Co-solvent: EtOH / ACN Column temperature: 35°C Co-solvent: 35°C Backpressure: 2000 ps Flow rate: 2 m³ / min Chnl.Proc. Descr. PDA 280.5 nm (210-400) nm PDA start wavelength: 200 nm PDA end wavelength: 400 nm Example 7a(+) is the second enantiomer to elute (retention time: 2.3 min, Figure 2a and 2c). This enantiomer is further characterized by a specific positive optical rotation of [aj^Hgses nm +83' (c = 0.5 g / 100 mi, CHCI3), (a]MNas89 nm +23' (c = 1 g / 100 mi, CHCI3). RMN1H (CDCh, 400 MHz) δ: 7.54 (d, J = 8.0 Hz, 2H), 7.35 (dtJ = 8.0 Hz, 2H), 7.15-7.08 (m, 2H), 7.02-6.98 (m, 1H), 4.08 (s, 2H), 3.74 (s, 3H), 3.06 (s, 1H), 2.71-2.67 (m, 1H), 1.41-1.36 (m, 1H), 1.31-1.26 (m, 1H), 1.08-1.05 (m, 1H), 0.98-0.94-0.91 (m, 1H). MS encontrado: 461,0 [M+Hj*. Example 7b: N-[5-(clopropyl sulfonyl methyldoyl)-4-methyl-tiazol-2-il]-N-methyl-2-[4(2-piridil)fenil]acetamida The Ejemplo 7b is prepared with a similar name to the description for the Ejemplo 7a using the acid 2-(4-(piridin-2-il)fenil)acético and the acético lugar 2-(2*,5dif Iuoro-[1,T-bifenil]-4-¡l)acétíco. RMN1H (CDCI3, 400 MHz) δ: 8.70-8.68 (m, 1H), 7.99 (d, J = 8.4 Hz, 2H), 7.80-7.65 (m, 2H), 7.37 (d, J = 8.4 Hz, 2H), 7,307.21 (m, 1H), 4.09 (s, 2H), 3.71 (s, 3H), 3.06 (s, 1H), 2.72-2.62 (m, 1H), 2.63 (s, 3H), 1.42-1.22 (m, 2H), 1.10-0.92 (m, 2H). MS encontrado: 427,2 [M+Hf. The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Preparation of enantiomers of the compound in example 7b: Example 7b (-): (-)-N-(5-(cyclopropanesulfonimidoyl)-4-methylhydroxylazo-2-11)-N-methyl-2-(4-(pyridin-2-yl)phenyl)acetamide * unknown absolute configuration Stage a) The racemic mixture 7b resulting from Example 7b was provided, comprising a mixture of the respective enantiomers / stereoisomers. Stage b) The title compound was prepared by separation of racemic mixture 7b using chiral SFC chromatography, using Chiralcel OZ-H as the stationary phase and 55 / 45% volume CO2 / (IPA / ACN, 3:2) as the mobile phase. The following conditions were applied: Co-solvent IFA:ACN-3:2 Column OZ-H 100H,€cm Sample Sum CD-MIX Sample Well Fl: 5C Column Temperature 39.9 CO2 Flow Rate ** *1* Co-solvent Flow Rate 1.8 % Co-solvent 45 Total Flow 4 Front Pressure 15€ Back Pressure 117 Pressure Drop 39 PDA Start Wavelength 2X4 1Q PDA End Wavelength 359 Example 7b (-) is the enantiomer that elutes first (retention time: 1.8 min, Figure 3a and 3b). This enantiomer is further characterized by a specific negative optical rotation of [aj^Hgses nm] -171' (c = 1 g / 100 ml, CHCl3), [a]20Na589 nm -24' (c = 1 g / 100 ml, CHCl3). 'H NMR (DMSO-de, 500 MHz) δ: 8.67-8.66 (m, 1H), 8.07 (d, J = 8.5 Hz, 2H), 7.97-7.87 (m, 2H), 7.39 (d, J = 8.5 Hz, 2H), 7.36-7.34 (m, 1H), 4.65 (s, 1H), 4.22 (s, 2H), 3.71 (s, 3H), 2.82-2.79 (m, 1H), 2.54 (s, 3H), 1.11-1.07 (m, 1H), 5 0.99-0.91 (m, 3H). MS found: 427.2 [M+H]*. Example 7b(+): (+)-N-(5-(cyclopropanesulfonimidoyl)-4-methylthiazol-2-yl)-N,methyl-2-(4-(pyridin-2-yl)phenyl)acetyl * unknown absolute configuration Stage a) The racemic mixture 7b resulting from Example 7b was provided, comprising a mixture of the respective enantiomers / stereoisomers. Stage b) The title compound was prepared by separation of the racemic mixture 7b by chiral SFC chromatography, using as the stationary phase Chiralcel OZ-H and as mobile phase 55 / 45% volume of CO2 / OPA / ACN, 3:2). The following conditions were applied: Codlsolvent Column Sample Pocilio gives our column temperature CO2 flow rate Solvent flow rate % Solvent flow rate Total flow Front pressure Backpressure Pressure drop IRAI 03:2 CZ-H 100*4,€cn 5un CD-P2 Pl; 5B 39,$ 1.8 45 4 156 117 Wavelength of PDA Start 214 PDA end wavelength. Example 7b (+) is the second enantiomer to elute (retention time: 2.8 mintFigure 3a and 3c). Said enantiomer is further characterized by a positive specific optical rotation of [a]20Hg365 nm +170' (c = 1 g / 100 ml. CHCh), [α]20Ν,5Μ nm+22' (c = 1 g / 100 mi. CHCh). 1H NMR (DMSO-dg, 500 MHz) δ: 8.67-8.66 (m, 1H), 8.07 (d, J = 8.5 Hz, 2H), 7.97-7.87 (m, 2H), 7.39 (d, J = 8.5 Hz, 2H), 7.36-7.34 (m, 1H), 4.65 (s, 1H), 4.22 (s, 2H), 3.71 (s, 3H), 2.82-2.79 (m, 1H), 2.54 (s, 3H), 1.11-1.07 (m, 1H), 10 0.99-0.91 (m, 3H). MS found: 427.2 [M+HJ*. Example 7c: ^-Methyl-^-[4-methyl-5-(methylsulfonyl-H)thiazol-2-l)-2-(4-(2plridyl)phenyl]acetamide Example 7c was prepared in a similar way to that described for Example 7, using 2-(4-(pyridine-2-yl)pheniI)acetic acid instead of 2-(2',5'-difluoro[1,1'-biphenyl]-4-ii)acetic acid. 1H NMR (DMSO-de, 400 MHz) 6: 8.67-8.66 (m, 1H), 8.07 (d, J = 8.4 Hz, 2H), 7.97-7.88 (m, 2H), 7.40-7.34 (m, 3H), 4.67 (s, 1H). 4.23 (s, 2H), 3.71 (s, 3H), 3.13 (s, 1H). 2.52 (s, 3H). MS found: 401.1 [M+Hf. The resulting product comprises a mixture of the respective enantiomers / stereoisomers and can be used to prepare the 5 particular enantiomeric compounds according to the present invention, for example, in step a) of the process of the present invention as described above, by isolating the enantiomers therefrom. Preparation of enantiomers of example compound 7c: Example 7c(-): (-)-N-Methyl-N-(4-methyl-5-(S-methylsulfonimidoyl)thiazol-2-yl)-210(4-(plridin-2-11)phenin)acetamide * absolute configuration unknown The compound in the title was prepared by separation from a racemic mixture. 7c by chiral SFC chromatography, using as stationary phase Chiralcel OD-3 and as a mobile phase 70 / 30% by volume of CO2 / (MeOH / ACN, The following conditions were applied: Column: Co-solvent; Column temperature: %Cosolvent: Reprint: Caudal: Descr. Chnl.Proc; PDA Start Wavelength: PDA end wavelength: CHIRALCEL D0-3(4.6*100mm,3um) ACN / MeOH(1:1) 2000ps 2ml / min PDA 280.0 nm (200-€00)nm 200 nm 400 nm Example 7c(-) is the enantiomer that elutes first (retention time: 5.6 min, Figure 4a and 4b). This enantiomer is further characterized by a specific negative optical rotation of [a]20Hg365 nm -19® (c = 1 g / 100 mi, CHCl3). 1H NMR (DMSO-d6t400 MHz) δ: 8.67-8.66 (m, 1H), 8.07 (d, J = 8.4 Hz, 2H), 7.97-7.88 (m. 2H), 7.40-7.34 (m, 3H), 4.67 (s, 1H), 4.23 (s, 2H), 3.71 (s, 3H). 3.13 (s, 1H), 2.52 (s, 3H). MS found: 401.1 [M+H]*. Example 7c(+): (+)-W-Methyl-W-(4-methyl-5-(S-methylsulfonimidoyl)tlazol-2-yl)-2(4-(plridin-2-II)phenyl)acetamide unknown absolute configuration Stage a) The racemic mixture 7c resulting from Example 7c was provided, comprising a mixture of the respective enantiomers / stereoisomers. Stage b) The title compound was prepared by separation of the racemic mixture 7c by chiral SFC chromatography, using Chiralcel OD-3 as the stationary phase and 70 / 30% by volume CO2 / (MeOH / ACN, 1:1) as the mobile phase. The following conditions were applied: Column: Co-solvent; Column temperature; %Cosolvent; Retropreslón; Caudal: Descr. Chnl.Proc; PDA start wavelength: PDA end wavelength: CHIRALCEL D0-3(4,6'100mm,3um) ACN / MeOH(1:1) 2000psi 2ml7min PDA 280.0 nm (200-600) nm 200 nm 400 nm Example 7c (+) is the second enantiomer to elute (retention time: 6.0 min, Figure 4a and 4c). This enantiomer is further characterized by a specific positive optical rotation of [a]20Hg365nm +18° (c=1g7l00 mi, CHCI3). 1H NMR (DMSO-de, 400 MHz) δ: 8.67-8.66 (m, 1H), 8.07 (d, J = 8.4 Hz, 2H), 7.97-7.88 (m, 2H), 7.40-7.34 (m, 3H), 4.67 (s, 1H), 4.23 (s, 2H), 3.71 (s, 3H), 3.13 (s, 1H), 2.52 (s, 3H). MS found: 401.1 [M+H]*. Example 8: (R)-N- (5- (N-acetyl-S-methylsuIfonlmldoll) -4-τηβΙΙΙΗ3ΖθΙ-2-ΙΙ)-2(2',5'-difluoro-[1l1*-biphenyl] -4-yl)-N-methylacetamlda (8) F To a solution of the second elution isomer of Example 7 (400 mg, 0.91 mmol) in DCM (10 mL), NEts (185 mg, 1.82 mmol) was added. Reaction 15 was stirred for 10 minutes, and then AcCI (107 mg, 1.35 mmol) was added in one portion. After stirring for an additional 30 minutes, the mixture was concentrated under vacuum and purified by HPLC preparation to give Example 8 (280 mg, 63 %) in the form of a white solid. 1H NMR (400 MHz, DMSO) δ: 7.57 (d, J = 6.8 Hz, 2H), 7.46-7.36 (m, 4H), 7.30-7.25 (m, 1H), 4.26 (s, 2H), 3.75 (s, 3H), 3.53 (s, 3H), 2.53 (s, 3H), 1.97 (s, 3H). MS found: 478.1 [M+H]*. Determination of absolute stereochemistry: Compound 8 was crystallized in diisopropyl ether at room temperature (slow evaporation) to obtain a colorless prism. The absolute configuration could be adequately determined so that the crystal examined is the (R) configuration in the acetylated sulfoximine moiety. The Ortep (50%) chart of Example 8 with labeling scheme illustrates these findings (Figure 5). Crystal data and structure refinement for compound 8: Empirical Formula Weight of formula Temperature Wavelength Crystal system Spacer group Cell unit dimensions C22 H21 F2 N3 O3 S2 477.54 110K 1.54178 A Monoclinic P2j 8=103167(5) A a-90°. b - 83533(4) A β= 96.088(2)°. c-13.1044(6) A γ-90°. Volume 2 Density (calculated) Absorption coefficient F(000) Crystal size Theta range for data collection Index ranges Collected reflections Independent reflections Termination at theta- 65.122° Absorption correction Max transmission and min Refining method Data / restrictions / parameters Goodness of fit in F final R indices [ l>2sigma(I)] R indices (all data) Absolute structure parameter Extinction coefficient Dif Largest, peak and hole 1122.95(9) A3 2 1.412 Mg / m3 2.557 mnr1 496 0.16 x 0.08 x 0.04 mm3 5.765 at 65.122°.-12 <h < 12, -9 < k< 9,-15 < 1 < 15 15475 3791 (R(ínt) = 0,0190] 99,8 % Semiempírica de equivalentes ¿ 0,90 y 0,77 Mínimos cuadrados de matriz completa en F 3791 / 1 / 293 1.060 R1 =0,0213, wR2 = 0,0582 R1 =0,0214, wR2 = 0,0585 0,048(3) n / a 0316 y -0,188 e.A*3. Bond lengths [A] and angles [e] for compound 8: S(l)-C(16) 1,735(2) C(8)-C(9) 1,388(3) S(D-C(17) 1,736(2) C(8)-H(8) 0,9500 S(2)-O(2) 1,4479(15) C(9)-C(l0) 1,389(3) S(2)-N(3) 13655(18) C(9)-H(9) 0,9500 S(2)-C(17) 1.749(2) C(10)-C(ll) 1386(3) S(2)-C(20) 1,758(2) C(l0)-C(13) 1,509(3) W(D ¡363(4) C(ll)-C(12) 1386(3) F(2)-C(4) 1356(3) C(ll)-H(ll) 0,9500 O(l)-C(14) 1320(3) C(12)-H(12) 0,9500 O(3)-C(2l) 132K3) C(13)-C(14) 1,523(3) N(l)-C(14) 1375(3)· C(13)-H(I3A) 0,9900 N(l)-C(16) 1390(3) C(I3)-H(13B) 0,9900 N(1>C(15) 1.474(3) C(15)-H(15A) 03800 N(2)-C(16) 1306(3) C(15>H(I5B) 0,9800 N(2)-C(18) 1368(3) C(15>II(15C) 03800 N(3)-C(21) 1381(3) C(17)-C(18) 1362(3) C(l)-C(2) 1378(4) C(18)-C(19) 1,496(3) C(l>C(6) 1381(3) C(19)-H(19A) 0,9800 C(2)-C(3) 1385(4) C(19)-H(19B) 0,9800 C(2)-H(2) 0.9500 C(19)-H(19C) 0,9800 C(3>C(4) 1381(3) C(20)-H(20A) 0,9800 C(3>H(3) 0,9500 C(20)-H(20B) 0,9800 C(4)-C(5) 1388(3) C(2O>H(2OC) 0,9800 C(5)-C(6) 1398(3) C(21)-C(22) 1,499(3) C(5)-C(7) 1.492(3) C(22)-H(22A) 0,9800 C(6>H(6) 03500 C(22)-H(22B) 0,9800 C(7)-C(12) 1395(3) C(22)-H(22C) 0,9800 C(7)-C(8) 1,401(3) C(16>S(1)-C(17) 87,15(10) N(3)-S(2X(20) 101,41(10) O(2)-S(2)-N(3) 120.48(9) C(I7)-S(2)-C(20) 105,19(10) O(2)-S(2)-C(17) 106,66(9) C(14)-N(l)-C(16) 120,05(17) N(3)-S(2)-C(17) 111,81(10) C(14)-N(l)-C(15) 122,54(17) O(2)-S(2)-C(20) 11037(10) C(16)-N(l)-C(15) . 117,42(16). C(16)-N(2)-C(18) C(21)-N(3)-S(2) F(l)-C(l)-C(2) F(1)-C(I)-C(6) 110,93(17) 117,68(14) 119,1(2) 117,5(3) C(ll)-C(12)-C(7) 120,99(19) C(1I)-C(I2)-H(12) 119,5 C(7)-C( 12)-11(12) 119,5 C(10)-C(13)-C(14) 112,96(18) C(2X(1)-C(6) 123,4(3) C(10)-C(13)-H(13A) 109,0 C(l)-C(2)-C(3) 117,6(2) C(14)-C( 13)-11(13 A) 109,0 C(l)-C(2)-H(2) 121,2 C(10)-C(13)-H(13B) 109,0 C(3)-C(2)-H(2) 121,2 C(14)-C(13)-H(13B) 109,0 C(4)-C(3)-C(2) 119,1(2) H(13A)-C(13>H(13B) 107,8 C(4)-C(3)-H(3) 120,4 O(l)-C(14)-N(l) 121,11(18) C(2)-C(3)-H(3) 120,4 O(1)-C(I4)-C(13) 122,83(19) F(2)-C(4)-C(3) 117,0(2) N(1)-C(14)<(13) 116,06(18) F(2)<(4)-C(5) 119,0(2) N(1)-C(15)-H(I5A) 1093 C(3>C(4)-C(5) 123,9(2) N(1)-C(15)-H(15B) 1093 C(4>C(5K(6) 116,3(2) H(15A)-C(15)-H(15B) 1093 C(4)-C(5)-C(7) 1233(2) • N(l)-C( 15)-11( 15C) 1093 C(6)-C(5)-C(7) 1203(2) H(15A)-C(I5)-H(15C) 109,5 C(l)-C(6)-C(5) 119,6(2) H(15B)-C( 15)-11( 15C) 109,5 C(1>C(6>H(6) 120,2 N(2)-C(16)-N(l) 120,74(18) C(5)-C(6>H(6) 120,2 N(2X(16)-S(1) 116,02(15) C(12>C(7)-C(8) 117,83(19) N(l)-C(I6)-SCl) 12334(15) C(12)-C(7)-C(5) 119,10(19) - C(18)-C(17)-S(l) 111,71(16) C(8)-C(7)-C(5) 123,1(2) C(18)-C(17)-S(2) 129,52(16) C(9)-C(8)-C(7) 120.6(2) S(1)-C(17>S(2) 118,70(12) C(9)-C(8>H(8) 119,7 C(17)-C(I8)-N(2) 114,13(17) C(7)-C(8)-H(8) 119,7 C(17)-C(18)-C(I9) 127,9(2) C(8)-C(9)-C(10) 1213(2) N(2)-C(18)-C(19) 117,95(18) C(8)-C(9)-H(9) 119,4 C(18)-C(19)-H(19A) 1093 C(IO)-C(9>H(9) 119,4 C(18)-C(19)-H(19B) 1093 C(1I)-C(1O)-C(9) 11835(19) H(19A)-C( 19)-11( 19B) 1093 C(ll)-C(10)-C(13) 119,9(2) C(18)-C(19)-H(19C) 109,5 C(9)-C(10)-C(13) 121,9(2) .H(19A)-C(19)-H(19C) 1093 C(10)-C(Il)-C(12) 121,1(2) H(19B)-C(19)-H(19C) 1093 C(10)-C(ll)-H(ll) 119,4 S(2)-C(20>H(20A) 109,5 C(12)-C(l 1)-11(11) 119,4 S(2)-C(20)-II(20B) 1093. H(20A)-C(20)-H(20B) 109,5 C(21)-C(22)-H(22A) 1093 S(2)-C(20)-H(20C) 109,5 C(21)-C(22)-H(22B) 1093 H(20A)-C(20)-H(20C) 109,5 H(22A)-C(22)-H(22B) 1093 H(20B)-C(20)-H(20C) 109,5 C(21)-C(22)-H(22C) 1093 O(3)-C(21)-N(3) 125,8(2) H(22A)-C(22)-H(22C) 1093 O(3)-C(21)-C(22) 121.8(2) H(22B)-C(22)-H(22C) 1093 N(3)-C(21)-C(22) 11237(18) Angulos de torsión [e] para el compuesto 8: O(2)-S(2)-N(3)-C(21) 62,35(19) C(9)-C(10)-C(ll)-C(I2) -03(3) . C(17)-S(2)-N(3)-C(21) -64,09(18) C(13)-C(10)-C(llX(12) -1793(2) C(20)-S(2)-N(3)-C(21) .-175,72(16) C(10)-C(ll)-C(12)-C(7) 0,6(3) F(l)-C(l)-C(2)-C(3) 179,8(2) C(8)-C(7)-C(12)-C(ll) -0,7(3) C(6)-C(l)-C(2)-C(3) 0,1(4) C(5)-C(7)-C(12)-C(ll) -179,9(2) C(l)-C(2)-C(3)-C(4) •0,3(4) C(ll)-C(10)-C(13>C(I4) -110,6(2) C(2)-C(3)-C(4)-F(2) 179,1(2) C(9)-C(10)-C(13)-C(I4) 70,4(3) C(2)-C(3)-C(4)-C(5) 0.4(4) C(16)-N(l)-C( 14)-0(1) 1.7(3) F(2)-C(4)-C(5)-C(6) -179,0(2) C(15)-N(1)-C(14)-O(1) -1783(2) C(3)-C(4)-C(5)-C(6) > -030) C(16)-N(l)-C(14)-C(13) -178,76(18) F(2)-C(4)-C(5)-C(7) -1,0(3) C(15)-N(l)-C(14)-C(13) 13(3) C(3K(4)-C(5)-C(7) 177,7(2) C(10)-C(13)-C( 14)-0(1) -3,6(3) F(I)-C(1)-C(6)-C(5) -179,7(2) C(10>C(13)-C(14)-N(l) 176,87(18) C(2)-C(l)-C(6)-C(5) 0,0(4) C(18)-N(2)-C(16)-N(1) -179,56(18) C(4)-C(5)-C(6)-C(l) 0,1(3).C(18)-N(2)-C(16>S(1) -0,4(2) C(7)-C(5FC(6)-C(1) -178,0(2) C(14)-N(l)-C(16)-N(2) 17730(19) C(4)-C(5)-C(7)-C(12) -145,5(2) C(15)-N(l)-C(16)-N(2) -23(3) C(6)-C(5)-C(7)-C(12) 32,4(3) C(14)-N(l)-C(16)-S(l) -13(3) C(4>C(5)-C(7)-C(8) 35,3(3) C(15)-N(l)-C(16)-S(l) 178,33(16) C(6)-C(5)-C(7)-C(8) -146,7(2) C(17)-S(l)-C(16)-N(2) -0,11(16) C(12)-C(7)-C(8)-C(9) 0,4(3) C(17)-S(l)-C(16>-N(l) 179,05(18) C(5)-C(7)-C(8)-C(9) 179,6(2) C(16>S(1)-C(17)-C(18) 036(16) C(7>C(8>C(9)-C(10) •0.1(3) C(16)-S(l)-C(17)-S(2) 177,73(13) C(8)-C(9)-C(10)-C(lI) 0,0(3) O(2>S(2)-C(17)-C(18) -17735(19) C(8)-C(9)-C(I0)-C(13) 179,0(2) N(3)-S{2)-C(17)-C(18) -43,9(2). C(20)-S(2)-C(17)-C(l8) 65,3(2) 0(2>S(2)-C(17)-S(l) 5,86(15) N(3>S(2)-C(17)-S(1) 139,50(12) C(20)-S(2)-C(17)-S(l) -111,27(13) S(1>C(17)-C(18>N(2) -0,9(2) S(2)-C(17)-C(18)-N(2) -177,69(16) S(1)-C(17)-C(18)-C(19) 177.80(18) S(2)-C(17)-C(18)-C(19) 1.0(3) C(16)-N(2)-C(18)-C(17) 0.8(3) C(16)-N(2)-C(18)-C(19) -178.03(18) S(2)-N(3)-C(21)-O(3) -0.3(3) S(2)-N(3>C(21)-C(22) 179.43(16) Example 9; ^-(bromomethiO^^^S'-difluoro-IIJ'-blfenll] -4-i1)-N-methylacetamide)thiazol-5-yl)(methyl)(oxo) -16-sulfaneylidene)tere-butylcarbamate To a solution of Example 6 (1.50 g, 2.80 mmol) in CHCl3 (50 mL), N-bromosuccinimide (524 mg, 2.94 mmol) and benzoyl peroxide (136 mg, 0.56 mmol) were added. The reaction solution was stirred at 70 °C for 2 hours, cooled to room temperature, inactivated with saturated Na₂SaO₃ (50 mL), and extracted with DCM (3 x 10⁻⁶ 100 mL). The combined organic layer was concentrated and purified by FCC (EA:PE = 1:2) to give Example 9 as a white solid. Example 10: 2-(2',5'-Difluoro-[1,r-biphenyl]-4-11)-N-(4-(hydroxymethyl)-5-(5-methylsulfonimido11)thazo1-2-11)-N-methylacetamide To a solution of Example 9 (600 mg, 0.98 mmol) in 1,4-dioxane (15 mL) H2O (10 mL) (396 mg, 2.40 mmol) was added, and then stirred at 100 °C overnight, cooled, and extracted with EtOAc (3 x 100 mL). The combined organic layer was concentrated and purified by FCC (EA: PE = 1:1), to give Example 10 as a white solid. Preparation of enantiomers of example compound 10: Example 10a: 2-(2,5,-Difluoro-[1,r-biphenyl]-4-yl)-N-(4-(hydroxymethyl)-5-(Smethylsulfonylmaldehyde thiazol-2-Π)-N-methylacetamide (first isolated enantiomer) * unknown absolute configuration The title compound was prepared by separation of the racemic mixture 10, resulting from Example 10, by chiral SFC chromatography, using the following instruments and conditions: Instrument: SFC-80 (Thart Waters) Column Name: OZ 20 x 250 nM, 10 μM (Daicel) Column Temperature: 35°C Flow Rate: 80 g / min Back Pressure: 100 bar Cycle Time: 4 min Sample Solution: 0.37 g dissolved in 30 ml of MeOH Injection Volume: 1 ml Example 10a is the first elution enantiomer (retention time: 2.3 min, Fig. 6a and 6b). 1H NMR (500 MHz. DMSO-de) δ: 7.57 (dd, J = 1.3,7.8 Hz, 2H), 7.45-7.36 (m, 4H), 7.29-7.25 (m, 1H), 5.25 (t, J = 5.8 Hz, 1H), 4.78 (s, 1H), 4.75-4.64 (m, 2H), 4.25 (s, 2H), 3.75 (s, 3H), 3.21 (d, J = 0.5 Hz, 3H). MS found: 452.1 [M+H]*. Example 10b: 2-(^^-Difluoro-II.r-blfenllj^-Ilj-W^-(Hydroxymethyl)-5-(Smethylsulfonyldo1l)thiazol-2-yl)-N-rnet1acetamide (second isolated enantiomer) • unknown absolute configuration Example 10b is the second enantiomer to elute (retention time: 2.9 min, Fig. 6a and 6c). The 'H NMR and MS data correspond to Example 10a. Biological assays The novel compounds according to the invention exhibit a surprisingly broad spectrum of activity. They display not only antiviral activity, especially against members of the Herpesviridae family, particularly herpes simplex virus (HSV), but also improved solubility and reduced carbonic anhydrase activity. These compound characteristics lead to an enhanced pharmacokinetic profile for the novel compounds of the present invention and, consequently, to profound antiviral activity in vivo. Therefore, they are suitable for the treatment and prophylaxis of disorders caused by viruses, especially herpesviruses, and in particular, disorders caused by herpes simplex virus. The new compounds according to the invention exhibit a surprising and unpredictable reduced carbonic anhydrase activity. The new compounds according to the invention exhibit a surprising and unpredictable reduced carbonic anhydrase activity, in particular, reduced or unprovoked side effects from carbonic anhydrase activity, such as urothelial hyperplasia or diuretic pharmacological activity (G. Durand-Cavagna et al. Fund. Appl. Toxico!. 1992:18,137). The increased solubility improves the formulation of compounds, enhances the characteristics of ADME, and especially the formulations used for intravenous applications. Aqueous solubility (PBS, pH 7.4) was determined at Eurofins, Cerep, Panlabs according to CA Lipinski et al. Adv. Drug Del. Rev. 1997:46,3. In vitro activity Viruses and cells: HSV (HSV-1 Walki, HSV-1F, HSV-2 MS, clinical HSV isolates, and HSV-resistant strains) were cultured in Vero cells (ATCC CCL-81) under the following conditions: Cells were cultured in M199 medium (5% fetal terephthalene serum, 2 mM glutamine, 100 µL / mL penicillin, 100 pg / mL streptomycin) in cell culture flasks at 37 °C and 5% CO₂. Cells were divided twice weekly (1:4). For infection, the medium was removed, cells were washed with Hank's solution, separated using 0.05% trypsin and 0.02% EDTA, and incubated at a density of 4 × 10⁵ cells / mL under the above conditions for 24 hours. The medium was removed and the virus solution was added at a moi of <0.05 in a volume of 2 ml per 175 cm2 surface. Infected cells were incubated at 37 °C, 5% CO2 for 1 hour and then the medium was made up to a volume of 50 ml per 175 cm2 bottle.Three days after infection, the cultures showed clear signs of a cytopathic effect. The virus was released by freezing (80 °C) and thawing (37 °C) the infected cultures twice. Cell debris was removed by centrifugation (300 g, 10 minutes, 4 °C) and the supernatant was frozen in aliquots at -80 °C. The virus titer was determined using a plaque assay. For this purpose, Vero cells were seeded in 24-well plates at 4 x 10⁵ cells per well and, after 24 hours of incubation (37 °C, 5% CO₂), infected with 100 µL of inoculum (dilutions (10⁻² to 10¹²) of the virus stock). One hour after infection, the medium was removed and the cells were coated with 1 mL of coating medium (0.5% methylcellulose, 0.22% sodium bicarbonate, 2 mM L-glutamine, 100 µL / mL penicillin, 100 pg / mL streptomycin, 5% fetal bovine serum in MEM-Eagle medium with Earl's salt) and incubated for 3 days in a cell incubator at (37 °C, 5% CO₂). The cells were fixed using 4% formalin for 1 hour, washed with water, stained with Giemsa for 30 minutes, and then washed and dried. Using a plate viewer, the virus titer was determined. The stocks used for the experiments had a titer of 1 x 10⁵ / ml to 1 x 10⁸ / ml. The antiviral activity was determined using a patented (DE10235967 and W02004 / 015416) and subsequently published (G. Kleymann et al. J. Biomol. Screen. 2004;9,578) activity selectivity assay in 96- or 384-well microtiter plates using various cell lines of neuronal, lymphoid, and epithelial origin, such as, for example, Vero (African green monkey kidney cells), MEF (murine embryonic fibroblasts), HELF (human embryonic fibroblasts), NT2 (human neuronal cell line), or Jurkat (human lymphoid T cell line). The relevant experimental details from the aforementioned patent and publication for evaluating the antiviral activity of the invention (disclosed compounds) are described below. The effect of the substances on the spread of the cytopathogenic effect was determined in comparison with the reference compound acyclovir-sodium (ZoviraxTM), a clinically approved anti-herpes chemotherapeutic agent.The compounds (50 mM stock solution diluted in DMSO) are examined in microtiter plates (e.g., 96-well flat-bottom cell culture plates) at a final concentration of 250 to 0.5 μM or, in the case of potent antiviral compounds, from 250 to 0.5 nM in 2 to 4 replicates (4 to 2 substances per plate). Toxic and cytostatic effects or precipitation of the compounds are also examined. After appropriate dilution of the compounds (1:2) in the microtiter plate in the appropriate medium (100 μL), a cell suspension (50 μL, 1 x 10⁴ cells per well), such as, for example, Vero cells in M199 (medium 199 with 5% fetal bovine serum, 2 mM glutamine and, optionally, 100 IU / ml penicillin and 100 pg / ml streptomycin) or MEF or HELF cells in EMEM (Eagle minimal essential medium with 10% fetal bovine serum, 2 mM glutamine and, optionally, 100 IU / ml penicillin and 100 pg / ml streptomycin) or NT2 and Jurkat cells in DMEM ((4,5 mg / L glucose plus pyridoxine) with 10% fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, non-essential amino acids, and optionally 100 IU / mL penicillin and 100 pg / mL streptomycin) are added to each well, and the cells in the relevant wells are infected with the appropriate amount of virus (HSV-1 or HSV-2, which has an MOI (multiplicity of infection) of 0.0025 for Vero, HELF, and MEF cells, and an MOI of 0.1 for NT2 and Jurkat cells). The plates were then incubated at 37 °C in a CO2 cell incubator (5% CO2) for several days. After this time, the cellular grass of, for example, Vero cells in virus-free controls from 25 infection sites is completely destroyed or lysed by the cytopathic effect (CPE) of herpesviruses (100% CPE). The plates are initially evaluated visually using a microscope and then analyzed using a fluorescent dye. For this purpose,The cell supernatant is aspirated from all wells of the MTP plate, and the wells are filled with 250 µL of PBS wash solution (phosphate-buffered saline). The PBS is then aspirated, and all wells are filled with 200 µL of fluorescent dye solution (fluroscein diacetate, 10 pg / ml in PBS). After an incubation time of 30 to 90 minutes, the test plates are read on a fluorescence detector at an excitation wavelength of 485 nm and an emission wavelength of 538 nm. In this case,The IC50 is the semimaximal fluorescence intensity relative to the uninfected cell control (value 100%). The IC50 [%] value ((infected cells treated with compound minus untreated virus-infected cells) divided by (cell control or infected cells treated with Zovirax minus untreated infected cells) × 100) can also be referenced to a suitable active compound control (see assay description: infected cells in the presence of suitable concentrations of an antiviral compound such as, for example, Zovirax 20 μM). This active compound control achieves fluorescence intensities of approximately 85 to 100% relative to the uninfected cell control. The results for some example compounds, comprising a mixture of the respective enantiomers (indicated in Table 1 by #) as well as the (+) and () enantiomers separated and isolated from Examples 7a, 7b, and 7c above,In the table 1 a continuation:, TABLA 1 10 Ejemplo CI50 (Video infections for VHS-1) CI50 (Vero infections for VHS-2) CI50 (ACV, consistent with VHS-1) 15 .7* 25-100 Nm 25-100 nM 25-100 nM 7(·) 10-50 nM 10-50 nM 10-50 nM 7(+) 30-200 nM 30-200 nM 30-200 nM 7a* 30-100 nM 50-500 nM 30-100 nM 7a(-) 20r50 nM 30-300 nM • 20-50 nM 20 7a(+) 250-750 nM 500-2000 nM 250-750 nM 7b* 100-400 nM 250-1000 nM 100-400 nM 7b(-) 75-250 nM 200-750 nM 75-250 nM ' 7b(+) 500-1500 nM 2000-8000 nM 500-1500 nM 7c 150-600 nM 200-1500 nM 150-600 nM 25 7c(·) 75-300 nM 100-750 nM 75-300 nM 7c(+) 0.3-0.75 pM 0.5-1.5 pM 0.3-0.75 pM 8 10-50 pM 50-250 pM 10-50 pM 10a 50-250 nM 1-5 μΜ 50-250 μΜ 10b 1-5 μΜ 5-25 μΜ 1-5 μΜ Aciclovir 0,5-3 μΜ 0,5-3 μΜ >25 μΜ Preference is given to antiviral compounds according to the invention whose IC50 (HSV-1 / Vero) in the activity selectivity assay described above is preferably below 100 μM, more preferably below 10 μM and very particularly preferably below 1 μM. As shown in Table 1, Examples 7, 7a, 7b, and 7c exhibit antiviral activity even when present as mixtures of their respective enantiomers. Furthermore, Examples 7, 7a, 7b, and 7c also demonstrate antiviral activity for the isolated enantiomers, confirming that individual enantiomers will also exhibit antiviral activity. The results also show that, surprisingly, enantiomers with a specific counterclockwise, levorotatory, or negative rotation exhibit more potent antiviral activity compared to the racemate and enantiomers with a specific clockwise, dextrorotatory, or positive rotation. The results also show that, surprisingly, the 7(-) enantiomer with the absolute (S) configuration exhibits more potent antiviral activity compared to the racemate and the 7(+) enantiomer with the absolute (R) configuration. The new compounds according to the invention are thus active compounds useful for the treatment and prophylaxis of disorders. caused by viruses, particularly herpesviruses and especially herpes simplex virus. The particularly active enantiomers are those that show a specific negative optical rotation and that elute first in the chiral column defined in the case of 7(-) the absolute configuration is (S), since they are at least a factor of two more potent than the respective enantiomers with opposite absolute configuration (R) with a specific positive optical rotation and that elute second in the chiral column defined in the case of 7(+). Examples of areas of indication that can be mentioned are: 1) Treatment and prophylaxis of herpes infections, particularly herpes simplex infections in patients with herpetic disease, such as oral herpes, genital herpes and herpes-related keratitis, Alzheimer's disease, encephalitis, pneumonia, hepatitis or viral dissemination, etc. 2) Treatment and prophylaxis of herpes infections, particularly herpes simplex infections, in patients with a suppressed immune system (e.g., patients with AIDS, cancer patients, patients with a genetic or hereditary immunodeficiency, transplant patients). 3) Treatment and prophylaxis of herpes infections, particularly herpes simplex infections, in newborn and infant children 4) Treatment and prophylaxis of herpes infections, in particular herpes simplex infections and in herpes-positive relatives, in particular herpes simplex-positive patients, to suppress recurrence or elimination of the virus (suppression therapy). 5) Treatment and prophylaxis of herpes infections, in particular herpes simplex infections and in herpes-positive patients, in particular herpes simplex-positive patients, who are resistant to nucleoside antiviral treatment such as acyclovir, penciclovir, famciclovir, ganciclovir, valacyclovir etc. Carbonic anhydrase activity Carbonic anhydrase II activity and its respective inhibition were performed according to R. Iyer et al. J. Biomol. Screen. 2006: 11.782 and / or in the case of carbonic anhydrase I activity according to AR Katritzky et al. J. Med. Chem. 1987:30,2058 based on human starting material. The following describes a protocol for determining the enzymatic activity of carbonic anhydrase at room temperature using the pH indicator method: One µL of inhibitor (50 mM stock solution in DMSO) is diluted to a final test concentration ranging from 100 µM to 1 nM (or 1 µL of water in controls) and incubated for 2 min with 0.5 to 2 EU of human carbanhydrase I (180 U / mg) in 400 µL of water and 200 µL of phenol red indicator solution (20 mg / L). An enzyme unit (EU) is defined as an amount that doubles the uncatalyzed rate. The hydration reaction is initiated by adding 100 µL of 0.5 M bicarbonate buffer (30.3 M Na₂CO₃; 30.2 M NaHCO₃) and subsequent CO₂ discharge through a needle (0.7 x 30 mm; 22G x 1.25) into the test solution at a rate of 10 mL of gas / min. The color change time (pH 7.2) is determined using a micro-chronometer or stopwatch. The percentage of inhibition is calculated as described below: (time to change color without enzyme - time to change color with enzyme and inhibitor) / (time to change color without enzyme - time to change color with enzyme). The IC50 (inhibitory concentration) values ​​reflect the molar amount of inhibitor, which reduces EU activity in the test system by 50%. In the test system, carbonic anhydrase inhibition was not detected nor was it significantly reduced for Example 7, 7(-), 7(+), 7c, 7c(-), 7c(+) and 7b. In contrast to this finding, Example 87 (document WO2001 / 047904) shows carbonic anhydrase inhibition in the 1 to 3 pM range (IC50). The example compounds, comprising a mixture of the respective enantiomers, are indicated in Table 2 with #. As shown in Table 2, Examples 7b and 7c show zero or reduced carbonic anhydrase inhibition, even when present as mixtures of the respective enantiomers. Furthermore, for Examples 7 and 7c, the isolated enantiomers also show zero or reduced carbonic anhydrase inhibition. This demonstrates that individual enantiomers will also exhibit reduced or non-reduced carbonic anhydrase inhibition (even if not explicitly shown here, as in Example 7b). The results are shown below in TABLE 2: TABLE 2 Example CI50 (pM) human carbanhydrase II 7* >10 7(-) >10 7(+) >10 7c* >10 7c(-) >10 7c(+) >10 7b* >10 reference example 87 (W02001 / 47904) 1.7 acetazolamide 0.026 Aqueous solubility (PBS, pH 7.4) The measurement of aqueous solubility was performed according to Lipinski, CA et al. Adv. Drug Del. Rev. 1997:46,3. The relevant information from the literature is described below. Aqueous solubility (μM, shaker flask, 24 h incubation, ta) of a compound (10 mM stock in DMSO) was determined by comparing the peak area (HPLC-UV / VIS) of the main peak in a calibration standard (200 pM) containing organic solvent (methanol / water, 60 / 40, v / v) with the peak area of ​​the corresponding peak in a buffer sample (PBS, pH 7.4). Additionally, chromatographic purity (%) was defined as the peak area of ​​the main peak relative to the total integrated peak area in the HPLC chromatogram of the calibration standard. In the aqueous solubility test system, a significantly increased solubility (at least one order of magnitude) was detected for Example 7 compared to Example 87 (WO2001 / 047904). The example compounds, comprising a mixture of the respective enantiomers, are indicated in Table 3 with #. The results are shown below in TABLE 3: TABLE 3 Example Solubility [pM] (PBS, pH 7.4, test concentration 200 pM) Detection wavelength [nm] Chromatographic purity [%] 7* 5 260 100 reference example 87 (W02001 / 47904) 0.7 260 100 Simvastatin 18.7 230 100 Similarly, good solubility can be expected for the individual enantiomers. Mechanism of action To elucidate the mechanism of action, compound-resistant herpesviruses were selected in the presence of, for example, 2 pM of Example 7(-) or 10 pM of Example 7c(-) according to G. Kleymann et al. Nat. Med. 2002;8,392. The viral DNA was prepared as described and used as a template in a subsequent PCR reaction employing the following method parameters: 5 min denaturation at 95 °C, 35 cycles denaturation at 95 °C 30 s, annealing at 60 °C 30 s, amplification / extension at 72 °C 30 s, final step 5 15 mins at 72 °C and then cool to 4-5 °C; “PCR Primers: Inv. Primer. VHS1 / 2 (5' atgagccgcgacaggaac 3'), dir primer VHS1 / 2 (5' ggtggatgattaacgccctg 3'). The amplified products (~849 bp in size) were purified by 1% agarose gel electrophoresis and subsequently sequenced using the sequencing primer (5' ttaacgccctgtaccacacc 3'). Sequencing revealed resistance conferred by the K356Q and K356R mutations in the HSV-1 helicase gene compared to the susceptible strain used as starting material for selected resistant viruses in the presence of the compounds from Example 7(-) and 7c(-). The K356R mutation is novel and has not been previously described for HHV-1. In vivo activity Pharmacoclinical Pharmacokinetic parameters for Example 7, 7(· ), 7{+) and 7c were determined in C57BL / 6J strain male mice at an intravenous (iv) dose of 5 mg / kg (DMSO 5% in heterologous plasma, 2.5 ml / kg ) and an oral (vo) dose of 10 mg / kg (DMSO / 0.5% HPMC (5:95), 5 ml / kg). Surprisingly, enantiomers with a specific negative optical rotation can show a better pharmacokinetic profile, illustrated by Example 7c(-), which demonstrates the highest exposure in the C57BL / 6J mouse strain with respect to Cmax (6647 ng / ml) and AUC (38034 ng * h / ml) at 10 mg / kg orally (DMSO / 0.5% HPMC (5:95), 5 ml / kg) compared to the racemate (Example 7c, Cmax 4289 ng / ml, AUC 22482 ng*h / ml) and the opposite enantiomer (Example 7c(+), Cmax 5704 ng / ml, AUC 31237 ng*h / ml) with a specific positive optical rotation. In addition, Example 7 in particular shows the highest brain exposure (*13-14 μM, 6000 ng / g of brain), which allows for the treatment of herpes encephalitis. Animal model Animal experiments were conducted in accordance with patent W02001 / 047904 or subsequent publications (UAK Betz et al. Antimicrob. Agents Chemother. 2002:46,1766 or G. Kleymann et al. Nat. Med. 2002;8,392). The relevant experimental details from the aforementioned patent and publication for evaluating the antiviral activity of the Invention (disclosed compounds) in vivo (animal models) are described below. Animals: Six-week-old female mice, BALB / cABom strain, were obtained from a commercial breeder. Infection: The animals were anesthetized with EbO in a sealed glass container. Fifty milliliters of a dilution of the virus stock (infection dose of 5 x 10⁴ PFU [plaque-forming units]) were introduced into the noses of the anesthetized animals using a pipette. In 90–100% of the animals, this infection dose caused death from systemic infection with prominent retinal and central nervous system symptoms on average after 5–8 days. Treatment and evaluation: Hours after infection, the animals were treated with doses of 0.1–150 mg / kg body weight, three times daily at 7 am, 2 pm, and 7 pm (tid), twice daily at 7 am and 7 pm (bid), or once daily at 1 pm (od) for a period of 5 days. The compounds were pre-dissolved in DMSO and resuspended in 0.5% HPMC (hydroxypropyl methylcellulose) in water or PBS (DMSO / 0.5% HPMC [maximum 5:95, ideally 1.5% HPMC]). DMSO, 0.5% HPMC in water or PBS). After the last administration, the animals were monitored further and the time of death was determined. A comparison of survival curves showed, for the compound in Example 7, for example, an ED50 of less than 10 mg / kg for either HSV-1 or HSV-2, where ED50 means that 50% of infected animals survive this dose. In particular, the Example 7(-) enantiomer shows an ED50 of less than 5 mg / kg for HSV-1. However, based on the in vivo data for Example 7, even if analyzed here as a mixture of the respective enantiomers, the activity of the individual enantiomers can also be expected. The novel active enantiomers of the present invention can be formulated in a known manner into common formulations, such as tablets, oblong tablets, sugar-coated tablets, pills, granules, aerosols, syrups, and pharmaceutically suitable vehicles and solvents. In this case, the therapeutically active compound should be present in each formulation at a concentration of approximately 0.1 to 90% by weight of the total mixture, i.e., in quantities sufficient to achieve the indicated dosage range. The formulations are prepared, for example, by extending the active compounds with solvents and / or excipients, if appropriate using emulsifiers and / or dispersants, if possible, for example, if the diluent used is water, to use, if appropriate, organic solvents as auxiliary solvents. Administration is carried out in a routine manner, preferably orally, parenterally or topically, particularly perlingually or intravenously. In the case of parenteral administration, solutions of the active compounds using suitable liquid vehicle materials may be employed. In general, it has been shown that in the case of intravenous administration, it is advantageous to administer quantities of approximately 0.001 to 20 mg / kg, preferably approximately 0.01 to 10 mg / kg of body weight to achieve effective results, and in the case of oral administration, the dose is approximately 0.01 to 30 mg / kg, preferably 0.1 to 20 mg / kg of body weight. Despite this, it may be necessary, if appropriate, to deviate from the stated amounts. This depends on factors such as body weight, route of administration, individual response to the medication, formulation, and the timing or interval at which administration takes place. Therefore, in some cases, a lower minimum dose than stated may be suitable, while in others, the upper limit should be exceeded. When administering relatively large amounts, it may be advisable to divide the dose into several individual administrations throughout the day. If appropriate, it may be useful to combine the compounds according to the invention with other active substances, in particular antiviral active compounds, the so-called combination therapy. Description of the figures Figure 1a: SFC chromatogram of a mixture from Example 7(·) and Figure 1b: Chiral SFC chromatogram of Example 7(-). Figure 1c: Chiral SFC chromatogram of Example 7(+). Figure 2a: Chiral SFC chromatogram of a racemic mixture of 7a(·) and 7a(+). Figure 2b: Chiral SFC chromatogram of 7a(-). Figure 2c: Chiral SFC chromatogram of 7a(+). Figure 3a: Chiral SFC chromatogram of a mixture of 7b(-) and 7b(+). Figure 3b: Chiral SFC chromatogram of 7b(-). Figure 3c: Chiral SFC chromatogram of 7b(+). Figure 4a: Chiral SFC chromatogram of a mixture of 7c(-) and 7c(+). Figure 4b: Chiral SFC chromatogram of 7c(-). Figure 4c: Chiral SFC chromatogram of 7c(+). Figure 5: Ortep plot (50%) of Example 8 with titration scheme. Figure 6a: Chiral SFC chromatogram of a mixture of 10a and 10b. Figure 6b: Chiral SFC chromatogram of 10a (isomer that elutes the first). Figure 6c:* Chiral SFC chromatogram of 10b (isomer that elutes the second).

Claims

1. A compound according to the formula: (FORMULA) or an N-oxide, a solvate, or a pharmaceutically acceptable salt thereof. Seven claims follow.