Methods of dosing engineered T cells for the treatment of B cell malignancies
Patent Information
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2019-11-15
- Publication Date
- 2026-08-13
AI Technical Summary
Current adoptive cell therapies for treating B cell malignancies, such as B-ALL and B-NHL, face challenges in determining optimal doses for pediatric and young adult subjects, leading to variable response rates and increased toxicity risks due to differences in body size and activity of administered cells.
Administering T cells expressing an anti-CD19 chimeric antigen receptor (CAR) in specific dose ranges based on the subject's age and body weight, ranging from 0.05 x 10^6 to 1.5 x 10^8 CAR+ T cells per kilogram, to achieve effective treatment while minimizing toxicity.
This approach enhances the likelihood of response and reduces the risk of toxicity, achieving high response rates and durable responses with low incidence of adverse effects, such as cytokine release syndrome and neurotoxicity, in pediatric and young adult subjects.
Abstract
Description
METHODS OF DOSING ENGINEERED T CELLS FOR THE TREATMENT OF B CELL MALIGNANCIES Cross-Reference to Related Applications
[0001] This application claims priority from U.S. provisional application No. 62 / 786,844, filed November 16, 2018, entitled “METHODS OF DOSING ENGINEERED T CELLS FOR THE TREATMENT OF B CELL MALIGNANCIES,” and U.S. provisional application No. 62 / 914,303, filed October 11, 2019, entitled “METHODS OF DOSING ENGINEERED T CELLS FOR THE TREATMENT OF B CELL MALIGNANCIES,” the contents of which are incorporated by reference in their entirety. Incorporation by Reference of Sequence Listing
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 735042019540SeqList.txt, created November 10, 2019, which is 34.0 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety. Field
[0003] The present disclosure relates in some aspects to methods for treatment and uses involving the administration of doses of engineered T cells for treating subjects with disease and conditions such as certain B cell malignancies, and related methods, compositions, uses and articles of manufacture. The engineered cells generally express recombinant receptors such as chimeric antigen receptors (CARs). In some embodiments, the disease or condition is acute lymphoblastic leukemia (ALL) or non-Hodgkin lymphoma (NHL). In some embodiments, the subject is within a particular range of age, such as subjects that are 25 years or less of age, such as pediatric subjects. Background
[0004] Various immunotherapy and / or cell therapy methods are available for treating diseases and conditions. For example, adoptive cell therapies (including those involving the administration of cells expressing recombinant receptors specific for a disease or disorder of interest, such as chimeric antigen receptors (CARs) and / or other recombinant receptors, as well as other adoptive immune cell and adoptive T cell therapies) can be beneficial in the treatment of diseases or disorders, such as B cell malignancies or hematological malignancies. Improved approaches are needed. Provided are methods and uses that meet such needs. Summary
[0005] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, such as a B-ALL or a B-NHL, including a malignancy thereof that is relapsed and / or refractory, the method comprising administering, to a subject at or younger than 25 years of age, or in some cases younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR). Such methods and uses include therapeutic methods and uses, for example, involving administration of the anti-CD19 CAR-expressing T cell compositions in an effective amount to effect treatment of the disease or disorder. Uses include uses of such anti-CD19 CAR-expressing in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods. In some embodiments, the methods thereby treat the disease or condition or disorder in the subject.
[0006] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0007] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, from at or about 0.5 x 108 CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.5 x 10% CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
[0008] In some of any embodiments, (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 106 CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 10% CAR+ T cells to at or about 0.75 x 108 CAR+ T cells.
[0009] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.05 x 10° CAR+ T cells / ’kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 10% CAR+ T cells.
[0010] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.5 x 10¢ CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.5 x 10® CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0011] In some of any embodiments, (i) if the subject is less than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 0.75 x 10° CAR+ T cells.
[0012] In some of any embodiments, if the subject is less than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1 x 10° CAR+ T cells / kg body weight of the subject. In some of any embodiments, if the subject is less than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.5 x 10% CAR+ T cells / ’kg body weight of the subject to at or about 1 x 10° CAR+ T cells / kg body weight of the subject.
[0013] In some of any embodiments, if the subject is at or greater than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some of any embodiments, if the subject is at or greater than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 10% CAR+ T cells to at or about 1 x 108 CAR+ T cells. In some of any embodiments, if the subject is at or greater than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.5 x 108 CAR+ T cells to at or about 1.5 x 108 CAR+ T cells. In some of any embodiments, if the subject is at or greater than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.5 x 108 CAR+ T cells to at or about 1 x 10° CAR+ T cells.
[0014] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.05 x 10% CAR+ T cells.
[0015] In some of any embodiments, if the subject exhibits no response and does not develop a toxicity at or about 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 days after administration of the T cell composition; further comprising administering to the subject an additional dose of the T cell composition in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.1 x 10% CAR+ T cells.
[0016] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.15 x 10° CAR+ T cells.
[0017] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.3 x 10° CAR+ T cells.
[0018] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.5 x 108 CAR+ T cells.
[0019] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.75 x 10 CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.75 x 10% CAR+ T cells.
[0020] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 1.0 x 10° CAR+ T cells.
[0021] Provided herein are methods of treating a subjecting having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age from at or about 0.05 x 108 CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells; or (ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0022] Provided herein are methods of treating a subjecting having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells; or (ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.5 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0023] In some of any embodiments,: (i) if the subject is younger than 18 years of age, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 0.75 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 0.75 x 10° CAR+ T cells.
[0024] Provided herein are methods of treating a subjecting having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount from at or about 0.05 x 10 CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 108 total CAR+ T cells.
[0025] In some of any embodiments, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 0.75 x 10° total CAR+ T cells.
[0026] In some of any embodiments, the T cell composition is administered in an amount that is at least at or about 0.05 x 10 CAR+ T cells / ’kg body weight of the subject but that does not exceed at or about 0.05 x 10° total CAR+ T cells. In some of any embodiments, if the subject exhibits no response and does not develop a toxicity at or about 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 days after administration of the T cell composition; further comprising administering to the subject an additional dose of the T cell composition wherein, the additional dose of the T cell composition is administered in an amount that is at least at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.1 x 10° total CAR+ T cells. In some of any embodiments, the T cell composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 108 total CAR+ T cells. In some of any embodiments, the T cell composition is administered in an amount that is at least at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells. In some of any embodiments, the T cell composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some of any embodiments, the T cell composition is administered in an amount that is at least at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.75 x 108 total CAR+ T cells. In some of any embodiments, the T cell composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 10° total CAR+ T cells.
[0027] In some of any embodiments, if the subject is younger than 18 years of age the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 108 total CAR+ T cells.
[0028] In some of any embodiments, if the subject is younger than 18 years of age the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 10% total CAR+ T cells.
[0029] In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 10° total CAR+ T cells. In some of any embodiments, if the subject exhibits no response and does not develop a toxicity at or about 21, 22, 23, 24,25, 26,27, 28, 29, 30, 31, 32, 33, 34 or 35 days after administration of the T cell composition; further comprising administering to the subject an additional dose of the T cell composition wherein, if the subject is younger than 18 years of age, the additional dose of the T cell composition is administered in an amount that is at least at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.1 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 108 total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.75 x 10% CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.75 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 108 total CAR+ T cells.
[0030] In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells to at or about 1.0 x 10% CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells to at or about 1.0 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.15 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.3 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.75 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 1.0 x 10° CAR+ T cells.
[0031] In some of any of the provided methods or uses, the subject is at least at or about 6 kg in body weight. In some of any of the provided methods or uses, the subject is at least at or about 12 kg in body weight.
[0032] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.05 x 10° CAR+ T cells / ’kg body weight of the subject, but not exceeding at or about 0.05 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.05 x 108 CAR+ T cells.
[0033] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.15 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.15 x 10° CAR+ T cells.
[0034] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.3 x 108 total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.3 x 10% CAR+ T cells.
[0035] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.5 x 10% CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.5 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
[0036] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.75 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.75 x 10° CAR+ T cells.
[0037] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 1 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 1 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1 x 108 CAR+ T cells.
[0038] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age and weighing 6 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from (i) if the subject is younger than 18 years of age at or about 1 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 1 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 10% CAR+ T cells.
[0039] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject younger than 18 years of age and weighing 12 kg or more, a composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10% CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10% total CAR+ T cells. In some of any embodiments, the composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 10% total CAR+ T cells.
[0040] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject younger than 18 years of age and weighing 12 kg or more, a composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells. In some of any embodiments, the composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 10° total CAR+ T cells.
[0041] In some of any embodiments, the composition is administered in an amount that is at least at or about 0.05 x 10% CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 108 total CAR+ T cells. In some of any embodiments, the composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 106 CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 0.75 x 10° total CAR+ T cells. In some of any embodiments, the composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 10° total CAR+ T cells. In some of any embodiments, the composition is administered in an amount that is at least at or about 0.3 x 10% CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells. In some of any embodiments, the composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some of any embodiments, the composition is administered in an amount that is at least at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.75 x 10° total CAR+ T cells. In some of any embodiments, the composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 10° total CAR+ T cells.
[0042] In some of any embodiments, a total volume of at least 0.05 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered. In some of any embodiments, a total volume of at least at or about 0.1 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered. In some of any of the provided methods or uses, a total volume of at least at or about 0.5 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered.
[0043] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 1.5 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, less than at or about 1.5 x 10° CAR+T cells.
[0044] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.05 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.05 x 10® CAR+ T cells.
[0045] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.15 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.15 x 10® CAR+ T cells.
[0046] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.3 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.3 x 10% CAR+ T cells.
[0047] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.5 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
[0048] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.75 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.75 x 10® CAR+ T cells.
[0049] In some of any embodiments, the concentration of the T cells is at or greater than 2.5 x 10° cells / mL.
[0050] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.05 x 10° total CAR+ T cells in a volume of at least 0.05 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.05 x 108 CAR+ T cells.
[0051]
[0052] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.15 x 10° total CAR+ T cells in a volume of at least 0.15 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.15 x 10° CAR+ T cells.
[0053] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.3 x 108 total CAR+ T cells in a volume of at least 0.3 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.3 x 10% CAR+ T cells.
[0054] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 108 cells / mL, wherein the T cell composition is administered in an amount selected from (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.5 x 10° total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 102 CAR+ T cells.
[0055] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method involving administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.75 x 10° total CAR+ T cells in a volume of at least 0.75 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.75 x 10% CAR+ T cells.
[0056] Provided herein are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 1 x 10° total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 10° CAR+ T cells. In some of any embodiments, a total volume of at least at or about 0.05 mL of the T cell composition is administered. In some of any embodiments, a total volume of at least at or about 0.1 mL of the T cell composition is administered. In some of any embodiments, a total volume of at least at or about 0.5 mL of the T cell composition is administered. In some of any embodiments, a total volume of at least at or about 1.0 mL of the T cell composition is administered.
[0057] In some of any embodiments, the total volume of the T cell composition administered is at least 0.05 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.1 mL. In some of any of the provided embodiments, the total volume of the T cell composition administered is at least 1.0 mL. In some of any of the provided embodiments, the concentration of the T cell composition is greater than at or about 5 x 10° cells / mL or is or is about 5 x 10° cells / mL In some of any of the provided embodiments, the concentration of the T cell composition is greater than at or about 10 x 10° cells / mL or is or is about 10 x 10° cells / mL. In some of any of the provided embodiments, the concentration of the T cell composition is greater than or greater than about 15 x 10° cells / mL or is or is about 15 x 10° cells / mL.
[0058] In some of any of the provided embodiments, the T cell composition comprises CD4* and CD8* CAR+ T cells. In some of any embodiments, the composition comprises a first composition comprising one of the CD4+ T cells and the CD8+ T cells and a second composition comprising the other of the CD4+ T cells and the CD8+ T cells. In some of any embodiments, the first composition and the second composition are administered separately. In some of any embodiments, the first composition and the second composition are administered simultaneously. In some of any embodiments, the first composition and the second composition are administered sequentially, in either order. In some aspects, the first composition comprises CD4* CAR+ T cells and the second composition comprises CD8+ T cells. In other aspects, the first composition comprises CD8* CAR+ T cells and the second composition comprises CD4+ CAR+ T cell.
[0059] In some of any of the provided embodiments, the amount of the T cell composition administered comprises a defined ratio of CD4* CAR+ T cells to CD8" CAR+ T cells and / or of CD4* T cells to CD8* T cells, that is or is approximately 1:1 or is between approximately 1:3 and approximately 3:1. In some of any embodiments, such as involving administration of a first and second composition, the CD4* CAR+ T cells in the one of the first and second compositions and the CD8* CAR+ T cells in the other of the first and second compositions are present at a defined ratio that is or is approximately 1:1 or is between approximately 1:3 and approximately 3:1. In some of any embodiments, such as involving administration of a first and second composition, the CD4* CAR+ T cells and the CD8* CAR+ T cells administered in the first and second compositions are present at a defined ratio, which ratio is or is approximately 1:1 or is between approximately 1:3 and approximately 3:1. In some of any of the provided embodiments, the defined ratio is or is approximately 1:1.
[0060] In some of any of the provided methods or uses, the B cell malignancy is a lymphoma or a leukemia. In some of any embodiments, the B cell malignancy is relapsed and / or refractory.
[0061] In some of any of the provided methods or uses, the B cell malignancy is a B-cell acute lymphoblastic leukemia (B-ALL). In some of any embodiments, the B cell malignancy is a B-cell acute lymphoblastic leukemia (B-ALL), optionally CD19+ B-ALL. In some of any embodiments, the B cell malignancy is relapsed or refractory (1 / r) B-cell Acute Lymphoblastic Leukemia (B-ALL). In some of any embodiments, subject with r / r B-ALL has morphological evidence of disease in bone marrow, optionally wherein the subject has 5% or greater lymphoblast by morphology. In some of any of the embodiments, the subject has a B-ALL that is any of the following: first or greater marrow relapse, any marrow relapse after allogeneic hematopoietic stem cell transplantation (HSCT); primary refractory, optionally following 2 or more separate induction regimens; chemo-refractory, optionally after 1 cycle of chemotherapy for relapsed leukemia; or is ineligible for allogeneic HSCT. In some of any of the embodiments, the B-ALL is relapsed and / or refractory. In some of any embodiments, the subject has a B- ALL comprising any of the following: first or greater marrow relapse, any marrow relapse after allogeneic hematopoietic stem cell transplantation (HSCT); primary refractory, optionally not achieving a complete response (CR) or complete response with incomplete blood count recovery (CRi), optionally following 2 or more separate induction regimens; chemo-refractory, optionally not achieving CR / Cri, optionally after 1 cycle of chemotherapy for relapsed leukemia; or is ineligible for allogeneic HSCT.
[0062] In some of any embodiments, the B-ALL is minimum residual disease positive (MRD+). . In some of any embodiments, subjects with B-ALL has less than 5% lymphoblast by morphology and / or minimum residual disease positive (MRD+) disease as detected by a validated assay at a frequency of 1 x10 or greater in bone marrow cells after two lines of therapy.
[0063] In some of any embodiments, the subject has Philadelphia chromosome positive ALL and is intolerant to or have failed one or more lines of tyrosine-kinase inhibitor (TKI) therapy, or TKI therapy is contraindicated.
[0064] In some of any of the provided methods or uses, the B cell malignancy is a B-cell non- Hodgkin lymphoma (B-NHL). In some of any embodiments, the B cell malignancy is a B-cell non- Hodgkin lymphoma (B-NHL), optionally CD19+ B-NHL. In some of any embodiments, the B cell malignancy is relapsed or refractory (r / r) B-cell non-Hodgkin lymphoma (B-NHL).
[0065] In some of any embodiments, the B-NHL is diffuse large B cell lymphoma (DLBCL), primary mediastinal large B cell lymphoma (PMBCL), or Burkitt's lymphoma. In some of any of the embodiments, the subject has a B-NHL in which there is measurable disease after 1 or more lines of chemotherapy, has failed HSCT, or is ineligible for HSCT. In some of any of the embodiments, the B- NHL is relapsed and / or refractory.
[0066] In some of any of the provided methods or uses, prior to the administration, the subject has been preconditioned with a lymphodepleting therapy comprising the administration of fludarabine and / or cyclophosphamide. In some of any of the provided methods or uses, the method further comprises, immediately prior to the administration, administering a lymphodepleting therapy to the subject comprising the administration of fludarabine and / or cyclophosphamide. In some of any embodiments, the lymphodepleting therapy comprises administration of cyclophosphamide at about 200-400 mg / m? optionally at or about 300 mg / m?, inclusive, and / or fludarabine at about 20-40 mg / m?, optionally 30 mg / m? daily for 2-4 days, optionally for 3 days. In some of any embodiments, the lymphodepleting therapy comprises administration of cyclophosphamide at about 300 mg / m? daily for 3 days and fludarabine at about 30 mg / m? daily for 3 days. In some of any embodiments, the cyclophosphamide and fludarabine are administered concurrently. In some of any embodiments, the cyclophosphamide and fludarabine are administered intravenously. In some of any embodiments, the lymphodepleting therapy is administered 2-7 days prior to the administration of the T cell composition.
[0067] In any of the provided methods or uses, the subject is a human.
[0068] In any of the provided methods or uses, the CAR comprises an scFv specific for human CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule. In some of any embodiments, the CAR comprises, in order, an scFv specific for human CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule. In some of any such embodiments, the cytoplasmic domain derived from a costimulatory molecule is or comprises a human 4-1BB. In some of any such embodiments, the cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule is or comprises a human CD3zeta signaling domain. In some of any such embodiments, the CAR optionally further comprises a spacer between the transmembrane domain and the scFv.
[0069] In any of the provided embodiments, the CAR comprises, in order, an scFv specific for human CD19, a spacer, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, and a cytoplasmic signaling domain derived from a primary signaling ITAM- containing molecule. In some of any such embodiments, the cytoplasmic domain derived from a costimulatory molecule is or comprises a human 4-1BB. In some of any such embodiments, the cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule is or comprises a human CD3zeta signaling domain.
[0070] In some of any of the provided embodiments, the spacer is a polypeptide spacer that comprises or consists of all or a portion of an immunoglobulin hinge or a modified version thereof, optionally an IgG4 hinge, or a modified version thereof. In some of any of the provided embodiments, the spacer is about 15 amino acids or less, and does not comprise a CD28 extracellular region or a CD8 extracellular region. In some of any of the provided embodiments, the spacer is at or about 12 amino acids in length. In some of any of the provided embodiments, the spacer has or consists of the sequence of SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID O:N 34, or a variant of any of the foregoing having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto. In some of any of the provided embodiments, the spacer comprises or consists of the formula X,PPX,P, where X| is glycine, cysteine or arginine and X; is cysteine or threonine.
[0071] In some of any of the provided embodiments, the cytoplasmic signaling domain derived from a costimulatory molecule, i.e., costimulatory domain, comprises SEQ ID NO: 12 or a variant thereof having at least 85%, 86%, 87%, 88%, 89%. 90%, 91%. 92%, 93%, 94%, 95%. 96%, 97%, 98%, 99% or more sequence identity thereto.
[0072] In some of any of the provided embodiments, the cytoplasmic signaling domain derived from a primary signaling IT AM-containing molecule, i.e., primary signaling domain, comprises SEQ ID NO: 13, 14 or 15 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.
[0073] In some of any of the provided embodiments, the scFv comprises a variable light (V1) chain comprising a CDRLI sequence of RASQDISKYLN (SEQ ID NO: 35), a CDRL2 sequence of SRLHSGV (SEQ ID NO: 36), and a CDRL3 sequence of GNTLPYTFG (SEQ ID NO: 37), and a variable heavy (Vy) chain comprising a CDRHI sequence of DYGVS (SEQ ID NO: 38), a CDRH2 sequence of VIWGSETTYYNSALKS (SEQ ID NO: 39), and a CDRH3 sequence of YAMDYWG (SEQ ID NO: 40). In some of any of the provided embodiments, the scFv comprises a V1. comprising a CDRLI sequence of FMC63, a CDRL2 sequence of FMC63, a CDRL3 sequence of FMC63, and a VH comprising a CDRH sequence of FMC63, a CDRH2 sequence of FMC63, and a CDRH3 sequence of FMC63. In some of any of the provided embodiments, the scFv comprises a Vy set forth in SEQ ID NO:41 and a Vy set forth in SEQ ID NO: 42. In some of any of the provided embodiments, the Vy and V1 are separated by a flexible linker. In some of any of the provided embodiments, the flexible linker is or comprises the sequence set forth in SEQ ID NO:24. In some of any of the provided embodiments, the scFv is or comprises the sequence set forth in SEQ ID NO:43.
[0074] In some of any of the provided embodiments, the T cells are primary T cells obtained from a subject. In some of any of the provide embodiments, the T cells are autologous to the subject.
[0075] In some of any of the provided embodiments, prior to administering the composition, the subject is or has been identified as having cells expressing CD19. In some of any of the provided embodiments, the expression of CD19 is detected by flow cytometry in the peripheral blood or bone marrow, and / or by immunohistochemistry of a bone marrow biopsy. In some of any embodiments, the expression of CD19 is detected by flow cytometry, optionally in the peripheral blood or bone marrow, and / or by immunohistochemistry, optionally of a bone marrow biopsy.
[0076] In some of any embodiments, the subject has not received prior cell therapy that comprises administration of a T cell composition comprising T cells expressing a CAR. In some of any embodiments, the subject has received a prior cell therapy that comprises administration of a T cell composition comprising T cells expressing a CAR. In some of any embodiments, the subject has received a prior therapy targeting CD19, optionally wherein the subject is or has been identified as having cells expressing CD19 or having a CD19-positive disease after completion of the prior therapy targeting CD19.
[0077] In some of any embodiments, at least at or about 35%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T cells, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CCR7, CD27, CD45RA and / or CD28.In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CCR7. In some of any embodiments, at least at or about 35%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o or more of the CAR-expressing T cells, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CCR7 and CD45RA.
[0078] In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CD27. In some of any embodiments, at least at or about 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o or more of the CAR-expressing T cells, CAR-expressing CD4+ T cells or CAR- expressing CD8+ T cells in the composition, are surface positive for CD27 and CD28. In some of any embodiments, at least at or about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T cells, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are negative for active Caspase 3.
[0079] Also provided herein is an article of manufacture comprising a composition of a cell therapy, or one of a plurality of compositions of a cell therapy, comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), and instructions for administering the cell therapy, wherein the instructions specify administering the T cell composition according to any of the provided methods. Detailed Description
[0080] Among the provided embodiments are methods and uses, such as therapeutic methods or uses, that involve administration of engineered cells (e.g., T cells) and / or compositions thereof, for the treatment of subjects having a disease or condition, which generally is or includes a B cell malignancy or a hematological malignancy. In some embodiments, the B cell malignancy is a B-cell acute lymphoblastic leukemia (B-ALL) or a B-cell non-Hodgkin lymphoma (B-NHL). In some embodiments, the engineered cells express a recombinant receptor, such as a chimeric antigen receptor (CAR), that can target, bind and / or recognize an antigen that is associated with the B cell malignancy. In some aspects, the subjects include subjects who are at or younger than 25 years of age, such as pediatric subjects or young adult subjects. In some aspects, the methods involve determining the amount, number or dose of engineered cells for administration for treatment in a particular group of subjects, such as subjects who are at or younger than 25 years of age, such as pediatric subjects or young adult subjects. In some embodiments, the subjects are pediatric subjects. In some embodiments, the subjects are young adults. Also provided are compositions for use in cell therapy, for example, in accordance with the methods and uses described herein. Also provided are articles of manufacture and kits, e.g., for use in the methods or uses provided herein. In some embodiments, the articles of manufacture and kits optionally contain instructions for using, according to the methods or uses provided herein.
[0081] Adoptive cell therapies (including those involving the administration of cells expressing chimeric receptors such as chimeric antigen receptors (CARs) and / or other recombinant antigen receptors, specific for a disease or disorder of interest, as well as other adoptive immune cell and adoptive T cell therapies) can be effective in the treatment of hematological malignancies or B cell malignancies, and other diseases and disorders, such as other cancers. In certain contexts, available approaches to adoptive cell therapy may not always be entirely satisfactory. In some contexts, optimal response to therapy can depend on the ability of the administered cells to recognize and bind to a target, e.g., target antigen, to traffic, localize to and successfully enter appropriate sites within the subject, tumors, and environments thereof, to become activated, expand, to exert various effector functions, including cytotoxic killing and secretion of various factors such as cytokines, to persist, including long- term, to differentiate, transition or engage in reprogramming into certain phenotypic states, to provide effective and robust recall responses following clearance and re-exposure to target ligand or antigen, and avoid or reduce exhaustion, anergy, terminal differentiation and / or differentiation into a suppressive state.
[0082] In some aspects, the therapeutic effect of adoptive cell therapy may be limited by risk and / or the development of toxicity in the subject to whom such cells are administered, which toxicity in some cases can be severe, at certain doses or exposure of administered cells. In some cases, while a higher dose of such cells can increase the therapeutic effect, for example, by increasing exposure to the cells such as by promoting expansion and / or persistence, they may also result in an even greater risk of developing a toxicity or a more severe toxicity. Also, in some cases, subjects with a higher disease burden also may be at a greater risk for developing a toxicity or a more severe toxicity. Further, among factors that may increase the risk, relative risk and / or probability of developing a toxicity following administration of a dose of cells of a cell therapy (e.g. CAR-T cell therapy), include the number of cells administered to a subject due to weight-based dosing of cells, e.g. more cells administered to subjects with a greater weight. Certain available methods for dosing subjects cell therapy may not always be entirely satisfactory. Increasing a dose of cells or promoting expansion or proliferation of administered cells in the subject can be related to higher response rates, but also an increase in development of toxicity.
[0083] In some aspects, particular group of subjects, such as pediatric subjects or young adult subjects, can exhibit differences in response to the adoptive cell therapy and / or development of toxicity after administration, due to the differences in body size, volume of circulation and / or activity or function of the administered cells. In some aspects, determining appropriate doses for particular group of subjects, where the dose results in a high or specified desired degree of likelihood of a treatment outcome such as a favorable outcome or response and / or a durable response or outcome, and also a relatively low or minimized or desired degree of likelihood of risk of developing a toxic outcome or toxicity following administration to the subject of the cell therapy, can be difficult. Provided are methods and uses that can achieve such results.
[0084] Thus, in some embodiments, the provided methods, uses, articles of manufacture and / or compositions, can offer advantages over other available methods or solutions or approaches for treatment such as for adoptive cell therapy. In particular, among the provided embodiments are those that include methods of administering a T cell therapy containing T cells (CD4 and / or CD8 T cells) expressing a CAR, such as an anti-CD19 CAR, to subjects at or younger than 25 years of age, such as pediatric subjects or young adult subjects, with a B cell malignancy, such as a B-ALL or a B-NHL. The provided methods and uses permit dosing of cells that can achieve or can be associated with an increased likelihood of response, and a decreased likelihood of risk for developing a toxicity.
[0085] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. if a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.
[0086] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. 1. METHODS AND USES IN CELL THERAPY WITH GENETICALLY ENGINEERED T CELLS
[0087] Provided are methods and uses, such as therapeutic methods and uses, involving administration of engineered cells (e.g., T cells) and / or compositions thereof, for the treatment of subjects having a disease or condition, which generally is or includes a B cell malignancy or a hematologic malignancy. In some aspects, the B cell malignancy is a B-cell acute lymphoblastic leukemia (B-ALL) or a B-cell non-Hodgkin lymphoma (B-NHL). In some aspects, the methods and uses are for treatment of a particular group of subjects, such as subjects who are at or younger than 25 years of age and / or pediatric subjects or young adult subjects.
[0088] In some embodiments, the methods and uses include administering to the subject cells expressing genetically engineered (recombinant) cell surface receptors in adoptive cell therapy, which generally include chimeric receptors such as chimeric antigen receptors (CARs), binding or recognizing an antigen expressed by, associated with and / or specific to the B cell malignancy, such as B-ALL or B- NHL, and / or cell type from which it is derived. The cells are generally administered in a composition formulated for administration. In some embodiments, engineered cells or compositions comprising the engineered cells are administered to a subject having the B cell malignancy, e.g., via adoptive cell therapy, such as adoptive T cell therapy. In some embodiments, the methods involve treating a subject having a B cell malignancy with a dose of antigen receptor-expressing cells (e.g. CAR-expressing cells).
[0089] In some embodiments, the methods involve administering a particular amount, such as one or more doses of the cells to the subject, which amount or dose(s) may include a particular number or relative number of cells or of the engineered cells, and / or a defined ratio or compositions of two or more sub-types within the composition, such as CD4 vs.CD8 T cells, or a particular number or relative number of cells per body weight of the subject (e.g., per kilogram (kg) body weight). In some aspects, if the subject exceeds a certain maximum body weight, a particular number or relative number of cells are administered. In some embodiments, the methods involve administering an amount or dose to a subject depending on the age and / or body weight of the subject.
[0090] In some embodiments, the provided methods and uses involve treating a specific group or subset of subjects, e.g., subjects that are of a particular age, such as subjects who are at or younger than 25 years of age. In some embodiments, the provided methods and uses involve treating subjects that are of a particular age, such as subjects who are younger than 18 years of age. In some embodiments, the provided methods and uses involve treating pediatric subjects or young adult subjects.
[0091] In some embodiments, the methods, uses and articles of manufacture involve, or are used for treatment of subjects involving, selecting or identifying a particular group or subset of subjects, e.g., based on age, specific types of disease, diagnostic criteria, prior treatments and / or response to prior treatments. In some embodiments, the methods involve treating a subject having relapsed following remission after treatment with, or become refractory to, one or more prior therapies; or a subject that has relapsed or is refractory (R / R) to one or more prior therapies, e.g., one or more lines of standard therapy. In some embodiments, the provided methods and uses involve treating a specific group or subset of subjects, such as pediatric subjects and / or young adult subjects identified as having a B cell malignancy that has R / R to standard therapy. In some embodiments, the subjects can have a high-risk disease, such as a B cell malignancy that is aggressive and / or has a poor prognosis or that has R / R to standard therapy. In some embodiments, the methods involve treating subjects having a R / R B-ALL, a R / R B-NHL, or a B- ALL that exhibits minimum residual disease (MRD+ B-ALL). In some aspects, the NHL can include a diffuse large B-cell lymphoma (DLBCL), a Burkitt's lymphoma (BL) or a primary mediastinal B-cell lymphoma (PMBCL). In some embodiments, the subject has a R / R DLBCL, a R / R BL or a R / R PMBCL.
[0092] In some embodiments, the antigen receptor (e.g. CAR) specifically binds to a target antigen associated with the disease, disorder or condition, such as those associated with a B cell malignancy, such as B-ALL or B-NHL. In some embodiments, the antigen associated with the disease or disorder is CD19, CD20, CD22, ROR1, CD45, CD21, CDS, CD33, Igkappa, Iglambda, CD7%a, CD79b or CD30. In some embodiments, the antigen associated with the disease or disorder is selected from CD19.
[0093] In some aspects, provided are compositions, methods and uses for administration of a defined composition of the cell therapy, at particular doses, that are associated with a high response rate and / or high durability of response, and low levels and / or incidence of toxicity. In some embodiments, the composition or dose administered, for some subjects, in a body weight-based dose, such as a particular amount or number of cells per kilogram (kg) body weight of the subject. In some embodiments, the composition or dose administered, for some subjects, in a flat and / or fixed dose, such as a precise flat dose, of cells and / or of one or more cells having a particular phenotype, such as a particular number of such cells or a number that is within a particular range and / or degree of variability or variance as compared to a target number.
[0094] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, such as a B-ALL or a B-NHL, including a malignancy thereof that is relapsed and / or refractory, the method comprising administering, to a subject at or younger than 25 years of age, or in some cases younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR). Such methods and uses include therapeutic methods and uses, for example, involving administration of the anti-CD19 CAR-expressing T cell compositions in an effective amount to effect treatment of the disease or disorder. Uses include uses of such anti-CD19 CAR-expressing T cells or compositions containing such cells, in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods. Also provided are compositions, such as pharmaceutical compositions, for example containing such anti-CD19 CAR- expressing T cells, in accordance with the methods provided herein. In some embodiments, the methods and uses thereby treat the disease or condition or disorder in the subject.
[0095] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (1) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
[0096] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, from at or about 0.5 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells to at or about 1.5 x 10% CAR+ T cells.
[0097] In some embodiments, the provided methods and uses involve, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0098] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.5 x 108 CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some embodiments, if the subject is less than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1 x 10° CAR+ T cells / kg body weight of the subject. In some embodiments, if the subject is at or greater than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.5 x 10® CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0099] In some of any embodiments, if the subject is less than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1 x 10° CAR+ T cells / kg body weight of the subject.
[0100] In some embodiments, provided are methods of treating a subjecting having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 106 CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 108 total CAR+ T cells; or (ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.5 x 10% CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
[0101] In some embodiments, if the subject is younger than 18 years of age the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 108 total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 10° total CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells to at or about 1.0 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 1.0 x 10% CAR+ T cells.
[0102] In some of the provided methods or uses, the subject is at least at or about 6 kg in body weight. In some of the provided methods or uses, the subject is at least at or about 12 kg in body weight. In some of the provided methods or uses, the subject less than at or about 100 kg in body weight.
[0103] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.5 x 106 CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.5 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
[0104] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age and weighing 6 kg or more, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from (i) if the subject is younger than 18 years of age at or about 1 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 1 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 108 CAR+ T cells.
[0105] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject younger than 18 years of age and weighing 12 kg or more, a composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells. In some embodiments, the composition is administered in an amount from at or about 0.5 x 10% CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 108 total CAR+ T cells. In some embodiments, the composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells.
[0106] In some embodiments, the methods involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age from at or about 0.05 x 10° CAR+ T cells’kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 108 total CAR+ T cells; or (ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 102 CAR+ T cells.
[0107] In some of the provided methods or uses, a total volume of at least 0.05 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered. In some of the provided methods or uses, a total volume of at least 0.5 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered.
[0108] In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 108 total CAR+ T cells.
[0109] In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.75 x 10° total CAR+ T cells. In some of any embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 10% total CAR+ T cells.
[0110] In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells to at or about 1.0 x 10% CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.15 x 10® CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.3 x 10% CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.75 x 10% CAR+ T cells. In some of any embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 1.0 x 10® CAR+ T cells.
[0111] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 106 cells / mL, wherein the T cell composition is administered in an amount selected from (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.5 x 10° total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 108 CAR+ T cells.
[0112] In some embodiments, provided are methods of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 1 x 10° total CAR+ T cells in a volume of at least 0.5 mL; and (i) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 108 CAR+ T cells.
[0113] In some of any embodiments, the total volume of the T cell composition administered is at least 0.05 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.1 mL. In some of the provided embodiments, the total volume of the T cell composition administered is at least 1.0 mL. In some of the provided embodiments, the concentration of the T cell composition is greater than at or about 5 x 10° cells / mL or is or is about 5 x 10° cells / mL In some of the provided embodiments, the concentration of the T cell composition is greater than at or about 10 x 10° cells / mL or is or is about 10 x 10° cells / mL. In some of the provided embodiments, the concentration of the T cell composition is greater than or greater than about 15 x 10 cells / mL or is or is about 15 x 10° cells / mL.
[0114] In some embodiments, the composition or dose administered contains a defined ratio of CD4* and CD8* cells (e.g., 1:1 ratio of CD4*:CD8* CAR* T cells) and / or contains a ratio that is within a certain degree of variability from such ratio, such as no more than + 10%, such as no more than + 8%, such as a degree of variability or variance of no more than + 10%, such as no more than + 8%. In some embodiments, the CD4* and CD8" cells are individually formulated and administered. In some embodiments, the administered cells exhibit consistent activity and / or function, e.g., cytokine production, apoptosis and / or expansion. In some embodiments, the provided compositions exhibit highly consistent and defined activity, and low variability between cells, e.g., in terms of cell number, cell function and / or cell activity, in the composition or between preparations. In some embodiments, the consistency in activity and / or function, e.g., low variability between preparations of compositions, allows improved efficacy and / or safety. In some embodiments, administration of the defined compositions resulted in low product variability and low toxicity, e.g., CRS or neurotoxicity, compared to administration of cell compositions with high heterogeneity. In some embodiments, the defined, consistent composition also exhibits consistent cell expansion. Such consistency can facilitate the identification of dose, therapeutic window, evaluation of dose response and identification of factors of the subject that may correlate with safety or toxicity outcomes.
[0115] In some embodiments, in a certain cohort of subjects receiving a single infusion of a particular dose level, a durable response rate after 6 months of greater than 60% can be achieved. In some embodiments, the subjects in some cohorts can achieve an overall response rate (ORR, in some cases also known as objective response rate) of more than 80%, a complete response (CR) rate of more than 60% and / or a high durable CR rate at 6 months. In some embodiments, subjects receiving a defined dose show improved safety outcomes, .g., more than two-thirds of the subjects that do not exhibit any CRS or NT. In some aspects, the rate of severe CRS or severe NT is low. In some embodiments, a higher exposure (e.g., Cmax and AUCo.2s) observed with a particular defined dose, does not associate with increased toxicity, e.g., CRS or NT. In some embodiments, particular factors of the subject, e.g., certain biomarkers, can be used to predict the risk of toxicity. In some embodiments, the provided embodiments can be used to achieve high response rate with low risk of toxicity.
[0116] In some embodiments, no more than 25%, no more than 20%, no more than 15%, no more than 10% or no more than 5% of subjects treated using the provided compositions, articles of manufacture, kits, methods and uses are administered an agent (e.g. tocilizumab and / or dexamethasone) to ameliorate, treat or prevent a toxicity, either prior to or subsequent to administration of the cell therapy. In some embodiments, the subject is not administered any prophylaxis treatment prior to receiving the engineered cells (e.g. CAR-T cells).
[0117] In some embodiments, the methods, cells and compositions can provide high rate of durable response to subjects across a range of patient characteristics and / or tumor burden. In some embodiments, the methods, cells and compositions can provide high rate of durable response to high risk patients with poor prognosis, with a reduced risk of adverse effects or toxicities. In some embodiments, the methods and uses provide for or achieve a higher response rate and / or more durable responses or efficacy and / or a reduced risk of toxicity or other side effects that can be associated with cell therapy, such as neurotoxicity (NT) or cytokine release syndrome (CRS). In some aspects, the provided observations indicated a low rate of severe NT (sNT) or severe CRS (sCRS), and a high rate of patients without any toxicities, e.g., NT or CRS. A. Method of Treatment
[0118] The methods provided herein are methods of treatment that involve administering engineered cells or compositions containing engineered cells, such as engineered T cells. Also provided are methods and uses, such as therapeutic and prophylactic uses, of engineered cells (e.g., T cells) and / or compositions thereof, including methods or uses for the treatment of subjects having a disease, disorder or condition, such as a B cell malignancy or hematological malignancy, that involves administration of the engineered cells and / or compositions thereof. Such methods and uses include therapeutic methods and uses, for example, involving administration of engineered cells, or compositions containing the same, to a subject having a B cell malignancy or hematological malignancy, such as B-cell acute lymphoblastic leukemia (B-ALL) or a B-cell non-Hodgkin lymphoma (B-NHL). In some embodiments, the molecule, cell, and / or composition is / are administered in an effective amount to effect treatment of the disease, disorder or condition.
[0119] In some aspects, the provided methods involve administering engineered cells or compositions containing engineered cells, such as engineered T cells, to a subject, such as a subject that has a hematological malignancy or a B cell malignancy. In some aspects, also provided are uses of engineered cells or compositions containing engineered cells, such as engineered T cells for treatment of a B cell malignancy or hematological malignancy, in some aspects, in accord with any of the methods described herein. In some aspects, also provided are uses of engineered cells or compositions containing engineered cells, such as engineered T cells for the manufacture of a medicament for the treatment of a B cell malignancy, for example, in order to carry out such therapeutic methods. In some aspects, also provided are methods of administering engineered cells or compositions containing engineered cells, such as engineered T cells, for use in treatment of a B cell malignancy, or for administration to a subject having a B cell malignancy. In some embodiments, the methods are carried out by administering the engineered cells or compositions comprising the same, to the subject having, having had, or suspected of having a B cell malignancy. In some embodiments, the methods thereby treat the B cell malignancy in the subject. Also provided herein are of use of any of the compositions, such as pharmaceutical compositions provided herein, for the treatment of a B cell malignancy, such as use in a treatment regimen.
[0120] In some embodiments, the provided methods and uses can achieve improved response and / or more durable responses or efficacy and / or a reduced risk of toxicity or other side effects, e.g., in particular groups of subjects treated, as compared to certain alternative methods.
[0121] General methods for administration of cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, adoptive T cell therapy methods are described, e.g., in US Patent App. Pub. No. 2003 / 0170238; US Patent No. 4,690,915; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85). See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338.
[0122] In some embodiments, the methods and uses involve treatment of subjects involving, selecting or identifying a particular group or subset of subjects, e.g., based on age, specific types of disease, diagnostic criteria, prior treatments and / or response to prior treatments.
[0123] In some embodiments, the B cell malignancy or hematological malignancy to be treated according to the methods and uses provided herein can be any in which expression of an antigen that is associated with and / or involved in the etiology of the B cell malignancy or hematological malignancy, e.g. causes, exacerbates or otherwise is involved in the B cell malignancy or hematological malignancy. In some aspects, the B cell malignancy is associated with transformation of cells (e.g. cancer). In particular embodiments, the recombinant receptor, e.g., CAR, specifically binds to an antigen associated with the B cell malignancy or hematological malignancy.
[0124] In some embodiments, the B cell malignancy or hematological malignancy is associated with a tumor, a cancer, a neoplasm, or other proliferative disease or disorder. In some aspects, such diseases include but are not limited to leukemia, lymphoma, e.g., acute myeloid (or myelogenous) leukemia (AML), chronic myeloid (or myelogenous) leukemia (CML), acute lymphocytic (or lymphoblastic) leukemia (ALL), chronic lymphocytic leukemia (CLL), hairy cell leukemia (HCL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphoma, Burkitt's lymphoma, Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), Anaplastic large cell lymphoma (ALCL), follicular lymphoma, refractory follicular lymphoma, diffuse large B-cell lymphoma (DLBCL) and multiple myeloma (MM). In some embodiments, disease or condition is a B cell malignancy selected from among acute lymphoblastic leukemia (ALL), adult ALL, chronic lymphoblastic leukemia (CLL), non-Hodgkin lymphoma (NHL), and Diffuse Large B-Cell Lymphoma (DLBCL). In some embodiments, the disease or condition is NHL and the NHL is selected from the group consisting of aggressive NHL, diffuse large B cell lymphoma (DLBCL), NOS (de novo or transformed from indolent), primary mediastinal large B cell lymphoma (PMBCL), T cell / histocyte-rich large B cell lymphoma (TCHRBCL), Burkitt's lymphoma (BL), mantle cell lymphoma (MCL), follicular lymphoma (FL), and / or follicular lymphoma Grade 3B (FL3B). Among the B cell malignancy are B-cell acute lymphoblastic leukemia (B-ALL) and a B-cell non-Hodgkin lymphoma (B-NHL). In some aspects, the NHL can include diffuse large B-cell lymphoma (DLBCL), Burkitt's lymphoma (BL) or primary mediastinal B-cell lymphoma (PMBCL).
[0125] In some embodiments, the B cell malignancy is an acute lymphoblastic leukemia (ALL), such as a B-cell acute lymphoblastic leukemia (B-ALL). In some aspects, ALL, an aggressive cancer of the blood and the bone marrow (BM), is classified by the World Health Organization (WHO) as a precursor lymphoid neoplasm of primarily the B-cell type, with only about 10% to 15% of cases involving T cells. In some aspects, precursor B-cell ALL (B-ALL), in some cases expressing CD79a, CD19, human leukocyte antigen — antigen D related (HLA-DR), and other B-cell antigens, accounts for 80% to 85% of childhood ALL and about 30% of all childhood cancers. ALL is the most prevalent cancer among children and adolescents in the United States (US), representing 20% of all cancers diagnosed in persons aged less than 20 years. In some aspects, the disease, disorder or condition can be referred to as lymphoblastic lymphoma (LBL) if the infiltration of bone marrow (BM) is below 25%, and if the BM involvement is above 25% the disease, disorder or condition can be referred to as a leukemia.
[0126] In some aspects, immunophenotyping (for example, by flow cytometry) and / or cytogenetics can be used to differentiate between B and T precursor ALL, and reveals the differentiation status of the malignant B-cells (for example, pro-B, common, pre-B, and mature B-cell). In some embodiments, the subject to be treated according to the methods and uses provided herein has ALL, and can be identified as having an immunophenotypic or a cytogenetic feature associated with different types of ALL, as described in described herein, for example, in Table 2. In some cases, the determination of disease type and differentiation status is essential for treatment selection. In some aspects, ALL is the most common form of precursor B-cell neoplasm and is characterized by the proliferation and accumulation of malignant, transformed, and immature hematopoietic cells (“blasts”) that accumulate in blood and in the bone marrow (see, e.g., Gokbuget et al., Blood. 2012 Aug 30;120(9):1868-76). In general, bone marrow analysis is required for the diagnosis of ALL. In some aspects, bone marrow analysis of children with ALL show that the majority of children with ALL exhibit a massive leukemic infiltration of more than 50% blast cells by light microscopy. In some cases, other lymphatic organs, such as lymph nodes and spleen, can also be affected, as well as non-lymphatic organs, notably the central nervous system (CNS). In some aspects, less than 10% of pediatric subjects have symptomatic CNS involvement, but the frequency is higher in subjects with mature B-ALL (Fader et al., Cancer. 2010 Mar 01;116(5):1165-76.). In general, risk factors for developing ALL include age, exposure to chemotherapy or radiation therapy, and genetic disorders, including Down's syndrome. In some aspects, the risk for developing ALL is highest in children younger than 5 years of age; the risk declines slowly until the mid-20s, and begins to rise again after the age of 50. In some cases, approximately 75% of patients with B-ALL have recurrent chromosomal translocations or somatic aneuploidy, some of which can be used for disease prognosis. In some aspects, approximately half of patients with childhood ALL have chromosomal translocations. In some cases, these chromosomal translocations are undetectable by conventional cytogenetic analysis, but detected using fluorescence in situ hybridization (FISH) or polymerase chain reaction (PCR). In general, the most common chromosomal translocation for ALL is the t(12;21) translocation, resulting in an ETV6-runt-related transcription factor 1 fusion that occurs in 20% to 25% of childhood National Cancer Institute (NCI) standard-risk B-ALL. In some cases, children with this genetic alteration can exhibit up to a> 95% overall survival (OS) rate.
[0127] In some aspects, multidrug chemotherapy is a treatment option for childhood ALL, and in some cases, is used as first-line therapy. In some aspects, first-line induction therapy, regardless of presenting features, includes vincristine, dexamethasone (or prednisone), asparaginase, and doxorubicin (in some cases referred to as the Berlin- Frankfurt-Miinster (BFM) regimen). In some cases, more than 95% of children receiving first-line therapy can achieve a complete response (CR) within the first 4 weeks of treatment, with a 5-year overall survival (OS) rate near 90% (Pui et al., J Clin Oncol. 2015 Sep 20;33(27):2938-48). In some cases, subjects presenting with central nervous system (CNS) disease, intrathecal triple therapy (administering methotrexate (MTX), cytarabine, and prednisolone) can be used during induction therapy together with intravenous (IV) high-dose MTX to reduce the risk of systemic relapse. In some cases, radiation therapy can be used in combination with intrathecal MTX in limited situations where there is a particularly high-risk of CNS relapse, but due to the risk of delayed neurocognitive impairment, radiation therapy is rarely used as a first-line therapy. In some aspects, once a subject achieves a complete response (CR), post-induction treatment can vary depending on risk group assignment. In general, all subjects receive an intensification therapy after CR and before beginning maintenance therapy. In some aspects, commonly used therapy includes cyclophosphamide, low-dose cytarabine, and a thiopurine. In some cases, maintenance therapy can include mercaptopurine, low-dose MTX, and in some cases, vincristine / steroid pulses. In some aspects, therapeutic regimen can depend on the risk category of the patient. Due to the risk of late toxicity, in some cases, exposure to anthracyclines and alkylating agents can be limited in children with standard-risk ALL. In some cases, anthracyclines and alkylating agents can be used if the subject presents minimal residual disease (MRD). In some aspects, for ALL, increased levels of MRD can be associated with worsening outcomes. In some cases, persistence of MRD at 12 weeks can be a very poor prognostic factor, with 5-year disease-free survival (DFS) of approximately 40% (Borowitz et al., Blood. 2015 Aug 20;126(8):964-71). In some cases, in subjects with intermediate risk BM relapse of ALL, low MRD after induction can be associated with good long-term prognosis with conventional chemo- / radiotherapy. In contrast, in some cases, subjects with insufficient response have an extremely poor prognosis. In some aspects, MRD levels after induction can be a strong independent prognostic factor for long-term outcome in children with intermediate risk BM relapse of ALL.
[0128] In some aspects, ALL can be further classified based on the World Health Organization classification of acute lymphoblastic leukemia. In some aspects, the classification can be based on genetic, immunophenotype, molecular, and morphological features found through cytogenetic and molecular diagnostics tests. (see, €.g., Arber et al., Blood. 127(20): 2391-2405; Mrozek et al., Hematol Oncol Clin North Am. 2009 October; 23(5): 991-v). In some aspects, the classification of B-cell lymphoblastic leukemia / lymphoma include the following categories: with recurrent genetic abnormalities; with t(9;22)(q34.1;q11.2),BCR-ABL1; with t(v;11q23.3), KMT2A rearranged; with t(12;21)(p13.2;g22.1), ETV6-RUNX1; with t(5;14)(q31.1;q32.3),IL3-IGH; with t(1;19)(q23;p13.3),TCF3-PBX1; with hyperdiploidy; with hypodiploidy; and not otherwise specified (NOS). In some aspects, ALL can include T-lymphoblastic leukemia / lymphoma. In some aspects, ALL can include acute leukemias of ambiguous lineage, categorized as follows: Acute undifferentiated leukemia; Mixed phenotype acute leukemia (MPAL) with t(9;22)(q34.1;q11.2),BCR-ABL1; MPAL with t(v;11g23.3),KMT2A rearranged; MPAL, B / myeloid, NOS; and MPAL, T / myeloid, NOS.
[0129] In some aspects, B-ALL can be subdivided into the following based on phenotypes of the cells: early pre B-ALL (TdT+, CD19+, CD10-); common ALL (CD19+, CD10+ / CALLA+); pre B ALL (CD10+ / -, CD19+, HLA Dr+, cytoplasmic IgM+); and mature B ALL (CD10+, CD19+, CD20+, CD22+, surface IgM+).
[0130] In some aspects, ALL can be classified based on the French-American-British (FAB) system, as follows: ALL-L1 (T cell or pre-B cell; with small and homogeneous (uniform) cells); ALL-L2 (T cell or pre-B cell; with large and heterogeneous (varied) cells); and ALL-L3 (B cell; with large and varied cells with vacuoles). In some aspects, mature B-cell ALL can also be referred to as Burkitt leukemia.
[0131] In some aspects, the ALL is a Philadelphia chromosome positive (Ph+) subtype of ALL. This subtype is characterized, in part, by poor outcomes with treatments of standard chemotherapy. The Philadelphia chromosome is present in 3—4% of pediatric acute lymphoblastic leukemia (Ph* ALL), and about 25% of adult ALL cases. In certain embodiments, the Philadelphia chromosome is contains a translocation, t(9;22)(q34;ql 1), that results in a novel chimeric gene and protein which fuses the BCR gene on chromosome 22 with the gene encoding the Abelson tyrosine kinase (ABL1) on chromosome 9. The resulting BCR-ABLY1 fusion transcript and protein is a constitutively activated tyrosine kinase which activates various signaling pathways to promote leukemic transformation in hematopoietic stem cells. In some embodiments, subjects having the Ph+ subtype of ALL have one or more cells that have a Philadelphia chromosome, such as bone marrow cells. In some aspects, the ALL is a Philadelphia-like (Ph-like) subtype of ALL. In some embodiments, the Ph-like subtype is characterized by related gene expression signatures variously referred to as “cluster group R8,” “Philadelphia Chromosome (Ph)-like, “Ph-like,” “BCR-ABLI-like,” or an “activated tyrosine kinase gene expression signature.” These gene expression signatures have been shown to be highly similar to gene expression profiles measured in Ph+ ALL subjects, despite the fact that, in some aspects, Ph-like subjects to not have the Philadelphia chromosome translocation or the BCR-ABL1 fusion transcript. The prevalence of the Ph-like subtype is approximately 12% in children, 21% in adolescents (16-20 years of age), and 20% to 24% in adults older than 40 years, with a peak (27%) in young adults 21 to 39 years old. In some cases, it occurs more often in male individuals and patients with Down syndrome. Ph-like ALL is overrepresented in those with Hispanic ethnicity and is associated with inherited genetic variants in GATA3 (rs3824662). In some aspects, Ph-like ALL a clinically and biologically heterogeneous subtype of B-ALL.
[0132] In some aspects, non-Hodgkin lymphoma (NHL) is a heterogeneous group of lymphoproliferative malignancies with differing clinical courses and responses to treatment. In some cases, the WHO Lymphoma Classification scheme is used to define specific subtypes of lymphoma and subdivides them based on cell of origin (B, T or natural killer (NK)) and the differentiation status of the lymphocytes. In some aspects, eighty percent to 90% of NHL are of B-cell origin and express CD19. In some cases, the prognosis of NHL depends on the histologic type (indolent versus aggressive), stage, age, and treatment. In some embodiments, the NHL subtypes that occur in adult and pediatric populations show both similarities as well as differences. In some embodiments, childhood NHL displays an aggressive clinical course, while, in some embodiments, adult NHLs show both indolent and aggressive histological forms. In some embodiments, indolent subtypes of NHL that occur in adults include follicular lymphoma (FL), marginal zone lymphoma (MZL), and chronic lymphocytic leukemia (CLL). In some embodiments, aggressive B-cell subtypes include diffuse large B-cell lymphoma (DLBCL) and mantle cell lymphoma (MCL).
[0133] In some aspects, many of the NHL types, including FL, CLL, and MCL, that are relatively common in adults occur rarely, if at all, in children. In some cases, pediatric B-cell non-Hodgkin's lymphoma (B-NHL), comprised of 3 main histological subtypes, are classified as aggressive: Burkitt lymphoma (BL), DLBCL, and primary mediastinal large B-cell lymphoma (PMBCL), in descending order of overall incidence. In some embodiments, LBL cases are T cell lineage with the remainder having a pre-B or mature B-cell immunophenotyped.
[0134] In some aspects, the occurrence of NHL in infants is rare, and the incidence in adults increases with age. In some aspects, adolescents have a higher mortality rate compared to children. In some aspects, prevalent forms of pediatric B-NHL comprise about 60% of all childhood NHL. In some aspects, approximately 25% to 30% of children will relapse or experience refractory disease with cure rates less than 30% (Jourdain et al., Haematologica. 2015 Jun;100(6):810-7).
[0135] In some cases, for both aggressive and indolent subtypes, t / r pediatric B-NHL represents a treatment challenge. In some cases, prognosis after relapse remains relatively poor. In some embodiments, salvage treatment consists of high-dose chemotherapy followed by an intensification phase with either autologous or allogenic hematopoietic SCT (HSCT).
[0136] In some aspects, diffuse large B-cell lymphoma (DLBCL) accounts for 10% to 20% of B-cell lymphoma in children and occurs more frequently in adolescents. In some aspects, diffuse large B-cell lymphoma is a prevalent form of NHL in children and adolescents, occurring with greater frequency in adolescents, and comprising up to 37% of all NHL in the 15 to 19 year age range.
[0137] In some aspects, BL is the most common NHL in children of 14 years of age or less, comprising 30% to 40% of all NHL in North America and Europe. In some aspects, NHL can arise in the abdomen and / or head and neck region and presents as advanced-stage disease involving the bone marrow and / or CNS in approximately 20% to 25% of patients. In some aspects, the incidence of BL remains relatively constant throughout life, in contrast to other NHL subtypes including DLBCL, which can increase with age. In some aspects, BL has a distinct epidemiological pattern because of its association with Epstein-Barr virus (EBV) and malaria infections that are endemic in sub-Saharan Africa.
[0138] In some aspects, until recently, PMBCL was considered as a form of DLBCL, comprising 10% or fewer of all cases. In some cases, PMBCL is now recognized as a distinct entity in the WHO classification because, in some aspects, PMBCL has a distinct immunophenotype, gene expression profile, and clinical presentation compared to other histologies. In some aspects, the incidence of PMBCL peaks in the third or fourth decade of life and is more common in women.
[0139] In some embodiments, NHL can be staged based on the Lugano classification (see, e.g., Cheson et al., (2014) JCO 32(27):3059-3067; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5). In some cases, the stages are described by Roman numerals I through IV (1-4), and limited stage (I or I) lymphomas that affect an organ outside the lymph system (an extranodal organ) are indicated by an E. Stage I represents involvement in one node or a group of adjacent nodes, or a single extranodal lesions without nodal involvement (IE). Stage 2 represents involvement in two or more nodal groups on the same side of the diaphragm or stage I or II by nodal extent with limited contiguous extranodal involvement (IIE). Stage III represents involvement in nodes on both sides of the diaphragm or nodes above the diaphragm with spleen involvement. Stage IV represents involvement in additional non- contiguous extralymphatic involvement. In addition, “bulky disease” can be used to describe large tumors in the chest, in particular for stage II. The extent of disease is determined by positron emission tomography (PET)—computed tomography (CT) for avid lymphomas, and CT for non-avid histologies.
[0140] In some embodiments, the subject to be treated according to the methods and uses provided herein has NHL, and has or has been identified as having an immunophenotypic or a cytogenetic feature as described in described herein, for example, in Table 2. In some embodiments, the subject to be treated according to the methods and uses provided herein has NHL, and has or has been identified as having as having a double / triple hit lymphoma or a lymphoma of the double / triple hit molecular subtypes. In some embodiments, the lymphoma is a double hit lymphoma characterized by the presence of MYC (myelocytomatosis oncogene), BCL2 (B-cell lymphoma 2), and / or BCL6 (B-cell lymphoma 6) gene rearrangements (e.g., translocations). In some embodiments, the gene rearrangement affects the MYC / 8q24 locus in combination with another gene rearrangement. For example, the other gene rearrangement includes t(14;18)(q32;q21) involving BCL2. In some embodiments, the gene rearrangements affect the MYC / 8q24 locus in combination with BCL6 / 3q27. In some embodiments, the lymphoma is a triple hit lymphoma characterized by the presence of MYC, BCL2, and BCL6 gene rearrangements; see, e.g., Aukema et al., (2011) Blood 117:2319-2331. In some aspects of such embodiments the subject is ECOG 0-1 or does not have or is not suspected or characterized as having DLBCL transformed from MZL or CLL. In aspects, the therapy is indicated for such subjects and / or the instructions indicate administration to a subject within such population. In some embodiments, based on the 2016 WHO criteria (Swerdlow et al., (2016) Blood 127(20):2375-2390), double / triple hit lymphoma can be considered high-grade B-cell lymphoma, with MYC and BCL2 and / or BCL6 rearrangements with DLBCL histology (double / triple hit).
[0141] In some embodiments, the type of B cell malignancy or hematological malignancy can be identified by assessing and / or analyzing the chromosomal structures for abnormalities, e.g., based on the cytogenetic features described herein, for example, in Table 2. For example, in some embodiments, the chromosomes are analyzed by karyotyping, e.g., a G-banding technique. G-banding produces an individual's karyotype, whereby Giemsa stain is used to produce a series of dark and light bands, with each chromosome displaying a unique banding pattern under light microscope. Each chromosome can be further distinguished by the position of its centromere (metacentric, submetacentric, acrocentric), dividing it into a shorter arm, the p (petite) arm and a longer arm, called the q arm. Chromosomes are then arranged with pairs side by side to detect abnormalities including deletions, duplications, or other structural rearrangements. This technique is relatively inexpensive and is a good first-line test for anomalies, but a limitation of this technique is the inability to detect small deletions or rearrangements.
[0142] In some embodiments, other techniques that can be used to determine the types of B cell malignancy or hematological malignancy include fluorescent in situ hybridization (FISH) and multicolor FISH which uses a fluorescently-labeled probes to detect the presence or absence of a particular chromosome segment or gene. FISH and multicolor FISH can detect small deletions, duplications and / or subtle chromosomal rearrangements. FISH and multicolor FISH analysis can be performed on the same specimens obtained for chromosome analysis. In some embodiments, the type of B cell malignancy is identified and / or detected by FISH and / or multicolor FISH.
[0143] In some embodiments, the methods involve treating a subject having relapsed following remission after treatment with, or become refractory to, one or more prior therapies; or a subject that has relapsed or is refractory (R / R) to one or more prior therapies, e.g., one or more lines of standard therapy. In some embodiments, the provided methods and uses involve treating a specific group or subset of subjects, such as pediatric subjects identified as having a B cell malignancy that has R / R to standard therapy. In some embodiments, the subjects can have a high-risk disease, such as a B cell malignancy that is aggressive and / or has a poor prognosis or that has R / R to standard therapy. In some embodiments, the methods involve treating subjects having a R / R B-ALL, a R / R B-NHL, or a B-ALL that exhibits minimum residual disease (MRD+ B-ALL). In some embodiments, the subject has a R / R DLBCL, a R / R BL or a R / R PMBCL.
[0144] In some embodiments, the provided methods and uses involve treating a specific group or subset of subjects, e.g., subjects that are of a particular age, such as subjects who are at or younger than 25 years of age. In some embodiments, the subject is at or younger than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16 or 15 of age. In some embodiments, the provided methods and uses involve treating subjects that are of a particular age, such as subjects who are at or younger than 25 years of age. In some embodiments, the provided methods and uses involve treating subjects that are of a particular age, such as subjects who are younger than 18 years of age. In some embodiments, the provided methods and uses involve treating pediatric subjects or young adult subjects.
[0145] In some embodiments, the provided methods and uses involve administering CAR- expressing cells to a subject that is at or greater than at or about 6 kg in body weight. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a subject that is at or greater than at or about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 kg in body weight. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a subject that is at or greater than at or about 12 kg in body weight. In some embodiments, the subject is less than at or about 100 kg in weight.
[0146] In some embodiments, the subject is younger than 18 years of age, and is at or greater than at or about 12 kg in body weight. In some embodiments, the subject is younger than 18 years of age, and is at or greater than at or about 6 kg in body weight. In some embodiments, the subject is 25 years of age or younger, and is at or greater than at or about 12 kg in body weight. In some embodiments, the subject is 25 years of age or younger, and is at or greater than at or about 6 kg in body weight.
[0147] In some embodiments, prior to administering the cells or composition, the subject is or has been identified as having cells expressing the antigen targeted by the recombinant receptor (e.g., CD19). In some embodiments, the subject or a biological sample from the subject exhibits evidence of CD19 expression or contains CD19-expressing cells, as determined via flow cytometry (e.g., from peripheral blood or bone marrow samples) or immunohistochemistry (e.g., bone marrow biopsy). In some embodiments, the expression of the antigen (e.g., CD19) is detected by flow cytometry in the peripheral blood or bone marrow, and / or by immunohistochemistry of a bone marrow biopsy.
[0148] In some embodiments, prior to administering the cells or composition, the subject is or has been identified as having a Karnofsky score of 50 or higher if the subject is 16 years of age or older, or a Lansky score of 50 or higher if the subject is less than 16 years of age.
[0149] In some embodiments, the methods include administration of cells to a subject selected or identified as having a certain prognosis or risk of an ALL or an NHL. In some cases, subjects with an ALL or an NHL may be classified into groups that may inform disease prognosis and / or recommended treatment strategy. In some cases, these groups may be “low risk,” “intermediate risk,” “high risk,” and / or “very high risk” and patients may be classified as such depending on a number of factors including, but not limited to, genetic abnormalities and / or morphological or physical characteristics. In some embodiments, subjects treated in accord with the methods, and / or with the articles of manufacture or compositions, are classified or identified based on the risk of an ALL or an NHL. In some embodiments, the subject is one that has a high risk ALL or a high risk NHL.
[0150] In some embodiments, the subject has been previously treated with a therapy or a therapeutic agent targeting the disease or condition, e.g., an ALL or an NHL, prior to administration of the cells expressing the recombinant receptor. In some embodiments, the subject has been previously treated with a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT or autologous HSCT. In some embodiments, the subject has had poor prognosis after treatment with standard therapy and / or has failed one or more lines of previous therapy. In some embodiments, the subject has been treated or has previously received at least or about at least or about 1, 2, 3, or 4 other therapies for treating the ALL or NHL other than a lymphodepleting therapy and / or the dose of cells expressing the antigen receptor. In some embodiments, the subject has been previously treated with chemotherapy or radiation therapy. In some aspects, the subject is refractory or non-responsive to the other therapy or therapeutic agent. In some embodiments, the subject has persistent or relapsed disease, €.g., following treatment with another therapy or therapeutic intervention, including chemotherapy or radiation.
[0151] In some embodiments, the subject is one that is eligible for a transplant, such as is eligible for a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. In some such embodiments, the subject has not previously received a transplant, despite being eligible, prior to administration of the engineered cells (e.g. CAR-T cells) or a composition containing the cells to the subject as provided herein.
[0152] In some embodiments, the subject is one that is not eligible for a transplant, such as is not eligible for a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. In some embodiments, such a subject is administered the engineered cells (e.g. CAR-T cells) or a composition containing the cells according to the provided embodiments herein.
[0153] In some embodiments, prior to administering the cells or composition, the subject has a relapsed and / or refractory (R / R) B-ALL. In some embodiments, the subject has a R / R B-ALL, which can be characterized as morphological evidence of disease in the bone marrow, e.g., 5% or greater lymphoblast by morphology, and any of the following: (a) first or greater marrow relapse, or (b) any marrow relapse after an allogeneic hematopoietic stem cell transplantation (HSCT), or (c) primary refractory defined as not achieving a complete response (CR) or a complete response with incomplete blood count recovery (CRi) after 2 or more separate induction regimens (or chemo-refractory as not achieving CR / CRI after 1 cycle of standard chemotherapy for relapsed leukemia), or (d) ineligible for allogeneic HSCT.
[0154] In some embodiments, prior to administering the cells or composition, the subject has minimal residual disease positive (MRD+) B-ALL. In some embodiments, the subject has MRD+ B- ALL, which can be characterized as having less than 5% lymphoblasts by morphology, and / or MRD can be detected by a validated assay at a frequency of 1 x10 or greater in BM cells after two lines of therapy.
[0155] In some embodiments, prior to administering the cells or composition, the subject has a B- NHL. In some embodiments, the subject has a B-NHL, which can be characterized as having measurable disease after 1 or more lines of chemotherapy and / or having failed HSCT or being ineligible for HSCT.
[0156] In some embodiments, prior to administering the cells or composition, the subject has a Philadelphia chromosome positive ALL, that is intolerant to or have failed one or more lines of tyrosine- kinase inhibitor (TKI) therapy, or TKI therapy has been contraindicated.
[0157] In some embodiments, prior to administering the cells or composition, the subject is shown to have adequate organ function, such as adequate bone marrow function, adequate kidney function, adequate pulmonary function and / or adequate cardiac function. In some aspects, adequate bone marrow function can be characterized as adequate bone marrow function to receive lymphodepleting therapy. In some aspects, adequate kidney function can be characterized as creatinine clearance calculated using the Schwartz formula, or radioisotope glomerular filtration rate (GFR) > 70 mL / min / 1.73 m2. In some aspects, adequate pulmonary function can be characterized as < Grade 1 dyspnea according to Common Toxicity Criteria for Adverse Events (CTCAE) and oxygen saturation (Sa02) > 92% on room air. In some aspects, adequate cardiac function can be characterized as left ventricular ejection fraction (LVEF) > 40% as assessed by echocardiogram (ECHO) or multi-gated acquisition scan (MUGA) within 4 weeks prior to leukapheresis.
[0158] In some embodiments, prior to administering the cells or composition, the subject is shown to have adequate vascular access for leukapheresis procedure.
[0159] In some embodiments, prior to and during the treatment regimen with cells or composition, the subject uses effective contraception.
[0160] In some cases, certain subjects are ineligible for treatment or are excluded from treatment according to the provided methods and uses. In some aspects, subjects that are not eligible or are excluded from treatment according to the provided methods and uses, can include the presence of any, some or all of the following: subject has any significant medical condition, laboratory abnormality, or psychiatric illness that would prevent the subject from receiving the treatment regimen; subject has any condition including the presence of laboratory abnormalities that can places the subject at an unacceptable risk if treated according to the methods and uses; subject has any condition that confounds the ability to interpret the results from the treatment; subject with a history of another primary malignancy that has not been in remission for at least 2 years prior to administration of the cells; subjects who have received prior therapies targeting the same antigen targeted by the recombinant receptor expressed by the cell (e.g., CD19), if shown to not express the antigen (e.g., CD19) or exhibits a CD19- negative disease after completing the prior therapy; subjects that have received a prior therapy that includes CAR T cell or other genetically-modified T cell therapy; subject with a previous history of or active hepatitis B, hepatitis C, or human immunodeficiency virus (HIV) infection; subjects with uncontrolled systemic fungal, bacterial, viral or other infection (including tuberculosis) despite appropriate antibiotics or other treatment at the time of leukapheresis or engineered cell administration; subject has presence of acute or chronic graft-versus-host disease (GVHD); subject with active autoimmune disease requiring immunosuppressive therapy; subject has cardiac disorders (CTCAE version 4.03 Grade 3 or 4) within the 6 months prior to leukapheresis or engineered cell administration; subject with a concomitant genetic syndrome, with the exception of Down's syndrome; subject with an active central nervous system (CNS) disease and significant neurological deterioration (subjects with CNS-2 or CNS-3 involvement can be eligible or can receive administration if they are asymptomatic and do not have significant neurological deterioration); subject with a history or presence of clinically relevant CNS pathology; subject that is pregnant or nursing.
[0161] In some aspects, subjects who have received one or more of the following treatments or therapies may be ineligible for or are excluded from treatment according to the provided methods or uses: therapeutic doses of corticosteroids (defined as > 20 mg / day prednisone or equivalent) within 7 days prior to leukapheresis or 72 hours prior to engineered cell administration (with the exception of physiologic replacement, topical, and inhaled steroids); low-dose chemotherapy (e.g., vincristine, rituximab, cyclophosphamide < 300 mg / m?) given after leukapheresis to maintain disease control must be discontinued > 7 days prior to lymphodepletion; cytotoxic chemotherapeutic agents that are not considered lymphotoxic within 1 week prior to leukapheresis (with the exception of oral anticancer agents, including lenalidomide and ibrutinib, if at least 3 half-lives have elapsed prior to leukapheresis); lymphotoxic chemotherapeutic agents (e.g., cyclophosphamide, ifosfamide, bendamustine) within 2 weeks prior to leukapheresis; experimental agents within 4 weeks prior to leukapheresis unless no response or PD is documented on the experimental therapy and at least 3 half-lives have elapsed prior to leukapheresis; immunosuppressive therapies within 4 weeks prior to leukapheresis and engineered cell administration (e.g., calcineurin inhibitors, methotrexate or other chemotherapeutics, mycophenolate, rapamycin, thalidomide, immunosuppressive antibodies such as antitumor necrosis factor (TNF), anti-IL- 6, or anti-IL-6R); donor lymphocyte infusions (DLI) within 6 weeks prior to engineered cell administration; radiation within 6 weeks prior to leukapheresis (subjects must have progressing disease (PD) in irradiated lesions or have additional non-irradiated lesions to be eligible to receive engineered cell administration, and radiation to a single lesion, if additional non-irradiated, measurable lesions are present, can be allowed up to 2 weeks prior to leukapheresis); or an allogeneic HSCT within 90 days prior to leukapheresis.
[0162] In some embodiments, the Eastern Cooperative Oncology Group (ECOG) performance status indicator can be used to assess or select subjects for treatment, e.g., subjects who have had poor performance from prior therapies (see, e.g., Oken et al. (1982) Am J Clin Oncol. 5:649-655). The ECOG Scale of Performance Status describes a patient's level of functioning in terms of their ability to care for themselves, daily activity, and physical ability (e.g., walking, working, etc.). In some embodiments, an ECOG performance status of 0 indicates that a subject can perform normal activity. In some aspects, subjects with an ECOG performance status of 1 exhibit some restriction in physical activity but the subject is fully ambulatory. In some aspects, patients with an ECOG performance status of 2 is more than 50% ambulatory. In some cases, the subject with an ECOG performance status of 2 may also be capable of self-care; see e.g., Sgrensen et al., (1993) Br J Cancer 67(4) 773-775. The criteria reflective of the ECOG performance status are described in Table 1 below: Table 1. ECOG Performance Status Criteria Grade ECOG performance status 0 Fully active, able to carry on all 1 1 Restricted in physically strenuous fa En [4 ECOG performance status Fully active, able to carry on all pre-disease performance without restriction Restricted in physically strenuous activity but ambulatory and able to carry out work of a light or sedentary nature, e.g., light house work, office work Ambulatory and capable of all self-care but unable to carry out any work activities; up and about more than 50% of waking hours Capable of only limited self-care; confined to bed or chair more than 50% of waking hours Completely disabled; cannot carry on any self-care; totally confined to bed or chair Dead 5
[0163] In some embodiments, the methods involve treating a subject that has an Eastern Cooperative Oncology Group Performance Status (ECOG) of 0-1 or 0-2. In some embodiments, the methods treat a poor-prognosis population or of DLBCL patients or subject thereof that generally responds poorly to therapies or particular reference therapies, such as one having one or more, such as two or three, chromosomal translocations (such as so-called “double-hit” or “triple-hit” lymphoma; having translocations MYC / 8q24 loci, usually in combination with the t(14; 18) (q32; q21) bcl-2 gene or / and BCL6 / 3q27 chromosomal translocation; see, e.g., Xu et al. (2013) Int J Clin Exp Pathol. 6(4): 788-794), and / or one having relapsed, optionally relapsed within 12 months, following administration of an autologous stem cell transplant (ASCT), and / or one having been deemed chemorefractory.
[0164] In some embodiments, the engineered cells or compositions containing such cells used in the methods and uses provided herein contain recombinant receptors that target an antigen associated with a B cell malignancy or a hematological malignancy. In some embodiments, antigens targeted by the receptors in some embodiments include antigens associated with a B cell malignancy, such as any of a number of known B cell marker. In some embodiments, the antigen is or includes CD19, CD20, CD22, ROR1, CD45, CD21, CD35, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
[0165] In some embodiments, the cell therapy, e.g., adoptive T cell therapy, is carried out by autologous transfer, in which the cells are isolated and / or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.
[0166] In some embodiments, the cell therapy, e.g., adoptive T cell therapy, is carried out by allogeneic transfer, in which the cells are isolated and / or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject. In such embodiments, the cells then are administered to a different subject, e.g., a second subject, of the same species. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.
[0167] The cells can be administered by any suitable means, for example, by bolus infusion, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus administration of the cells. In some embodiments, it is administered by multiple bolus administrations of the cells, for example, over a period of no more than 3 days, or by continuous infusion administration of the cells. In some embodiments, administration of the cell dose or any additional therapies, e.g., the lymphodepleting therapy, intervention therapy and / or combination therapy, is carried out via outpatient delivery.
[0168] For the prevention or treatment of disease, the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the cells, and the discretion of the attending physician. The compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments.
[0169] In some embodiments, the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another or additional therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. The cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order. In some embodiments, the additional therapeutic agent is any interventions or agents described herein, such as any combination therapy agents described in Section IV, or such as any interventions or agents that can ameliorate symptoms of toxicity described herein, for example, in Section LD. In some contexts, the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents include a cytokine, such as IL-2, for example, to enhance persistence. In some embodiments, the methods comprise administration of a chemotherapeutic agent.
[0170] In some embodiments, the methods comprise administration of a chemotherapeutic agent, e.g., a conditioning chemotherapeutic agent, for example, to reduce tumor burden prior to the administration.
[0171] Preconditioning subjects with immunodepleting (e.g., lymphodepleting) therapies in some aspects can improve the effects of adoptive cell therapy (ACT).
[0172] Thus, in some embodiments, the methods include administering a preconditioning agent, such as a lymphodepleting or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or combinations thereof, to a subject prior to the initiation of the cell therapy. For example, the subject may be administered a preconditioning agent at least 2 days prior, such as at least 3, 4, 5, 6, or 7 days prior, to the initiation of the cell therapy. In some embodiments, the subject is administered a preconditioning agent no more than 7 days prior, such as no more than 6, 5, 4, 3, or 2 days prior, to the initiation of the cell therapy.
[0173] In some embodiments, the subject is preconditioned with cyclophosphamide at a dose between or between about 20 mg / kg and 100 mg / kg body weight of the subject, such as between or between about 40 mg / kg and 80 mg / kg. In some aspects, the subject is administered about 60 mg / kg of cyclophosphamide. In some embodiments, the cyclophosphamide is administered once daily for one or two days. In some embodiments, where the lymphodepleting agent comprises cyclophosphamide, the subject is administered cyclophosphamide at a dose between or between about 100 mg / m? and 500 mg / m? body surface area of the subject, such as between or between about 200 mg / m? and 400 mg / m? or 250 mg / m? and 350 mg / m?, inclusive. In some instances, the subject is administered about 100 mg / m? of cyclophosphamide. In some instances, the subject is administered about 150 mg / m? of cyclophosphamide. In some instances, the subject is administered about 200 mg / m? of cyclophosphamide. In some instances, the subject is administered about 250 mg / m? of cyclophosphamide. In some instances, the subject is administered about 300 mg / m? of cyclophosphamide. In some embodiments, the cyclophosphamide can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, cyclophosphamide is administered daily, such as for 1-5 days, for example, for 3 to 5 days. In some instances, the subject is administered about 300 mg / m? body surface area of the subject, of cyclophosphamide, daily for 3 days, prior to initiation of the cell therapy. In some embodiments, the subject is administered a total of at or about 300 mg / m?, 400 mg / m?, 500 mg / m?, 600 mg / m?, 700 mg / m?, 800 mg / m?, 900 mg / m?, 1000 mg / m?, 1200 mg / m?, 1500 mg / m?, 1800 mg / m?, 2000 mg / m?, 2500 mg / m? 2700 mg / m?, 3000 mg / m?, 3300 mg / m?, 3600 mg / m?, 4000 mg / m? or 5000 mg / m? cyclophosphamide, or a range defined by any of the foregoing, prior to initiation of the cell therapy.
[0174] In some embodiments, where the lymphodepleting agent comprises fludarabine, the subject is administered fludarabine at a dose between or between about 1 mg / m? and 100 mg / m? body surface area of the subject, such as between or between about 10 mg / m? and 75 mg / m?, 15 mg / m? and 50 mg / m? 20 mg / m? and 40 mg / m?, or 24 mg / m? and 35 mg / m’, inclusive. In some instances, the subject is administered about 10 mg / m? of fludarabine. In some instances, the subject is administered about 15 mg / m? of fludarabine. In some instances, the subject is administered about 20 mg / m? of fludarabine. In some instances, the subject is administered about 25 mg / m? of fludarabine. In some instances, the subject is administered about 30 mg / m? of fludarabine. In some embodiments, the fludarabine can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, fludarabine is administered daily, such as for 1-5 days, for example, for 2 to 4 days. In some instances, the subject is administered about 30 mg / m? body surface area of the subject, of fludarabine, daily for 3 days, prior to initiation of the cell therapy. In some embodiments, the subject is administered a total of at or about 10 mg / m?, 20 mg / m?, 25 mg / m?, 30 mg / m? 40 mg / m>, 50 mg / m?, 60 mg / m?, 70 mg / m? 80 mg / m? 90 mg / m? 100 mg / m? 120 mg / m? 150 mg / m? 180 mg / m?, 200 mg / m?, 250 mg / m?, 270 mg / m? 300 mg / m?, 330 mg / m?, 360 mg / m?, 400 mg / m? or 500 mg / m? cyclophosphamide, or a range defined by any of the foregoing, prior to initiation of the cell therapy.
[0175] In some embodiments, the lymphodepleting agent comprises a single agent, such as cyclophosphamide or fludarabine. In some embodiments, the subject is administered cyclophosphamide only, without fludarabine or other lymphodepleting agents. In some embodiments, prior to the administration, the subject has received a lymphodepleting therapy comprising the administration of cyclophosphamide at or about 200-400 mg / m? body surface area of the subject, optionally at or about 300 mg / m? daily, for 2-4 days. In some embodiments, the subject is administered fludarabine only, for example, without cyclophosphamide or other lymphodepleting agents. In some embodiments, prior to the administration, the subject has received a lymphodepleting therapy comprising the administration of fludarabine at or about 20-40 mg / m? body surface area of the subject, optionally at or about 30 mg / m?, daily, for 2-4 days.
[0176] In some embodiments, the lymphodepleting agent comprises a combination of agents, such as a combination of cyclophosphamide and fludarabine. Thus, the combination of agents may include cyclophosphamide at any dose or administration schedule, such as those described above, and fludarabine at any dose or administration schedule, such as those described above. For example, in some aspects, the subject is administered 60 mg / kg (~2 g / m?) of cyclophosphamide and 3 to 5 doses of 25 mg / m? fludarabine prior to the first or subsequent dose. In some the subject is administered fludarabine (30 mg / m?*day for 3 days) and cyclophosphamide (300 mg / m?day for 3 days) (flu / cy) concurrently, intravenously, prior to administration of the cells.
[0177] Following administration of the cells, the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods. Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry. In certain embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable known methods, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004). In certain embodiments, the biological activity of the cells is measured by assaying expression and / or secretion of one or more cytokines, such as CD107a, IFNy, IL-2, and TNF. In some aspects the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
[0178] In certain embodiments, the engineered cells are further modified in any number of ways, such that their therapeutic or prophylactic efficacy is increased. For example, the engineered recombinant receptor expressed by the population can be conjugated either directly or indirectly through a linker to a targeting moiety. The practice of conjugating compounds, e.g., the CAR, to targeting moieties is known. See, for instance, Wadwa et al., J. Drug Targeting 3: 1 1 1 (1995), and U.S. Patent 5,087,616. In some embodiments, the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. The cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agent includes a cytokine, such as IL-2, for example, to enhance persistence. B. Dosing
[0179] In some embodiments, the provided methods and uses involve administering all or a portion of a composition containing cells, such as engineered T cells expressing a recombinant receptor, such as a chimeric antigen receptor (CAR). In some aspects, a particular amount or number of cells, or a particular amount of the composition containing the particular amount or number of cells, is administered to a subject. In some aspects, one or more doses of cells, containing a particular amount or number of cells or a particular amount of the composition containing the particular amount or number of cells, is administered to a subject. In some embodiments, a dose of cells is administered to subjects in accord with the provided methods, and / or with the provided articles of manufacture or compositions. In some embodiments, the size, amount or timing of the doses is determined as a function the age of the subject. In some embodiments, the size, amount or timing of the doses is determined as a function the body weight of the subject. In some embodiments, the size, amount or timing of the doses is determined as a function of the particular type of B cell malignancy or hematological malignancy in the subject.
[0180] In some embodiments, the amount or number of cells in the dose is determined as a function of the age of the subject. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a subject at or younger than 25 years of age. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a subject that is younger than 18 years of age. In some embodiments, the provided methods and uses involve administering CAR- expressing cells to a pediatric subject. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a young adult subject.
[0181] In some embodiments, the amount or number of cells that are administered in the methods and uses described herein is with reference to the amount or number of recombinant receptor-expressing cells, chimeric antigen receptor (CAR)-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs). In some embodiments, the amount or number of cells that are administered in the methods and uses described herein is with reference to the amount or number of CD3+ T cells, CD4+ T cells, CD8+ T cells, and in some cases also recombinant receptor-expressing or CAR-expressing T cells.
[0182] In some embodiments, the amount or number of cells in the dose is determined as a function of the body weight of the subject. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a subject that is less than 100 kilograms (kg) in body weight. In some embodiments, the provided methods and uses involve administering CAR-expressing cells to a subject that is at or greater than 100 kg in body weight. In some aspects, based on the body weight of the subject, the subject is administered a dose that is calculated depending on the body weight (e.g., cells’kg body weight of the subject) or a flat or fixed dose.
[0183] In some embodiments, the methods involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 10 CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 10% CAR+ T cells.
[0184] In some embodiments, if the subject is less than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1 x 106 CAR+ T cells / kg body weight of the subject.
[0185] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.05 x 10% CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
[0186] In some embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
[0187] In some embodiments, if the subject is less than 100 kilograms (kg) in body weight the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1 x 10° CAR+ T cells / kg body weight of the subject. In some embodiments, if the subject is at or greater than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 1 x 102 CAR+ T cells.
[0188] In some embodiments, the provided embodiments involve comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells; or ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.05 x 10% CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
[0189] In some embodiments, if the subject is younger than 18 years of age the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.0 x 108 total CAR+ T cells.
[0190] In some embodiments, subjects younger than 18 years of age, are administered a dose that is determined based on the body weight of the subject, but up to a maximum amount or maximum number of cells, or a cap amount or a cap number of cells. In some embodiments, the maximum or cap number or amount of cells in a dose can be a fixed number or amount. In some embodiments, the subject is younger than 18 years of age, and is administered a dose of cells, such as CAR-expressing cells, per kilogram body weight of the subject (cells / kg), up to a maximum number of cells. In some embodiments, the subject is younger than 18 years of age, and is administered from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but an amount that does not exceed at or about 1.5 x 10° total CAR+ T cells. In some embodiments, the subject is younger than 18 years of age, and is administered from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject, but an amount that does not exceed at or about 1.0 x 108 total CAR+ T cells. In some embodiments, the subject is younger than 18 years of age, and is administered at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but an amount that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some embodiments, the subject is younger than 18 years of age, and is administered at least at or about that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but an amount that does not exceed at or about 1.0 x 108 total CAR+ T cells.
[0191] In some embodiments, the subject is younger than 18 years of age and is less than 100 kilograms (kg) in body weight, the subject is administered from at or about 0.5 x 10% CAR+ T cells / kg body weight of the subject to at or about 1.5 x 105 CAR+ T cells’kg body weight of the subject. In some embodiments, the subject is younger than 18 years of age and is less than 100 kilograms (kg) in body weight, the subject is administered at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject. In some embodiments, the subject is younger than 18 years of age and is less than 100 kilograms (kg) in body weight, the subject is administered at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject.
[0192] In some embodiments, for subjects that are administered a body weight-based dose of cells, the dose of cells, such as CAR-expressing cells, comprises between at or about 2 x 10° cells per kg body weight of the subject (cells / kg) and at or about 2 x 10° cells / kg body weight of the subject, such as between at or about 4 x 10° cells / kg body weight of the subject and at or about 1 x 10° cells / kg body weight of the subject or between at or about 6 x 10° cells / kg body weight of the subject and at or about 8 x 10° cells / kg body weight of the subject. In some embodiments, the dose of cells comprises no more than 2 x 10° cells per kilogram body weight of the subject (cells / kg), such as no more than at or about 3 x 10° cells / kg, no more than at or about 4 x 10° cells / kg, no more than at or about 5 x 10° cells / kg, no more than at or about 6 x 10° cells / kg, no more than at or about 7 x 10° cells / kg, no more than at or about 8 x 10° cells / kg, no more than at or about 9 x 10° cells / kg, no more than at or about 1 x 10° cells / kg, or no more than at or about 2 x 10° cells / kg. In some embodiments, the dose of cells comprises at least or at least about or at or about 2 x 10° cells per kilogram body weight of the subject (cells / kg), such as at least or at least about or at or about 3 x 10° cells / kg, at least or at least about or at or about 4 x 10° cells / kg, at least or at least about or at or about 5 x 10% cells / kg, at least or at least about or at or about 6 x 10° cells / kg, at least or at least about or at or about 7 x 10° cells / kg, at least or at least about or at or about 8 x 10° cells / kg, at least or at least about or at or about 9 x 10° cells / kg, at least or at least about or at or about 1x 108 cells / kg, or at least or at least about or at or about 2 x 10° cells / kg.
[0193] In some embodiments, the subject is younger than 18 years of age and is at or greater than 100 kilograms (kg) in body weight, the subject is administered from at or about 0.5 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some embodiments, the subject is younger than 18 years of age and is at or greater than 100 kilograms (kg) in body weight, the subject is administered from at or about 0.5 x 10° CAR+ T cells to at or about 1.0 x 10° CAR+ T cells. In some embodiments, the subject is younger than 18 years of age and is at or greater than 100 kilograms (kg) in body weight, the subject is administered at or about 0.5 x 108 CAR+ T cells. In some embodiments, the subject is younger than 18 years of age and is at or greater than 100 kilograms (kg) in body weight, the subject is administered at or about 1.0 x 10 CAR+ T cells.
[0194] In some of any embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.05 x 108 CAR+ T cells.
[0195] In some of any embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.15 x 108 CAR+ T cells.
[0196] In some of any embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.3 x 10° CAR+ T cells.
[0197] In some of any embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.5 x 108 CAR+ T cells.
[0198] In some of any embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.75 x 108 CAR+ T cells.
[0199] In some of any embodiments, the provided methods and uses involve administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti- CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 1.0 x 10® CAR+ T cells.
[0200] In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.05 x 10% CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 10° total CAR+ T cells. In some of such embodiments, after administration of at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 10° total CAR+ T cells, the subject does not exhibit a response or an adverse event, e.g., toxicity such as CRS or NT, at or around day 28 after the initial administration, the subject receives another lymphodepleting therapy and the dose is escalated to at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.1 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.1 x 10° CAR+ T cells’kg body weight of the subject but that does not exceed at or about 0.1 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.75 x 10° total CAR+ T cells. In some embodiments, if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 10° total CAR+ T cells.
[0201] In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 1.0 x 10% CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.15 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.3 x 108 CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 0.75 x 10° CAR+ T cells. In some embodiments, if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount that is at or about 1.0 x 10° CAR+ T cells.
[0202] In some embodiments, provided are methods and uses that involve administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.05 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.05 x 10% CAR+ T cells.
[0203] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.15 x 108 total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.15 x 10% CAR+ T cells.
[0204] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.3 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.3 x 10° CAR+ T cells.
[0205] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.5 x 10% CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.5 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
[0206] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.75 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.75 x 10% CAR+ T cells.
[0207] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 1 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 1 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1 x 108 CAR+ T cells.
[0208] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age and weighing 6 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age at or about 1 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 1 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 10° CAR+ T cells.
[0209] In some embodiments, the provided methods and uses involve administering, to a subject younger than 18 years of age and weighing 12 kg or more, a composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells.
[0210] In some embodiments, subjects younger than 18 years of age, are administered a dose that is determined based on particular volume of the composition, but up to a maximum or cap amount or number of cells. In some embodiments, the subject is younger than 18 years of age, and is administered a dose of cells, such as CAR-expressing cells, that contains a minimum volume of a composition containing the cells at a particular concentration, up to a maximum number of cells. In some embodiments, the minimum volume of cells to be administered is at least at or about 0.05 mL. In some embodiments, the minimum volume of cells to be administered is at least at or about 0.1 mL. In some embodiments, the minimum volume of cells to be administered is at least at or about 0.5 mL. In some embodiments, the minimum volume of cells to be administered is at least at or about 0.75 mL. In some embodiments, the minimum volume of cells to be administered is at least at or about 1.0 mL.
[0211] In some embodiments, the composition is administered at or about 0.05 mL in volume. In some embodiments, the composition is administered at or about 0.1 mL in volume. In some embodiments, the composition is administered at or about 0.5 mL in volume. In some embodiments, the composition is administered at or about 0.75 mL in volume. In some embodiments, the composition is administered at or about 1.0 mL in volume.
[0212] In some embodiments, two separate compositions of cells are administered, such as a composition comprising CD4+ CAR+ T cells and a composition comprising CD8+ CAR+ T cells, and each composition is administered with a minimum volume of at least at or about 0.5 mL, or at least at or about 1.0 mL.
[0213] In some embodiments, a total volume of at least 0.05 mL at a concentration of at or greater than 2.5 x 106 cells / mL of the T cell composition is administered. In some embodiments, a total volume of at least 0.5 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered.
[0214] In some embodiments, the methods involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 0.25 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount from at or about 0.05 x 10% CAR+ T cells to at or about 1.5 x 108 CAR+ T cell in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 108 CAR+ T cell.
[0215] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.5 x 10% total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
[0216] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.05 x 10° total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.05 x 102 CAR+ T cells.
[0217] In some embodiments, the provided methods and uses involve administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10 cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 1 x 108 total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 10° CAR+ T cells.
[0218] In some of any embodiments, the total volume of the T cell composition administered is at least 0.05 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.1 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.15 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.3 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.5 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 0.75 mL. In some of any embodiments, the total volume of the T cell composition administered is at least 1.0 mL.
[0219] In some of any embodiments, the concentration of the T cell composition is greater than at or about 0.5 x 10° cells / mL or is or is about 0.5 x 10° cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than at or about 1 x 10° cells / mL or is or is about 1 x 106 cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than at or about 1.5 x 106 cells / mL or is or is about 1.5 x 10° cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than at or about 3 x 10° cells / mL or is or is about 3 x 10° cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than at or about 5 x 10° cells / mL or is or is about 5 x 106 cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than at or about 7.5 x 10° cells / mL or is or is about 7.5 x 108 cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than at or about 10 x 10° cells / mL or is or is about 10 x 10° cells / mL. In some of any embodiments, the concentration of the T cell composition is greater than or greater than about 15 x 10° cells / mL or is or is about 15 x 10° cells / mL.
[0220] In some embodiments, the compositions are formulated at particular concentration of cells. In some embodiments, the concentration of cells in the composition is between about 10 x 10° cells / mL and about 70 x 10° cells / mL, between about 10 x 10¢ cells / mL and about 50 x 10° cells / mL, between about 10 x 10° cells / mL and about 25 x 10° cells / mL, between about 10 x 10° cells / mL and about 15 x 106 cells / mL, 15 x 10° cells / mL and about 70 x 10° cells / mL, between about 15 x 10° cells / mL and about 50 x 10° cells / mL, between about 15 x 10° cells / mL and about 25 x 10° cells / mL, between about 25 x 10° cells / mL and about 70 x 10° cells / mL, between about 25 x 10° cells / mL and about 50 x 10° cells / mL, and between about 50 x 10° cells / mL and about 70 x 10° cells / mL. In some embodiments, the concentration of the T cell composition is greater than at or about 5 x 10° cells / mL or is or is about 5 x 10° cells / mL. In some embodiments, the concentration of the T cell composition is greater than at or about 10 x 10° cells / mL or is or is about 10 x 10° cells / mL. In some embodiments, the concentration of the T cell composition is greater than or greater than about 15 x 10° cells / mL or is or is about 15 x 10° cells / mL. In some embodiments, a minimum volume of at least at or about 0.5 mL or at least at or about 1.0 mL of any of such compositions can be administered.
[0221] In some embodiments, subjects between 18 and 25 years of age, inclusive, are administered a dose that is a flat dose of cells or fixed dose of cells such that the dose of cells is not tied to or based on the body surface area or weight of a subject. In some embodiments, the subject is between 18 and 25 years of age, inclusive, and is administered from at or about 0.5 x 10® CAR+ T cells to at or about 1.5 x 10° CAR+ T cells. In some embodiments, the subject is between 18 and 25 years of age, inclusive, and is administered from at or about 0.5 x 10° CAR+ T cells to at or about 1.0 x 10° CAR+ T cells. In some embodiments, the subject is between 18 and 25 years of age, inclusive, and is administered at or about 0.5 x 10° CAR+ T cells. In some embodiments, the subject is between 18 and 25 years of age, inclusive, and is administered at or about at or about 1.0 x 108 CAR+ T cells.
[0222] In some embodiments, the maximum {or cap) amount or number of cells to be administered is an amount or number that is equivalent to a body weight-based dose for a subject with a particular body weight, such as between at or about 50 kg to at or about 150 kg. In some embodiments, the maximum (or cap) amount or number of cells to be administered is an amount or number that is equivalent to a body weight-based dose for a subject that has a body weight of 100 kg. In some embodiments, the maximum (or cap) amount or number of cells to be administered is an amount or number that is equivalent to a body weight-based dose for a subject that has a body weight of 150 kg. In some embodiments, the body weight-based dose is from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; or is from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; or is at or about 0.05 x 10° CAR+ T cells’ / kg body weight of the subject; or is at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject. In some embodiments, the body weight-based dose is from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; or is from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; or is at or about 0.5 x 10° CAR+ T cells / ’kg body weight of the subject; or is at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject.
[0223] In some embodiments, the flat or fixed amount or number of cells to be administered to a subject, for example, a subject that is between 18 and 25 years of age, inclusive, is an amount or number that is equivalent to a body weight-based dose for a subject with a particular body weight, such as between at or about 50 kg to at or about 150 kg. In some embodiments, the flat or fixed amount or number of cells to be administered to a subject, for example, a subject that is between 18 and 25 years of age, inclusive, is an amount or number that is equivalent to a body weight-based dose for a subject that has a body weight of 100 kg. In some embodiments, the flat or fixed amount or number of cells to be administered to a subject, for example, a subject that is between 18 and 25 years of age, inclusive, is an amount or number that is equivalent to a body weight-based dose for a subject that has a body weight of 150 kg. In some embodiments, the body weight-based dose is from at or about 0.05 x 106 CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; or is from at or about 0.05 x 106 CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; or is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject; or is at or about 1.5 x 106 CAR+ T cells / kg body weight of the subject. In some embodiments, the body weight-based dose is from at or about 0.5 x 10° CAR+ T cells / ’kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; or is from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; or is at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject; or is at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject.
[0224] In some embodiments, for subjects that are administered a flat or fixed number amount of cells, the dose of cells, such that the dose of cells is not tied to or based on the body surface area or weight of a subject. In some embodiments, for the subjects that are administered a flat or fixed dose of cells, the dose comprises a range of about one million to about 100 billion cells and / or that amount of cells per kilogram of body weight, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells) or any value in between these ranges. In some embodiments, the amount or number of cells described herein is with reference to the amount or number of recombinant receptor-expressing cells, chimeric antigen receptor (CAR)-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), or the amount or number of CD3+ T cells, CD4+ T cells, CD8+ T cells, and in some cases also recombinant receptor-expressing or CAR-expressing T cells.
[0225] In some embodiments, the flat or fixed dose of cells comprises from or from about 1 x 10° to 5x 10° total CAR+ T cells, 1 x 10° to 2.5 x 10° total CAR+ T cells, 1 x 10% to 1 x 10° total CAR+ T cells, 1x 10° to 5 x 107 total CAR+ T cells, 1 x 10° to 2.5 x 10 total CAR+ T cells, 1 x 10° to 1 x 10” total CAR+ T cells, 1x 10° to 5 x 10° total CAR+ T cells, 1 x 10° to 2.5 x 10° total CAR+ T cells, 1 x 10°to 1 x 106 total CAR+ T cells, 1 x 10° to 5 x 10° total CAR+ T cells, 1 x 10 to 2.5 x 10° total CAR+ T cells, 1 x 10% to 1 x 108 total CAR+ T cells, 1 x 10° to 5 x 107 total CAR+ T cells, 1 x 108 to 2.5 x 107 total CAR+ T cells, 1 x 10°to 1 x 107 total CAR+ T cells, 1 x 10° to 5 x 10° total CAR+ T cells, 1 x 10° to 2.5 x 10¢ total CAR+ T cells, 2.5 x 10% to 5 x 108 total CAR+ T cells, 2.5 x 10° to 2.5 x 108 total CAR+ T cells, 2.5 x 10% to 1 x 108 total CAR+ T cells, 2.5 x 105to 5 x 107 total CAR+ T cells, 2.5 x 10° to 2.5 x 107 total CAR+ T cells, 2.5 x 106 to 1 x 107 total CAR+ T cells, 2.5 x 10° to 5 x 10° total CAR+ T cells, 5 x 10¢ to 5x 108 total CAR+ T cells, 5 x 10° to 2.5 x 108 total CAR+ T cells, 5 x 106 to 1 x 10° total CAR+ T cells, 5x 10%to 5x 107 total CAR+ T cells, 5 x 10° to 2.5 x 107 total CAR+ T cells, 5 x 10% to 1 x 107 total CAR+ T cells, 1 x 107 to 5 x 10% total CAR+ T cells, 1 x 107 to 2.5 x 10% total CAR+ T cells, 1 x 107 to 1 x 108 total CAR+ T cells, 1 x 107 to 5 x 107 total CAR+ T cells, 1 x 107 to 2.5 x 10 total CAR+ T cells, 2.5x 107 to 5 x 10° total CAR+ T cells, 2.5 x 107 to 2.5 x 10° total CAR+ T cells, 2.5 x 107 to 1 x 10% total CAR+ T cells, 2.5 x 10” to 5 x 107 total CAR+ T cells, 5 x 10” to 5 x 10° total CAR+ T cells, 5 x 107 to 2.5 x 10% total CAR+ T cells, 5 x 107 to 1 x 10° total CAR+ T cells, 1 x 10° to 5 x 10° total CAR+ T cells, 1.5 x 108 to 2.5 x 108 total CAR+ T cells, or 2.5 x 10% to 5 x 108 total CAR+ T cells.
[0226] In some embodiments, the dose of genetically engineered cells comprises at least or at least about 1 x 10° CAR+ T cells, at least or at least about 2.5 x 10° CAR+ T cells, at least or at least about 5 x 10° CAR+ T cells, at least or at least about 1 x 105 CAR+ T cells, at least or at least about 2.5 x 10° CAR+ T cells, at least or at least about 5 x 106 CAR+ T cells, at least or at least about 1 x 10’ CAR+ T cells, at least or at least about 2.5 x 107 CAR+ T cells, at least or at least about 5 x 10” CAR+ T cells, at least or at least about 1 x 108 CAR+ T cells, at least or at least about 2.5 x 108 CAR+ T cells, or at least or at least about 5 x 108 CAR+ T cells.
[0227] In some embodiments, the T cells of the dose include CD4* T cells, CD8* T cells or CD4* and CD&* T cells.
[0228] In some embodiments, for example, the CD8* T cells of the dose, including in a dose including CD4* and CD8* T cells, includes between about 1 x 10 and 5 x 108 total CAR+ CD8*cells, e.g., in the range of about 5 x 10° to 1 x 10° such cells, such cells 5x 10% 1x 107, 1.5 x 107, 3x 107, 2.5 x 107, 5x 107, 7.5 x 107, 1 x 108, 1.5 x 108, or 5 x 10° total such cells, or the range between any two of the foregoing values. In some embodiments, the subject is administered multiple doses, and each of the doses or the total dose can be within any of the foregoing values. In some embodiments, the dose of cells comprises the administration of from or from about 1 x 107 to 0.75 x 108 total CAR+ CD8* T cells, 1 x 107 to 2.5 x 107 total CAR+ CD8* T cells, from or from about 1 x 107 to 0.75 x 10° total CAR+ CD8* T cells, each inclusive. In some embodiments, the dose of cells comprises the administration of or about 5 x 10% 1x 107, 1.5 x 107, 3x 107, 2.5x 107, 5x 107, 7.5 x 107, 1 x 10%, 1.5 x 10%, or 5 x 10° total CAR+ CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 5 x 10” CAR+ T cells or at or about 2.5 x 107 CAR+ CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 1 x 108 CAR+ T cells or at or about 5 x 107 CAR+ CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 1.5 x 10° CAR+ T cells or at or about 0.75 x 10* CAR+ CD8* T cells.
[0229] In some embodiments, the dose of cells, e.g., recombinant receptor-expressing T cells, is administered to the subject as a single dose or is administered only one time within a period of two weeks, one month, three months, six months, 1 year or more.
[0230] In the context of adoptive cell therapy, administration of a given “dose” encompasses administration of the given amount or number of cells as a single composition and / or single uninterrupted administration, e.g., as a single injection or continuous infusion, and also encompasses administration of the given amount or number of cells as a split dose or as a plurality of compositions, provided in multiple individual compositions or infusions, over a specified period of time, such as over no more than 3 days. Thus, in some contexts, the dose is a single or continuous administration of the specified number of cells, given or initiated at a single point in time. In some contexts, however, the dose is administered in multiple injections or infusions over a period of no more than three days, such as once a day for three days or for two days or by multiple infusions over a single day period.
[0231] Thus, in some aspects, the cells of the dose are administered in a single pharmaceutical composition. In some embodiments, the cells of the dose are administered in a plurality of compositions, collectively containing the cells of the dose.
[0232] In some embodiments, the term “split dose” refers to a dose that is split so that it is administered over more than one day. This type of dosing is encompassed by the present methods and is considered to be a single dose.
[0233] Thus, the dose of cells may be administered as a split dose, e.g., a split dose administered over time. For example, in some embodiments, the dose may be administered to the subject over 2 days or over 3 days. Exemplary methods for split dosing include administering 25% of the dose on the first day and administering the remaining 75% of the dose on the second day. In other embodiments, 33% of the dose may be administered on the first day and the remaining 67% administered on the second day. In some aspects, 10% of the dose is administered on the first day, 30% of the dose is administered on the second day, and 60% of the dose is administered on the third day. In some embodiments, the split dose is not spread over more than 3 days.
[0234] In some embodiments, cells of the dose may be administered by administration of a plurality of compositions or solutions, such as a first and a second, optionally more, each containing some cells of the dose. In some aspects, the plurality of compositions, each containing a different population and / or sub-types of cells, are administered separately or independently, optionally within a certain period of time. For example, the populations or sub-types of cells can include CD8* and CD4* T cells, respectively, and / or CD8*- and CD4*-enriched populations, respectively, e.g., CD4* and / or CD8* T cells each individually including cells genetically engineered to express the recombinant receptor. In some embodiments, the administration of the dose comprises administration of a first composition comprising a dose of CD8"* T cells or a dose of CD4* T cells and administration of a second composition comprising the other of the dose of CD4* T cells and the CD8* T cells.
[0235] In some embodiments, the administration of the composition or dose, e.g., administration of the plurality of cell compositions, involves administration of the cell compositions separately. In some aspects, the separate administrations are carried out simultaneously, or sequentially, in any order. In some embodiments, the dose comprises a first composition and a second composition, and the first composition and second composition are administered 0 to 12 hours apart, 0 to 6 hours apart or 0 to 2 hours apart. In some embodiments, the initiation of administration of the first composition and the initiation of administration of the second composition are carried out no more than 2 hours, no more than 1 hour, or no more than 30 minutes apart, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart. In some embodiments, the initiation and / or completion of administration of the first composition and the completion and / or initiation of administration of the second composition are carried out no more than 2 hours, no more than 1 hour, or no more than 30 minutes apart, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart.
[0236] In some composition, the first composition, e.g., first composition of the dose, comprises CD4* T cells. In some composition, the first composition, e.g., first composition of the dose, comprises CD8* T cells. In some embodiments, the first composition is administered prior to the second composition.
[0237] In some embodiments, the dose or composition of cells includes a defined or target ratio of CD4* cells expressing a recombinant receptor to CD8* cells expressing a recombinant receptor and / or of CD4* cells to CD8* cells, which ratio optionally is approximately 1:1 or is between approximately 1:3 and approximately 3:1, such as approximately 1:1. In some aspects, the administration of a composition or dose with the target or desired ratio of different cell populations (such as CD4*:CD8* ratio or CAR*CD4*:CAR*CDS8* ratio, e.g., 1:1) involves the administration of a cell composition containing one of the populations and then administration of a separate cell composition comprising the other of the populations, where the administration is at or approximately at the target or desired ratio. In some aspects, administration of a dose or composition of cells at a defined ratio leads to improved expansion, persistence and / or antitumor activity of the T cell therapy.
[0238] In some embodiments, the subject receives multiple doses, e.g., two or more doses or multiple consecutive doses, of the cells. In some embodiments, two doses are administered to a subject. In some embodiments, the subject receives the consecutive dose, €.g., second dose, is administered approximately 4, 5, 6,7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 days after the first dose. In some embodiments, multiple consecutive doses are administered following the first dose, such that an additional dose or doses are administered following administration of the consecutive dose. In some aspects, the number of cells administered to the subject in the additional dose is the same as or similar to the first dose and / or consecutive dose. In some embodiments, the additional dose or doses are larger than prior doses.
[0239] In some aspects, the size of the first and / or consecutive dose is determined based on one or more criteria such as response of the subject to prior treatment, e.g. chemotherapy, disease burden in the subject, such as tumor load, bulk, size, or degree, extent, or type of metastasis, stage, and / or likelihood or incidence of the subject developing toxic outcomes, e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or a host immune response against the cells and / or recombinant receptors being administered.
[0240] In some aspects, the time between the administration of the first dose and the administration of the consecutive dose is about 9 to about 35 days, about 14 to about 28 days, or 15 to 27 days. In some embodiments, the administration of the consecutive dose is at a time point more than about 14 days after and less than about 28 days after the administration of the first dose. In some aspects, the time between the first and consecutive dose is about 21 days. In some embodiments, an additional dose or doses, e.g. consecutive doses, are administered following administration of the consecutive dose. In some aspects, the additional consecutive dose or doses are administered at least about 14 and less than about 28 days following administration of a prior dose. In some embodiments, the additional dose is administered less than about 14 days following the prior dose, for example, 4, 5, 6, 7, 8,9, 10, 11, 12, or 13 days after the prior dose. In some embodiments, no dose is administered less than about 14 days following the prior dose and / or no dose is administered more than about 28 days after the prior dose.
[0241] In some embodiments, the dose of cells, .g., recombinant receptor-expressing cells, comprises two doses (e.g., a double dose), comprising a first dose of the T cells and a consecutive dose of the T cells, wherein one or both of the first dose and the second dose comprises administration of the split dose of T cells.
[0242] In some embodiments, the dose of cells is generally large enough to be effective in reducing disease burden.
[0243] In some embodiments, the cells are administered at a desired dosage, which in some aspects includes a desired dose or number of cells or cell type(s) and / or a desired ratio of cell types. Thus, the dosage of cells in some embodiments is based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types, such as the CD4* to CD8* ratio. In some embodiments, the dosage of cells is based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types. In some embodiments, the dosage is based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations.
[0244] In some embodiments, the populations or sub-types of cells, such as CD8* and CD4* T cells, are administered at or within a tolerated difference of a desired dose of total cells, such as a desired dose of T cells. In some aspects, the desired dose is a desired number of cells or a desired number of cells per unit of body weight of the subject to whom the cells are administered, e.g., cells / kg. In some aspects, the desired dose is at or above a minimum number of cells or minimum number of cells per unit of body weight. In some aspects, among the total cells, administered at the desired dose, the individual populations or sub-types are present at or near a desired output ratio (such as CD4* to CD8" ratio), e.g., within a certain tolerated difference or error of such a ratio.
[0245] In some embodiments, the cells are administered at or within a tolerated difference of a desired dose of one or more of the individual populations or sub-types of cells, such as a desired dose of CD4* cells and / or a desired dose of CD8* cells. In some aspects, the desired dose is a desired number of cells of the sub-type or population, or a desired number of such cells per unit of body weight of the subject to whom the cells are administered, e.g., cells / kg. In some aspects, the desired dose is at or above a minimum number of cells of the population or sub-type, or minimum number of cells of the population or sub-type per unit of body weight.
[0246] Thus, in some embodiments, the dosage is based on a desired fixed dose of total cells and a desired ratio, and / or based on a desired fixed dose of one or more, e.g., each, of the individual sub-types or sub-populations. Thus, in some embodiments, the dosage is based on a desired fixed or minimum dose of T cells and a desired ratio of CD4* to CD8* cells, and / or is based on a desired fixed or minimum dose of CD4* and / or CD8* cells.
[0247] In some embodiments, the cells are administered at or within a tolerated range of a desired output ratio of multiple cell populations or sub-types, such as CD4* and CD8* cells or sub-types. In some aspects, the desired ratio can be a specific ratio or can be a range of ratios. for example, in some embodiments, the desired ratio (e.g., ratio of CD4* to CD8* cells) is between at or about 5:1 and at or about 5:1 (or greater than about 1:5 and less than about 5:1), or between at or about 1:3 and at or about 3:1 (or greater than about 1:3 and less than about 3:1), such as between at or about 2:1 and at or about 1:5 (or greater than about 1:5 and less than about 2:1, such as at or about 5:1, 4.5:1, 4:1, 3.5:1, 3:1, 2.5:1, 2:1, 1.9:1,1.8:1,1.7:1, 1.6:1, 1.5:1, 1.4:1, 1.3:1, 1.2:1, 1.1:1, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8,1:1.9: 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, or 1:5. In some aspects, the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
[0248] In particular embodiments, the numbers and / or concentrations of cells refer to the number of recombinant receptor (e.g., CAR)-expressing cells. In other embodiments, the numbers and / or concentrations of cells refer to the number or concentration of all cells, T cells, or peripheral blood mononuclear cells (PBMCs) administered.
[0249] In some aspects, the size of the dose is determined based on one or more criteria such as response of the subject to prior treatment, e.g. chemotherapy, disease burden in the subject, such as tumor load, bulk, size, or degree, extent, or type of metastasis, stage, and / or likelihood or incidence of the subject developing toxic outcomes, e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or a host immune response against the cells and / or recombinant receptors being administered.
[0250] In some embodiments, the methods and uses also include administering one or more additional doses of cells expressing a chimeric antigen receptor (CAR) and / or lymphodepleting therapy and / or a combination therapy, and / or one or more steps of the methods are repeated. In some embodiments, the one or more additional dose is the same as the initial dose. In some embodiments, the one or more additional dose is different from the initial dose, e.g., higher, such as 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold or more higher than the initial dose, or lower, such as e.g., higher, such as 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold or more lower than the initial dose. In some embodiments, administration of one or more additional doses is determined based on response of the subject to the initial treatment or any prior treatment, disease burden in the subject, such as tumor load, bulk, size, or degree, extent, or type of metastasis, stage, and / or likelihood or incidence of the subject developing toxic outcomes, e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or a host immune response against the cells and / or recombinant receptors being administered. C. Response, Efficacy and Survival
[0251] In some embodiments, the administration according to the methods and uses can result in treatment of the disease or condition in the subject. In some embodiments, the administration according to the methods and uses can result in the subject exhibiting a response (e.g., a clinical response) to treatment. In some embodiments, the administration according to the methods and uses can treat the subject despite the subject having become resistant to another therapy.
[0252] In some embodiments, at least 30%, at least 35%, at least 40% or at least 50% of subjects treated according to the method achieve complete remission (CR); and / or at least about 40%, at least about 50%, at least about 60% or at least about 70% of the subjects treated according to the method achieve an objective response (OR). In some embodiments, at least or about at least 50% of subjects, at least or about at least 60% of the subjects, at least or about at least 70% of the subjects, at least or about at least 80% of the subjects or at least or about at least 90% of the subjects treated according to the method and uses achieve CR and / or achieve an objective response (OR).
[0253] In some embodiments, criteria assessed for response to treatment includes overall response rate (ORR; also known in some cases as objective response rate), complete response (CR; also known in some cases as complete response), duration of response (DOR), progression-free survival (PFS), overall survival (OS), minimal residual disease (MRD) negative rate, relapse-free survival (RFS), event-free survival (EFS), rate of hematopoietic stem cell transplant (HSCT) after administration of the engineered cells, and / or pharmacokinetic parameters such as Cuax, Tmax, and area under the curve (AUC).
[0254] In some embodiments, the measure or criterion assessed is the overall response rate (ORR). In some embodiments, ORR for certain subjects can be described as the total number of subjects achieving a complete response (CR) or CR with incomplete blood count recovery (CRi), after a period of time after administration of the engineered cells, e.g., on day 28 and / or day 56. In some embodiments, the ORR of the subjects treated according to the method and uses is at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%.
[0255] In some embodiments, the measure or criterion assessed is the minimal residual disease (MRD) negative rate. In some embodiments, MRD negative response is described as the total number of subjects achieving a MRD negative response, after a period of time after administration of the engineered cells, e.g., on day 28 and / or day 56. In some embodiments, the MRD negative response rate of the subjects treated according to the method and uses is at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%. In some embodiments, MRD can be measured using any criteria described herein. In some aspects, a MRD relapse after treatment can be described as an MRD detection by validated assay at a frequency of 1 x 10% or greater in BM cells following an initial MRD negative (less than 1 x 10%) complete response (CR) or complete response with incomplete blood count recovery (CRi).
[0256] In some aspects, MRD negative rate can be described as the proportion of subjects achieving a CR or CRi with an MRD negative BM on day 28, confirmed on day 56, divided by the number of total subjects included in the analysis. In some aspects, the first assessment is performed at 28 days after administration of the CAR-expressing cells. In some embodiments, if the subject cannot be assessed for CR / CRI due to hypoplastic marrow, a repeat marrow examination is performed when there is evidence of hematopoietic recovery such that MRD negative remission can be assessed. In some cases, for the best overall disease response to be considered MRD negative CR or CRi, there is no clinical evidence of relapse as assessed by peripheral blood, bone marrow, cerebrospinal fluid and extramedullary disease assessment (where applicable) with no MRD detected in the bone marrow (below the level of detection, <0.01% by a validated assay). In some aspects, the MRD result is confirmed at a minimum of 4 weeks (28 days) after the initial achievement of MRD negative CR or CRi. In some aspects, additional assessments also are included in the same evaluation. In some embodiments, the measure or criterion assessed is the overall response rate (ORR). In some embodiments, ORR for certain subjects can be described as the total number of subjects achieving a complete response (CR) or a partial response (PR), after a period of time after administration of the engineered cells, e.g., on day 28 and / or day 56. In some embodiments, the ORR of the subjects treated according to the method and uses is at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%.
[0257] In some embodiments, the measure or criterion assessed is duration of response (DOR). In some embodiments, DOR can be described as the time from first response until progressive disease (PD), disease relapse, or death from any cause, whichever occurs first. In some aspects, the DOR is measured until up to approximately 2, 3, or 4 years after administration of the engineered cells. In some aspects, the response is durable for at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 36 or 48 months after initiation of administration of the engineered cells, in at least at or about 20%, at least at or about 30%, at or about 40%, at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%, of the subjects that were treated according to the method and uses.
[0258] In some embodiments, the measure or criterion assessed is relapse-free survival (RES). In some embodiments, RFS can be described as the time from first response to documentation of progressive disease (PD), disease relapse, or death due to any cause, whichever occurs first. In some aspects, the RFS is measured until up to approximately 2, 3, or 4 years after administration of the engineered cells. In some aspects, the RFS is at least 3,4, 5, 6,7, 8,9, 10, 11, 12, 18, 24, 36 or 48 months after initiation of administration of the engineered cells, in at least at or about 20%, at least at or about 30%, at or about 40%, at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%, of the subjects that were treated according to the method and uses.
[0259] In some embodiments, the measure or criterion assessed is event-free survival (EFS). In some embodiments, EFS can be described as the time from initiation of administration of infusion to progressive disease (PD), disease relapse, start of a new anticancer therapy, or death from any cause, whichever occurs first. In some aspects, the EFS is measured until up to approximately 2, 3, or 4 years after administration of the engineered cells. In some aspects, the EFS is at least 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 18, 24, 36 or 48 months after initiation of administration of the engineered cells, in at least at or about 20%, at least at or about 30%, at or about 40%, at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at or about 85%, at least at or about 90% or at least at or about 95%, of the subjects that were treated according to the method and uses.
[0260] In some embodiments, the measure or criterion assessed is overall survival (OS). In some embodiments, OS can be described as the time from initiation of administration of the engineered cells to time of death due to any cause. In some aspects, the OS is measured until up to approximately 2, 3, or 4 years after administration of the engineered cells. In some aspects, the OS is at least 3, 4, 5, 6,7, 8,9, 10, 11, 12, 18, 24, 36 or 48 months after initiation of administration of the engineered cells, in at least at or about 20%, at least at or about 30%, at or about 40%, at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%, of the subjects that were treated according to the method and uses.
[0261] In some embodiments, the measure or criterion assessed is the minimal residual disease (MRD) negative rate. In some embodiments, MRD negative response in some subjects can be described as the percentage of B-ALL subjects achieving a CR or CRi and a negative MRD bone marrow, after a period of time after administration of the engineered cells. In some aspects, the MRD negative response is measured until up to approximately 2, 3, or 4 years after administration of the engineered cells. In some embodiments, the MRD negative response rate of the subjects treated according to the method and uses is at least at or about 20%, at least at or about 30%, at or about 40%, at least at or about 50%, at least at or about 60%, at or about 70%, at least at or about 80%, at least at or about 85%, at least at or about 90% or at least at or about 95%.
[0262] In some embodiments, the measure or criterion assessed is the rate of hematopoietic stem cell transplant (HSCT) after response to administration of engineered cells. In some embodiments, rate of HSCT can be described as the percentage of subjects who achieve a response after the administration of engineered cells, and then proceed to receive HSCT. In some aspects, the rate of HSCT is measured until up to approximately 2, 3, or 4 years after administration of the engineered cells. In some embodiments, the rate of HSCT after response of the subjects treated according to the method and uses is less than at or about 80%; less than at or about 70%, at or about 60%, less than at or about 50%, less than at or about 40%, at or about 30%, less than at or about 20% or less than at or about 10%.
[0263] In some embodiments, at least 40% or at least 50% of subjects treated according to the methods provided herein achieve complete remission (CR; also known in some cases as complete response), exhibit progression-free survival (PFS) and / or overall survival (OS) of greater than at or about 3 months, 6 months or 12 months or greater than 13 months or approximately 14 months; on average, subjects treated according to the method exhibit a median PFS or OS of greater than at or about 6 months, 12 months, or 18 months; and / or the subject exhibits PFS or OS following therapy for at least at or about 6, 12, 18 or more months or longer.
[0264] In some embodiments, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve a complete response (CR). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve an objective response (OR). In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve a CR or OR by one month, by two months or by three months.
[0265] In some embodiments, by three months, four months, five months, six months or more after initiation of administration of the cell therapy, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, remain in response, such as remain in CR or OR. In some embodiments, such response, such as CR or OR, is durable for at least three months, four months, five months, six months, seven months, eight months or nine months, such as in at least or about at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided methods or in such subjects who achieve a CR by one month or by three months. In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, or such subjects who achieve a CR by one month or by three months, survive or survive without progression for greater than or greater than about three months, four months, five months, six months, seven months, eight months or nine months.
[0266] In some embodiments, the resulting response observed in such subjects by the treatment in accord with the provided methods, and / or with the provided articles of manufacture or compositions, is associated with or results in a low risk of any toxicity or a low risk of severe toxicity in a majority of the subjects treated. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods and / or with the provided articles of manufacture or compositions do not exhibit any grade of CRS or any grade of neurotoxicity (NT). In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects treated according to the provided methods and / or with the provided articles of manufacture or compositions do not exhibit severe CRS or grade 3 or higher CRS. In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, do not exhibit severe neurotoxicity or grade 3 or higher neurotoxicity, such as grade 4 or 5 neurotoxicity.
[0267] In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the method and / or with the provided articles of manufacture or compositions do not exhibit early onset CRS or neurotoxicity and / or do not exhibit onset of CRS earlier than 1 day, 2 days, 3 days or 4 days following initiation of the administration. In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the methods, and / or with the provided articles of manufacture or compositions, do not exhibit onset of neurotoxicity earlier than 3 days, 4 days, 5 days, six days or 7 days following initiation of the administration. In some aspects, the median onset of neurotoxicity among subjects treated according to the methods, and / or with the provided articles of manufacture or compositions, is at or after the median peak of, or median time to resolution of, CRS in subjects treated according to the method. In some cases, the median onset of neurotoxicity among subjects treated according to the method is greater than at or about 8, 9, 10, or 11 days.
[0268] In some aspects, the dose is within a range in which a correlation is observed (optionally a linear relationship) between the number of such cells (e.g., of total CAR* T cells or of CD8* and / or CD4* CAR* T cells) and one or more outcomes indicative of therapeutic response, or duration thereof (e.g., likelihood of achieving a remission, a complete remission, and / or a particular duration of remission) and / or duration of any of the foregoing. In some aspects, it is found that the higher dose of cells administered can result in greater response without or without substantially impacting or affecting the incidence or risk of toxicity (e.g. CRS or neurotoxicity), or degree of incidence or risk of toxicity, in the subject e.g. severe CRS or severe neurotoxicity.
[0269] In some aspects, the provided methods can achieve a high or a particular rate of response (such as a rate of response among a population as assessed after a certain period post-administration, such as three months or six months), e.g., ORR (such as a 6-month or 3-month ORR) of 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or 80% or 81%, 82%, 83%, 84% or 85% or more and CR rate (such as a 6-month or 3-month CR rate) of 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 71%, 72%, 73% or more or approximately 75% or more, which also is durable such as for a particular period of time or at least a particular period of time, e.g., is sustained for more than 1, 3 or 6 months or more or 9 months or more after initiation of therapy. In some embodiments, such rates of response and durability are received following only a single administration or dose of such therapy. Treatment of such subjects by the provided methods, and / or with the provided articles of manufacture or compositions, in some embodiments, also result in the subjects achieving the high rate of response, yet not exhibiting higher incidence of developing toxicities, such as neurotoxicity or CRS, even at a higher cell dosage. In some embodiments, about or greater than 50%, 55% or 60% of subjects achieving such responses do not develop any grade of toxicity, such as any grade of CRS and / or neurotoxicity.
[0270] In some aspects, response rates in subjects, such as subjects with ALL or NHL, are based on the Lugano criteria. (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5). In some aspects, response assessment utilizes any of clinical, hematologic, and / or molecular methods. In some aspects, response assessed using the Lugano criteria involves the use of positron emission tomography (PET)—computed tomography (CT) and / or CT as appropriate. PET-CT evaluations may further comprise the use of fluorodeoxyglucose (FDG) for FDG-avid lymphomas. In some aspects, response assessed using the Lugano criteria involves the use of positron emission tomography (PET)—computed tomography (CT) and / or CT as appropriate for imaging evaluation. FDG-avid lymphomas include Hodgkin lymphoma (HL) and certain non- Hodgkin lymphomas (NHL), including diffuse large B cellular lymphoma (DLBCL), marginal zone NHL with an aggressive transformation, and FDG-avid nodal lymphomas (essentially all histologic types except: chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma, lymphoplasmacytic lymphoma / Waldenstrom macroglobulinaemia, and mycosis fungoides). In some cases, for non-FDG- avid histologies, CT is the preferred imaging method. In some aspects, the post-treatment scans are taken as long as possible after administration of treatment. In some aspects the post-treatment scans are taken a minimum of 3 weeks after therapy, such as 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12, weeks or more after administration of treatment. In some aspects, where PET-CT will be used to assess response in FDG-avid histologies, a 5-point scale may be used. In some respects, the 5-point scale comprises the following criteria: 1, no uptake above background; 2, uptake < mediastinum; 3, uptake > mediastinum but < liver; 4, uptake moderately > liver; 5, uptake markedly higher than liver and / or new lesions; X, new areas of uptake unlikely to be related to lymphoma.
[0271] In some aspects, where PET-CT will be used to assess response in FDG-avid histologies, a 5- point scale, such as the Deauville five-point scale (Deauville 5ps), may be used for evaluation or staging. The Deauville score is based on visual interpretation of fluorodeoxyglucose (FDG) uptake, visualized by PET / CT scans, of each lesion, compared to two reference organs, the mediastinum (i.e., blood pool) and the liver. One assessment (initial staging) is made prior to treatment and a second round of FDG PET / CT scans is used to evaluate residual masses (in comparison to the FDG update in the reference organs) during and / or after treatment. The scale ranges from 1 to 5, where 1 is best and 5 is the worst. Each FDG- avid (or previously FDG-avid) lesion is rated independently. In some respects, the 5-point scale comprises the following criteria: 1, no uptake above background; 2, uptake < mediastinum; 3, uptake > mediastinum but < liver; 4, uptake moderately > liver; 5, uptake markedly higher than liver (e.g., maximum standard uptake value (SUVmax >2x liver; 5a) and / or new lesion (on response evaluation) that is possibly related to lymphoma (5b); X, new areas of uptake unlikely to be related to lymphoma.
[0272] A Deauville score of 1 or 2 is considered to represent complete metabolic response (CMR) at interim and end of treatment. A Deauville score of 3 also represents CMR, but interpretation of score 3 depends on the timing of the assessment, the clinical context and the treatment. A Deauville score of 4 or 5 at interim is considered to represent partial metabolic response. However, a Deauville score of 4 or 5 at the end of treatment represents residual metabolic disease, if the uptake has reduced from baseline; no metabolic response (NMR) if there is no change in uptake from baseline; and progressive metabolic disease (PMD) if there in an increase in uptake from baseline and / or there are new lesions. At interim and end of treatment, NMR or PMD indicates treatment failure.
[0273] In some aspects, a complete response as described using the Lugano criteria involves a complete metabolic response and a complete radiologic response at various measureable sites. In some aspects, these sites include lymph nodes and extralymphatic sites, wherein a CR is described as a score of 1, 2, or 3 with or without a residual mass on the 5-point scale, when PET-CT is used. In some aspects, in ‘Waldeyer's ring or extranodal sites with high physiologic uptake or with activation within spleen or marrow (e.g., with chemotherapy or myeloid colony-stimulating factors), uptake may be greater than normal mediastinum and / or liver. In this circumstance, complete metabolic response may be inferred if uptake at sites of initial involvement is no greater than surrounding normal tissue even if the tissue has high physiologic uptake. In some aspects, response is assessed in the lymph nodes using CT, wherein a CR is described as no extralymphatic sites of disease and target nodes / nodal masses must regress to < 1.5 cm in longest transverse diameter of a lesion (LDi). Further sites of assessment include the bone marrow wherein PET-CT-based assessment should indicate a lack of evidence of FDG-avid disease in marrow and a CT-based assessment should indicate a normal morphology, which if indeterminate should be IHC negative. Further sites may include assessment of organ enlargement, which should regress to normal. In some aspects, non-measured lesions and new lesions are assessed, which in the case of CR should be absent (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5).
[0274] In some aspects, a partial response (PR; also known in some cases as partial remission) as described using the Lugano criteria involves a partial metabolic and / or radiological response at various measureable sites. In some aspects, these sites include lymph nodes and extralymphatic sites, wherein a PR is described as a score of 4 or 5 with reduced uptake compared with baseline and residual mass(es) of any size, when PET-CT is used. At interim, such findings can indicate responding disease. At the end of treatment, such findings can indicate residual disease. In some aspects, response is assessed in the lymph nodes using CT, wherein a PR is described as 250% decrease in SPD of up to 6 target measureable nodes and extranodal sites. if a lesion is too small to measure on CT, 5 mm x 5 mm is assigned as the default value; if the lesion is no longer visible, the value is 0 mm x 0 mm; for a node >5 mm x 5 mm, but smaller than normal, actual measurements are used for calculation. Further sites of assessment include the bone marrow wherein PET-CT-based assessment should indicate residual uptake higher than uptake in normal marrow but reduced compared with baseline (diffuse uptake compatible with reactive changes from chemotherapy allowed). In some aspects, if there are persistent focal changes in the marrow in the context of a nodal response, consideration should be given to further evaluation with MRI or biopsy, or an interval scan. In some aspects, further sites may include assessment of organ enlargement, where the spleen must have regressed by >50% in length beyond normal. In some aspects, non-measured lesions and new lesions are assessed, which in the case of PR should be absent / normal, regressed, but no increase. No response / stable disease (SD) or progressive disease (PD) can also be measured using PET- CT and / or CT based assessments (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5).
[0275] In some respects, progression-free survival (PFS) is described as the length of time during and after the treatment of a disease, such as cancer, that a subject lives with the disease but it does not get worse. In some aspects, objective response (OR) is described as a measurable response. In some aspects, objective response rate (ORR; also known in some cases as overall response rate) is described as the proportion of patients who achieved CR or PR. In some aspects, overall survival (OS) is described as the length of time from either the date of diagnosis or the start of treatment for a disease, such as cancer, that subjects diagnosed with the disease are still alive. In some aspects, event-free survival (EFS) is described as the length of time after treatment for a cancer ends that the subject remains free of certain complications or events that the treatment was intended to prevent or delay. These events may include the return of the cancer or the onset of certain symptoms, such as bone pain from cancer that has spread to the bone, or death.
[0276] In some embodiments, the measure of duration of response (DOR) includes the time from documentation of tumor response to disease progression. In some embodiments, the parameter for assessing response can include durable response, e.g., response that persists after a period of time from initiation of therapy. In some embodiments, durable response is indicated by the response rate at approximately 1,2, 3,4,5,6,7, 8,9, 10, 11, 12, 18 or 24 months after initiation of therapy. In some embodiments, the response is durable for greater than 3 months or greater than 6 months.
[0277] In some aspects, the RECIST criteria is used to determine objective tumor response; in some aspects, in solid tumors (Eisenhauer et al., European Journal of Cancer 45 (2009) 228-247.) In some aspects, the RECIST criteria is used to determine objective tumor response for target lesions. In some respects, a complete response as determined using RECIST criteria is described as the disappearance of all target lesions and any pathological lymph nodes (whether target or non-target) must have reduction in short axis to <10 mm. In other aspects, a partial response as determined using RECIST criteria is described as at least a 30% decrease in the sum of diameters of target lesions, taking as reference the baseline sum diameters. In other aspects, progressive disease (PD) is described as at least a 20% increase in the sum of diameters of target lesions, taking as reference the smallest sum on study (this includes the baseline sum if that is the smallest on study). In addition to the relative increase of 20%, the sum must also demonstrate an absolute increase of at least 5 mm (in some aspects the appearance of one or more new lesions is also considered progression). In other aspects, stable disease (SD) is described as neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD, taking as reference the smallest sum diameters while on study.
[0278] In some aspects, the administration in accord with the provided methods, and / or with the provided articles of manufacture or compositions, generally reduces or prevents the expansion or burden of the disease or condition in the subject. For example, where the disease or condition is a tumor, the methods generally reduce tumor size, bulk, metastasis, percentage of blasts in the bone marrow or molecularly detectable cancer and / or improve prognosis or survival or other symptom associated with tumor burden.
[0279] Disease burden can encompass a total number of cells of the disease in the subject or in an organ, tissue, or bodily fluid of the subject, such as the organ or tissue of the tumor or another location, e.g., which would indicate metastasis. For example, tumor cells may be detected and / or quantified in the blood or bone marrow in the context of certain hematological malignancies. Disease burden can include, in some embodiments, the mass of a tumor, the number or extent of metastases and / or the percentage of blast cells present in the bone marrow.
[0280] In some embodiments, a subject has leukemia. The extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.
[0281] In some aspects, response rates in subjects, such as subjects with CLL, are based on the International Workshop on Chronic Lymphocytic Leukemia (IWCLL) response criteria (Hallek, et al., Blood 2008, Jun 15; 111(12): 5446-5456). In some aspects, these criteria are described as follows: complete remission (CR; also known in some cases as complete response), which in some aspects requires the absence of peripheral blood clonal lymphocytes by immunophenotyping, absence of lymphadenopathy, absence of hepatomegaly or splenomegaly, absence of constitutional symptoms and satisfactory blood counts; complete remission with incomplete marrow recovery (CRi), which in some aspects is described as CR above, but without normal blood counts; partial remission (PR; also known in some cases as partial response), which in some aspects is described as > 50% fall in lymphocyte count, > 50% reduction in lymphadenopathy or > 50% reduction in liver or spleen, together with improvement in peripheral blood counts; progressive disease (PD), which in some aspects is described as > 50% rise in lymphocyte count to > 5 x10% / L, > 50% increase in lymphadenopathy, > 50% increase in liver or spleen size, Richter’s transformation, or new cytopenias due to CLL; and stable disease, which in some aspects is described as not meeting criteria for CR, CRi, PR or PD.
[0282] In some embodiments, the subjects exhibits a CR or OR if, within 1 month of the administration of the dose of cells, lymph nodes in the subject are less than at or about 20 mm in size, less than at or about 10 mm in size or less than at or about 10 mm in size.
[0283] In some embodiments, an index clone of the CLL is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods. In some embodiments, an index clone of the CLL is assessed by IgH deep sequencing. In some embodiments, the index clone is not detected at a time that is at or about or at least ator about 1,2, 3,4, 5, 6, 12, 18 or 24 months following the administration of the cells.
[0284] In some embodiments, a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow. In some embodiments, a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.
[0285] In some embodiments, a subject has leukemia. The extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.
[0286] In some embodiments, a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow. In some embodiments, a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.
[0287] In some embodiments, a subject may exhibit complete remission, but a small proportion of morphologically undetectable (by light microscopy techniques) residual leukemic cells are present. A subject is said to exhibit minimum residual disease (MRD) if the subject exhibits less than 5% blasts in the bone marrow and exhibits molecularly detectable cancer. In some embodiments, molecularly detectable cancer can be assessed using any of a variety of molecular techniques that permit sensitive detection of a small number of cells. In some aspects, MRD is detected by a validated assay at a frequency of 1 x 10% or greater in BM cells. In some aspects, such techniques include PCR assays, which can determine unique Ig / T-cell receptor gene rearrangements or fusion transcripts produced by chromosome translocations. In some embodiments, flow cytometry can be used to identify cancer cell based on leukemia-specific immunophenotypes. In some embodiments, molecular detection of cancer can detect as few as 1 leukemia cell in 100,000 normal cells. In some embodiments, a subject exhibits MRD that is molecularly detectable if at least or greater than 1 leukemia cell in 100,000 cells is detected, such as by PCR or flow cytometry. In some embodiments, the disease burden of a subject is molecularly undetectable or MRD", such that, in some cases, no leukemia cells are able to be detected in the subject using PCR or flow cytometry techniques.
[0288] In some embodiments, an index clone of the leukemia, is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods. In some embodiments, an index clone of the leukemia, is assessed by IGH deep sequencing. In some embodiments, the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.
[0289] In some aspects, MRD is detected by flow cytometry. Flow cytometry can be used to monitor bone marrow and peripheral blood samples for cancer cells. In particular aspects, flow cytometry is used to detect or monitor the presence of cancer cells in bone marrow. In some aspects, multiparameter immunological detection by flow cytometry is used to detect cancer cells (see for example, Coustan- Smith et al., (1998) Lancet 351:550-554). In some aspects, multiparameter immunological detection by mass cytometry is used to detect cancer cells. In some examples, 1, 2, 3,4, 5,6,7, 8,9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50 parameters can be used to detect cancer cells. The antigens used for detection are selected based on the cancer being detected (Foon and Todd (1986) Blood 68:1-31).
[0290] In some examples, bone marrow is harvested by bone marrow aspirates or bone marrow biopsies, and lymphocytes are isolated for analysis. Monoclonal and / or polyclonal antibodies conjugated to a fluorochrome (e.g., fluorescein isothiocyanate (FITC), phycoerythrin, peridinin chlorophyll protein, or biotin) can be used to detect epitopes, such as terminal deoxynucleotidyl transferase (TdT), CD3, CD10, CD11¢, CD13, CD14, CD33, CD19, CD20, CD21, CD22, CD23, CD34, CD45, CD56, CD79b, IgM, and / or KORSA3544, on isolated lymphocytes. Labeled cells can then be detected using flow cytometry, such as multiparameter flow cytometry, or mass cytometry, to detect multiple epitopes.
[0291] In some embodiments, the presence of MRD in ALL can be determined based on having less than 5% lymphoblasts by morphology, and / or MRD detected by a validated assay at a frequency of 1 x10 or greater in bone marrow cells after two lines of therapy. In some aspects, the MRD response rate can be determined from the proportion of subjects achieving a CR or CRi with no MRD detected in bone marrow (e.g., <0.01% by a validated assay), up to 24 months after administration of the engineered cell composition, over the number of subjects available for the analysis.
[0292] Lymphoid cells can be identified and gated based on a light-scatter dot plot and then secondarily gated to identify cell populations expressing the immunophenotypic features of interest. Exemplary epitopes are set forth in Table 2 below. Other immunologic classification of leukemias and lymphomas include those described in, for example, Foon and Todd Blood (1986) 68(1): 1-31, and Mrozek et al., Hematol Oncol Clin North Am. 2009 October; 23(5): 991-v. In some aspects, flow cytometric assessment of MRD can be achieved by quantifying live lymphocytes bearing one or more ALL or NHL phenotypes. In some aspects, flow cytometric assessment of MRD can be achieved by quantifying live lymphocytes bearing one or more CLL immunophenotypes (e.g., low forward / side scatter; CD3™8; CD5*; CD14™¢; CD19*; CD23*; CD45; CD56™¥). B-Cell Acute - Lymphoblastic Leukemia / Lymphoma CD19+; CD22+; CD79%a+; TdT+; 1a | CD10+ / -; cytoplasmic Ig + / -; surface Ig + / - nodal low-grade MALT lymphoma; indolent disease Table 2. Exemplary Immnunophenotype and Cytogentics Characteristics Immunophenotype Cytogenetics Acute Lymphoblastic | B cell lineage: cryptic t(12;21) Leukemia (ALL) CD19+; CD22+; 1(1;19)(q23;p13) CD79a+; TdT+; Philadelphia chromosome (t(9;22)(q34;q11)) CD10+ / -; cytoplasmic t(4;11)(q21;923) Ig + / -; surface Ig + / - (8;14)(q24;932) t(11;14)(p13;q11) T cell lineage: CD2+; t(v;11g23.3) CD3+; CD4+; CD5+; hyperdiploidy CD7+; CD8+; TdT+ hypodiploidy recurrent genetic abnormalities Philadelphia chromosome-like B-Cell Acute CD19+; CD22+; 1%(9;22)(q34.1;,q11.2) Lymphoblastic CD79%a+; TdT+; t(v;11g23.3) Leukemia / Lymphoma | CD10+ / -; cytoplasmic 1(12;21)(p13.2;922.1) Ig + / -; surface Ig + / - t(5;14)(q31.1;q32.3) (1519)(q23;p13.3 Chronic Lymphocytic | Pan-B+; CD5+; CD23+; | Trisomyl2 Leukemia (CLL) CD79b / CD22 weak; del(13)(q14.3) FMC7-; slg weak del 1122-923 del 17p13 (p53) t(11;14)(q13;q32) BCL1 / IgH rearrangement 1(14;19)(q32;q13) IgH deletion (14932) del(6q) +8924 +3 +18 del 6921 Small lymphocytic Pan-B+; CD5+; CD23+; | del(6)(q21-23) lymphoma (SLL CD10-; sIgM+ faint Lymphoplasmacytic Pan-B+; CD5-; CD10-; 1(9;14)(p13;932) PAX5 / IgH lymphoma cylgM+ Follicle center cell Pan-B+; CD10+ / -; CDS- | t(14;18)(q32;q21) / BCL2 Rearr lymphoma ; slg+ Diffuse large cell CD19+; CD22+; CD10- | t(14;18) and p53 mutations lymphoma I+; SIg+ (3; V)(q27;V) / BCL6 Rearr variants c-MYC Rearr Pan-B+; TdT-; CD10+; | (8;14)(q24;932) or variants / c-MYC Rearr (BL) CDS5-; sIgM+ Burkitt-like lymphoma (8:14) or variants CD3-; sIg+ t(8;14)+ t(14;18 Mantle cell lymphoma t(11;14)(q13;q32) / BCL1 Rearr CD10- / +; sIgM+ bright Marginal zone B-cell pan-B+; CD5- / +; CD10- | t(11;18)(q21;q921) / PI2 / MLT fusion: Extra- lymphoma (MZBCL) |; CD23-; CD1lc+ / ; nodal low-grade MALT lymphoma; indolen cylg + (40% of the disease cells), sIgM+ bright; t(1;14)(p21;q32): Extra-nodal MALT lymphom slgD- del(7)(q22-31): Splenic MZBCL t(1;14)(p21;932): Extra-nodal MALT lymphoma del(7)(q22-31): Splenic MZBCL / +3q: Nodal, extra-nodal and splenic MZBCL Table 2. Exemplary Immnunophenotype and Cytogentics Characteristics Immunophenotype Cytogenetics +: positive in >90% of the cases + / -: positive in more than 50% of the cases - / +: positive in less than 50% of cases -: positive in <10% of the cases Pan-B markers: e.g., CD19, CD20, CD79a sIG: surface immunoglobulins | cylg: cytoplasmic immunoglobulins
[0293] In some aspects, deep sequencing of the immunoglobulin heavy chain (IGH) locus of harvested B cells can be used to detect minimal residual disease (MRD). Clonal presence of a particular IgG rearrangement can provide a marker to detect the presence of B cell malignancies, such as ALL or NHL and / or residual presence of malignant cells thereof. In some aspects cells such as a population containing or suspected of containing B cells are harvested and isolated from blood. In some aspects, cells are harvested and isolated from bone marrow, ¢.g., from bone marrow aspirates or bone marrow biopsies and / or from other biological samples. In some aspects, polymerase chain reaction (PCR) amplification of the complementarity determining region 3 (CDR3) is achieved using primers to highly conserved sequences within the V and J regions of the gene locus, which may be used to identify clonal populations of cells for purposes of assessing minimal residual disease. Other methods for detecting clonal populations, such as single cell sequencing approaches, including those providing information regarding number of cells of a particular lineage and / or expressing a particular variable chain such as variable heavy chain or binding site thereof, such as a clonal population, may be used. In some aspects, the IGH DNA is amplified using a degenerate primers or primers recognizing regions of variable chains shared among different cell clones, such as those recognizing consensus V and degenerate consensus J region of the IGH sequence. An exemplary sequence of the V region is ACACGGCCTCGTGTATTACTGT (SEQ ID NO: 57). An exemplary degenerate consensus sequence of the J region is ACCTGAGGAGACGGTGACC (SEQ ID NO: 58).
[0294] The PCR product or sequencing result in some aspects is specific to the rearranged allele and serves as a clonal marker for MRD detection. Following PCR amplification of the CDR3 region, PCR products can be sequenced to yield patient-specific oligonucleotides constructed as probes for allele- specific PCR for sensitive detection of MRD following treatment of B-cell malignancies with CAR-T cell therapy, e.g. CD19 CAR- T cell therapy. In examples where a PCR product is not generated using the consensus primers, V region family-specific primers for the framework region 1 can be used instead.
[0295] In some aspects, persistence of PCR-detectable tumor cells such as cells of the B cell malignancy such as ALL or NHL, such as detectable IGH sequences corresponding to the malignant or clonal IGH sequences, after treatment is associated with increased risk of relapse. In some aspects, patients who are negative for malignant IGH sequences following treatment (in some aspects, even in the context of other criteria indicating progressive disease or only a partial response, such as persistence of enlarged lymph nodes or other criteria that may in some contexts be associated with disease or lack of complete response) may be deemed to have increased likelihood of PFS or to enter into CR or durable CR or prolonged survival, compared to patients with persistent malignant IGH sequences. In some embodiments, such prognostic and staging determinations are particularly relevant for treatments in which clearance of malignant cells is observed within a short period of time following administration of the therapy, e.g., in comparison to resolution of other clinical symptoms such as lymph node size or other staging criteria. For example, in some such aspects, absence of detectable IGH or minimal residual disease in a sample such as the bone marrow may be a preferred readout for response or likelihood of response or durability thereof, as compared to other available staging or prognostic approaches. In some aspects, results from MRD, e.g., IGH deep sequencing information, may inform further intervention or lack thereof. For example, the methods and other provided embodiments in some contexts provide that a subject deemed negative for malignant IGH may in some aspects be not further treated or not be further administered a dose of the therapy provided, or that the subject be administered a lower or reduced dose. Conversely, it may be provided or specified that a subject exhibiting MRD via IGH deep sequencing be further treated, e.g., with the therapy initially administered at a similar or higher dose or with a further treatment. In some aspects, the disease or condition persists following administration of the first dose and / or administration of the first dose is not sufficient to eradicate the disease or condition in the subject.
[0296] In some embodiments, the method reduces the burden of the disease or condition, e.g., number of tumor cells, size of tumor, duration of patient survival or event-free survival, to a greater degree and / or for a greater period of time as compared to the reduction that would be observed with a comparable method using an alternative dosing regimen, such as one in which the subject receives one or more alternative therapeutic agents and / or one in which the subject does not receive a dose of cells and / or a lymphodepleting agent in accord with the provided methods, and / or with the provided articles of manufacture or compositions. In some embodiments, the burden of a disease or condition in the subject is detected, assessed, or measured. Disease burden may be detected in some aspects by detecting the total number of disease or disease-associated cells, e.g., tumor cells, in the subject, or in an organ, tissue, or bodily fluid of the subject, such as blood or serum. In some aspects, survival of the subject, survival within a certain time period, extent of survival, presence or duration of event-free or symptom-free survival, or relapse-free survival, is assessed. In some embodiments, any symptom of the disease or condition is assessed. In some embodiments, the measure of disease or condition burden is specified.
[0297] In some embodiments, the event-free survival rate or overall survival rate of the subject is improved by the methods, as compared with other methods, for example, methods in which the subject receives one or more alternative therapeutic agents and / or one in which the subject does not receive a dose of cells and / or a lymphodepleting agent in accord with the provided methods, and / or with the provided articles of manufacture or compositions. For example, in some embodiments, event-free survival rate or probability for subjects treated by the methods at 6 months following the dose is greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or greater than about 95%. In some aspects, overall survival rate is greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or greater than about 95%. In some embodiments, the subject treated with the methods exhibits event-free survival, relapse-free survival, or survival to at least 6 months, or at least 1,2,3,4,5,6,7, 8,9, or 10 years. In some embodiments, the time to progression is improved, such as a time to progression of greater than at or about 6 months, or at least 1, 2, 3,4, 5, 6,7, 8,9, or 10 years.
[0298] In some embodiments, following treatment by the methods or uses, the probability of relapse is reduced as compared to other methods, for example, methods in which the subject receives one or more alternative therapeutic agents and / or one in which the subject does not receive a dose of cells and / or a lymphodepleting agent in accord with the provided methods, and / or with the provided articles of manufacture or compositions. For example, in some embodiments, the probability of relapse at 6 months following the first dose is less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%. less than about 20%, or less than about 10%.
[0299] In some embodiments, the measure or criterion assessed is a pharmacokinetic parameter or a parameter that is associated with exposure. In some embodiments, the pharmacokinetic parameter is the maximum concentration (Cmax) of engineered cells present in the subject, after a period of time after administration of the engineered cells. In some embodiments, the Cua is measured until up to approximately 1, 2, 3,4,5,6,7, 8,9, 10, 11, 12, 18 or 24 months after administration of the engineered cells. In some embodiments, the pharmacokinetic parameter is the time to maximum concentration (Tmax) of engineered cells present in the subject. In some embodiments, the Tax is measured until up to approximately 1, 2, 3,4,5,6,7, 8,9, 10, 11, 12, 18 or 24 months after administration of the engineered cells. In some embodiments, the pharmacokinetic parameter is the area under the curve (AUC) of engineered cells present in the subject. In some embodiments, the AUC is measured until up to approximately 1, 2, 3,4,5,6,7, 8,9, 10, 11, 12, 18 or 24 months after administration of the engineered cells.
[0300] In some cases, pharmacokinetics can be assessed by measuring such parameters as the maximum (peak) plasma concentration (Cua), the peak time (i.e. when maximum plasma concentration (Cuax) occurs; Tmax), the minimum plasma concentration (i.e. the minimum plasma concentration between doses of a therapeutic agent, e.g., CAR+ T cells; Cin), the elimination half-life (Ty) and area under the curve (i.e. the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+ T cells; AUC), following administration. The concentration of a particular therapeutic agent, e.g., CAR+ T cells, in the plasma following administration can be measured using any method known in the art suitable for assessing concentrations of the therapeutic agents, e.g., CAR+ T cells, in samples of blood, or any methods described herein. For example, nucleic acid-based methods, such as quantitative PCR (qPCR) or flow cytometry-based methods, or other assays, such as an immunoassay, ELISA, or chromatography / mass spectrometry-based assays can be used.
[0301] In some embodiments, the pharmacokinetics (PK) of administered cells, e.g., CAR* T cell composition, are determined to assess the availability, e.g., bioavailability, of the administered cells. In some embodiments, the determined pharmacokinetic parameters of the administered cells include maximum (peak) plasma concentrations (Cmax), such as Cmax of CD3* CAR* cells, CD4* CAR* cells and or CD8* CAR* T cells; the time point at which Cuax is achieved (Tmax), such as the Tmax of CD3* CAR* cells, CD4* CAR" cells and or CD8* CAR* T cells, and or area under the curve (AUC), such as the AUC, 28, of CD3* CARY cells, CD4* CAR* cells and or CD8*CAR* T cells. In some embodiments, the pharmacokinetic parameter is peak CD3* CAR" T cell concentration (Cmax CD3* CAR* T cells), or CD8* CAR" T cell concentration (Cmax CD8* CAR* T cells). In some embodiments, the pharmacokinetic parameter is AUCq.s, of CD3* CAR" T cells, (AUC0-28 CD3* CAR* T cells), or AUCq.25, of CD8* CAR* T cells, (AUCp.2s CD8* CAR* T cells),
[0302] In some embodiments, “exposure” can refer to the body exposure of a therapeutic agent, e.g., CAR+ T cells in the plasma (blood or serum) after administration of the therapeutic agent over a certain period of time. In some embodiments exposure can be set forth as the area under the therapeutic agent concentration-time curve (AUC) as determined by pharmacokinetic analysis after administration of a dose of the therapeutic agent, e.g., CAR+ T cells. In some cases, the AUC is expressed in cells*days / uL, for cells administered in cell therapy, or in corresponding units thereof. In some embodiments, the AUC is measured as an average AUC in a patient population, such as a sample patient population, e.g., the average AUC from one or more patient(s). In some embodiments, systemic exposure refers to the area under the curve (AUC) within a certain period of time, e.g., from day Oto day 1, 2, 3,4,5,6,7, 8,9, 10, 11, 12, 13, 14, 21, 28 days or more, or week 1, 2, 3, 4, 5,6, 7, 8,9, 10, 11, 12, 13, 14, 15 or more, or month 1,2, 3,4,5,6,7,8,9, 10, 11, 12, 18, 24, 48 or more. In some embodiments, the AUC is measured as an AUC from day 0 to day 28 (AUCo.2s) after administration of the therapeutic agent, e.g., CAR+T cells, including all measured data and data extrapolated from measured pharmacokinetic (PK) parameters, such as an average AUC from a patient population, such as a sample patient population. In some embodiments, to determine exposure over time, e.g., AUC for a certain period of time, such as AUCs, a therapeutic agent concentration-time curve is generated, using multiple measurements or assessment of parameters, e.g., cell concentrations, over time, e.g., measurements taken every 1, 2, 3, 4, 5,6,7,8,9,10, 11, 12, 13, 14, 21 or 28 days or more.
[0303] In some embodiments, the presence and / or amount of cells expressing the recombinant receptor (e.g., CAR-expressing cells administered for T cell based therapy) in the subject following the administration of the T cells and before, during and / or after the administration of the therapy is detected. In some aspects, nucleic acid-based methods, such as quantitative PCR (qPCR), is used to assess the quantity of cells expressing the recombinant receptor (e.g., CAR-expressing cells administered for T cell based therapy) in the blood or serum or organ or tissue sample (e.g., disease site, e.g., tumor sample) of the subject. In some aspects, persistence is quantified as copies of DNA or plasmid encoding the receptor, e.g., CAR, per microgram of DNA, or as the number of receptor-expressing, e.g., CAR- expressing, cells per microliter of the sample, e.g., of blood or serum, or per total number of peripheral blood mononuclear cells (PBMCs) or white blood cells or T cells per microliter of the sample. In some embodiments, the primers or probe used for qPCR or other nucleic acid-based methods are specific for binding, recognizing and / or amplifying nucleic acids encoding the recombinant receptor, and / or other components or elements of the plasmid and / or vector, including regulatory elements, e.g., promoters, transcriptional and / or post-transcriptional regulatory elements or response elements, or markers, e.g., surrogate markers. In some embodiments, the primers can be specific for regulatory elements, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
[0304] In some embodiments, the cells are detected in the subject at or at least at 4, 14, 15, 27, or 28 days following the administration of the T cells, e.g., CAR-expressing T cells. In some aspects, the cells are detected at or at least at 2, 4, or 6 weeks following, or 3, 6, or 12, 18, or 24, or 30 or 36 months, or 1, 2,3, 4, 5, or more years, following the administration of the T cells, e.g., CAR-expressing T cells.
[0305] In some embodiments, the peak levels and / or AUC are assessed and / or the sample is obtained from the subject at a time that is at least 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days or 21 days after initiation of administration of the genetically engineered cells. In some embodiments the peak levels and / or AUC are assessed and / or the sample is obtained from the subject at a time that is between or between about 11 to 22 days, 12 to 18 days or 14 to 16 days, each inclusive, after initiation of administration of the genetically engineered cells.
[0306] The exposure, e.g., number or concentration of cells, e.g. T cells administered for T cell therapy, indicative of expansion and / or persistence, may be stated in terms of maximum numbers or concentration of the cells to which the subject is exposed, duration of detectable cells or cells above a certain number or percentage, area under the curve (AUC) for number or concentration of cells over time, and / or combinations thereof and indicators thereof. Such outcomes may be assessed using known methods, such as qPCR to detect copy number of nucleic acid encoding the recombinant receptor compared to total amount of nucleic acid or DNA in the particular sample, e.g., blood, serum, plasma or tissue, such as a tumor sample, and / or flow cytometric assays detecting cells expressing the receptor generally using antibodies specific for the receptors. Cell-based assays may also be used to detect the number or percentage or concentration of functional cells, such as cells capable of binding to and / or neutralizing and / or inducing responses, e.g., cytotoxic responses, against cells of the disease or condition or expressing the antigen recognized by the receptor.
[0307] In some cases, the pharmacokinetics of administered cells, e.g., adoptively transferred cells are determined to assess the availability, e.g., bioavailability of the administered cells. Methods for determining the pharmacokinetics of adoptively transferred cells may include drawing peripheral blood from subjects that have been administered engineered cells, and determining the number or ratio of the engineered cells in the peripheral blood. Approaches for selecting and / or isolating cells may include use of chimeric antigen receptor (CAR)-specific antibodies (e.g., Brentjens et al., Sci. Transl. Med. 2013 Mar; 5(177): 177ra38) Protein L (Zheng et al., J. Transl. Med. 2012 Feb; 10:29), epitope tags, such as Strep-Tag sequences, introduced directly into specific sites in the CAR, whereby binding reagents for Strep-Tag are used to directly assess the CAR (Liu et al. (2016) Nature Biotechnology, 34:430; international patent application Pub. No. W02015095895) and monoclonal antibodies that specifically bind to a CAR polypeptide (see international patent application Pub. No. W02014190273). Extrinsic marker genes may in some cases be utilized in connection with engineered cell therapies to permit detection or selection of cells and, in some cases, also to promote cell suicide. A truncated epidermal growth factor receptor (EGFRt) in some cases can be co-expressed with a transgene of interest (e.g., encoding a CAR) in transduced cells (see e.g. U.S. Patent No. 8,802,374). EGFRt may contain an epitope recognized by the antibody cetuximab (Erbitux®) or other therapeutic anti-EGFR antibody or binding molecule, which can be used to identify or select cells that have been engineered with the EGFRt construct and another recombinant receptor, such as a chimeric antigen receptor (CAR), and / or to eliminate or separate cells expressing the receptor. See U.S. Patent No. 8,802,374 and Liu et al., Nature Biotech. 2016 April; 34(4): 430-434).
[0308] In some embodiments, the number of CAR* T cells in a biological sample obtained from the patient, e.g., blood, can be determined at a period of time after administration of the cell therapy, e.g., to determine the pharmacokinetics of the cells. In some embodiments, number of CAR* T cells, optionally CAR* CD8* T cells and / or CAR* CD4* T cells, detectable in the blood of the subject, or in a majority of subjects so treated by the method, is greater than 1 cells per pL, greater than 5 cells per pL or greater than per 10 cells per pL. D. Toxicity
[0309] In some embodiments, the provided methods and uses can include features that result in a lower rate and / or lower degree of toxicity, toxic outcome or symptom, toxicity-promoting profile, factor, or property, such as a symptom or outcome associated with or indicative of cytokine release syndrome (CRS) or neurotoxicity, for example, compared to administration of an alternative cell therapy, such as an alternative CAR* T cell composition and / or an alternative dosing of cells, e.g. a dosing of cells that is not administered at a defined ratio.
[0310] In some embodiments, the provided methods and uses does not result in a high rate or likelihood of toxicity or toxic outcomes, or reduces the rate or likelihood of toxicity or toxic outcomes, such as neurotoxicity (NT), cytokine release syndrome (CRS), such as compared to certain other cell therapies. In some embodiments, the methods do not result in, or do not increase the risk of, severe NT (sNT), severe CRS (sCRS), macrophage activation syndrome, tumor lysis syndrome, fever of at least at or about 38 degrees Celsius for three or more days and a plasma level of CRP of at least at or about 20 mg / dL. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods do not exhibit any grade of CRS or any grade of neurotoxicity. In some embodiments, no more than 50% of subjects treated (e.g. at least 60%, at least 70%, at least 80%; at least 90% or more of the subjects treated) exhibit a cytokine release syndrome (CRS) higher than grade 2 and / or a neurotoxicity higher than grade 2. In some embodiments, at least 50% of subjects treated according to the method (e.g. at least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated) do not exhibit a severe toxic outcome (e.g. severe CRS or severe neurotoxicity), such as do not exhibit grade 3 or higher neurotoxicity and / or does not exhibit severe CRS, or does not do so within a certain period of time following the treatment, such as within a week, two weeks, or one month of the administration of the cells. In some embodiments, parameters assessed to determine certain toxicities include adverse events (AEs), dose-limiting toxicities (DLTs), CRS and NT.
[0311] Administration of adoptive T cell therapy, such as treatment with T cells expressing chimeric antigen receptors, can induce toxic effects or outcomes such as cytokine release syndrome and neurotoxicity. In some examples, such effects or outcomes parallel high levels of circulating cytokines, which may underlie the observed toxicity.
[0312] In some embodiments, the presence or development of adverse events (AEs), is measured or determined after administration of the engineered cells. In some aspects, the type, frequency and severity of adverse events (AEs), serious adverse events (SAE), and laboratory abnormalities (overall and in clinical, histological and molecular subgroups), are measured. In some embodiments, greater than or greater than about 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods do not exhibit any AEs or SAEs.
[0313] In some aspects, the toxic outcome is or is associated with or indicative of cytokine release syndrome (CRS) or severe CRS (sCRS). CRS, e.g., sCRS, can occur in some cases following adoptive T cell therapy and administration to subjects of other biological products. See Davila et al., Sci Transl Med 6, 224ra25 (2014); Brentjens et al., Sci. Transl. Med. 5, 177ra38 (2013); Grupp et al., N. Engl. J. Med. 368, 1509-1518 (2013); and Kochenderfer et al., Blood 119, 2709-2720 (2012); Xu et al., Cancer Letters 343 (2014) 172-78.
[0314] Typically, CRS is caused by an exaggerated systemic immune response mediated by, for example, T cells, B cells, NK cells, monocytes, and / or macrophages. Such cells may release a large amount of inflammatory mediators such as cytokines and chemokines. Cytokines may trigger an acute inflammatory response and / or induce endothelial organ damage, which may result in microvascular leakage, heart failure, or death. Severe, life-threatening CRS can lead to pulmonary infiltration and lung injury, renal failure, or disseminated intravascular coagulation. Other severe, life-threatening toxicities can include cardiac toxicity, respiratory distress, neurologic toxicity and / or hepatic failure.
[0315] CRS may be treated using anti-inflammatory therapy such as an anti-IL-6 therapy, e.g., anti- IL-6 antibody, e.g., tocilizumab, or antibiotics or other agents as described. Outcomes, signs and symptoms of CRS are known and include those described herein. In some embodiments, where a particular dosage regimen or administration effects or does not effect a given CRS-associated outcome, sign, or symptom, particular outcomes, signs, and symptoms and / or quantities or degrees thereof may be specified.
[0316] In the context of administering CAR-expressing cells, CRS typically occurs 6-20 days after infusion of cells that express a CAR. See Xu et al., Cancer Letters 343 (2014) 172-78. In some cases, CRS occurs less than 6 days or more than 20 days after CAR T cell infusion. The incidence and timing of CRS may be related to baseline cytokine levels or tumor burden at the time of infusion. Commonly, CRS involves elevated serum levels of interferon (IFN)-y, tumor necrosis factor (TNF)-a, and / or interleukin (IL)-2. Other cytokines that may be rapidly induced in CRS are IL-1B, IL-6, IL-8, and IL-10.
[0317] Exemplary outcomes associated with CRS include fever, rigors, chills, hypotension, dyspnea, acute respiratory distress syndrome (ARDS), encephalopathy, ALT / AST elevation, renal failure, cardiac disorders, hypoxia, neurologic disturbances, and death. Neurological complications include delirium, seizure-like activity, confusion, word-finding difficulty, aphasia, and / or becoming obtunded. Other CRS- related outcomes include fatigue, nausea, headache, seizure, tachycardia, myalgias, rash, acute vascular leak syndrome, liver function impairment, and renal failure. In some aspects, CRS is associated with an increase in one or more factors such as serum-ferritin, d-dimer, aminotransferases, lactate dehydrogenase and triglycerides, or with hypofibrinogenemia or hepatosplenomegaly. Other exemplary signs or symptoms associated with CRS include hemodynamic instability, febrile neutropenia, increase in serum C-reactive protein (CRP), changes in coagulation parameters (for example, international normalized ratio (INR), prothrombin time (PTI) and / or fibrinogen), changes in cardiac and other organ function, and / or absolute neutrophil count (ANC).
[0318] In some embodiments, outcomes associated with CRS include one or more of: persistent fever, e.g., fever of a specified temperature, ¢.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines, such as a max fold change, e.g., of at least at or about 75, compared to pre-treatment levels of at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5, and / or tumor necrosis factor alpha (TNFa), or a max fold change, e.g., of at least at or about 250 of at least one of such cytokines; and / or at least one clinical sign of toxicity, such as hypotension (e.g., as measured by at least one intravenous vasoactive pressor); hypoxia (e.g., plasma oxygen (PO) levels of less than at or about 90%); and / or one or more neurologic disorders (including mental status changes, obtundation, and seizures).
[0319] Exemplary CRS-related outcomes include increased or high serum levels of one or more factors, including cytokines and chemokines and other factors associated with CRS. Exemplary outcomes further include increases in synthesis or secretion of one or more of such factors. Such synthesis or secretion can be by the T cell or a cell that interacts with the T cell, such as an innate immune cell or B cell.
[0320] In some embodiments, the CRS-associated serum factors or CRS-related outcomes include inflammatory cytokines and / or chemokines, including interferon gamma (IFN-y), TNF-a, IL-1p, IL-2, IL- 6, IL-7, IL-8, IL-10, IL-12, sIL-2Ra, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage inflammatory protein (MIP)-1, tumor necrosis factor alpha (TNFa), IL-6, and IL-10, IL-1B, IL-8, IL-2, MIP-1, Flt-3L, fracktalkine, and / or IL-5. In some embodiments, the factor or outcome includes C reactive protein (CRP). In addition to being an early and easily measurable risk factor for CRS, CRP also is a marker for cell expansion. In some embodiments, subjects that are measured to have high levels of CRP, such as > 15 mg / dL, have CRS. In some embodiments, subjects that are measured to have high levels of CRP do not have CRS. In some embodiments, a measure of CRS includes a measure of CRP and another factor indicative of CRS.
[0321] In some embodiments, one or more inflammatory cytokines or chemokines are monitored before, during, or after CAR treatment. In some aspects, the one or more cytokines or chemokines include IFN-y, TNF-q, IL-2, IL-1B, IL-6, IL-7, IL-8, IL-10, IL-12, sIL-2Ra, granulocyte macrophage colony stimulating factor (GM-CSF), or macrophage inflammatory protein (MIP). In some embodiments, IFN-y, TNF-q, and IL-6 are monitored.
[0322] CRS criteria that appear to correlate with the onset of CRS to predict which patients are more likely to be at risk for developing sCRS have been developed (see Davilla et al. Science translational medicine. 2014;6(224):224ra25). Factors include fevers, hypoxia, hypotension, neurologic changes, elevated serum levels of inflammatory cytokines, such as a set of seven cytokines (IFNy, IL-5, IL-6, IL- 10, Flt-3L, fractalkine, and GM-CSF) whose treatment-induced elevation can correlate well with both pretreatment tumor burden and sCRS symptoms. Other guidelines on the diagnosis and management of CRS are known (see e.g., Lee et al, Blood. 2014;124(2):188-95). In some embodiments, the criteria reflective of CRS grade are those detailed in Table 3 below. Exemplary Grading Criteria for CRS Grade Mild Hypotension responsive to fluids or low dose of a single vasopressor, or | Table 3: Exemplary Grading Criteria for CRS Grade Description of Symptoms Not life-threatening, require only symptomatic treatment such as antipyretics Mild and anti-emetics (e.g., fever, nausea, fatigue, headache, myalgias, malaise) 2 Require and respond to moderate intervention: Moderate Oxygen requirement < 40%, or Hypotension responsive to fluids or low dose of a single vasopressor, or Grade 2 organ toxicity (by CTCAE v4.0) 3 Require and respond to aggressive intervention: Severe ; Oxygen requirement > 40%, or Hypotension requiring high dose of a single vasopressor (e.g., a TL ad a Te Tr Tr ela. Aly norepinephrine > 20 ug / kg / min, dopamine > 10 pg / kg / min, phenylephrine | ay ly a Thy at = ED > 200 pg / kg / min, or epinephrine > 10 pg / kg / min), or Hypotension requiring multiple vasopressors (e.g., vasopressin + one of the above agents, or combination vasopressors equivalent to > 20 ng / kg / min norepinephrine), or Grade 3 organ toxicity or Grade 4 transaminitis (by CTCAE v4.0) 4 Life-threatening: 4, 3. ! : 5 Life-threatening Requirement for ventilator support, or Grade 4 organ toxicity (excluding transaminitis) 5 Death Fatal
[0323] In some embodiments, a subject is deemed to develop “severe CRS” (“sCRS”) in response to or secondary to administration of a cell therapy or dose of cells thereof, if, following administration, the subject displays: (1) fever of at least 38 degrees Celsius for at least three days; (2) cytokine elevation that includes either (a) a max fold change of at least 75 for at least two of the following group of seven cytokines compared to the level immediately following the administration: interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5 and / or (b) a max fold change of at least 250 for at least one of the following group of seven cytokines compared to the level immediately following the administration: interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5; and (c) at least one clinical sign of toxicity such as hypotension (requiring at least one intravenous vasoactive pressor) or hypoxia (PO; < 90%) or one or more neurologic disorder(s) (including mental status changes, obtundation, and / or seizures). In some embodiments, severe CRS includes CRS with a grade of 3 or greater, such as set forth in Table 3.
[0324] In some embodiments, outcomes associated with severe CRS or grade 3 CRS or greater, such as grade 4 or greater, include one or more of: persistent fever, e.g., fever of a specified temperature, e.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines, such as a max fold change, e.g., of at least at or about 75, compared to pre-treatment levels of at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5, and / or tumor necrosis factor alpha (TNFa)), or a max fold change, e.g., of at least at or about 250 of at least one of such cytokines; and / or at least one clinical sign of toxicity, such as hypotension (e.g., as measured by at least one intravenous vasoactive pressor); hypoxia (e.g., plasma oxygen (PO) levels of less than at or about 90%); and / or one or more neurologic disorders (including mental status changes, obtundation, and seizures). In some embodiments, severe CRS includes CRS that requires management or care in the intensive care unit (ICU).
[0325] In some embodiments, the CRS, such as severe CRS, encompasses a combination of (1) persistent fever (fever of at least 38 degrees Celsius for at least three days) and (2) a serum level of CRP of at least at or about 20 mg / dL. In some embodiments, the CRS encompasses hypotension requiring the use of two or more vasopressors or respiratory failure requiring mechanical ventilation. In some embodiments, the dosage of vasopressors is increased in a second or subsequent administration.
[0326] In some embodiments, severe CRS or grade 3 CRS encompasses an increase in alanine aminotransferase, an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, left ventricular dysfunction, encephalopathy, hydrocephalus, and / or tremor.
[0327] The method of measuring or detecting the various outcomes may be specified.
[0328] In some aspects, the toxic outcome is or is associated with neurotoxicity. In some embodiments, symptoms associated with a clinical risk of neurotoxicity include confusion, delirium, aphasia, expressive aphasia, obtundation, myoclonus, lethargy, altered mental status, convulsions, seizure-like activity, seizures (optionally as confirmed by electroencephalogram [EEG]), elevated levels of beta amyloid (Ap), elevated levels of glutamate, and elevated levels of oxygen radicals. In some embodiments, neurotoxicity is graded based on severity (e.g., using a Grade 1-5 scale (see, e.g., Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute—Common Toxicity Criteria version 4.03 (NCI-CTCAE v4.03).
[0329] In some instances, neurologic symptoms may be the earliest symptoms of sCRS. In some embodiments, neurologic symptoms are seen to begin 5 to 7 days after cell therapy infusion. In some embodiments, duration of neurologic changes may range from 3 to 19 days. In some cases, recovery of neurologic changes occurs after other symptoms of sCRS have resolved. In some embodiments, time or degree of resolution of neurologic changes is not hastened by treatment with anti-IL-6 and / or steroid(s).
[0330] In some embodiments, a subject is deemed to develop “severe neurotoxicity” in response to or secondary to administration of a cell therapy or dose of cells thereof, if, following administration, the subject displays symptoms that limit self-care (e.g. bathing, dressing and undressing, feeding, using the toilet, taking medications) from among: 1) symptoms of peripheral motor neuropathy, including inflammation or degeneration of the peripheral motor nerves; 2) symptoms of peripheral sensory neuropathy, including inflammation or degeneration of the peripheral sensory nerves, dysesthesia, such as distortion of sensory perception, resulting in an abnormal and unpleasant sensation, neuralgia, such as intense painful sensation along a nerve or a group of nerves, and / or paresthesia, such as functional disturbances of sensory neurons resulting in abnormal cutaneous sensations of tingling, numbness, pressure, cold and warmth in the absence of stimulus. In some embodiments, severe neurotoxicity includes neurotoxicity with a grade of 3 or greater, such as set forth in Table 4. Exemplary Grading Criteria for neurotoxicity Table 4: Exemplary Grading Criteria for neurotoxicity Grade Description of Symptoms Mild or asymptomatic symptoms Asymptomatic or Mild 2 Presence of symptoms that limit instrumental activities of daily living (ADL), Moderate ! such as preparing meals, shopping for groceries or clothes, using the telephone, managing money 3 hinted itemint Sati — te Sneteet Presence of symptoms that limit self-care ADL, such as bathing, dressing and Ne yn a rye Severe undressing, feeding self, using the toilet, taking medications 4 Symptoms that are life-threatening, requiring urgent intervention Life-threatening 5 Death Fatal
[0331] In some embodiments, the methods reduce symptoms associated with CRS or neurotoxicity compared to other methods. In some aspects, the provided methods reduce symptoms, outcomes or factors associated with CRS, including symptoms, outcomes or factors associated with severe CRS or grade 3 or higher CRS, compared to other methods. For example, subjects treated according to the present methods may lack detectable and / or have reduced symptoms, outcomes or factors of CRS, e.g. severe CRS or grade 3 or higher CRS, such as any described, e.g. set forth in Table 3. In some embodiments, subjects treated according to the present methods may have reduced symptoms of neurotoxicity, such as limb weakness or numbness, loss of memory, vision, and / or intellect, uncontrollable obsessive and / or compulsive behaviors, delusions, headache, cognitive and behavioral problems including loss of motor control, cognitive deterioration, and autonomic nervous system dysfunction, and sexual dysfunction, compared to subjects treated by other methods. In some embodiments, subjects treated according to the present methods may have reduced symptoms associated with peripheral motor neuropathy, peripheral sensory neuropathy, dysethesia, neuralgia or paresthesia.
[0332] In some embodiments, the methods reduce outcomes associated with neurotoxicity including damages to the nervous system and / or brain, such as the death of neurons. In some aspects, the methods reduce the level of factors associated with neurotoxicity such as beta amyloid (Ap), glutamate, and oxygen radicals.
[0333] In some embodiments, the toxicity outcome is a dose-limiting toxicity (DLT). In some embodiments, the toxic outcome is a dose-limiting toxicity. In some embodiments, the toxic outcome is the absence of a dose-limiting toxicity. In some embodiments, a dose-limiting toxicity (DLT) is defined as any grade 3 or higher toxicity as assessed by any known or published guidelines for assessing the particular toxicity, such as any described above and including the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) version 4.0.
[0334] In some embodiments, the low rate, risk or likelihood of developing a toxicity, e.g. CRS or neurotoxicity or severe CRS or neurotoxicity, e.g. grade 3 or higher CRS or neurotoxicity, observed with administering a dose of T cells in accord with the provided methods, and / or with the provided articles of manufacture or compositions, permits administration of the cell therapy on an outpatient basis. In some embodiments, the administration of the cell therapy, e.g. dose of T cells (e.g. CAR* T cells) in accord with the provided methods, and / or with the provided articles of manufacture or compositions, is performed on an outpatient basis or does not require admission to the subject to the hospital, such as admission to the hospital requiring an overnight stay.
[0335] In some aspects, subjects administered the cell therapy, e.g. dose of T cells (e.g. CAR* T cells) in accord with the provided methods, and / or with the provided articles of manufacture or compositions, including subjects treated on an outpatient basis, are not administered an intervention for treating any toxicity prior to or with administration of the cell dose, unless or until the subject exhibits a sign or symptom of a toxicity, such as of a neurotoxicity or CRS. Exemplary agents for treating, delaying, attenuating or ameliorating a toxicity are described herein.
[0336] In some embodiments, if a subject administered the cell therapy, e.g. dose of T cells (e.g. CAR* T cells), including subjects treated on an outpatient basis, exhibits a fever the subject is given or is instructed to receive or administer a treatment to reduce the fever. In some embodiments, the fever in the subject is characterized as a body temperature of the subject that is (or is measured at) at or above a certain threshold temperature or level. In some aspects, the threshold temperature is that associated with at least a low-grade fever, with at least a moderate fever, and / or with at least a high-grade fever. In some embodiments, the threshold temperature is a particular temperature or range. For example, the threshold temperature may be at or about or at least at or about 38, 39, 40, 41, or 42 degrees Celsius, and / or may be arange of at or about 38 degrees Celsius to at or about 39 degrees Celsius, a range of at or about 39 degrees Celsius to at or about 40 degrees Celsius, a range of at or about 40 degrees Celsius to at or about 41 degrees, or a range of at or about 41 degrees Celsius to at or about 42 degrees Celsius.
[0337] In some embodiments, the treatment designed to reduce fever includes treatment with an antipyretic. An antipyretic may include any agent, e.g., compound, composition, or ingredient, that reduces fever, such as one of any number of agents known to have antipyretic effects, such as NSAIDs (such as ibuprofen, naproxen, ketoprofen, and nimesulide), salicylates, such as aspirin, choline salicylate, magnesium salicylate, and sodium salicylate, paracetamol, acetaminophen, Metamizole, Nabumetone, Phenaxone, antipyrine, febrifuges. In some embodiments, the antipyretic is acetaminophen. In some embodiments, acetaminophen can be administered at a dose of 12.5 mg / kg orally or intravenously up to every four hours. In some embodiments, it is or comprises ibuprofen or aspirin.
[0338] In some embodiments, if the fever is a sustained fever, the subject is administered an alternative treatment for treating the toxicity, such as any described herein. For subjects treated on an outpatient basis, the subject is instructed to return to the hospital if the subject has and / or is determined to or to have a sustained fever. In some embodiments, the subject has, and / or is determined to or considered to have, a sustained fever if he or she exhibits a fever at or above the relevant threshold temperature, and where the fever or body temperature of the subject is not reduced, or is not reduced by or by more than a specified amount (e.g., by more than 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C), following a specified treatment, such as a treatment designed to reduce fever such as treatment with an antipyreticm, e.g. NSAID or salicylates, e.g. ibuprofen, acetaminophen or aspirin. For example, a subject is considered to have a sustained fever if he or she exhibits or is determined to exhibit a fever of at least at or about 38 or 39 degrees Celsius, which is not reduced by or is not reduced by more than at or about 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C, or by at or about 1%, 2%, 3%, 4%, or 5%, over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours, even following treatment with the antipyretic such as acetaminophen. In some embodiments, the dosage of the antipyretic is a dosage ordinarily effective in such as subject to reduce fever or fever of a particular type such as fever associated with a bacterial or viral infection, e.g., a localized or systemic infection.
[0339] In some embodiments, the subject has, and / or is determined to or considered to have, a sustained fever if he or she exhibits a fever at or above the relevant threshold temperature, and where the fever or body temperature of the subject does not fluctuate by about, or by more than about, 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C. Such absence of fluctuation above or at a certain amount generally is measured over a given period of time (such as over a 24-hour, 12-hour, 8-hour, 6-hour, 3-hour, or 1-hour period of time, which may be measured from the first sign of fever or the first temperature above the indicated threshold). For example, in some embodiments, a subject is considered to or is determined to exhibit sustained fever if he or she exhibits a fever of at least at or about or at least at or about 38 or 39 degrees Celsius, which does not fluctuate in temperature by more than at or about 0.5°C, 0.4 °C, 0.3 °C, or 0.2 °C, over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours.
[0340] In some embodiments, the fever is a sustained fever; in some aspects, the subject is treated at a time at which a subject has been determined to have a sustained fever, such as within one, two, three, four, five six, or fewer hours of such determination or of the first such determination following the initial therapy having the potential to induce the toxicity, such as the cell therapy, such as dose of T cells, e.g. CAR" T cells.
[0341] In some embodiments, one or more interventions or agents for treating the toxicity, such as a toxicity-targeting therapies, is administered at a time at which or immediately after which the subject is determined to or confirmed to (such as is first determined or confirmed to) exhibit sustained fever, for example, as measured according to any of the aforementioned embodiments. In some embodiments, the one or more toxicity-targeting therapies is administered within a certain period of time of such confirmation or determination, such as within 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, or 8 hours thereof. 11. RECOMBINANT RECEPTORS
[0342] In some embodiments, the cells for use in or administered in connection with the provided methods contain or are engineered to contain an engineered receptor, €.g., an engineered antigen receptor, such as a chimeric antigen receptor (CAR). Also provided are populations of such cells, compositions containing such cells and / or enriched for such cells, such as in which cells of a certain type such as T cells or CD8* or CD4* cells are enriched or selected. Among the compositions are pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy. Also provided are therapeutic methods for administering the cells and compositions to subjects, e.g., patients, in accord with the provided methods, and / or with the provided articles of manufacture or compositions.
[0343] In some embodiments, the cells contain one or more nucleic acids introduced via genetic engineering, and thereby express recombinant or genetically engineered products of such nucleic acids. In some embodiments, gene transfer is accomplished by first stimulating the cells, such as by combining it with a stimulus that induces a response such as proliferation, survival, and / or activation, e.g., as measured by expression of a cytokine or activation marker, followed by introduction of the nucleic acids, e.g., by transduction, into the stimulated cells, and optionally incubation or expansion in culture to numbers sufficient for clinical applications.
[0344] The cells generally express recombinant receptors, such as antigen receptors including chimeric antigen receptors (CARs), and other antigen-binding receptors such as transgenic T cell receptors (TCRs). Also among the receptors are other chimeric receptors. A. Chimeric Antigen Receptors (CARs)
[0345] In some embodiments of the provided methods and uses, chimeric receptors, such as a chimeric antigen receptors, contain one or more domains that combine an antigen- or ligand-binding domain (e.g. antibody or antibody fragment) that provides specificity for a desired antigen (e.g., tumor antigen) with intracellular signaling domains. In some embodiments, the intracellular signaling domain is a stimulating or an activating intracellular domain portion, such as a T cell stimulating or activating domain, providing a primary activation signal or a primary signal. In some embodiments, the intracellular signaling domain contains or additionally contains a costimulatory signaling domain to facilitate effector functions. In some embodiments, chimeric receptors when genetically engineered into immune cells can modulate T cell activity, and, in some cases, can modulate T cell differentiation or homeostasis, thereby resulting in genetically engineered cells with improved longevity, survival and / or persistence in vivo, such as for use in adoptive cell therapy methods.
[0346] Exemplary antigen receptors, including CARs, and methods for engineering and introducing such receptors into cells, include those described, for example, in W0200014257, W02013126726, W02012 / 129514, W02014031687, W02013 / 166321, W02013 / 071154, W02013 / 123061, U.S. patent app. Pub. Nos. US2002131960, US2013287748, US20130149337, U.S. Patent Nos. 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118, and European patent app. No. EP2537416, and / or those described by Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): 261338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160-75. In some aspects, the antigen receptors include a CAR as described in U.S. Patent No.: 7,446,190, and those described in W(0 / 2014055668. Examples of the CARs include CARs as disclosed in any of the aforementioned publications, such as W02014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, US 7,446,190, US 8,389,282, Kochenderfer et al., (2013) Nature Reviews Clinical Oncology, 10, 267-276; Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also W02014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, US 7,446,190, and US 8,389,282.
[0347] The recombinant receptors, such as CARs, generally include an extracellular antigen binding domain, such as a portion of an antibody molecule, generally a variable heavy (Vg) chain region and / or variable light (V1) chain region of the antibody, e.g., an scFv antibody fragment.
[0348] In some embodiments, the antigen targeted by the receptor is a polypeptide. In some embodiments, it is a carbohydrate or other molecule. In some embodiments, the antigen is selectively expressed or overexpressed on cells of the disease or condition, e.g., the tumor or pathogenic cells, as compared to normal or non-targeted cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or is expressed on the engineered cells.
[0349] In some embodiments, the antigen targeted by the receptor includes antigens associated with a B cell malignancy, such as any of a number of known B cell marker. In some embodiments, the antigen targeted by the receptor is CD20, CD19, CD22, ROR1, CD45, CD21, CDS, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
[0350] In some embodiments, the chimeric antigen receptor includes an extracellular portion containing an antibody or antibody fragment. In some aspects, the chimeric antigen receptor includes an extracellular portion containing the antibody or fragment and an intracellular signaling domain. In some embodiments, the antibody or fragment includes an scFv.
[0351] In some embodiments, the antigen targeted by the antigen-binding domain is CD19. In some aspects, the antigen-binding domain of the recombinant receptor, e.g., CAR, and the antigen-binding domain binds, such as specifically binds or specifically recognizes, a CD19, such as a human CD19. In some embodiments, the scFv contains a Vy and a Vy. derived from an antibody or an antibody fragment specific to CD19. In some embodiments, the antibody or antibody fragment that binds CD19 is a mouse derived antibody such as FMC63 and SJ25C1. In some embodiments, the antibody or antibody fragment is a human antibody, e.g., as described in U.S. Patent Publication No. US 2016 / 0152723.
[0352] The term “antibody” herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab"), fragments, Fab’ fragments, Fv fragments, recombinant IgG (rIgG) fragments, heavy chain variable (Vu) regions capable of specifically binding the antigen, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific or trispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di- scFv, tandem tri-scFv. Unless otherwise stated, the term “antibody” should be understood to encompass functional antibody fragments thereof also referred to herein as “antigen-binding fragments.” The term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.
[0353] The terms “complementarity determining region,” and “CDR,” synonymous with “hypervariable region” or “HVR,” are known to refer to non-contiguous sequences of amino acids within antibody variable regions, which confer antigen specificity and / or binding affinity. In general, there are three CDRs in each heavy chain variable region (CDR-H1, CDR-H2, CDR-H3) and three CDRs in each light chain variable region (CDR-L1, CDR-L2, CDR-L3). “Framework regions” and “FR” are known to refer to the non-CDR portions of the variable regions of the heavy and light chains. In general, there are four FRs in each full-length heavy chain variable region (FR-H1, FR-H2, FR-H3, and FR-H4), and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4).
[0354] The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) IMB 273,927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732- 745.” (“Contact” numbering scheme); Lefranc MP er al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, 2003 Jan;27(1):55-77 (“IMGT” numbering scheme); Honegger A and Pliickthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657-70, (*Aho” numbering scheme); and Martin ef al., “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272, (“AbM” numbering scheme).
[0355] The boundaries of a given CDR or FR may vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignments, while the Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels™) at different positions, resulting in differential numbering. The Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme. The AbM scheme is a compromise between Kabat and Chothia definitions based on that used by Oxford Molecular’s AbM antibody modeling software.
[0356] Table 5, below, lists exemplary position boundaries of CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3 as identified by Kabat, Chothia, AbM, and Contact schemes, respectively. For CDR-H1, residue numbering is listed using both the Kabat and Chothia numbering schemes. FRs are located between CDRs, for example, with FR-L1 located before CDR-L1, FR-L2 located between CDR- L1 and CDR-L2, FR-L3 located between CDR-L2 and CDR-L3 and so forth. It is noted that because the s...
Claims
Claims WHAT IS CLAIMED: i A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
2. The method of claim 1, wherein: (i) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 105 CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells to at or about 1.5 x 10° CAR+ T cells.
3. The method of claim 1, wherein: (1) if the subject is less than 100 kilograms (kg) in body weight and is younger than 18 years of age, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight or is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells to at or about 0.75 x 10% CAR+ T cells.
4. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, from at or about 0.05 x 108 CAR+ T cells to at or about 1.5 x 10% CAR+ T cells.
5. The method of claim 4, wherein: (i) if the subject is less than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.5 x 10 CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
6. The method of any of claims 1-5, wherein: (1) if the subject is less than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10 CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 0.75 x 10° CAR+ T cells.
7. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.05 x 10° CAR+ T cells.
8. The method of claim 7, wherein, if the subject exhibits no response and does not develop a toxicity at or about 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 days after administration of the T cell composition; further comprising administering to the subject an additional dose of the T cell composition in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.1 x 10® CAR+ T cells.
9. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.15 x 10° CAR+ T cells.
10. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.3 x 10% CAR+ T cells. i A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.5 x 10° CAR+ T cells.
12. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 0.75 x 10° CAR+ T cells.
13. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject that is younger than 18 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is less than 100 kilograms (kg) in body weight, at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject; and (ii) if the subject is at or greater than 100 kilograms (kg) in body weight, at or about 1.0 x 10° CAR+ T cells.
14. A method of treating a subjecting having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, from at or about 0.05 x 10° CAR+ T cells’kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 108 total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, from at or about 0.05 x 10° CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
15. The method of claim 14, wherein: (1) if the subject is younger than 18 years of age, the T cell composition is administered in an amount from at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.5 x 10% CAR+ T cells to at or about 1.5 x 108 CAR+ T cells.
16. The method of claim 14, wherein: (i) if the subject is younger than 18 years of age, the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 0.75 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 0.75 x 108 CAR+ T cells. 17 A method of treating a subjecting having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10% total CAR+ T cells.
18. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age and weighing 12 kg or more, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject, but not exceeding at or about 0.5 x 10° total CAR+ T cells; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
19. The method of any of claims 1-38, wherein if the subject is between 18 and 25 years of age, inclusive, the T cell composition is administered in an amount from at or about 0.05 x 108 CAR+ T cells to at or about 0.75 x 108 CAR+ T cells.
20. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject younger than 18 years of age and weighing 6 kg or more, a composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 108 total CAR+ T cells.
21. The method of any of claims 1-20, wherein if the subject is younger than 18 years of age the T cell composition is administered in an amount from at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 0.75 x 102 total CAR+ T cells.
22. The method of any of claims 1-21, wherein if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 108 total CAR+ T cells.
23. The method of claim 22, wherein, if the subject exhibits no response and does not develop a toxicity at or about 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 days after administration of the T cell composition; further comprising administering to the subject an additional dose of the T cell composition wherein, if the subject is younger than 18 years of age, the additional dose of the T cell composition is administered in an amount that is at least at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.1 x 10° total CAR+ T cells.
24. The method of any of claims 1-21, wherein if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 10° total CAR+ T cells.
25. The method of any of claims 1-21, wherein if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells.
26. The method of any of claims 1-21, wherein if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells.
27. The method of any of claims 1-21, wherein if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.75 x 108 total CAR+ T cells.
28. The method of any of claims 1-21, wherein if the subject is younger than 18 years of age, the T cell composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells’kg body weight of the subject but that does not exceed at or about 1.0 x 10° total CAR+ T cells.
29. The method of any of claims 1-21, wherein the composition is administered in an amount that is at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject to at or about 1.5 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 1.5 x 10 total CAR+ T cells.
30. The method of any of claims 1-21, wherein the composition is administered in an amount that is at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject to at or about 0.75 x 10° CAR+ T cells / kg body weight of the subject, but that does not exceed at or about 0.75 x 10° total CAR+ T cells.
31. The method of any of claims 1-21 and 30, wherein the composition is administered in an amount that is at least at or about 0.05 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.05 x 108 total CAR+ T cells.
32. The method of claim 31, wherein, if the subject exhibits no response and does not develop a toxicity at or about 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 days after administration of the T cell composition; further comprising administering to the subject an additional dose of the T cell composition wherein,, the additional dose of the T cell composition is administered in an amount that is at least at or about 0.1 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.1 x 108 total CAR+ T cells.
33. The method of any of claims 1-21 and 30, wherein the composition is administered in an amount that is at least at or about 0.15 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.15 x 10° total CAR+ T cells. 34, The method of any of claims 1-21 and 30, wherein the composition is administered in an amount that is at least at or about 0.3 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.3 x 10° total CAR+ T cells.
35. The method of any of claims 1-21 and 30, wherein the composition is administered in an amount that is at least at or about 0.5 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 0.5 x 10° total CAR+ T cells.
36. The method of any of claims 1-21 and 30, wherein the composition is administered in an amount that is at least at or about 0.75 x 10° CAR+ T cells’kg body weight of the subject but that does not exceed at or about 0.75 x 102 total CAR+ T cells.
37. The method of any of claims 1-21 and 30, wherein the composition is administered in an amount that is at least at or about 1.0 x 10° CAR+ T cells / kg body weight of the subject but that does not exceed at or about 1.0 x 108% total CAR+ T cells.
38. The method of any of claims 1-37, wherein the subject is at least at or about 6 kg in body weight.
39. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 1.5 x 10% total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, less than at or about 1.5 x 10% CAR+ T cells.
40. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.05 x 10% total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.05 x 10° CAR+ T cells.
41. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.15 x 10% total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.15 x 10° CAR+ T cells.
42. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.3 x 10° total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.3 x 108 CAR+ T cells.
43. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.5 x 10% total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
44. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.75 x 10% total CAR+ T cells in a volume of at least 0.1 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.75 x 10° CAR+ T cells.
45. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 0.5 x 10% total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 0.5 x 10° CAR+ T cells.
46. A method of treating a subject having or suspected of having a B cell malignancy, the method comprising administering, to a subject at or younger than 25 years of age, a T cell composition comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR) at a concentration of at or greater than 2.5 x 10° cells / mL, wherein the T cell composition is administered in an amount selected from: (i) if the subject is younger than 18 years of age, an amount not exceeding at or about 1 x 10% total CAR+ T cells in a volume of at least 0.5 mL; and (ii) if the subject is between 18 and 25 years of age, inclusive, at or about 1.0 x 10° CAR+ T cells.
47. The method of any of claims 1-46, wherein a total volume of at least at or about 0.05 mL of the T cell composition is administered.
48. The method of any of claims 1-46, wherein a total volume of at least at or about 0.1 mL of the T cell composition is administered.
49. The method of any of claims 1-46, wherein a total volume of at least at or about 0.5 mL of the T cell composition is administered.
50. The method of any of claims 1-46, wherein a total volume of at least at or about 1 mL of the T cell composition is administered.
51. The method of any of claims 1-50, wherein the concentration of the T cells is at or greater than 2.5 x 106 cells / mL.
52. The method of any of claims 1-51, wherein a total volume of at least at or about 0.1 mL at a concentration of at or greater than 2.5 x 10 cells / mL of the T cell composition is administered.
53. The method of any of claims 1-51, wherein a total volume of at least at or about 0.5 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered.
54. The method of any of claims 1-51, wherein a total volume of at least at or about 1 mL at a concentration of at or greater than 2.5 x 10° cells / mL of the T cell composition is administered.
55. The method of any of claims 1-54, wherein the T cell composition comprises CD4* and CD8* CAR* T cells.
56. The method of claim 55, wherein the composition comprises a first composition comprising one of the CD4+ T cells and the CD8+ T cells and a second composition comprising the other of the CD4+ T cells and the CD8&+ T cells.
57. The method of claim 56, wherein the first composition and the second composition are administered separately.
58. The method of claim 56 or claim 57, wherein the first composition and the second composition are administered simultaneously.
59. The method of claim 56 or claim 57, wherein the first composition and the second composition are administered sequentially, in either order.
60. The method of any of claims 56-59, wherein the first composition comprises CD4* CAR* T cells and the second composition comprises CD8* CAR* T cells.
61. The method of any of claims 56-59, wherein the first composition comprises CD8* CAR* T cells and the second composition comprises CD4* CAR* T cell.
62. The method of any of claims 56-61, wherein the amount of the T cell composition administered comprises a defined ratio of CD4* CAR" T cells to CD8* CAR* T cells and / or of CD4* T cells to CD8* T cells, that is or is approximately 1:1 or is between approximately 1:3 and approximately 3:
1.
63. The method of claim 62, wherein the defined ratio is or is approximately 1:
1.
64. The method of any of claims 1-63, wherein the B cell malignancy is a lymphoma or a leukemia.
65. The method of any of claims 1-64, wherein the B cell malignancy is relapsed and / or refractory.
66. The method of any of claims 1-65, wherein the B cell malignancy is a B-cell acute lymphoblastic leukemia (B-ALL), optionally CD19+ B-ALL.
67. The method of any of claims 1-66, wherein the B cell malignancy is relapsed or refractory (r / r) B-cell Acute Lymphoblastic Leukemia (B-ALL).
68. The method of claim 67, wherein subject with 1 / r B-ALL has morphological evidence of disease in bone marrow, optionally wherein the subject has 5% or greater lymphoblast by morphology.
69. The method of any of claims 66-68, wherein the subject has a B-ALL comprising any of the following: first or greater marrow relapse, any marrow relapse after allogeneic hematopoietic stem cell transplantation (HSCT); primary refractory, optionally not achieving a complete response (CR) or complete response with incomplete blood count recovery (CRi), optionally following 2 or more separate induction regimens; chemo-refractory, optionally not achieving CR / Cri, optionally after 1 cycle of chemotherapy for relapsed leukemia; or is ineligible for allogeneic HSCT.
70. The method of claim 66 or claim 69, wherein the B-ALL is minimum residual disease positive (MRD™).
71. The method of any of claims 66, 69 or 70, wherein subjects with B-ALL has less than 5% lymphoblast by morphology and / or minimum residual disease positive (MRD+) disease as detected by a validated assay at a frequency of 1 x10 or greater in bone marrow cells after two lines of therapy.
72. The method of any of claims 1-71, wherein the subject has Philadelphia chromosome positive ALL and is intolerant to or have failed one or more lines of tyrosine-kinase inhibitor (TKI) therapy, or TKI therapy is contraindicated.
73. The method of any of claims 1-65, wherein the B cell malignancy is a B-cell non- Hodgkin lymphoma (B-NHL), optionally CD19+ B-NHL.
74. The method of claim 73, wherein the B cell malignancy is relapsed or refractory (r / r) B- cell non-Hodgkin lymphoma (B-NHL).
75. The method of claim 73 or claim 74, wherein the subject has a B-NHL in which there is measurable disease after 1 or more lines of chemotherapy, has failed HSCT, or is ineligible for HSCT.
76. The method of any of claims 73-75, wherein the B-NHL is diffuse large B cell lymphoma (DLBCL), primary mediastinal large B cell lymphoma (PMBCL), or Burkitt's lymphoma (BL).
77. The method of any of claims 1-76, wherein prior to administering the composition, the subject is or has been identified as having cells expressing CD19.
78. The method of claim 77, wherein the expression of CD19 is detected by flow cytometry, optionally in the peripheral blood or bone marrow, and / or by immunohistochemistry, optionally of a bone marrow biopsy.
79. The method of any of claims 1-78, wherein the subject has not received prior cell therapy that comprises administration of a T cell composition comprising T cells expressing a CAR.
80. The method of any of claims 1-78, wherein the subject has received a prior cell therapy that comprises administration of a T cell composition comprising T cells expressing a CAR.
81. The method of any of claims 1-80, wherein the subject has received a prior therapy targeting CD19, optionally wherein the subject is or has been identified as having cells expressing CD19 or having a CD19-positive disease after completion of the prior therapy targeting CD19.
82. The method of any of claims 1-81, wherein, prior to the administration, the subject has been preconditioned with a lymphodepleting therapy comprising the administration of fludarabine and / or cyclophosphamide.
83. The method of any of claims 1-82, further comprising, immediately prior to the administration, administering a lymphodepleting therapy to the subject comprising the administration of fludarabine and / or cyclophosphamide.
84. The method of claims 82 or claim 83, wherein the lymphodepleting therapy comprises administration of cyclophosphamide at about 200-400 mg / m?, optionally at or about 300 mg / m?, inclusive, and / or fludarabine at about 20-40 mg / m?, optionally 30 mg / m?, daily for 2-4 days, optionally for 3 days.
85. The method of any of claims 82-84, wherein the lymphodepleting therapy comprises administration of cyclophosphamide at about 300 mg / m? daily for 3 days and fludarabine at about 30 mg / m? daily for 3 days.
86. The method of any of claims 82-83, wherein the cyclophosphamide and fludarabine are administered concurrently.
87. The method of any of claims 82-86, wherein the lymphodepleting therapy is administered 2-7 days prior to the administration of the T cell composition.
88. The method of any of claims 1-87, wherein the subject is a human.
89. The method of any of claims 1-88, wherein the CAR comprises an scFv specific for a human CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, which optionally is or comprises a human 4-1BB, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule, which optionally is or comprises a human CD3zeta signaling domain, and wherein the CAR optionally further comprises a spacer between the transmembrane domain and the scFv.
90. The method of any of claims 1-89, wherein the CAR comprises, in order, an scFv specific for a human CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, which optionally is or comprises a human 4-1BB signaling domain, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule, which optionally is or comprises a human CD3zeta signaling domain.
91. The method of claim 89 or claim 90, wherein the spacer is a polypeptide spacer that comprises or consists of all or a portion of an immunoglobulin hinge or a modified version thereof, optionally an IgG4 hinge, or a modified version thereof.
92. The method of any of claims 89-91, wherein the spacer is about 15 amino acids or less, optionally at or about 12 amino acids in length.
93. The method of any of claims 89-92, wherein: the spacer comprises or consists of the sequence of SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID O:N 34,0r a variant of any of the foregoing having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto; and / or the spacer comprises the formula X,PPX,P, where X is glycine, cysteine or arginine and X; is cysteine or threonine.
94. The method of any of claims 85-93, wherein the cytoplasmic signaling domain derived from a costimulatory molecule comprises SEQ ID NO: 12 or a variant thereof having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.
95. The method of any of claims 89-94, wherein the cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule comprises SEQ ID NO: 13, 14 or 15 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.
96. The method of any of claims 89-95, wherein: the scFv comprises a variable light (Vy) chain comprising a CDRLI1 sequence of RASQDISKYLN (SEQ ID NO: 35), a CDRL2 sequence of SRLHSGV (SEQ ID NO: 36), and a CDRL3 sequence of GNTLPYTFG (SEQ ID NO: 37), and a variable heavy (Vu) chain comprising a CDRHI1 sequence of DYGVS (SEQ ID NO: 38), a CDRH2 sequence of VIWGSETTYYNSALKS (SEQ ID NO: 39), and a CDRH3 sequence of YAMDYWG (SEQ ID NO: 40); or the scFv comprises a Vi. comprising a CDRL1 sequence of FMC63, a CDRL2 sequence of FMC63, a CDRL3 sequence of FMC63, and a Vi comprising a CDRH1 sequence of FMC63, a CDRH2 sequence of FMC63, and a CDRH3 sequence of FMC63.
97. The method of any of claims 89-96, wherein the scFv comprises a Vyset forth in SEQ ID NO:41 and a V1 set forth in SEQ ID NO:
42.
98. The method of claim 96 or claim 97, wherein the Vi and Vy are separated by a flexible linker, optionally wherein the flexible linker is or comprises the sequence set forth in SEQ ID NO:
24.
99. The method of any of claims 89-98, wherein the scFv is or comprises the sequence set forth in SEQ ID NO:
43. 100 The method of any of claims 1-99, wherein at least at or about 35%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR- expressing T cells, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CCR7, CD27, CD45RA and / or CD28.
101. The method of any of claims 1-100, wherein at least at or about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%. 99% or more of the CAR-expressing T, CAR- expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CCR7.
102. The method of any of claims 1-101, wherein at least at or about 35%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%. 99% or more of the CAR- expressing T cells, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CCR7 and CD45RA.
103. The method of any of claims 1-102, wherein at least at or about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T, CAR- expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CD27.
104. The method of any of claims 1-103, wherein at least at or about 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T cells, CAR-expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are surface positive for CD27 and CD28.
105. The method of any of claims 1-104, wherein at least at or about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the CAR-expressing T cells, CAR- expressing CD4+ T cells or CAR-expressing CD8+ T cells in the composition, are negative for active Caspase 3.
106. The method of any of claims 1-105, wherein the T cells are primary T cells obtained from a subject.
107. The method of any of claims 1-106, wherein the T cells are autologous to the subject.
108. An article of manufacture comprising a composition of a cell therapy, or one of a plurality of compositions of a cell therapy, comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), and instructions for administering the cell therapy, wherein the instructions specify administering the T cell composition according to the methods of any of claims 1-107.
Citation Information
Patent Citations
Therapeutic regimens for chimeric antigen receptor (CAR)- expressing cells
WO2017210617A2