A novel polypeptide, transducin 18 and the polynucleotide encoding thereof

Abstract

The invention discloses a novel polypeptide, transducin 18, the polynucleotide encoding such polypeptide and the method of production thereof by DNA recombinant techniques. Methods of using the polypeptide for treating various diseases such as malignant tumors, blood disease, HIV infection and immune disorder, and inflammation and the like are also disclosed. Furthermore, the invention discloses the antagonist of the polypeptide and the effects thereof. The use of the polynucleotide encoding the novel transducin 18 is also disclosed.

Description

[0001] The field of technology for a new polypeptide—transductionin 18—and the polynucleotides encoding this polypeptide.

[0002] This invention belongs to the field of biotechnology. Specifically, this invention describes a novel polypeptide—transductionin 18—and the polynucleotide sequence encoding this polypeptide. This invention also relates to methods for preparing this polynucleotide and polypeptide, and their applications. Background Art

[0003] Beta-transductionin is a G protein that activates cGMP-specific phosphodiesterases. Beta-transductionin (G-beta) is one of the three subunits of a G protein, which are heterotrisomes of GTP-binding proteins. Beta-transductionin plays a crucial role in transmembrane receptor signal transduction, acting as an intermediate in various physiological responses, including visual and hormonal responses. The alpha subunit binds and hydrolyzes GTP, belonging to the GTPase superfamily; the beta and gamma subunits are essential for GTP substitution of GDP and for membrane anchoring and receptor recognition, and also participate in the inactivation of the alpha subunit.

[0004] In higher eukaryotes, G-beta belongs to a small family of polygenic genes containing approximately 340 conserved amino acid residues. The G-beta structure consists of eight tandem repeats of approximately 40 amino acids each, with each repeat containing a central Trp-Asp motif (WD-40). Proteins containing the WD-40 motif are often referred to as WD proteins or GH-WD proteins (GH stands for glycine-histidine). Such repeating structures are present in many proteins. The number of repeats varies from 5 to 8 in these proteins. In G-beta and G-beta-like proteins, repeating structures are distributed almost throughout the entire sequence, while in other proteins, they are only distributed at the N-terminus, central portion, or C-terminus. The conserved core structure composed of WD repeating structures connects to various regions, which are likely located on the surface. The longest variable region is located before GH, but other smaller variable regions are located in the conserved core region.

[0005] The central core domain of the WD protein exhibits a structural feature: [LIVMSTAC]-[LIVMFYWSTAGC]-[LIMXTAG]-[LIVMMSTAGC]-X(2)-[DN]-X(2)-[LIVMWSTAC]-X-[LIVMFSTAG]-W-[DEN]-[LIVMFSTAGCN]. The continuous expression and hydrophobicity of this feature pattern suggest that the WD repeat structure may fold into a variable loop preceding the GH, followed by a β-sheet-turn-P-sheet-turn-β-sheet, and finally the WD repeat. It is highly likely that stable intramolecular dimers or tetramers form between the WD repeats. The core structure composed of the TO repeats may interact with other cores, thus providing a specific platform for surface reactions. This platform's mobility provides a variable protein-protein interface for the WD family proteins, allowing different WD family proteins to exhibit different functional responses with various other proteins. To date, WD proteins have been found only in all eukaryotes, not prokaryotes. They function as intracellular regulatory proteins, such as in cell differentiation, cell determination, gene transcription, transmembrane signaling, mRNA modification, and vesicle fusion.

[0006] The polypeptide of this invention has the central nuclear domain of the WD protein, belongs to the TO protein family, and is also presumed to have similar biological functions to the WD protein.

[0007] As described above, transductionin 18 protein plays a crucial role in important functions within the body, and it is believed that numerous proteins are involved in these regulatory processes. Therefore, there has been a long-standing need in the art to identify more transductionin 18 proteins involved in these processes, particularly to identify their amino acid sequences. The isolation of the gene encoding a novel transductionin 18 protein also provides a foundation for determining the role of this protein in healthy and disease states. This protein may form the basis for developing diagnostic and / or therapeutic agents for diseases; therefore, isolating its encoding DNA is of paramount importance. Disclosure of the Invention

[0008] One object of the present invention is to provide isolated novel polypeptides—transductionin 18, as well as fragments, analogs and derivatives thereof.

[0009] Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

[0010] Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding transductionin 18.

[0011] Another object of the present invention is to provide genetically engineered host cells containing a polynucleotide encoding transductionin 18.

[0012] Another object of the present invention is to provide a method for producing transductionin 18.

[0013] Another object of the present invention is to provide an antibody against the polypeptide transductionin 18 of the present invention.

[0014] Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors for the polypeptide-transductionin 18 of the present invention.

[0015] Another object of the present invention is to provide a method for diagnosing and treating diseases associated with transductionin 18 abnormalities. The present invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conserved variant thereof, a bioactive fragment, or a derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

[0016] The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0017] (a) A polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

[0018] (b) A polynucleotide complementary to polynucleotide (a);

[0019] (c) A polynucleotide that has at least 70% identity with the polynucleotide sequence of ω or (b).

[0020] More preferably, the sequence of the polynucleotide is selected from one of the following groups: (a) having the sequence in SEQ ID NO: 1 (a) A sequence of positions 1351-1851; and (b) A sequence having positions 1-2887 of SEQ ID NO: 1.

[0021] • The present invention also relates to a vector containing the polynucleotides of the present invention, particularly an expression vector; a host cell genetically engineered using the vector, including a transformed, transduced, or transfected host cell; and a method for preparing the polypeptides of the present invention, including culturing the host cell and recovering the expression product.

[0022] The present invention also relates to an antibody that can specifically bind to the polypeptide of the present invention.

[0023] The present invention also relates to a method for screening compounds that mimic, activate, antagonize, or inhibit the activity of transductionin 18 protein, comprising a polypeptide utilizing the present invention. The present invention also relates to compounds obtained using this method.

[0024] The present invention also relates to a method for in vitro detection of diseases or disease susceptibility associated with abnormal expression of transductionin 18 protein, comprising detecting mutations in the polypeptide or its encoding polynucleotide sequence in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.

[0025] The present invention also relates to a pharmaceutical composition comprising the polypeptide of the present invention or an analogue thereof, an activator, an antagonist or inhibitor, and a pharmaceutically acceptable carrier.

[0026] The present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of medicaments for treating cancer, developmental disorders or immune disorders or other diseases caused by abnormal expression of transductionin 18.

[0027] Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

[0028] Unless otherwise specified, the following terms used in this specification and claims have the following meanings: "Nucleic acid sequence" refers to oligonucleotides, nucleotides, or polynucleotides and fragments or portions thereof, and may also refer to genomes or synthetic DM or RNA, which may be single-stranded or double-stranded, representing sense or antisense strands. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof. When "amino acid sequence" in this invention refers to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean limiting the amino acid sequence to the complete natural amino acids associated with said protein molecule.

[0029] A protein or polynucleotide "variant" is an amino acid sequence or polynucleotide sequence encoding it that has one or more amino acid or nucleotide changes. These changes may include the deletion, insertion, or substitution of amino acids or nucleotides in the amino acid or nucleotide sequence. Variants may have "conserved" changes, where the substituted amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine. Variants may also have non-conserved changes, such as replacing glycine with tryptophan.

[0030] "Deficiency" refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

[0031] "Insertion" or "addition" refers to a change in the amino acid or nucleotide sequence that results in the addition of one or more amino acids or nucleotides compared to a naturally occurring molecule. "Substitution" refers to the addition of a different amino acid. Or, a nucleotide can replace one or more amino acids or nucleotides.

[0032] "Bioactivity" refers to proteins that possess the structural, regulatory, or biochemical functions of natural molecules. Similarly, the term "immunologic activity" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce specific immune responses and bind to specific antibodies in suitable animals or cells.

[0033] An "agonist" is a molecule that, when bound to transductionin-18, causes changes in the protein, thereby regulating its activity. Agonists can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to transductionin-18.

[0034] An "antagonist" or "inhibitor" is a molecule that, when bound to transductionin-18, blocks or modulates the biological or immunological activity of transductionin-18. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to transductionin-18.

[0035] "Regulation" refers to changes in the function of transductionin-18, including increases or decreases in protein activity, changes in binding properties, and any other changes in the biological, functional, or immune properties of transductionin-18.

[0036] "Substantially pure" means substantially free of other naturally occurring or associated proteins, lipids, sugars, or other substances. Those skilled in the art can purify transductionin-18 using standard protein purification techniques. Substantially pure transductionin-18 produces a single master band on a non-reducing polyacrylamide gel. The purity of the transductionin-18 peptide can be determined by amino acid sequence analysis.

[0037] "Complementary" or "complementary" refers to the natural binding of polynucleotides through base pairing under permissible salt concentration and temperature conditions. For example, the sequence "C-T-G-A" can bind to the complementary sequence "G-AC-T". Complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.

[0038] "Homology" refers to the degree of complementarity, which can be partial or complete homology. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization between a completely complementary sequence and the target nucleic acid. This inhibition of hybridization can be detected by hybridization under reduced stringency conditions (such as Southern or Northern blotting). Essentially, homologous sequences or hybridization probes can compete for and inhibit the binding of completely homologous sequences to the target sequence under reduced stringency conditions. This does not mean that reduced stringency conditions allow non-specific binding, because reduced stringency conditions require the binding of the two sequences to be a specific or selective interaction.

[0039] "Identity percentage" refers to the percentage of identical or similar sequences in a comparison of two or more amino acid or nucleic acid sequences. The identity percentage can be determined electronically, such as using the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences using different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73...). 2 37- 244 Cluster's method arranges the sequences into clusters by examining the distances between all pairs. Then, the clusters are assigned in pairs or groups. The percentage of similarity between two amino acid sequences, such as sequence A and sequence B, is calculated using the following formula:

[0040] Number of matching residues between sequence A and sequence B x 100

[0041] (Number of residues in sequence A - Number of spacer residues in sequence A - Number of spacer residues in sequence B) The percentage of identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).

[0042] "Similarity" refers to the degree of similarity or conserved substitution of amino acid residues at corresponding positions when comparing the arrangement of amino acid sequences. Examples of amino acids used for conserved substitution include negatively charged amino acids such as aspartic acid and glutamic acid; positively charged amino acids such as lysine and arginine; amino acids with similar hydrophilicity and uncharged head groups such as leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

[0043] "Antense" refers to a nucleotide sequence that is complementary to a specific DNA or RNA sequence. "Antense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

[0044] "Derivatives" refer to chemical modifications of HFPs or the nucleic acids that encode them. These modifications can involve replacing hydrogen atoms with alkyl, acyl, or amino groups. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of the natural molecule.

[0045] "Antibody" refers to the complete antibody molecule and its fragments, such as Fa, ? (^')2 and ?, which can specifically bind to the antigenic determinant of transductionin 18.

[0046] "Humanized antibody" refers to an antibody whose non-antigen binding region amino acid sequence has been replaced to make it more similar to human antibody, but still retains its original binding activity.

[0047] The term "separated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living organism is not separated, but the same polynucleotide or polypeptide separated from some or all of the substances that coexist with it in the natural system is considered separated. Such a polynucleotide may be part of a carrier, or it may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still separated.

[0048] As used in this invention, "isolated" means that a substance has been separated from its original environment (or, if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0049] As used in this article, "isolated transductionin 18" means that transductionin 18 is essentially free of its natural counterparts. Other proteins, lipids, carbohydrates, or other substances. Those skilled in the art can purify transductionin 18 using standard protein purification techniques. A substantially pure peptide produces a single master band on a non-reducing polyacrylamide gel. The purity of the transductionin 18 peptide can be determined by amino acid sequence analysis.

[0050] This invention provides a novel polypeptide—transductionin 18—which is essentially composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of this invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of this invention can be a naturally purified product, a chemically synthesized product, or produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of this invention can be glycosylated or non-glycosylated. The polypeptide of this invention may or may not include an initial methionine residue.

[0051] This invention also includes fragments, derivatives, and analogs of transductionin 18. As used herein, the terms "fragment," "derivative," and "analyte" refer to polypeptides that substantially retain the same biological function or activity as transductionin 18 of this invention. Fragments, derivatives, or analogs of the polypeptides of this invention may be: (I) in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues (preferably conserved amino acid residues), and the substituted amino acids may or may not be encoded by a genetic codon; or (II) in which a group on one or more amino acid residues is substituted with another group containing a substituent; or (III) in which the mature polypeptide is fused with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) in which an additional amino acid sequence is fused into the mature polypeptide to form a polypeptide sequence (e.g., a leader sequence, a secretory sequence, or a sequence used to purify the polypeptide or a proteogen sequence). By way of the description herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

[0052] This invention provides isolated nucleic acids (polynucleotides) that are essentially composed of polynucleotides encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of this invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of this invention was discovered from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2887 bases, with open reading frames 1351-1851 encoding 166 amino acids. This polypeptide possesses characteristic sequences of the TO protein family, suggesting that this transductionin 18 has the structure and function represented by the WD protein family.

[0053] The polynucleotides of this invention can be in DNA form or RM form. DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in this invention, "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2, but differing from the coding region sequence shown in SEQ ID NO: 1. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0054] The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polynucleotide encoding the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

[0055] This invention also relates to variants of the polynucleotides described above, which encode polypeptides or polypeptide fragments, analogs, and derivatives having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.

[0056] The present invention also relates to polynucleotides that hybridize with the sequences described above (the two sequences having at least 50%, preferably 70%, similarity). The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2xSSC, 0.1% SDS, 60 °C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42 °C, etc.; or (3) hybridization only occurs when the similarity between the two sequences is at least 95%, preferably at least 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

[0057] This invention also relates to nucleic acid fragments that hybridize with the sequences described above. As used in this invention, the length of a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding transductionin 18.

[0058] The polypeptides and polynucleotides of this invention are preferably provided in isolated form, and more preferably purified to homogeneity. The specific polynucleotide sequence encoding transductionin 18 of this invention can be obtained by a variety of methods. For example, polynucleotides can be isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes with genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect polynucleotide fragments of clones with common structural features.

[0059] The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from genomic DNA; 2) chemically synthesizing the MA sequence to obtain the double-stranded DNA of the polypeptide.

[0060] Of the methods mentioned above, isolating genomic DNA is the least common. Direct chemical synthesis of DNA sequences is the frequently chosen method. An even more common method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that highly express the gene and perform reverse transcription to form plasmids or... Phage cDM libraries. Several mature techniques exist for mRNA extraction, and kits are commercially available (Qiagene). Constructing cDM libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as various cDNA libraries from Clontech. When combined with polymerase chain reaction technology, even very small amounts of expression products can be cloned.

[0061] Genes of the present invention can be screened from these cDM libraries using conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) marking the presence or loss of gene function; (3) measuring the level of transductionin 18 transcripts; and (4) detecting the protein products of gene expression by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.

[0062] In method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. Furthermore, the length of the probe is generally within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is typically a chemically synthesized DNA sequence based on the gene sequence information of the present invention. The gene itself or a fragment of the present invention can, of course, be used as a probe. The DNA probe can be labeled with radioactive isotopes, fluorescein, or enzymes (such as alkaline phosphatase), etc.

[0063] In the fourth method, the protein products of transductionin 18 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

[0064] The method of amplifying DNA / RM using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferred for obtaining the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA end amplification) is preferred. The primers used for PCR can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RM fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0065] The polynucleotide sequences of the gene or various DNA fragments obtained as described above can be determined using conventional methods such as the dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). These polynucleotide sequences can also be determined using commercial sequencing kits. To obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes, it is necessary to determine the cDNA sequences of multiple clones before they can be assembled into a full-length cDNA sequence.

[0066] The present invention also relates to vectors containing the polynucleotides of the present invention, host cells generated by genetic engineering using the vectors of the present invention or directly using the transductionin 18 coding sequence, and methods for generating the polypeptides of the present invention via recombinant technology.

[0067] In this invention, a polynucleotide sequence encoding transductionin 18 can be inserted into a vector to construct a recombinant vector containing the polynucleotide described in this invention. The term "vector" refers to bacterial plasmids, phages, etc., as well as those well-known in the art. The vectors used in this invention include, but are not limited to: T7 promoter-based expression vectors for bacterial expression (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors for mammalian cells (Lee and Nathans, J Bio Chera. 263: 3521, 1988); and baculovirus-derived vectors for insect cell expression. In short, any plasmid and vector that can replicate and remain stable within a host can be used to construct recombinant expression vectors. An important characteristic of expression vectors is that they typically contain a replication origin, promoter, marker gene, and translational regulatory elements.

[0068] Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding transductionin 18 and suitable transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Chaining, a Laboratories Manual, Co. Spring Harbor Laboratories. New York, 1989). The DNA sequence can be efficiently linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the LAC or TRP promoter of *E. coli*; the PL promoter of *λ* phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Inserting enhancer sequences into a vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors of DNA expression, typically ranging from 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0069] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0070] Those skilled in the art are well aware of how to select appropriate vectors / transcriptional regulatory elements (such as promoters, enhancers, etc.) and selective marker genes.

[0071] In this invention, a polynucleotide encoding transductionin 18 or a recombinant vector containing such polynucleotide can be transformed or introduced into a host cell to constitute a genetically engineered host cell containing such polynucleotide or recombinant vector. The term "host cell" refers to prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: *Escherichia coli*, *Streptomyces*; bacterial cells such as *Salmonella typhimurium*; fungal cells such as yeast; plant cells; insect cells such as *Drosophila S2* or *Sf9*; and animal cells such as CHO, COS, or Bowes melanoma cells. Transformation of host cells using the DNA sequence described in this invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *Escherichia coli*, competent cells capable of DM uptake can be harvested after the exponential growth phase and treated with the 12-dimer method, the steps of which are well known in the art. MgCl2 can also be used. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0072] Using conventional recombinant DNA techniques, the polynucleotide sequence of this invention can be used to express or produce recombinant transductionin 18 (Science, 1984; 224: 1431). Generally, the following steps are involved:

[0073] (1) Transform or transduce suitable host cells using the polynucleotide (or variant) encoding human transductionin 18 of the present invention, or using a recombinant expression vector containing the polynucleotide;

[0074] (2) Culture the host cells in a suitable culture medium;

[0075] (3) Isolate and purify proteins from culture media or cells.

[0076] In step (2), the culture medium used in the culture can be selected from various conventional culture media, depending on the host cells used. The cells are cultured under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature change or chemical induction), and the cells are cultured for a further period.

[0077] In step (3), the recombinant polypeptide may be encapsulated intracellularly, expressed on the cell membrane, or secreted extracellularly. If desired, the recombinant protein may be separated and purified using various separation methods based on its physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional refolding treatment, protein precipitation (salting out), centrifugation, percolation, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof. Brief description of the figures.

[0078] The following figures are used to illustrate specific embodiments of the present invention, and are not intended to limit the scope of the invention as defined by the claims.

[0079] Figure 1 is a comparison of the amino acid sequences of transductionin 18 and the functional domains of the WD protein family in this invention. Figure 2 is a polyacrylamide gel electrophoresis (SDS-PAGE) image of the isolated transductionin 18. 18 kDa is the molecular weight of the protein. The arrows indicate the isolated protein bands. Optimal mode for realizing this invention

[0080] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only. This invention is not intended to limit the scope of the invention. Experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0081] Example 1: Cloning of transductionin-18

[0082] Total MAP was extracted from human fetal brain using a one-step guanidine isothiocyanate / phenol / chloroform method. Poly(A) mRNA was isolated from the total RNA using the Quik mRNA Isolation Kit (Qiegene). 2 μg of poly(A) mRNA was reverse transcribed to form cDNA. The cDNA fragment was directionally inserted into the multiple cloning site of a pBSK(+) vector (Clontech) using the Smart cDNA Cloning Kit (Clontech), and the cells were transformed into DH'5a bacteria to form a cDNA library. The 5' and 3' ends of all clones were sequenced using a Dye terminate cycle reaction sequencing kit (PerkinElmer) and an ABI 377 automated sequencer (PerkinElmer). The determined cDNA sequences were compared with existing public DNA sequence databases (Genebank), and the cDNA sequence of clone 0109e03 was identified as novel. A series of primers were synthesized to perform bidirectional sequencing of the inserted cDNA fragment contained in this clone. The results showed that the full-length cDNA contained in clone 0109e03 was 2887 bp (as shown in SeqIDN0: l), with a 501 bp cDNA from 1351 bp to 1851 bp. P The open reading frame (ORF) of the cDNA clone encodes a novel protein (as shown in Seq ID NO: 2). We named this clone pBS-0109e03, and the encoded protein transductionin 18. Example 2: Domain Analysis of cDNA Cloning

[0083] The sequence of transductionin 18 and its encoded protein sequence of the present invention were analyzed using the profiling program in GCG.

[0084] The domain was analyzed using the Basic Local Alignment Search Tool [Altschul, SF et al. J. Mol. Biol. 1990; 215:403-10] in databases such as Prosite. The transductionin 18 of this invention is homologous to the TO protein family, and the homology results are shown in Figure 1. Example 3: Cloning of the gene encoding transductionin 18 using RT-PCR.

[0085] Using total RNA from fetal brain cells as a template, cDM was synthesized via reverse transcription using oligo-dT as a primer. After purification using a Qiagen kit, PCR amplification was performed using the following primers:

[0086] Primerl: 5'- AGAGAGGGAGTCTTATTCTGTTGC -3' (SEQ ID NO: 3)

[0087] Primer2: 5'- TAATAGGAAGCAAGTGACAGGAAA - 3, (SEQ ID NO: 4)

[0088] Primerl is the forward sequence starting at the 5th lbp end of SEQ ID NO: 1;

[0089] Primer2 is the reversed 3' end sequence of SEQ ID NO: 1.

[0090] Conditions for the amplification reaction: 5 A 0 μL reaction volume contains 50 mmol / L KCl and 10 mmol / L Tris- CI, (pH 8.5), 1.5 mmol / L MgCl2, 200 μmol / L dNTP, 1 Opmol primer, 1 U Taq DNA polymerase (Clontech). The reaction was performed for 25 cycles on a PE9600 DNA thermal cycler (PerkinElmer) under the following conditions: 94°C for 30 sec; 55°C for 30 sec; 72°C for 2 min. For RT-PCR, β-actin was used as a positive control and template blank as a negative control. The amplified products were purified using a QIAGEN kit and ligated into a PCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis showed that the DNA sequence of the PCR product was identical to 1-2887 bp as shown in SEQ ID NO: 1. Example 4: Northern blot analysis of transductionin 18 gene expression:

[0091] Total RNA (MA) was extracted using a one-step method [Ana l. Biochem 1987, 162, 156-159]. This method involves acidic guanidine thiocyanate-phenol-chloroform extraction. Specifically, tissue was homogenized with 4M guanidine isothiocyanate, 25mM sodium citrate, and 0.2M sodium acetate (pH 4.0). One volume of phenol and 1 / 5 volume of chloroform-isoamyl alcohol (49:1) were added, and the mixture was centrifuged. The aqueous phase was aspirated, and isopropanol (0.8 volume) was added. The mixture was then centrifuged to obtain the RNA precipitate. The RNA precipitate was washed with 70% ethanol, dried, and dissolved in water. 20 g of RNA was extracted using a solution containing 20mM 3-(N-morpholino)propanesulfonic acid (pH 7.0), 5mM sodium acetate, 1mM EDTA, and 2.2M formaldehyde at a concentration of 1.2°C. Electrophoresis was performed on an agarose gel. The gel was then transferred to a nitrocellulose membrane. Using α-... 32 P dATP was prepared using a random primer method. 32 P-labeled DM probes. The DNA probes used were the transductionin 18 coding region sequence (1351 bp to 1.851 bp) amplified by PCR, as shown in Figure 1. 32 P-labeled probes (approximately 2 x 10⁻⁶) were then used. 6 (cpm / ml) Nitrocellulose membranes containing transferred RNA were hybridized overnight at 42°C in a solution containing 50% formamide - 25 mM KH2PO4 (pH 7.4) - 5 x SSC - 5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the membrane was washed in 1 x SSC - 0.1 g / ml SDS at 55°C for 30 min. Then, analysis and quantification were performed using a Phosphor Imager. Example 5: In vitro expression, isolation, and purification of recombinant transductionin 18.

[0092] Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, with the following sequences:

[0093] Primer 3: 5'- CATGCTAGCATGACCAGTGTCCCAGTGAAGGAA -3' ( Seq ID No: 5 )

[0094] Primer4: 5' - CATGGATCCTCAGCCAATCCTGAGACTCAGGGA -3' (Seq ID No: 6) The 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively, followed by the coding sequences for the 5' and 3' ends of the target gene. The Nhel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865. 3). PCR was performed using the pBS-0109e03 plasmid containing the full-length target gene as a template. The PCR reaction conditions were: 50 μL containing 10 pg of pBS-0109e03 plasmid, 10 μmol of primers Primer-3 and Primer4, and 1 μL of Advantage polymerase Mix (Clontech). Cycle parameters: 94°C for 20s, 60°C for 30s, 68°C for 2 min, for a total of 25 cycles. Cycle. The amplified product and plasmid pET-28(+) were double-digested with Nhel and BamHI, respectively, and the large fragments were recovered and ligated using T4 ligase. The ligation product was transformed into E. coli DH5α using the calcium chloride method in a kanamycin-containing medium.

[0095] (final concentration 30 μ) § After overnight culture on LB agar plates, positive clones were screened using colony PCR and sequenced. The selected positive clone (pET-0109e03) was transformed into *E. coli* BL21(DE3) plySs (Novagen product) using the calcium chloride method. The host bacterium BL21 (pET-0109e03) was cultured in LB liquid medium containing kanamycin (final concentration 3 μg / ml) at 37°C to the logarithmic growth phase. IPTG was added to a final concentration of 1 μmol / L, and cultured for another 5 hours. The bacterial cells were collected by centrifugation, and the supernatant was collected by centrifugation and analyzed using an affinity chromatography column (His. Bind Quick Column) that binds to six histidine residues (6His-Tag).

[0096] (Novagen product) Chromatography was performed to obtain the purified target protein, transductionin 18. SDS-PAGE electrophoresis yielded a single band at 18 kDa (Figure 2). This band was transferred to a PVDF membrane and analyzed for its N-terminal amino acid sequence using the Edams hydrolysis method. The results showed that the N-terminal 15 amino acids were identical to the N-terminal 15 amino acid residues shown in SEQ ID NO: 2. Example 6: Generation of Anti-Transductionin 18 Antibody

[0097] The following transductionin 18-specific peptides were synthesized using a peptide synthesizer (PE company product):

[0098] NH2-Met-Thr-Ser-Val-Pro-Val-Lys-Glu-Arg-Val-Lys-Val-Ser-Gln-Asn-C00H (SEQ ID NO: 7). This polypeptide was coupled with hemocyanin and bovine serum albumin to form complexes, as described in: Avrameas, et al. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with ½ g of the above hemocyanin polypeptide complex plus complete Freund's adjuvant, followed by a booster immunization with the hemocyanin polypeptide complex plus incomplete Freund's adjuvant after 15 days. The antibody titer in rabbit serum was determined by ELISA using a titration plate coated with 15 g / ml bovine serum albumin polypeptide complex. Total IgG was separated from antibody-positive rabbit serum using Protein A-Sepharose. The polypeptide was bound to a cyanogen bromide-activated Sepharose 4B column, and anti-polypeptide antibodies were separated from total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to transductin-18. Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe.

[0099] Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes has many applications. For example, the probe can be used to hybridize with the genomes or cDM libraries of normal or pathological tissues from different sources to identify whether they contain the polynucleotide sequence of the present invention and to detect homologous polynucleotide sequences. Furthermore, the probe can be used to detect whether the expression of the polynucleotide sequence of the present invention or its homologous polynucleotide sequences is abnormal in normal or pathological tissue cells.

[0100] The purpose of this embodiment is to select suitable oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes, and to use membrane hybridization to identify whether some tissues contain the polynucleotides of the present invention. The nucleotide sequence or its homologous polynucleotide sequence. Filter membrane hybridization methods include dot blot, Southern blotting, Northern blotting, and photocopying methods, all of which involve immobilizing the polynucleotide sample to be tested on a filter membrane and then hybridizing using essentially the same steps. These identical steps are: the filter membrane with the sample immobilized is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding sites of the sample on the filter membrane with the carrier and the synthesized polymer. Then, the pre-hybridization buffer is replaced with a hybridization buffer containing labeled probes, and the membrane is incubated to allow the probes to hybridize with the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of washing steps. This embodiment utilizes high-intensity washing conditions (such as low salt concentration and high temperature) to reduce hybridization background and retain only highly specific signals. The probes used in this embodiment include two types: the first type of probe is an oligonucleotide fragment that is completely identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention; the second type of probe is an oligonucleotide fragment that is partially identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under high-intensity membrane washing conditions, the hybridization specificity of the first type of probe with the sample is the strongest and thus it is preserved.

[0101] I. Probe Selection

[0102] When selecting oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of this invention for use as hybridization probes, the following principles and several aspects should be followed:

[0103] 1. The preferred probe size range is 18-50 nucleotides;

[0104] 2. The GC content should be 30%-70%; exceeding this will increase non-specific hybridization.

[0105] 3. There should be no complementary regions inside the probe;

[0106] 4. Probes that meet the above conditions can be used as preliminary selection probes. Then, computer sequence analysis is performed, including comparing the homology of the preliminary selection probe with its source sequence region (i.e., SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive identical bases, then the preliminary selection probe should generally not be used.

[0107] 5. Whether the initial probe is ultimately selected as a probe with practical application value should be further determined by experiments.

[0108] After completing the above analysis, the following two probes were selected and synthesized:

[0109] Probe 1 (probel), belonging to class 1 probes, is completely homologous to or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

[0110] 5, -TGACCAGTGTCCCAGTGAAGGAACGAGTGAAGGTGTCTCAG -3' (SEQ ID NO: 8) probe 2 (probe2), belongs to the second class of probes, and is equivalent to the gene fragment of SEQ ID NO: 1 or its complementary fragment substitution mutation sequence (41Nt):

[0111] 5-TGACCAGTGTCCCAGTGAAGCAACGAGTGAAGGTGTCTCAG-3' (SEQ ID NO: 9) For other commonly used reagents not listed and their preparation methods related to the following specific experimental steps, please refer to: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 (USA) and more. The molecular cloning laboratory manuals used include "Molecular Cloning: A Laboratory Manual" (2nd edition, 1998) by Sambrook et al., published by Science Press.

[0112] Sample preparation:

[0113] 1. Extracting DNA from fresh or frozen tissues

[0114] Steps: 1) Place fresh or freshly thawed normal liver tissue into a container of phosphate buffer that is immersed on ice.

[0115] 1) Place the tissue in a petri dish containing PBS. Cut the tissue into small pieces using scissors or a scalpel. Keep the tissue moist during the process. 2) Centrifuge at 1000g for 10 minutes to mince the tissue. 3) Resuspend the pellet (approximately 10 ml / g) in cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl2). 4) Homogenize the tissue suspension at full speed using an electric homogenizer at 4°C until the tissue is completely broken down. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1g of the initial tissue sample), then centrifuge at 1000g. gCentrifuge for 10 minutes. 7) Resuspend the precipitate with lysis buffer (1 ml per 0.1g of the initial tissue sample), and then proceed with the following phenol extraction method.

[0116] 2. Phenol extraction method for DNA

[0117] Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the precipitated cells in cold cell lysis buffer (1 x 10 ml). 8 (Cells / ml) Use at least 100ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break down, reducing the overall yield. This is especially important when extracting >10... 7 The reaction is particularly severe in cells. 4) Add proteinase K to a final concentration of 200 μg / ml. 5) Incubate at 50°C for 1 hour or gently shake overnight at 37°C. 6) Extract with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes in a small centrifuge tube. The two phases should be clearly separated; otherwise, repeat the centrifugation. 7) Transfer the aqueous phase to a new tube. 8) Extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. Then perform DNA purification and ethanol precipitation.

[0118] 3. DNA purification and ethanol precipitation

[0119] Steps: 1) Add 1 / 10 volume of 2 mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix well. Incubate at -20°C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour off the ethanol. 4) Wash the precipitate with 500 μL of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour off the ethanol. Wash the precipitate with 500 μL of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour off the ethanol, then invert the container on absorbent paper to allow any remaining ethanol to drain. Air dry for 10-15 minutes to allow surface ethanol to evaporate. Do not allow the precipitate to dry completely, otherwise it will be difficult to redissolve. 7) Resuspend the DNA precipitate in a small volume of TE or water. Vortex at low speed or use a dropper to aspirate, while gradually increasing the TE, mixing until the DNA is fully dissolved, every 1-5 x 10⁻⁶ seconds. ό The amount extracted from the cells is approximately 1 ul.

[0120] Steps 8-13 below are only used when it is necessary to remove contaminants; otherwise, you can proceed directly to step 14. 8) Add RNase A to the DNA solution to a final concentration of 100 μg / ml and incubate at 37°C for 30 minutes. 9) Add SDS and proteinase K to final concentrations of 0.5% and 100 μg / ml, respectively. Incubate at 37°C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1 / 10 volume of 2 mol / L sodium acetate and 2.5 volumes of cold ethanol, mix well, and incubate at -20°C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air-dry, and resuspend the nucleic acid, following the same procedure as steps 3-6. 14) Determination of A 26 And A 28 To detect DNA purity and yield. 15) After aliquoting, store at -20°C. Sample membrane preparation:

[0121] 1) Take 4 x 2 appropriately sized nitrocellulose membranes (NC membranes), and lightly mark the spotting locations and sample numbers on them with a pencil. Two NC membranes are needed for each probe so that the membranes can be washed under high-intensity and low-intensity conditions respectively in the subsequent experimental steps.

[0122] 2) Take 15 μL of each sample and control sample, spot them onto the sample film, and let them air dry at room temperature.

[0123] 3) Place on filter paper soaked in 0.1 mol / L NaOH and 1.5 mol / L NaCl for 5 minutes (twice), then air dry.

[0124] 4) Place it between clean filter paper, wrap it with aluminum foil, and vacuum dry at 60-80°C for 2 hours.

[0125] Probe marking

[0126] 1) Add 3 μl Probe (0.10D / 10 μl) to 2 μl Kinase buffer, 8-10 uCi y- 32 P-dATP + 2U Kinase, to be added to a final volume of 20 μL.

[0127] 2) Keep warm at 37 °C for 2 hours.

[0128] 3) Add 1 / 5 volume of bromophenol blue indicator (BPB).

[0129] 4) Pass through Sephadex G-50 column.

[0130] 5) To have 32 The first peak is collected before the P-Probe wash (it can be monitored using a monitor).

[0131] 6) 5 drops / tube, collect 10-15 tubes.

[0132] 7) Monitor isotope levels using a liquid scintillation analyzer

[0133] 8) The collected liquid from the first peak is the desired product. 32 P-Probe (the second peak is free γ-) 32 Ρ- dATP )0

[0134] prehybridization

[0135] Place the sample membrane in a plastic bag, add 3-10 mg of prehybridization solution (10x Denhardt's; 6x SSC, 0.1 mg / ml CT DNA (calf thymus DNA)), seal the bag, and incubate at 68°C with water for 2 hours.

[0136] Hybridization

[0137] Cut off a corner of the plastic bag, add the prepared probe, seal the bag, and incubate overnight at 42°C with water. Washing the mask:

[0138] High-intensity film washing:

[0139] 1) Take out the hybridized sample membrane.

[0140] 2) Wash at 40°C for 15 minutes (twice) in 2xSSC and 0.1%SDS.

[0141] 3) In 0.1% SSC and 0.1% SDS, wash at 40°C for 15 minutes (twice).

[0142] 4) Wash in 0.1% SSC and 0.1% SDS at 55°C for 30 minutes (twice), then air dry at room temperature.

[0143] Low-intensity film washing:

[0144] 1) Take out the hybridized sample membrane.

[0145] 2) Mix 2xSSC and 0.1 SDS, and wash at 37°C for 15 minutes (twice).

[0146] 3) Wash in 0.1xSSC and 0.1 SDS at 37°C for 15 minutes (twice).

[0147] 4) Wash in 0.1% SSC and 0.1% SDS at 40°C for 15 minutes (twice), then air dry at room temperature.

[0148] X-ray autoradiography:

[0149] - 70°C, X-ray autoradiography (compression time depends on the intensity of radioactivity of the hybridization spot).

[0150] Experimental results:

[0151] Hybridization experiments conducted under low-intensity washing conditions showed no significant difference in radioactivity between the two probe hybridization spots; however, hybridization experiments conducted under high-intensity washing conditions showed that the radioactivity intensity of the hybridization spot of probe 1 was significantly stronger than that of the other probe hybridization spot. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of this invention in different tissues. Example 8 DNA Microarray

[0152] Gene chips, or DNA microarrays, are new technologies that many national laboratories and large pharmaceutical companies are currently researching and developing. They involve arranging a large number of target gene fragments in an orderly, high-density manner on a carrier such as glass or silicon, and then using fluorescence detection and computer software to compare and analyze the data, achieving rapid, efficient, and high-throughput analysis of biological information. The polynucleotides of this invention can be used as target DNA in gene chip technology for high-throughput research on the function of new genes; for finding and screening tissue-specific new genes, especially those related to diseases such as tumors; and for the diagnosis of diseases, such as hereditary diseases. The specific methods and steps have been reported in various literatures, such as DeRi si , JL , Lyer , V. & Brown , P. O. (1997) Science 278, 680-686. and Hele , RA , Schema , M., Chai , A. , Sha lom , D. , (1997) PNAS 94: 2150-2155.

[0153] (a) Spotting

[0154] A total of 4000 polynucleotide sequences of various full-length cDNAs were used as target DNAs, including the polynucleotides of this invention. These sequences were amplified separately by PCR, and the purified amplified products were adjusted to the appropriate concentration. Approximately 500 ng / ul was applied to a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Corporation, USA), with a spot spacing of 280 μm. The spotted slides were then hydrated, dried, and cross-linked in a UV cross-linker. After elution and drying, the DNA was immobilized on the glass slides to prepare a chip. Specific methods and steps have been reported in various literatures. The post-spotting processing steps in this embodiment are as follows:

[0155] 1. Hydrate for 4 hours in a humid environment;

[0156] 2. Wash with 0.2% SDS for 1 minute;

[0157] 3. Wash twice with ddH2O, 1 minute each time;

[0158] 4. NaBH4 seal for 5 minutes;

[0159] 5. In 95°C water for 2 minutes;

[0160] 6. Wash with 0.2% SDS for 1 minute;

[0161] 7. Rinse twice with ddH2O;

[0162] 8. Allow to air dry, then store in a dark place at 25°C for later use.

[0163] (II) Probe Marking

[0164] Total mRNA was extracted from normal liver and hepatocellular carcinoma (HCC) using a one-step method. The mRNA was purified using the Oligotex mRNA Midi Kit (QiaGen). Normal liver mRNA was labeled with the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, Amersham Phamacia Biotech) via reverse transcription, while HCC mRNA was labeled with the fluorescent reagent Cy5dUTP (5-Amino-propargyl 1-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, Araershani Phamacia Biotech). Probes were prepared after purification. For detailed steps and methods, please refer to:

[0165] Schena,

[0166] M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol.93: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science.270. (20): 467-480.

[0167] (III) Hybridization

[0168] Probes from the two tissues mentioned above were respectively integrated with the chip in UniHyb™ Hybridization

[0169] Hybridization was performed in the hybridization solution (purchased from TeleChem) for 16 hours. After washing with washing solution (lx SSC, 0.2% SDS) at room temperature, the samples were scanned using a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were processed using Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio for each point. Points with a ratio less than 0.5 and greater than 2 were considered to express differentially expressed genes.

[0170] Experimental results showed that Cy3 signal = 3255.07 (average of four experiments), Cy5 signal = 4478.6 (average of four experiments), and Cy3 / Cy5 = 0.72681. The polynucleotide of this invention was effective in both tissues. There was no significant difference in expression. Industrial applicability.

[0171] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be used directly for the treatment of diseases, such as malignant tumors, adrenal insufficiency, skin diseases, various inflammations, HIV infection, and immune diseases.

[0172] Beta-transducin is a G protein that activates cGMP-specific phosphodiesterases. Beta-transducin (G-beta) is one of the three subunits of a G protein and acts as an intermediate in transmembrane signal transduction in a wide range of physiological responses, including visual and hormonal responses. The beta subunit is essential for GTP substitution of GDP, as well as membrane anchoring and receptor recognition, and also participates in the inactivation of the alpha subunit. Beta-transducin possesses the characteristic WD-40 repeat sequence, which is essential for peptide biological activity.

[0173] The polypeptide of this invention is a polypeptide containing the characteristic WD-40 repeat sequence of Beta-transferin. Abnormal expression of this polypeptide leads to abnormal cell signaling and related diseases.

[0174] Therefore, abnormal expression of transductionin 18 in this invention will lead to various diseases, especially embryonic developmental disorders, endocrine disorders, tumors, and growth and developmental disorders, including but not limited to:

[0175] Embryonic developmental disorders: Congenital miscarriage, cleft palate, limb agenesis, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, dipleureters, cryptorchidism, congenital inguinal hernia, didelphic uterus, vaginal atresia, hypospadias, intersex conditions, atrial septal defect, ventricular septal defect, pulmonary stenosis, patent ductus arteriosus, neural tube defects, congenital hydrocephalus, iris defects, congenital cataracts, congenital glaucoma or cataracts, congenital deafness.

[0176] Endocrine disorders: Simple goiter, thyroiditis, hyperthyroidism, hypothyroidism, cretinism, diabetes insipidus, precocious puberty, acromegaly, hyperprolactinemia (galactorrhea-amenorrhea syndrome), pituitary syndrome, adult hypopituitarism (Simmonds-Sheehan syndrome), pituitary dwarfism, pituitary adenoma (prolactinoma), hyperparathyroidism, hypoparathyroidism, Cushing's syndrome, primary aldosteronism, adrenocortical insufficiency, diabetes mellitus; Ovarian diseases: Premenstrual tension, menopausal syndrome, ovarian hypoplasia, amenorrhea; Male hypogonadism, male precocious puberty.

[0177] Growth and developmental disorders: intellectual disability, cerebral palsy, brain development disorders, intellectual disability, familial cranial nucleus dysplasia syndrome, strabismus, skin, fat, and muscle dysplasia such as congenital cutis laxa, progeria, congenital keratosis, various metabolic disorders such as various amino acid metabolism disorders, cretinism, dwarfism, and delayed sexual development.

[0178] Tumors in various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, Thyroid tumors, uterine fibroids, neuroblastomas, astrocytomas, ependymomas, gliomas, colon cancer, melanomas, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumors, nasal and sinus tumors, nasopharyngeal carcinoma, laryngeal cancer, tracheal tumors, fibromas, fibrosarcomas, lipomas, liposarcomas, leiomyomas

[0179] Abnormal expression of transductionin 18 of the present invention will also lead to certain hereditary, hematologic and immune system diseases.

[0180] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be used directly for disease treatment, such as treating various diseases, especially embryonic developmental disorders, diseases related to abnormal thyroid hormone regulation, tumors, growth and developmental disorders, certain hereditary, hematologic, and immune system diseases.

[0181] This invention also provides a method for screening compounds to identify agents that enhance (agonist) or inhibit (antagonist) transductionin 18. Agonists enhance the biological functions of transductionin 18, such as stimulating cell proliferation, while antagonists inhibit and treat disorders associated with excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing transductionin 18 can be cultured together with labeled transductionin 18 in the presence of the drug. The ability of the drug to enhance or inhibit this interaction can then be determined.

[0182] Antagonists of transductionin 18 include screened antibodies, compounds, receptor-deficient derivatives, and analogs. Antagonists of transductionin 18 can bind to transductionin 18 and eliminate its function, or inhibit the production of the peptide, or bind to the active site of the peptide, preventing it from performing its biological function.

[0183] When screening compounds for antagonism, transductionin 18 can be added to a bioanalytical assay. The antagonist status is determined by measuring the compound's effect on the interaction between transductionin 18 and its receptor. Using the same method, receptor deletions and analogs that act as antagonists can be screened. Peptides that bind to transductionin 18 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. Transductionin 18 molecules are generally labeled during screening.

[0184] This invention provides a method for producing antibodies using polypeptides, fragments thereof, derivatives, analogs, or their cellular components as antigens. These antibodies may be polyclonal or monoclonal antibodies. This invention also provides antibodies against the transductionin 18 antigenic determinant. These antibodies include, but are not limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

[0185] Polyclonal antibodies can be produced by directly injecting transductionin-18 into immunized animals (such as rabbits, mice, and rats). Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies against transductionin-18 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), three-cell hybridoma technology, human β-cell hybridoma technology, and EBV-hybridoma technology. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques. Production (Morrison et al., PNAS, 1985, 81: 6851). Existing technology for producing single-chain antibodies (US Patent No. 4946778) can also be used to produce single-chain antibodies against transductionin-18.

[0186] Anti-transductionin-18 antibodies can be used in immunohistochemistry to detect transductionin in biopsy specimens.

[0187] 18.

[0188] Monoclonal antibodies that bind to transductionin-18 can also be labeled with radioactive isotopes, allowing for tracking of their location and distribution after injection into the body. These radiolabeled antibodies can serve as a non-invasive diagnostic method for locating tumor cells and determining the presence of metastasis.

[0189] Antibodies can also be used to design immunotoxins targeting specific sites in the body. For example, monoclonal antibodies with high affinity for transductionin 18 can covalently bind to bacterial or biological toxins (such as diphtheria toxin, ricin, and erythrine). A common method is to use a thiol cross-linking agent, such as SPDP, to attack the amino group of the antibody, binding the toxin to the antibody through disulfide bond exchange. Such hybrid antibodies can be used to kill transductionin 18-positive cells.

[0190] The antibodies of this invention can be used to treat or prevent diseases associated with transductionin 18. Administration of appropriate doses of the antibodies can stimulate or block the production or activity of transductionin 18.

[0191] This invention also relates to diagnostic assays for the quantitative and localized detection of transductionin 18 levels. These assays are well known in the art and include FISH and radioimmunoassay assays. The transductionin 18 levels detected in these assays can be used to interpret the importance of transductionin 18 in various diseases and to diagnose diseases in which transductionin 18 functions.

[0192] The peptides of this invention can also be used for peptide profiling analysis. For example, the peptides can be specifically cleaved by physical, chemical, or enzymatic methods and analyzed by one-dimensional, two-dimensional, or three-dimensional gel electrophoresis, and more preferably by mass spectrometry. Polynucleotides encoding transductionin 18 can also be used for various therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of transductionin 18. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant transductionin 18 to inhibit endogenous transductionin 18 activity. For example, a variant transductionin 18 can be a shortened transductionin 18 lacking a signal transduction domain; although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of transductionin 18. Viral expression vectors, such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex viruses, and parvoviruses, can be used to transfer polynucleotides encoding transductionin 18 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding transductionin 18 can be found in existing literature (Sambrook, et al.). Additionally, recombinant polynucleotides encoding transductionin 18 can be packaged into liposomes and transferred into cells.

[0193] Methods for introducing polynucleotides into tissues or cells include: directly injecting polynucleotides into in vivo tissues; or introducing polynucleotides into cells in vitro using vectors (such as viruses, bacteriophages, or plasmids). Then the cells are transplanted into the body, etc.

[0194] Oligonucleotides (including antisense RNA and DNA) that inhibit transductionin 18 mRNA, as well as ribozymes, are also within the scope of this invention. A ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs; its mechanism of action involves the ribozyme molecule specifically hybridizing with a complementary target RNA (MA) and then performing endonuclease. Antisense RNA (RM), DNA, and ribozymes can be obtained using any existing RM or DM synthesis technology, such as the widely used solid-phase phosphoramide chemical synthesis method for oligonucleotides. Antisense RNA molecules can be obtained by transcription in vitro or in vivo using a DM sequence encoding the RM. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. To increase the stability of nucleic acid molecules, they can be modified in various ways, such as increasing the length of the flanking sequences, and using phosphothioester or peptide bonds instead of phosphodiester bonds for the ribonucleosides.

[0195] Polynucleotides encoding transductionin 18 can be used for the diagnosis of diseases related to transductionin 18. These polynucleotides can be used to detect the expression of transductionin 18 or its abnormal expression in disease states. For example, the DM sequence encoding transductionin 18 can be used to hybridize biopsy specimens to determine the expression status of transductionin 18. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of this invention can be immobilized as probes on microarrays or DM chips (also known as "gene chips") for differential gene expression analysis and gene diagnosis in tissues. Transductionin 18 transcripts can also be detected by in vitro amplification using transductionin 18-specific primers via RNA-polymerase chain reaction (RT-PCR).

[0196] Detecting mutations in the transductionin 18 gene can also be used to diagnose transductionin 18-related diseases. Transductionin 18 mutations can take the form of point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type transductionin 18 DNA sequence. Existing techniques such as sono-thermography, DM sequence analysis, PCR, and in situ hybridization can be used to detect mutations. Furthermore, mutations may affect protein expression; therefore, Nor-thermography and Western blotting can be used to indirectly determine the presence of gene mutations.

[0197] The sequences of this invention are also valuable for chromosome identification. These sequences specifically target a particular location on a human chromosome and can hybridize with it. Currently, there is a need to identify the specific sites of genes on chromosomes. At present, only a few chromosome markers based on actual sequence data (repetitive polymorphisms) are available for labeling chromosome locations. According to this invention, a crucial first step in associating these sequences with disease-related genes is to locate these DNA sequences on chromosomes.

[0198] In short, PCR primers (preferably 15-35 bp) are prepared based on cDM, allowing the sequence to be located on the chromosome. These primers are then used for PCR screening of somatic cell hybrids containing each human chromosome. Only those hybrid cells containing the corresponding human genes from the primers will produce amplified fragments.

[0199] PCR localization of somatic hybrid cells is a rapid method for locating DNA to specific chromosomes. Using the oligonucleotide primers of this invention, sub-localization can be achieved using a set of fragments from a specific chromosome or a large number of genomic clones through similar methods. Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening using labeled flow cytometry, and hybridization pre-selection, thereby constructing chromosome-specific cDNA libraries.

[0200] Fluorescence in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows for precise chromosome localization in a single step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

[0201] Once a sequence is pinpointed to its precise chromosomal location, that physical location on the chromosome can be correlated with gene mapping data. This data can be found, for example, in V. McKusick, Mendelian Inheritance in Man (accessible via link to Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between the gene and diseases already located on the chromosomal region.

[0202] Next, it is necessary to determine the differences in cDNA or genomic sequences between diseased and healthy individuals. If a mutation is observed in some or all diseased individuals, but not in any healthy individuals, then that mutation may be the cause of the disease. Comparing diseased and healthy individuals typically involves first looking for structural changes in the chromosomes, such as deletions or translocations visible at the chromosomal level or detectable by cDNA sequence-based PCR. Depending on the resolution of current physical mapping and gene localization techniques, cDNA precisely located to the chromosomal region associated with the disease can be one of 50 to 500 potential pathogenic genes (assuming a mapping resolution of 1 megabase and one gene per 20 kb).

[0203] The peptides, polynucleotides and their analogues, agonists, antagonists and inhibitors of the present invention can be used in combination with suitable drug carriers. These carriers can be water, glucose, ethanol, salts, buffer solutions, glycerol and combinations thereof. The compositions contain a safe and effective amount of the peptide or antagonist, as well as a carrier and excipients that do not affect the efficacy of the drug. These compositions can be used as drugs for the treatment of diseases.

[0204] The present invention also provides a kit or reagent kit containing one or more containers, wherein the containers contain one or more pharmaceutical composition ingredients of the present invention. Along with these containers, there may be indicative instructions from the government regulatory authority that manufactures, uses, or sells the pharmaceutical or biological product, reflecting the authority's permission for its administration to humans. Furthermore, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

[0205] The pharmaceutical composition can be administered in a convenient manner, such as via local, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes. Transduction 18 is administered in an amount that effectively treats and / or prevents a specific indication. The amount and dosage range of transduction 18 administered to a patient will depend on many factors, such as the route of administration, the patient's health condition, and the diagnostic physician's judgment.

Claims

Claims 1. An isolated polypeptide-transductionin 18, characterized in that... It contains a polypeptide, or an active fragment of the polypeptide, analogue or derivative thereof, having the amino acid sequence shown in SEQ ID NO:

2.

2. The polypeptide as described in claim 1, characterized in that... The amino acid sequence of the polypeptide, analogue or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO:

2.

3. The polypeptide as claimed in claim 2, characterized in that... It contains a polypeptide having the amino acid sequence shown in SEQ ID NO:

2.

4. An isolated polynucleotide, characterized in that... The polynucleotide comprises one selected from the group consisting of: (a) A polypeptide or a fragment thereof, analogue, or derivative thereof encoding the amino acid sequence shown in SEQ ID NO: 2; (b) Polynucleotides complementary to polynucleotides; or (c) A polynucleotide that has at least 70½ percent identity with (a) or (b).

5. The polynucleotide as described in claim 4, characterized in that... The polynucleotide comprises a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:

2.

6. The polynucleotide as described in claim 4, characterized in that... The polynucleotide sequence contains the sequence of positions 1351-1851 in SEQ ID NO: 1 or the sequence of positions 1-2887 in SEQ ID NO:

1.

7. A recombinant vector containing exogenous polynucleotides, characterized in that... It is a recombinant vector constructed from the polynucleotide described in any one of claims 4-6 and a plasmid, virus, or vector expression vector.

8. A genetically engineered host cell containing exogenous polynucleotides, characterized in that... It is selected from one of the following host cells: (a) Host cells transformed or transduced using the recombinant vector of claim 7; or (b) Host cells transformed or transduced with the polynucleotide as described in any one of claims 4-6.

9. A method for preparing a polypeptide with transductionin-18 activity, characterized in that... The method includes: (a) Culture the engineered host cells described in requirement 8 under conditions expressing transductionin 18; (b) Isolate a polypeptide with transductionin 18 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that... The antibody is an antibody that can specifically bind to transductionin 18.

11. A class of compounds that mimic or regulate the activity or expression of peptides, characterized in that... These are compounds that mimic, promote, antagonize, or inhibit the activity of transductionin 18.

12. The compound as claimed in claim 11, characterized in that... It is the antisense sequence of the polynucleotide sequence or a fragment thereof shown in SEQ ID NO:

1.

13. An application of the compound of claim 11, characterized in that... The compound is used in methods for regulating the in vivo and in vitro activity of transductionin-18.

14. A method for detecting a disease or susceptibility to a disease associated with the polypeptide described in any one of claims 1-3, characterized in that... This includes detecting the expression level of the polypeptide, or detecting the activity of the polypeptide, or detecting nucleotide variations in the polynucleotide that cause abnormal expression or activity of the polypeptide.

15. The use of the polypeptide according to any one of claims 1-3, characterized in that... It is used to screen transductionin 18 mimics, agonists, antagonists or inhibitors; or for peptide fingerprint identification.

16. The application of the nucleic acid molecule as claimed in any one of claims 4-6, characterized in that... It can be used as a primer in nucleic acid amplification reactions, or as a probe in hybridization reactions, or in the manufacture of gene chips.

17. The use of the polypeptide, polynucleotide, or compound as claimed in any of claims 1-6 and 11, characterized in that... The polypeptide, polynucleotide or its analogue, agonist, antagonist or inhibitor, in a safe and effective dose with a pharmaceutically acceptable carrier, constitutes a pharmaceutical composition for the diagnosis or treatment of diseases associated with transductionin 18 abnormalities.

18. The use of the polypeptide, polynucleotide, or compound according to any one of claims 1-6 and 11, characterized in that... Drugs for treating conditions such as malignant tumors, hematological diseases, HIV infection, immune disorders, and various types of inflammation can be prepared using the aforementioned polypeptides, polynucleotides, or compounds.