Novel polypeptide---human pdz protein 20 and polynucleotide encoding it

Abstract

The invention concerns human PDZ protein 20 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, infection of HIV, immunological diseases and a variety of inflammation utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes human PDZ protein 20.

Description

[0001] A novel polypeptide—human PDZ protein 20 and the polynucleotide encoding this polypeptide—are in the field of technology.

[0002] This invention belongs to the field of biotechnology. Specifically, this invention describes a novel polypeptide—human PDZ protein 20—and the polynucleotide sequence encoding this polypeptide. This invention also relates to methods for preparing this polynucleotide and polypeptide, and their applications. Background Art

[0003] The PDZ domain is a repeating sequence of 80-100 amino acid residues, also known as the DHR or GLGF domain. Previously found only in mammals, worms, and fruit flies, analogues of the PDZ domain have now been discovered in yeast, plants, and bacteria. [Protein Sci 1997 Feb; 6(2): 464-8]

[0004] The PDZ domain has been found in many proteins involved in membrane signaling, such as ion channel proteins, receptor cluster proteins, and proteins that link receptors to their coupled biologically functional enzymes. The PDZ domain has also been found in the MAGUK family of guanylate kinase homologs, several protein phosphatases and kinases, neuronal nitric oxide synthase, and several dystrophin proteins. [Bios says 1997 Jun; 19(6): 469-79] The PDZ domain found in mouse Shrm protein is involved in multi-level regulation of cytoskeleton structure. [Cell 1999 Nov 24; 99(5): 485-97]

[0005] The PDZ domain is a structure involved in protein recognition. Some proteins containing this structure bind to the C-terminal tetrapeptide domain X-Ser / Thr-X-Val-COO- of ion channels or receptors. Studies have shown that the C-terminal tetrapeptide domain binds to the PDZ domain through antiparallel backbone-P-sheet interactions. Recognition of the C-terminal tetrapeptide structure is accomplished by a basket-like structure of the backbone amino group formed by a Gly-Leu-Gly-Phe ring and an arginine side chain. [Cell 1996 Jun 28; 85(7): 1067-76] Other PDZ domains form homodimers, such as the PDZ domain of neuronal nitric oxide synthase binding to the PDZ domain of PSD-95 protein. [Nature 1996 Aug 15; 382(6592): 649-52] Neuronal nitric oxide synthase may also bind to the AspX-Val terminus of polypeptides. These peptides include glutamate and melatonin receptors. [Na t B io techno l 1997 Apr; 15 (4): 336-42]

[0006] The polypeptide of this invention contains a PDZ domain, and therefore can be considered a new member of the PDZ family with similar biological functions, and is named human PDZ protein XX.

[0007] As mentioned above, human PDZ protein 20 plays a crucial role in important functions within the body, and it is believed that numerous proteins are involved in these regulatory processes. Therefore, there has been a long-standing need in the art to identify more human PDZ protein 20 proteins involved in these processes, particularly to identify their amino acid sequences. The isolation of the gene encoding the novel human PDZ protein 20 also provides a foundation for determining the role of this protein in healthy and disease states. This protein may form the basis for the development of drugs for disease diagnosis and / or treatment; therefore, isolating its encoding DNA is crucial. Disclosure of the Invention

[0008] One object of the present invention is to provide an isolated novel polypeptide—human PDZ protein 20, as well as its fragments, analogs and derivatives.

[0009] Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

[0010] Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human PDZ protein 20. Another object of the present invention is to provide genetically engineered host cells containing a polynucleotide encoding human PDZ protein 20.

[0011] Another object of the present invention is to provide a method for producing human PDZ protein 20.

[0012] Another object of the present invention is to provide an antibody against the polypeptide of the present invention—human PDZ protein 20. Another object of the present invention is to provide mimicry compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention—human PDZ protein 20.

[0013] Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human PDZ protein 20.

[0014] This invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conserved variant thereof, a bioactive fragment, or a derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

[0015] The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0016] (a) A polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

[0017] (b) A polynucleotide complementary to polynucleotide (a);

[0018] (c) A polynucleotide that has at least 70% identity with the polynucleotide sequence of (a) or (b).

[0019] More preferably, the sequence of the polynucleotide is selected from one of the following groups: (a) having a sequence having positions 233-778 of SEQ ID NO: 1; and (b) having a sequence having positions 1-1274 of SEQ ID NO: 1.

[0020] The present invention also relates to a vector containing the polynucleotides of the present invention, particularly an expression vector; a host cell genetically engineered using the vector, including a transformed, transduced, or transfected host cell; and a method for preparing the polypeptides of the present invention, including culturing the host cell and recovering the expression product.

[0021] The present invention also relates to an antibody that can specifically bind to the polypeptide of the present invention.

[0022] The present invention also relates to a method for screening compounds that mimic, activate, antagonize, or inhibit the activity of human PDZ protein 20, comprising a polypeptide utilizing the present invention. The present invention also relates to compounds obtained using this method. The present invention also relates to a method for in vitro detection of diseases or disease susceptibility associated with abnormal expression of human PDZ protein 20, comprising detecting mutations in the polypeptide or its encoding polynucleotide sequence in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.

[0023] The present invention also relates to a pharmaceutical composition comprising the polypeptide of the present invention or an analogue thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

[0024] The present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of medicaments for treating cancer, developmental disorders or immune disorders or other diseases caused by abnormal expression of human PDZ protein 20.

[0025] Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

[0026] Unless otherwise specified, the following terms used in this specification and claims have the following meanings: "Nucleic acid sequence" refers to oligonucleotides, nucleotides, or polynucleotides and fragments or portions thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing sense or antisense strands. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof. When "amino acid sequence" in this invention refers to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean limiting the amino acid sequence to the complete natural amino acids associated with said protein molecule.

[0027] A protein or polynucleotide "variant" is an amino acid sequence or polynucleotide sequence encoding it that has one or more amino acid or nucleotide changes. These changes may include the deletion, insertion, or substitution of amino acids or nucleotides in the amino acid or nucleotide sequence. Variants may have "conserved" changes, where the substituted amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine. Variants may also have non-conserved changes, such as replacing glycine with tryptophan.

[0028] "Deficiency" refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

[0029] "Insertion" or "addition" refers to a change in the amino acid or nucleotide sequence that results in the addition of one or more amino acids or nucleotides compared to the naturally occurring molecule. "Replacement" refers to the substitution of one or more amino acids or nucleotides by different amino acids or nucleotides.

[0030] "Bioactivity" refers to proteins that possess the structural, regulatory, or biochemical functions of natural molecules. Similarly, the term "immunologic activity" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce specific immune responses and bind to specific antibodies in suitable animals or cells.

[0031] An "agonist" is a molecule that, when bound to human PDZ protein 20, causes changes in the protein, thereby regulating its activity. Agonists can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to human PDZ protein 20. An "antagonist" or "inhibitor" is a molecule that, when bound to human PDZ protein 20, blocks or modulates the biological or immunological activity of human PDZ protein 20. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to human PDZ protein 20.

[0032] "Regulation" refers to changes in the function of human PDZ protein 20, including increases or decreases in protein activity, changes in binding properties, and any other changes in the biological, functional, or immunological properties of human PDZ protein 20.

[0033] "Substantially pure" means substantially free of other naturally occurring or associated proteins, lipids, carbohydrates, or other substances. Those skilled in the art can purify human PDZ protein 20 using standard protein purification techniques. Substantially pure human PDZ protein 20 produces a single master band on a non-reducing polyacrylamide gel. The purity of the human PDZ protein 20 peptide can be determined by amino acid sequence analysis.

[0034] "Complementary" or "complementary" refers to the natural binding of polynucleotides through base pairing under permissible salt concentration and temperature conditions. For example, the sequence "C-TG-A" can bind to the complementary sequence "G-A-CT". Complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.

[0035] "Homology" refers to the degree of complementarity, which can be partial or complete homology. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence with the target nucleic acid. This inhibition of hybridization can be detected by hybridization under reduced stringency conditions (such as Southern blotting or Northern blotting). Essentially, homologous sequences or hybridization probes can compete for and inhibit the binding of completely homologous sequences to the target sequence under reduced stringency conditions. This does not mean that reduced stringency conditions allow non-specific binding, because reduced stringency conditions require the binding of the two sequences to be a specific or selective interaction.

[0036] "Identity percentage" refers to the percentage of identical or similar sequences in a comparison of two or more amino acid or nucleic acid sequences. The identity percentage can be determined electronically, such as using the MEGALIGN program (Lasergene software package, STAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences using different methods, such as the Cluster method (Higgins, DG, and PM Sharp (1988) Gene 73: 237-244). The Cluster method clusters sequences by examining the distance between all pairs. The clusters are then assigned in pairs or groups. The identity percentage between two amino acid sequences, such as sequence A and sequence B, is calculated using the following formula:

[0037] Number of matching residues between sequence A and sequence B x 100

[0038] (Number of residues in sequence A - Number of interstitial residues in sequence A - Number of interstitial residues in sequence B) The percentage of similarity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645). "Similarity" refers to the degree of similarity or conserved substitution of amino acid residues at corresponding positions when comparing the arrangement of amino acid sequences. Examples of amino acids used for conserved substitution include negatively charged amino acids such as aspartic acid and glutamic acid; positively charged amino acids such as lysine and arginine; amino acids with similar hydrophilicity and uncharged head groups such as leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

[0039] "Antense" refers to a nucleotide sequence that is complementary to a specific DM or RNA sequence. "Antense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

[0040] "Derivatives" refer to chemical modifications of HFPs or the nucleic acids that encode them. These modifications can involve replacing hydrogen atoms with alkyl, acyl, or amino groups. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of the natural molecule.

[0041] "Antibody" refers to the complete antibody molecule and its fragments, such as Fa, ? (^')2 and ?, which can specifically bind to the antigenic determinant of human PDZ protein 20.

[0042] "Humanized antibody" refers to an antibody whose non-antigen binding region amino acid sequence has been replaced to make it more similar to human antibody, but still retains its original binding activity.

[0043] The term "separated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living organism is not separated, but the same polynucleotide or polypeptide separated from some or all of the substances that coexist with it in the natural system is considered separated. Such a polynucleotide may be part of a carrier, or it may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still separated.

[0044] As used in this invention, "isolated" means that a substance has been separated from its original environment (or, if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0045] As used herein, "isolated human PDZ protein 20" means that human PDZ protein 20 is substantially free of other naturally occurring proteins, lipids, carbohydrates, or other substances associated with it. Those skilled in the art can purify human PDZ protein 20 using standard protein purification techniques. A substantially pure peptide will produce a single master band on a non-reducing polyacrylamide gel. The purity of the human PDZ protein 20 peptide can be determined by amino acid sequence analysis.

[0046] This invention provides a novel polypeptide—human PDZ protein 20—which is essentially composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of this invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of this invention can be a naturally purified product, a chemically synthesized product, or a product obtained using recombinant technology from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher plants, insects, and mammals). Produced in cells. Depending on the host used in the recombinant production protocol, the polypeptides of the present invention may be glycosylated or non-glycosylated. The polypeptides of the present invention may also include or exclude an initial methionine residue.

[0047] This invention also includes fragments, derivatives, and analogs of human PDZ protein 20. As used herein, the terms "fragment," "derivative," and "analyte" refer to polypeptides that substantially retain the same biological function or activity as the human PDZ protein 20 of this invention. Fragments, derivatives, or analogs of the polypeptides of this invention may be: (I) in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues (preferably conserved amino acid residues), and the substituted amino acids may or may not be encoded by a genetic codon; or (II) in which a group on one or more amino acid residues is substituted with another group containing a substituent; or (III) in which a mature polypeptide is fused with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) in which an additional amino acid sequence is fused into the mature polypeptide to form a polypeptide sequence (e.g., a leader sequence, a secretory sequence, or a sequence used to purify the polypeptide or a proteogen sequence). By way of the description herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

[0048] This invention provides isolated nucleic acids (polynucleotides) that are essentially composed of polynucleotides encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of this invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of this invention was discovered from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1274 bases, with open reading frames 233-778 encoding 181 amino acids. This polypeptide possesses characteristic sequences of PDZ family members, suggesting that this human PDZ protein 20 has the structure and function represented by PDZ family members.

[0049] The polynucleotides of this invention can be in DNA or RNA form. DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DM can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to or a degenerate variant of the coding region sequence shown in SEQ ID NO: 1. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2, but differing from the coding region sequence shown in SEQ ID NO: 1.

[0050] The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0051] The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polynucleotide encoding the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

[0052] This invention also relates to variants of the polynucleotides described above, which encode polypeptides or polypeptide fragments, analogs, and derivatives having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring... Allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a form of substitution of a polynucleotide, which may be the substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.

[0053] The present invention also relates to polynucleotides that hybridize with the sequences described above (the two sequences having at least...)

[0054] (50%, preferably 70% similarity). This invention particularly relates to polynucleotides that are hybridizable with the polynucleotides described herein under stringent conditions. In this invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the similarity between the two sequences is at least 95%, preferably at least 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

[0055] This invention also relates to nucleic acid fragments that hybridize with the sequences described above. As used in this invention, the length of a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides or more. The nucleic acid fragment can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate the polynucleotide encoding human PDZ protein 20.

[0056] The polypeptides and polynucleotides of this invention are preferably provided in isolated form, and more preferably purified to homogenization. The specific polynucleotide sequence encoding human PDZ protein 20 of this invention can be obtained by a variety of methods. For example, polynucleotides can be isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes with genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect polynucleotide fragments of clones with common structural features.

[0057] The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating double-stranded DNA sequences from genomic DNA; 2) chemically synthesizing DNA sequences to obtain double-stranded DNA of the polypeptide.

[0058] Of the methods mentioned above, isolating genomic DNA is the least common. Direct chemical synthesis of DNA sequences is the frequently chosen method. An even more common method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate raRNA from donor cells that highly express the gene and perform reverse transcription to form plasmid or phage cDNA libraries. Several mature techniques exist for extracting mRNA, and kits are commercially available (Qiagene). Constructing cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as various cDNA libraries from Clontech. When combined with polymerase chain reaction technology, even very small amounts of expression products can be cloned.

[0059] Genes of the present invention can be screened from these cDNA libraries using conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) marker gene function presence or loss; (3) detection. (3) Determine the level of the transcript of human PDZ protein 20; (4) Detect the protein product of gene expression by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.

[0060] In method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. Furthermore, the length of the probe is generally within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is typically a chemically synthesized DNA sequence based on the gene sequence information of the present invention. The gene itself or a fragment of the present invention can, of course, be used as a probe. The DNA probe can be labeled with radioactive isotopes, fluorescein, or enzymes (such as alkaline phosphatase), etc.

[0061] In the fourth method, the protein product of human PDZ protein 20 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA).

[0062] The method of amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferred for obtaining the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA end amplification) is preferred. The primers used for PCR can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0063] The polynucleotide sequences of the gene or various DNA fragments obtained as described above can be determined using conventional methods such as the dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). These polynucleotide sequences can also be determined using commercial sequencing kits. To obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes, it is necessary to determine the cDNA sequences of multiple clones before they can be assembled into a full-length cDNA sequence.

[0064] The present invention also relates to vectors containing the polynucleotides of the present invention, host cells generated by genetic engineering using the vectors of the present invention or directly using the coding sequence of human PDZ protein 20, and methods for generating the polypeptides of the present invention via recombinant technology.

[0065] In this invention, a polynucleotide sequence encoding human PDZ protein 20 can be inserted into a vector to construct a recombinant vector containing the polynucleotides described in this invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors applicable in this invention include, but are not limited to: expression vectors based on the T7 promoter expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988); and vectors derived from baculoviruses expressed in insect cells. In short, any plasmid and vector can be used to construct a recombinant expression vector, provided it can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain a replication origin, a promoter, a marker gene, and translational regulatory elements. Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human PDZ protein 20 and suitable transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; and the P promoter of λ phage. L Promoters; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. Expression vectors also include ribosome binding sites for translation initiation and transcription terminators. Inserting enhancer sequences into a vector will enhance transcription in higher eukaryotic cells. Enhancers are cis-acting factors of DNA expression, typically about 10 to 300 base pairs, that act on promoters to enhance gene transcription. Examples include the 100 to 270 base pair SV40 enhancer on the late side of replication initiation, the polytumor enhancer on the late side of replication initiation, and adenoviral enhancers.

[0066] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0067] Those skilled in the art are well aware of how to select appropriate vectors / transcriptional regulatory elements (such as promoters, enhancers, etc.) and selective marker genes.

[0068] In this invention, a polynucleotide encoding human PDZ protein 20 or a recombinant vector containing such polynucleotide can be transformed or introduced into a host cell to constitute a genetically engineered host cell containing such polynucleotide or recombinant vector. The term "host cell" refers to prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: *Escherichia coli*, *Streptomyces*; bacterial cells such as *Salmonella typhimurium*; fungal cells such as yeast; plant cells; insect cells such as *Drosophila S2* or *Sf9*; and animal cells such as CHO, COS, or Bowes melanoma cells.

[0069] Transformation of host cells using the DNA sequence described in this invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *Escherichia coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. MgCl2 is also an option. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, DNA transfection methods such as calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc., can be used.

[0070] Using conventional recombinant DNA technology, the polynucleotide sequence of this invention can be used to express or produce... Recombinant human PDZ protein 20 (Science, 1984; 224: 1431). Generally, the following steps are involved:

[0071] (1) Transform or transduce suitable host cells with the polynucleotide (or variant) encoding human PDZ protein 20 of the present invention, or with a recombinant expression vector containing the polynucleotide;

[0072] (2) Culture the host cells in a suitable culture medium;

[0073] (3) Isolate and purify proteins from culture media or cells.

[0074] In step (2), the culture medium used in the culture can be selected from various conventional culture media, depending on the host cells used. The cells are cultured under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature change or chemical induction), and the cells are cultured for a further period.

[0075] In step (3), the recombinant polypeptide may be encapsulated intracellularly, expressed on the cell membrane, or secreted extracellularly. If desired, the recombinant protein may be separated and purified using various separation methods based on its physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional refolding treatment, protein precipitation (salting out), centrifugation, percolation, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof. Brief description of the figures.

[0076] The following figures are used to illustrate specific embodiments of the present invention, and are not intended to limit the scope of the invention as defined by the claims.

[0077] Figure 1 is a comparison of the amino acid sequences of the functional domains of the human PDZ protein 20 and PDZ family members. Figure 2 is a polyacrylamide gel electrophoresis (SDS-PAGE) image of the isolated human PDZ protein 20. 20 kDa is the molecular weight of the protein. The arrows indicate the isolated protein bands. Optimal mode for carrying out the invention

[0078] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods not specifically described in the following embodiments are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Example 1: Cloning of Human PDZ Protein 20

[0079] Total RNA was extracted from human fetal brain using a one-step guanidine isothiocyanate / phenol / chloroform method. The Quik mRNA Isolation Kit was used. (Qiegene product) Poly(A) mRNA was isolated from total RNA. 2 μg of poly(A) mRNA was reverse transcribed to form cDNA. The cDNA fragment was directionally inserted into the multiple cloning site of a pBSK(+) vector (Clontech product) using the Smart cDNA Cloning Kit (Clontech product), and the bacteria were transformed into DH5α to form a cDNA library. The 5' and 3' ends of all clones were sequenced using a Dye terminate cycle reaction sequencing kit (Perkin-Elmer product) and an ABI 377 automated sequencer (Perkin-Elmer). The determined cDNA sequences were compared with the existing public DM sequence database (Genebank), and the cDNA sequence of clone 0515a08 was found to be novel. A series of primers were synthesized to perform bidirectional sequencing of the inserted cDNA fragment contained in this clone. The results showed that the full-length cDNA of clone 0515a08 was 1274 bp (as shown in Seq ID NO: 1), with a 546 bp open reading frame (ORF) from 233 bp to 778 bp, encoding a new protein (as shown in Seq ID NO: 2). We named this clone pBS-0515a08, and the encoded protein human PDZ protein 20. Example 2: Domain Analysis of cDNA Cloning

[0080] The sequence of human PDZ protein 20 and its encoded protein sequence of the present invention were analyzed for domain structure in databases such as Prosite using the profile scan program (Basic Local Alignment Search Tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215:403-10]. The human PDZ protein 20 of the present invention is homologous to members of the PDZ family of domains; the homology results are shown in Figure 1. Example 3: Cloning of the gene encoding human PDZ protein 20 using RT-PCR.

[0081] cDNA was synthesized using reverse transcription with total RNA from fetal brain cells as a template and oligo-dT as a primer.

[0082] After purification using the Qiagene kit, PCR amplification was performed using the following primers:

[0083] Primerl: 5'-GGGCTGCGGCAGTAGCTCTCGCCT -3' (SEQ ID NO: 3)

[0084] Primer2: 5'- TTAATTTTTTATTTTTAGTACAGA -3' (SEQ ID NO: 4)

[0085] Primerl is the forward sequence starting at the 5th lbp end of SEQ ID NO: 1;

[0086] Primer2 is the reversed 3' sequence of SEQ ID NO: 1.

[0087] Amplification conditions: A 50 μL reaction volume contained 50 mmol / L KCl, 10 mmol / L Tris-Cl (pH 8.5), 1.5 mmol / L MgCl2, 200 μmol / L dNTP, 10 pmol primer, and 1 U of Taq DNA polymerase (Clontech). The reaction was performed for 25 cycles on a PE 9600 DNA thermal cycler (PerkinElmer) under the following conditions: 94°C for 30 sec; 55°C for 30 sec; 72°C for 2 min. β-actin was used as a positive control and template blank as a negative control during RT-PCR. The amplified products were purified using a QIAGEN kit and ligated into a PCR vector (InvUrogen) using a TA cloning kit. DNA sequence analysis showed that the DNA sequence of the PCR product was identical to 1-1274 bp as shown in SEQ ID NO: 1.

[0088] 1 Example 4: Northern blot analysis of human PDZ protein 20 gene expression:

[0089] Total RNA extraction using a one-step method [Anal. Biochem 1987, 162, 156-159] involves acidic guanidinium thiocyanate-phenol-chloroform extraction. Specifically, it uses 4M guanidinium isothiocyanate-25mM sodium citrate and 0.2M sodium acetate. PThe tissue was homogenized at H4.0, and 1 volume of phenol and 1 / 5 volume of chloroform-isoamyl alcohol (49:1) were added. The mixture was then centrifuged. The aqueous phase was aspirated, and 0.8 volume of isopropanol was added. The mixture was centrifuged again to obtain the RNA precipitate. The RNA precipitate was washed with 70% ethanol, dried, and dissolved in water. 20 μL of RNA was used for electrophoresis on a 1.2% agarose gel containing 20 mM 3-(N-morpholino)propanesulfonic acid (pH 7.0), 5 mM sodium acetate, 1 raM EDTA, and 2.2 M formaldehyde. The precipitate was then transferred to a nitrocellulose membrane. Using α- 32 P dATP was prepared using a random primer method. 32 P-labeled DNA probes. The DNA probes used were the human PDZ protein 20 coding region sequence (233bp to 778bp) amplified by PCR, as shown in Figure 1. 32P-labeled probes (approximately 2 x 10⁻⁶) were then used. 0 The RNA-transferred nitrocellulose membrane (cpm / ml) was hybridized overnight at 42°C in a solution containing 50% formamide - 25mM H2PO4 (pH 7.4) - 5× SSC - 5× Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the membrane was washed in 1× SSC - 0.1°C SDS at 55°C for 30 min. Then, it was analyzed and quantified using a Phosphor Imager. Example 5: In vitro expression, isolation, and purification of recombinant human PDZ protein 20.

[0090] Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, with the following sequences:

[0091] Primer3: 5- CCCCATATGATGGCGCAGGGTTTCGCAGTGGGC -3' (Seq ID No: 5) Primer4: 5'- CCCGAATTCTCACCACGTGGTCTTCTCCTTGGA -3' (Seq ID No: 6) These two primers contain Ndel and EcoRI restriction sites at their 5' ends, respectively, followed by the coding sequences for the 5' and 3' ends of the target gene. The Ndel and EcoRI restriction sites correspond to the selective restriction enzyme sites on the expression vector plasmid pET 28b (+) (Novagen product, Cat. No. 69865.3). PCR was performed using the pBS-0515a08 plasmid containing the full-length target gene as a template. The PCR reaction conditions were: a total volume of 50 μL containing... P BS-0515a08 plasmid 10 pg, primers ? 1^1116]:-3 and ? 1^[^]:-4 (separately !] 10011101, Advantage polymerase Mix (Clontech product) 1 μL. Cycling parameters: 94°C 20s, 60°C 30s, 68°C 2 min, for a total of 25 cycles. The amplified product and plasmid pET-28 (+) were double-digested with Ndel and EcoRI, respectively, and the large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5α using the calcium chloride method. After overnight culture on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. Selected positive clones with correct sequences (pET-0515a08) were transformed into *E. coli* BL21(DE3)plySs (Novagen product) using the calcium chloride method. The host bacterium BL21 (DE3) was then transformed into LB broth containing kanamycin (final concentration 30 g / ml). P ET-0515a08 was cultured at 37°C until the logarithmic growth phase, and then IPTG was added. The final concentration was increased to 1 mol / L, and the culture was continued for 5 hours. The bacterial cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was then purified using a His. Bind-Quick Cartridge (Novagen) affinity chromatography column that binds to six histidine residues (6 His-Tag). The purified target protein, human PDZ protein 20, was obtained. SDS-PAGE electrophoresis showed a single band at 20 kDa (Figure 2). This band was transferred to a PVDF membrane and analyzed for its N-terminal amino acid sequence using the Edams hydrolysis method. The results showed that the N-terminal 15 amino acids were identical to the N-terminal 15 amino acid residues shown in SEQ ID NO: 2. Example 6: Generation of Anti-Human PDZ Protein 20 Antibody

[0092] Synthesize the following human PDZ protein 20-specific peptides using a peptide synthesizer (PE company product):

[0093] NH2-Met-A 1 aG 1 nG 1 y-Phe-A 1 a-Va 1 - G 1 y-Phe-As p-Pro-Leu-G 1 y-Leu-G 1 y-C00H (SEQ ID NO: 7). This polypeptide was coupled with hemocyanin and bovine serum albumin to form complexes, as described in: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with ½ g of the above hemocyanin polypeptide complex plus complete Freund's adjuvant, and boosted with the hemocyanin polypeptide complex plus incomplete Freund's adjuvant 15 days later. The antibody titer in rabbit serum was determined by ELISA using a titration plate coated with 15 μg / ml bovine serum albumin polypeptide complex. Total IgG was isolated from the antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose 4B column, and the anti-peptide antibody was separated from total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically bound to human PDZ protein 20. Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe.

[0094] Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes has many applications. For example, the probe can be used to hybridize with genomic or cDNA libraries of normal or pathological tissues from different sources to identify whether they contain the polynucleotide sequence of the present invention and to detect homologous polynucleotide sequences. Furthermore, the probe can be used to detect whether the expression of the polynucleotide sequence of the present invention or its homologous polynucleotide sequences is abnormal in normal or pathological tissue cells.

[0095] The purpose of this embodiment is to select suitable oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes, and to identify whether some tissues contain the polynucleotide sequence of the present invention or its homologous polynucleotide sequence using a membrane hybridization method. Membrane hybridization methods include dot blot, Southern blot, Northern blot, and photocopying methods, all of which involve fixing the polynucleotide sample to be tested onto a membrane and then hybridizing using essentially the same steps. These identical steps are: the membrane with the sample fixed is first pre-hybridized with a hybridization buffer without probes to saturate the non-specific binding sites of the sample on the membrane with the carrier and the synthesized polymer. Then the pre-hybridization solution is replaced with a hybridization buffer containing labeled probes, and the membrane is incubated to allow the probes to hybridize with the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes high-intensity washing conditions (such as low salt concentration and high temperature) to reduce hybridization background and retain only highly specific signals. The probes used in this embodiment include two types: the first type is an oligonucleotide fragment that is completely identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention; the second type is an oligonucleotide fragment that is partially identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention. This embodiment uses dot blot to immobilize the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe exhibits the strongest hybridization specificity with the sample and is thus retained.

[0096] I. Probe Selection

[0097] When selecting oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of this invention for use as hybridization probes, the following principles and several aspects should be followed:

[0098] 1. The preferred probe size range is 18-50 nucleotides;

[0099] 2. The GC content should be 30%-70%; exceeding this will increase non-specific hybridization.

[0100] 3. There should be no complementary regions inside the probe;

[0101] 4. Probes that meet the above conditions can be used as preliminary selection probes. Then, computer sequence analysis is performed, including comparing the homology of the preliminary selection probe with its source sequence region (i.e., SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive identical bases, then the preliminary selection probe should generally not be used.

[0102] 5. Whether the initial probe is ultimately selected as a probe with practical application value should be further determined by experiments.

[0103] After completing the above analysis, the following two probes were selected and synthesized:

[0104] Probe 1 (probel), belonging to class I probes, is completely homologous to or complementary to the gene fragment of SEQ ID NO: 1 (41Nt).

[0105] 5'-TGGCGCAGGGTTTCGCAGTGGGCTTCGACCCACTGGGCCTA-3' (SEQ ID NO: 8) Probe 2 (probe2), belonging to the second class of probes, is a substitution mutation sequence (41Nt) equivalent to the gene fragment of SEQ ID NO: 1 or its complementary fragment:

[0106] 5'-TGGCGCAGGGTTTCGCAGTGCGCTTCGACCCACTGGGCCTA-3' (SEQ ID NO: 9) For other commonly used reagents not listed and their preparation methods related to the following specific experimental steps, please refer to the following references: DNA PROBES G. H. Keller; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as Molecular Cloning: A Laboratory Manual (2nd edition, 1998) [US] Sambrook et al., Science Press.

[0107] Sample preparation:

[0108] 1. Extracting DNA from fresh or frozen tissues

[0109] Steps: 1) Place fresh or freshly thawed normal liver tissue into a petri dish containing phosphate-buffered saline (PBS) and kept on ice. Cut the tissue into small pieces using scissors or a scalpel. Keep the tissue moist during the procedure. 2) 1) Centrifuge at 1000g to mince the tissue for 10 minutes. 2) Resuspend the pellet (approximately 10 ml / g) in cold homogenization buffer (0.25 mol / L sucrose; 25 mol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl2). 3) Homogenize the tissue suspension at full speed using an electric homogenizer at 4°C until the tissue is completely ruptured. 4) Centrifuge at 1000g for 10 minutes. 5) Resuspend the cell pellet (1-5 ml per 0.1g of the initial tissue sample) and centrifuge again at 1000g for 10 minutes. 6) Resuspend the pellet in lysis buffer (1 ml per 0.1g of the initial tissue sample), then proceed with the following phenol extraction method.

[0110] 2. Phenol extraction method for DNA

[0111] Steps: 1) Wash cells with 1-10 ml of cold PBS, centrifuge at 1000 g for 10 minutes. 2) Resuspend the precipitated cells in cold cell lysis buffer (1 x 10^6 ml). 8 (Cells / ml) Use at least 100ul of lysis buffer. 3) The final SDS concentration should be 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break down, reducing the overall yield. This is especially important when extracting >10... 7 The reaction is particularly severe in cells. 4) Add proteinase K to a final concentration of 200 μg / ml. 5) Incubate at 50°C for 1 hour or at 37°C with gentle shaking overnight. 6) Extract with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes in a small centrifuge tube. The two phases should be clearly separated; otherwise, repeat the centrifugation. 7) Transfer the aqueous phase to a new tube. 8) Extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. Then perform DM purification and ethanol precipitation.

[0112] 3. DNA purification and ethanol precipitation

[0113] Steps: 1) Add 10 volumes of 2 mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix well. Incubate at -20°C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour off the ethanol. 4) Wash the precipitate with 500 μL of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour off the ethanol. Wash the precipitate with 500 μL of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour off the ethanol, then invert the container on absorbent paper to allow any remaining ethanol to drain. Air dry for 10-15 minutes to allow surface ethanol to evaporate. Do not allow the precipitate to dry completely, otherwise it will be difficult to redissolve. 7) Resuspend the DNA precipitate in a small volume of TE or water. Vortex at low speed or use a dropper to gradually increase the TE, mixing until the DNA is fully dissolved, adding 1-5 x 10⁻⁶ drops at a time. 6 The amount extracted from the cells is approximately 1 ul.

[0114] Steps 8-13 below are only used when it is necessary to remove contaminants; otherwise, proceed directly to step 14.

[0115] 8) Add RNase A to the DNA solution to a final concentration of 100 μg / ml and incubate at 37°C for 30 minutes. 9) Add SDS and proteinase K to final concentrations of 0.5% and 100 μg / ml, respectively. Incubate at 37°C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 10 volumes of 2 mol / L sodium acetate and 2.5 volumes of cold ethanol, mix well, and incubate at -20°C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air-dry, resuspend the nucleic acid, and repeat the process in step 3- 6 steps. 14) Determine A 26 And A 28 To determine the purity and yield of DM. 15) After dispensing, store at -20°C. Sample membrane preparation:

[0116] 1) Take 4 x 2 appropriately sized nitrocellulose membranes (NC membranes), and lightly mark the spotting positions and sample numbers on them with a pencil. Two NC membranes are needed for each probe so that the membranes can be washed under high-intensity conditions and low-intensity conditions respectively in the subsequent experimental steps.

[0117] 2) Take 15 μL of each sample and control sample, spot them onto the sample film, and let them air dry at room temperature.

[0118] 3) Place on filter paper soaked in 0.1 mol / L NaOH and 1.5 mol / L NaCl for 5 minutes (twice), then air dry.

[0119] 4) Place it between clean filter paper, wrap it with aluminum foil, and vacuum dry at 60-80°C for 2 hours.

[0120] Probe marking

[0121] 1) 3μ lProbe (0. IOD / Ιθμ 1), add 2 μl inase buffer, 8-10 uCi γ- 32 P-dATP+2U Kinase, to be added to a final volume of 20 μL.

[0122] 2) Keep warm at 37 °C for 2 hours.

[0123] 3) Add 1 / 5 volume of bromophenol blue indicator (BPB).

[0124] 4) Pass through Sephadex G-50 column.

[0125] 5) To have 32 The first peak is collected before the P-Probe wash (it can be monitored using a monitor).

[0126] 6) 5 drops / tube, collect 10-15 tubes.

[0127] 7) Monitor isotope levels using a liquid scintillation analyzer

[0128] 8) The collected liquid from the first peak is the desired product. 32 P-Probe (the second peak is free γ-) 32 P-dATP).

[0129] prehybridization

[0130] Place the sample membrane in a plastic bag, add 3-10 mg of prehybridization solution (10x Denhardt's; 6x SSC, 0.1 mg / ml CT DNA (calf thymus DM)), seal the bag, and incubate at 68°C for 2 hours.

[0131] Hybridization

[0132] Cut off a corner of the plastic bag, add the prepared probe, seal the bag, and incubate overnight at 42°C with water and shaking. Wash the membrane:

[0133] High-intensity film washing:

[0134] 1) Take out the hybridized sample membrane.

[0135] 2) Wash at 40°C for 15 minutes (twice) in 2xSSC and 0.1%SDS.

[0136] 3) Wash at 40°C for 15 minutes in 0.1xSSC and 0.1°SSDS (twice).

[0137] 4) Wash in 0.1% SSC and 0.1% SDS at 55°C for 30 minutes (twice), then air dry at room temperature. Low-intensity film washing:

[0138] 1) Take out the hybridized sample membrane.

[0139] 2) Wash at 37°C for 15 minutes (twice) in 2xSSC and 0.1%SDS.

[0140] 3) In 0.1% SSC and 0.1% SDS, wash at 37°C for 15 minutes (twice).

[0141] 4) Wash in 0.1% SSC and 0.1% SDS at 40°C for 15 minutes (twice), then air dry at room temperature.

[0142] X-ray autoradiography:

[0143] -70°C, X-ray autoradiography (the compression time depends on the intensity of the radioactivity of the hybridization spot).

[0144] Experimental results:

[0145] Hybridization experiments conducted under low-intensity washing conditions showed no significant difference in radioactivity intensity between the two probe hybridization spots. However, hybridization experiments conducted under high-intensity washing conditions showed that the radioactivity intensity of the hybridization spot of probe 1 was significantly stronger than that of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of this invention in different tissues. Example 8 DNA Microarray

[0146] Gene chips, or gene microarrays (DM Microarrays), are new technologies currently being researched and developed by many national laboratories and large pharmaceutical companies. They involve the orderly and high-density arrangement of a large number of target gene fragments on carriers such as perlite and silica, followed by fluorescence detection and computer software for data comparison and analysis, achieving rapid, efficient, and high-throughput analysis of biological information. The polynucleotides of this invention can be used as target DNA in gene chip technology for high-throughput research on the function of novel genes; for finding and screening tissue-specific novel genes, especially those related to diseases such as tumors; and for the diagnosis of diseases, such as hereditary diseases. The specific methods and steps have been reported in various literatures, such as DeRisi, JL, Lyer, V. & Brown, P. O. (1997) Science 278, 680-686. and Hellle, RA, Schema, M., Chai, A., Shalom, D. (1997) PNAS 94: 2150-2155.

[0147] (a) Spotting

[0148] A total of 4000 polynucleotide sequences of various full-length cDNAs were used as target DNA molecules, including the polynucleotides of this invention. These sequences were amplified separately by PCR. After purification, the amplified products were adjusted to a concentration of approximately 500 ng / µl and spotted onto a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA), with a spot distance of 280 µm. The spotted slides were then hydrated, dried, and cross-linked in a UV cross-linker. After elution and drying, the DNA was immobilized on the glass slides to prepare a chip. Specific methods and steps have been reported in various literatures. The post-spotting processing steps in this embodiment are as follows:

[0149] 1. Hydrate for 4 hours in a humid environment;

[0150] 2. Wash with 0.2% SDS for 1 minute; 3. Wash twice with ddH2O, 1 minute each time;

[0151] 4. NaBH4 seal for 5 minutes;

[0152] 5. In 95°C water for 2 minutes;

[0153] 6. Wash with 0.2% SDS for 1 minute;

[0154] 7. Rinse twice with ddH2O;

[0155] 8. Let it air dry and store in a dark place at 25°C for later use.

[0156] (II) Probe Marking

[0157] Total mRNA was extracted from normal liver and liver cancer cells using a one-step method, and the mRNA was purified using the Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP was then used for reverse transcription. 5 Normal liver tissue mRNA was labeled with 5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech). Liver cancer tissue mRNA was labeled with the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech)). The probe was then purified. For detailed steps and methods, please refer to:

[0158] Schena,

[0159] M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol.93: 10614- 10619. Schena, M., Shalon, Dar i., Davis, RW (1995) Science.270. (20): 467-480.

[0160] (III) Hybridization

[0161] Probes from the two tissues were hybridized with the chip in UniHyb™ Hybridization Solution (TeleChem) for 16 hours. After washing with washing solution (1 SSC, 0.2% SDS) at room temperature, the samples were scanned using a ScanArray 3000 scanner (General Scanning, USA). The scanned images were analyzed using Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio for each point. Points with a ratio less than 0.5 and greater than 2 were considered to express differentially expressed genes.

[0162] Experimental results showed that Cy3 signal = 4193.88 (average of four experiments), Cy5 signal = 3400.45 (average of four experiments), and Cy3 / Cy5 = 1.2333, indicating that the expression of the polynucleotides of this invention showed no significant difference in the two tissues. Industrial applicability.

[0163] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be used directly for the treatment of diseases, such as malignant tumors, adrenal insufficiency, skin diseases, various inflammations, HIV infection, and immune diseases. The PDZ domain, also known as the DHR or GLGF domain, is found in many proteins involved in membrane signaling, such as ion channel proteins, receptor cluster proteins, and proteins that link receptors to their coupled enzymes that perform biological functions. The PDZ domain has also been found in the MAGUK family of guanylate kinase homologs, several protein phosphatases and kinases, neuronal nitric oxide synthase, and several dystrophin proteins. The PDZ domain found in mouse Shrm protein is involved in multi-level regulation of cytoskeleton structure.

[0164] Research has revealed that the PDZ domain is a structure involved in protein recognition. Some proteins containing this structure bind to the X-Ser / Thr-X-Val-COO- tetrapeptide domain at the C-terminus of ion channels or receptors. Other PDZ domains form homodimers; for example, the PDZ domain of neuronal nitric oxide synthase binds to the PDZ domain of the PSD-95 protein. Neuronal nitric oxide synthase may also bind to the Asp-X-Val terminus of peptides. These peptides include glutamate and melatonin receptors.

[0165] The polypeptides of this invention contain the characteristic PDZ domain sequence of the PDZ family and possess biological functions similar to those of the PDZ family. For example, they are involved in membrane signaling in the nervous system, substance transport in ion channels, signal feedback in receptor cluster proteins, and are associated with several dystrophin proteins. Therefore, abnormal expression of the characteristic PDZ domain sequence of the polypeptides of this invention can lead to the aforementioned abnormalities in cellular and tissue physiological and pathological functions, and result in related diseases.

[0166] Therefore, it is evident that abnormal expression of human PDZ protein 20 in this invention will lead to various diseases, especially neurological diseases, neuromuscular diseases, various tumors, metabolic diseases, and growth and development disorders. These diseases include, but are not limited to:

[0167] Neurological disorders: Glioma, Meningioma, Neurofibroma, Pituitary adenoma, Intracranial granuloma, Alzheimer's disease, Parkinson's disease, Chorea, Depression, Amnesia, Huntington's disease, Epilepsy, Migraine, Multiple sclerosis, Tuberous sclerosis, Ataxia-telangiectasia, Schizophrenia, Depression, Paranoia, Anxiety disorder, Obsessive-compulsive disorder, Phobia, Neurasthenia, Acute myelitis, Spinal cord compression, Trigeminal neuralgia, Facial nerve palsy, Bulbar palsy, Sciatica, Guillain-Barré syndrome, Neural tube insufficiency, Brain malformations, Neuronal migration disorders

[0168] Neuromuscular diseases: Myasthenia gravis, spinal muscular atrophy, pseudohypertrophy, Duchenne dystrophy, myotonic dystrophy, muscle tension, bradykinesia, dystonia

[0169] Tumors in various tissues: Stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, neurocytoma, astrocytoma, ependymoma, glioma, neurofibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumors, nasal cavity and sinus tumors, nasopharyngeal carcinoma, laryngeal cancer, tracheal tumors, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma.

[0170] Metabolic disorders: dehydration, water excess and water intoxication, hyponatremia, hypernatremia, hypokalemia, hyperkalemia Metabolic acidosis, metabolic acidosis, metabolic alkalosis, respiratory acidosis, respiratory alkalosis, mixed acid-base imbalance, gout, organic acidemia

[0171] Growth and developmental disorders: intellectual disability, cerebral palsy, brain development disorders, intellectual disability, familial cranial nucleus dysplasia syndrome, strabismus, skin, fat, and muscle dysplasia such as congenital cutis laxa, albinism, progeria, congenital keratosis, bone and joint dysplasia such as achondroplasia, epiphyseal dysplasia, metabolic bone diseases, various metabolic disorders such as various amino acid metabolic disorders, cretinism, dwarfism, Cushing's syndrome, and sexual developmental delay.

[0172] Abnormal expression of human PDZ protein 20 in this invention will also lead to certain hereditary, hematologic, and immune system diseases.

[0173] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be directly used for disease treatment, for example, to treat various diseases, especially neurological diseases, neuromuscular diseases, various tumors, metabolic diseases, growth and development disorders, certain genetic, hematological, and immune system diseases. The present invention also provides a method for screening compounds to identify agents that enhance (agonist) or inhibit (antagonist) human PDZ protein 20. Agonists enhance the biological functions of human PDZ protein 20, such as stimulating cell proliferation, while antagonists inhibit and treat disorders associated with excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human PDZ protein 20 can be co-cultured with labeled human PDZ protein 20 in the presence of the drug. The ability of the drug to enhance or inhibit this interaction can then be determined.

[0174] Antagonists of human PDZ protein 20 include screened antibodies, compounds, receptor-deficient derivatives, and analogs. Antagonists of human PDZ protein 20 can bind to human PDZ protein 20 and eliminate its function, or inhibit the production of the peptide, or bind to the active site of the peptide, preventing it from performing its biological function.

[0175] When screening compounds for antagonistic effects, human PDZ protein 20 can be added to a bioanalytical assay. The antagonist status is determined by measuring the compound's effect on the interaction between human PDZ protein 20 and its receptor. The same method used to screen compounds can be used to screen for receptor deletions and analogs that act as antagonists. Peptides that bind to human PDZ protein 20 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. During screening, human PDZ protein 20 molecules are generally labeled.

[0176] This invention provides a method for producing antibodies using polypeptides, fragments thereof, derivatives, analogs, or their cellular components as antigens. These antibodies may be polyclonal or monoclonal antibodies. This invention also provides antibodies against the human PDZ protein 20 antigenic determinant. These antibodies include, but are not limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

[0177] Polyclonal antibodies can be produced by directly injecting human PDZ protein 20 into immunized animals (such as rabbits, mice, etc.). Methods involving rats, etc., are used to obtain antibodies against human PDZ protein 20. Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies against human PDZ protein 20 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), three-cell hybridoma technology, human β-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851). Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human PDZ protein 20.

[0178] Antibodies against human PDZ protein 20 can be used in immunohistochemistry to detect human PDZ protein 20 in biopsy specimens.

[0179] Monoclonal antibodies that bind to human PDZ protein 20 can also be labeled with radioactive isotopes and injected into the body to track their location and distribution. These radiolabeled antibodies can serve as a non-invasive diagnostic method for locating tumor cells and determining whether metastasis has occurred.

[0180] Antibodies can also be used to design immunotoxins targeting specific sites in the body. For example, high-affinity monoclonal antibodies against human PDZ protein 20 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, and erythrine). A common method is to use a thiol cross-linking agent, such as SPDP, to attack the amino group of the antibody, binding the toxin to the antibody through disulfide bond exchange. Such hybrid antibodies can be used to kill human PDZ protein 20-positive cells.

[0181] The antibodies of this invention can be used to treat or prevent diseases associated with human PDZ protein 20. Administration of appropriate doses of the antibodies can stimulate or block the production or activity of human PDZ protein 20.

[0182] This invention also relates to diagnostic assays for the quantitative and localized detection of human PDZ protein 20 levels. These assays are well known in the art and include FISH assays and radioimmunoassays. The human PDZ protein 20 levels detected in these assays can be used to interpret the importance of human PDZ protein 20 in various diseases and to diagnose diseases in which human PDZ protein 20 plays a role.

[0183] The peptides of the present invention can also be used for peptide profiling analysis. For example, the peptides can be specifically cleaved by physical, chemical or enzymatic methods and analyzed by one-dimensional, two-dimensional or three-dimensional gel electrophoresis, or more preferably by mass spectrometry.

[0184] Polynucleotides encoding human PDZ protein 20 can also be used for various therapeutic purposes. Gene therapy can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of human PDZ protein 20. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human PDZ protein 20 to inhibit endogenous human PDZ protein 20 activity. For example, a variant human PDZ protein 20 could be a shortened version, lacking the signal transduction domain, which can bind to downstream substrates but lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human PDZ protein 20. Viral expression vectors such as retroviruses, adenoviruses, etc. Adenovirus-associated viruses, herpes simplex virus, and parvovirus can be used to transfer polynucleotides encoding human PDZ protein 20 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human PDZ protein 20 can be found in existing literature (Sambrook, et al.). Additionally, recombinant polynucleotides encoding human PDZ protein 20 can be packaged into liposomes and transferred into cells.

[0185] Methods for introducing polynucleotides into tissues or cells include: directly injecting polynucleotides into tissues in vivo; or introducing polynucleotides into cells in vitro using vectors (such as viruses, bacteriophages, or plasmids) and then transplanting the cells into the body.

[0186] Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human PDZ protein 20 mRNA are also within the scope of this invention. A ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs; its mechanism of action involves the ribozyme molecule specifically hybridizing with complementary target RNA and then performing endonuclease. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the widely used technique of solid-phase phosphoramide chemical synthesis of oligonucleotides. Antisense RNA molecules can be obtained by transcription in vitro or in vivo from the DNA sequence encoding that RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. To increase the stability of nucleic acid molecules, they can be modified in various ways, such as increasing the length of the flanking sequences, and using phosphothioester or peptide bonds instead of phosphodiester bonds for the ribonucleosides.

[0187] Polynucleotides encoding human PDZ protein 20 can be used for the diagnosis of diseases related to human PDZ protein 20. These polynucleotides can be used to detect the expression of human PDZ protein 20 or its abnormal expression in disease states. For example, the DNA sequence encoding human PDZ protein 20 can be used to hybridize biopsy specimens to determine the expression status of human PDZ protein 20. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques are all publicly available and mature technologies, and related kits are commercially available. Part or all of the polynucleotides of this invention can be used as probes immobilized on microarrays or DNA chips (also known as "gene chips") for differential gene expression analysis and gene diagnosis in tissues. The transcript of human PDZ protein 20 can also be detected by in vitro amplification using human PDZ protein 20-specific primers via RNA-polymerase chain reaction (RT-PCR).

[0188] Detection of mutations in the human PDZ protein 20 gene can also be used to diagnose diseases related to human PDZ protein 20. Mutations in human PDZ protein 20 can take the form of point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human PDZ protein 20 DNA sequence. Existing techniques such as Southern blotting, DNA sequencing, PCR, and in situ hybridization can be used to detect mutations. Furthermore, mutations may affect protein expression; therefore, Northern blotting and Western blotting can be used to indirectly determine the presence of gene mutations.

[0189] The sequence of this invention is also valuable for chromosome identification. This sequence specifically targets a particular location on a human chromosome and can hybridize with it. Currently, there is a need to identify the specific loci of each gene on a chromosome. At present, only a few chromosome markers based on actual sequence data (repetitive polymorphisms) are available. To mark chromosomal locations. According to the present invention, an important first step in order to associate these sequences with disease-related genes is to locate these DNA sequences on chromosomes.

[0190] In short, PCR primers (preferably 15-35 bp) are prepared based on cDNA, allowing the sequence to be located on the chromosome. These primers are then used for PCR screening of somatic heterozygous cells containing each human chromosome. Only heterozygous cells containing the corresponding human genes from the primers will produce amplified fragments.

[0191] PCR localization of somatic hybrid cells is a rapid method for locating DNA to specific chromosomes. Using the oligonucleotide primers of this invention, sub-localization can be achieved using a set of fragments from a specific chromosome or a large number of genomic clones through a similar method. Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening using labeled flow cytometry, and hybridization pre-selection, thereby constructing chromosome-specific cDNA libraries.

[0192] Fluorescence in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows for precise chromosome localization in a single step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

[0193] Once a sequence is pinpointed to its precise chromosomal location, that physical location on the chromosome can be correlated with gene mapping data. This data can be found, for example, in V. McKusick, Mendelian Inheritance in Man (available via link to Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between the gene and diseases already located on the chromosomal region.

[0194] Next, it is necessary to determine the differences in cDNA or genomic sequences between diseased and healthy individuals. If a mutation is observed in some or all diseased individuals, but not in any healthy individuals, then that mutation may be the cause of the disease. Comparing diseased and healthy individuals typically involves first looking for structural changes in the chromosomes, such as deletions or translocations visible at the chromosomal level or detectable by cDNA sequence-based PCR. Depending on the resolution of current physical mapping and gene localization techniques, cDNA precisely located to the chromosomal region associated with the disease can be one of 50 to 500 potential pathogenic genes (assuming a mapping resolution of 1 megabase and one gene per 20 kb).

[0195] The peptides, polynucleotides and their analogues, agonists, antagonists and inhibitors of the present invention can be used in combination with suitable drug carriers. These carriers can be water, glucose, ethanol, salts, buffer solutions, glycerol and combinations thereof. The compositions contain a safe and effective amount of the peptide or antagonist, as well as a carrier and excipients that do not affect the efficacy of the drug. These compositions can be used as drugs for the treatment of diseases.

[0196] The present invention also provides a medicine box or reagent kit containing one or more containers, wherein the containers contain one or more pharmaceutical composition ingredients of the present invention. Along with these containers, there may be indicative instructions given by the government regulatory agency that manufactures, uses, or sells the pharmaceutical or biological product, reflecting the production, use, and distribution of the product. The drug may be licensed for human use by a government regulatory authority. Furthermore, the polypeptides of this invention can be used in combination with other therapeutic compounds.

[0197] The pharmaceutical composition can be administered in a convenient manner, such as via local, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes. Human PDZ protein 20 is administered in an amount that is effective in treating and / or preventing a specific indication. The amount and dosage range of human PDZ protein 20 administered to a patient will depend on many factors, such as the route of administration, the patient's health condition, and the diagnostic physician's judgment.

Claims

Claims 1. An isolated polypeptide-human PDZ protein 20, characterized in that... It contains: a polypeptide of the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide thereof, an analogue or a derivative thereof.

2. The polypeptide as described in claim 1, characterized in that... The amino acid sequence of the polypeptide, analogue or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO:

2.

3. The polypeptide as described in claim 2, characterized in that... It contains a polypeptide having the amino acid sequence shown in SEQ ID NO:

2.

4. An isolated polynucleotide, characterized in that... The polynucleotide comprises one selected from the group consisting of: (a) A polypeptide or a fragment thereof, analogue, or derivative thereof encoding the amino acid sequence shown in SEQ ID NO: 2; (b) A polynucleotide complementary to polynucleotide (a); or (c) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide as described in claim 4, characterized in that... The polynucleotide comprises a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:

2.

6. The polynucleotide as described in claim 4, characterized in that... The polynucleotide sequence comprises the sequence of positions 233-778 in SEQ ID NO: 1 or the sequence of positions 1-1274 in SEQ ID NO:

1.

7. A recombinant vector containing exogenous polynucleotides, characterized in that... It is a recombinant vector constructed from the polynucleotide described in any one of claims 4-6 and a plasmid, virus, or vector expression vector.

8. A genetically engineered host cell containing exogenous polynucleotides, characterized in that... It is selected from one of the following host cells: (a) Host cells transformed or transduced using the recombinant vector of claim 7; or (b) Host cells transformed or transduced with the polynucleotide as described in any one of claims 4-6.

9. A method for preparing a polypeptide with human PDZ protein 20 activity, characterized in that... The method includes: (a) The engineered host cells of claim 8 are cultured under conditions expressing human PDZ protein 20; (b) Isolate a polypeptide with human PDZ protein 20 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that... The antibody is an antibody that specifically binds to human PDZ protein 20.

11. A class of compounds that mimic or regulate the activity or expression of peptides, characterized in that... These are compounds that mimic, promote, antagonize, or inhibit the activity of human PDZ protein 20.

12. The compound according to claim 11, characterized in that... It is the antisense sequence of the polynucleotide sequence or a fragment thereof shown in SEQ ID NO:

1.

13. An application of the compound of claim 11, characterized in that... The compound is used in a method for regulating the in vivo and in vitro activity of human PDZ protein 20.

14. A method for detecting a disease or susceptibility to a disease associated with the polypeptide described in any one of claims 1-3, characterized in that... This includes detecting the expression level of the polypeptide, or detecting the activity of the polypeptide, or detecting nucleotide variations in the polynucleotide that cause abnormal expression or activity of the polypeptide.

15. The use of the polypeptide according to any one of claims 1-3, characterized in that... It is used to screen for mimics, agonists, antagonists, or inhibitors of human PDZ protein 20; or for peptide fingerprint identification.

16. The application of the nucleic acid molecule according to any one of claims 4-6, characterized in that... It can be used as a primer for nucleic acid amplification reactions, or as a probe for hybridization reactions, or for manufacturing gene chips or microarrays.

17. The use of the polypeptide, polynucleotide, or compound as described in any one of claims 1-6 and 11, characterized in that... The polypeptide, polynucleotide or its analogue, agonist, antagonist or inhibitor, in a safe and effective dose with a pharmaceutically acceptable carrier, constitutes a pharmaceutical composition for the diagnosis or treatment of diseases associated with abnormalities of human PDZ protein 20.

18. The use of the polypeptide, polynucleotide, or compound according to any one of claims 1-6 and 11, characterized in that... Drugs for treating conditions such as malignant tumors, hematological diseases, HIV infection, immune disorders, and various types of inflammation can be prepared using the aforementioned polypeptides, polynucleotides, or compounds.