Novel polypeptide---a human parkinson's disease related protein 11 and polynucleotide encoding it

Abstract

The invention concerns a human Parkinson's disease-related protein 11 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. cerebral cortical functional disorder, extrapyramidal functional disorder, diseases associated with abnormal cerebellar function, congestive heart disease, male sexual dysgenesis etc. utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes a human Parkinson's disease related protein 11.

Description

[0001] A novel polypeptide is identified as Parkinson's syndrome-associated protein 11, and the polynucleotide antagonist domain of this polypeptide is also described.

[0002] This invention belongs to the field of biotechnology. Specifically, this invention describes a novel polypeptide—human Parkinson's disease-associated protein 11—and the polynucleotide sequence encoding this polypeptide. This invention also relates to methods for preparing this polynucleotide and polypeptide, and their applications. Background Technology

[0003] Common neurodegenerative diseases have complex clinical features. Research has found that mutations or deletions at the q25.2-q27 locus on human chromosome 6 are the main cause of autosomal recessive juvenile Parkinson's disease. Mutations or abnormal expression of the protein encoded by this locus will lead to the development of juvenile Parkinson's disease. This indicates that the protein encoded by this locus plays an important regulatory role in the development and growth of the related nervous system in the body.

[0004] Several proteins associated with the development of Parkinson's disease have been cloned, and their structures and functions have been studied. In 1998, Tohru et al. cloned a new protein associated with Parkinson's disease—Parkinin. This protein is expressed in various human tissues, including the brain, heart, testes, and skeletal muscle. In the brain, it is expressed in various regions, including the substantia nigra. Mutations in this protein or the deletion of exons will lead to the development of Parkinson's disease. Studies have found that the amino terminus of this protein is very similar to the N-terminus of ubiquitin proteins, where the conserved lysine residues are essential for the formation of polyubiquitin chains; the rest of the perkinin sequence is rich in cysteine, and its protein sequence also contains a RING zinc finger protein structural motif at the C-terminus: Cys-X2-Cys-X9-Cys-Xl-His-X2-[Cys-X4-Cys]-X4-Cys-X2-Cys0. Therefore, it is believed that this protein is a member of the RING zinc finger protein family and has similar biological functions to other members of the zinc finger protein family [Tohru K tada, Shui chi Asakawa et al. , 1998, Nature, 392: 605-608].

[0005] As shown above, Parkin plays a crucial regulatory role in the development of the nervous system, and its involvement in the pathogenesis of various neurodegenerative diseases is a key aspect of research. The C-terminus of this protein contains a highly conserved RING motif from the RING protein family. This protein shares similar biological functions with other members of the zinc finger protein family. In vivo, it participates in regulating the differentiation, growth, and development of various related tissues and cells. Mutations or abnormal expression of this protein can lead to abnormal development and growth of related tissues, thereby triggering various related diseases. This protein is typically closely associated with the occurrence of various neurodevelopmental and metabolic disorders, immune system diseases, and tumors and cancers in related tissues. It can also be used to diagnose and treat these diseases. Gene chip analysis revealed that the expression profiles of the polypeptides of this invention are very similar to those of human Parkinson's disease-related proteins in bladder mucosa, PMA+ Ecv304 cell line, LPS+ Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibrobladder t (stimulated with growth factor), 1024NT, scar fc (stimulated with growth factor), 1013HT, scar fc (not stimulated with growth factor), 1013HC, bladder cancer cells EJ, adjacent bladder cancer cells, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunal adenocarcinoma, and gastric cardia cancer. Therefore, their functions may also be similar. This invention is named Human Parkinson's Disease-Related Protein 11.

[0006] As mentioned above, human Parkinson's disease-associated protein 11 plays a crucial role in regulating vital bodily functions such as cell division and embryonic development. Given that these regulatory processes are believed to involve numerous proteins, there has been a long-standing need in the art to identify more human Parkinson's disease-associated protein 11 proteins involved in these processes, particularly to identify their amino acid sequences. The isolation of the gene encoding this novel human Parkinson's disease-associated protein 11 provides a foundation for determining its role in both healthy and disease states. This protein may form the basis for developing diagnostic and / or therapeutic agents for the disease; therefore, isolating its encoding DM is of paramount importance. Objective of the Invention

[0007] One object of the present invention is to provide an isolated novel polypeptide—human Parkinson's syndrome-associated protein 11, as well as its fragments, analogs and derivatives.

[0008] Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

[0009] Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human Parkinson's disease-associated protein 11.

[0010] Another object of the present invention is to provide genetically engineered host cells containing a polynucleotide encoding human Parkinson's disease-associated protein 11.

[0011] Another object of the present invention is to provide a method for producing human Parkinson's disease-associated protein 11. Another object of the present invention is to provide an antibody against the polypeptide of the present invention—human Parkinson's disease-associated protein 11.

[0012] Another object of the present invention is to provide a mimicry compound, antagonist, agonist, or inhibitor of the present invention’s polypeptide, human Parkinson’s syndrome-associated protein 11.

[0013] Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human Parkinson's syndrome-associated protein 11. Invention Summary

[0014] This invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conserved variant thereof, a bioactive fragment, or a derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

[0015] The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0016] (a) A polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

[0017] (b) A polynucleotide complementary to polynucleotide (a);

[0018] (c) A polynucleotide that has at least 70% identity with the polynucleotide sequence of (a) or (b).

[0019] More preferably, the sequence of the polynucleotide is selected from one of the following groups: (a) a sequence having positions 216-518 of SEQ ID NO: 1; and (b) a sequence having positions 1-1252 of SEQ ID NO: 1.

[0020] The present invention also relates to a vector containing the polynucleotides of the present invention, particularly an expression vector; a host cell genetically engineered using the vector, including a transformed, transduced, or transfected host cell; and a method for preparing the polypeptides of the present invention, including culturing the host cell and recovering the expression product.

[0021] The present invention also relates to an antibody that can specifically bind to the polypeptide of the present invention.

[0022] The present invention also relates to a method for screening compounds that mimic, activate, antagonize, or inhibit the activity of human Parkinson's disease-associated protein 11, comprising utilizing the polypeptide of the present invention. The present invention also relates to compounds obtained by this method.

[0023] The present invention also relates to a method for in vitro detection of diseases or susceptibility to diseases associated with abnormal expression of human Parkinson's syndrome-associated protein 11, comprising detecting mutations in the polypeptide or its encoding polynucleotide sequence in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.

[0024] The present invention also relates to a pharmaceutical composition comprising the polypeptide of the present invention or an analogue thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

[0025] The present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of medicaments for treating cancer, developmental or immune diseases or other diseases caused by abnormal expression of human Parkinson's syndrome-associated protein 11.

[0026] Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. Brief Description of the Drawings

[0027] The following figures are used to illustrate specific embodiments of the present invention, and are not intended to limit the scope of the invention as defined by the claims. Figure 1 is a comparison of the gene chip expression profiles of human Parkinson's syndrome-related protein 11 and other human Parkinson's syndrome-related proteins. The upper figure is a folded graph of the expression profile of human Parkinson's syndrome-related protein 11, and the lower figure is a folded graph of the expression profile of other human Parkinson's syndrome-related proteins. Among them, 1-bladder mucosa, 2-PMA+ Ecv304 cell line, 3-LPS+ Ecv304 cell line thymus, 4-normal fibroblast 1024NC, 5-Fibroblas t, growth factor stimulated, 1024NT, 6-scar fc growth factor stimulated, 1013HT, 7-scar fc unstimulated with growth factor, 1013HC, 8-bladder cancer cell line EJ, 9-bladder adjacent to cancer cells, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunal adenocarcinoma, 17-cardia cancer.

[0028] Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) image of isolated human Parkinson's disease-associated protein 11. 1kDa represents the molecular weight of the protein. The arrows indicate the isolated protein bands. Summary of the Invention

[0029] Unless otherwise specified, the following terms used in this specification and claims have the following meanings: "Nucleic acid sequence" refers to oligonucleotides, nucleotides, or polynucleotides and fragments or portions thereof, and may also refer to genomes or synthetic DM or RNA, which may be single-stranded or double-stranded, representing sense or antisense strands. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof. When "amino acid sequence" in this invention refers to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean limiting the amino acid sequence to the complete natural amino acids associated with said protein molecule.

[0030] A protein or polynucleotide "variant" is an amino acid sequence or polynucleotide sequence encoding it that has one or more amino acid or nucleotide changes. These changes may include the deletion, insertion, or substitution of amino acids or nucleotides in the amino acid or nucleotide sequence. Variants may have "conserved" changes, where the substituted amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine. Variants may also have non-conserved changes, such as replacing glycine with tryptophan.

[0031] "Deficiency" refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

[0032] "Insertion" or "addition" refers to a change in the amino acid or nucleotide sequence that results in the addition of one or more amino acids or nucleotides compared to the naturally occurring molecule. "Replacement" refers to the substitution of one or more amino acids or nucleotides by different amino acids or nucleotides.

[0033] "Bioactivity" refers to proteins that possess the structural, regulatory, or biochemical functions of natural molecules. Similarly, the term "immunologic activity" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce specific immune responses and bind to specific antibodies in suitable animals or cells.

[0034] "Agonist" refers to a substance that, when bound to Parkinson's disease-associated protein 11, can cause this protein to... Agonists are molecules that modify the activity of a protein by altering its composition. They can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to human Parkinson's disease-associated protein 11.

[0035] An "antagonist" or "inhibitor" is a molecule that, when bound to human Parkinson's disease-associated protein 11, blocks or modulates the biological or immunological activity of 11. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to 11.

[0036] "Regulation" refers to changes in the function of human Parkinson's disease-associated protein 11, including increases or decreases in protein activity, changes in binding properties, and any other changes in the biological, functional, or immune properties of human Parkinson's disease-associated protein 11.

[0037] "Substantially pure" means substantially free of other naturally occurring or related proteins, lipids, carbohydrates, or other substances. Those skilled in the art can purify human Parkinson's disease-associated protein 11 using standard protein purification techniques. Substantially pure human Parkinson's disease-associated protein 11 produces a single master band on a non-reducing polyacrylamide gel. The purity of the human Parkinson's disease-associated protein 11 peptide can be determined by amino acid sequence analysis.

[0038] "Complementary" or "complementary" refers to the natural binding of polynucleotides through base pairing under permissible salt concentration and temperature conditions. For example, the sequence "C-TGA" can bind to the complementary sequence "G-A-C-T". Complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.

[0039] "Homology" refers to the degree of complementarity, which can be partial or complete homology. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence with the target nucleic acid. This inhibition of hybridization can be detected by hybridization under reduced stringency conditions (such as Southern or Northern blotting). Essentially, homologous sequences or hybridization probes can competitively inhibit the binding of completely homologous sequences to the target sequence under reduced stringency conditions. This does not mean that reduced stringency conditions allow non-specific binding, because reduced stringency conditions require the binding of the two sequences to be a specific or selective interaction.

[0040] "Identity percentage" refers to the percentage of identical or similar sequences in a comparison of two or more amino acid or nucleic acid sequences. The identity percentage can be determined electronically, such as using the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences using different methods, such as the Cluster method (Higgins, DG, and PM Sharp (1988) Gene 73: 237-244). The Cluster method clusters sequences by examining the distance between all pairs. The clusters are then assigned in pairs or groups. The identity percentage between two amino acid sequences, such as sequence A and sequence B, is calculated using the following formula: The number of matching residues between sequences ^

[0041] The number of residues in the sequence – the number of spacer residues in sequence ^ (the number of spacer residues in sequence 3) can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein's determination of the percentage of identity between nucleic acid sequences (Hein J., (1990) Methods in enzymology 183: 625-645).

[0042] "Similarity" refers to the degree of identical or conserved substitution of amino acid residues at corresponding positions when comparing the arrangement of amino acid sequences. Amino acids used for conserved substitution, such as negatively charged amino acids, can include aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similar hydrophilicity and uncharged head groups can include leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

[0043] "Antense" refers to a nucleotide sequence that is complementary to a specific DM or RNA sequence. "Antense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

[0044] "Derivatives" refer to HFPs or chemical modifications that encode their nucleic acids. These modifications can involve replacing hydrogen atoms with alkyl, acyl, or amino groups. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of the natural molecule.

[0045] "Antibody" refers to the complete antibody molecule and its fragments, such as Fa, ? (^,)2 and ? 7, which can specifically bind to the antigenic determinant of human Parkinson's disease-associated protein 11.

[0046] "Humanized antibody" refers to an antibody whose non-antigen binding region amino acid sequence has been replaced to make it more similar to a human antibody, but still retains its original binding activity.

[0047] The term "separated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living organism is not separated, but the same polynucleotide or polypeptide separated from some or all of the substances that coexist with it in the natural system is considered separated. Such a polynucleotide may be part of a carrier, or it may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still separated.

[0048] As used in this invention, "isolated" means that a substance has been separated from its original environment (or, if the substance is natural, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0049] As used herein, "isolated human Parkinson's disease-associated protein 11" means that human Parkinson's disease-associated protein 11 is substantially free of other naturally occurring related proteins, lipids, carbohydrates, or other substances. Those skilled in the art can purify human Parkinson's disease-associated protein using standard protein purification techniques. 11. Essentially pure peptides produce a single master band on non-reducing polyacrylamide gels. The purity of the human Parkinson's disease-associated protein 11 peptide can be analyzed using its amino acid sequence.

[0050] This invention provides a novel polypeptide, a Parkinson's syndrome-associated protein 11, which is essentially composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of this invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of this invention can be a naturally purified product, a chemically synthesized product, or produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of this invention can be glycosylated or non-glycosylated. The polypeptide of this invention may or may not include an initial methionine residue.

[0051] This invention also includes fragments, derivatives, and analogs of human Parkinson's disease-associated protein 11. As used herein, the terms "fragment," "derivative," and "analyte" refer to polypeptides that substantially retain the same biological function or activity as human Parkinson's disease-associated protein 11 of this invention. Fragments, derivatives, or analogs of the polypeptides of this invention may be: (I) in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues (preferably conserved amino acid residues), and the substituted amino acids may or may not be encoded by a genetic codon; or (II) in which a group on one or more amino acid residues is substituted with another group containing a substituent; or (III) in which a mature polypeptide is fused with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) in which an additional amino acid sequence is fused into the mature polypeptide to form a polypeptide sequence (e.g., a leader sequence, a secretory sequence, or a sequence used to purify the polypeptide or a proteogenic sequence). Based on the description herein, such fragments, derivatives, and analogues are considered to be within the knowledge of those skilled in the art.

[0052] This invention provides isolated nucleic acids (polynucleotides) that are essentially composed of polynucleotides encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of this invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of this invention was discovered from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1252 bases, with open reading frames 216-518 encoding 100 amino acids. Based on gene chip expression profile comparison, this polypeptide has a similar expression profile to human Parkinson's disease-related proteins, suggesting that this human Parkinson's disease-related protein 11 has similar functions to human Parkinson's disease-related proteins.

[0053] The polynucleotides of this invention can be in DM or RNA form. DM forms include cDNA, genomic DM, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to or a degenerate variant of the coding region sequence shown in SEQ ID NO: 1. As used in this invention, "degenerate variant" refers to... It refers to a nucleic acid sequence that encodes a protein or polypeptide having SEQ ID NO: 2, but differs from the coding region sequence shown in SEQ ID NO: 1.

[0054] The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0055] The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polynucleotide encoding the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

[0056] This invention also relates to variants of the polynucleotides described above, which encode polypeptides or polypeptide fragments, analogs, and derivatives having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.

[0057] The present invention also relates to polynucleotides that hybridize with the sequences described above (having at least 50%, preferably 70%, similarity between the two sequences). The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2xSSC, 0.1% SDS, 6 (TC); or (2) the use of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficol, 42 °C, etc.; or (3) hybridization only occurs when the similarity between the two sequences is at least 95%, preferably at least 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

[0058] This invention also relates to nucleic acid fragments that hybridize with the sequences described above. As used in this invention, the length of a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human Parkinson's disease-associated protein 11.

[0059] The polypeptides and polynucleotides of this invention are preferably provided in isolated form, and more preferably purified to homogeneity. The specific polynucleotide sequence encoding human Parkinson's disease-associated protein 11 of this invention can be obtained by a variety of methods. For example, polynucleotides can be isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes with genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect polynucleotide fragments of clones with common structural features.

[0060] The DM fragment sequence of the present invention can also be obtained by the following methods: 1) Isolating double-stranded DNA from genomic DNA. 1) Sequence; 2) Chemically synthesize DNA sequences to obtain double-stranded DM of the polypeptide.

[0061] Of the methods mentioned above, isolating genomic DM is the least common. Direct chemical synthesis of DNA sequences is the frequently chosen method. An even more common method is the isolation of cDNA sequences. The standard method for isolating cDM of interest is to isolate mRNA from donor cells that highly express the gene and perform reverse transcription to form plasmid or phage cDNA libraries. Several mature techniques exist for mRNA extraction, and kits are commercially available (Qiagene). Constructing cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as various cDNA libraries from Clontech. When combined with polymerase chain reaction technology, even very small amounts of expression products can be cloned.

[0062] The gene of the present invention can be selected from these cDNA libraries using conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RM hybridization; (2) marking the presence or loss of gene function; (3) determining the level of transcripts of human Parkinson's syndrome-associated protein 11; and (4) detecting the protein product of gene expression by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.

[0063] In method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. Furthermore, the length of the probe is generally within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is typically a chemically synthesized DM sequence based on the gene sequence information of the present invention. The gene itself or a fragment of the present invention can, of course, be used as a probe. The DNA probe can be labeled with radioactive isotopes, fluorescein, or enzymes (such as alkaline phosphatase), etc.

[0064] In the fourth method, the protein product of the human Parkinson's syndrome-related protein 11 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

[0065] The method of amplifying DNA / RM using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferred for obtaining the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA end amplification method) is preferred. The primers used for PCR can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DM / RM fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0066] The polynucleotide sequences of the gene or various DNA fragments obtained as described above can be determined using conventional methods such as the dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). These polynucleotide sequences can also be determined using commercial sequencing kits. To obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes, it is necessary to determine the cDNA sequences of multiple clones before they can be assembled into a complete sequence. Long cDNA sequence.

[0067] The present invention also relates to vectors containing the polynucleotides of the present invention, and host cells genetically engineered using the vectors of the present invention or directly using the coding sequence of human Parkinson's syndrome-associated protein 11, and methods for generating the polypeptides of the present invention via recombinant technology.

[0068] In this invention, a polynucleotide sequence encoding human Parkinson's disease-associated protein 11 can be inserted into a vector to construct a recombinant vector containing the polynucleotides described in this invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well-known in the art. Vectors applicable in this invention include, but are not limited to: expression vectors based on the T7 promoter expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988); and vectors derived from baculoviruses expressed in insect cells. In short, any plasmid and vector can be used to construct a recombinant expression vector, provided it can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain a replication origin, a promoter, a marker gene, and translational regulatory elements.

[0069] Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human Parkinson's disease-associated protein 11 and suitable transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; the PL promoter of *λ* phage; eukaryotic promoters including the immediate early promoter of CMV, the thymidine kinase promoter of HSV, early and late SV40 promoters, LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Inserting enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors of DNA expression, typically consisting of approximately 10 to 300 base pairs, that act on promoters to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0070] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0071] Those skilled in the art are well aware of how to select appropriate vectors / transcriptional regulatory elements (such as promoters). (e.g., enhancers, etc.) and selective marker genes.

[0072] In this invention, a polynucleotide encoding human Parkinson's disease-associated protein 11, or a recombinant vector containing such a polynucleotide, can be transformed or introduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: *Escherichia coli*, *Streptomyces*; bacterial cells such as *Salmonella typhimurium*; fungal cells such as yeast; plant cells; insect cells such as *Drosophila S2* or *Sf9*; and animal cells such as CHO, COS, or Bowes melanoma cells.

[0073] Transformation of host cells using the DNA sequence described in this invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *Escherichia coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated using the (1 / 2) method, the steps of which are well known in the art. MgCl2 is an alternative. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0074] Using conventional recombinant DM technology, the polynucleotide sequence of this invention can be used to express or produce recombinant human Parkinson's syndrome-associated protein 11 (Science, 1984; 224: 1431). Generally, the following steps are involved:

[0075] (1) Transform or transduce suitable host cells using the polynucleotide (or variant) encoding human Parkinson's syndrome-associated protein 11 of the present invention, or using a recombinant expression vector containing the polynucleotide;

[0076] (2) Culture the host cells in a suitable culture medium;

[0077] (3) Isolate and purify proteins from culture media or cells.

[0078] In step (2), the culture medium used in the culture can be selected from various conventional culture media, depending on the host cells used. The cells are cultured under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature change or chemical induction), and the cells are cultured for a further period.

[0079] In step (3), the recombinant polypeptide may be encapsulated within cells, expressed on the cell membrane, or secreted extracellularly. If desired, the recombinant protein may be separated and purified using various separation methods based on its physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional refolding treatment, protein precipitation (salting out), centrifugation, percolation, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof.

[0080] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be directly used for disease treatment, for example, to treat malignant tumors, adrenal insufficiency, skin diseases, various inflammations, HIV infection, and Immunological diseases, etc.

[0081] Parkinson's disease is a common neurodegenerative disease with complex clinical features. Research has found that mutations or deletions at the q25.2-q27 locus on human chromosome 6 are the main cause of autosomal recessive juvenile Parkinson's disease. Mutations or abnormal expression of the protein encoded by this locus lead to juvenile Parkinson's disease. This indicates that the protein encoded by this locus plays an important regulatory role in the development and growth of the related nervous system. Parkinson's disease-associated protein (Parkinin) is a novel protein associated with the occurrence of Parkinson's disease. This protein is expressed in various human tissues, including the brain, heart, testes, and skeletal muscle. In the brain, this protein is expressed in various regions, including the substantia nigra. Mutations or exon deletions of this protein lead to Parkinson's disease. The C-terminus of this protein contains a highly conserved RING motif from the RING protein family of zinc finger proteins. This protein has similar biological functions to other members of the zinc finger protein family. This invention involves regulating the differentiation, growth, and development of various related tissue cells in vivo. Mutations or abnormal expression of this peptide can lead to abnormal development and growth of related tissues, thereby triggering various related diseases. The expression profile of the polypeptide of this invention is consistent with that of the human Parkinson's disease-related protein (Parkinsonin), and both have similar biological functions. The polypeptide of this invention participates in regulating the differentiation, growth, and development of various related tissue cells in vivo. Mutations or abnormal expression of this peptide can lead to abnormal development and growth of related tissues, thereby triggering various related diseases, including but not limited to:

[0082] Clinical symptoms related to cerebral cortex dysfunction:

[0083] I. Frontal lobe: Dementia, personality changes (anterior frontal lobe), strabismus, inability to write (posterior middle frontal gyrus), motor aphasia (posterior inferior frontal gyrus), loss of smell (basal frontal lobe), limb paralysis, convulsions (precentral gyrus), etc.

[0084] II. Parietal lobe: Sensory disturbances (postcentral gyrus), alexia (left angular gyrus), body image disturbances (right parietal lobe), etc.;

[0085] III. Temporal lobe: Uncus seizures (anterior temporal lobe), sensory / amnesic aphasia (left temporal lobe), hearing impairment (posterior superior temporal gyrus), etc.;

[0086] IV. Occipital lobe: Hemianopsia, visual hallucinations, visual agnosia, etc.;

[0087] V. Limbic System: Emotional symptoms, memory loss, altered consciousness, hallucinations, etc.;

[0088] Extrapyramidal dysfunction:

[0089] I. Hyperkinetic-Tonic Syndrome: Chorea, Athetosis, Torsion Spasticity, etc.; II. Hypokinetic-Tonic Rigid Syndrome: Parkinson's Disease, etc.;

[0090] Cerebellar dysfunction disorders:

[0091] Balance disorders, positional nystagmus, cerebellar ataxia, fine motor disorder, etc. In addition, there are various congenital heart diseases (atrial septal defects, ventricular septal defects), male sexual development disorders, etc.; the polypeptide of the present invention, as well as its antagonists, agonists and inhibitors, can be directly used to treat a variety of diseases, such as cerebral cortex dysfunction, extrapyramidal dysfunction, cerebellar dysfunction, and various congenital heart diseases, male sexual development disorders, etc.

[0092] This invention also provides a method for screening compounds to identify agents that enhance (agonist) or inhibit (antagonist) human Parkinson's disease-associated protein 11. Agonists enhance the biological functions of human Parkinson's disease-associated protein 11, such as stimulating cell proliferation, while antagonists inhibit and treat disorders associated with excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane formulations expressing human Parkinson's disease-associated protein 11 can be co-cultured with labeled human Parkinson's disease-associated protein 11 in the presence of the drug. The ability of the drug to enhance or inhibit this interaction is then determined.

[0093] Antagonists of human Parkinson's disease-associated protein 11 (HLP11) include screened antibodies, compounds, receptor-deficient derivatives, and analogues. These antagonists can bind to HLP11 and eliminate its function, inhibit the production of the peptide, or bind to the active site of the peptide, preventing it from performing its biological function.

[0094] When screening compounds for antagonism, human Parkinson's disease-associated protein 11 (HLP11) can be added to a bioanalytical assay. The antagonist status is determined by measuring the compound's effect on the interaction between HLP11 and its receptor. The same method used to screen compounds can be used to screen for receptor deletions and analogs that act as antagonists. Peptides that can bind to HLP11 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. During screening, HLP11 molecules are generally labeled.

[0095] This invention provides a method for producing antibodies using polypeptides, fragments thereof, derivatives, analogs, or their cellular components as antigens. These antibodies may be polyclonal or monoclonal antibodies. This invention also provides antibodies against the human Parkinson's syndrome-associated protein 11 antigenic determinant. These antibodies include, but are not limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

[0096] Polyclonal antibodies can be produced by directly immunizing animals (such as rabbits, mice, and rats) with human Parkinson's disease-associated protein 11. Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies against human Parkinson's disease-associated protein 11 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), three-hybridoma technology, human β-cell hybridoma technology, and EBV-hybridoma technology. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al.). al, PNAS, 1985, 81: 6851). Existing technology for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human Parkinson's disease-associated protein 11.

[0097] Antibodies against human Parkinson's disease-associated protein 11 can be used in immunohistochemistry to detect human Parkinson's disease-associated protein 11 in biopsy specimens.

[0098] Monoclonal antibodies that bind to human Parkinson's disease-associated protein 11 can also be labeled with radioactive isotopes and injected into the body to track their location and distribution. These radiolabeled antibodies can serve as a non-invasive diagnostic method for locating tumor cells and determining whether metastasis has occurred.

[0099] Antibodies can also be used to design immunotoxins targeting specific sites in the body. For example, high-affinity monoclonal antibodies against human Parkinson's disease-associated protein 11 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, and erythrine). A common method is to use a thiol cross-linking agent, such as SPDP, to attack the amino group of the antibody, binding the toxin to the antibody through disulfide bond exchange. Such hybrid antibodies can be used to kill human Parkinson's disease-associated protein 11-positive cells.

[0100] The antibody of this invention can be used to treat or prevent diseases associated with human Parkinson's disease-associated protein 11. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human Parkinson's disease-associated protein 11.

[0101] This invention also relates to diagnostic assays for the quantitative and localized detection of levels of human Parkinson's disease-associated protein 11. These assays are well known in the art and include FISH assays and radioimmunoassays. The levels of human Parkinson's disease-associated protein 11 detected in these assays can be used to interpret the importance of human Parkinson's disease-associated protein 11 in various diseases and to diagnose diseases in which human Parkinson's disease-associated protein 11 plays a role.

[0102] The peptides of the present invention can also be used for peptide profiling analysis. For example, the peptides can be specifically cleaved by physical, chemical or enzymatic methods and analyzed by one-dimensional, two-dimensional or three-dimensional gel electrophoresis, or more preferably by mass spectrometry.

[0103] Polynucleotides encoding human Parkinson's disease-associated protein 11 (HLP11) can also be used for various therapeutic purposes. Gene therapy can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of HLP11. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant HLP11 to inhibit the activity of endogenous HLP11. For example, a variant of HLP11 could be a shortened version, lacking the signal transduction domain; it can bind to downstream substrates but lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of HLP11. Viral expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex viruses, and parvoviruses can be used. The polynucleotide encoding human Parkinson's disease-associated protein 11 was transferred into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human Parkinson's disease-associated protein 11 can be found in existing literature (Sambrook, et al.). Alternatively, the recombinant polynucleotide encoding human Parkinson's disease-associated protein 11 can be packaged into liposomes and transferred into cells.

[0104] Methods for introducing polynucleotides into tissues or cells include: directly injecting polynucleotides into tissues in vivo; or introducing polynucleotides into cells in vitro using vectors (such as viruses, bacteriophages, or plasmids) and then transplanting the cells into the body.

[0105] Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human Parkinson's disease-associated protein 11 mRNA are also within the scope of this invention. A ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. Its mechanism of action involves the ribozyme molecule specifically hybridizing with a complementary target RM and then performing endonuclease. Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as the widely used solid-phase phosphoramide chemical synthesis method for oligonucleotides. Antisense RM molecules can be obtained by transcription of the DNA sequence encoding the RM in vitro or in vivo. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. To increase the stability of the nucleic acid molecule, it can be modified in various ways, such as increasing the length of the flanking sequences, and using phosphothioester bonds or peptide bonds instead of phosphodiester bonds for the ribonucleosides.

[0106] The polynucleotide encoding human Parkinson's disease-associated protein 11 (HLP11) can be used for the diagnosis of diseases related to HLP11. The polynucleotide encoding HLP11 can be used to detect the expression of HLP11 or its abnormal expression in disease states. For example, the DM sequence encoding HLP11 can be used to hybridize biopsy specimens to determine the expression status of HLP11. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of this invention can be immobilized as probes on microarrays or DM chips (also known as "gene chips") for differential gene expression analysis and gene diagnosis in tissues. The transcript of human Parkinson's disease-associated protein 11 can also be detected by in vitro amplification of RNA-polymerase chain reaction (RT-PCR) using primers specific to human Parkinson's disease-associated protein 11.

[0107] Detection of mutations in the human Parkinson's disease-associated protein 11 (HLP11) gene can also be used to diagnose diseases related to HLP11. HLP11 mutations can take the form of point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type HLP11 DNA sequence. Existing techniques such as Southern blotting, DNA sequencing, PCR, and in situ hybridization can be used to detect mutations. Furthermore, mutations may affect protein expression; therefore, Northern blotting is used to detect them. Imprinting and Western blotting can indirectly determine whether a gene has mutated.

[0108] The sequences of this invention are also valuable for chromosome identification. These sequences specifically target a particular location on a human chromosome and can hybridize with it. Currently, there is a need to identify the specific sites of genes on chromosomes. At present, only a few chromosome markers based on actual sequence data (repetitive polymorphisms) are available for labeling chromosome locations. According to this invention, a crucial first step in associating these sequences with disease-related genes is to locate these DNA sequences on chromosomes.

[0109] In short, PCR primers (preferably 15-35 bp) are prepared based on cDM, allowing the sequence to be located on the chromosome. These primers are then used for PCR screening of somatic cell hybrids containing each human chromosome. Only those hybrid cells containing the corresponding human genes from the primers will produce amplified fragments.

[0110] PCR localization of somatic hybrid cells is a rapid method for locating DNA to specific chromosomes. Using the oligonucleotide primers of this invention, sub-localization can be achieved using a set of fragments from a specific chromosome or a large number of genomic clones through a similar method. Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening using labeled flow cytometry, and hybridization pre-selection, thereby constructing chromosome-specific cDNA libraries.

[0111] Fluorescence in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows for precise chromosome localization in a single step. A review of this technique can be found in Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

[0112] Once a sequence is pinpointed to its precise chromosomal location, that physical location on the chromosome can be correlated with gene mapping data. This data is available from V. McKusick, *Mendelian Inheritance in Man* (accessible via link to the Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between the gene and diseases located on the chromosomal region.

[0113] Next, it is necessary to determine the differences in cDNA or genomic sequences between diseased and healthy individuals. If a mutation is observed in some or all diseased individuals, but not in any healthy individuals, then that mutation may be the cause of the disease. Comparing diseased and healthy individuals typically involves first looking for structural changes in the chromosomes, such as deletions or translocations visible at the chromosomal level or detectable by cDNA sequence-based PCR. Depending on the resolution of current physical mapping and gene localization techniques, cDNA precisely located to the chromosomal region associated with the disease can be one of 50 to 500 potential pathogenic genes (assuming a mapping resolution of 1 megabase and one gene per 20 kb).

[0114] The peptides, polynucleotides and their analogues, agonists, antagonists and inhibitors of the present invention can be used in combination with suitable drug carriers. These carriers can be water, glucose, ethanol, salts, buffer solutions, glycerol, and combinations thereof. The composition contains a safe and effective amount of the peptide or antagonist and does not affect… Carriers and excipients for drug efficacy. These compositions can be used as drugs for the treatment of diseases.

[0115] The present invention also provides a kit or reagent kit containing one or more containers, wherein the containers contain one or more pharmaceutical composition ingredients of the present invention. Along with these containers, there may be indicative instructions from the government regulatory authority that manufactures, uses, or sells the pharmaceutical or biological product, reflecting the authority's permission for its administration to humans. Furthermore, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

[0116] The pharmaceutical composition can be administered in a convenient manner, such as via local, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes. Human Parkinson's Syndrome-Related Protein 11 is administered in an amount effective for the treatment and / or prevention of a specific indication. The amount and dosage range of Human Parkinson's Syndrome-Related Protein 11 administered to a patient will depend on many factors, such as the route of administration, the patient's health condition, and the diagnostic physician's judgment. Examples

[0117] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0118] Example 1: Cloning of human Parkinson's disease-associated protein 11

[0119] Total RNA (RM) was extracted from human fetal brain using a one-step method of guanidine isothiocyanate / phenol / chloroform. Poly(A) mRNA was isolated from the total RNA using Quik mRNA Isolation Kit (Qiegene). 2 μg of poly(A) mRNA was reverse transcribed to form cDNA. The cDNA fragment was directionally inserted into the multiple cloning site of a pBSK(+) vector (Clontech) using a Smart cDNA cloning kit (Clontech), and the cells were transformed into DH5α bacteria to form a cDNA library. The 5' and 3' ends of all clones were sequenced using a Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and an ABI 377 automated sequencer (Perkin-Elmer). The determined cDNA sequences were compared with existing public DNA sequence databases (Genebank), and one clone, 06, was found to be positive. 4 The cDNA sequence of 5A11 is novel. A series of primers were synthesized to perform bidirectional sequencing of the inserted cDNA fragment contained in this clone. The results showed that the full-length cDNA fragment contained in the G645A11 clone is 1252 bp (as shown in Seq ID NO: l), from the 5A11 sequence... 2 From 16bp to 518bp, there is a 302bp open reading frame (ORF) encoding a novel protein (as shown in Seq ID NO: 2). We named this clone pBS-0645A11, and the encoded protein is named human Parkinson's syndrome-associated protein 11. Example 2: Cloning the gene encoding human Parkinson's disease-associated protein 11 using RT-PCR. Using total RNA from fetal brain cells as a template, cDNA was synthesized via reverse transcription using oligo-dT primers. After purification using a Qiagen kit, PCR amplification was performed using the following primers:

[0120] Primer 1: 5,—CACCAACTAAAACTGTGGGTTTCA—3, (SEQ ID NO: 3)

[0121] Primer2: 5'- TAAAGAAAGTCAGATGTATTAGAA -3' (SEQ ID NO: 4)

[0122] Primer is the forward sequence starting at the 5th lbp end of SEQ ID NO: 1;

[0123] Primer2 is the reversed 3-end sequence of SEQ ID NO: 1.

[0124] Amplification reaction conditions: A 50 μL reaction volume contained 50 mmol / L KCl, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl2, 20 μmol / L dNTP, 10 pmol primer, and 1 U of Taq DNA polymerase (Clontech). The reaction was performed for 25 cycles on a PE9600 DNA thermal cycler (PerkinElmer) under the following conditions: 94°C for 30 sec; 55°C for 30 sec; 72°C for 2 min. β-actin was used as a positive control and template blank as a negative control during RT-PCR. The amplified products were purified using a QIAGEN kit and ligated into a PCR vector (Invitrogen) using a TA cloning kit. DM sequence analysis showed that the DNA sequence of the PCR product was identical to 1-1252 bp as shown in SEQ ID NO: 1. Example 3 Northern Analysis of the expression of human Parkinson's disease-associated protein 11 gene using Western blot method: Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159]. This method includes acidic guanidine thiocyanate-phenol-chloroform extraction. Specifically, tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate and 0.2M sodium acetate (pH 4.0), then 1 volume of phenol and 1 / 5 volume of chloroform-isoamyl alcohol (49:1) are added, mixed, and centrifuged. The aqueous phase is aspirated, isopropanol (0.8 volume) is added, and the mixture is centrifuged to obtain RNA precipitate. The precipitate is washed with 70% ethanol, dried, and dissolved in water. The precipitate is then extracted with 20 μL of ethanol. δ RNA was electrophoresed on a 1.2°C agarose gel containing 20 mM 3-(N-morpholino)propanesulfonic acid (H7.0), 5 mM sodium acetate, 1 mM EDTA, and 2.2 M formaldehyde. The RNA was then transferred to a nitrocellulose membrane. Using α- 32 P dATP was prepared using a random primer method. 32P-labeled DNA probes. The DM probes used were the PCR-amplified coding region sequence (216 bp to 518 bp) of human Parkinson's syndrome-associated protein 11, as shown in Figure 1. 32P-labeled probes (approximately 2 x 10⁻⁶) were then used. 6 cptn / ml) was hybridized overnight at 42°C with nitrocellulose membranes transferred with RM in a solution containing 50% formamide - 25mM KH2PO4 (pH 7.4) - 5 330-5 < 061111&1(^, 3 solution and 20(^ § / 1111 salmon sperm 0. After hybridization, the filter membrane was washed in 1x SSC-0.1% SDS at 55°C for 30 min. Then, it was analyzed and quantified using a Phosphor Imager. Example 4 In vitro expression, isolation and purification of recombinant human Parkinson's syndrome-related protein 11 Based on the coding region sequence shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, with the following sequences: Primer 3: 5'-CATGGATCCATGGGATCTGTTAGCATCAGTTCC-3' (Seq ID No: 5) Primer 4: 5'-CCCCTCGAGTTAAAGCACCAAATGTGCGCCTGC-3' (Seq ID No: 6) These two primers contain Xhol and Xhol restriction sites at their 5' ends, respectively, followed by the coding sequences for the 5' and 3' ends of the target gene. The Xhol and Xhol restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b(+) (Novagen product, Cat. No. 69865. 3). PCR was performed using the pBS-0645A11 plasmid containing the full-length target gene as a template. PCR reaction conditions were as follows: 50 μL total volume containing 10 pg of pBS-0645All plasmid, primers Primer-3 and Primer-4 (1 oz each), and Advantage polymerase Mix.

[0125] (Clontech product) 1 μL. Cycling parameters: 94°C 20s, 60°C 30s, 68°C 2 min, for a total of 25 cycles. The amplified product and plasmid pET-28(+) were double-digested with Xhol and Xhol, respectively. Large fragments were recovered and ligated using T4 ligase. The ligation product was transformed into E. coli DH5α using the calcium chloride method in a kanamycin-containing medium.

[0126] After overnight incubation on LB agar plates at a final concentration of 3 g / ml, positive clones were screened using colony PCR and sequenced. The selected positive clone (pET-0645A11) was transformed into *E. coli* BL21(DE3) plySs (Novagen product) using the calcium chloride method. The host bacterium BL21 (pET-0645A11) was cultured in LB liquid medium containing kanamycin (final concentration 30 μmol) at 37°C to the logarithmic growth phase. IPTG was added to a final concentration of 1 μmol / L, and the culture was continued for 5 hours. The bacterial cells were collected by centrifugation, and the supernatant was collected by centrifugation and analyzed using an affinity chromatography column (His. Bind Quick Cartridge) that binds to six histidine residues (6His-Tag).

[0127] Chromatography using (Novagen product) yielded purified target protein, human Parkinson's disease-associated protein 11. SDS-PAGE electrophoresis showed a single band at 11kDa (Figure 2). This band was transferred to a PVDF membrane and analyzed for its N-terminal amino acid sequence using the Edams hydrolysis method. The results showed that the N-terminal 15 amino acids were identical to those shown in SEQ ID NO: 2. Example 5: Generation of Anti-Human Parkinson's Disease-Associated Protein 11 Antibody

[0128] The following human Parkinson's disease-related protein 11-specific peptides were synthesized using a peptide synthesizer (PE company product):

[0129] NH2-Met-Gly-Ser-Val-Ser-I le-Ser-Ser-Thr-Leu-Leu-Leu-Glu-Ala-Met-C00H (SEQ ID NO: 7). This polypeptide was coupled with hemocyanin and bovine serum albumin to form complexes, as described in: Avrameas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above hemocyanin polypeptide complex plus complete Freund's adjuvant, and then boosted with hemocyanin polypeptide complex plus incomplete Freund's adjuvant 15 days later. The antibody was administered via 15 μL... § The titer of antibodies in rabbit serum was determined by ELISA using a titration plate coated with bovine serum albumin-peptide complex. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was then bound to cyanogen-activated Sepharose. ar0S Antipeptide antibodies were isolated from total IgG using affinity chromatography on an e4B column. Immunoprecipitation demonstrated that the purified antibodies specifically targeted human Parkinson's syndrome. Binding to protein 11. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe.

[0130] Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes has many applications. For example, the probe can be used to hybridize with genomic or cDNA libraries of normal or pathological tissues from different sources to identify whether they contain the polynucleotide sequence of the present invention and to detect homologous polynucleotide sequences. Furthermore, the probe can be used to detect whether the expression of the polynucleotide sequence of the present invention or its homologous polynucleotide sequences is abnormal in normal or pathological tissue cells.

[0131] The purpose of this embodiment is to select suitable oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes, and to identify whether some tissues contain the polynucleotide sequence of the present invention or its homologous polynucleotide sequence using a membrane hybridization method. Membrane hybridization methods include dot blot, Southern blotting, Northern blotting, and photocopying methods, all of which involve immobilizing the polynucleotide sample to be tested on a membrane and then hybridizing using essentially the same steps. These identical steps are: the membrane with the sample immobilized is first pre-hybridized with a hybridization buffer without probes to saturate the non-specific binding sites of the sample on the membrane with the carrier and the synthesized polymer. Then the pre-hybridization solution is replaced with a hybridization buffer containing labeled probes, and the membrane is incubated to allow the probes to hybridize with the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of washing steps. This embodiment utilizes high-intensity washing conditions (such as low salt concentration and high temperature) to reduce the hybridization background and retain only highly specific signals. The probes used in this embodiment include two types: the first type of probe is an oligonucleotide fragment that is completely identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention; the second type of probe is an oligonucleotide fragment that is partially identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention. In this embodiment, dot blot is used to immobilize the sample on a filter membrane. Under high-intensity washing conditions, the first type of probe exhibits the strongest hybridization specificity with the sample and is thus retained. When selecting oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of this invention for use as hybridization probes, the following principles and several aspects should be followed:

[0132] 1. The preferred probe size range is 18-50 nucleotides;

[0133] 2. GC content should be 30% - 70%; exceeding this will increase non-specific hybridization.

[0134] 3. There should be no complementary regions inside the probe;

[0135] 4. Probes that meet the above conditions can be used as preliminary selection probes. Then, computer sequence analysis is performed, including comparing the homology of the preliminary selection probe with its source sequence region (i.e., SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive identical bases, then the preliminary selection probe should generally not be used. 5. Whether the initial probe is ultimately selected as a probe with practical application value should be further determined by experiments.

[0136] After completing the above analysis, the following two probes were selected and synthesized:

[0137] Probe 1, belonging to class 1 probes, is completely homologous to or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

[0138] 5'-TGGGATCTGTTAGCATCAGTTCCACGCTGCTCCTGGAGGCC-3' (SEQ ID NO: 8) Probe 2 (probe2), belonging to the second class of probes, is a substitution mutation sequence (41Nt) equivalent to the gene fragment of SEQ ID NO: 1 or its complementary fragment:

[0139] 5'-TGGGATCTGTTAGCATCAGTCCCACGCTGCTCCTGGAGGCC-3' (SEQ ID NO: 9) For other commonly used reagents not listed and their preparation methods related to the following specific experimental steps, please refer to: DNA PROBES GH Keller; M. M. Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as *Molecular Cloning: A Laboratory Manual* (2nd edition, 1998) by Sambrook et al., Science Press.

[0140] Sample preparation:

[0141] 1. Extracting DNA from fresh or frozen tissues

[0142] Steps: 1) Place fresh or freshly thawed normal liver tissue into a petri dish containing phosphate-buffered saline (PBS) and place it on ice. Cut the tissue into small pieces using scissors or a scalpel. Keep the tissue moist during the process. 2) Centrifuge at 1000g for 10 minutes to mince the tissue. 3) Resuspend the pellet (approximately 10 ml / g) in cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl2). 4) Homogenize the tissue suspension at full speed using an electric homogenizer at 4°C until the tissue is completely broken down. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1g of the initial tissue sample) and centrifuge again at 1000g for 10 minutes. 7) Resuspend the precipitate with lysis buffer (1 ml for every 0.1g of the initial tissue sample), and then proceed with the following phenol extraction method.

[0143] 2. Phenol extraction method for DNA

[0144] Steps: 1) Wash cells with 1-10 ml of cold PBS, centrifuge at 1000 g for 10 minutes. 2) Resuspend the precipitated cells (1 x 10^6) cells in cold cell lysis buffer. 8 (Cells / ml) Use at least 100ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break down, reducing the overall yield. This is especially important when extracting >10... 7 The situation is particularly severe in cells. 4) Add proteinase K to a final concentration of 200 μg / ml. 5) Incubate at 50°C for 1 hour or gently shake overnight at 37°C. 6) Extract with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes in a small centrifuge tube. The two phases should be clearly separated; otherwise, repeat the centrifugation. 7) Transfer the aqueous phase to a new tube. 8) Extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. The DNA was then purified and precipitated with ethanol.

[0145] 3. DNA purification and ethanol precipitation

[0146] Steps: 1) Add 1 / 10 volume of 2 mol / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix well. Incubate at -20°C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour off the ethanol. 4) Wash the precipitate with 500 μL of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour off the ethanol. Wash the precipitate with 500 μL of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour off the ethanol, then invert the container on absorbent paper to allow any remaining ethanol to drain. Air dry for 10-15 minutes to allow surface ethanol to evaporate. Do not allow the precipitate to dry completely, otherwise it will be difficult to redissolve. 7) Resuspend the DNA precipitate in a small volume of TE or water. Vortex at low speed or use a dropper while gradually increasing the TE, mixing until the DM is fully dissolved, adding 1-5 x 10⁻⁶ drops per 100 mL. fi The amount extracted from the cells is approximately 1 ul.

[0147] Steps 8-13 below are only used when it is necessary to remove contaminants; otherwise, proceed directly to step 14.

[0148] 8) Add RNase A to the DNA solution to a final concentration of 100 μg / ml and incubate at 37°C for 30 minutes. 9) Add SDS and proteinase K to final concentrations of 0.5% and 100 μg / ml, respectively. Incubate at 37°C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1 / 10 volume of 2 fflol / L sodium acetate and 2.5 volumes of cold ethanol, mix well, and incubate at -20°C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air-dry, and resuspend the nucleic acid, following steps 3-6. 14) Determine A 26 And A 28 To test the purity and yield of DM. 15) Store at -20°C after dispensing.

[0149] Preparation of the sample membrane:

[0150] 1) Take 4x2 appropriately sized nitrocellulose membranes (NC membranes) and lightly mark the spotting locations and sample numbers on them with a pencil. Two NC membranes are needed for each probe so that the membranes can be washed under high-intensity and low-intensity conditions respectively in the subsequent experimental steps.

[0151] 2) Take 15 μL of each sample and control sample, spot them onto the sample film, and let them air dry at room temperature.

[0152] 3) Place on filter paper soaked in 0.1 mol / L NaOH and 1.5 mol / L NaCl for 5 minutes (twice), then air dry.

[0153] 4) Place it between clean filter paper, wrap it with aluminum foil, and vacuum dry at 60-80°C for 2 hours.

[0154] Probe marking

[0155] 1) 3μ1 Probe (0. IOD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- 32 P-dATP + 2U Kinase, to a final volume of 20 μL.

[0156] 2) Keep warm at 37 °C for 2 hours.

[0157] 3) Add 1 / 5 volume of bromophenol blue indicator (BPB). 4) Pass through Sephadex G-50 column.

[0158] 5) To have 32 The first peak is collected before the P-Probe wash (monitoring can be done with a Moni tor).

[0159] 6) 5 drops / tube, collect 10-15 tubes.

[0160] 7) Monitor isotope levels using a liquid scintillation meter.

[0161] 8) The collected liquid from the first peak is the desired product. 32 P-Probe (the second peak is free γ-) 32 P - dATP D

[0162] prehybridization

[0163] Place the sample membrane in a plastic bag and add 3-10 mg of prehybridization solution (1 0x Denhardt's; 6x SSC, 0.1 mg / L CT DNA (calf thymus DNA)). Seal the bag and incubate at 68°C for 2 hours.

[0164] Hybridization. Cut off a corner of the plastic bag, add the prepared probe, seal the bag, and incubate overnight in a 42°C water bath with shaking. Membrane washing:

[0165] High-intensity film washing:

[0166] 1) Take out the hybridized sample membrane.

[0167] 2) Wash in 2xSSC and 0.1%SDS at 40°C for 15 minutes (twice).

[0168] 3) Wash in 0.1xSSC and 0.1xSDS at 40°C for 15 minutes (twice).

[0169] 4) In 0.1x SSC, 0.1°C SDS, wash for 30 minutes (twice), then air dry at room temperature. Low-intensity washing:

[0170] 1) Take out the hybridized sample membrane.

[0171] 2) Wash at 37°C for 15 minutes (twice) in 2xSSC and 0.1%SDS.

[0172] 3) Wash at 37°C for 15 minutes (twice) in 0.1% SSC and 0.1% SDS.

[0173] 4) Wash in 0.1% SSC and 0.1% SDS at 40°C for 15 minutes (twice), then air dry at room temperature.

[0174] X-ray autoradiography:

[0175] -70°C, X-ray autoradiography (the compression time depends on the intensity of the radioactivity of the hybridization spot).

[0176] Experimental results:

[0177] Hybridization experiments conducted under low-intensity washing conditions showed no significant difference in radioactivity between the two probe hybridization spots. However, hybridization experiments conducted under high-intensity washing conditions showed that the radioactivity intensity of the hybridization spot of probe 1 was significantly stronger than that of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of this invention in different tissues. Example 7 DNA Microarray

[0178] Gene chips, or DNA microarrays, are new technologies that many national laboratories and large pharmaceutical companies are currently researching and developing. They involve arranging a large number of target gene fragments in an orderly, high-density manner on a carrier such as glass or silicon, and then using fluorescence detection and computer software to compare and analyze the data, achieving rapid, efficient, and high-throughput analysis of biological information. The polynucleotides of this invention can be used as target DNA microarrays for high-throughput research on novel gene functions; for finding and screening tissue-specific novel genes, especially those related to diseases such as tumors; and for the diagnosis of diseases, such as hereditary diseases. The specific methods and steps have been reported in various literatures, such as DeRisi, JL, Lyer, V. & Brown, P. O. (1997) Science 278, 680-686. and Hele, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

[0179] (a) Spotting

[0180] A total of 4000 polynucleotide sequences of various full-length cDM were used as target DNA, including the polynucleotides of this invention. These sequences were amplified separately by PCR. After purification, the amplified products were adjusted to a concentration of approximately 500 ng / µl and spotted onto a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA), with a spot distance of 280 µm. The spotted glass slides were then hydrated, dried, and cross-linked in a UV cross-linker. After elution and drying, the DM was immobilized on the glass slide to prepare a chip. Specific methods and steps have been reported in various literatures. The post-spotting processing steps in this embodiment are as follows:

[0181] 1. Hydrate for 4 hours in a humid environment;

[0182] 2. Wash with 0.2% SDS for 1 minute;

[0183] 3. Wash twice with ddH2O, 1 minute each time;

[0184] 4. NaBH4 seal for 5 minutes;

[0185] 5. In 95°C water for 2 minutes;

[0186] 6. Wash with 0.2°C SDS for 1 minute;

[0187] 7. Rinse twice with ddH2O;

[0188] 8. Let it air dry and store in a dark place at 25°C for later use.

[0189] (II) Probe Marking

[0190] Total mRNA was extracted from mixed human tissues and specific tissues (or stimulated cell lines) using a one-step method. The mRNA was purified using Oligotex mRNA MidiKit (QiaGen). The mRNA from the mixed human tissues was then labeled with Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, Amersham Phamacia Biotech) via reverse transcription. The mRNA from the mixed human tissues was further labeled with Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, Amersham Phamacia Biotech). The company labels specific tissues (or stimulated cell lines) with mRNA, which is then purified to prepare probes. For detailed steps and methods, please refer to:

[0191] Schena, E, Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USi Vol. 93: 10614-10619.

[0192] Schena, M., Shalon, Dari., Davids, R. W. (1995) Science. 270 (20): 467-480.

[0193] (III) Hybridization

[0194] The probes from the two tissues were hybridized with the chip in UniHyb™ Hybridization Solution (purchased from TeleChem) for 16 hours. After washing with washing solution (1x SSC, 0.2% SDS) at room temperature, the chips were scanned using a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed using Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio for each point.

[0195] The specific tissues (or stimulated cell lines) mentioned above are bladder mucosa, PMA+ Ecv304 cell line, LPS+ Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblasts stimulated with growth factors 1024NT, scar fc cells stimulated with growth factors 1013HT, scar fc cells not stimulated with growth factors 1013HC, bladder cancer cell line EJ, adjacent to bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunal adenocarcinoma, and gastric cardia cancer. A fold plot was drawn based on these 17 Cy3 / Cy5 ratios (Figure 1). As can be seen from the figure, the expression profiles of human Parkinson's syndrome-related protein 11 and other human Parkinson's syndrome-related proteins described in this invention are very similar.

Claims

Scholi demanded 1. An isolated polypeptide—human Parkinson's disease-associated protein 11, characterized in that... It contains: a polypeptide of the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide, analogue or derivative thereof.

2. The polypeptide as described in claim 1, characterized in that... The amino acid sequence of the polypeptide, analogue or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO:

2.

3. The polypeptide as described in claim 2, characterized in that... It contains a polypeptide having the amino acid sequence shown in SEQ ID NO:

2.

4. An isolated polynucleotide, characterized in that... The polynucleotide comprises one selected from the group consisting of '-' (a) A polypeptide or a fragment thereof, analogue, or derivative thereof encoding the amino acid sequence shown in SEQ ID NO: 2; (b) Polynucleotides complementary to polynucleotides; or (c) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide as described in claim 4, characterized in that... The polynucleotide comprises a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:

2.

6. The polynucleotide as described in claim 4, characterized in that... The polynucleotide sequence comprises the sequence of positions 216-518 in SEQ ID NO: 1 or the sequence of positions 1-1252 in SEQ ID NO:

1.

7. A recombinant vector containing exogenous polynucleotides, characterized in that... It is a recombinant vector constructed from the polynucleotide claimed in any of claims 4-6 and a plasmid, virus, or vector expression vector.

8. A genetically engineered host cell containing exogenous polynucleotides, characterized in that... It is selected from one of the following host cells: (a) Host cells transformed or transduced using the recombinant vector of claim 7; or (b) The host cell for which the polynucleotide is transformed or transduced is claimed by any of the claims in claims 4-6.

9. A method for preparing a polypeptide with activity related to human Parkinson's syndrome protein 11, characterized in that... The method includes: (a) Culture the engineered host cells described in claim 8 under conditions expressing human Parkinson's syndrome-related protein 11; (b) Isolate a polypeptide with human Parkinson's disease-associated protein 11 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that... The antibody is an antibody that specifically binds to human Parkinson's disease-associated protein 11.

11. A class of compounds that mimic or regulate the activity or expression of peptides, characterized in that... These are compounds that mimic, promote, antagonize, or inhibit the activity of human Parkinson's disease-associated protein 11.

12. The compound of claim 11, characterized in that... It is the antisense sequence of the polynucleotide sequence or a fragment thereof shown in SEQ ID NO:

1.

13. An application of the compound of claim 11, characterized in that... The compound is used for methods of regulating the in vivo and in vitro activity of human Parkinson's syndrome-associated protein 11.

14. A method for detecting a disease or susceptibility to a disease associated with the polypeptide described in any one of claims 1-3, characterized in that... This includes detecting the expression level of the polypeptide, or detecting the activity of the polypeptide, or detecting nucleotide variations in the polynucleotide that cause abnormal expression or activity of the polypeptide.

15. The use of the polypeptide claimed in any one of claims 1-3, characterized in that... It is used to screen mimics, agonists, antagonists, or inhibitors of human Parkinson's disease-associated protein 11; or for peptide fingerprint identification.

16. The use of the nucleic acid molecule as described in any of claims 4-6, characterized in that... It can be used as a primer for nucleic acid amplification reactions, or as a probe for hybridization reactions, or for manufacturing gene chips or microarrays.

17. The use of the polypeptide, polynucleotide, or compound according to any one of claims 1-6 and 11, characterized in that... The polypeptide, polynucleotide or its analogue, agonist, antagonist or inhibitor, in a safe and effective dose with a pharmaceutically acceptable carrier, constitutes a pharmaceutical composition for the diagnosis or treatment of diseases associated with abnormalities of human Parkinson's syndrome-associated protein 11.

18. The use of the polypeptide, polynucleotide, or compound described in any of claims 1-6 and 11, characterized in that... Drugs for treating conditions such as malignant tumors, hematological diseases, HIV infection, immune disorders, and various types of inflammation can be prepared using the aforementioned polypeptides, polynucleotides, or compounds.