A novel polypeptide-homo transcription factorlcr-f19.02 and polynucleotide encoding said polypeptide

Abstract

The invention discloses a new kind of polypeptide-HOMO transcription factorLCR-F19.02 and polynucleotide encoding said polypeptide and a process for producing said polypeptide by DNA recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as erythropathy. Antagonist and the therapeutic use of the polypeptide is also disclosed. In addition, it refers to the use of polynucleotide encoding said HOMO transcription factorLCR-F19.02.

Description

[0001] A novel polypeptide, human transgenic LCR-F19.02, and polynucleotides encoding this polypeptide.

[0002] This invention belongs to the field of biotechnology. Specifically, this invention describes a novel polypeptide-Δ transcription factor LCR-F19.02, and the polynucleotide sequence encoding this polypeptide. This invention also relates to methods for preparing this polynucleotide and polypeptide, and their applications. Background Technology

[0003] Hemoglobin is the main component of red blood cells in vertebrates, responsible for transporting oxygen and carbon dioxide within the body. Each hemoglobin molecule consists of two identical subunits containing four heme molecules; hemoglobin without heme is called globin. All globin subunit genes have very similar structures, but the subunit composition of hemoglobin varies at different stages of individual development. The transcription and expression of globin subunits in vivo are regulated by related transcription factors. The transcription factor LCR regulates the transcription and expression of globin Y, ε, and P subunits in vivo. It has two important functions: first, it binds to chromosomes containing the globin β subunit gene; second, it enhances the transcription and expression of globin ε, γ, and p subunits. Therefore, this transcription factor plays a crucial regulatory role in the transcriptional expression of globins. Mutations or abnormal expression of LCR will lead to abnormal expression of related globins in vivo, thereby affecting the expression and function of related hemoglobins and potentially causing various related diseases.

[0004] In 1994, John et al. cloned a new transcription factor, LCR-F1, from humans and studied its structure and function. Similar to the known transcription factor LCR, this protein also contains a conserved CNC domain, which may play an important regulatory role in the transcriptional regulation of the protein. In vivo, this protein also binds to the globin β subunit gene and regulates the transcription and expression of globin ε, γ, and β subunits. It plays a crucial regulatory role in the formation of globin in vivo. Mutations or abnormal expression of this protein will lead to abnormal expression of related globins in the body, thereby affecting the activity of related hemoglobins in the body, thus triggering various related diseases [John J. Caterina, David Donze et al., 1994, Nucleic Acids Research, 22(12): 2383-2391]. As can be seen from the above, transcription factor LCR-F1 plays a crucial role in the formation of globins in the body. Mutations or abnormal expression of this protein will lead to abnormal formation of related hemoglobins in the body, thereby affecting the occurrence of various related metabolic pathways. In vivo, it is usually closely related to the occurrence of various related respiratory and metabolic disorders and related material metabolism disorders. It can also be used to diagnose and treat the aforementioned related diseases.

[0005] Gene chip analysis revealed that in the bladder mucosa, PMA+ Ecv304 cell line, and LPS+... In Ecv30 cell line (thymus), normal fibroblasts 1024NC, Fibroblasts 1024NT (stimulated with growth factor), scar fibroblasts 1013HT (not stimulated with growth factor), scar fibroblasts 1013HC, bladder cancer cells (EJ), adjacent cells to bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, and gastric cardia cancer, the expression profile of the polypeptides of this invention is very similar to that of human transcription factor LCR-F1, therefore their functions may also be similar. This invention is named Human Transcription Factor LCR-F19.02.

[0006] As mentioned above, the human transcription factor LCR-F19.02 protein plays a crucial role in regulating vital bodily functions such as cell division and embryonic development. Given that these regulatory processes are believed to involve numerous proteins, there has been a long-standing need in the art to identify more human transcription factor LCR-F19.02 proteins involved in these processes, particularly to identify their amino acid sequences. The isolation of the gene encoding the novel human transcription factor LCR-F19.02 protein provides a foundation for determining the protein's role in healthy and disease states. This protein may form the basis for developing diagnostic and / or therapeutic agents for diseases; therefore, isolating its encoding DNA is of paramount importance. Objective of the Invention

[0007] One object of the present invention is to provide an isolated novel polypeptide human transcription factor LCR-F19.02, as well as its fragments, analogs and derivatives.

[0008] Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

[0009] Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding the human transcription factor LCR-F19.02.

[0010] Another object of the present invention is to provide genetically engineered host cells containing a polynucleotide encoding the human transcription factor LCR-F19.02.

[0011] Another object of the present invention is to provide a method for producing human transcription factor LCR-F19.02.

[0012] Another object of the present invention is to provide an antibody against the polypeptide LCR-F19.02 of the present invention.

[0013] Another object of the present invention is to provide mimicry compounds, antagonists, agonists, and inhibitors for the polypeptide of the present invention—human transcription factor LCR-F19.02.

[0014] Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in the human transcription factor LCR-F19.02. Summary of the Invention

[0015] This invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No., or a conserved variant thereof, a bioactive fragment, or a derivative thereof. Preferably, the… The polypeptide is a polypeptide having the amino acid sequence SEQ ID NO: 2.

[0016] The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

[0017] (a) A polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

[0018] (b) A polynucleotide complementary to polynucleotide (a);

[0019] (c) A polynucleotide that has at least 70½ percent identity with the polynucleotide sequence of (a) or (b).

[0020] More preferably, the sequence of the polynucleotide is selected from one of the following groups: (a) a sequence having positions 994-1242 of SEQ ID NO: 1; and (b) a sequence having positions 1-1409 of SEQ ID NO: 1.

[0021] The present invention also relates to a vector containing the polynucleotides of the present invention, particularly an expression vector; a host cell genetically engineered using the vector, including a transformed, transduced, or transfected host cell; and a method for preparing the polypeptides of the present invention, including culturing the host cell and recovering the expression product.

[0022] The present invention also relates to an antibody that can specifically bind to the polypeptide of the present invention.

[0023] The present invention also relates to a method for screening compounds that mimic, activate, antagonize, or inhibit the activity of the human transcription factor LCR-F19.02 protein, comprising a polypeptide utilizing the present invention. The present invention also relates to compounds obtained using this method.

[0024] The present invention also relates to a method for in vitro detection of diseases or disease susceptibility associated with abnormal expression of human transcription factor LCR-F19.02 protein, comprising detecting mutations in the polypeptide or its encoding polynucleotide sequence in a biological sample, or detecting the amount or biological activity of the polypeptide of the present invention in a biological sample.

[0025] The present invention also relates to a pharmaceutical composition comprising the polypeptide of the present invention or an analogue thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

[0026] The present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of medicaments for treating cancer, developmental disorders or immune disorders or other diseases caused by abnormal expression of human transcription factor LCR-F19.02.

[0027] Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. Brief Description of the Drawings

[0028] The following figures are used to illustrate specific embodiments of the present invention, and are not intended to limit the scope of the invention as defined by the claims.

[0029] Figure 1 shows the human transcription factor LCR-F19.0 of this invention. 2 A comparison of gene chip expression profiles with those of human transcription factor LCR-F1. The top image shows human transcription factor LCR-F19.0. 2 The expression profile of human transcription factor LCR-F1 is shown in the following diagram. The diagram includes expression profiles of fetal brain, bladder mucosa, Ecv304 cells with PMA+ expression, and LPS+ expression. Ecv304 cell line thymus, 5-normal fibroblasts 1024NC; 6-Fibroblasts t, growth factor stimulated, 1024NT; 7-scar fibroblasts growth factor stimulated, 1013HT; 8-scar fibroblasts unstimulated with growth factor, 1013HC; 9-bladder cancer cell line EJ; 10-bladder cancer adjacent to bladder cancer; 11-bladder cancer; 12-liver cancer; 13-liver cancer cell line; 14-fetal skin; 15-spleen; 16-prostate cancer; 17-jejunal adenocarcinoma; 18-gastric cardia cancer.

[0030] Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) image of the isolated human transcription factor LCR-F19.02. 9 kDa represents the molecular weight of the protein. The arrows indicate the isolated protein bands. (Summary of the Invention)

[0031] Unless otherwise specified, the following terms used in this specification and claims have the following meanings: "Nucleic acid sequence" refers to oligonucleotides, nucleotides, or polynucleotides and fragments or portions thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing sense or antisense strands. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof. When "amino acid sequence" in this invention refers to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean limiting the amino acid sequence to the complete natural amino acids associated with said protein molecule.

[0032] A protein or polynucleotide "variant" is an amino acid sequence or polynucleotide sequence encoding it that has one or more amino acid or nucleotide changes. These changes may include the deletion, insertion, or substitution of amino acids or nucleotides in the amino acid or nucleotide sequence. Variants may have "conserved" changes, where the substituted amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine. Variants may also have non-conserved changes, such as replacing glycine with tryptophan.

[0033] "Deficiency" refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

[0034] "Insertion" or "addition" refers to a change in the amino acid or nucleotide sequence that results in the addition of one or more amino acids or nucleotides compared to the naturally occurring molecule. "Replacement" refers to the substitution of one or more amino acids or nucleotides by different amino acids or nucleotides.

[0035] "Bioactivity" refers to proteins that possess the structural, regulatory, or biochemical functions of natural molecules. Similarly, the term "immunologic activity" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce specific immune responses and bind to specific antibodies in suitable animals or cells.

[0036] An "agonist" is a molecule that, when bound to the human transcription factor LCR-F19.02, causes alterations in the protein, thereby regulating its activity. Agonists can include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to the human transcription factor LCR-F19.02.

[0037] "Antagonist" or "inhibitor" refers to a substance that, when bound to the human transcription factor LCR-F19.02, can inhibit [the activity of the transcription factor]. Molecules that block or regulate the biological or immunological activity of human transcription factor LCR-F19.02. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecules that can bind to human transcription factor LCR-F19.02.

[0038] "Regulation" refers to changes in the function of human transcription factor LCR-F19.02, including increases or decreases in protein activity, changes in binding properties, and any other biological, functional, or immune changes in human transcription factor LCR-F19.02.

[0039] "Substantially pure" means substantially free of other naturally occurring or associated proteins, lipids, carbohydrates, or other substances. Those skilled in the art can purify human transcription factor LCR-F19.02 using standard protein purification techniques. Substantially pure human transcription factor LCR-F19.02 produces a single master band on a non-reducing polyacrylamide gel. The purity of the human transcription factor LCR-F19.02 peptide can be determined by amino acid sequence analysis.

[0040] "Complementary" or "complementary" refers to the natural binding of polynucleotides through base pairing under permissible salt concentration and temperature conditions. For example, the sequence "CT-G-A" can bind to the complementary sequence "G-A-C-T". Complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant impact on the efficiency and strength of hybridization between nucleic acid strands.

[0041] "Homology" refers to the degree of complementarity, which can be partial or complete homology. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization between a completely complementary sequence and the target nucleic acid. This inhibition of hybridization can be detected by hybridization under reduced stringency conditions (such as Southern or Northern blotting). Essentially, homologous sequences or hybridization probes can compete for and inhibit the binding of completely homologous sequences to the target sequence under reduced stringency conditions. This does not mean that reduced stringency conditions allow non-specific binding, because reduced stringency conditions require the binding of the two sequences to be a specific or selective interaction.

[0042] "Identity percentage" refers to the percentage of identical or similar sequences in a comparison of two or more amino acid or nucleic acid sequences. The identity percentage can be determined electronically, such as using the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences using different methods, such as the Cluster method (Higgins, DG, and PM Sharp (1988) Gene 73: 237-244). The Cluster method clusters sequences by examining the distance between all pairs. The clusters are then assigned in pairs or groups. The identity percentage between two amino acid sequences, such as sequence A and sequence B, is calculated using the following formula:

[0043] Number of matching residues between sequence 4 and the sequence

[0044] Number of residues in sequence - Number of spacer residues in sequence - Number of spacer residues in sequence S X

[0045] The percentage of identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the field, such as Jotun Hein (Hein J., (1990) Methods in enzyraology 183: 625-645). "Similarity" refers to the degree of identical or conserved substitution of amino acid residues at corresponding positions when comparing the arrangement of amino acid sequences. Amino acids used for conserved substitution include, for example, negatively charged amino acids such as aspartic acid and glutamic acid; positively charged amino acids such as lysine and arginine; amino acids with similar hydrophilicity and uncharged head groups such as leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

[0046] "Antense" refers to a nucleotide sequence that is complementary to a specific DNA or RNA sequence. "Antense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

[0047] "Derivatives" refer to HFPs or chemical modifications that encode their nucleic acids. These chemical modifications can involve replacing hydrogen atoms with alkyl, acyl, or amino groups. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of the natural molecule.

[0048] "Antibody" refers to the complete antibody molecule and its fragments, such as Fa, F ( a b,)2 and F V It can specifically bind to the antigenic determinant of human transcription factor LCR-F19.02.

[0049] "Humanized antibody" refers to an antibody whose non-antigen binding region amino acid sequence has been replaced to make it more similar to human antibody, but still retains its original binding activity.

[0050] The term "separated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living organism is not separated, but the same polynucleotide or polypeptide separated from some or all of the substances that coexist with it in the natural system is considered separated. Such a polynucleotide may be part of a carrier, or it may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still separated.

[0051] As used in this invention, "isolated" means that a substance has been separated from its original environment (or, if the substance is natural, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0052] As used in this article, "isolated human transcription factor LCR-F19.0" 2 "This refers to human transcription factor LCR-F19.02, which is essentially free of other naturally occurring proteins, lipids, carbohydrates, or other substances associated with it. Those skilled in the art can purify human transcription factor LCR-F19.02 using standard protein purification techniques. A substantially pure polypeptide produces a single master band on a non-reducing polyacrylamide gel. The purity of the human transcription factor LCR-F19.02 polypeptide can be determined by amino acid sequence analysis."

[0053] This invention provides a novel polypeptide, a human transcription factor LCR-F19.02, which is essentially composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of this invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of this invention can be a naturally purified product or a chemically synthesized product. The polypeptides of the present invention may be produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technologies. Depending on the host used in the recombinant production protocol, the polypeptides of the present invention may be glycosylated or non-glycosylated. The polypeptides of the present invention may also include or exclude an initial methionine residue.

[0054] This invention also includes fragments, derivatives, and analogs of the human transcription factor LCR-F19.02. As used herein, the terms "fragment," "derivative," and "analyte" refer to polypeptides that substantially retain the same biological function or activity as the human transcription factor LCR-F19.02 of this invention. Fragments, derivatives, or analogs of the polypeptides of this invention may be: (I) in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues (preferably conserved amino acid residues), and the substituted amino acids may or may not be encoded by a genetic codon; or (II) in which a group on one or more amino acid residues is substituted with another group containing a substituent; or (II) in which the mature polypeptide is fused with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) in which an additional amino acid sequence is fused into the mature polypeptide to form a polypeptide sequence (e.g., a leader sequence, a secretory sequence, or a sequence used to purify the polypeptide, or a proteogen sequence). Based on the description herein, such fragments, derivatives, and analogues are considered to be within the knowledge of those skilled in the art.

[0055] This invention provides isolated nucleic acids (polynucleotides) that are essentially composed of polynucleotides encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of this invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of this invention was discovered from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1409 bases, with open reading frames 994-1242 encoding 82 amino acids. Based on gene chip expression profile comparison, this polypeptide has a similar expression profile to human transcription factor LCR-F1, suggesting that this human transcription factor LCR-F19.02 has a similar function to human transcription factor LCR-F1.

[0056] The polynucleotides of this invention can be in DNA or RNA form. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in this invention, "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2, but differing from the coding region sequence shown in SEQ ID NO: 1.

[0057] The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0058] The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polynucleotide encoding the polypeptide and additional... Polynucleotides that encode and / or do not encode sequences.

[0059] This invention also relates to variants of the polynucleotides described above, which encode polypeptides or polypeptide fragments, analogs, and derivatives having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.

[0060] The present invention also relates to polynucleotides that hybridize with the sequences described above (the two sequences having at least 50%, preferably 70%, similarity). The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2xSSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the similarity between the two sequences is at least 95%, preferably at least 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

[0061] This invention also relates to nucleic acid fragments that hybridize with the sequences described above. As used in this invention, the length of a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate the polynucleotide encoding the human transcription factor LCR-F19.02.

[0062] The polypeptides and polynucleotides in this invention are preferably provided in isolated form, and more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human transcription factor LCR-F19.02 of this invention can be obtained by a variety of methods. For example, polynucleotides can be isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes with genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect polynucleotide fragments of clones with common structural features.

[0063] The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating double-stranded DNA sequences from genomic DNA; 2) chemically synthesizing DNA sequences to obtain double-stranded DNA of the polypeptide.

[0064] Of the methods mentioned above, isolating genomic DNA is the least common. Direct chemical synthesis of the D sequence is a frequently chosen method. An even more common method is the isolation of cDNA sequences. The standard method for isolating cDM of interest is to isolate raR from donor cells that highly express the gene and perform reverse transcription to form plasmid or phage cD libraries. Several mature techniques exist for extracting mRNA, and kits are commercially available (Qiagene). Constructing cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory). (New York, 1989). Commercially available cDNA libraries, such as various cDNA libraries from Clontech, are also available. When combined with polymerase reaction technology, even very small amounts of expression products can be cloned.

[0065] The genes of this invention can be screened from these cDNA libraries using conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) marking the presence or loss of gene function; (3) measuring the level of transcripts of human transcription factor LCR-F19.02; and (4) detecting the protein products of gene expression by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.

[0066] In method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. Furthermore, the length of the probe is generally within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is typically a chemically synthesized D sequence based on the gene sequence information of the present invention. The gene itself or a fragment of the present invention can, of course, be used as a probe. The labeling of the DM probe can be done using radioactive isotopes, fluorescein, or enzymes (such as alkaline phosphatase), etc.

[0067] In the fourth method, the protein products of human transcription factor LCR-F19.02 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

[0068] The method of amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferred for obtaining the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA end amplification method) is preferred. The primers used for PCR can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0069] The polynucleotide sequences of the gene or various DNA fragments obtained as described above can be determined using conventional methods such as the dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). These polynucleotide sequences can also be determined using commercial sequencing kits. To obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes, it is necessary to determine the cDNA sequences of multiple clones before they can be assembled into a full-length cDNA sequence.

[0070] The present invention also relates to vectors containing the polynucleotides of the present invention, and host cells genetically engineered using the vectors of the present invention or directly using the coding sequence of the human transcription factor LCR-F19.02, and methods for generating the polypeptides of the present invention via recombinant technology.

[0071] In this invention, a polynucleotide sequence encoding the human transcription factor LCR-F19.02 can be inserted into a vector to construct a recombinant vector containing the polynucleotide described in this invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well-known in the art. Vectors applicable in this invention include, but are not limited to: expression vectors based on the T7 promoter for expression in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); and vectors for expression in mammals. The pMSXND expression vector is used in mammalian cells (Lee and Nathans, J Bio Chera. 263: 3521, 1988), and a baculovirus-derived vector is used in insect cells. In short, any plasmid and vector can be used to construct recombinant expression vectors, provided they can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain a replication origin, promoter, marker gene, and translational regulatory elements.

[0072] Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding the human transcription factor LCR-F19.02 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA techniques, DM synthesis techniques, in vivo recombination techniques, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, CFold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; the PL promoter of *λ* phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Inserting enhancer sequences into a vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors of DNA expression, typically ranging from 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0073] In addition, the expression vector preferably contains one or more selective gene markers to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0074] Those skilled in the art are well aware of how to select appropriate vectors / transcriptional regulatory elements (such as promoters, enhancers, etc.) and selective marker genes.

[0075] In this invention, a polynucleotide encoding the human transcription factor LCR-F19.02, or a recombinant vector containing such a polynucleotide, can be transformed or introduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: *Escherichia coli*, *Streptomyces*; bacterial cells such as *Salmonella typhimurium*; fungal cells such as yeast; plant cells; insect cells such as *Drosophila S2* or *Sf9*; and animal cells such as CHO, COS, or Bowes melanoma cells.

[0076] Transformation of host cells using the DNA sequence described in this invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *Escherichia coli*, it can... Competent cells that absorb D can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. MgCl2 is also an option. Transformation can also be performed by electroporation if desired. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0077] Using conventional recombinant DNA technology, the polynucleotide sequence of this invention can be used to express or produce the recombinant human transcription factor LCR-F19.02 (Science, 1984; 224: 1431). Generally, the following steps are involved:

[0078] (1) Transform or transduce suitable host cells with the polynucleotide (or variant) encoding the human transcription factor LCR-F19.02 of the present invention, or with a recombinant expression vector containing the polynucleotide;

[0079] (2) Culture the host cells in a suitable culture medium;

[0080] (3) Isolate and purify proteins from culture media or cells.

[0081] In step (2), the culture medium used in the culture can be selected from various conventional culture media, depending on the host cells used. The cells are cultured under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature change or chemical induction), and the cells are cultured for a further period.

[0082] In step (3), the recombinant polypeptide may be encapsulated within cells, expressed on the cell membrane, or secreted extracellularly. If desired, the recombinant protein may be separated and purified using various separation methods based on its physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional refolding treatment, protein precipitation (salting out), centrifugation, percolation, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof.

[0083] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be used directly for the treatment of diseases, such as malignant tumors, adrenal insufficiency, skin diseases, various inflammations, HIV infection, and immune diseases.

[0084] Hemoglobin is the main component of red blood cells, responsible for transporting oxygen and carbon dioxide in the body. Each hemoglobin molecule consists of two identical subunits and four heme molecules. Hemoglobin without heme is called globin. All globin subunit genes have very similar structures, but the composition of hemoglobin subunits varies at different stages of individual development. The transcription and expression of globin subunits in the body are regulated by related transcription factors. The transcription factor LCR regulates globin γ, ... £ The transcription and expression of the β subunit involve first binding to chromosomes containing the β subunit gene, and then enhancing the transcription of β-globin ε.

[0085] Transcription and expression of the γ and β subunits.

[0086] Transcription factor LCR-F1 is a gene with a structure and function similar to the known transcription factor LCR. The conserved CNC domain in its protein sequence plays a crucial regulatory role in the transcription and expression of globin ε, γ, and P subunits, thus playing a vital role in the formation of globin. Mutations or abnormal expression of this protein will lead to abnormal expression of related globins in vivo, thereby affecting the activity of related hemoglobins and triggering various related diseases.

[0087] The expression profile of the polypeptides of this invention is consistent with that of the human transcription factor LCR-F1, and both have similar biological functions. The polypeptides of this invention participate in the regulation of the transcription and expression of globin ε, γ, and P subunits in vivo, which is of great significance for the normal formation of globin. Abnormal expression of these polypeptides will lead to abnormal erythrocyte formation and related diseases.

[0088] Therefore, it is evident that abnormal expression of the human transcription factor LCR-F19.02 of this invention will lead to various diseases, especially erythrocyte diseases, including but not limited to:

[0089] Red blood cell disorders: various anemias, polycythemia vera, symptomatic polycythemia, hereditary elliptic polycythemia.

[0090] The polypeptides of the present invention, as well as their antagonists, agonists, and inhibitors, can be used directly for disease treatment, for example, to treat various diseases, especially erythrocyte diseases.

[0091] This invention also provides a method for screening compounds to identify agents that enhance (agonist) or inhibit (antagonist) human transcription factor LCR-F19.02. Agonists enhance biological functions such as cell proliferation stimulated by human transcription factor LCR-F19.02, while antagonists prevent and treat disorders associated with excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human transcription factor LCR-F19.02 can be cultured together with labeled human transcription factor LCR-F19.02 in the presence of the drug. The ability of the drug to enhance or inhibit this interaction is then determined.

[0092] Antagonists of human transcription factor LCR-F19.02 include screened antibodies, compounds, receptor deletion modifiers, and analogs. Antagonists of human transcription factor LCR-F19.02 can bind to and eliminate its function, either by inhibiting the production of the peptide or by binding to the active site of the peptide, preventing it from exerting its biological function.

[0093] When screening compounds for antagonism, human transcription factor LCR-F19.02 can be added to a bioanalytical assay. The antagonist status is determined by measuring the compound's effect on the interaction between LCR-F19.02 and its receptor. The same method used to screen compounds can be used to screen for receptor deletions and analogs that act as antagonists. Peptides that bind to LCR-F19.02 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. Generally, LCR-F19.02 molecules should be labeled during screening.

[0094] This invention provides a method for producing antibodies using polypeptides, fragments thereof, derivatives, analogs, or their cellular components as antigens. These antibodies can be polyclonal or monoclonal antibodies. This invention also provides... Antibodies targeting the antigenic determinant of human transcription factor LCR-F19.02 were developed. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

[0095] Polyclonal antibodies can be produced by directly immunizing animals (such as rabbits, mice, and rats) with human transcription factor LCR-F19.02. Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies against human transcription factor LCR-F19.02 include, but are not limited to, hybridoma technology (Kohl and Milstein. Nature, 1975, 256: 495-497), three-cell hybridoma technology, human β-cell hybridoma technology, and EBV-hybridoma technology. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851). Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human transcription factor LCR-F19.02.

[0096] Antibodies against human transcription factor LCR-F19.02 can be used in immunohistochemistry to detect human transcription factor LCR-F19.02 in biopsy specimens.

[0097] Monoclonal antibodies that bind to the human transcription factor LCR-F19.02 can also be labeled with radioactive isotopes, and their location and distribution can be tracked after injection into the body. These radiolabeled antibodies can serve as a non-invasive diagnostic method for locating tumor cells and determining whether metastasis has occurred.

[0098] Antibodies can also be used to design immunotoxins targeting specific sites in the body. For example, monoclonal antibodies with high affinity for human transcription factor LCR-F19.02 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, and erythrine). A common method is to use a thiol cross-linking agent, such as SPDP, to attack the amino group of the antibody, binding the toxin to the antibody through disulfide bond exchange. Such hybrid antibodies can be used to kill human transcription factor LCR-F19.02-positive cells.

[0099] The antibodies of this invention can be used to treat or prevent diseases associated with human transcription factor LCR-F19.02. Administration of appropriate doses of the antibody can stimulate or block the production or activity of human transcription factor LCR-F19.02.

[0100] This invention also relates to diagnostic assays for the quantitative and localized detection of human transcription factor LCR-F19.02 levels. These assays are well known in the art and include FISH assays and radioimmunoassays. The human transcription factor LCR-F19.02 levels detected in these assays can be used to interpret the importance of human transcription factor LCR-F19.02 in various diseases and for diagnosing diseases in which human transcription factor LCR-F19.02 plays a role.

[0101] The peptides of the present invention can also be used for peptide profiling analysis. For example, the peptides can be specifically cleaved by physical, chemical or enzymatic methods and analyzed by one-dimensional, two-dimensional or three-dimensional gel electrophoresis, or more preferably by mass spectrometry.

[0102] Polynucleotides encoding human transcription factor LCR-F19.02 can also be used for various therapeutic purposes. Gene therapy techniques can be used to treat conditions caused by the absence or abnormal / inactive expression of human transcription factor LCR-F19.02. Human transcription factor LCR-F19.02 can cause abnormal cell proliferation, development, or metabolism. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human transcription factor LCR-F19.02 to inhibit the activity of endogenous human transcription factor LCR-F19.02. For example, a variant human transcription factor LCR-F19.02 may be a shortened version lacking the signal transduction domain; although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human transcription factor LCR-F19.02. Viral expression vectors, such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex viruses, and parvoviruses, can be used to transfer polynucleotides encoding human transcription factor LCR-F19.02 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human transcription factor LCR-F19.02 can be found in existing literature (Sambrook, et al.). Furthermore, the recombinant polynucleotides encoding human transcription factor LCR-F19.02 can be packaged into liposomes and transferred into cells.

[0103] Methods for introducing polynucleotides into tissues or cells include: directly injecting polynucleotides into tissues in vivo; or introducing polynucleotides into cells in vitro using vectors (such as viruses, bacteriophages, or plasmids) and then transplanting the cells into the body.

[0104] Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human transcription factor LCR-F19.02 mRNA are also within the scope of this invention. A ribozyme is an enzyme-like RM molecule that specifically breaks down specific RNAs. Its mechanism of action involves the ribozyme molecule specifically hybridizing with a complementary target RM and then performing endonuclease. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technique, such as the widely used technique of synthesizing oligonucleotides via solid-phase phosphoramide chemical synthesis. Antisense RNA molecules can be obtained by transcription in vitro or in vivo using a DM sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. To increase the stability of nucleic acid molecules, they can be modified in various ways, such as increasing the length of the flanking sequences, and using phosphothioester or peptide bonds instead of phosphodiester bonds for the ribonucleosides.

[0105] The polynucleotide encoding human transcription factor LCR-F19.02 can be used for the diagnosis of diseases related to human transcription factor LCR-F19.02. The polynucleotide encoding human transcription factor LCR-F19.02 can be used to detect the expression of human transcription factor LCR-F19.02 or its abnormal expression in disease states. For example, the DNA sequence encoding human transcription factor LCR-F19.02 can be used to hybridize biopsy specimens to determine the expression status of human transcription factor LCR-F19.02. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques are all publicly available and mature technologies, and related kits are commercially available. Part or all of the polynucleotides of this invention can be immobilized as probes on microarrays or DNA chips (also known as "gene chips") for differential gene expression analysis and gene diagnosis in tissues. The transcription of human transcription factor LCR-F19.02 can also be detected by in vitro amplification using RNA-polymerase chain reaction (RT-PCR) with primers specific to human transcription factor LCR-F19.02. product.

[0106] Detection of mutations in the human transcription factor LCR-F19.02 gene can also be used to diagnose diseases related to human transcription factor LCR-F19.02. Mutations in human transcription factor LCR-F19.02 can take the form of point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human transcription factor LCR-F19.02 DNA sequence. Existing techniques such as Southern blotting, DNA sequencing, PCR, and in situ hybridization can be used to detect mutations. Furthermore, mutations may affect protein expression; therefore, Northern blotting and Western blotting can be used to indirectly determine the presence of gene mutations.

[0107] The sequences of this invention are also valuable for chromosome identification. These sequences specifically target a particular location on a human chromosome and can hybridize with it. Currently, there is a need to identify the specific sites of genes on chromosomes. At present, only a few chromosome markers based on actual sequence data (repetitive polymorphisms) are available for labeling chromosome locations. According to this invention, a crucial first step in associating these sequences with disease-related genes is to locate these DNA sequences on chromosomes.

[0108] In short, PCR primers (preferably 15-35 bp) are prepared based on cDM, allowing sequences to be located on chromosomes. These primers are then used for PCR screening of somatic heterozygous cells containing each human chromosome. Only heterozygous cells containing the corresponding human genes from the primers will produce amplified fragments.

[0109] PCR localization of somatic hybrid cells is a rapid method for locating DNA to specific chromosomes. Using the oligonucleotide primers of this invention, sub-localization can be achieved using a set of fragments from a specific chromosome or a large number of genomic clones through a similar method. Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening using labeled flow cytometry, and hybridization pre-selection, thereby constructing chromosome-specific cDNA libraries.

[0110] Fluorescence in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows for precise chromosome localization in a single step. A review of this technique can be found in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergaraon Press, New York (1988).

[0111] Once a sequence is pinpointed to its precise chromosomal location, that physical location on the chromosome can be correlated with gene mapping data. This data is available from V. McKusick, *Mendelian Inheritance in Man* (accessible via link to the Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between the gene and diseases already located on the chromosomal region.

[0112] Next, it is necessary to determine the differences in cDNA or genomic sequences between diseased and healthy individuals. If a mutation is observed in some or all diseased individuals, but not in any healthy individuals, then that mutation may be the cause of the disease. Comparing diseased and healthy individuals typically involves first looking for structural changes in chromosomes, such as those visible at the chromosomal level or detectable by cDNA sequence-based PCR. Loss or translocation. Based on the resolution of current physical mapping and gene localization technologies, cDNA precisely located to the chromosomal region associated with the disease can be one of 50 to 500 potential pathogenic genes (assuming a mapping resolution of 1 megabase and one gene per 20 kb).

[0113] The peptides, polynucleotides and their analogues, agonists, antagonists and inhibitors of the present invention can be used in combination with suitable drug carriers. These carriers can be water, glucose, ethanol, salts, buffer solutions, glycerol and combinations thereof. The compositions contain a safe and effective amount of the peptide or antagonist, as well as a carrier and excipients that do not affect the efficacy of the drug. These compositions can be used as drugs for the treatment of diseases.

[0114] The present invention also provides a kit or reagent kit containing one or more containers, wherein the containers contain one or more pharmaceutical composition ingredients of the present invention. Along with these containers, there may be indicative instructions from the government regulatory authority that manufactures, uses, or sells the pharmaceutical or biological product, reflecting the authority's permission for its administration to humans. Furthermore, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

[0115] The pharmaceutical composition can be administered in a convenient manner, such as via local, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes. Human transcription factor LCR-F19.02 is administered in an amount that is effective in treating and / or preventing a specific indication. The amount and dosage range of human transcription factor LCR-F19.02 administered to a patient will depend on many factors, such as the route of administration, the patient's health condition, and the diagnostic physician's judgment. Examples

[0116] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0117] Example 1: Human transcription factor LCR-F1 9 Cloning of .02

[0118] Total RNA was extracted from human fetal brain using a one-step guanidine isothiocyanate / phenol / chloroform method. Poly(A) mRNA was isolated from the total RNA using Quik mRNA Isolation Kit (Qiegene). 2 μg of poly(A) mRNA was reverse transcribed to form cDNA. The cDNA fragment was directionally inserted into the multiple cloning site of a pBSK(+) vector (Clontech) using the Smart cDNA Cloning Kit (Clontech), and the cells were transformed into DH5α bacteria to form a cDNA library. The 5' and 3' ends of all clones were sequenced using a Dye terminate cycle reaction sequencing kit (PerkinElmer) and an ABI 377 automated sequencer (PerkinElmer). The determined cDNA sequences were compared with existing public D sequence databases (Genebank), and one clone was found to be... The cDNA sequence of 0093f03 is novel. A series of primers were synthesized to perform bidirectional sequencing of the inserted cDNA fragment contained in this clone. The results showed that the full-length cDNA contained in the 0093f03 clone is 1409 bp (as shown in Seq ID NO: l), with a 248 bp segment from 994 bp to 1242 bp. P The open reading frame (ORF) of the gene encodes a novel protein (as shown in Seq ID NO: 2). We named this clone pBS-0093f03, and the encoded protein human transcription factor LCR-F19.02. Example 2: Cloning of the gene encoding human transcription factor LCR-F19.02 using RT-PCR.

[0119] Using total RNA from fetal brain cells as a template, cMA was synthesized via reverse transcription using oligo-dT primers. After purification using a Qiagen kit, PCR amplification was performed using the following primers:

[0120] Priraerl: 5,-GAGATTCACAAAGAAAAAAAGCAA-3' (SEQ ID NO: 3)

[0121] Primer 2: 5'- AAATATAACTTTATTTTTCAGGTT -3' (SEQ ID NO: 4)

[0122] Primerl is the forward sequence starting at the 5th lbp end of SEQ ID NO: 1;

[0123] Primer 2 It is the reverse sequence of the 3rd end of SEQ ID NO: 1.

[0124] Amplification reaction conditions: A 50 μL reaction volume contained 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl2, 200 mol / L dNTP, 10 0 μmol primer, and 1 U of Taq DNA polymerase (Clontech). The reaction was performed for 25 cycles on a PE9600 DNA thermal cycler (PerkinElmer) under the following conditions: 94°C for 30 sec; 55°C for 30 sec; 72°C for 2 min. β-actin was used as a positive control and template blank as a negative control during RT-PCR. The amplified products were purified using a QIAGEN kit and ligated into a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis showed that the DNA sequence of the PCR product was identical to 1-1409 bp as shown in SEQ ID NO: 1. Example 3: Northern Blot Analysis of Human Transcription Factor LCR-F19.02 Gene Expression. Total RNA was extracted using a one-step method [Anal. Biochem 1987, 162, 156-159]. This method includes acidic guanidine thiocyanate-phenol-chloroform extraction. Specifically, tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate and 0.2% sodium acetate (114.0). One volume of phenol and 1 / 5 volume of chloroform-isoamyl alcohol (49:1) were added, and the mixture was centrifuged. The aqueous phase was aspirated, and isopropanol (0.8 volume) was added. The mixture was then centrifuged to obtain RNA precipitate. The obtained RNA precipitate was then... 7 Wash with 0% ethanol, dry and dissolve in water. Use 20 μL δ RNA was electrophoresed on a 1.2% agarose gel containing 20 mM 3-(N-morpholino)propanesulfonic acid (pH 7.0), 5 mM sodium acetate, 1 mM EDTA, and 2.2 M formaldehyde. The RNA was then transferred to a nitrocellulose membrane. [The text abruptly ends here, likely due to an incomplete sentence or missing information.] 32 P dATP was prepared using a random primer method. 32P-labeled DNA probes. The DNA probes used were the coding region sequence (994 bp to 1242 bp) of the human transcription factor LCR-F19.02, amplified by PCR as shown in Figure 1. 32P-labeled probes (approximately 2 x 10⁻⁶) were then used. 6 cpm / ra l) with a nitrocellulose membrane containing transferred RNA in a solution 42 Hybridization overnight at °C; the solution contains 50% formamide-25ra KH2PO4. (pH 7.4) - 5 x SSC - 5 x Denhardt, s solution and 200 μL ε / ιη1 salmon sperm DM. After hybridization, the filter membrane was washed in 1 x SSC - 0.1% SDS at 55°C for 30 min. Then, it was analyzed and quantified using a Phosphor Imager. Example 4 In vitro expression, isolation and purification of recombinant human transcription factor LCR-F19.02

[0125] Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, with the following sequences:

[0126] Primer 3: 5'-CCCCATATGATGCAGATGGTGCTGCTGCCATAT-3' (Seq ID No: 5) Primer 4: 5'-CCCAAGCTTTCAAAATGTAGACCCACATCTTTC-3' (Seq ID No: 6) These two primers contain Ndel and Hindlll restriction sites at their 5' ends, respectively, followed by the coding sequences for the 5' and 3' ends of the target gene. The Ndel and Hindlll restriction sites correspond to the selective restriction enzyme sites on the expression vector plasmid pET-28b(+) (Novagen product, Cat. No. 69865.3). PCR was performed using the PBS-0093f03 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μL containing 10 pg of pBS-0093f03 plasmid, 1 0 mol of Primer-3 and Primer-4, and 1 μL of Advantage polymerase Mix (Clontech). Cycling parameters were: 94°C for 20 s, 60°C for 30 s, and 68°C for 2 min, for a total of 25 cycles. The amplified product and plasmid pET-28(+) were double-digested with Ndel and Hindyl, respectively, and the large fragments were recovered and ligated using T4 ligase. The ligation product was transformed into E. coli DH5CC using the calcium chloride method. After overnight culture on LB agar plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. Selected positive clones with correct sequences (pET-0093f03) were transformed into *E. coli* BL21(DE3) plySs (Novagen product) using the calcium chloride method. The recombinant plasmid was then transformed into kanamycin (final concentration 30 μg / mL). ΕIn LB broth medium (pET-0093f03), the host bacterium BL21 was cultured at 37°C to the logarithmic growth phase. IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours. The bacterial cells were collected by centrifugation, and the supernatant was collected by centrifugation. The purified target protein, human transcription factor LCR-F19.02, was obtained by His. Bind Quick Cartridge (Novagen) affinity chromatography column, which binds to six histidine residues (6His-Tag). SDS-PAGE electrophoresis showed a single band at 9 kDa (Figure 2). This band was transferred to a PVDF membrane, and N-terminal amino acid sequence analysis was performed using the Edaras hydrolysis method. The results showed that the N-terminal 15 amino acids were identical to the N-terminal 15 amino acid residues shown in SEQ ID NO: 2. Example 5: Production of Antibody against Human Transcription Factor LCR-F19.02

[0127] The following human transcription factor LCR-F19.02-specific polypeptide, NH2-Met-Gln-Met-Val-Leu-Leu-Pro-Tyr-Phe-Pro-Gly-Thr-Pro-Leu-Ser-C00H (SEQ ID NO: 7), was synthesized using a polypeptide synthesizer (PE company product). This polypeptide was then coupled with hemocyanin and bovine serum albumin to form complexes, as described in: Avrameas, et al. Immune Chemistry, 1969; 6: 43. 4 mg of the above hemocyanin polypeptide was used... Rabbits were immunized with the complex plus complete Freund's adjuvant, and then boosted with the hemocyanin-peptide complex plus incomplete Freund's adjuvant 15 days later. The antibody titer in rabbit serum was determined by ELISA using a titration plate coated with 15 g / ml bovine serum albumin-peptide complex. Total IgG was isolated from the serum of antibody-positive rabbits using protein A-Sepharose. The peptides were bound to cyanogen bromide-activated Se... P har 0S e On a 4B column, anti-peptide antibodies were isolated from total IgG using affinity chromatography. Immunoprecipitation demonstrated that the purified antibodies specifically bound to human transcription factor LCR-F19.02. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe.

[0128] Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes has many applications. For example, the probe can be used to hybridize with genomic or cDNA libraries of normal or pathological tissues from different sources to identify whether they contain the polynucleotide sequence of the present invention and to detect homologous polynucleotide sequences. Furthermore, the probe can be used to detect whether the expression of the polynucleotide sequence of the present invention or its homologous polynucleotide sequences is abnormal in normal or pathological tissue cells.

[0129] The purpose of this embodiment is to select suitable oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes, and to identify whether some tissues contain the polynucleotide sequence of the present invention or its homologous polynucleotide sequence using a membrane hybridization method. Membrane hybridization methods include dot blot, Southern blotting, Northern blotting, and photocopying methods, all of which involve immobilizing the polynucleotide sample to be tested on a membrane and then hybridizing using essentially the same steps. These identical steps are: the membrane with the sample immobilized is first pre-hybridized with a hybridization buffer without probes to saturate the non-specific binding sites of the sample on the membrane with the carrier and the synthesized polymer. Then the pre-hybridization solution is replaced with a hybridization buffer containing labeled probes, and the membrane is incubated to allow the probes to hybridize with the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of washing steps. This embodiment utilizes high-intensity washing conditions (such as low salt concentration and high temperature) to reduce the hybridization background and retain only highly specific signals. The probes used in this embodiment include two types: the first type of probe is an oligonucleotide fragment that is completely identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention; the second type of probe is an oligonucleotide fragment that is partially identical to or complementary to the polynucleotide SEQ ID NO: 1 of this invention. In this embodiment, dot blot is used to immobilize the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe exhibits the strongest hybridization specificity with the sample and is thus retained.

[0130] I. Probe Selection

[0131] When selecting oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of this invention for use as hybridization probes, the following principles and several aspects should be followed:

[0132] 1. The preferred probe size range is 18-50 nucleotides;

[0133] 2. GC content should be 30%-70%; exceeding this will increase non-specific hybridization. 3. There should be no complementary regions inside the probe;

[0134] 4. Probes that meet the above conditions can be used as preliminary selection probes. Then, further computer sequence analysis is performed, including comparing the homology of the preliminary selection probe with its source sequence region (i.e., SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive identical bases, then the preliminary selection probe should generally not be used.

[0135] 5. Whether the initially selected probes are ultimately chosen as having practical application value should be further determined experimentally. After completing the above analyses, the following two probes were selected and synthesized:

[0136] Probe 1 (robol), belonging to class 1 probes, is completely homologous to or complementary to the gene fragment of SEQ ID NO: 1 (41Nt).

[0137] 5'-TGCAGATGGTGCTGCTGCCATATTTTCCTGGCACACCTTTA-3' (SEQ ID NO: 8) Probe 2 (probe2), belonging to the second class of probes, is a substitution mutation sequence (41Nt) equivalent to the gene fragment of SEQ ID NO: 1 or its complementary fragment:

[0138] 5'-TGCAGATGGTGCTGCTGCCACATTTTCCTGGCACACCTTTA-3' (SEQ ID NO: 9) For other commonly used reagents not listed and their preparation methods related to the following specific experimental steps, please refer to: DM PROBES GHKeller; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as *Molecular Cloning: A Laboratory Manual* (2nd edition, 1998) by Sambrook et al., Science Press.

[0139] Sample preparation:

[0140] 1. Extracting DNA from fresh or frozen tissues

[0141] Steps: 1) Place fresh or freshly thawed normal liver tissue into a petri dish containing phosphate-buffered saline (PBS) and place it on ice. Cut the tissue into small pieces using scissors or a scalpel. Keep the tissue moist during the process. 2) Centrifuge the tissue at 1000g for 10 minutes to break it up. 3) Resuspend the pellet in cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl2) (approximately 10 ml / g). 4) Homogenize the tissue suspension at full speed using an electric homogenizer at 4°C until the tissue is completely broken up. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 liters per 0.1g of the initial tissue sample) and centrifuge again at 1000g for 10 minutes. 7) Resuspend the precipitate with lysis buffer (1 ml for every 0.1 g of the initial tissue sample), and then proceed with the following phenol extraction method.

[0142] 2. Phenol extraction method for DNA

[0143] Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the precipitated cells (1 x 10^6) cells in cold cell lysis buffer. 8 (Cells / ml) Use at least 100ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break down, reducing the overall yield. This is especially important when extracting >10... 7 It is particularly severe in cells. 4) 5) Add proteinase K to a final concentration of 200 μg / ml. 6) Incubate at 50°C for 1 hour or gently shake overnight at 37°C. 7) Extract with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), centrifuging for 10 minutes in a small centrifuge tube. The two phases should be clearly separated; otherwise, repeat the centrifugation. 8) Transfer the aqueous phase to a new tube. 9) Extract with an equal volume of chloroform:isoamyl alcohol (24:1), centrifuging for 10 minutes. 10) Transfer the aqueous phase containing DNA to a new tube. Then perform DNA purification and ethanol precipitation.

[0144] 3. DNA purification and ethanol precipitation

[0145] Steps: 1) Add 1 / 10 volume of 2 mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix well. Incubate at -20°C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour off the ethanol. 4) Wash the precipitate with 500 μL of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour off the ethanol. Wash the precipitate with 500 μL of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour off the ethanol, then invert the container on absorbent paper to allow any remaining ethanol to drain. Air dry for 10-15 minutes to allow surface ethanol to evaporate. Do not allow the precipitate to dry completely, otherwise it will be difficult to redissolve. 7) Resuspend the DNA precipitate in a small volume of TE or water. Vortex at low speed or use a dropper to aspirate, while gradually increasing the TE, mixing until the DNA is fully dissolved, adding 1-5 x 10 μL each time. 6 The amount extracted from the cells is approximately 1 ul.

[0146] Steps 8-13 below are only used when it is necessary to remove contaminants; otherwise, proceed directly to step 14.

[0147] 8) Add RNase A to the DNA solution to a final concentration of 100 μg / ml and incubate at 37°C for 30 minutes. 9) Add SDS and proteinase K to final concentrations of 0.5% and 100 μg / ml, respectively. Incubate at 37°C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform:isoamyl alcohol (24:1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1 / 10 volume of 2 mol / L sodium acetate and 2.5 volumes of cold ethanol, mix well, and incubate at -20°C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air-dry, and resuspend the nucleic acid, following steps 3-6. 14) Determine A. 26Q and A 28D To test the purity and yield of D. 15) Store at -20°C after dispensing.

[0148] Preparation of the sample membrane:

[0149] 1) Take 4x2 appropriately sized nitrocellulose membranes (NC membranes) and lightly mark the spotting locations and sample numbers on them with a pencil. Two NC membranes are needed for each probe so that the membranes can be washed under high-intensity and low-intensity conditions respectively in the subsequent experimental steps.

[0150] 2) Take 15 μL of each sample and control sample, spot them onto the sample film, and let them air dry at room temperature.

[0151] 3) Place it on filter paper soaked in 0.1 mol / L NaOH and 1.5 mol / L NaCl for 5 minutes (twice), then air dry.

[0152] 4) Place it between clean filter paper, wrap it with aluminum foil, and vacuum dry at 60-80°C for 2 hours.

[0153] Probe marking 1) 3μ1 Probe (0. IOD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- 32 P-dATP + 2U Kinase, to a final volume of 20μl.

[0154] 2) Keep warm at 37 °C for 2 hours.

[0155] 3) Add 1 / 5 volume of bromophenol blue indicator (BPB).

[0156] 4) Pass through Sephadex G-50 column.

[0157] 5) To have 32 The first peak is collected before the P-Probe wash (it can be monitored using a monitor).

[0158] 6) 5 drops / tube, collect 10-15 tubes.

[0159] 7) Monitor isotope levels using a liquid scintillation meter.

[0160] 8) The collected liquid from the first peak is the desired product. 32 P-Probe (the second peak is free γ-) 32 P-dATP).

[0161] prehybridization

[0162] Place the sample membrane in a plastic bag and add 3–10 mg of prehybridization solution (10x Denhardt's; 6x SSC, 0.1 mg / ml CT DM (calf thymus DNA)). Seal the bag and incubate at 68°C with water for 2 hours.

[0163] Hybridization

[0164] Cut off a corner of the plastic bag, add the prepared probe, seal the bag, and incubate overnight in a 42°C water bath. Wash the membrane:

[0165] High-intensity film washing:

[0166] 1) Take out the hybridized sample membrane.

[0167] 2) Wash in 2xSSC and 0.1%SDS at 40°C for 15 minutes (twice).

[0168] 3) Wash at 40°C for 15 minutes (twice) in 0.1% SSC and 0.1% SDS.

[0169] 4) In 0.1x SSC, 0.1°C SDS, wash for 30 minutes (twice), then air dry at room temperature. Low-intensity film washing:

[0170] 1) Take out the hybridized sample membrane.

[0171] 2) Wash at 37°C for 15 minutes (twice) in 2xSSC and 0.1%SDS.

[0172] 3) Wash at 37°C for 15 minutes (twice) in 0.1% SSC and 0.1% SDS.

[0173] 4) 0.1 x SSC, 0.1 g medium, wash at 40°C for 15 minutes (twice), then air dry at room temperature.

[0174] X-ray autoradiography:

[0175] - 0°C, X-ray autoradiography (the compression time depends on the intensity of the radioactivity of the hybridization spot).

[0176] Experimental results:

[0177] Hybridization experiments conducted under low-intensity washing conditions did not show a significant difference in the radioactivity intensity of the hybridization spots of the two probes. There is a clear difference; and in hybridization experiments conducted under high-intensity washing conditions, the radioactivity intensity of the hybridization spot of probe 1 is significantly stronger than that of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of the present invention in different tissues. Example 7 DNA Microarray

[0178] Gene chips, or DNA microarrays, are new technologies that many national laboratories and large pharmaceutical companies are currently researching and developing. They involve arranging a large number of target gene fragments in an orderly and high-density manner on a carrier such as glass or silicon, and then using fluorescence detection and computer software to compare and analyze the data, achieving rapid, efficient, and high-throughput analysis of biological information. The polynucleotides of this invention can be used as target DNA in gene chip technology for high-throughput research on the function of new genes; for finding and screening tissue-specific new genes, especially those related to diseases such as tumors; and for the diagnosis of diseases, such as hereditary diseases. Specific methods and steps have been reported in various literatures, such as DeRisi, JL, Lyer, V. & Brown, P. O. (1997) Science 278, 680-686. and Helle, RA, Schema, M., Chai, A., Shalom, D. (1997) PNAS 94: 2150-2155.

[0179] (a) Spotting

[0180] A total of 4000 polynucleotide sequences of various full-length cDNAs were used as target DNA molecules (MAs), including the polynucleotides of this invention. These sequences were amplified separately by PCR. After purification, the amplified products were adjusted to a concentration of approximately 500 ng / µl and spotted onto a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA), with a spot spacing of 280 µm. The spotted slides were then hydrated, dried, and cross-linked in a UV cross-linker. After elution and drying, the DNA was immobilized on the glass slides to prepare a chip. Specific methods and steps have been reported in various literatures. The post-spotting processing steps in this embodiment are as follows:

[0181] 1. Hydrate for 4 hours in a humid environment;

[0182] 2.0.2% SDS wash for 1 minute;

[0183] 3. Wash twice with dd0, 1 minute each time;

[0184] 4. NaBH4 seal for 5 minutes;

[0185] 5. In 95°C water for 2 minutes;

[0186] 6. Wash with 0.2% SDS for 1 minute;

[0187] 7. Rinse twice with ddH2O;

[0188] 8. Let it air dry and store in a dark place at 25°C for later use.

[0189] (II) Probe Marking

[0190] Total mRNA was extracted from mixed human tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using the Oligotex mRNA Midi Kit (purchased from QiaGen). The mRNA from mixed human tissues was labeled with Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amershara Phamacia Biotech) using fluorescent reagent, while mRNA from specific tissues (or stimulated cell lines) was labeled with Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amershara Phamacia Biotech) using fluorescent reagent. The probes were then purified. For detailed steps and methods, please refer to:

[0191] Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Sha Ion, Da ri., Davis, RW (1995) Science. 270 (20): 467-480.

[0192] (III) Hybridization

[0193] The probes from the two tissues were hybridized with the chip in UniHyb™ Hybridization Solution (purchased from TeleChem) for 16 hours. After washing with washing solution (1x SSC, 0.2% SDS) at room temperature, the chips were scanned using a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed using Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio for each point.

[0194] The specific tissues (or stimulated cell lines) mentioned above are fetal brain, bladder mucosa, PMA+ Ecv304 cell line, LPS+ Ecv304 cell line, thymus, normal fibroblast 1024NC, Fibroblast, growth factor stimulation, and 10 24 NT, scar-forming fc cells stimulated with growth factor, 1013HT, scar-forming fc cells not stimulated with growth factor, 1013HC, bladder cancer cell line EJ, adjacent to bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunal adenocarcinoma, and gastric cardia cancer. A fold plot was drawn based on these 18 Cy3 / Cy5 ratios (Figure 1). As can be seen from the figure, the expression profiles of human transcription factor LCR-F19.02 and human transcription factor LCR-F1 described in this invention are very similar.

Claims

Scholi demanded 1. An isolated polypeptide, LCR-F19.02, is characterized in that... It contains: a polypeptide of the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide thereof, an analogue or a derivative thereof.

2. The polypeptide as described in claim 1, characterized in that... The amino acid sequence of the polypeptide, analogue or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO:

2.

3. The polypeptide as described in claim 2, characterized in that... It contains a polypeptide having the amino acid sequence shown in SEQ ID NO:

2.

4. An isolated polynucleotide, characterized in that... The polynucleotide comprises one selected from the group consisting of: (a) A polypeptide or fragment thereof, analogue, or derivative thereof encoding the amino acid sequence shown in SEQ ID NO: 2; (b) A polynucleotide complementary to polynucleotide (a); or (c) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide as described in claim 4, characterized in that... The polynucleotide comprises a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:

2.

6. The polynucleotide as described in claim 4, characterized in that... The polynucleotide sequence comprises the sequence of positions 994-1242 of SEQ ID NO: 1 or the sequence of positions 1-1409 of SEQ ID NO:

1.

7. A recombinant vector containing exogenous polynucleotides, characterized in that... It is a recombinant vector constructed from the polynucleotide described in any one of claims 4-6 and a plasmid, virus, or vector expression vector.

8. A genetically engineered host cell containing exogenous polynucleotides, characterized in that... It is selected from one of the following host cells: (a) Host cells transformed or transduced using the recombinant vector of claim 7; or (b) Host cells transformed or transduced with the polynucleotide as described in any one of claims 4-6.

9. A method for preparing a polypeptide with human transcription factor LCR-F19.02 activity, characterized in that... The method includes: (a) Under conditions expressing human transcription factor LCR-F19.02, culture the engineered host cells as described in requirement 8; (b) A polypeptide with human transcription factor LCR-F19.02 activity was isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that... The antibody is an antibody that specifically binds to human transcription factor LCR-F19.

02.

11. A class of compounds that mimic or regulate the activity or expression of peptides, characterized in that... These are compounds that mimic, promote, antagonize, or inhibit the activity of human transcription factor LCR-F19.

02.

12. The compound of claim 11, characterized in that... It is the antisense sequence of the polynucleotide sequence or a fragment thereof shown in SEQ ID NO:

1.

13. An application of the compound of claim 11, characterized in that... The compound is used in a method for regulating the in vivo and in vitro activity of the human transcription factor LCR-F19.

02.

14. A method for detecting a disease or susceptibility to a disease associated with the polypeptide described in any one of claims 1-3, characterized in that... This includes detecting the expression level of the polypeptide, or detecting the activity of the polypeptide, or detecting nucleotide variations in the polynucleotide that cause abnormal expression or activity of the polypeptide.

15. The use of the polypeptide as described in any one of claims 1-3, characterized in that... It is used to screen for mimics, agonists, antagonists, or inhibitors of human transcription factor LCR-F19.02; or for peptide fingerprint identification.

16. The application of the nucleic acid molecule as described in any one of claims 4-6, characterized in that... It can be used as a primer for nucleic acid amplification reactions, or as a probe for hybridization reactions, or for manufacturing gene chips or microarrays.

17. The use of the polypeptide, polynucleotide, or compound according to any one of claims 1-6 and 11, characterized in that... The polypeptide, polynucleotide or its analogue, agonist, antagonist or inhibitor, in a safe and effective dose with a pharmaceutically acceptable carrier, constitutes a pharmaceutical composition for the diagnosis or treatment of diseases associated with abnormalities of human transcription factor LCR-F19.

02.

18. The use of the polypeptide, polynucleotide, or compound according to any one of claims 1-6 and 11, characterized in that... Drugs for treating conditions such as malignant tumors, hematological diseases, HIV infection, immune disorders, and various types of inflammation can be prepared using the aforementioned polypeptides, polynucleotides, or compounds.