Combination gene targets for improved immunotherapy

Abstract

The present disclosure provides methods and compositions related to the modification of immune effector cells to increase therapeutic efficacy. In some embodiments, immune effector cells modified to reduce expression of one or more endogenous target genes, or to reduce one or more functions of an endogenous protein to enhance effector functions of the immune cells are provided. In some embodiments, immune effector cells further modified by introduction of transgenes conferring antigen specificity, such as exogenous T cell receptors (TCRs) or chimeric antigen receptors (CARs) are provided. Methods of treating a cell proliferative disorder, such as a cancer, using the modified immune effector cells described herein are also provided.

Description

COMBINATION GENE TARGETS FOR IMPROVED IMMUNOTHERAPY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 800,999, filed on February 4, 2019; and U.S. Provisional Patent Application No. 62 / 818,677, filed on March 14, 2019, both of which are incorporated herein by reference in their entireties. DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

[0002] The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: 700061 KSQW-014 ST25 txt; date recorded: February 4, 2020; file size: 945 kilobytes). FIELD

[0003] The disclosure relates to methods, compositions, and components for editing a target nucleic acid sequence, or modulating expression of a target nucleic acid sequence, and applications thereof in connection with immunotherapy, including use with receptor-engineered immune effector cells, in the treatment of cell proliferative diseases, inflammatory diseases, and / or infectious diseases. BACKGROUND

[0004] Adoptive cell transfer utilizing genetically modified T cells, in particular CAR-T cells, has entered clinical testing as a therapeutic for solid and hematologic malignancies. Results to date have been mixed. In hematologic malignancies (especially lymphoma, CLL and ALL), the majority of patients in several Phase 1 and 2 trials exhibited at least a partial response, with some exhibiting complete responses (Kochenderfer ef al., 2012 Blood 1 19, 2709-2720). In 2017, the FDA approved two CAR-T therapies, Kymriah™ and Yescarta™, both for the treatment of hematological cancers. However, in most tumor types (including melanoma, renal cell carcinoma and colorectal cancer), fewer responses have been observed (Johnson ef al., 2009 Blood 1 14, 535-546; Lamers ef al., 2013 Mol. Ther. 21, 904-912; Warren et al, 1998 Cancer Gene Ther. 5, S1-S2). As such, there is considerable room for improvement with adoptive T cell therapies, as success has largely been limited to CAR-T cells approaches targeting hematological malignancies of the B cell lineage. SUMMARY

[0005] There exists a need to improve the efficacy of adoptive transfer of modified immune cells in cancer treatment, in particular increasing the efficacy of adoptive cell therapies against solid malignancies, as reduced responses have been observed in these tumor types (melanoma, renal cell carcinoma and colorectal cancer; Yong, 2017, Imm Cell Biol., 95:356-363). In addition, even in hematological malignancies where a benefit of adoptive transfer has been observed, not all patients respond and relapses occur with a greater than desired frequency, likely as a result of diminished function of the adoptively transferred T cells.

[0006] Factors limiting the efficacy of genetically modified immune cells as cancer therapeutics include: (1) cell proliferation, e.g., limited proliferation of T cells following adoptive transfer; (2) cell survival, e.g., induction of T cell apoptosis by factors in the tumor environment; and (3) cell function, e.g., inhibition of cytotoxic T cell function by inhibitory factors secreted by host immune cells and cancer cells and exhaustion of immune cells during manufacturing processes and / or after transfer.

[0007] Particular features thought to increase the anti-tumor effects of an immune cell include a cell’s ability to: 1) proliferate in the host following adoptive transfer; 2) infiltrate a tumor; 3) persist in the host and / or exhibit resistance to immune cell exhaustion; and 4) function in a manner capable of killing tumor cells. The present disclosure provides immune cells comprising decreased expression and / or function of one or more endogenous target genes wherein the modified immune cells demonstrate an enhancement of one or more effector functions including increased proliferation, increased infiltration into tumors, persistence of the immune cells in a subject, and / or increased resistance to immune cell exhaustion. The present disclosure also provides methods and compositions for modification of immune effector cells to elicit enhanced immune cell activity towards a tumor cell, as well as methods and compositions suitable for use in the context of adoptive immune cell transfer therapy.

[0008] In some embodiments, the present disclosure provides a modified immune effector cell comprising a gene-regulating system capable of reducing the expression and / or function of at least two endogenous target genes selected from SOCSI, PTPN2, and ZC3H12A4, wherein the reduced expression and / or function of the at least two endogenous target genes enhances an effector function of the immune effector cell. In some embodiments, the at least two target genes are SOCS! and PTPN2. In some embodiments, the at least two target genes are SOCS! and ZC3HI12A4. In some embodiments, the at least two target genes are PTPN2 and ZC3H12A. In some embodiments, the gene regulating system is further capable of reducing the expression and / or function of CBLB.

[0009] In some embodiments, the gene-regulating system comprises (i) a nucleic acid molecule; (ii) an enzymatic protein; or (iii) a nucleic acid molecule and an enzymatic protein. In some embodiments, the gene-regulating system comprises a nucleic acid molecule selected from an siRNA, an shRNA, a microRNA (miR), an antagomiR, or an antisense RNA. In some embodiments, the gene- regulating system comprises an enzymatic protein, and wherein the enzymatic protein has been engineered to specifically bind to a target sequence in one or more of the endogenous genes. In some embodiments, the protein is a Transcription activator-like effector nuclease (TALEN), a zinc-finger nuclease, or a meganuclease. In some embodiments, the gene-regulating system comprises a nucleic acid molecule and an enzymatic protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule and the enzymatic protein is a Cas protein or Cas ortholog. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas protein is a wild-type Cas protein comprising two enzymatically active domains, and capable of inducing double stranded DNA breaks. In some embodiments, the Cas protein is a Cas nickase mutant comprising one enzymatically active domain and capable of inducing single stranded DNA breaks. In some embodiments, the Cas protein is a deactivated Cas protein (dCas) and is associated with a heterologous protein capable of modulating the expression of the one or more endogenous target genes. In some embodiments, the heterologous protein is selected from the group consisting of MAX-interacting protein 1 (MXI1), Kriippel- associated box (KRAB) domain, methyl-CpG binding protein 2 (MECP2), and four concatenated mSin3 domains (SID4X).

[0010] In some embodiments, the at least two endogenous genes are SOCS / and PTPN2, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least two endogenous genes are SOCSI and PTPN2, and wherein the gene-regulating system comprises at least one SOCS-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least two endogenous genes are SOCS! and PTPN2, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 185-207. In some embodiments, the at least two endogenous genes are SOCS / and PTPN2, and wherein the gene-regulating system comprises at least one SOCS / -targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 185-207.

[0011] In some embodiments, the at least two endogenous genes are SOCS! and ZC3H124, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4, and at least one ZC3HI2A-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are SOCS! and ZC3H12A, and wherein the gene-regulating system comprises at least one SOCS-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are SOCS! and ZC3H124, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 208-230. In some embodiments, the at least two endogenous genes are SOCSI and ZC3HI124, and wherein the gene-regulating system comprises at least one SOCS / -targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one ZC3H12A4-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 208-230.

[0012] In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H / 2A-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3HI24, and wherein the gene-regulating system comprises at least one P7TPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 185-207 and at least one ZC3H12A4-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 208-230. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3HI124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 185-207 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 208-230.

[0013] In some embodiments, the at least two endogenous genes are SOCS! and PTPN2, and wherein the gene-regulating system comprises at least one SOCSI-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least two endogenous genes are SOCS! and PTPN2, and wherein the gene-regulating system comprises at least one SOCS!-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least two endogenous genes are SOCS / and PTPN2, wherein the gene-regulating system comprises at least one SOCSI-targeting siRNA or shRNA comprising about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one PTPN2-targeting siRNA or shRNA comprising about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 185-207.

[0014] In some embodiments, the at least two endogenous genes are SOCS! and ZC3H124, wherein the gene-regulating system comprises at least one SOCSI-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one ZC3HI12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are SOCS! and ZC3HI12A, wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Table 3 and 4 and at least one ZC3H12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are SOCS! and ZC3H124, wherein the gene-regulating system comprises at least one SOCSI-targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one ZC3H12A4-targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 208-230.

[0015] In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one P7PN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and at least one ZC3HI12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H12A, wherein the gene-regulating system comprises at least one PTPN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one P7PN2-targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 185-207 and at least one ZC3H12A4-targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 208-230.

[0016] In some embodiments, the at least two endogenous genes are SOCS! and PTPN2, and wherein the gene-regulating system comprises at least one SOCS / -targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least two endogenous genes are SOCSI and PTPN2, wherein the gene-regulating system comprises at least one SOCSI-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 185-207.

[0017] In some embodiments, the at least two endogenous genes are SOCS! and ZC3HI24, wherein the gene-regulating system comprises at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one ZC3H12A4-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are SOCS! and ZC3H124, wherein the gene-regulating system comprises at least one SOCSI-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 208-230.

[0018] In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one PTPN2- targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A4-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one PTPN2- targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 185-207 and at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 208-230.

[0019] In some embodiments, the gene-regulating system is introduced to the immune effector cell by transfection, transduction, electroporation, or physical disruption of the cell membrane by a microfluidics device. In some embodiments, the gene-regulating system is introduced as a polynucleotide encoding one or more components of the system, a protein, or a ribonucleoprotein (RNP) complex.

[0020] In some embodiments, the present disclosure provides a modified immune effector cell, comprising reduced expression and / or function of at least two endogenous genes selected from SOCS1, PTPN2, and ZC3H124, wherein the reduced expression and / or function of the at least two endogenous genes enhances an effector function of the immune effector cell. In some embodiments, the at least two target genes are SOCS / and PTPN2. In some embodiments, the at least two target genes are SOCS! and ZC3H12A4. In some embodiments, the at least two target genes are P7PN2 and ZC3HI2A

[0021] In some embodiments, the present disclosure provides a modified immune effector cell, comprising an inactivating mutation in at least two endogenous genes selected from SOCS1, PTPN2, and ZC3HI2A4. In some embodiments, the immune effector cell is a tumor infiltrating lymphocyte (TIL) or a CAR-T cell. In some embodiments, the at least two target genes are SOCS / and PTPN2. In some embodiments, the at least two target genes are SOCSI and ZC3HI124. In some embodiments, the at least two target genes are PTPN2 and ZC3HI2A. In some embodiments, the inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in the genomic sequences of the two or more endogenous genes. In some embodiments, the deletion is a partial or complete deletion of the two or more endogenous target genes. In some embodiments, the inactivating mutation is a frame shift mutation. In some embodiments, the inactivating mutation reduces the expression and / or function of the two or more endogenous target genes.

[0022] In some embodiments, the present disclosure provides a modified immune effector cell, comprising one or more exogenous polynucleotides encoding at least two nucleic acid inhibitors of at least two endogenous target genes selected from SOCSI, PTPN2, and ZC3HI2A. In some embodiments, the immune effector cell is a tumor infiltrating lymphocyte (TIL) or a CAR-T cell. In some embodiments, the at least two target genes are SOCS7 and PTPN2. In some embodiments, the at least two target genes are SOCS! and ZC3H12A. In some embodiments, the at least two target genes are PTPN2 and ZC3HI12A. In some embodiments, the at least two nucleic acid inhibitors reduce the expression and / or function of the two or more endogenous target genes. In some embodiments, the expression of the two or more endogenous target genes is reduced by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to an un-modified or control immune effector cell. In some embodiments, the function of the two or more endogenous target genes is reduced by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to an un-modified or control immune effector cell. In some embodiments, the inactivating mutation or nucleic acid inhibitors substantially inhibits the expression of the two or more endogenous target genes. In some embodiments, the inactivating mutation or nucleic acid inhibitors substantially inhibits the function of the two or more endogenous target genes. In some embodiments, the inactivating mutation or nucleic acid inhibitors enhances one or more effector functions of the modified immune effector cell. In some embodiments, the one or more effector functions are enhanced compared to an un-modified or control immune effector cell.

[0023] In some embodiments, the immune effector cell is a T cell, a natural killer (NK) cell, an NKT cell, or a tumor infiltrating lymphocyte (TIL). In some embodiments, the modified immune effector cell further comprises an exogenous transgene expressing an immune activating molecule. In some embodiments, the immune activating molecule is selected from the group consisting of a cytokine, a chemokine, a co-stimulatory molecule, an activating peptide, an antibody, or an antigen- binding fragment thereof.

[0024] In some embodiments, the effector function is selected from cell proliferation, cell viability, tumor infiltration, cytotoxicity, anti-tumor immune responses, and / or resistance to exhaustion.

[0025] In some embodiments, the modified immune effector cell further comprises an engineered immune receptor displayed on the cell surface. In some embodiments, the engineered immune receptor is a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the engineered immune receptor is an engineered T cell receptor (TCR). In some embodiments, the engineered immune receptor is capable of specifically binding to an antigen expressed on the surface of a target cell, wherein the antigen is a tumor-associated antigen.

[0026] In some embodiments, the present disclosure provides a composition comprising a modified immune effector cell described herein. In some embodiments, the composition comprises at least 1x 10%, 1x 10°, 1x 10% 1x 107, 1x 10%, 1x 10°, 1 x 10°, 1 x 10", or more modified immune effector cells. In some embodiments, the composition comprises a pharmaceutically acceptable carrier or diluent. n some embodiments, the composition comprises autologous immune effector cells. In some embodiments, the composition comprises allogeneic immune effector cells.

[0027] In some embodiments, the present disclosure provides a gene-regulating system capable of reducing expression of at least two endogenous target genes in a cell selected from SOCS1 / , PTPN2, and ZC3HI124, comprising (i) a nucleic acid molecule; (ii) an enzymatic protein; or (iii) a nucleic acid molecule and an enzymatic protein. In some embodiments, the at least two target genes are SOCS! and PTPN2. In some embodiments, the at least two target genes are SOCS! and ZC3H12A. In some embodiments, the at least two endogenous genes are PTPN2 and ZC3HI24.

[0028] In some embodiments, the system comprises at least two guide RNA (gRNA) nucleic acid molecules and a Cas endonuclease. In some embodiments, the at least two target genes are SOCS / and PTPN2, and wherein the system comprises at least one SOCS / -targeting guide RNA (gRNA) molecule, at least one P7PN2-targeting gRNA molecule, and a Cas endonuclease. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207.

[0029] In some embodiments, the at least two target genes are SOCS! and ZC3H124, and wherein the system comprises at least one SOCS!-targeting gRNA molecule, at least one ZC3H12A4- targeting gRNA molecule, and a Cas endonuclease. In some embodiments, the at least one SOCSI- targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3HI2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230. In some embodiments, the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H124-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0030] In some embodiments, the at least two endogenous genes are PTPN2 and ZC3H124, wherein the system comprises at least one PTNP2-targeting gRNA molecule, at least one ZC3H124- targeting gRNA molecule, and a Cas endonuclease. In some embodiments, the at least one PTPN2- targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0031] In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas protein is a wild-type Cas protein comprising two enzymatically active domains, and capable of inducing double stranded DNA breaks. In some embodiments, the Cas protein is a Cas nickase mutant comprising one enzymatically active domain and capable of inducing single stranded DNA breaks. In some embodiments, the Cas protein is a deactivated Cas protein (dCas) and is associated with a heterologous protein capable of modulating the expression of the one or more endogenous target genes. In some embodiments, the heterologous protein is selected from the group consisting of MAX- interacting protein 1 (MXI1), Kriippel-associated box (KRAB) domain, and four concatenated mSin3 domains (SID4X).

[0032] In some embodiments, the system comprises at least two nucleic acid molecules and wherein the at least two nucleic acid molecules are selected from an siRNA, an shRNA, a microRNA (miR), an antagomiR, or an antisense RNA. In some embodiments, the at least two target genes are SOCS! and PTPN2, and wherein the system comprises at least one SOCS / -targeting guide siRNA or shRNA molecule and at least one PTPN2-targeting siRNA or shRNA molecule. In some embodiments, the SOCS / -targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the atleast one SOCS!-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19- 30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the at least one SOCS!-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207.

[0033] In some embodiments, the at least two target genes are SOCSI and ZC3HI124, and wherein the system comprises at least one SOCS!-targeting guide siRNA or shRNA molecule and at least one ZC3H12A-targeting siRNA or shRNA molecule. In some embodiments, the at least one SOCS1-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H / 2A-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A4-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides and binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCSI-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230.

[0034] In some embodiments, the at least two target genes are PTPN2 and ZC3HI24, and wherein the system comprises at least one PTPN2-targeting guide siRNA or shRNA molecule and at least one ZC3H12A-targeting siRNA or shRNA molecule. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A4-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230.

[0035] In some embodiments, the gene-regulating system comprises an enzymatic protein, and wherein the enzymatic protein has been engineered to specifically bind to a target sequence in one or more of the endogenous genes. In some embodiments, the system comprises a protein comprising a DNA binding domain and an enzymatic domain and is selected from a zinc finger nuclease and a transcription-activator-like effector nuclease (TALEN). In some embodiments, the system comprises one or more vectors encoding at least one gRNA targeting a first target gene, at least one gRNA targeting a second target gene, and a Cas endonuclease protein, wherein the first target gene is SOCS7 and the least one SOCS!-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151, and wherein the second target gene is PTPN2 and the at least one PTPN2-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207.

[0036] In some embodiments, the gene-regulating system comprises one or more vectors encoding at least one gRNA targeting a first target gene, at least one gRNA targeting a second target gene, and a Cas endonuclease protein, wherein the first target gene is SOCS! and the least one SOCSI- targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151, and wherein the second target gene is ZC3H12A4 and the at least one ZC3H12A-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0037] In some embodiments, the gene-regulating system comprises one or more vectors encoding at least one gRNA targeting a first target gene, at least one gRNA targeting a second target gene, and a Cas endonuclease protein, wherein the first target gene is PTPN2 and the PTPN2-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, and wherein the second target gene is ZC3H / 24 and the at least one ZC2H12A- targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0038] In some embodiments, the at least one gRNA targeting the first target gene, the at least one gRNA targeting the second target gene, and the Cas endonuclease protein are encoded by one vector. In some embodiments, the at least one gRNA targeting the first target gene and the at least one gRNA targeting the second target gene are encoded by a first vector, and the Cas endonuclease protein is encoded by a second vector. In some embodiments, the at least one gRNA targeting the first target gene is encoded by a first vector, the at least one gRNA targeting the second target gene is encoded by a second vector, and the Cas endonuclease protein is encoded by a third vector.

[0039] In some embodiments, the gene-regulating system comprises (i) one or more vectors encoding at least one SOCS / -targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and at least one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207; and (ii) an mRNA molecule encoding the Cas endonuclease protein.

[0040] In some embodiments, the gene-regulating system comprises (i) one or more vectors encoding at least one SOCS-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230; and (ii) an mRNA molecule encoding the Cas endonuclease protein.

[0041] In some embodiments, the gene-regulating system comprises (i) one or more vectors encoding at least one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207 and at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230; and (ii) an mRNA molecule encoding the Cas endonuclease protein.

[0042] In some embodiments, the at least one gRNA targeting the first target gene and the at least one gRNA targeting the second target gene are encoded by one vector. In some embodiments, the at least one gRNA targeting the first target gene is encoded by a first vector and the at least one gRNA targeting the second target gene is encoded by a second vector.

[0043] In some embodiments, the gene-regulating system comprises (i) at least one SOCSI- targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 complexed to a first Cas endonuclease protein to form a first ribonucleoprotein (RNP) complex; and (ii) at least one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207 complexed to a second Cas endonuclease protein to form a second RNP complex.

[0044] In some embodiments, the gene-regulating system comprises (i) at least one SOCSI- targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 complexed to a first Cas endonuclease protein to form a first RNP complex; and (ii) at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230 complexed to a second Cas endonuclease protein to form a second RNP complex.

[0045] In some embodiments, the gene-regulating system comprises (i) at least one PTPN2- targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207 complexed to a first Cas endonuclease protein to form a first RNP complex; and (ii) at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230 complexed to a second Cas endonuclease protein to form a second RNP complex.

[0046] In some embodiments, the present disclosure provides a kit comprising a gene- regulating system described herein.

[0047] In some embodiments, the present disclosure provides a composition comprising a plurality of gRNA molecules, wherein the plurality of gRNA molecules comprises at least one gRNA molecule targeting a first target gene and at least one gRNA molecule targeting a second target gene, wherein the first and second target gene are selected from SOCSZ, PTPN2, and ZC3HI2A. In some embodiments, the first target gene is SOCS! / and the second target gene is PTPN2. In some embodiments, the plurality of gRNA molecules comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the plurality of gRNA molecules comprises at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the plurality of gRNA molecules comprises at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207. In some embodiments, the plurality of gRNA molecules comprises at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207.

[0048] In some embodiments, the first target gene is SOCS / and the second target gene is ZC3HI24. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCS / - targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC 3H / 2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208- 230. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0049] In some embodiments, the first target gene is PTPN2 and the second target gene is ZC3HI2A4. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H]2A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2- targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3HI2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0050] In some embodiments, the gRNAs are modular gRNA molecules. In some embodiments, the gRNAs are dual gRNA molecules. In some embodiments, the gRNA targeting domains are 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or more nucleotides in length. In some embodiments, the RNAs comprise a modification at or near the 5° end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 5° end) and / or a modification at or near the 3” end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 3° end). In some embodiments, the modified gRNAs exhibit increased resistance to nucleases when introduced into an immune effector cell. In some embodiments, the modified gRNAs do not induce an innate immune response when introduced into an immune effector cell or induce a decreased innate immune response compared to an unmodified gRNA when introduced into an immune effector cell.

[0051] In some embodiments, the present disclosure provides a polynucleotide molecule encoding a plurality of gRNA molecules, wherein the plurality of gRNA molecules comprises at least one gRNA molecule targeting a first target gene and at least one gRNA molecule targeting a second target gene, wherein the first and second target gene are selected from SOCS / , PTPN2, and ZC3H12A4.

[0052] In some embodiments, the first target gene is SOCS / and the second target gene is PTPN2. In some embodiments, the plurality of gRNA molecules comprises at least one SOCS!- targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2- targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the plurality of gRNA molecules comprises at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the plurality of gRNA molecules comprises at least one SOCS!-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2- targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207. In some embodiments, the plurality of gRNA molecules comprises at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2- targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207.

[0053] In some embodiments, the first target gene is SOCS! and the second target gene is ZC3HI24. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCSI- targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC 3H 12A4-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208- 230. In some embodiments, the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0054] In some embodiments, the first target gene is PTPN2 and the second target gene is ZC3HI2A. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H / 2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2- targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230. In some embodiments, at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230.

[0055] In some embodiments, the present disclosure provides a polynucleotide molecule encoding a plurality of siRNA or shRNA molecules, wherein the plurality of siRNA or shRNA molecules comprises at least one siRNA or shRNA molecule targeting a first target gene and at least one siRNA or shRNA molecule targeting a second target gene, wherein the first and second target gene are selected from SOCS!, PTPN2, and ZC3HI24.

[0056] In some embodiments, the first target gene is SOCS / and the second target gene is PTPN2. In some embodiments, the plurality of siRNA or shRNA molecules comprises at least one SOCS targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting siRNA or siRNA molecule comprising a targeting domain sequence complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the plurality of siRNA or shRNA molecules comprises at least one SOCS / -targeting siRNA or shRNA molecule comprising a targeting domain sequence t that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207.

[0057] In some embodiments, the first target gene is SOCS! and the second target gene is ZC3HI24. In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H124- targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one SOCSI-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs; 208-230.

[0058] In some embodiments, the first target gene is PTPN2 and the second target gene is ZC3HI24. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H124- targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207 and the at least one ZC3HI2A-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230.

[0059] In some embodiments, the present disclosure provides a polynucleotide molecule encoding at least one TALEN, zinc finger, or meganuclease protein targeting a first target gene and at least one TALEN, zinc finger, or meganuclease protein targeting a second target gene, wherein the first and second target gene are selected from SOCS1, PTPN2, and ZC3HI12A.

[0060] In some embodiments, the first target gene is SOCS! and the second target gene is PTPN2. In some embodiments, the polynucleotide encodes at least one SOCSI-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2- targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6. In some embodiments, the polynucleotide encodes at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 185-207.

[0061] In some embodiments, the first target gene is SOCS! and the second target gene is ZC3HI124. In some embodiments, the polynucleotide encodes at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the polynucleotide encodes at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 208-230.

[0062] In some embodiments, the first target gene is P7PN2 and the second target gene is ZC3HI24. In some embodiments, the polynucleotide encodes least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8. In some embodiments, the polynucleotide encodes at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 185-207 and at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 208-230.

[0063] In some embodiments, the present disclosure provides a composition comprising the polynucleotide described herein.

[0064] In some embodiments, the present disclosure provides a kit comprising the polynucleotide or composition described herein.

[0065] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising: introducing a gene-regulating system into the immune effector cell, wherein the gene-regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS!I, PTPN2, and ZC3HI2A.

[0066] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising: obtaining an immune effector cell from a subject; introducing a gene-regulating system into the immune effector cell, wherein the gene-regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3H124; and culturing the immune effector cell such that the expression and / or function of one or more endogenous target genes is reduced compared to an immune effector cell that has not been modified. In some embodiments, the gene-regulating system is one selected from those described herein. In some embodiments, the method further comprises introducing a polynucleotide sequence encoding an engineered immune receptor selected from a CAR and a TCR. In some embodiments, the gene-regulating system and / or the polynucleotide encoding the engineered immune receptor are introduced to the immune effector cell by transfection, transduction, electroporation, or physical disruption of the cell membrane by a microfluidics device. In some embodiments, the gene-regulating system is introduced as a polynucleotide sequence encoding one or more components of the system, as a protein, or as a ribonucleoprotein (RNP) complex.

[0067] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising: expanding a population of immune effector cells in a first round expansion and a second round of expansion; and introducing a gene-regulating system into the population of immune effector cells, wherein the gene-regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCSZ, PTPN2, and ZC3HI2A

[0068] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising: obtaining a population of immune effector cells; expanding the population of immune effector cells in a first round expansion and a second round of expansion; introducing a gene-regulating system into the population of immune effector cells, wherein the gene-regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS / , PTPN2, and ZC3H 124; and culturing the immune effector cell such that the expression and / or function of one or more endogenous target genes is reduced compared to an immune effector cell that has not been modified. In some embodiments, the gene-regulating system is introduced to the population of immune effector cells prior to the first and second rounds of expansion. In some embodiments, the gene-regulating system is introduced to the population of immune effector cells after the first round of expansion and prior to the second round of expansion. In some embodiments, the gene-regulating system is introduced to the population of immune effector cells after the first and second rounds of expansion. In some embodiments, the gene- regulating system is one selected from those described herein.

[0069] In some embodiments, the present disclosure provides a method of treating a disease or disorder in a subject in need thereof comprising administering to the subject an effective amount of the modified immune effector cells described herein or composition thereof. In some embodiments, the disease or disorder is a cell proliferative disorder, an inflammatory disorder, or an infectious disease. In some embodiments, the disease or disorder is a cancer or a viral infection. In some embodiments, the cancer is selected from a leukemia, a lymphoma, or a solid tumor. In some embodiments, the solid tumor is a melanoma, a pancreatic tumor, a bladder tumor, or a lung tumor or metastasis. In some embodiments, the cancer is a PD] resistant or insensitive cancer. In some embodiments, the subject has previously been treated with a PD1 inhibitor or a PDL1 inhibitor. In some embodiments, the modified immune effector cells are autologous to the subject. In some embodiments, the modified immune effector cells are allogenic to the subject.

[0070] In some embodiments, the method further comprises administering to the subject an antibody or binding fragment thereof that specifically binds to and inhibits the function of the protein encoded by NRP1, HAVCR2, LAG3, TIGIT, CTLA4, or PDCD1. In some embodiments, the subject has not undergone lymphodepletion prior to administration of the modified immune effector cells or compositions thereof. In some embodiments, administration of the modified immune effector cells or compositions thereof to the subject is not accompanied by high dose IL-2 treatment. In some embodiments, administration of the modified immune effector cells or compositions thereof to the subject is not accompanied by any IL-2 treatment. In some embodiments, the subject has not undergone any IL-2 treatment prior to administration of the modified immune effector cells or compositions thereof. In some embodiments, the subject has not undergone any high dose IL-2 treatment prior to administration of the modified immune effector cells or compositions thereof. In some embodiments, the subject has not undergone lymphodepletion prior to administration of the modified immune effector cells or compositions thereof and the administration of modified immune effector cells or compositions thereof to the subject is not accompanied by high dose IL-2 treatment. In some embodiments, the subject has not undergone lymphodepletion prior to administration of the modified immune effector cells or compositions thereof and the administration of modified immune effector cells or compositions thereof to the subject is not accompanied by any IL-2 treatment. In some embodiments, the subject has not undergone lymphodepletion or high dose IL-2 treatment prior to administration of the modified immune effector cells or compositions thereof. In some embodiments, the subject has not undergone lymphodepletion or any IL-2 treatment prior to administration of the modified immune effector cells or compositions thereof.

[0071] In some embodiments, the present disclosure provides a method of killing a cancerous cell comprising exposing the cancerous cell to a modified immune effector cell described herein or composition thereof, wherein exposure to the modified immune effector cell results in increased killing of the cancerous cells compared to exposure to an immune effector cell that has not been modified. In some embodiments, the exposure is in vitro, in vivo, or ex vivo.

[0072] In some embodiments, the present disclosure provides a method of enhancing one or more effector functions of an immune effector cell comprising introducing a gene-regulating system into the immune effector cell, wherein the gene-regulating system is capable of reducing the expression and / or function of at least two endogenous target genes selected from SOCS!, PTPN2, and ZC3HI2A.

[0073] In some embodiments, the present disclosure provides a method of enhancing one or more effector functions of an immune effector cell comprising: introducing a gene-regulating system into the immune effector cell, wherein the gene-regulating system is capable of reducing the expression and / or function of at least two endogenous target genes selected from SOCS!, PTPN2, and ZC3H124; and culturing the immune effector cell such that the expression and / or function of one or more endogenous target genes is reduced compared to an immune effector cell that has not been modified, wherein the modified immune effector cell demonstrates one or more enhanced effector functions compared to the immune effector cell that has not been modified. In some embodiments, the one or more effector functions are selected from cell proliferation, cell viability, cytotoxicity, tumor infiltration, increased cytokine production, anti-tumor immune responses, and / or resistance to exhaustion. In some embodiments, the gene-regulating system is one described herein.

[0074] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising introducing an inactivating mutation in at least two endogenous target genes in an immune effector cell, wherein the at least two endogenous target genes are selected from SOCS1, PTPN2, and ZC3HI2A.

[0075] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising: expanding a population of immune effector cells in a first round expansion and a second round of expansion; and introducing an inactivating mutation in at least two endogenous target genes in the population of immune effector cells, wherein the at least two endogenous target genes are selected from SOCS1, PTPN2, and ZC3H12A.

[0076] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising introducing one or more exogenous polynucleotides encoding at least two nucleic acid inhibitors of at least two endogenous target genes in an immune effector cell, wherein the at least two endogenous target genes are selected from SOCSZ, PTPN2, and ZC3HI2A.

[0077] In some embodiments, the present disclosure provides a method of producing a modified immune effector cell comprising: expanding a population of immune effector cells in a first round expansion and a second round of expansion; and introducing one or more exogenous polynucleotides encoding at least two nucleic acid inhibitors of at least two endogenous target genes in the population of immune effector cells, wherein the at least two endogenous target genes are selected from SOCSI, PTPN2, and ZC3HI12A.

[0078] In some embodiments, the methods further comprise introducing a polynucleotide sequence encoding an engineered immune receptor selected from a CAR and a TCR. In some embodiments, the inactivating mutation is introduced by the nucleic acid gene-regulating system of any one of the preceding claims. In some embodiments, the at least two nucleic acid inhibitors are comprised in a gene-regulating system described herein. In some embodiments, the disclosure provides a method of killing a cancerous cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of modified immune effector cell according to any one of claims 1-57 or the composition of any one of claims 79- 83, wherein exposure to the modified immune effector cell results in increased killing of the cancerous cells compared to exposure to an immune effector cell that has not been modified, wherein the number of modified immune effector cells necessary to comprise a therapeutically effective amount is at least ten fold less or at least 100 fold less than the number of non-modified immune effector cells necessary to comprise a therapeutically effective amount. In some embodiments, the number of modified immune effector cells necessary to comprise a therapeutically effective amount is at least 1 x 10°, 5 x 10%, 1x 10% 5x 10% 1x 10%, 5x 10°, 1 x 105, 2x 10%, 3 x 10%, 4x 10%, 5x 10%, 1x 107, 5x 107, 1 x 108, 5x 10% 1x 10° cells. BRIEF DESCRIPTION OF THE FIGURES

[0079] Fig. 1 shows the anti-tumor efficacy of Ppm2 / Socs! dual-edited transgenic T cells in a B16-Ova murine tumor model.

[0080] Fig. 2 shows the anti-tumor efficacy of Zc3hi12a / Socsl dual-edited transgenic T cells in a B16-Ova murine tumor model.

[0081] Fig. 3 shows the anti-tumor efficacy of Zc3h12a / SocsI dual-edited TILs in a B16-Ova ‘murine tumor model

[0082] Fig. 4 shows the anti-tumor efficacy of Pdl / Lag3 dual-edited transgenic T cells in a B16-Ova murine tumor model.

[0083] Fig. 5 shows the increase in pSTATS levels in primary human CD8 T cells in response to IL-2 signaling after deletion of SOCSI.

[0084] Fig. 6 shows the increase pSTATI levels in Jurkat T cells in response to IFNy stimulation after genetic knockdown of PTPN2.

[0085] Figs. 7A-7D show the production of IFNy (Fig. 7A) and TNFa (Fig. 7B) by dual SOCS1 / PTPN2-edited human TILs as well as the ability of CD8 T cells within TIL populations to degranulate as measured by positivity (Fig. 7C) and intensity (Fig. 7D) of CD107a staining upon stimulation with phorbol 12-myristate 13-acetate (PMA) and ionomycin.

[0086] Figs. 8A-8D show the ability of Pspn2" / Socs!” OT1s to completely regress 100mm? B160va tumors in seventeen out of eighteen mice. (Fig. 8A). Also shown is the ability of the mice who previously regressed a B160va tumor to completely resist subsequent inoculation with B160va and partially resist subsequent parental B16F10 tumor inoculation. (Fig. 8B). The OT1 population in peripheral blood was tracked over the course of the rechallenge study (Fig. 8C) along with their memory phenotype (Fig. 8D).

[0087] Figs. 9A-9E show the ability of Pepn2” / Socsl”" OT1s to completely regress larger 343mm® B160va tumors in eight out of eight mice. (Fig. 9A). In a separate cohort of mice total OT1 infiltration into the tumor (Fig. 9B) and their ability to produce granzyme B (Fig. 9C) is presented. Also shown is the ability of the mice who previously regressed a B160va tumor to completely resist subsequent inoculation with B160va and partially resist subsequent parental B16F10 tumor inoculation. (Fig. 9D). The OT1 population in peripheral blood was tracked over the course of the rechallenge study along with their memory phenotype. (Fig. 9E).

[0088] Figs. 10A-G shows tumor volume measurements after increasing doses of Pipn2 / Socs! dual-edited or control edited mouse OT1 CD8+ T cells adoptively transferred into the large tumor B160va model. Figs. 10A-10D show control cells administered at 4.1x10% 4.1x10°, 4.1x10° and 4.1x107, respectively. Figs. 10E-10G show Ptpn2 / Socs! dual-edited cells administered at 4.1x10%, 4.1x10%, 4.1x10° and 4.1x107, respectively. Each line represents the results for a separate animal. DETAILED DESCRIPTION

[0089] The present disclosure provides methods and compositions related to the modification of immune effector cells to increase their therapeutic efficacy in the context of immunotherapy. In some embodiments, immune effector cells are modified by the methods of the present disclosure to reduce the expression and / or function of two or more endogenous target genes selected from SOCS!, PTPN2, and ZC3H12A such that one or more effector functions of the immune cells are enhanced. In some embodiments, the immune effector cells are further modified by introduction of transgenes conferring antigen specificity, such as introduction of T cell receptor (TCR) or chimeric antigen receptor (CAR) expression constructs. In some embodiments, the present disclosure provides compositions and methods for modifying the immune effector cells, such as compositions of gene- regulating systems capable of reducing the expression and / or function of two or more endogenous target genes selected from SOCSI, PTPN2, and ZC3HI2A. In some embodiments, the present disclosure provides methods of treating a cell proliferative disorder, such as a cancer, comprising administration of the modified immune effector cells described herein to a subject in need thereof, 1. Definitions

[0090] As used in this specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the content clearly dictates otherwise.

[0091] As used in this specification, the term “and / or” is used in this disclosure to mean either “and” or “or” unless indicated otherwise.

[0092] Throughout this specification, unless the context requires otherwise, the words “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0093] As used in this application, the terms “about” and “approximately” are used as equivalents. Any numerals used in this application with or without about / approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0094] “Decrease” or “reduce” refers to a decrease or a reduction in a particular value of at least 5%, for example, a 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% decrease as compared to a reference value. A decrease or reduction in a particular value may also be represented as a fold-change in the value compared to a reference value, for example, atleasta 1.1,1.2,13,14,1.5,16,1.7,1.8,19, 2, 3,4,5,6,7,8,9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold, or more, decrease as compared to a reference value.

[0095] “Increase” refers to an increase in a particular value of at least 5%, for example, a 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, 200%, 300%, 400%, 500%, or more increase as compared to a reference value. An increase in a particular value may also be represented as a fold-change in the value compared to a reference value, for example, at leasta 1.1,1.2,1.3,14,1.5,16, 1.7, 18, 1.9, 2, 3, 4, 5,6,7,8,09, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000-fold or more, increase as compared to the level of a reference value.

[0096] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[0097] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. “Oligonucleotide” generally refers to polynucleotides of between about 5 and about 100 nucleotides of single- or double-stranded DNA. However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as “oligomers” or “oligos” and may be isolated from genes, or chemically synthesized by methods known in the art. The terms “polynucleotide” and “nucleic acid” should be understood to include, as applicable to the embodiments being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.

[0098] “Fragment” refers to a portion of a polypeptide or polynucleotide molecule containing less than the entire polypeptide or polynucleotide sequence. In some embodiments, a fragment of a polypeptide or polynucleotide comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% of the entire length of the reference polypeptide or polynucleotide. In some embodiments, a polypeptide or polynucleotide fragment may contain 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more nucleotides or amino acids.

[0099] The term “sequence identity” refers to the percentage of bases or amino acids between two polynucleotide or polypeptide sequences that are the same, and in the same relative position. As such one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. The term “reference sequence” refers to a molecule to which a test sequence is compared.

[00100] “Complementary” refers to the capacity for pairing, through base stacking and specific hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of a nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a target, then the bases are considered to be complementary to each other at that position. Nucleic acids can comprise universal bases, or inert abasic spacers that provide no positive or negative contribution to hydrogen bonding. Base pairings may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Nichols ef al., Nature, 1994;369:492-493 and Loakes ef al., Nucleic Acids Res., 1994;22:4039-4043. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.

[00101] As referred to herein, a “complementary nucleic acid sequence” is a nucleic acid sequence comprising a sequence of nucleotides that enables it to non-covalently bind to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength.

[00102] Methods of sequence alignment for comparison and determination of percent sequence identity and percent complementarity are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), by manual alignment and visual inspection (see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology), by use of algorithms know in the art including the BLAST and BLAST 2.0 algorithms, which are described in Altschul ez al, (1977) Nuc. Acids Res. 25:3389-3402; and Altschul ef al., (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[00103] Herein, the term “hybridize” refers to pairing between complementary nucleotide bases (e.g., adenine (A) forms a base pair with thymine (T) in a DNA molecule and with uracil (U) in an RNA molecule, and guanine (G) forms a base pair with cytosine (C) in both DNA and RNA molecules) to form a double-stranded nucleic acid molecule. (See, e.g., Wahl and Berger (1987) Methods Enzymol. 152:399; Kimmel, (1987) Methods Enzymol. 152:507). In addition, it is also known in the art that for hybridization between two RNA molecules (e.g., dsRNA), guanine (G) base pairs with uracil (U). For example, G / U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. In the context of this disclosure, a guanine (G) of a protein-binding segment (dsRNA duplex) of a guide RNA molecule is considered complementary to a uracil (U), and vice versa. As such, when a G / U base-pair can be made at a given nucleotide position a protein-binding segment (dsRNA duplex) of a guide RNA molecule, the position is not considered to be non-complementary, but is instead considered to be complementary. It is understood in the art that the sequence of polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g, a loop structure or hairpin structure). A polynucleotide can comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted.

[00104] The term “modified” refers to a substance or compound (e.g., a cell, a polynucleotide sequence, and / or a polypeptide sequence) that has been altered or changed as compared to the corresponding unmodified substance or compound.

[00105] The term “naturally-occurring” as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is naturally occurring.

[00106] “Isolated” refers to a material that is free to varying degrees from components which normally accompany it as found in its native state.

[00107] An “expression cassette” or “expression construct” refers to a DNA polynucleotide sequence operably linked to a promoter. “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of the polynucleotide sequence.

[00108] The term “recombinant vector” as used herein refers to a polynucleotide molecule capable transferring or transporting another polynucleotide inserted into the vector. The inserted polynucleotide may be an expression cassette. In some embodiments, a recombinant vector may be viral vector or a non-viral vector (e.g., a plasmid).

[00109] The term “sample” refers to a biological composition (e.g., a cell or a portion of a tissue) that is subjected to analysis and / or genetic modification. In some embodiments, a sample is a “primary sample” in that it is obtained directly from a subject; in some embodiments, a “sample” is the result of processing of a primary sample, for example to remove certain components and / or to isolate or purify certain components of interest.

[00110] The term “subject” includes animals, such as e.g. mammals. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; or domesticated animals such as dogs and cats. In some embodiments (e.g., particularly in research contexts) subjects are rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like. The terms “subject” and “patient” are used interchangeably herein.

[00111] “Administration” refers herein to introducing an agent or composition into a subject.

[00112] “Treating” as used herein refers to delivering an agent or composition to a subject to affect a physiologic outcome.

[00113] As used herein, the term “effective amount” refers to the minimum amount of an agent or composition required to result in a particular physiological effect. The effective amount of a particular agent may be represented in a variety of ways based on the nature of the agent, such as mass / volume, # of cells / volume, particles / volume, (mass of the agent) / (mass of the subject), # of cells / (mass of subject), or particles / (mass of subject). The effective amount of a particular agent may also be expressed as the half-maximal effective concentration (ECs), which refers to the concentration of an agent that results in a magnitude of a particular physiological response that is half-way between a reference level and a maximum response level.

[00114] “Population” of cells refers to any number of cells greater than 1, but is preferably at least 1x10? cells, at least 1x10* cells, at least 1x10° cells, at least 1x10° cells, at least 1x10” cells, at least 1x108 cells, at least 1x10 cells, at least 1x10'° cells, or more cells. A population of cells may refer to an in vitro population (e.g., a population of cells in culture) or an in vivo population (e.g., a population of cells residing in a particular tissue).

[00115] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel ef al. eds., John Wiley & Sons 1999); Protein Methods (Bollag ef al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. 11. Modified Immune Effector Cells

[00116] In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of two or more endogenous target genes selected from SOCS1, PTPN2, and ZC3HI2A. In some embodiments, the present disclosure provides modified immune effector cells comprising a gene-regulating system capable of reducing the expression and / or function of two or more endogenous target genes selected from SOCS!, PTPN2, and ZC3HI2A. Herein, the term “modified immune effector cells” encompasses immune effector cells comprising one or more genomic modifications resulting in the reduced expression and / or function of two or more endogenous target genes as well as immune effector cells comprising a gene-regulating system capable of reducing the expression and / or function of two or more endogenous target genes. Herein, an “un-modified immune effector cell” or “control immune effector cell” refers to a cell or population of cells wherein the genomes have not been modified and that does not comprise a gene-regulating system or comprises a control gene-regulating system (e.g., an empty vector control, a non-targeting gRNA, a scrambled siRNA, etc.).

[00117] The term “immune effector cell” refers to cells involved in mounting innate and adaptive immune responses, including but not limited to lymphocytes (such as T-cells (including thymocytes) and B-cells), natural killer (NK) cells, NKT cells, macrophages, monocytes, eosinophils, basophils, neutrophils, dendritic cells, and mast cells. In some embodiments, the modified immune effector cell is a T cell, such as a CD4+ T cell, a CD8+ T cell (also referred to as a cytotoxic T cell or CTL), a regulatory T cell (Treg), a Th1 cell, a Th2 cell, or a Th17 cell.

[00118] In some embodiments, the modified immune effector cell is a T cell that has been isolated from a tumor sample (referred to herein as “tumor infiltrating lymphocytes” or “TILs”). Without wishing to be bound by theory, it is thought that TILs possess increased specificity to tumor antigens (Radvanyi ef al., 2012 Clin Canc Res 18:6758-6770) and can therefore mediate tumor antigen-specific immune response (e.g, activation, proliferation, and cytotoxic activity against the cancer cell) leading to cancer cell destruction (Brudno ef al., 2018 Nat Rev Clin Onc 15:31-46)) without the introduction of an exogenous engineered receptor. Therefore, in some embodiments, TILs are isolated from a tumor in a subject, expanded ex vivo, and re-infused into a subject. In some embodiments, TILs are modified to express one or more exogenous receptors specific for an autologous tumor antigen, expanded ex vivo, and re-infused into the subject. Such embodiments can be modeled using in vivo mouse models wherein mice have been transplanted with a cancer cell line expressing a cancer antigen (e.g, CD19) and are treated with modified T cells that express an exogenous receptor that is specific for the cancer antigen (See e.g., Examples 6-9).

[00119] In some embodiments, the modified immune effector cell is an animal cell or is derived from an animal cell, including invertebrate animals and vertebrate animals (e.g., fish, amphibian, reptile, bird, or mammal). In some embodiments, the modified immune effector cell is a mammalian cell or is derived from a mammalian cell (e.g., a pig, a cow, a goat, a sheep, a rodent, a non-human primate, a human, etc.). In some embodiments, the modified immune effector cell is a rodent cell or is derived from a rodent cell (e.g, a rat or a mouse). In some embodiments, the modified immune effector cell is a human cell or is derived from a human cell.

[00120] In some embodiments, the modified immune effector cells comprise one or more modifications (e.g., insertions, deletions, or mutations of one or more nucleic acids) in the genomic DNA sequence of an endogenous target gene resulting in the reduced expression and / or function the endogenous gene. In such embodiments, the modified immune effector cells comprise a “modified endogenous target gene.” In some embodiments, the modifications in the genomic DNA sequence reduce or inhibit mRNA transcription, thereby reducing the expression level of the encoded mRNA transcript and protein. In some embodiments, the modifications in the genomic DNA sequence reduce or inhibit mRNA translation, thereby reducing the expression level of the encoded protein. In some embodiments, the modifications in the genomic DNA sequence encode a modified endogenous protein with reduced or altered function compared to the unmodified (i.e., wild-type) version of the endogenous protein (e.g., a dominant-negative mutant, described infra). In some embodiments, the modified immune effector cells comprise at least two modified endogenous target genes selected from SOCS1, PTPN2, and ZC3HI2A.

[00121] In some embodiments, the modified immune effector cells comprise one or more genomic modifications at a genomic location other than an endogenous target gene that result in the reduced expression and / or function of the endogenous target gene or that result in the expression of a modified version of an endogenous protein. For example, in some embodiments, a polynucleotide sequence encoding a gene regulating system is inserted into one or more locations in the genome, thereby reducing the expression and / or function of an endogenous target gene upon the expression of the gene-regulating system. In some embodiments, a polynucleotide sequence encoding a modified version of an endogenous protein is inserted at one or more locations in the genome, wherein the function of the modified version of the protein is reduced compared to the un-modified or wild-type version of the protein (e.g., a dominant-negative mutant, described infra).

[00122] In some embodiments, the modified immune effector cells described herein comprise two or more modified endogenous target genes, wherein the one or more modifications result in a reduced expression and / or function of a gene product (i.e., an mRNA transcript or a protein) encoded by the endogenous target gene compared to an unmodified immune effector cell. For example, in some embodiments, a modified immune effector cell demonstrates reduced expression of an mRNA transcript and / or reduced expression of a protein. In some embodiments, the expression of the gene product in a modified immune effector cell is reduced by at least 5% compared to the expression of the gene product in an unmodified immune effector cell. In some embodiments, the expression of the gene product in a modified immune effector cell is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more compared to the expression of the gene product in an unmodified immune effector cell. In some embodiments, the modified immune effector cells described herein demonstrate reduced expression and / or function of gene products encoded by a plurality (e.g., two or more) of endogenous target genes compared to the expression of the gene products in an unmodified immune effector cell. For example, in some embodiments, a modified immune effector cell demonstrates reduced expression and / or function of gene products from 2, 3, 4, 5, 6, 7, 8, 9, 10, or more endogenous target genes compared to the expression of the gene products in an unmodified immune effector cell.

[00123] In some embodiments, the present disclosure provides a modified immune effector cell wherein two or more endogenous target genes, or a portion thereof, are deleted (i.e., “knocked-out™) such that the modified immune effector cell does not express the mRNA transcript or protein. In some embodiments, a modified immune effector cell comprises deletion of a plurality of endogenous target genes, or portions thereof. In some embodiments, a modified immune effector cell comprises deletion of2,3,4,5,6,7,8,9, 10, or more endogenous target genes.

[00124] In some embodiments, the modified immune effector cells described herein comprise one or more modified endogenous target genes, wherein the one or more modifications to the target DNA sequence result in expression of a protein with reduced or altered function (e.g., a “modified endogenous protein”) compared to the function of the corresponding protein expressed in an unmodified immune effector cell (e.g., a “unmodified endogenous protein”). In some embodiments, the modified immune effector cells described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified endogenous target genes encoding 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified endogenous proteins. In some embodiments, the modified endogenous protein demonstrates reduced or altered binding affinity for another protein expressed by the modified immune effector cell or expressed by another cell; reduced or altered signaling capacity; reduced or altered enzymatic activity; reduced or altered DNA- binding activity; or reduced or altered ability to function as a scaffolding protein.

[00125] In some embodiments, the modified endogenous target gene comprises one or more dominant negative mutations. As used herein, a “dominant-negative mutation” refers to a substitution, deletion, or insertion of one or more nucleotides of a target gene such that the encoded protein acts antagonistically to the protein encoded by the unmodified target gene. The mutation is dominant- negative because the negative phenotype confers genic dominance over the positive phenotype of the corresponding unmodified gene. A gene comprising one or more dominant-negative mutations and the protein encoded thereby are referred to as a “dominant-negative mutants”, e.g. dominant-negative genes and dominant-negative proteins. In some embodiments, the dominant negative mutant protein is encoded by an exogenous transgene inserted at one or more locations in the genome of the immune effector cell.

[00126] Various mechanisms for dominant negativity are known. Typically, the gene product of a dominant negative mutant retains some functions of the unmodified gene product but lacks one or more crucial other functions of the unmodified gene product. This causes the dominant-negative mutant to antagonize the unmodified gene product. For example, as an illustrative embodiment, a dominant-negative mutant of a transcription factor may lack a functional activation domain but retain a functional DNA binding domain. In this example, the dominant-negative transcription factor cannot activate transcription of the DNA as the unmodified transcription factor does, but the dominant- negative transcription factor can indirectly inhibit gene expression by preventing the unmodified transcription factor from binding to the transcription-factor binding site. As another illustrative embodiment, dominant-negative mutations of proteins that function as dimers are known. Dominant- negative mutants of such dimeric proteins may retain the ability to dimerize with unmodified protein but be unable to function otherwise. The dominant-negative monomers, by dimerizing with unmodified monomers to form heterodimers, prevent formation of functional homodimers of the unmodified monomers. Dominant negative mutations of the SOCS! gene are known in the art and include the murine F59D mutant (See e.g., Hanada et al., J Biol Chem, 276:44:2 (2001), 40746-40754; and Suzuki et al., J Exp Med, 193:4 (2001), 471-482), and the human F58D mutant, identified by sequence alignments of the human and murine SOCS1 amino acid sequences.

[00127] In some embodiments, the modified immune effector cells comprise a gene-regulating system capable of reducing the expression and / or function of two or more endogenous target genes selected from SOCS!I, PTPN2, and ZC3H12A. The gene-regulating system can reduce the expression and / or function of the endogenous target genes modifications by a variety of mechanisms including by modifying the genomic DNA sequence of the endogenous target gene (e.g., by insertion, deletion, or mutation of one or more nucleic acids in the genomic DNA sequence); by regulating transcription of the endogenous target gene (e.g., inhibition or repression of mRNA transcription); and / or by regulating translation of the endogenous target gene (e.g., by mRNA degradation).

[00128] In some embodiments, the modified immune effector cells described herein comprise a gene-regulating system comprising: (a) two or more nucleic acid molecules capable of reducing the expression and / or modifying the function of a gene product encoded by two or more endogenous target genes selected from SOCS1, PTPN2, and ZC3H124; (b) one or more polynucleotides encoding two or more nucleic acid molecules that are capable of reducing the expression and / or modifying the function of the gene products encoded by two or more endogenous target genes selected from SOCS1, PTPN2, and ZC3HI124, (c) two or more proteins capable of reducing the expression and / or modifying the function of the gene products encoded by two or more endogenous target genes selected from SOCS1, PTPN2, and ZC3H124: (d) one or more polynucleotides encoding two or more proteins that are capable of reducing the expression and / or modifying the function of a gene product encoded by two or more endogenous target genes selected from SOCSI, PTPN2, and ZC3H124, (e) two or more guide RNAs (gRNAs) capable of binding to a target DNA sequence in two or more endogenous genes selected from SOCS1, PTPN2, and ZC3H124; ®) one or more polynucleotides encoding two or more gRNAs capable of binding to a target DNA sequence in two or more endogenous genes selected from SOCSI, PTPN2, and ZC3HI24; (g) one or more site-directed modifying polypeptides capable of interacting with a gRNA and modifying a target DNA sequence in an endogenous gene selected from SOCS1, PTPN2, and ZC3HI24; (h) one or more polynucleotides encoding a site-directed modifying polypeptide capable of interacting with a gRNA and modifying a target DNA sequence in an endogenous gene selected from SOCS1, PTPN2, and ZC3H 124; (i) two or more guide DNAs (gDNAs) capable of binding to a target DNA sequence in two or more endogenous genes selected from SOCS1, PTPN2, and ZC3H124; @) one or more polynucleotides encoding two or more gDNAs capable of binding to a target DNA sequence in two or more endogenous genes selected from SOCSZ, PTPN2, and ZC3HI24:; (k) one or more site-directed modifying polypeptides capable of interacting with a gDNA and modifying a target DNA sequence in an endogenous gene selected from SOCS1, PTPN2, and ZC3HI124; 0 one or more polynucleotides encoding a site-directed modifying polypeptide capable of interacting with a gDNA and modifying a target DNA sequence in an endogenous gene selected from SOCSI, PTPN2, and ZC3HI12A4; (m) two or more gRNAs capable of binding to a target mRNA sequence encoded by two or more endogenous genes selected from SOCSI, PTPN2, and ZC3H124, (n) one or more polynucleotides encoding two or more gRNAs capable of binding to a target mRNA sequence encoded by two or more endogenous genes selected from SOCSI, PTPN2, and ZC3HI24: (0) one or more site-directed modifying polypeptides capable of interacting with a gRNA and modifying a target mRNA sequence encoded by an endogenous gene selected from SOCS / , PTPN2, and ZC3HI24: (p) one or more polynucleotides encoding a site-directed modifying polypeptide capable of interacting with a gRNA and modifying a target mRNA sequence encoded by an endogenous gene selected from SOCSI, PTPN2, and ZC3H12A4; or (q) any combination of the above.

[00129] In some embodiments, one or more polynucleotides encoding the gene-regulating system are inserted into the genome of the immune effector cell. In some embodiments, one or more polynucleotides encoding the gene-regulating system are expressed episomaly and are not inserted into the genome of the immune effector cell.

[00130] In some embodiments, the modified immune effector cells described herein comprise reduced expression and / or function of two or more endogenous target genes and further comprise one or more exogenous transgenes inserted at one or more genomic loci (e.g., a genetic “knock-in”). In some embodiments, the one or more exogenous transgenes encode detectable tags, safety-switch systems, chimeric switch receptors, and / or engineered antigen-specific receptors.

[00131] In some embodiments, the modified immune effector cells described herein further comprise an exogenous transgene encoding a detectable tag. Examples of detectable tags include but are not limited to, FLAG tags, poly-histidine tags (e.g. 6xHis), SNAP tags, Halo tags, cMyc tags, glutathione-S-transferase tags, avidin, enzymes, fluorescent proteins, luminescent proteins, chemiluminescent proteins, bioluminescent proteins, and phosphorescent proteins. In some embodiments the fluorescent protein is selected from the group consisting of blue / UV proteins (such as BFP, TagBFP, mTagBFP2, Azurite, EBFP2, mKalamal, Sirius, Sapphire, and T-Sapphire); cyan proteins (such as CFP, eCFP, Cerulean, SCFP3A, mTurquoise, mTurquoise2, monomeric Midoriishi- Cyan, TagCFP, and mTFP1); green proteins (such as: GFP, eGFP, meGFP (A208K mutation), Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, Clover, and mNeonGreen); yellow proteins (such as YFP, eYFP, Citrine, Venus, SYFP2, and TagYFP); orange proteins (such as Monomeric Kusabira-Orange, mKOk, mKO2, mOrange, and mOrange2); red proteins (such as RFP, mRaspberry, mCherry, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, and mRuby2); far-red proteins (such as mPlum, HcRed-Tandem, mKate2, mNeptune, and NirFP); near-infrared proteins (such as TagRFP657, IFP1.4, and iRFP); long stokes shift proteins (such as mKeima Red, LSS-mKatel, LSS-mKate2, and mBeRFP); photoactivatible proteins (such as PA-GFP, PAmCherry1, and PATagRFP); photoconvertible proteins (such as Kaede (green), Kaede (red), KikGR1 (green), KikGR1 (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), mEos3.2 (green), mEos3.2 (red), PSmOrange, and PSmOrange); and photoswitchable proteins (such as Dronpa). In some embodiments, the detectable tag can be selected from AmCyan, AsRed, DsRed2, DsRed Express, E2-Crimson, HcRed, ZsGreen, Zs Yellow, mCherry, mStrawberry, mOrange, mBanana, mPlum, mRasberry, td Tomato, DsRed Monomer, and / or AcGFP, all of which are available from Clontech.

[00132] In some embodiments, the modified immune effector cells described herein further comprise an exogenous transgene encoding a safety-switch system. Safety-switch systems (also referred to in the art as suicide gene systems) comprise exogenous transgenes encoding for one or more proteins that enable the elimination of a modified immune effector cell after the cell has been administered to a subject. Examples of safety-switch systems are known in the art. For example, safety-switch systems include genes encoding for proteins that convert non-toxic pro-drugs into toxic compounds such as the Herpes simplex thymidine kinase (Hsv-#k) and ganciclovir (GCV) system (Hsv-tk / GCV). Hsv-tk converts non-toxic GCV into a cytotoxic compound that leads to cellular apoptosis. As such, administration of GCV to a subject that has been treated with modified immune effector cells comprising a transgene encoding the Hsv-rk protein can selectively eliminate the modified immune effector cells while sparing endogenous immune effector cells. (See e.g., Bonini et al., Science, 1997, 276(5319):1719-1724; Ciceri et al., Blood, 2007, 109(11):1828-1836; Bondanza et al, Blood 2006, 107(5):1828-1836).

[00133] Additional safety-switch systems include genes encoding for cell-surface markers, enabling elimination of modified immune effector cells by administration of a monoclonal antibody specific for the cell-surface marker via ADCC. In some embodiments, the cell-surface marker is CD20 and the modified immune effector cells can be eliminated by administration of an anti-CD20 monoclonal antibody such as Rituximab (See e.g., Introna ef a / ., Hum Gene Ther, 2000, 11(4):611- 620; Serafini ez al., Hum Gene Ther, 2004, 14, 63-76; van Meerten ef al., Gene Ther, 2006, 13, 789- 797). Similar systems using EGF-R and Cetuximab or Panitumumab are described in International PCT Publication No. WO 2018006880. Additional safety-switch systems include transgenes encoding pro-apoptotic molecules comprising one or more binding sites for a chemical inducer of dimerization (CID), enabling elimination of modified immune effector cells by administration of a CID which induces oligomerization of the pro-apoptotic molecules and activation of the apoptosis pathway. In some embodiments, the pro-apoptotic molecule is Fas (also known as CD95) (Thomis ef al., Blood, 2001, 97(5), 1249-1257). In some embodiments, the pro-apoptotic molecule is caspase-9 (Straathof ez al., Blood, 2005, 105(11), 4247-4254).

[00134] In some embodiments, the modified immune effector cells described herein further comprise an exogenous transgene encoding a chimeric switch receptor. Chimeric switch receptors are engineered cell-surface receptors comprising an extracellular domain from an endogenous cell-surface receptor and a heterologous intracellular signaling domain, such that ligand recognition by the extracellular domain results in activation of a different signaling cascade than that activated by the wild type form of the cell-surface receptor. In some embodiments, the chimeric switch receptor comprises the extracellular domain of an inhibitory cell-surface receptor fused to an intracellular domain that leads to the transmission of an activating signal rather than the inhibitory signal normally transduced by the inhibitory cell-surface receptor. In particular embodiments, extracellular domains derived from cell-surface receptors known to inhibit immune effector cell activation can be fused to activating intracellular domains. Engagement of the corresponding ligand will then activate signaling cascades that increase, rather than inhibit, the activation of the immune effector cell. For example, in some embodiments, the modified immune effector cells described herein comprise a transgene encoding a PD1-CD28 switch receptor, wherein the extracellular domain of PDI is fused to the intracellular signaling domain of CD28 (See e.g., Liu ef al., Cancer Res 76:6 (2016), 1578-1590 and Moon et al., Molecular Therapy 22 (2014), S201). In some embodiments, the modified immune effector cells described herein comprise a transgene encoding the extracellular domain of CD200R and the intracellular signaling domain of CD28 (See Oda ef al., Blood 130:22 (2017), 2410-2419).

[00135] In some embodiments, the modified immune effector cells described herein further comprise an engineered antigen-specific receptor recognizing a protein target expressed by a target cell, such as a tumor cell or an antigen presenting cell (APC), referred to herein as “modified receptor- engineered cells” or “modified RE-cells”. The term “engineered antigen receptor” refers to a non- naturally occurring antigen-specific receptor such as a chimeric antigen receptor (CAR) or a recombinant T cell receptor (TCR). In some embodiments, the engineered antigen receptor is a CAR comprising an extracellular antigen binding domain fused via hinge and transmembrane domains to a cytoplasmic domain comprising a signaling domain. In some embodiments, the CAR extracellular domain binds to an antigen expressed by a target cell in an MHC-independent manner leading to activation and proliferation of the RE cell. In some embodiments, the extracellular domain of a CAR recognizes a tag fused to an antibody or antigen-binding fragment thereof. In such embodiments, the antigen-specificity of the CAR is dependent on the antigen-specificity of the labeled antibody, such that a single CAR construct can be used to target multiple different antigens by substituting one antibody for another (See e.g., US Patent Nos. 9,233,125 and 9,624,279; US Patent Application Publication Nos. 20150238631 and 20180104354). In some embodiments, the extracellular domain of a CAR may comprise an antigen binding fragment derived from an antibody. Antigen binding domains that are useful in the present disclosure include, for example, scFvs; antibodies; antigen binding regions of antibodies; variable regions of the heavy / light chains; and single chain antibodies.

[00136] In some embodiments, the intracellular signaling domain of a CAR may be derived from the TCR complex zeta chain (such as CD3¢ signaling domains), FcyRIII, FceRl, or the T- lymphocyte activation domain. In some embodiments, the intracellular signaling domain of a CAR further comprises a costimulatory domain, for example a 4-1BB, CD28, CD40, MyD88, or CD70 domain. In some embodiments, the intracellular signaling domain of a CAR comprises two costimulatory domains, for example any two of 4-1BB, CD28, CD40, MyD88, or CD70 domains. Exemplary CAR structures and intracellular signaling domains are known in the art (See e.g., WO 2009 / 091826; US 20130287748; WO 2015 / 142675; WO 2014 / 055657; and WO 2015 / 090229, incorporated herein by reference).

[00137] CARs specific for a variety of tumor antigens are known in the art, for example CD171- specific CARs (Park ef al., Mol Ther (2007) 15(4):825-833), EGFRvIII-specific CARs (Morgan et al., Hum Gene Ther (2012) 23(10):1043-1053), EGF-R-specific CARs (Kobold er al., J Natl Cancer Inst (2014) 107(1):364), carbonic anhydrase K-specific CARs (Lamers et al., Biochem Soc Trans (2016) 44(3):951-959), FR-a-specific CARs (Kershaw ef al., Clin Cancer Res (2006) 12(20):6106- 6015), HER2-specific CARs (Ahmed ef al., J Clin Oncol (2015) 33(15)1688-1696; Nakazawa et al., Mol Ther (2011) 19(12):2133-2143; Ahmed et al., Mol Ther (2009) 17(10):1779-1787; Luo et al., Cell Res (2016) 26(7):850-853; Morgan ef al., Mol Ther (2010) 18(4):843-851; Grada er al., Mol Ther Nucleic Acids (2013) 9(2):32), CEA-specific CARs (Katz ef al., Clin Cancer Res (2015) 21(14):3149- 3159), IL13Ra2-specific CARs (Brown ef al., Clin Cancer Res (2015) 21(18):4062-4072), GD2- specific CARs (Louis ef al., Blood (2011) 118(23):6050-6056; Caruana et al., Nat Med (2015) 21(5):524-529), ErbB2-specific CARs (Wilkie ef al, J Clin Immunol (2012) 32(5):1059-1070), VEGF-R-specific CARs (Chinnasamy et al., Cancer Res (2016) 22(2):436-447), FAP-specific CARs (Wang ef al., Cancer Immunol Res (2014) 2(2):154-166), MSLN-specific CARs (Moon et al, Clin Cancer Res (2011) 17(14):4719-30), NKG2D-specific CARs (VanSeggelen et al., Mol Ther (2015) 23(10):1600-1610), CD19-specific CARs (Axicabtagene ciloleucel (Yescarta®) and Tisagenlecleucel (Kymriah®). See also, Li et al., ] Hematol and Oncol (2018) 11(22), reviewing clinical trials of tumor- specific CARs. Exemplary CARs suitable for use according to the present disclosure are described below in Table 1. Table 1: Exemplary CAR constructs human rFMCO3 . | KSQCAR1909 I = CD3 zeta CDSahinge ~~ 266 | 267 human | Herceptin : | ksQcaro10 Tn | Dee CD3 zeta CD8ahinge 268 | 269 AA | NA Ag-binding | Intracellular | Transmembrane E | SE CARReLID | Target | Somain | Domain | Domain Sen 9 Toma | Sefer D3 zet CDSahinge ~~ 264 | 265 | KSQCAROL7 | parr | H225 scFv C2 zeta human | FMC63 . 266 267 | KSQCAR1909 ool o | scFv CD3 zeta CD8a hinge | hi Herceptin ; 269 | KSQCARO10 i oy) P CD3 zeta CD8a hinge 268 |

[00138] In some embodiments, the engineered antigen receptor is a recombinant TCR. Recombinant TCRs comprise TCRa and / or TCR chains that have been isolated and cloned from T cell populations recognizing a particular target antigen. For example, TCRa and / or TCR genes (i.e., TRAC and TRBC) can be cloned from T cell populations isolated from individuals with particular malignancies or T cell populations that have been isolated from humanized mice immunized with specific tumor antigens or tumor cells. Recombinant TCRs recognize antigen through the same mechanisms as their endogenous counterparts (e.g., by recognition of their cognate antigen presented in the context of major histocompatibility complex (MHC) proteins expressed on the surface of a target cell). This antigen engagement stimulates endogenous signal transduction pathways leading to activation and proliferation of the TCR-engineered cells.

[00139] Recombinant TCRs specific for tumor antigens are known in the art, for example WT1- specific TCRs (JTCRO16, Juno Therapeutics; WT1-TCRc4, described in US Patent Application Publication No. 20160083449), MART-1 specific TCRs (including the DMF4T clone, described in Morgan et al., Science 314 (2006) 126-129); the DMF5T clone, described in Johnson ef al., Blood 114 (2009) 535-546); and the ID3T clone, described in van den Berg ef al., Mol. Ther. 23 (2015) 1541-1550), gp100-specific TCRs (Johnson ef al., Blood 114 (2009) 535-546), CEA-specific TCRs (Parkhurst ez al., Mol Ther. 19 (2011) 620-626), NY-ESO and LAGE-1 specific TCRs (1G4T clone, described in Robbins ez al., J Clin Oncol 26 (2011) 917-924; Robbins ez al., Clin Cancer Res 21 (2015) 1019-1027; and Rapoport ef al., Nature Medicine 21 (2015) 914-921), and MAGE-A3-specific TCRs (Morgan et al., J Inmunother 36 (2013) 133-151) and Linette et a / ., Blood 122 (2013) 227-242). (See also, Debets et al., Seminars in Immunology 23 (2016) 10-21).

[00140] To generate the recombinant TCRs, the native TRAC (SEQ ID NO: 260) and TRBC (SEQ ID NOs: 262) protein sequences are fused to the C-terminal ends of TCR-o and TCR- chain variable regions specific for a protein or peptide of interest. For example, the engineered TCR can recognize an amino acid sequence comprising the NY-ESO peptide (SLLMWITQC, SEQ ID NO: 239), such as the 1G4 TCR or the 95:LY TCR (Robbins et a / , Journal of Immunology 2008 180:6116- 6131). In such illustrative embodiments, the paired 1G4-TCR o / Bchains comprise SEQ ID NOs: 249 and 248, respectively and the paired 95:LY-TCR a / Bchains comprise SEQ ID NOs: 252 and 251, respectively. The recombinant TCR can recognize the MART-1 peptide (AAGIGILTV, SEQ ID NO: 240), such as the DMF4 and DMF5 TCRs (Robbins ef al, Journal of Immunology 2008 180:6116- 6131). In such illustrative embodiments, the paired DMF4-TCR o / Bchains comprise SEQ ID NOs: 255 and 254, respectively and the paired DMF5-TCR o / Bchains comprise SEQ ID NOs: 258 and 257, respectively. The recombinant TCR can recognize the WT-1 peptide (RMFPNAPYL, SEQ ID NO: 241), such as the DLT TCR (Robbins et al, Journal of Immunology 2008 180:6116-6131). In such illustrative embodiments, the paired high-affinity DLT-TCR o / Bchains comprise SEQ ID NOs: 246 and 245, respectively.

[00141] Codon-optimized DNA sequences encoding the recombinant TCRa and TCRp chain proteins can be generated such that expression of both TCR chains is driven off of a single promoter in a stoichiometric fashion. In such embodiment, the P2A sequence (SEQ ID NO: 238) can be inserted between the DNA sequences encoding the TCRp and the TCRa chain, such that the expression cassettes encoding the recombinant TCR chains comprise the following format: TCRB — P2A — TCRa. As an illustrative embodiment, the protein sequence of the 1G4 NY-ESO-specific TCR expressed from such a cassette would comprise SEQ ID NO: 250, the protein sequence of the 95:LY NY-ESO- specific TCR expressed from such a cassette would comprise SEQ ID NO: 23, the protein sequence of the DMF4 MART 1-specific TCR expressed from such a cassette would comprise SEQ ID NO: 256, the protein sequence of the DMF5 MART 1-specific TCR expressed from such a cassette would comprise SEQ ID NO: 259, and the protein sequence of the DLT WT1-specific TCR expressed from such a cassette would comprise SEQ ID NO: 247.

[00142] In some embodiments, the engineered antigen receptor is directed against a target antigen selected from a cluster of differentiation molecule, such as CD3, CD4, CD8, CD16, CD24, CD25, CD33, CD34, CD45, CD64, CD71, CD78, CD80 (also known as B7-1), CD86 (also known as B7-2), CD96, ,CD116,CD117, CD123, CD133, and CD138, CD371 (also known as CLL1); a tumor- associated surface antigen, such as 5T4, BCMA (also known as CD269 and TNFRSF17, UniProt# Q02223), carcinoembryonic antigen (CEA), carbonic anhydrase 9 (CAIX or MN / CAIX), CD19, CD20, CD22, CD30, CD40, disialogangliosides such as GD2, ELF2M, ductal-epithelial mucin, ephrin B2, epithelial cell adhesion molecule (EpCAM), ErbB2 (HER2 / neu), FCRLS (UniProt# Q68SN8), FKBP11 (UniProt# QINYL4), glioma-associated antigen, glycosphingolipids, gp36, GPRC5D (UniProt# QI9NZD1), mut hsp70-2, intestinal carboxyl esterase, IGF-I receptor, ITGA8 (UniProt# P53708), KAMP3, LAGE-1a, MAGE, mesothelin, neutrophil elastase, NKG2D, Nkp30, NY-ESO-1, PAP, prostase, prostate-carcinoma tumor antigen-1 (PCTA-1), prostate specific antigen (PSA), PSMA, prostein, RAGE-1, ROR1, RUI (SEMBT1), RU2 (DCDC2), SLAMF7 (UniProt# QONQ25), survivin, TAG-72, and telomerase; a major histocompatibility complex (MHC) molecule presenting a tumor-specific peptide epitope; tumor stromal antigens, such as the extra domain A (EDA) and extra domain B (EDB) of fibronectin; the Al domain of tenascin-C (TnC Al) and fibroblast associated protein (FAP); cytokine receptors, such as epidermal growth factor receptor (EGFR), EGFR variant III (EGFRvIII), TFGB-R or components thereof such as endoglin; a major histocompatibility complex (MHC) molecule; a virus-specific surface antigen such as an HIV-specific antigen (such as HIV gp120), an EBV-specific antigen, a CMV-specific antigen, a HPV-specific antigen, a Lassa virus- specific antigen, an Influenza virus-specific antigen as well as any derivate or variant of these surface antigens.

[00143] In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of SOCS! and PTPN2 or a gene-regulating system capable of reducing the expression and / or function of SOCS! and PTPN2 and further comprising a CAR or recombinant TCR expressed on the cell surface. In some embodiments, the modified immune effector cells comprise reduced expression and / or function of SOCS! and PTPN2 or a gene-regulating system capable of reducing the expression and / or function of SOCS! and P7PN2 and further comprising a recombinant expression vector encoding a CAR or a recombinant TCR.

[00144] In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of SOCSI and ZC3H124 or a gene-regulating system capable of reducing the expression and / or function of SOCS! and ZC3H12A and further comprising a CAR or recombinant TCR expressed on the cell surface. In some embodiments, the modified immune effector cells comprise reduced expression and / or function of SOCS! and ZC3HI2A4 or a gene- regulating system capable of reducing the expression and / or function of SOCS! and ZC3H12A4 and further comprising a recombinant expression vector encoding a CAR or a recombinant TCR.

[00145] In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of PTPN2 and ZC3H 124 or a gene-regulating system capable of reducing the expression and / or function of PTPN2 and ZC3H12A and further comprising a CAR or recombinant TCR expressed on the cell surface. In some embodiments, the modified immune effector cells comprise reduced expression and / or function of PTPN2 and ZC3HI2A or a gene-regulating system capable of reducing the expression and / or function of PTPN2 and ZC3H124 and further comprising a recombinant expression vector encoding a CAR or a recombinant TCR.

[00146] In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of SOCS! and PTPN2 or a gene-regulating system capable of reducing the expression and / or function of SOCS1 and PTPN2, wherein the immune effector cell is a TIL. In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of SOCS! and ZC3H124 or a gene-regulating system capable of reducing the expression and / or function of SOCS! and ZC3H124, wherein the immune effector cell is a TIL. In some embodiments, the present disclosure provides modified immune effector cells comprising reduced expression and / or function of PTPN2 and ZC3HI124 or a gene-regulating system capable of reducing the expression and / or function of PTPN2 and ZC3HI24, wherein the immune effector cell is a TIL. A. Effector functions

[00147] In some embodiments, the modified immune effector cells described herein comprise reduced expression and / or function (or a gene-regulating system capable of reducing the expression and / or function) of two or more endogenous target genes selected from SOCSI, PTPN2, and ZC3HI12A and demonstrate an increase in one or more immune cell effector functions. Herein, the term “effector function” refers to functions of an immune cell related to the generation, maintenance, and / or enhancement of an immune response against a target cell or target antigen. In some embodiments, the modified immune effector cells described herein demonstrate one or more of the following characteristics compared to an unmodified immune effector cell: increased infiltration or migration in to a tumor, increased proliferation, increased or prolonged cell viability, increased resistance to inhibitory factors in the surrounding microenvironment such that the activation state of the cell is prolonged or increased, increased production of pro-inflammatory immune factors (e.g., pro-inflammatory cytokines, chemokines, and / or enzymes), increased cytotoxicity, and / or increased resistance to exhaustion.

[00148] In some embodiments, the modified immune effector cells described herein demonstrate increased infiltration into a tumor compared to an unmodified immune effector cell. In some embodiments, increased tumor infiltration by modified immune effector cells refers to an increase the number of modified immune effector cells infiltrating into a tumor during a given period of time compared to the number of unmodified immune effector cells that infiltrate into a tumor during the same period of time. In some embodiments, the modified immune effector cells demonstrate a 1.1, 12,13,1.4,1.5,16,1.7,1.8,19,2,2.5,3,3.5,4,4.5,5,6,7, 8,9, 10, 15, 20,25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more fold increase in tumor infiltration compared to an unmodified immune cell. Tumor infiltration can be measured by isolating one or more tumors from a subject and assessing the number of modified immune cells in the sample by flow cytometry, immunohistochemistry, and / or immunofluorescence.

[00149] In some embodiments, the modified immune effector cells described herein demonstrate an increase in cell proliferation compared to an unmodified immune effector cell. In these embodiments, the result is an increase in the number of modified immune effector cells present compared to unmodified immune effector cells after a given period of time. For example, in some embodiments, modified immune effector cells demonstrate increased rates of proliferation compared to unmodified immune effector cells, wherein the modified immune effector cells divide at a more rapid rate than unmodified immune effector cells. In some embodiments, the modified immune effector cells demonstrate a 1.1, 1.2, 1.3,1.4,1.5,1.6,1.7,1.8,1.9,2,2.5,3,3.5,4,45,5,6,7,8,9, 10, 15, 20,25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more fold increase in the rate of proliferation compared to an unmodified immune cell. In some embodiments, modified immune effector cells demonstrate prolonged periods of proliferation compared to unmodified immune effector cells, wherein the modified immune effector cells and unmodified immune effector cells divide at similar rates, but wherein the modified immune effector cells maintain the proliferative state for a longer period of time. In some embodiments, the modified immune effector cells maintain a proliferative state for 1.1, 1.2, 1.3, 14,15, 1.6,1.7,1.8,19,2,2.5,3,35,4,45,5,6,7, 8,9, 10, 15, 20,25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more times longer than an unmodified immune cell.

[00150] In some embodiments, the modified immune effector cells described herein demonstrate increased or prolonged cell viability compared to an unmodified immune effector cell. In such embodiments, the result is an increase in the number of modified immune effector cells or present compared to unmodified immune effector cells after a given period of time. For example, in some embodiments, modified immune effector cells described herein remain viable and persist for 1.1, 1.2, 13,14,15,16,1.7,1.8,1.9,2,2.5,3,35,4,45,5,6,7,8,9, 10, 15, 20,25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more times longer than an unmodified immune cell.

[00151] In some embodiments, the modified immune effector cells described herein demonstrate increased resistance to inhibitory factors compared to an unmodified immune effector cell. Exemplary inhibitory factors include signaling by immune checkpoint molecules (e.g., PD1, PDL1, CTLA4, LAG3, IDO) and / or inhibitory cytokines (e.g., IL-10, TGF).

[00152] In some embodiments, the modified T cells described herein demonstrate increased resistance to T cell exhaustion compared to an unmodified T cell. T cell exhaustion is a state of antigen-specific T cell dysfunction characterized by decreased effector function and leading to subsequent deletion of the antigen-specific T cells. In some embodiments, exhausted T cells lack the ability to proliferate in response to antigen, demonstrate decreased cytokine production, and / or demonstrate decreased cytotoxicity against target cells such as tumor cells. In some embodiments, exhausted T cells are identified by altered expression of cell surface markers and transcription factors, such as decreased cell surface expression of CD122 and CD127; increased expression of inhibitory cell surface markers such as PD1, LAG3, CD244, CD160, TIM3, and / or CTLA4; and / or increased expression of transcription factors such as Blimpl, NFAT, and / or BATF. In some embodiments, exhausted T cells demonstrate altered sensitivity cytokine signaling, such as increased sensitivity to TGF signaling and / or decreased sensitivity to IL-7 and IL-15 signaling. T cell exhaustion can be determined, for example, by co-culturing the T cells with a population of target cells and measuring T cell proliferation, cytokine production, and / or lysis of the target cells. In some embodiments, the modified immune effector cells described herein are co-cultured with a population of target cells (e.g., autologous tumor cells or cell lines that have been engineered to express a target tumor antigen) and effector cell proliferation, cytokine production, and / or target cell lysis is measured. These results are then compared to the results obtained from co-culture of target cells with a control population of immune cells (such as unmodified immune effector cells or immune effector cells that have a control modification).

[00153] In some embodiments, resistance to T cell exhaustion is demonstrated by increased production of one or more cytokines (e.g., IFNy, TNFa, or IL-2) from the modified immune effector cells compared to the cytokine production observed from the control population of immune cells. In some embodiments, a 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5,6, 7, 8, 9, 10, 15, 20, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more fold increase in cytokine production from the modified immune effector cells compared to the cytokine production from the control population of immune cells is indicative of an increased resistance to T cell exhaustion. In some embodiments, resistance to T cell exhaustion is demonstrated by increased proliferation of the modified immune effector cells compared to the proliferation observed from the control population of immune cells. In some embodiments, a 1.1, 1.2, 1.3, 1.4,1.5,1.6,1.7,1.8,1.9, 2.0,2.5, 3.0, 3.5,4.0,4.5,5,6,7,8, 9, 10, 15, 20, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more fold increase in proliferation of the modified immune effector cells compared to the proliferation of the control population of immune cells is indicative of an increased resistance to T cell exhaustion. In some embodiments, resistance to T cell exhaustion is demonstrated by increased target cell lysis by the modified immune effector cells compared to the target cell lysis observed by the control population of immune cells. In some embodiments, a 1.1, 1.2, 1.3,1.4,1.5,1.6,1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5,6, 7, 8, 9, 10, 15, 20, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more fold increase in target cell lysis by the modified immune effector cells compared to the target cell lysis by the control population of immune cells is indicative of an increased resistance to T cell exhaustion.

[00154] In some embodiments, exhaustion of the modified immune effector cells compared to control populations of immune cells is measured during the in vitro or ex vivo manufacturing process. For example, in some embodiments, TILs isolated from tumor fragments are modified according to the methods described herein and then expanded in one or more rounds of expansion to produce a population of modified TILs. In such embodiments, the exhaustion of the modified TILs can be determined immediately after harvest and prior to a first round of expansion, after the first round of expansion but prior to a second round of expansion, and / or after the first and the second round of expansion. In some embodiments, exhaustion of the modified immune effector cells compared to control populations of immune cells is measured at one or more time points after transfer of the modified immune effector cells into a subject. For example, in some embodiments, the modified cells are produced according to the methods described herein and administered to a subject. Samples can then be taken from the subject at various time points after the transfer to determine exhaustion of the modified immune effector cells in vivo over time.

[00155] In some embodiments, the modified immune effector cells described herein demonstrate increased expression or production of pro-inflammatory immune factors compared to an unmodified immune effector cell. Examples of pro-inflammatory immune factors include cytolytic factors, such as granzyme B, perforin, and granulysin; and pro-inflammatory cytokines such as interferons (IFNo, IFNB, IFNy), TNFo, IL-1, IL-12, IL-2, IL-17, CXCLS, and / or IL-6.

[00156] In some embodiments, the modified immune effector cells described herein demonstrate increased cytotoxicity against a target cell compared to an unmodified immune effector cell. In some embodiments, the modified immune effector cells demonstrate a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more fold increase in cytotoxicity against a target cell compared to an unmodified immune cell. In some embodiments, the modified immune effector cells described herein produce a TIL population that persists with both the central memory phenotype (Tem cells) and effector memory phenotype (Tem cells). These phenotypes provide durable anti-tumor memory and invoke eptitope spreading.

[00157] Assays for measuring immune effector function are known in the art. For example, tumor infiltration can be measured by isolating tumors from a subject and determining the total number and / or phenotype of the lymphocytes present in the tumor by flow cytometry, immunohistochemistry, and / or immunofluorescence. Cell-surface receptor expression can be determined by flow cytometry, immunohistochemistry, immunofluorescence, Western blot, and / or qPCR. Cytokine and chemokine expression and production can be measured by flow cytometry, immunohistochemistry, immunofluorescence, Western blot, ELISA, and / or qPCR. Responsiveness or sensitivity to extracellular stimuli (e.g., cytokines, inhibitory ligands, or antigen) can be measured by assaying cellular proliferation and / or activation of downstream signaling pathways (e.g, phosphorylation of downstream signaling intermediates) in response to the stimuli. Cytotoxicity can be measured by target-cell lysis assays known in the art, including in vitro or ex vivo co-culture of the modified immune effector cells with target cells and / n vivo murine tumor models, such as those described throughout the Examples. B. Regulation of endogenous pathways and genes

[00158] In some embodiments, the modified immune effector cells described herein demonstrate a reduced expression and / or function of two or more endogenous target genes selected from SOCSI, PTPN2, and ZC3H12A. Further details on the endogenous target genes are provided below in Table 2. In such embodiments, the reduced expression or function of the two or more endogenous target genes enhances one or more effector functions of the immune cell.

[00159] In some embodiments, the modified effector cells described herein comprise reduced expression and / or function of the Suppressors of cytokine signaling SOCS 1 (SOCS!) gene. The SOCSI protein comprises C-terminal SOCS box motifs, an SH2-domain, an ESS domain, and an N- terminal KIR domain. The 12 amino-acid residues called the kinase inhibitory region (KIR) has been found to be critical in the ability of SOCS1 to negatively regulate JAK1, TYK2 and JAK2 tyrosine kinase function.

[00160] In some embodiments, the modified effector cells described herein comprise reduced expression and / or function of the PTPN2 gene. The protein tyrosine phosphatase family (PTP) dephosphorylate phospho-tyrosine residues by their phosphatase catalytic domain. PTPN2 functions as a brake on both TCRs and cytokines, which signal through JAK / STAT signaling complexes, and thus serves as a checkpoint on both Signals 1 and 3. Following T Cell engagement with antigen and activation of the TCR, positive signals are amplified downstream by the kinases Lck and Fyn by phosphorylation of tyrosine residues. PTPN2 serves to dephosphorylate both Leck and Fyn and thus attenuate TCR signaling. In addition, following T cell encounter with cytokines and signaling through common vy chain receptor complex, which transmit positive signals though JAK / STAT signaling, PTPN2 also attenuates by dephosphorylation of STATI and STAT3. The sum functional impact of PTPN2 loss on T cell function is a lowering of the activation threshold needed for fulminant T cell activation through the TCR, and a hypersensitivity to growth and differentiation-enhancing cytokines The protein tyrosine phosphatase family (PTP) dephosphorylate phospho-tyrosine residues by their phosphatase catalytic domain. PTPN2 functions as a brake on both TCRs and cytokines, which signal through JAK / STAT signaling complexes, and thus serves as a checkpoint on both Signals 1 and 3. Following T Cell engagement with antigen and activation of the TCR, positive signals are amplified downstream by the kinases Lck and Fyn by phosphorylation of tyrosine residues. PTPN2 serves to dephosphorylate both Lck and Fyn and thus attenuate TCR signaling. In addition, following T cell encounter with cytokines and signaling through common yc chain receptor complex, which transmit positive signals though JAK / STAT signaling, PTPN2 also attenuates by dephosphorylation of STAT1 and STAT3. The sum functional impact of PTPN2 loss on T cell function is a lowering of the activation threshold needed for fulminant T cell activation through the TCR, and a hypersensitivity to growth and differentiation-enhancing cytokines.

[00161] In addition, in genetically engineered mouse (GEM) models, deletion of PTPN2 in the whole mouse increases cytokine levels, lymphocytic infiltration in nonlymphoid tissues and early signs of rheumatoid arthritis-like symptoms; these mice do not survive past 5 weeks of age. Thus, PTPN2 has been identified as critical for postnatal development in mice. Consistent with this autoimmune phenotype, deletion of Prpn2 in the T cell lineage from birth also results in an increase in lymphocytic infiltration in non-lymphoid tissues. Importantly, an inducible knockout of Prpn2 in adult mouse T cells did not result in any autoimmune manifestations of its role in autoimmunity, Pipn2 deletion was identified to associate with a small percentage of T cell acute lymphoblastic leukemia in humans (ALL), and to enhance skin tumor development in a two-stage chemically-induced carcinogenicity mouse model. These data have led some to postulate that PTPN2 may be a tumor suppressor protein.

[00162] In some embodiments, the modified effector cells described herein comprise reduced expression and / or function of the ZC3HI2A gene. ZC3H12A, also referred to as MCPIP1 and REGNASE-1, is an RNase that possesses a RNase domain just upstream of a CCCH-type zinc-finger motif. Through its nuclease activity, ZC3H12A targets and destabilizes the mRNAs of transcripts, such as IL-6, by binding a conserved stem loop structure within the 3° UTR of these genes. In T cells, ZC3HI12A controls the transcript levels of a number of pro-inflammatory genes, including c-Rel, 0X40 and IL-2. REGNASE-1activation is transient and is subject to negative feedback mechanisms including proteasome-mediated degradation or mucosa-associated lymphoid tissue 1 (MALT) mediated cleavage. The major function of REGNASE-1 is promoting mRNA decay via its ribonuclease activity by specifically targeting a subset of genes in different cell types. In monocytes, REGNASE-1downregulates IL-6 and IL-12B mRNAs, thus mitigating inflammation, whereas in T cells, it restricts T-cell activation by targeting c-Rel, Ox40 and IL-2 transcripts. In cancer cells, REGNASE-1promotes apoptosis by inhibiting anti-apoptotic genes including BCL2LI, BCL2A1, RELB and BCL3. Table 2: Endogenous target genes Human Murine . Gone Gene Name UniProt | Human NCBI Ref | UniProt | Murine NCBI Symbol | ney nip Ref Ref. "Ref. SOCS1 | suppressor of . 8651 | J 12703 015524 o60O1 12 / 05 (SEQ ID NO: 1) | 035716 | (SEQ ID NO: 2) 5771 Z 1 19255 phosphatase, 2 / 11 15255 PIPN? fo ype | P1706 | sEQm No: 3 | Qosiso | sEQ ID NO: 4) Q5DI1ES8 80149 | 230738 230 / 38 | QSDIET7 | (SEQ ID NO: 6) R68 y ¥ 208650 SOCS! | suppressor of — 8651 cytokine 015524 (SEQ ID NO: 1) signaling 1 protein tyrosine 5771 phosphatase, Po non-receptor type | PL7705 | (SEQ ID NO: 3) 2 Endoribonuclease | QSDIE8 80149 | ZC3HI124 | 7C3H124 (SEQ ID NO: 5) Cbl proto- 868 CBLB | oncogene B Q13191 | (SEQ ID NO: 82; L 01 proto- 600 £2Us00U CBLB | oncogene B QI3191 | (SEQ ID NO: 823) | Q3TTA7 | (SEQ ID NO: 824) |

[00163] In some embodiments, the modified immune effector cells comprise reduced expression and / or function of SOCS / and reduced expression and / or function of PTPN2. In some embodiments, the modified immune effector cells comprise reduced expression and / or function of SOCS! and reduced expression and / or function of ZC3H12A. In some embodiments, the modified immune effector cells comprise reduced expression and / or function of PTPN2 and reduced expression and / or function of ZC3H12A. In some embodiments, the modified immune effector cells comprise reduced expression and / or function of at least two genes endogenous target genes selected from SOCS1, PTPN2, and ZC3H12A4 and further comprise reduced expression and / or function of CBLB. III. Gene-Regulating Systems

[00164] Herein, the term “gene-regulating system” refers to a protein, nucleic acid, or combination thereof that is capable of modifying an endogenous target DNA sequence when introduced into a cell, thereby regulating the expression or function of the encoded gene product. Numerous gene editing systems suitable for use in the methods of the present disclosure are known in the art including, but not limited to, shRNAs, siRNAs, zinc-finger nuclease systems, TALEN systems, and CRISPR / Cas systems,

[00165] As used herein, “regulate,” when used in reference to the effect of a gene-regulating system on an endogenous target gene encompasses any change in the sequence of the endogenous target gene, any change in the epigenetic state of the endogenous target gene, and / or any change in the expression or function of the protein encoded by the endogenous target gene.

[00166] In some embodiments, the gene-regulating system may mediate a change in the sequence of the endogenous target gene, for example, by introducing one or more mutations into the endogenous target sequence, such as by insertion or deletion of one or more nucleic acids in the endogenous target sequence. Exemplary mechanisms that can mediate alterations of the endogenous target sequence include, but are not limited to, non-homologous end joining (NHEJ) (e.g., classical or alternative), microhomology-mediated end joining (MMEJ), homology-directed repair (e.g., endogenous donor template mediated), SDSA (synthesis dependent strand annealing), single strand annealing or single strand invasion.

[00167] In some embodiments, the gene-regulating system may mediate a change in the epigenetic state of the endogenous target sequence. For example, in some embodiments, the gene- regulating system may mediate covalent modifications of the endogenous target gene DNA (e.g, cytosine methylation and hydroxymethylation) or of associated histone proteins (e.g. lysine acetylation, lysine and arginine methylation, serine and threonine phosphorylation, and lysine ubiquitination and sumoylation).

[00168] In some embodiments, the gene-regulating system may mediate a change in the expression of the protein encoded by the endogenous target gene. In such embodiments, the gene- regulating system may regulate the expression of the encoded protein by modifications of the endogenous target DNA sequence, or by acting on the mRNA product encoded by the DNA sequence. In some embodiments, the gene-regulating system may result in the expression of a modified endogenous protein. In such embodiments, the modifications to the endogenous DNA sequence mediated by the gene-regulating system result in the expression of an endogenous protein demonstrating a reduced function as compared to the corresponding endogenous protein in an unmodified immune effector cell. In such embodiments, the expression level of the modified endogenous protein may be increased, decreased or may be the same, or substantially similar to, the expression level of the corresponding endogenous protein in an unmodified immune cell. A. Nucleic acid-based gene-regulating systems

[00169] In some embodiments, the present disclosure provides nucleic acid gene-regulating systems comprising two or more nucleic acids capable of reducing the expression and / or function of at least two endogenous genes selected from SOCS / , PTPN2, and ZC3H12A. In some embodiments, the present disclosure provides modified immune effector cells comprising such gene-regulating systems. As used herein, a nucleic acid-based gene-regulating system is a system comprising one or more nucleic acid molecules that is capable of regulating the expression of an endogenous target gene without the requirement for an exogenous protein. In some embodiments, the nucleic acid-based gene- regulating system comprises an RNA interference molecule or antisense RNA molecule that is complementary to a target nucleic acid sequence.

[00170] An “antisense RNA molecule” refers to an RNA molecule, regardless of length, that is complementary to an mRNA transcript. Antisense RNA molecules refer to single stranded RNA molecules that can be introduced to a cell, tissue, or subject and result in decreased expression of an endogenous target gene product through mechanisms that do not rely on endogenous gene silencing pathways, but rather rely on RNaseH-mediated degradation of the target mRNA transcript. In some embodiments, an antisense nucleic acid comprises a modified backbone, for example, phosphorothioate, phosphorodithioate, or others known in the art, or may comprise non-natural internucleoside linkages. In some embodiments, an antisense nucleic acid can comprise locked nucleic acids (LNA).

[00171] “RNA interference molecule” as used herein refers to an RNA polynucleotide that mediates the decreased the expression of an endogenous target gene product by degradation of a target mRNA through endogenous gene silencing pathways (e.g, Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference agents include micro RNAs (also referred to herein as “miRNAs”), short hair-pin RNAs (shRNAs), small interfering RNAs (siRNAs), RNA aptamers, and morpholinos.

[00172] In some embodiments, the nucleic acid-based gene-regulating system comprises one or more miRNAs. miRNAs are naturally occurring, small non-coding RNA molecules of about 21-25 nucleotides in length. miRNAs are at least partially complementary to one or more target mRNA molecules. miRNAs can downregulate (e.g., decrease) expression of an endogenous target gene product through translational repression, cleavage of the mRNA, and / or deadenylation.

[00173] In some embodiments, the nucleic acid-based gene-regulating system comprises one or more shRNAs. shRNAs are single stranded RNA molecules of about 50-70 nucleotides in length that form stem-loop structures and result in degradation of complementary mRNA sequences. shRNAs can be cloned in plasmids or in non-replicating recombinant viral vectors to be introduced intracellularly and result in the integration of the shRNA-encoding sequence into the genome. As such, an shRNA can provide stable and consistent repression of endogenous target gene translation and expression.

[00174] In some embodiments, nucleic acid-based gene-regulating system comprises one or more siRNAs. siRNAs refer to double stranded RNA molecules typically about 21-23 nucleotides in length. The siRNA associates with a multi protein complex called the RNA-induced silencing complex (RISC), during which the “passenger” sense strand is enzymatically cleaved. The antisense “guide” strand contained in the activated RISC then guides the RISC to the corresponding mRNA because of sequence homology and the same nuclease cuts the target mRNA, resulting in specific gene silencing. Optimally, an siRNA is 18, 19, 20, 21, 22, 23 or 24 nucleotides in length and has a 2 base overhang at its 3’ end. siRNAs can be introduced to an individual cell and / or culture system and result in the degradation of target mRNA sequences. siRNAs and shRNAs are further described in Fire et al, Nature, 391:19, 1998 and US Patent Nos. 7,732,417, 8,202,846; and 8,383,599.

[00175] In some embodiments, the nucleic acid-based gene-regulating system comprises one or more morpholinos. “Morpholino” as used herein refers to a modified nucleic acid oligomer wherein standard nucleic acid bases are bound to morpholine rings and are linked through phosphorodiamidate linkages. Similar to siRNA and shRNA, morpholinos bind to complementary mRNA sequences. However, morpholinos function through steric-inhibition of mRNA translation and alteration of mRNA splicing rather than targeting complementary mRNA sequences for degradation.

[00176] In some embodiments, the nucleic acid-based gene-regulating system comprises a nucleic acid molecule (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino) that binds to a target RNA sequence that is at least 90% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Tables 3-8. Throughout this application, the referenced genomic coordinates are based on genomic annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available at the National Center for Biotechnology Information website. Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to the corresponding coordinates in another assembly of the human genome, including conversion to an earlier assembly generated by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion an assembly generated by a different institution or algorithm (e.g., from GRCh38 to NCBI33, generated by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, NCBI Genome Remapping Service, available at the National Center for Biotechnology Information website, UCSC LiftOver, available at the UCSC Genome Brower website, and Assembly Converter, available at the Ensembl.org website.

[00177] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two nucleic acid molecules (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino), wherein at least one nucleic acid molecule is a SOCS!-targeting nucleic acid molecule. In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2). In some embodiments, the at least one SOCS targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2). In some embodiments, the least one SOCS-targeting nucleic acid molecule is an siRNA or an shRNA molecule. In some embodiments, the at least one SOCS / -targeting siRNA or an shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2). In some embodiments, the at least one SOCS / -targeting siRNA or an shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socsi gene (SEQ ID NO: 2).

[00178] In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCSI- targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151. In some embodiments, the at least one SOCSI-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151.

[00179] In some embodiments, the at least one SOCSI-targeting nucleic acid molecule is a SOCS 1-targeting shRNA or siRNA molecule. In some embodiments, the at least one SOCS / -targeting shRNA or siRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCS!-targeting shRNA or siRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCSI-targeting shRNA or siRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151. In some embodiments, the at least one SOCSI-targeting shRNA or siRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151.

[00180] In some embodiments, the nucleic acid-based gene-regulating system comprises at least one SOCS-targeting siRNA molecule or shRNA molecule selected from those known in the art. For example, in some embodiments, the SOCS! targeting nucleic acid molecule is a SOCS / -targeting shRNA molecule that binds to a target sequence selected from SEQ ID NOs: 152-171 shown in Table A (See US Patent No. 9,944,931). In some embodiments, the SOCS / -targeting shRNA molecule is encoded by a nucleic acid sequence selected from SEQ ID NOs: 172-174 shown in Table A (See US Patent No. 8,324,369). In some embodiments, the SOCS-targeting nucleic acid molecule is a SOCSI- targeting siRNA comprising a nucleic acid sequence selected from SEQ ID NOs: 175-184 shown in Table B (See International PCT Publication Nos. WO 2017120996, WO 2018137295; WO 2017120998; and WO 2018137293). Table 3: SOCSI Human Genome Coordinates Coordinates Target Coordinates SOCS] Coordinates Target Coordinates chrl6:11255062-11255081 SOCS1 | chr16:11255317-11255336 chr16:11255259-11255278 SOCS! | chrl6:11255351-11255370 chrl6:11255230-11255249 SOCSI | chr16:11254811-11254830 chrl6:11255084-11255103 SOCS1 | chr16:11255353-11255372 chr16:11255175-11255194 SOCSI | chrl6:11255350-11255369 chr16:11255419-11255438 SOCSI | chrl6:11255309-11255328 chr16:11254903-11254922 SOCSI | chr16:11255390-11255409 chr16:11255089-11255108 SOCS1 | chr16:11255478-11255497 chr16:11255379-11255398 SOCSI | chrl6:11255330-11255349 chrl6:11255206-11255225 SOCSI | chr16:11254875-11254894 chr16:11255090-11255109 SOCS1 | chr16:11255124-11255143 chr16:11255208-11255227 SOCS! | chrl6:11255352-11255371 chr16:11254956-11254975 SOCS! | chrl16:11254872-11254891 chrl16:11255118-11255137 SOCS!I | chr16:11255331-11255350 chr16:11254906-11254925 SOCSI | chrl6:11255315-11255334 chr16:11255167-11255186 SOCS! | chrl16:11255482-11255501 chrl6:11254835-11254854 SOCSI | chr16:11254995-11255014 chrl6:11255292-11255311 SOCSI | chr16:11255316-11255335 chr16:11255416-11255435 SOCSI | chrl6:11255308-11255327 chr16:11255136-11255155 SOCSI | chrl6:11255321-11255340 chr16:11254964-11254983 SOCS1 | chr16:11255322-11255341 chr16:11254896-11254915 SOCSI | chrl6:11255330-11255349 chr16:11254940-11254959 SOCSI | chrl6:11255368-11255387 chrl16:11255349-11255368 SOCSI | chr16:11255377-11255396 chr16:11254992-11255011 SOCS!1 | chrl16:11255380-11255399 Table 4: Socsl Murine Genome Coordinates Target Coordinates Socsl] chr16:10784479-10784498 Socsl] chr16:10784409-10784428 Socsl] chr16:10784456-10784475 Socsl] chr16:10784322-10784341 Socsl] chr16:10784548-10784567 Socsl] chr16:10784596-10784615 Socsl] chr16:10784264-10784283 Socsl] chr16:10784628-10784647 Socsl] chr16:10784526-10784545 Socsl] chr16:10784508-10784527 Socsl] chr16:10784565-10784584 Socsl] chr16:10784474-10784493 Socsl] chr16:10784293-10784312 Table A: Exemplary shRNA Target Sequences SEQ ID 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 Sequence SEQ ID TTTCGAGCTGCTGGAGCACTA 152 153 TCGCCAACGGAACTGCTTCTT 154 ACTTCTGGCTGGAGACCTCAT 155 GCGAGACCTTCGACTGCCTTT 156 CGACACTCACTTCCGCACCTT 157 CTACCTGAGTTCCTTCCCCTT 158 TTCCGCTCCCACTCCGATTAC 159 TAACCCGGTACTCCGTGACTA 160 TACTCCGTGACTACCTGAGTT 161 CTTCCGCTCCCACTCCGATTA 162 163 TGGACGCCTGCGGCTTCTATT 164 CGCATCCCTCTTAACCCGGTA 165 TACATATTCCCAGTATCTTTG 166 GCGCCTTATTATTTCTTATTA 167 CCGTGACTACCTGAGTTCCTT 168 GGAGGGTCTCTGGCTTCATTT 169 170 ATCCCTCTTAACCCGGTACTC 171 CACGCACTTCCGCACATTC 172 TTCCGTTCGCACGCCGATT 173 GAGCTTCGACTGCCTCTTC 174 Table B: Exemplary siRNA Target Sequences SEQ ID 175 176 177 178 179 180 181 182 183 Sequence SEQ ID 175 176 177 178 179 180 181 182 183 184

[00181] some embodiments, the nucleic acid-based gene-regulating system comprises at least two nuc acid molecules (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino), wherein at least one nucleic acid molecule is a PTPN2-targeting nucleic acid molecule. In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4). In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4). In some embodiments, the least one P7PN2-targeting nucleic acid molecule is an siRNA or an shRNA molecule. In some embodiments, the at least one PTPN2-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Ptpn2 gene (SEQ ID NO: 4). In some embodiments, the at least one PTPN2-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4).

[00182] In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2- targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207. In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207.

[00183] In some embodiments, the at least one PTPN2-targeting nucleic acid molecule is a SOCS1-targeting shRNA or siRNA molecule. In some embodiments, the at least one PTPN2-targeting shRNA or siRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2-targeting shRNA or siRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2-targeting shRNA or siRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207. In some embodiments, the at least one PTPN2-targeting shRNA or siRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207. Table 5: PTPN2 Human Genome Coordinates PTPN?2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN?2 PTPN?2 PTPN2 PTPN?2 PTPN?2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 PTPN2 Table 6: Ptpn2 Murine Genome Coordinates Target Coordinates Pmpn2 Chr18:67680998-67681017 Pipn2 Chr18:67677801-67677820 Ptpn2 Chr18:67680904-67680923 Ptpn2 Chr18:67681553-67681572 Pmpn2 Chr18:67688965-67688984 Ptpn2 Chr18:67680958-67680977 Ptpn2 Chr18:67688944-67688963 Pmpn2 Chr18:67677855-67677874 Ptpn2 Chr18:67677734-67677753 Ppn2 Chr18:67680967-67680986 Ppn2 Chr18:67688912-67688931 Ptpn2 Chr18:67680881-67680900 Pwpn2 Chr18:67681529-67681548

[00184] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two nucleic acid molecules (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino), wherein at least one nucleic acid molecule is a ZC3H12A-targeting nucleic acid molecule. In some embodiments, the at least one ZC3H / 2A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the least one ZC3H2A-targeting nucleic acid molecule is an siRNA or an shRNA molecule. In some embodiments, the at least one ZC3H12A-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one ZC3H12A4-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the ZC3HI24 gene (SEQ ID NO: 5) or the Zc3h124 gene (SEQ ID NO: 6).

[00185] In some embodiments, the at least one ZC3H12A4-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H124-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H / 24- targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the at least one ZC3H / 2A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230.

[00186] In some embodiments, the at least one ZC3H2A4-targeting nucleic acid molecule is a SOCS1-targeting shRNA or siRNA molecule. In some embodiments, the at least one ZC3H / 24- targeting shRNA or siRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H12A-targeting shRNA or siRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H / 2A-targeting ShRNA or siRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the at least one ZC3H / 2A-targeting shRNA or siRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the ZC3H 124 -targeting nucleic acid molecule is a ZC3H12A-targeting shRNA molecule encoded by a nucleic acid sequence selected from SEQ ID NOs: 234-237 (See Huang ef al., J Biol Chem (2015) 290(34), 20782-20792). In some embodiments, the ZC3HI2A-targeting nucleic acid molecule is a ZC3HI2A-targeting siRNA comprising a nucleic acid sequence selected from SEQ ID NOs: 231-233 (See Liu et al., Scientific Reports (2016), 6, Article # 24073 and Mino et al., Cell (2015) 161(5), 1058-1073). Table 7: ZC3HI12A Human Genome Coordinates Target Coordinates ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 ZC3HI24 ZC3HI2A ZC3HI24 Target Coordinates ZC3HI24 ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI2A ZC3HI24 Table 8: Zc3h12a Murine Genome Coordinates Target Coordinates Zc3hl2a Zc3hil2a Zc3hl2a Zc3hl2a Zc3hl2a Zc3hl2a Zc3hl2a Zc3hil2a

[00187] In some embodiments, the at least one SOCSI-, PTPN2-, or ZC3H12A-targeting siRNA molecule or shRNA molecule is obtained from a commercial suppliers such as Sigma Aldrich®, Dharmacon®, ThermoFisher®, and the like. In some embodiments, the at least one SOCS / - , PTPN2-, or ZC3H12A-targeting siRNA molecule is one shown in Table 9. In some embodiments, the at least one SOCSI-, PTPN2-, or ZC3H12A-targeting shRNA molecule is one shown in Table 10. Table 9: Exemplary SOCS1, PTPN2, and ZC3H12A4 siRNAs siRNA construct SOCS] PTPN?2 Target Gene siRNA construct MISSION® esiRNA targeting mouse Socs / (SigmaAlrich# EMU203261 SOCS1 Rosetta Predictions human (SigmaAlrich# NM_003745 Rosetta Predictions murine (SigmaAlrich# NM 009896 MISSION® esiRNA human PTPN2 (esiRNA1) (SigmaAldrich# EHU113971 human Rosetta Predictions (SigmaAldrich# NM 002828 PTPN2 human Rosetta Predictions (SigmaAldrich# NM 080422 human Rosetta Predictions (SigmaAldrich# NM_080423 murine Rosetta Predictions (SigmaAldrich# NM 001127177 MISSION® esiRNA targeting human ZC3H124 (esiRNA1) (SigmaAldrich# EHU009491 ZC3HI24 MISSION® esiRNA targeting mouse Zc3h / 2a (esiRNAT) (SigmaAldrich# EMU048551 Target Gene siRNA construct Rosetta Predictions human (SigmaAldrich# NM_025079 Rosetta Predictions mouse (SigmaAldrich# NM 153159 Table 10: Exemplary SOCS1, PTPN2, and ZC3H12A shRNAs shRNA construct SOCS] PTPN?2 shRNA construct MISSION® shRNA Plasmid DNA human (SigmaAlrich# SHCLND- SOCS1 NM 003745 MISSION® shRNA Plasmid DNA murine (SigmaAlrich# SHCLND- NM_009896 PTPN? MISSION® shRNA Plasmid human (SigmaAldrich# SHCLND-NM 002827 MISSION® shRNA Plasmid murine (SigmaAldrich# SHCLND-NM 011201 MISSION® shRNA Plasmid DNA human (SigmaAldrich# SHCLND- NM 025079, ZC3HI2A 1SSION® ShRNA Plasmid DNA mouse (SigmaAldrich# SHCLND- NM 153159

[00188] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two nucleic acid molecules (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino), wherein at least one nucleic acid molecule is a SOCS / -targeting nucleic acid molecule and at least one nucleic acid molecule is a PTPN2-targeting nucleic acid molecule. In some embodiments, the at least one SOCS targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the SOCS / gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4). In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the SOCS? gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4).

[00189] In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one SOCS 1-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6.

[00190] In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207. In some embodiments, the at least one SOCSI- targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207.

[00191] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two siRNA or shRNA molecules, wherein at least one siRNA or shRNA molecule is a SOCSI- targeting siRNA or siRNA molecule and at least one siRNA or siRNA molecule is a PTPN2-targeting siRNA or shRNA molecule. In some embodiments, the least one SOCSI-targeting nucleic acid molecule is an siRNA or an shRNA molecule and at least one PTPN2-targeting nucleic acid molecule is an siRNA or shRNA molecule. In some embodiments, the at least one SOCS / -targeting siRNA or an shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the PTPN?2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4). In some embodiments, the at least one SOCS-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4).

[00192] In some embodiments, the at least one SOCS!-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6.

[00193] In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207. In some embodiments, the at least one SOCS-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one PTPN2- targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207.

[00194] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two nucleic acid molecules (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino), wherein at least one nucleic acid molecule is a SOCS / -targeting nucleic acid molecule and at least one nucleic acid molecule is a ZC3H2A-targeting nucleic acid molecule. In some embodiments, the at least one SOCSI-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one ZC3HI2A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one SOCS!-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00195] In some embodiments, the at least one SOCS / -targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one SOCSI-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00196] In some embodiments, the at least one SOCS!-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the at least one SOCSI- targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one ZC3H2A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230.

[00197] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two siRNA or shRNA molecules, wherein at least one siRNA or shRNA molecule is a SOCSI- targeting siRNA or shRNA molecule and at least one siRNA or shRNA molecule is a ZC3H124- targeting siRNA or shRNA molecule. In some embodiments, the least one SOCS!-targeting nucleic acid molecule is an siRNA or an shRNA molecule and at least one ZC3H12A4-targeting nucleic acid molecule is an siRNA or shRNA molecule. In some embodiments, the at least one SOCS!-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one ZC3H12A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one SOCSI-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one ZC3H12A4-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3hi2a gene (SEQ ID NO: 6).

[00198] In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H12A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H12A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00199] In some embodiments, the at least one SOCS / -targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one ZC3H / 2A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the at least one SOCS targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 7-151 and the at least one ZC3H124- targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230.

[00200] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two nucleic acid molecules (e.g., an siRNA, an shRNA, an RNA aptamer, or a morpholino), wherein at least one nucleic acid molecule is a PTPN2-targeting nucleic acid molecule and at least one nucleic acid molecule is a ZC3H2A-targeting nucleic acid molecule. In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Ptpn2 gene (SEQ ID NO: 4) and the at least one ZC3H / 2A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4) and the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00201] In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC 3H12A-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00202] In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207 and the at least one ZC3HI2A-targeting nucleic acid molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the at least one PTPN2-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207 and the at least one ZC3H12A4-targeting nucleic acid molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230.

[00203] In some embodiments, the nucleic acid-based gene-regulating system comprises at least two siRNA or shRNA molecules, wherein at least one siRNA or shRNA molecule is a PTPN2- targeting siRNA or shRNA molecule and at least one siRNA or shRNA molecule is a ZC3H124- targeting siRNA or shRNA molecule. In some embodiments, the at least one PTPN2-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Ptpn2 gene (SEQ ID NO: 4) and the at least one ZC3H12A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one PTPN2-targeting siRNA or an shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4) and the at least one ZC3H]2A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00204] In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H2A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H12A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to a RNA sequence encoded by a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00205] In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting siRNA or shRNA molecule binds to a target RNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. In some embodiments, the at least one PTPN2-targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 185-207 and the at least one ZC3H124- targeting siRNA or shRNA molecule binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by one of SEQ ID NOs: 208-230. B. Protein-based gene-regulating systems

[00206] In some embodiments, the present disclosure provides protein gene-regulating systems comprising two or more proteins capable of reducing the expression and / or function of at least two endogenous genes selected from SOCS1, PTPN2, and ZC3H12A. In some embodiments, the present disclosure provides modified immune effector cells comprising such gene-regulating systems. In some embodiments, a protein-based gene-regulating system is a system comprising one or more proteins capable of regulating the expression of an endogenous target gene in a sequence specific manner without the requirement for a nucleic acid guide molecule. In some embodiments, the protein-based gene-regulating system comprises a protein comprising one or more zinc-finger binding domains and an enzymatic domain. In some embodiments, the protein-based gene-regulating system comprises a protein comprising a Transcription activator-like effector nuclease (TALEN) domain and an enzymatic domain. Such embodiments are referred to herein as “TALENs”. 1. Zinc finger systems

[00207] In some embodiments, the present disclosure provides zinc finger gene-regulating systems comprising two or more zinc finger fusion proteins capable of reducing the expression and / or function of at least two endogenous genes selected from SOCS!I, PTPN2, and ZC3HI24. In some embodiments, the present disclosure provides modified immune effector cells comprising such gene- regulating systems. Herein, zinc finger-based systems comprise a fusion protein with two protein domains: a zinc finger DNA binding domain and an enzymatic domain. A “zinc finger DNA binding domain”, “zinc finger protein”, or “ZFP” is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The zinc finger domain, by binding to a target DNA sequence, directs the activity of the enzymatic domain to the vicinity of the sequence and, hence, induces modification of the endogenous target gene in the vicinity of the target sequence. A zinc finger domain can be engineered to bind to virtually any desired sequence. Accordingly, after identifying a target genetic locus containing a target DNA sequence at which cleavage or recombination is desired (e.g., a target locus in a target gene referenced in Tables 2 or 3), one or more zinc finger binding domains can be engineered to bind to one or more target DNA sequences in the target genetic locus. Expression of a fusion protein comprising a zinc finger binding domain and an enzymatic domain in a cell affects modification in the target genetic locus.

[00208] In some embodiments, a zinc finger binding domain comprises one or more zinc fingers. Miller et al. (1985) EMBO J. 4:1609-1614; Rhodes (1993) Scientific American Febuary:56- 65; U.S. Pat. No. 6,453,242. Typically, a single zinc finger domain is about 30 amino acids in length. An individual zinc finger binds to a three-nucleotide (i.e., triplet) sequence (or a four-nucleotide sequence which can overlap, by one nucleotide, with the four-nucleotide binding site of an adjacent zinc finger). Therefore, the length of a sequence to which a zinc finger binding domain is engineered to bind (e.g., a target sequence) will determine the number of zinc fingers in an engineered zinc finger binding domain. For example, for ZFPs in which the finger motifs do not bind to overlapping subsites, a six-nucleotide target sequence is bound by a two-finger binding domain; a nine-nucleotide target sequence is bound by a three-finger binding domain, etc. Binding sites for individual zinc fingers (i.e., subsites) in a target site need not be contiguous, but can be separated by one or several nucleotides, depending on the length and nature of the amino acids sequences between the zinc fingers (i.e., the inter-finger linkers) in a multi-finger binding domain. In some embodiments, the DNA-binding domains of individual ZFNs comprise between three and six individual zinc finger repeats and can each recognize between 9 and 18 basepairs.

[00209] Zinc finger binding domains can be engineered to bind to a sequence of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637, Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416. An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein. Engineering methods include, but are not limited to, rational design and various types of selection.

[00210] Selection of a target DNA sequence for binding by a zinc finger domain can be accomplished, for example, according to the methods disclosed in U.S. Pat. No. 6,453,242. It will be clear to those skilled in the art that simple visual inspection of a nucleotide sequence can also be used for selection of a target DNA sequence. Accordingly, any means for target DNA sequence selection can be used in the methods described herein. A target site generally has a length of at least 9 nucleotides and, accordingly, is bound by a zinc finger binding domain comprising at least three zinc fingers. However binding of, for example, a 4-finger binding domain to a 12-nucleotide target site, a 5-finger binding domain to a 15-nucleotide target site or a 6-finger binding domain to an 18-nucleotide target site, is also possible. As will be apparent, binding of larger binding domains (e.g., 7-, 8-, 9- finger and more) to longer target sites is also possible.

[00211] In some embodiments, the protein-based gene-regulating system comprises at least two zine finger fusion proteins (ZFP), wherein at least one ZFP comprises a SOCS!-targeting zinc finger binding domain. In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2). In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a target DNA sequence in the SOCS gene (SEQ ID NO: 1) or the Socs1 gene (SEQ ID NO: 2).

[00212] In some embodiments, the at least one SOCS / -targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCSI-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCS-targeting zinc finger binding domain binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151. In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151. Exemplary SOCS! target DNA sequences are shown in Tables 12 and 13.

[00213] In some embodiments, the protein-based gene-regulating system comprises at least two zinc finger fusion proteins (ZFP), wherein at least one ZFP comprises a PTPN2-targeting zinc finger binding domain. In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4). In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a target DNA sequence in the P7PN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4).

[00214] In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one P7PN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185- 207. In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207. Exemplary PTPN2 target DNA sequences are shown in Tables 14 and 15.

[00215] In some embodiments, the protein-based gene-regulating system comprises at least two zinc finger fusion proteins (ZFP), wherein at least one ZFP comprises a ZC3H12A-targeting zinc finger binding domain. In some embodiments, the at least one ZC3H12A4-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence in the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3hi2a gene (SEQ ID NO: 6). In some embodiments, the at least one ZC3H / 2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a target DNA sequence in the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00216] In some embodiments, the at least one ZC3H / 2A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H / 2A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the at least one ZC3H / 2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary ZC3HI2A target DNA sequences are shown in Tables 16 and 17.

[00217] In some embodiments, the at least one SOCS / -, PTPN2-, or ZC3H12A-targeting ZFP is obtained from a commercial suppliers such as Sigma Aldrich, Dharmacon, ThermoFisher, and the like. For example, in some embodiments, the at least one SOCSI, PTPN2, or ZC3HI2A ZFP is one shown in Table 11. PTPN2 ZC3HI2A4 Table 11: Exemplary SOCS1, PTPN2, and ZC3H12A Zinc Finger Systems Target Gene Zinc Finger System CompoZr® Knockout ZFN plasmid Human SOCS / (NM_003745) SOCSI SigmaAldrich# CKOZFND20320 CompoZr® Knockout ZFN plasmid Mouse Socs / (NM_009896.2) SigmaAldrich# CKOZFND41801 PTPN2 CompoZr ® Knockout ZFN human plasmid PTPN2 (NM_002828) PTPN2 SigmaAldrich# CKOZFND17697 CompoZr ® Knockout ZFN murine plasmid Ptpn2 (NM_008977.3) SigmaAldrich# CKOZFND39632 CompoZr® Knockout ZFN Kit, ZFN plasmid Human ZC3H124 ZC3HI24 025079) (SigmaAldrich# CKOZFND23094 Target Gene Zinc Finger System CompoZr® Knockout ZFN Kit, ZFN plasmid mouse Zc3hi2a 153159.2) (SigmaAldrich# CKOZFND44851

[00218] In some embodiments, the protein-based gene-regulating system comprises at least two ZFPs, wherein at least one ZFP comprises a SOCS / -targeting zinc finger binding domain and at least one ZFP comprises a PTPN2-targeting zinc finger binding domain. In some embodiments, the at least one SOCS targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the SOCS / gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4). In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the SOCS / gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the P7PN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4).

[00219] In some embodiments, the at least one SOCS / -targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6.

[00220] In some embodiments, the at least one SOCS / -targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the at least one SOCS / -targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the at least one PTPN2- targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207.

[00221] In some embodiments, the protein-based gene-regulating system comprises at least two ZFPs, wherein at least one ZFP comprises a SOCS / -targeting zinc finger binding domain and at least one ZFP comprises a ZC3H12A-targeting zinc finger binding domain. In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3hi12a gene (SEQ ID NO: 6). In some embodiments, the at least one SOCS / -targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs] gene (SEQ ID NO: 2) and the at least one ZC3H2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3hi12a gene (SEQ ID NO: 6).

[00222] In some embodiments, the at least one SOCS!-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one SOCSI-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00223] In some embodiments, the at least one SOCS / -targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208- 230. In some embodiments, the at least one SOCSI-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230.

[00224] In some embodiments, the protein-based gene-regulating system comprises at least two ZFPs, wherein at least one ZFP comprises a PTPN2-targeting zinc finger binding domain and at least one ZFP comprises a ZC3H12A-targeting zinc finger binding domain. In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4) and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3hi12a gene (SEQ ID NO: 6). In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4) and the at least one ZC3H2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3hi12a gene (SEQ ID NO: 6).

[00225] In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H2A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00226] In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207 and the at least one ZC3H 12A-targeting zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208- 230. In some embodiments, the at least one PTPN2-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting zinc finger binding domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230.

[00227] The enzymatic domain portion of the zinc finger fusion proteins can be obtained from any endo- or exonuclease. Exemplary endonucleases from which an enzymatic domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, Mass.; and Belfort ez al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes which cleave DNA are known (e.g., 51 Nuclease; mung bean nuclease; pancreatic DNase; micrococcal nuclease; yeast HO endonuclease; see also Linn ef al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains.

[00228] Exemplary restriction endonucleases (restriction enzymes) suitable for use as an enzymatic domain of the ZFPs described herein are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding. Certain restriction enzymes (e.g, Type IIS) cleave DNA at sites removed from the recognition site and have separable binding and cleavage domains. For example, the Type IIS enzyme FokI catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; as well as Li ez al. (1992) Proc. Natl. Acad. Sci. USA 89:4275- 4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887;, Kim ef al. (1994b) J. Biol. Chem. 269:31,978-31,982. Thus, in one embodiment, fusion proteins comprise the enzymatic domain from at least one Type IIS restriction enzyme and one or more zinc finger binding domains.

[00229] An exemplary Type IIS restriction enzyme, whose cleavage domain is separable from the binding domain, is FokI. This particular enzyme is active as a dimer. Bitinaite ez al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Thus, for targeted double-stranded DNA cleavage using zinc finger-FokI fusions, two fusion proteins, each comprising a FokI enzymatic domain, can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two FokI enzymatic domains can also be used. Exemplary ZFPs comprising FokI enzymatic domains are described in US Patent No. 9,782,437. 2. TALEN systems

[00230] In some embodiments, the present disclosure provides TALEN gene-regulating systems comprising two or more TALEN fusion proteins capable of reducing the expression and / or function of at least two endogenous genes selected from SOCSI, PTPN2, and ZC3HI2A. In some embodiments, the present disclosure provides modified immune effector cells comprising such gene- regulating systems. TALEN-based systems comprise a TALEN fusion protein comprising a TAL effector DNA binding domain and an enzymatic domain. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts DNA strands). The FokI restriction enzyme described above is an exemplary enzymatic domain suitable for use in TALEN- based gene-regulating systems.

[00231] TAL effectors are proteins that are secreted by Xanthomonas bacteria via their type III secretion system when they infect plants. The DNA binding domain contains a repeated, highly conserved, 33-34 amino acid sequence with divergent 12th and 13th amino acids. These two positions, referred to as the Repeat Variable Diresidue (RVD), are highly variable and strongly correlated with specific nucleotide recognition. Therefore, the TAL effector domains can be engineered to bind specific target DNA sequences by selecting a combination of repeat segments containing the appropriate RVDs. The nucleic acid specificity for RVD combinations is as follows: HD targets cytosine, NI targets adenine, NG targets thymine, and NN targets guanine (though, in some embodiments, NN can also bind adenenine with lower specificity).

[00232] Methods and compositions for assembling the TAL-effector repeats are known in the art. See e.g., Cermak ef al, Nucleic Acids Research, 39:12, 2011, e82. Plasmids for constructions of the TAL-effector repeats are commercially available from Addgene.

[00233] In some embodiments, the protein-based gene-regulating system comprises at least two TALEN fusion proteins, wherein at least one TALEN fusion protein comprises a SOCS!-targeting TAL effector domain. In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2). In some embodiments, the at least one SOCSI-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a target DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 1).

[00234] In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCS targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151. In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151. Exemplary SOCS! target DNA sequences are shown in Tables 12 and 13.

[00235] In some embodiments, the protein-based gene-regulating system comprises at least two TALEN fusion proteins, wherein at least one TALEN fusion protein comprises a PTPN2-targeting TAL effector domain. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4). In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a target DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4).

[00236] In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207. Exemplary PTPN2 target DNA sequences are shown in Tables 14 and 15.

[00237] In some embodiments, the protein-based gene-regulating system comprises at least two TALEN fusion proteins, wherein at least one TALEN fusion protein comprises a ZC3H12A-targeting TAL effector domain. In some embodiments, the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a target DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3hi12a gene (SEQ ID NO: 6).

[00238] In some embodiments, the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one ZC3H2A-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the at least one ZC3H2A-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary ZC3H124 target DNA sequences are shown in Tables 16 and 17.

[00239] In some embodiments, the protein-based gene-regulating system comprises at least two TAL fusion proteins, wherein at least one TALEN fusion protein comprises a SOCS!-targeting TAL effector domain and at least one TALEN fusion protein comprises a PTPN2-targeting TAL effector domain. In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one PTPN2- targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4). In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Ptpn2 gene (SEQ ID NO: 4).

[00240] In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2- targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the at least one SOCSI-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6.

[00241] In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207.

[00242] In some embodiments, the protein-based gene-regulating system comprises at least two TALEN fusion proteins, wherein at least one TALEN fusion protein comprises a SOCS]-targeting TAL effector domain and at least one TALEN fusion protein comprises a ZC3H2A-targeting TAL effector domain. In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the at least one ZC3H / 24- targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2) and the at least one ZC3H12A4-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00243] In some embodiments, the at least one SOCS-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H124- targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one SOCSI-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00244] In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the at least one SOCS / -targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208- 230.

[00245] In some embodiments, the protein-based gene-regulating system comprises at least two TALEN fusion proteins, wherein at least one TALEN fusion protein comprises a PTPN2-targeting TAL effector domain and at least one TALEN fusion protein comprises a ZC3H2A-targeting TAL effector domain. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Ppn2 gene (SEQ ID NO: 4) and the at least one ZC3H12A- targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4) and the at least one ZC3H124-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00246] In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H124- targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the at least one ZC3H12A4-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00247] In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the at least one PTPN2-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207 and the at least one ZC3H12A-targeting TAL effector domain binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208- 230. C. Combination nucleic acid / protein-based gene-regulating systems

[00248] Combination gene-regulating systems comprise a site-directed modifying polypeptide and a nucleic acid guide molecule. Herein, a “site-directed modifying polypeptide” refers to a polypeptide that binds to a nucleic acid guide molecule, is targeted to a target nucleic acid sequence, (for example, an endogenous target DNA or RNA sequence) by the nucleic acid guide molecule to which it is bound, and modifies the target nucleic acid sequence (e.g., cleavage, mutation, or methylation of a target nucleic acid sequence).

[00249] A site-directed modifying polypeptide comprises two portions, a portion that binds the nucleic acid guide and an activity portion. In some embodiments, a site-directed modifying polypeptide comprises an activity portion that exhibits site-directed enzymatic activity (e.g., DNA methylation, DNA or RNA cleavage, histone acetylation, histone methylation, etc.), wherein the site of enzymatic activity is determined by the guide nucleic acid. In some cases, a site-directed modifying polypeptide comprises an activity portion that has enzymatic activity that modifies the endogenous target nucleic acid sequence (e.g., nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity or glycosylase activity). In other cases, a site-directed modifying polypeptide comprises an activity portion that has enzymatic activity that modifies a polypeptide (e.g., a histone) associated with the endogenous target nucleic acid sequence (e.g., methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity). In some embodiments, a site-directed modifying polypeptide comprises an activity portion that modulates transcription of a target DNA sequence (e.g., to increase or decrease transcription). In some embodiments, a site- directed modifying polypeptide comprises an activity portion that modulates expression or translation of a target RNA sequence (e.g., to increase or decrease transcription).

[00250] The nucleic acid guide comprises two portions: a first portion that is complementary to, and capable of binding with, an endogenous target nucleic sequence (referred to herein as a “nucleic acid-binding segment”), and a second portion that is capable of interacting with the site-directed modifying polypeptide (referred to herein as a “protein-binding segment”). In some embodiments, the nucleic acid-binding segment and protein-binding segment of a nucleic acid guide are comprised within a single polynucleotide molecule. In some embodiments, the nucleic acid-binding segment and protein-binding segment of a nucleic acid guide are each comprised within separate polynucleotide molecules, such that the nucleic acid guide comprises two polynucleotide molecules that associate with each other to form the functional guide.

[00251] The nucleic acid guide mediates the target specificity of the combined protein / nucleic acid gene-regulating systems by specifically hybridizing with a target nucleic acid sequence. In some embodiments, the target nucleic acid sequence is an RNA sequence, such as an RNA sequence comprised within an mRNA transcript of a target gene. In some embodiments, the target nucleic acid sequence is a DNA sequence comprised within the DNA sequence of a target gene. Reference herein to a target gene encompasses the full-length DNA sequence for that particular gene which comprises a plurality of target genetic loci (i.e., portions of a particular target gene sequence (e.g., an exon or an intron)). Within each target genetic loci are shorter stretches of DNA sequences referred to herein as “target DNA sequences” that can be modified by the gene-regulating systems described herein. Further, each target genetic loci comprises a “target modification site,” which refers to the precise location of the modification induced by the gene-regulating system (e.g., the location of an insertion, a deletion, or mutation, the location of a DNA break, or the location of an epigenetic modification). The gene-regulating systems described herein may comprise 2 or more nucleic acid guides (e.g., 2, 3, 4,5,6,7,8,9, 10, or more nucleic acid guides).

[00252] In some embodiments, the combined protein / nucleic acid gene-regulating systems comprise site-directed modifying polypeptides derived from Argonaute (Ago) proteins (e.g., T. thermophiles Ago or TtAgo). In such embodiments, the site-directed modifying polypeptide is a 7. thermophiles Ago DNA endonuclease and the nucleic acid guide is a guide DNA (gDNA) (See, Swarts et al., Nature 507 (2014), 258-261). In some embodiments, the present disclosure provides a polynucleotide encoding a gDNA. In some embodiments, a gDNA-encoding nucleic acid is comprised in an expression vector, e.g., a recombinant expression vector. In some embodiments, the present disclosure provides a polynucleotide encoding a TtAgo site-directed modifying polypeptide or variant thereof. In some embodiments, the polynucleotide encoding a TtAgo site-directed modifying polypeptide is comprised in an expression vector, e.g., a recombinant expression vector.

[00253] In some embodiments, the gene editing systems described herein are CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas (CRISPR Associated) nuclease systems. In some embodiments, the CRISPR / Cas system is a Class 2 system. Class 2 CRISPR / Cas systems are divided into three types: Type II, Type V, and Type VI systems. In some embodiments, the CRISPR / Cas system is a Class 2 Type II system, utilizing the Cas9 protein. In such embodiments, the site-directed modifying polypeptide is a Cas9 DNA endonuclease (or variant thereof) and the nucleic acid guide molecule is a guide RNA (gRNA). In some embodiments, the CRISPR / Cas system is a Class 2 Type V system, utilizing the Cas12 proteins (e.g., Cas12a (also known as Cpf1), Cas12b (also known as C2cl1), Casl2c (also known as C2¢3), Cas12d (also known as CasY), and Cas12e (also known as CasX)). In such embodiments, the site-directed modifying polypeptide is a Cas12 DNA endonuclease (or variant thereof) and the nucleic acid guide molecule is a gRNA. In some embodiments, the CRISPR / Cas system is a Class 2 and Type VI system, utilizing the Cas13 proteins (e.g., Casl3a (also known as C2¢2), Casl3b, and Casl3c). (See, Pyzocha et al., ACS Chemical Biology, 13(2), 347-356). In such embodiments, the site-directed modifying polypeptide is a Cas13 RNA riboendonuclease and the nucleic acid guide molecule is a gRNA.

[00254] A Cas polypeptide refers to a polypeptide that can interact with a gRNA molecule and, in concert with the gRNA molecule, home or localize to a target DNA or target RNA sequence. Cas polypeptides include naturally occurring Cas proteins and engineered, altered, or otherwise modified Cas proteins that differ by one or more amino acid residues from a naturally-occurring Cas sequence.

[00255] A guide RNA (gRNA) comprises two segments, a DNA-binding segment and a protein-binding segment. In some embodiments, the protein-binding segment of a gRNA is comprised in one RNA molecule and the DNA-binding segment is comprised in another separate RNA molecule. Such embodiments are referred to herein as “double-molecule gRNAs” or “two-molecule gRNA” or “dual gRNAs.” In some embodiments, the gRNA is a single RNA molecule and is referred to herein as a “single-guide RNA” or an “sgRNA.” The term “guide RNA” or “gRNA” is inclusive, referring both to two-molecule guide RNAs and sgRNAs.

[00256] The protein-binding segment of a gRNA comprises, in part, two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex), which facilitates binding to the Cas protein. The nucleic acid-binding segment (or “nucleic acid-binding sequence”) of a gRNA comprises a nucleotide sequence that is complementary to and capable of binding to a specific target nucleic acid sequence. The protein-binding segment of the gRNA interacts with a Cas polypeptide and the interaction of the gRNA molecule and site-directed modifying polypeptide results in Cas binding to the endogenous nucleic acid sequence and produces one or more modifications within or around the target nucleic acid sequence. The precise location of the target modification site is determined by both (i) base-pairing complementarity between the gRNA and the target nucleic acid sequence; and (ii) the location of a short motif; referred to as the protospacer adjacent motif (PAM), in the target DNA sequence (referred to as a protospacer flanking sequence (PFS) in target RNA sequences). The PAM / PFS sequence is required for Cas binding to the target nucleic acid sequence. A variety of PAM / PFS sequences are known in the art and are suitable for use with a particular Cas endonuclease (e.g., a Cas9 endonuclease). (See e.g., Nat Methods. 2013 Nov; 10(11): 1116-1121 and Sci Rep. 2014; 4: 5405). In some embodiments, the PAM sequence is located within 50 base pairs of the target modification site in a target DNA sequence. In some embodiments, the PAM sequence is located within 10 base pairs of the target modification site in a target DNA sequence. The DNA sequences that can be targeted by this method are limited only by the relative distance of the PAM sequence to the target modification site and the presence of a unique 20 base pair sequence to mediate sequence-specific, gRNA-mediated Cas binding. In some embodiments, the PFS sequence is located at the 3” end of the target RNA sequence. In some embodiments, the target modification site is located at the 5’ terminus of the target locus. In some embodiments, the target modification site is located at the 3° end of the target locus. In some embodiments, the target modification site is located within an intron or an exon of the target locus.

[00257] In some embodiments, the present disclosure provides a polynucleotide encoding a gRNA. In some embodiments, a gRNA-encoding nucleic acid is comprised in an expression vector, e.g., a recombinant expression vector. In some embodiments, the present disclosure provides a polynucleotide encoding a site-directed modifying polypeptide. In some embodiments, the polynucleotide encoding a site-directed modifying polypeptide is comprised in an expression vector, e.g., a recombinant expression vector. 1. Cas proteins

[00258] In some embodiments, the site-directed modifying polypeptide is a Cas protein. Cas molecules of a variety of species can be used in the methods and compositions described herein, including Cas molecules derived from S. pyogenes, S. aureus, N. meningitidis, S. thermophiles, Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Cycliphilusdenitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterospoxus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candlidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputomm, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp., or Verminephrobacter eiseniae.

[00259] In some embodiments, the Cas protein is a naturally-occurring Cas protein. In some embodiments, the Cas endonuclease is selected from the group consisting of C2C1, C2C3, Cpfl (also referred to as Casl2a), Cas12b, Casl2c, Casl2d, Casl2e, Casl3a, Cas13b, Casl3c, Casl3d, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csx10, Csx16, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, and Csf4.

[00260] In some embodiments, the Cas protein is an endoribonuclease such as a Cas13 protein. In some embodiments, the Cas13 protein is a Cas13a (Abudayyeh ez al., Nature 550 (2017), 280-284), Cas13b (Cox et al., Science (2017) 358:6336, 1019-1027), Casl3c (Cox ef al., Science (2017) 358:6336, 1019-1027), or Cas13d (Zhang et al., Cell 175 (2018), 212-223) protein.

[00261] In some embodiments, the Cas protein is a wild-type or naturally occurring Cas9 protein or a Cas9 ortholog. Wild-type Cas9 is a multi-domain enzyme that uses an HNH nuclease domain to cleave the target strand of DNA and a RuvC-like domain to cleave the non-target strand. Binding of WT Cas9 to DNA based on gRNA specificity results in double-stranded DNA breaks that can be repaired by non-homologous end joining (NHEJ) or homology-directed repair (HDR). Exemplary naturally occurring Cas9 molecules are described in Chylinski ef al., RNA Biology 2013 10:5, 727-737 and additional Cas9 orthologs are described in International PCT Publication No. WO 2015 / 071474. Such Cas9 molecules include Cas9 molecules of a cluster 1 bacterial family, cluster 2 bacterial family, cluster 3 bacterial family, cluster 4 bacterial family, cluster 5 bacterial family, cluster 6 bacterial family, a cluster 7 bacterial family, a cluster 8 bacterial family, a cluster 9 bacterial family, a cluster 10 bacterial family, a cluster 1 1 bacterial family, a cluster 12 bacterial family, a cluster 13 bacterial family, a cluster 14 bacterial family, a cluster 15 bacterial family, a cluster 16 bacterial family, a cluster 17 bacterial family, a cluster 18 bacterial family, a cluster 19 bacterial family, a cluster 20 bacterial family, a cluster 21 bacterial family, a cluster 22 bacterial family, a cluster 23 bacterial family, a cluster 24 bacterial family, a cluster 25 bacterial family, a cluster 26 bacterial family, a cluster 27 bacterial family, a cluster 28 bacterial family, a cluster 29 bacterial family, a cluster 30 bacterial family, a cluster 31 bacterial family, a cluster 32 bacterial family, a cluster 33 bacterial family, a cluster 34 bacterial family, a cluster 35 bacterial family, a cluster 36 bacterial family, a cluster 37 bacterial family, a cluster 38 bacterial family, a cluster 39 bacterial family, a cluster 40 bacterial family, a cluster 41 bacterial family, a cluster 42 bacterial family, a cluster 43 bacterial family, a cluster 44 bacterial family, a cluster 45 bacterial family, a cluster 46 bacterial family, a cluster 47 bacterial family, a cluster 48 bacterial family, a cluster 49 bacterial family, a cluster 50 bacterial family, a cluster 51 bacterial family, a cluster 52 bacterial family, a cluster 53 bacterial family, a cluster 54 bacterial family, a cluster 55 bacterial family, a cluster 56 bacterial family, a cluster 57 bacterial family, a cluster 58 bacterial family, a cluster 59 bacterial family, a cluster 60 bacterial family, a cluster 61 bacterial family, a cluster 62 bacterial family, a cluster 63 bacterial family, a cluster 64 bacterial family, a cluster 65 bacterial family, a cluster 66 bacterial family, a cluster 67 bacterial family, a cluster 68 bacterial family, a cluster 69 bacterial family, a cluster 70 bacterial family, a cluster 71 bacterial family, a cluster 72 bacterial family, a cluster 73 bacterial family, a cluster 74 bacterial family, a cluster 75 bacterial family, a cluster 76 bacterial family, a cluster 77 bacterial family, or a cluster 78 bacterial family.

[00262] In some embodiments, the naturally occurring Cas9 polypeptide is selected from the group consisting of SpCas9, SpCas9-HF 1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, and NmeCas9. In some embodiments, the Cas9 protein comprises an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a Cas9 amino acid sequence described in Chylinski ez al, RNA Biology 2013 10:5, 727-737; Hou et al., PNAS Early Edition 2013, 1-6).

[00263] In some embodiments, the Cas polypeptide comprises one or more of the following activities: (a) a nickase activity, ie., the ability to cleave a single strand, e.g., the non- complementary strand or the complementary strand, of a nucleic acid molecule; (b) adouble stranded nuclease activity, i.e., the ability to cleave both strands of a double stranded nucleic acid and create a double stranded break, which in an embodiment is the presence of two nickase activities; (c) an endonuclease activity; (d) an exonuclease activity; and / or (e) a helicase activity, i.e., the ability to unwind the helical structure of a double stranded nucleic acid.

[00264] In some embodiments, the Cas polypeptide is fused to heterologous proteins that recruit DNA-damage signaling proteins, exonucleases, or phosphatases to further increase the likelihood or the rate of repair of the target sequence by one repair mechanism or another. In some embodiments, a WT Cas polypeptide is co-expressed with a nucleic acid repair template to facilitate the incorporation of an exogenous nucleic acid sequence by homology-directed repair.

[00265] In some embodiments, different Cas proteins (i.e., Cas9 proteins from various species) may be advantageous to use in the various provided methods in order to capitalize on various enzymatic characteristics of the different Cas proteins (e.g., for different PAM sequence preferences; for increased or decreased enzymatic activity; for an increased or decreased level of cellular toxicity; to change the balance between NHEJ, homology-directed repair, single strand breaks, double strand breaks, etc.).

[00266] In some embodiments, the Cas protein is a Cas9 protein derived from S. pyogenes and recognizes the PAM sequence motif NGG, NAG, NGA (Mali ef al, Science 2013; 339(6121): 823- 826). In some embodiments, the Cas protein is a Cas9 protein derived from S. thermophiles and recognizes the PAM sequence motif NGGNG and / or NNAGAAW (W = A or T) (See, e.g., Horvath et al, Science, 2010; 327(5962): 167-170, and Deveau et al, J Bacteriol 2008; 190(4): 1390-1400). In some embodiments, the Cas protein is a Cas9 protein derived from S. mutans and recognizes the PAM sequence motif NGG and / or NAAR (R = A or G) (See, e.g, Deveau ef al, J BACTERIOL 2008; 190(4): 1390-1400). In some embodiments, the Cas protein is a Cas9 protein derived from S. aureus and recognizes the PAM sequence motif NNGRR (R = A or G). In some embodiments, the Cas protein is a Cas9 protein derived from S. aureus and recognizes the PAM sequence motif N GRRT (R = A or G). In some embodiments, the Cas protein is a Cas9 protein derived from S. aureus and recognizes the PAM sequence motif N GRRV (R = A or G). In some embodiments, the Cas protein is a Cas9 protein derived from N. meningitidis and recognizes the PAM sequence motif N GATT or N GCTT R=AorG V=A, Gor C) (See, e.g, Hou et ah, PNAS 2013, 1-6). In the aforementioned embodiments, N can be any nucleotide residue, e.g., any of A, G, C or T. In some embodiments, the Cas protein is a Cas13a protein derived from Leprotrichia shahii and recognizes the PFS sequence motif of a single 3° A, U, or C.

[00267] In some embodiments, a polynucleotide encoding a Cas protein is provided. In some embodiments, the polynucleotide encodes a Cas protein that is at least 90% identical to a Cas protein described in International PCT Publication No. WO 2015 / 071474 or Chylinski ef al., RNA Biology 2013 10:5, 727-737. In some embodiments, the polynucleotide encodes a Cas protein that is at least 95%, 96%, 97%, 98%, or 99% identical to a Cas protein described in International PCT Publication No. WO 2015 / 071474 or Chylinski et al., RNA Biology 2013 10:5, 727-737. In some embodiments, the polynucleotide encodes a Cas protein that is 100% identical to a Cas protein described in International PCT Publication No. WO 2015 / 071474 or Chylinski ef al., RNA Biology 2013 10:5, 72371737. 2. Cas Mutants

[00268] In some embodiments, the Cas polypeptides are engineered to alter one or more properties of the Cas polypeptide. For example, in some embodiments, the Cas polypeptide comprises altered enzymatic properties, e.g., altered nuclease activity, (as compared with a naturally occurring or other reference Cas molecule) or altered helicase activity. In some embodiments, an engineered Cas polypeptide can have an alteration that alters its size, e.g., a deletion of amino acid sequence that reduces its size without significant effect on another property of the Cas polypeptide. In some embodiments, an engineered Cas polypeptide comprises an alteration that affects PAM recognition. For example, an engineered Cas polypeptide can be altered to recognize a PAM sequence other than the PAM sequence recognized by the corresponding wild-type Cas protein.

[00269] Cas polypeptides with desired properties can be made in a number of ways, including alteration of a naturally occurring Cas polypeptide or parental Cas polypeptide, to provide a mutant or altered Cas polypeptide having a desired property. For example, one or more mutations can be introduced into the sequence of a parental Cas polypeptide (e.g., a naturally occurring or engineered Cas polypeptide). Such mutations and differences may comprise substitutions (e.g., conservative substitutions or substitutions of non-essential amino acids), insertions; or deletions. In some embodiments, a mutant Cas polypeptide comprises one or more mutations (e.g, at least 1, 2, 3, 4, 5, 10, 15, 20, 30, 40 or 50 mutations) relative to a parental Cas polypeptide.

[00270] In an embodiment, a mutant Cas polypeptide comprises a cleavage property that differs from a naturally occurring Cas polypeptide. In some embodiments, the Cas is a deactivated Cas (dCas) mutant. In such embodiments, the Cas polypeptide does not comprise any intrinsic enzymatic activity and is unable to mediate target nucleic acid cleavage. In such embodiments, the dCas may be fused with a heterologous protein that is capable of modifying the target nucleic acid in a non-cleavage based manner. For example, in some embodiments, a dCas protein is fused to transcription activator or transcription repressor domains (e.g., the Kruppel associated box (KRAB or SKD), the Mad mSIN3 interaction domain (SID or SID4X); the ERF repressor domain (ERD), the MAX-interacting protein 1 (MXI1); methyl-CpG binding protein 2 (MECP2); etc.). In some such cases, the dCas fusion protein is targeted by the gRNA to a specific location (i.e., sequence) in the target nucleic acid and exerts locus-specific regulation such as blocking RNA polymerase binding to a promoter (which selectively inhibits transcription activator function), and / or modifying the local chromatin status (e.g., when a fusion sequence is used that modifies the target DNA or modifies a polypeptide associated with the target DNA). In some cases, the changes are transient (e.g., transcription repression or activation). In some cases, the changes are inheritable (e.g., when epigenetic modifications are made to the target DNA or to proteins associated with the target DNA, e.g., nucleosomal histones).

[00271] In some embodiments, the dCas is a dCas13 mutant (Konermann ef al., Cell 173 (2018), 665-676). These dCas13 mutants can then be fused to enzymes that modify RNA, including adenosine deaminases (e.g., ADAR1 and ADAR2). Adenosine deaminases convert adenine to inosine, which the translational machinery treats like guanine, thereby creating a functional A > G change in the RNA sequence. In some embodiments, the dCas is a dCas9 mutant.

[00272] In some embodiments, the mutant Cas9 is a Cas9 nickase mutant. Cas9 nickase mutants comprise only one catalytically active domain (either the HNH domain or the RuvC domain). The Cas9 nickase mutants retain DNA binding based on gRNA specificity, but are capable of cutting only one strand of DNA resulting in a single-strand break (e.g. a “nick”). In some embodiments, two complementary Cas9 nickase mutants (e.g., one Cas9 nickase mutant with an inactivated RuvC domain, and one Cas9 nickase mutant with an inactivated HNH domain) are expressed in the same cell with two gRNAs corresponding to two respective target sequences; one target sequence on the sense DNA strand, and one on the antisense DNA strand. This dual-nickase system results in staggered double stranded breaks and can increase target specificity, as it is unlikely that two off-target nicks will be generated close enough to generate a double stranded break. In some embodiments, a Cas9 nickase mutant is co-expressed with a nucleic acid repair template to facilitate the incorporation of an exogenous nucleic acid sequence by homology-directed repair.

[00273] In some embodiments, the Cas polypeptides described herein can be engineered to alter the PAM / PFS specificity of the Cas polypeptide. In some embodiments, a mutant Cas polypeptide has aPAM / PFS specificity that is different from the PAM / PFS specificity of the parental Cas polypeptide. For example, a naturally occurring Cas protein can be modified to alter the PAM / PFS sequence that the mutant Cas polypeptide recognizes to decrease off target sites, improve specificity, or eliminate a PAM / PFS recognition requirement. In some embodiments, a Cas protein can be modified to increase the length of the PAM / PFS recognition sequence. In some embodiments, the length of the PAM recognition sequence is at least 4, 5, 6, 7, 8, 9, 10 or 15 amino acids in length. Cas polypeptides that recognize different PAM / PFS sequences and / or have reduced off-target activity can be generated using directed evolution. Exemplary methods and systems that can be used for directed evolution of Cas polypeptides are described, e.g., in Esvelt ef al. Nature 2011, 472(7344): 499-503.

[00274] Exemplary Cas mutants are described in International PCT Publication No. WO 2015 / 161276 and Konermann et al., Cell 173 (2018), 665-676which are incorporated herein by reference in their entireties. 3. gRNAs

[00275] The present disclosure provides guide RNAs (gRNAs) that direct a site-directed modifying polypeptide to a specific target nucleic acid sequence. A gRNA comprises a nucleic acid- targeting segment and protein-binding segment. The nucleic acid-targeting segment of a gRNA comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid sequence. As such, the nucleic acid-targeting segment of a gRNA interacts with a target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing), and the nucleotide sequence of the nucleic acid-targeting segment determines the location within the target nucleic acid that the gRNA will bind. The nucleic acid-targeting segment of a gRNA can be modified (e.g, by genetic engineering) to hybridize to any desired sequence within a target nucleic acid sequence.

[00276] The protein-binding segment of a guide RNA interacts with a site-directed modifying polypeptide (e.g. a Cas protein) to form a complex. The guide RNA guides the bound polypeptide to a specific nucleotide sequence within target nucleic acid via the above-described nucleic acid- targeting segment. The protein-binding segment of a guide RNA comprises two stretches of nucleotides that are complementary to one another and which form a double stranded RNA duplex.

[00277] In some embodiments, a gRNA comprises two separate RNA molecules. In such embodiments, each of the two RNA molecules comprises a stretch of nucleotides that are complementary to one another such that the complementary nucleotides of the two RNA molecules hybridize to form the double-stranded RNA duplex of the protein-binding segment. In some embodiments, a gRNA comprises a single RNA molecule (sgRNA).

[00278] The specificity of a gRNA for a target locus is mediated by the sequence of the nucleic acid-binding segment, which comprises about 20 nucleotides that are complementary to a target nucleic acid sequence within the target locus. In some embodiments, the corresponding target nucleic acid sequence is approximately 20 nucleotides in length. In some embodiments, the nucleic acid- binding segments of the gRNA sequences of the present disclosure are at least 90% complementary to a target nucleic acid sequence within a target locus. In some embodiments, the nucleic acid-binding segments of the gRNA sequences of the present disclosure are at least 95%, 96%, 97%, 98%, or 99% complementary to a target nucleic acid sequence within a target locus. In some embodiments, the nucleic acid-binding segments of the gRNA sequences of the present disclosure are 100% complementary to a target nucleic acid sequence within a target locus. In some embodiments, the target nucleic acid sequence is an RNA target sequence. In some embodiments, the target nucleic acid sequence is a DNA target sequence.

[00279] In some embodiments, the target nucleic acid sequence within the target locus must be changed. For example, changes in the target nucleic acid sequence may occur because the Cas protein being used is changed and the new Cas protein has a different PAM. The description provides many examples of target nucleic acid sequences for gRNAs in the specification and tables provided herein. Any of these target nucleic acid sequences can be changed by moving the target nucleic acid sequence 5’ or 3” within the target locus within a given gene. In some embodiments, the target nucleic acid sequence is moved, at most, 100 bp 5” or 3” within the target locus within a given gene. In other embodiments, the target nucleic acid sequence is moved, at most, 1, 2, 3, 4, 5,6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95 bp 5° or 3° within the target locus within a given gene.

[00280] In some embodiments, the gene-regulating system comprises at least two gRNA molecules, wherein at least one gRNA molecule comprises a SOCS / -targeting nucleic acid-binding segment (i.e., a SOCSI-targeting gRNA). In some embodiments, the nucleic acid-binding segment of the at least one SOCSI-targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2). In some embodiments, the nucleic acid-binding segment of the at least one SOCSI-targeting gRNA molecule binds to a target DNA sequence that is 100% identical to a DNA sequence encoded by the SOCS! gene (SEQ ID NO: 1) or the Socs! gene (SEQ ID NO: 2).

[00281] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the nucleic acid-binding segment of the at least one SOCS / -targeting gRNA molecules binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4. In some embodiments, the nucleic acid-binding segment of the at least one SOCS!-targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151. In some embodiments, the nucleic acid-binding segment of the at least one SOCSI-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151. Exemplary SOCS! target DNA sequences are shown in Tables 12 and 13.

[00282] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151. In some embodiments, the nucleic acid-binding segment of the at least one SOCS!-targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151. Exemplary DNA sequences encoding the nucleic acid-binding segment of the SOCS-targeting gRNAs are shown in Tables 12 and 13. Table 12: Exemplary human SOCSI gRNA sequences SEQ Target Sequence fol 20 21 22 23 24 25 26 37 28 20 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 89 53 54 a5 56 57 58 50 147 148 149 150 151 146 [hSOCS1 gRNA 128 | TGTCGCCGGGGGCCGGGGCC 147 GCGGTCCCGGCCCCGGCCCC 148 149 150 151 Table 13: Exemplary murine Socs! gRNA sequences SEQ Target Sequence 1D 8 9 10 11 12 13 14 15 16 17 18 19 mSocs! gRNA 1 7 mSocsl gRNA 2 8 mSocs] gRNA 3 9 mSocsl gRNA 4 10 mSocsl gRNA 5 11 mSocs] gRNA 6 12 mSocsl gRNA 7 13 mSocs] gRNA 8 | GGACGCCTGCGGCTTCTATT 14 mSocs] gRNA 9 15 16 CGAGCCCGTGGGCACCTTCT 17 18 19

[00283] In some embodiments, the gene-regulating system comprises at least two gRNA molecules, wherein at least one gRNA molecule comprises a PTPN2-targeting nucleic acid-binding segment (i.e., a PTPN2-targeting gRNA). In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Ptpn2 gene (SEQ ID NO: 4). In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to a DNA sequence encoded by the PTPN2 gene (SEQ ID NO: 3) or the Ppn2 gene (SEQ ID NO: 4).

[00284] In some embodiments, the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207. Exemplary PTPN2 target DNA sequences are shown in Tables 14 and 15.

[00285] In some embodiments, the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 272-375. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 272-375. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 272-308. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 272-308. Exemplary DNA sequences encoding the nucleic acid-binding segment of the PTPN2- targeting gRN As are shown in Tables 14 and 15. Table 14: Exemplary human PTPN2 gRNA sequences 185 186 187 188 189 190 191 192 193 194 Target Sequence SEQ ID hPTPN2 gRNA 1 185 hPTPN2 gRNA 2 186 hPTPN2 gRNA 3 TTTAGTATATTGAGAACTTG 187 hPTPN2 gRNA 4 188 hPTPN2 AS TGTCATGCTGAACCGCATTG 189 hPTPN2 gRNA 6 190 hPTPN2 gRNA 7 GTATTTGAAATTATTAATGC 191 hPTPN2 gRNA 8 192 hPTPN2 gRNA 9 GGGTCTGAATAAGACCCATT 193 hPTPN2 gRNA 10 194 272 273 274. 275 276. 2717 278 279 280 281 282 283. 284. 285 286. 287 288 289. 290. 291 292 203° 204. 205° 296. 207 208° 1299 300 301 302. 303. 304. 305° 306. 307 308° 1309. 310 El S12 313 314 in 316. 317 318. 319. 320 321 322 323 324. 325 326 327 328° 329 330. 331 EE 333 334 335 336. 337 338 339. 340. 341 342 34 344. 345. 346. 347 348 349. 350 351 352 353 354. 355 356 357 358 350 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 Target Sequence SEQ ID hPTPN2 gRNA 95 | TCAACTGAGATTCTCATACA 356 hPTPN2 gRNA 96 | TGAGAATCTCAGTTGATCTG 357 hPTPN2_gRNA 97 | ATGAGAATCTCAGTTGATCT 358 hPTPN2_gRNA 98 359 hPTPN2 gRNA 99 | TGTCATGCTGAACCGCATTG 360 361 hPTPN2 gRNA 101 362 TATTTCCTCATAGTGCTCTA 363 hPTPN2 gRNA 103 364 TTTGTTTGGTGAATGATCAA 365 366 hPTPN2 gRNA 106 367 368 GGCTCCTTGAACCCTGACCA 369 370 371 hPTPN2 gRNA [11 372 GCGCTCTGGCACCTTCTCTC 373 CTGCTGCACCTTCTGAGCTG 374 hPTPN2 gRNA 114 | TCTTCCCTACCTAGAAACGA 375 Table 15: Exemplary murine Pfpn2 gRNA sequences 196 197 198 199 200 201 202 203 204 205 206 Target Sequence [ SEQ ID | mPTPN2 Al AATCTGGCCAGGTGGTATAA 195 mPTPN2 A 2 AATATGAGAAAGTATCGAAT 196 mPTPN2 A3 ATCACTGCAGGTCCATGGTC 197 mPTPN2 gRNA 4 ATGTGCACAGTACTGGCCAA 198 mPTPN2 AS GGCAGCATGTGTTCGGAAGT 199 mPTPN2 A 6 AAGAAGTTTAGAAATGAAGC 200 mPTPN2 A 7 GCCACACCATGAGCCAGAAA 201 mPTPN2 A 8 CCTTTCTTGCAGATGGAAAA 202 mPTPN2 A 9 GTACTTTGCTCCTTCTATTA 203 mPTPN2 A_10 AGAAATGAAGCTGGTGACTC 204 mPTPN2 gRNA 11 GTTTAGCATGACAACTGCTT 205 mPTPN2 A 12 GCCCGATGCCCGCACTGCAA 206 mPTPN2 A 13 TGACAGAGAAATGGTGTTTA 207 mPTPN2 gRNA 13 TGACAGAGAAATGGTGTTTA 207

[00286] In some embodiments, the gene-regulating system comprises at least two gRNA molecules, wherein at least one gRNA molecule comprises a ZC3H / 2A4-targeting nucleic acid-binding segment (i.e., a ZC3H 12A-targeting gRNA). In some embodiments, the nucleic acid-binding segment of the at least one ZC3H2A-targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence encoded by the ZC3HI24 gene (SEQID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to a DNA sequence encoded by the ZC3H124 gene (SEQ ID NO: 5) or the Zc3hi2a gene (SEQ ID NO: 6).

[00287] In some embodiments, the nucleic acid-binding segment of the at least one ZC3H124- targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the nucleic acid-binding segment of the at least one ZC3H124-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the nucleic acid- binding segment of the at least one ZC3H12A-targeting gRNA molecules binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one ZC3H12A4-targeting gRNA molecules binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary ZC3H12A target DNA sequences are shown in Tables 16 and 17.

[00288] In some embodiments, the nucleic acid-binding segment of the at least one ZC3H124- targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 376-812. In some embodiments, the nucleic acid-binding segment of the at least one ZC3HI2A-targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 376-812. In some embodiments, the nucleic acid-binding segment of the at least one ZC3H12A4-targeting gRNA molecules is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 376-575. In some embodiments, the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA molecules is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 376-575. Exemplary DNA sequences encoding the nucleic acid-binding segment of the ZC3H 12A-targeting gRNAs are shown in Tables 16 and 17. Table 16: Exemplary human ZC3H124 gRNA sequences SEQID 216 317 218 219 220 221 RAR) 353 224 225 226 227 228 220 230 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 3901 392 303 304 305 396 397 308 399 400 401 SEQ ID CAGCCAGCTGCTGGGGGTCC 402 TCCACTCCTGCCGCTCGCCT 403 CGTCCAGGCAGACACCAACA | 404 CCCACCCACATCAGTCCTTC = 405 GCCAGCTCTTGACCCGGCCT 406 CTGCCCTICCTITTICCTICTITIC 407 CCAGCCCCACCATGAGTCTG 408 GCCGATTCTTCCACCCAGAG 409 410 411 412 ATGCCCCCTGATGACCCACT 413 AGCCTTCTCTGCCTTTGGCC 414 CTCTGCCTTTGGCCGGGCCA 415 GGAACCCAGCCTGCCCTCCC 416 417 TCCCAGACCAGCACATICCIG ~ 418 GTGAGCAGTGCAGCCTGGAT | 419 GAGCCAGATGTCGGAACTTT 420 GGCCGATGGCAAGCCTTGCT 421 422 423 424 425 CAGCCCCACCATGAGTCTGT = 426 ACCCCCCAGAGCCCCAAGCA | 427 GAGGCACCACTCACCIGIGA 1 2428 429 GTACGTCTCCCAGGATIGCC ' 430 CACAGCCTCCACCAGGTGCG | 431 GATCTCGGCAGCCAGCTGCT 432 CAGCCTTCTCTGCCTTTIGGC 433 CAGAAGTGACACTTACCTCA 434 GCTGGCCGCTGAGGAGGCCT | 435 CAGCTCCCTCTAGTCCCGCG 436 437 GACACATACCGTGACCTCCA 438 439 440 CTCTCCTATTICTTCCCAGCA 441 GCCCGAGTCCAGGCAATCCT 442 CACCTTCATCTGCAGTTCCA 443 SEQ ID 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 SEQ ID 486 487 488 4890 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 500 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 SEQ ID 528 520 530 831 532 533 534 535 536 8377 538 530 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 550 560 561 562 563 564 565 566 567 568 569 SEQ ID 570 571 8772 573 574 575 576 877] 578 570 580 581 582 583 584 585 586 587 588 589 500 591 5902 503 504 595 506 507 508 500 600 601 602 603 604 605 606 607 608 609 610 611 SEQ ID 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 SEQ ID 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 SEQ ID 696 697 6908 690 700 701 702 703 704 705 706 707 708 709 710 711 713. 713 714 715 716 717 718 719 720 721 73 723 724 JAN 726 T7 728 729 730 731 732 733 734 735 736 737 SEQ ID 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 T]2. 713 774 T75 776 777 778 779 SEQ ID 780 781 782 783 784 785 786 787 TR8 780 790 701 792 703 794 795 706 797 798 799 {00 801 802 {03 {04 805 R06 {07 808 {09 {10 Target Sequence SEQ ID AGCGTGTATACTAAGCTGTG 780 GCTCCTGCCTGATGGGGCAT 781 GICTGTCAGGGCCTCTGGGA 782 GTAGCCCGTGTAAGGGGCTC 783 AGCCCCTGGGCTCTGCACTG 784 GTGAACTGGTTTCTGGAGCG 785 CTACGAGTCTGACGGGATCG 786 AGTGAACTGGTTTCTGGAGC 787 788 789 790 AAGTGAGTGGCTTCTTACGC 791 792 TTGCCACCCACGCGTCGTGA 793 794 TCTTCTTCTCCAGTTCCCGC 795 79 797 798 799 800 801 802 GCTCCTGGACCCCCAGCAGC 803 804 805 806 807 808 GCTGGGGGTCCAGGAGCTGT 809 810 TGGGAGTGGAGGCTCCAGGT 811 812 Table 17: Exemplary murine Zc3h12a gRNA sequences 200 210 211 Target Sequence SEQ ID mZc3h2a gRNA 1 208 mZc3h12a gRNA 2 209 mZc3h12a gRNA 3 210 mZc3hl2a gRNA 4 TTCCCTCCTCTGCCAGCCAT 211 213 214 215 Target Sequence SEQ ID mZc3h12a gRNA 5 212 mZc3h12a_gRNA 6 213 mZc3h12a gRNA 7 214 mZc3h12a gRNA 8 215

[00289] In some embodiments, the gene-regulating system comprises at least two gRNA molecules, wherein at least one gRNA molecule comprises a SOCS / -targeting nucleic acid-binding segment (i.e., a SOCSI-targeting gRNA) and at least one gRNA molecule comprises a PTPN2- targeting nucleic acid-binding segment (i.e., a PTPN2-targeting gRNA). In some embodiments, the nucleic acid-binding segment of the at least one SOCS / -targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the SOCS / gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4). In some embodiments, the nucleic acid-binding segment of the at least one SOCS / - targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence in the SOCS1 gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4).

[00290] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6. In some embodiments, the nucleic acid-binding segment of the at least one SOCS / -targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6.

[00291] In some embodiments, the nucleic acid-binding segment of the at least one SOCS1- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the nucleic acid-binding segment of the at least one SOCSI-targeting gRNA binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207. Exemplary SOCS1 target DNA sequences are shown in Tables 12 and 13 and exemplary PTPN2 target DNA sequences are shown in Tables 14 and 15.

[00292] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207. In some embodiments, the nucleic acid-binding segment of the at least one SOCS!-targeting gRNA is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207. Exemplary DNA sequences encoding the nucleic acid-binding segment of the SOCS / -targeting gRNAs are shown in Tables 12 and 13 and exemplary DNA sequences encoding the nucleic acid-binding segment of the PTPN2-targeting gRNAs are shown in Tables 14 and 15.

[00293] In some embodiments, the gene-regulating system comprises at least two gRNA molecules, wherein at least one gRNA molecule comprises a SOCS!-targeting nucleic acid-binding segment (i.e., a SOCSI-targeting gRNA) and at least one gRNA molecule comprises a ZC3H124- targeting nucleic acid-binding segment (i.e., a ZC3H124-targeting gRNA). In some embodiments, the nucleic acid-binding segment of the at least one SOCSI-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the SOCS / gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the ZC3H12A4 gene (SEQ ID NO: 5) or the Zc3hi2a gene (SEQ ID NO: 6). In some embodiments, the nucleic acid-binding segment of the at least one SOCS1-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence in the SOCS1 gene (SEQ ID NO: 1) or the Socs / gene (SEQ ID NO: 2) and the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6).

[00294] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the nucleic acid-binding segment of the at least one SOCSI-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 3 or Table 4 and the nucleic acid-binding segment of the at least one ZC3H12A4-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00295] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one ZC3H124- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one SOCS!-targeting gRNA binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one ZC3H2A-targeting gRNA binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary SOCS! target DNA sequences are shown in Tables 12 and 13 and exemplary ZC3H124 target DNA sequences are shown in Tables 16 and 17.

[00296] In some embodiments, the nucleic acid-binding segment of the at least one SOCSI- targeting gRNA is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one ZC3H124- targeting gRNA is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one SOCS!-targeting gRNA is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 7-151 and the nucleic acid-binding segment of the at least one ZC3H12A4-targeting gRNA is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary DNA sequences encoding the nucleic acid-binding segment of the SOCSI-targeting gRNAs are shown in Tables 12 and 13 and exemplary DNA sequences encoding the nucleic acid-binding segment of the ZC3HI12A-targeting gRNAs are shown in Tables 16 and 17.

[00297] In some embodiments, the gene-regulating system comprises at least two gRNA molecules, wherein at least one gRNA molecule comprises a PTPN2-targeting nucleic acid-binding segment (i.e., a PTPN2-targeting gRNA) and at least one gRNA molecule comprises a ZC3HI24- targeting nucleic acid-binding segment (i.e., a ZC3H12A-targeting gRNA). In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Prpn2 gene (SEQ ID NO: 4) and the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence in the ZC3H 124 gene (SEQ ID NO: 5) or the Zc3h12a gene (SEQ ID NO: 6). In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence in the PTPN2 gene (SEQ ID NO: 3) or the Pipn2 gene (SEQ ID NO: 4) and the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence in the ZC3H124 gene (SEQ ID NO: 5) or the Zc3h!2a gene (SEQ ID NO: 6).

[00298] In some embodiments, the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the nucleic acid-binding segment of the at least one ZC3H124-targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 5 or Table 6 and the nucleic acid-binding segment of the at least one ZC3H12A-targeting gRNA binds to a target DNA sequence that is 100% identical to a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8.

[00299] In some embodiments, the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207 and the nucleic acid-binding segment of the at least one ZC3H124- targeting gRNA binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207 and the nucleic acid-binding segment of the at least one ZC3H12A4-targeting gRNA binds to a target DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary PTPN2 target DNA sequences are shown in Tables 14 and 15 and exemplary ZC3H124 target DNA sequences are shown in Tables 16 and 17.

[00300] In some embodiments, the nucleic acid-binding segment of the at least one PTPN2- targeting gRNA is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 185-207 and the nucleic acid-binding segment of the at least one ZC3H12A4- targeting gRNA is encoded by a DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID NOs: 208-230. In some embodiments, the nucleic acid-binding segment of the at least one PTPN2-targeting gRNA is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 185-207 and the nucleic acid-binding segment of the at least one ZC3H2A-targeting gRNA is encoded by a DNA sequence that is 100% identical to one of SEQ ID NOs: 208-230. Exemplary DNA sequences encoding the nucleic acid-binding segment of the PTPN2-targeting gRNAs are shown in Tables 14 and 15 and exemplary DNA sequences encoding the nucleic acid-binding segment of the ZC3HI12A-targeting gRNAs are shown in Tables 16 and 17.

[00301] In some embodiments, the nucleic acid-binding segments of the gRNA sequences described herein are designed to minimize off-target binding using algorithms known in the art (e.g., Cas-OFF finder) to identify target sequences that are unique to a particular target locus or target gene.

[00302] In some embodiments, the gRNAs described herein can comprise one or more modified nucleosides or nucleotides which introduce stability toward nucleases. In such embodiments, these modified gRNAs may elicit a reduced innate immune as compared to a non-modified gRNA. The term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, generally of viral or bacterial origin, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.

[00303] In some embodiments, the gRNAs described herein are modified at or near the 5” end (e.g., within 1-10, 1-5, or 1-2 nucleotides of their 5’ end). In some embodiments, the 5° end of a gRNA is modified by the inclusion of a eukaryotic mRNA cap structure or cap analog (e.g., a G(5’)ppp(5°)G cap analog, a m7G(5’)ppp(5°)G cap analog, or a 3’-0-Me-m7G(5’)ppp(5’)G anti reverse cap analog (ARCA)). In some embodiments, an in vitro transcribed gRNA is modified by treatment with a phosphatase (e.g., calf intestinal alkaline phosphatase) to remove the 5° triphosphate group. In some embodiments, a gRNA comprises a modification at or near its 3” end (e.g., within 1-10, 1-5, or 1-2 nucleotides of its 3” end). For example, in some embodiments, the 3’ end of a gRNA is modified by the addition of one or more (e.g., 25-200) adenine (A) residues.

[00304] In some embodiments, modified nucleosides and modified nucleotides can be present in a gRNA, but also may be present in other gene-regulating systems, e.g., mRNA, RNAi, or siRNA- based systems. In some embodiments, modified nucleosides and nucleotides can include one or more of: (a) alteration, e.g, replacement, of one or both of the non-linking phosphate oxygens and / or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage; (b) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g, of the 2’ hydroxyl on the ribose sugar; (c) wholesale replacement of the phosphate moiety with “dephospho” linkers; (d) modification or replacement of a naturally occurring nucleobase; (e) replacement or modification of the ribose-phosphate backbone; ® modification of the 3° end or 5° end of the oligonucleotide, e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety; and (g) modification of the sugar.

[00305] In some embodiments, the modifications listed above can be combined to provide modified nucleosides and nucleotides that can have two, three, four, or more modifications. For example, in some embodiments, a modified nucleoside or nucleotide can have a modified sugar and a modified nucleobase. In some embodiments, every base of a gRNA is modified. In some embodiments, each of the phosphate groups of a gRNA molecule are replaced with phosphorothioate groups.

[00306] In some embodiments, a software tool can be used to optimize the choice of gRNA within a user’s target sequence, e.g., to minimize total off-target activity across the genome. Off target activity may be other than cleavage. For example, for each possible gRNA choice using S. pyogenes Cas9, software tools can identify all potential off-target sequences (preceding either NAG or NGG PAM) across the genome that contain up to a certain number (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of mismatched base-pairs. The cleavage efficiency at each off-target sequence can be predicted, e.g., using an experimentally-derived weighting scheme. Each possible gRNA can then be ranked according to its total predicted off-target cleavage; the top-ranked gRNAs represent those that are likely to have the greatest on-target and the least off-target cleavage. Other functions, e.g., automated reagent design for gRNA vector construction, primer design for the on-target Surveyor assay, and primer design for high-throughput detection and quantification of off-target cleavage via next- generation sequencing, can also be included in the tool. IV. Methods of producing modified immune effector cells

[00307] In some embodiments, the present disclosure provides methods for producing modified immune effector cells. In some embodiments, the methods comprise introducing a gene-regulating system into a population of immune effector cells wherein the gene-regulating system is capable of reducing expression and / or function of two or more endogenous target genes selected from SOCS / , PTPN2, and ZC3HI2A.

[00308] The components of the gene-regulating systems described herein, e.g., a nucleic acid- , protein-, or nucleic acid / protein-based system can be introduced into target cells in a variety of forms using a variety of delivery methods and formulations. In some embodiments, a polynucleotide encoding one or more components of the system is delivered by a recombinant vector (e.g., a viral vector or plasmid). In some embodiments, where the system comprises more than a single component, a vector may comprise a plurality of polynucleotides, each encoding a component of the system. In some embodiments, where the system comprises more than a single component, a plurality of vectors may be used, wherein each vector comprises a polynucleotide encoding a particular component of the system. In some embodiments, a vector may also comprise a sequence encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, mitochondrial localization), fused to the polynucleotide encoding the one or more components of the system. For example, a vector may comprise a nuclear localization sequence (e.g, from SV40) fused to the polynucleotide encoding the one or more components of the system. In some embodiments, the introduction of the gene-regulating system to the cell occurs in vitro. In some embodiments, the introduction of the gene-regulating system to the cell occurs in vivo. In some embodiments, the introduction of the gene-regulating system to the cell occurs ex vivo.

[00309] In some embodiments, the recombinant vector comprising a polynucleotide encoding one or more components of a gene-regulating system described herein is a viral vector. Suitable viral vectors include, but are not limited to, viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5:1088 1097, 1999; WO 94 / 12649, WO 93 / 03769, WO 93 / 19191 ; WO 94 / 28938, WO 95 / 11984 and WO 95 / 00655), adeno-associated virus (see, e.g., U.S. Patent No. 7,078,387; Ali ef al., Hum Gene Ther 9:81 86, 1998, Flannery ef al,, PNAS 94:6916 6921 , 1997; Bennett ef al., Invest Opthalmol Vis Sci 38:2857 2863, 1997; Jomary et al., Gene Ther 4:683 690, 1997, Rolling ef al., Hum Gene Ther 10:641 648, 1999; Ali et al., Hum Mol Genet 5:591 594, 1996; Srivastava in WO 93 / 09239, Samulski ez al., J. Vir. (1989) 63:3822-3828; Mendelson et al,, Virol. (1988) 166:154-165; and Flotte et al., PNAS (1993) 90:10613- 10617), SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., PNAS 94:10319 23, 1997, Takahashi ef al., J Virol 73:7812 7816, 1999); a retroviral vector (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); and the like.

[00310] In some embodiments, the recombinant vector comprising a polynucleotide encoding one or more components of a gene-regulating system described herein is a plasmid. Nume...

Claims

CLAIMS 9 A modified immune effector cell comprising a gene-regulating system capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3H124, wherein the reduced expression and / or function of the at least two endogenous target genes enhances an effector function of the immune effector cell 2 The modified immune effector cell of claim 1, wherein the at least two target genes are SOCS / and PTPN2.

3. The modified immune effector cell of claim 1, wherein the at least two target genes are SOCS / and ZC3HI2A.

4. The modified immune effector cell of claim 1, wherein the at least two target genes are PTPN2 and ZC3HI2A.

5. The modified immune effector cell of any one of claims 1-4, wherein the gene regulating system is further capable of reducing the expression and / or function of CBLB.

6. The modified immune effector cell of any one of claims 1-5, wherein the gene-regulating system comprises (i) a nucleic acid molecule; (ii) an enzymatic protein; or (iii) a nucleic acid molecule and an enzymatic protein.

7. The modified immune effector cell of claim 6, wherein the gene-regulating system comprises a nucleic acid molecule selected from an siRNA, an shRNA, a microRNA (miR), an antagomiR, or an antisense RNA.

8. The modified immune effector cell of claim 6, wherein the gene-regulating system comprises an enzymatic protein, and wherein the enzymatic protein has been engineered to specifically bind to a target sequence in one or more of the endogenous genes.

9. The modified immune effector cell of claim 8, wherein the protein is a Transcription activator- like effector nuclease (TALEN), a zinc-finger nuclease, or a meganuclease.

10. The modified immune effector cell of claim 6, wherein the gene-regulating system comprises a nucleic acid molecule and an enzymatic protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule and the enzymatic protein is a Cas protein or Cas ortholog.

11. The modified immune effector cell of claim 10, wherein the Cas protein is a Cas9 protein.

12. The modified immune effector cell of claim 10, wherein the Cas protein is a wild-type Cas protein comprising two enzymatically active domains, and capable of inducing double stranded DNA breaks.

13. The modified immune effector cell of claim 10, wherein the Cas protein is a Cas nickase mutant comprising one enzymatically active domain and capable of inducing single stranded DNA breaks.

14. The modified immune effector cell of claim 10, wherein the Cas protein is a deactivated Cas protein (dCas) and is associated with a heterologous protein capable of modulating the expression of the one or more endogenous target genes.

15. The modified immune effector cell of claim 14, wherein the heterologous protein is selected from the group consisting of MAX-interacting protein 1 (MXI1), Kriippel-associated box (KRAB) domain, methyl-CpG binding protein 2 (MECP2), and four concatenated mSin3 domains (SID4X).

16. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCS / and PTPN2, and wherein the gene-regulating system comprises at least one SOCS-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6.

17. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCS / and PTPN2, and wherein the gene-regulating system comprises at least one SOCS targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6.

18. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCS / and PTPN2, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one PTPN2- targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 185-207.

19. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCS! and PTPN2, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one PTPN2- targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs; 185-207.

20. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCSI and ZC3H124, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4, and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8.

21. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCSI and ZC3H124, and wherein the gene-regulating system comprises at least one SOCS-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 3 and 4 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8. 22, The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCSI and ZC3H124, and wherein the gene-regulating system comprises at least one SOCS!-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

23. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are SOCSI and ZC3H124, and wherein the gene-regulating system comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

24. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are PTPN2 and ZC3H124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8.

25. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are PTPN2 and ZC3H124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a nucleic acid sequence defined by any one of the set of genome coordinates shown in Tables 7 and 8.

26. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are PTPN2 and ZC3H124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and at least one ZC3H12A-targeting gRNA molecule comprising a targeting domain sequence that binds to a target DNA sequence selected from the group consisting of SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

27. The modified immune effector cell of any one of claims 10-15, wherein the at least two endogenous genes are PTPN2 and ZC3H124, and wherein the gene-regulating system comprises at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and at least one ZC3H12A4-targeting gRNA molecule comprising a targeting domain sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

28. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are SOCS1 and PTPN2, and wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

29. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are SOCS1 and PTPN2, and wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

30. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are SOCS1I and PTPN2, wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA comprising about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one PTPN2- targeting siRNA or shRNA comprising about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

31. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are SOCS1 and ZC3HI124, wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one ZC 3H 12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

32. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are SOCS1 and ZC3HI124, wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Table 3 and 4 and at least one ZC3H12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

33. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are SOCS1 and ZC3HI124, wherein the gene-regulating system comprises at least one SOCS / -targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 7-151 and at least one ZC3H124- targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

34. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one P7PN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H2A-targeting siRNA or siRNA molecule comprising about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

38. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one P7TPN2-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A-targeting siRNA or shRNA molecule comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

36. The modified immune effector cell of claim 7, wherein the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one P7PN2-targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and at least one ZC3H12A-targeting siRNA or shRNA comprising about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence selected from the group consisting of SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

37. The modified immune effector cell of claim 9, wherein the at least two endogenous genes are SOCS1 and PTPN2, and wherein the gene-regulating system comprises at least one SOCS / -targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

38. The modified immune effector cell of claim 9, wherein the at least two endogenous genes are SOCS!I and PTPN2, wherein the gene-regulating system comprises at least one SOCS / -targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one P7PN2-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

39. The modified immune effector cell of claim 9, wherein the at least two endogenous genes are SOCS1I and ZC3HI124, wherein the gene-regulating system comprises at least one SOCS / -targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one ZC3H12A4-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

40. The modified immune effector cell of claim 9, wherein the at least two endogenous genes are SOCS! and ZC3H12A, wherein the gene-regulating system comprises at least one SOCS / -targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one ZC3H12A4-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

41. The modified immune effector cell of claim 9, wherein the at least two endogenous genes are PTPN2 and ZC3HI124, wherein the gene-regulating system comprises at least one PTPN2- targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and at least one ZC3H12A4-targeting TALEN, zinc finger, or meganuclease protein that binds to a target DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

42. The modified immune effector cell of claim 9, wherein the at least two endogenous genes are PTPN2 and ZC3H124, wherein the gene-regulating system comprises at least one PTPN2- targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein that binds to a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

43. The modified immune effector cell of any one of claims 1-42, wherein the gene-regulating system is introduced to the immune effector cell by transfection, transduction, electroporation, or physical disruption of the cell membrane by a microfluidics device.

44. The modified immune effector cell of claim 43, wherein the gene-regulating system is introduced as a polynucleotide encoding one or more components of the system, a protein, or a ribonucleoprotein (RNP) complex.

45. A modified immune effector cell, comprising reduced expression and / or function of at least two endogenous genes selected from SOCS!, PTPN2, and ZC3H12A, wherein the reduced expression and / or function of the at least two endogenous genes enhances an effector function of the immune effector cell.

46. The modified immune effector cell of claim 45, wherein the at least two target genes are SOCS] and PTPN?.

47. The modified immune effector cell of claim 45, wherein the at least two target genes are SOCS] and ZC3HI2A.

48. The modified immune effector cell of claim 45, wherein the at least two target genes are PTPN2 and ZC3HI2A.

49. A modified immune effector cell, comprising an inactivating mutation in at least two endogenous genes selected from SOCS1, PTPN2, and ZC3HI12A.

50. The modified immune effector cell of claim 49, wherein the immune effector cell is a tumor infiltrating lymphocyte (TIL) or a CAR-T cell.

51. The modified immune effector cell of claim 49 or claim 50, wherein the at least two target genes are SOCSI and PTPN2.

52. The modified immune effector cell of claim 49 or claim 50, wherein the at least two target genes are SOCSI and ZC3HI12A.

53. The modified immune effector cell of claim 49 or claim 50, wherein the at least two target genes are PTPN2 and ZC3HI124.

54. The modified cell of any one of claims 49-53, wherein the inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in the genomic sequences of the two or more endogenous genes.

55. The modified immune effector cell of claim 54, wherein the deletion is a partial or complete deletion of the two or more endogenous target genes.

56. The modified immune effector cell of claim 54, wherein the inactivating mutation is a frame shift mutation.

57. The modified immune effector cell of any one of claims 49-56, wherein the inactivating mutation reduces the expression and / or function of the two or more endogenous target genes.

58. The modified immune effector cell of any one of claims 45-57, further comprising reduced expression and / or function of CBLB.

59. A modified immune effector cell, comprising one or more exogenous polynucleotides encoding at least two nucleic acid inhibitors of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3HI2A.

60. The modified immune effector cell of claim 59, wherein the immune effector cell is a tumor infiltrating lymphocyte (TIL) or a CAR-T cell.

61. The modified immune effector cell of claim 59 or claim 60, wherein the at least two target genes are SOCSI and PTPN2.

62. The modified immune effector cell of claim 59 or claim 60, wherein the at least two target genes are SOCSI and ZC3HI12A.

63. The modified immune effector cell of claim 59 or claim 60, wherein the at least two target genes are PTPN2 and ZC3HI124.

64. The modified immune effector cell of any one of claims 59-63, wherein the at least two nucleic acid inhibitors reduce the expression and / or function of the two or more endogenous target genes.

65. The modified immune effector cell of claim 58 or claim 64, wherein the expression of the two or more endogenous target genes is reduced by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to an un-modified or control immune effector cell.

66. The modified immune effector cell of claim 65, wherein the function of the two or more endogenous target genes is reduced by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to an un-modified or control immune effector cell.

67. The modified immune effector cell of claim 65, wherein the inactivating mutation or nucleic acid inhibitors substantially inhibits the expression of the two or more endogenous target genes.

68. The modified immune effector cell of claim 65, wherein the inactivating mutation or nucleic acid inhibitors substantially inhibits the function of the two or more endogenous target genes.

69. The modified immune effector cell of any one of claims 50-68, wherein the inactivating mutation or nucleic acid inhibitors enhances one or more effector functions of the modified immune effector cell 70. The modified immune effector cell of claim 69, wherein the one or more effector functions are enhanced compared to an un-modified or control immune effector cell.

71. The modified immune effector cell of any one of claims 1-70, wherein the immune effector cell is a T cell, a natural killer (NK) cell, an NKT cell, or a tumor infiltrating lymphocyte (TIL).

72. The modified immune effector cell of any one of claims 1-71, further comprising an exogenous transgene expressing an immune activating molecule.

73. The modified immune effector cell of claim 1, wherein the immune activating molecule is selected from the group consisting of a cytokine, a chemokine, a co-stimulatory molecule, an activating peptide, an antibody, or an antigen-binding fragment thereof.

74. The modified immune effector cell of any one of claims 1-73, wherein the effector function is selected from cell proliferation, cell viability, tumor infiltration, cytotoxicity, anti-tumor immune responses, and / or resistance to exhaustion, 75. The modified immune effector cell of any one of claims 1-74, further comprising an engineered immune receptor displayed on the cell surface.

76. The modified immune effector cell of claim 75, wherein the engineered immune receptor is a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain.

77. The modified immune effector cell of claim 76, wherein the engineered immune receptor is an engineered T cell receptor (TCR).

78. The modified immune effector cell of any one of claims 75-77, wherein the engineered immune receptor is capable of specifically binding to an antigen expressed on the surface of a target cell, wherein the antigen is a tumor-associated antigen.

79. A composition, comprising the modified immune effector cells of any one of claims 1-78.

80. The composition of claim 79, comprising at least 1 x 10%, 1x 10%, 1x 10%, 1x 107, 1x 10%, 1 x 10°, 1x 10°, 1 x 10'., or more modified immune effector cells.

81. The composition of claim 79 or 80, wherein the composition comprises a pharmaceutically acceptable carrier or diluent.

82. The composition of any one of claims 79-81, comprising autologous immune effector cells 83. The composition of any one of claims 79-81, comprising allogeneic immune effector cells.

84. A gene-regulating system capable of reducing expression of at least two endogenous target genes in a cell selected from SOCS!I, PTPN2, and ZC3H12A, comprising (i) a nucleic acid molecule; (ii) an enzymatic protein; or (iii) a nucleic acid molecule and an enzymatic protein.

85. The gene regulating system of claim 84, wherein the at least two target genes are SOCS / and PTPN?2.

86. The gene regulating system of claim 84, wherein the at least two target genes are SOCS / and ZO3HI2A 87. The gene regulating system of claim 84, wherein the at least two endogenous genes are PTPN2 and ZC3HI2A.

88. The gene-regulating system of any one of claims 84-87, wherein the system comprises at least two guide RNA (gRNA) nucleic acid molecules and a Cas endonuclease.

89. The gene-regulating system of claim 88, wherein the at least two target genes are SOCS / and PTPN2, and wherein the system comprises at least one SOCSI-targeting guide RNA (gRNA) molecule, at least one PTPN2-targeting gRNA molecule, and a Cas endonuclease.

90. The gene-regulating system of claim 89, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6.

91. The gene-regulating system of claim 89, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6.

92. The gene-regulating system of claim 89, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

93. The gene-regulating system of claim 89, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

94. The gene-regulating system of claim 89, wherein the at least two target genes are SOCS! and ZC3H124, and wherein the system comprises at least one SOCS-targeting gRNA molecule, at least one ZC3H12A-targeting gRNA molecule, and a Cas endonuclease.

95. The gene-regulating system of claim 94, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A4-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

96. The gene-regulating system of claim 94, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

97. The gene-regulating system of claim 94, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

98. The gene-regulating system of claim 94, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3HI2A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

99. The gene-regulating system of claim 88, wherein the at least two endogenous genes are PTPN2 and ZC3H124, wherein the system comprises at least one PTNP2-targeting gRNA molecule, at least one ZC3H12A-targeting gRNA molecule, and a Cas endonuclease.

100. The gene-regulating system of claim 99, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A4-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

101. The gene-regulating system of claim 99, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A4-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

102. The gene-regulating system of claim 99, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376- 575.

103. The gene-regulating system of claim 99, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376- 575.

104. The gene-regulating system of any one of claims 88-103, wherein the Cas protein is a Cas9 protein.

105. The gene-regulating system of any one of claims 88-103, wherein the Cas protein is a wild- type Cas protein comprising two enzymatically active domains, and capable of inducing double stranded DNA breaks.

106. The gene-regulating system of any one of claims 88-103, wherein the Cas protein is a Cas nickase mutant comprising one enzymatically active domain and capable of inducing single stranded DNA breaks.

107. The gene-regulating system of any one of claims 88-103, wherein the Cas protein is a deactivated Cas protein (dCas) and is associated with a heterologous protein capable of modulating the expression of the one or more endogenous target genes.

108. The gene-regulating system of claim 107, wherein the heterologous protein is selected from the group consisting of MAX-interacting protein 1 (MXI1), Kriippel-associated box (KRAB) domain, and four concatenated mSin3 domains (SID4X).

109. The gene-regulating system of claim 84-87, wherein the system comprises at least two nucleic acid molecules and wherein the at least two nucleic acid molecules are selected from an siRNA, an shRNA, a microRNA (miR), an antagomiR, or an antisense RNA.

110. The gene-regulating system of claim 109, wherein the at least two target genes are SOCS7 and PTPN2, and wherein the system comprises at least one SOCS!-targeting guide siRNA or shRNA molecule and at least one PTPN2-targeting siRNA or shRNA molecule.

111. The gene-regulating system of claim 110, wherein the SOCS!-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

112. The gene-regulating system of claim 110, wherein the at least one SOCS!-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

113. The gene-regulating system of claim 110, wherein the at least one SOCS!-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

114. The gene-regulating system of claim 109, wherein the at least two target genes are SOCSI and ZC3HI124, and wherein the system comprises at least one SOCS-targeting guide siRNA or shRNA molecule and at least one ZC3H12A-targeting siRNA or shRNA molecule.

115. The gene-regulating system of claim 114, wherein the at least one SOCS!-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H2A-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

116. The gene-regulating system of claim 114, wherein the at least one SOCS!-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides and binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

117. The gene-regulating system of claim 114, wherein the at least one SOCS!-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H / 2A-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

118. The gene-regulating system of claim 109, wherein the at least two target genes are P7PN2 and ZC3HI124, and wherein the system comprises at least one PTPN2-targeting guide siRNA or shRNA molecule and at least one ZC3H2A4-targeting siRNA or shRNA molecule.

119. The gene-regulating system of claim 118, wherein the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that are complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

120. The gene-regulating system of claim 118, wherein the at least one PTPN2-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprises about 19-30 nucleotides that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

121. The gene-regulating system of claim 118, wherein the at least one PTPN2-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H12A-targeting siRNA or shRNA comprises about 19-30 nucleotides that bind to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376- 812, or SEQ ID NOs: 376-575.

122. The gene-regulating system of claim 84-87, wherein the gene-regulating system comprises an enzymatic protein, and wherein the enzymatic protein has been engineered to specifically bind to a target sequence in one or more of the endogenous genes 123. The gene-regulating system of claim 122, wherein the system comprises a protein comprising a DNA binding domain and an enzymatic domain and is selected from a zinc finger nuclease and a transcription-activator-like effector nuclease (TALEN).

124. The gene-regulating system of any one of claims 84-108, comprising one or more vectors encoding at least one gRNA targeting a first target gene, at least one gRNA targeting a second target gene, and a Cas endonuclease protein, wherein the first target gene is SOCS! and the least one SOCS-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151, and wherein the second target gene is PTPN2 and the at least one PTPN2-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

125. The gene-regulating system of any one of claims 84-108, comprising one or more vectors encoding at least one gRNA targeting a first target gene, at least one gRNA targeting a second target gene, and a Cas endonuclease protein, wherein the first target gene is SOCS! and the least one SOCSI-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151, and wherein the second target gene is ZC3H124 and the at least one ZC3H124-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

126. The gene-regulating system of any one of claims 84-108, comprising one or more vectors encoding at least one gRNA targeting a first target gene, at least one gRNA targeting a second target gene, and a Cas endonuclease protein, wherein the first target gene is P7PN2 and the PTPN2-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308, and wherein the second target gene is ZC3H124 and the at least one ZC2H12A-targeting gRNA comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

127. The gene-regulating system of any one of claims 124-126, wherein the at least one gRNA targeting the first target gene, the at least one gRNA targeting the second target gene, and the Cas endonuclease protein are encoded by one vector.

128. The gene-regulating system of any one of claims 124-126, wherein the at least one gRNA targeting the first target gene and the at least one gRNA targeting the second target gene are encoded by a first vector, and the Cas endonuclease protein is encoded by a second vector.

129. The gene-regulating system of any one of claims 124-126, wherein the at least one gRNA targeting the first target gene is encoded by a first vector, the at least one gRNA targeting the second target gene is encoded by a second vector, and the Cas endonuclease protein is encoded by a third vector.

130. The gene-regulating system of any one of claims 84-108, comprising: i) one or more vectors encoding at least one SOCS / -targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and at least one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272- 308; and (ii) an mRNA molecule encoding the Cas endonuclease protein.

131. The gene-regulating system of any one of claims 84-108, comprising; i) one or more vectors encoding at least one SOCS / -targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376- 575; and (ii) an mRNA molecule encoding the Cas endonuclease protein.

132. The gene-regulating system of any one of claims 84-108, comprising: i) one or more vectors encoding at least one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575; and (ii) an mRNA molecule encoding the Cas endonuclease protein.

133. The gene-regulating system of any one of claims 130-132, wherein the at least one gRNA targeting the first target gene and the at least one gRNA targeting the second target gene are encoded by one vector.

134. The gene-regulating system of any one of claims 130-132, wherein the at least one gRNA targeting the first target gene is encoded by a first vector and the at least one gRNA targeting the second target gene is encoded by a second vector.

135. The gene-regulating system of any one of claims 84-108, comprising: i) at least one SOCS!-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 complexed to a first Cas endonuclease protein to form a first ribonucleoprotein (RNP) complex; and (ii) atleast one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 complexed to a second Cas endonuclease protein to form a second RNP complex.

136. The gene-regulating system of any one of claims 84-108, comprising; i) at least one SOCS!-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 complexed to a first Cas endonuclease protein to form a first RNP complex; and (ii) at least one ZC2H12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575 complexed to a second Cas endonuclease protein to form a second RNP complex.

137. The gene-regulating system of any one of claims 84-108, comprising: i) at least one PTPN2-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 complexed to a first Cas endonuclease protein to form a first RNP complex; and (ii) at least one ZC2HI12A-targeting gRNA comprising a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575 complexed to a second Cas endonuclease protein to form a second RNP complex.

138. A kit comprising the gene-regulating system of any one of claims 84-137.

139. A composition comprising a plurality of gRNA molecules, wherein the plurality of gRNA molecules comprises at least one gRNA molecule targeting a first target gene and at least one gRNA molecule targeting a second target gene, wherein the first and second target gene are selected from SOCS1, PTPN2, and ZC3HI2A.

140. The composition of claim 139, wherein the first target gene is SOCS! and the second target gene is PTPN2.

141. The composition of claim 140, wherein the plurality of gRNA molecules comprises at least one SOCSI-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6.

142. The composition of claim 140, wherein the plurality of gRNA molecules comprises at least one SOCS-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6.

143. The composition of claim 140, wherein the plurality of gRNA molecules comprises at least one SOCS-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

144. The composition of claim 140, wherein the plurality of gRNA molecules comprises at least one SOCS1-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

145. The composition of claim 139, wherein the first target gene is SOCS! and the second target gene is ZC3HI2A.

146. The composition of claim 145, wherein the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

147. The composition of claim 145, wherein the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

148. The composition of claim 145, wherein the at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

149. The composition of claim 145, wherein the at least one SOCS / -targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

150. The composition of claim 139, wherein the first target gene is P7ZPN2 and the second target gene is ZC3HI124.

151. The composition of claim 150, wherein the at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

152. The composition of claim 150, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

153. The composition of claim 150, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H124- targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

154. The composition of claim 150, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H124- targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

155. The composition of any one of claims 139-154, wherein the gRNAs are modular gRNA molecules.

156. The composition of any one of claims 139-154, wherein the gRNAs are dual gRNA molecules.

157. The composition of any one of claims 139-156, wherein the gRNA targeting domains are 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or more nucleotides in length.

158. The composition of any one of claims 139-157, wherein the gRNAs comprise a modification at or near the 5” end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 5’ end) and / or a modification at or near the 3’ end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 3° end).

159. The composition of claim 158, wherein the modified gRNAs exhibit increased resistance to nucleases when introduced into an immune effector cell.

160. The composition of claim 158 or 159, wherein the modified gRNAs do not induce an innate immune response when introduced into an immune effector cell or induce a decreased innate immune response compared to an unmodified gRNA when introduced into an immune effector cell.

161. A polynucleotide molecule encoding a plurality of gRNA molecules, wherein the plurality of gRNA molecules comprises at least one gRNA molecule targeting a first target gene and at least one gRNA molecule targeting a second target gene, wherein the first and second target gene are selected from SOCS1, PTPN2, and ZC3HI124.

162. The polynucleotide of claim 161, wherein the first target gene is SOCS! and the second target gene is PTPN2.

163. The polynucleotide of claim 162, wherein the plurality of gRNA molecules comprises at least one SOCS-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting gRNA molecule comprising a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6.

164. The polynucleotide of claim 162, wherein the plurality of gRNA molecules comprises at least one SOCS]-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6.

165. The polynucleotide of claim 162, wherein the plurality of gRNA molecules comprises at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

166. The polynucleotide of claim 162, wherein the plurality of gRNA molecules comprises at least one SOCSI-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one P7PN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

167. The polynucleotide of claim 161, wherein the first target gene is SOCS! and the second target gene is ZC3HI24.

168. The polynucleotide of claim 167, wherein the at least one SOCS!-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

169. The polynucleotide of claim 167, wherein the at least one SOCS!-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

170. The polynucleotide of claim 167, wherein the at least one SOCS!-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

171. The polynucleotide of claim 167, wherein the at least one SOCS!-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A4-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

172. The polynucleotide of claim 161, wherein the first target gene is PTPN2 and the second target gene is ZC3HI24.

173. The polynucleotide of claim 172, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence complementary to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

174. The polynucleotide of claim 172, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H2A-targeting gRNA molecule comprises a targeting domain sequence that binds to a nucleic acid sequence defined by a set of genome coordinates shown in Tables 7 and 8.

175. The polynucleotide of claim 172, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H124- targeting gRNA molecule comprises a targeting domain sequence that binds to a target DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

176. The polynucleotide of claim 172, wherein the at least one PTPN2-targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3H124- targeting gRNA molecule comprises a targeting domain sequence encoded by a nucleic acid sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

177. A polynucleotide molecule encoding a plurality of siRNA or siRNA molecules, wherein the plurality of siRNA or shRNA molecules comprises at least one siRNA or shRNA molecule targeting a first target gene and at least one siRNA or shRNA molecule targeting a second target gene, wherein the first and second target gene are selected from SOCSI, PTPN2, and ZC3H12A.

178. The polynucleotide of claim 177, wherein the first target gene is SOCS / and the second target gene is PTPN2.

179. The polynucleotide of claim 178, wherein the plurality of siRNA or shRNA molecules comprises at least one SOCS-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting siRNA or siRNA molecule comprising a targeting domain sequence complementary to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

180. The polynucleotide of claim 178, wherein the plurality of siRNA or shRNA molecules comprises at least one SOCSI-targeting siRNA or shRNA molecule comprising a targeting domain sequence t that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one PTPN2-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

181. The polynucleotide of claim 177, wherein the first target gene is SOCS1 and the second target gene is ZC3HI2A.

182. The polynucleotide of claim 181, wherein the at least one SOCS!-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

183. The polynucleotide of claim 181, wherein the at least one SOCS-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 7-151 and the at least one ZC3H12A4-targeting siRNA or siRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

184. The polynucleotide of claim 177, wherein the first target gene is P7PN2 and the second target gene is ZC3HI2A.

185. The polynucleotide of claim 184, wherein the at least one PTPN2-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H12A-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

186. The polynucleotide of claim 184, wherein the at least one PTPN2-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and the at least one ZC3HI2A-targeting siRNA or shRNA molecule comprising a targeting domain sequence that binds to an RNA sequence encoded by a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

187. A polynucleotide molecule encoding at least one TALEN, zinc finger, or meganuclease protein targeting a first target gene and at least one TALEN, zinc finger, or meganuclease protein targeting a second target gene, wherein the first and second target gene are selected from SOCS1, PTPN2, and ZC3HI2A.

188. The polynucleotide of claim 187, wherein the first target gene is SOCS / and the second target gene is PTPN2.

189. The polynucleotide of claim 188, encoding at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6.

190. The polynucleotide of claim 188, encoding at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308.

191. The polynucleotide of claim 187, wherein the first target gene is SOCS / and the second target gene is ZC3HI24.

192. The polynucleotide of claim 191, encoding at least one SOCS!-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 3 and 4 and the at least one ZC3H124- targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

193. The polynucleotide of claim 191, encoding at least one SOCS / -targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 7-151 and at least one ZC3H12A4-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

194. The polynucleotide of claim 187, wherein the first target gene is PTPN2 and the second target gene is ZC3HI124.

195. The polynucleotide of claim 194, encoding least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 5 and 6 and the at least one ZC3H2A-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence defined by a set of genome coordinates shown in Tables 7 and 8.

196. The polynucleotide of claim 194, encoding at least one PTPN2-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 185-207, SEQ ID NOs: 272-375, or SEQ ID NOs: 272-308 and at least one ZC3H12A-targeting TALEN, zinc finger, or meganuclease protein comprising a targeting domain sequence that binds to a DNA sequence selected from SEQ ID NOs: 208-230, SEQ ID NOs: 376-812, or SEQ ID NOs: 376-575.

197. A composition comprising the polynucleotide of any one of claims 161-196.

198. A kit comprising the polynucleotide of any one of claims 161-196 or the composition of claim 176.

199. A method of producing a modified immune effector cell comprising: introducing a gene-regulating system into the immune effector cell, wherein the gene- regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCSI, PTPN2, and ZC3HI24.

200. A method of producing a modified immune effector cell comprising: obtaining an immune effector cell from a subject; introducing a gene-regulating system into the immune effector cell, wherein the gene- regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3H124; and culturing the immune effector cell such that the expression and / or function of one or more endogenous target genes is reduced compared to an immune effector cell that has not been modified.

201. The method of claim 199 or 200, wherein the gene-regulating system is one selected from claims 84-137.

202. The method of any one of claims 199-201, further comprising introducing a polynucleotide sequence encoding an engineered immune receptor selected from a CAR and a TCR.

203. The method of claim 202, wherein the gene-regulating system and / or the polynucleotide encoding the engineered immune receptor are introduced to the immune effector cell by transfection, transduction, electroporation, or physical disruption of the cell membrane by a microfluidics device.

204. The method of any one of claims 199-203, wherein the gene-regulating system is introduced as a polynucleotide sequence encoding one or more components of the system, as a protein, or as a ribonucleoprotein (RNP) complex.

205. A method of producing a modified immune effector cell comprising: expanding a population of immune effector cells in a first round expansion and a second round of expansion; and introducing a gene-regulating system into the population of immune effector cells, wherein the gene-regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3HI2A.

206. A method of producing a modified immune effector cell comprising: obtaining a population of immune effector cells; expanding the population of immune effector cells in a first round expansion and a second round of expansion; introducing a gene-regulating system into the population of immune effector cells, wherein the gene-regulating system is capable of reducing expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3HI12A4; and culturing the immune effector cell such that the expression and / or function of one or more endogenous target genes is reduced compared to an immune effector cell that has not been modified.

207. The method of claim 205 or 206, wherein the gene-regulating system is introduced to the population of immune effector cells prior to the first and second rounds of expansion.

208. The method of claim 205 or 206, wherein the gene-regulating system is introduced to the population of immune effector cells after the first round of expansion and prior to the second round of expansion.

209. The method of claim 205 or 206, wherein the gene-regulating system is introduced to the population of immune effector cells after the first and second rounds of expansion.

210. The method of any one of claims 204-209, wherein the gene-regulating system is one selected from claims 84-137.

211. A method of treating a disease or disorder in a subject in need thereof comprising administering to the subject an effective amount of the modified immune effector cells of any one of claims 1-78, or the composition of any one of claims 79-83.

212. The method of claim 211, wherein the disease or disorder is a cell proliferative disorder, an inflammatory disorder, or an infectious disease.

213. The method of claim 211, wherein the disease or disorder is a cancer or a viral infection.

214. The method of claim 213, wherein the cancer is selected from a leukemia, a lymphoma, or a solid tumor.

215. The method of claim 214, wherein the solid tumor is a melanoma, a pancreatic tumor, a bladder tumor, or a lung tumor or metastasis.

216. The method of any one of claims 213-215, wherein the cancer is a PD1 resistant or insensitive cancer.

217. The method of any one of claims 211-216, wherein the subject has previously been treated with a PD1 inhibitor or a PDL1 inhibitor.

218. The method of any one of claims 211-217, wherein the modified immune effector cells are autologous to the subject.

219. The method of any one of claims 211-217, wherein the modified immune effector cells are allogenic to the subject.

220. The method of any one of claims 211-219, further comprising administering to the subject an antibody or binding fragment thereof that specifically binds to and inhibits the function of the protein encoded by NRP1, HAVCR2, LAG3, TIGIT, CTLA4, or PDCDI.

221. The method of any one of claims 211-220, wherein the subject has not undergone lymphodepletion prior to administration of the modified immune effector cells or compositions thereof 222. The method of any one of claims 211-220, wherein administration of the modified immune effector cells or compositions thereof to the subject is not accompanied by high dose IL-2 treatment.

223. The method of any one of claims 211-220, wherein administration of the modified immune effector cells or compositions thereof to the subject is not accompanied by any IL-2 treatment.

224. The method of claims 221 or 222, wherein the subject has not undergone lymphodepletion prior to administration of the modified immune effector cells or compositions thereof and the modified immune effector cells or compositions thereof to the subject is not accompanied by high dose IL-2 treatment.

225. A method of killing a cancerous cell comprising exposing the cancerous cell to a modified immune effector cell according to any one of claims 1-78 or the composition of any one of claims 79- 83, wherein exposure to the modified immune effector cell results in increased killing of the cancerous cells compared to exposure to an immune effector cell that has not been modified.

226. The method of claim 225, wherein the exposure is in vitro, in vivo, or ex vivo.

227. A method of enhancing one or more effector functions of an immune effector cell comprising introducing a gene-regulating system into the immune effector cell, wherein the gene-regulating system is capable of reducing the expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3HI2A.

228. A method of enhancing one or more effector functions of an immune effector cell comprising: introducing a gene-regulating system into the immune effector cell, wherein the gene- regulating system is capable of reducing the expression and / or function of at least two endogenous target genes selected from SOCS1, PTPN2, and ZC3HI124; and culturing the immune effector cell such that the expression and / or function of one or more endogenous target genes is reduced compared to an immune effector cell that has not been modified, wherein the modified immune effector cell demonstrates one or more enhanced effector functions compared to the immune effector cell that has not been modified.

229. The method of claim 227 or 228, wherein the one or more effector functions are selected from cell proliferation, cell viability, cytotoxicity, tumor infiltration, increased cytokine production, anti- tumor immune responses, and / or resistance to exhaustion.

230. The method of any one of claims 227-228, wherein the gene-regulating system is one selected from claims 85-137.

231. A method of producing a modified immune effector cell comprising introducing an inactivating mutation in at least two endogenous target genes in an immune effector cell, wherein the at least two endogenous target genes are selected from SOCS7, PTPN2, and ZC3HI2A.

232. A method of producing a modified immune effector cell comprising: expanding a population of immune effector cells; and introducing an inactivating mutation in at least two endogenous target genes in the population of immune effector cells, wherein the at least two endogenous target genes are selected from SOCS1, PTPN2, and ZC3HI2A.

233. A method of producing a modified immune effector cell comprising introducing one or more exogenous polynucleotides encoding at least two nucleic acid inhibitors of at least two endogenous target genes in an immune effector cell, wherein the at least two endogenous target genes are selected from SOCS1, PTPN2, and ZC3H124.

234. A method of producing a modified immune effector cell comprising: expanding a population of immune effector cells; and introducing one or more exogenous polynucleotides encoding at least two nucleic acid inhibitors of at least two endogenous target genes in the population of immune effector cells, wherein the at least two endogenous target genes are selected from SOCS1, PTPN2, and ZC3HI2A.

235. The method of claim 231 or 234, wherein the population of immune effector cells is expanded in a first and / or second round of expansion 236. The method of any one of claims 231-235, further comprising introducing a polynucleotide sequence encoding an engineered immune receptor selected from a CAR and a TCR.

237. The method of claim 231 or claim 232, wherein inactivating mutation is introduced by the gene-regulating system of any one of claims 85-137. 238, The method of claim 233 or claim 234, wherein the at least two nucleic acid inhibitors are comprised in the gene-regulating system of any one of claims 85-137.

239. A method of killing a cancerous cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of modified immune effector cell according to any one of claims 1-78 or the composition of any one of claims 79-83, wherein exposure to the modified immune effector cell results in increased killing of the cancerous cells compared to exposure to an immune effector cell that has not been modified, wherein the number of modified immune effector cells necessary to comprise a therapeutically effective amount is at least ten fold less than the number of non-modified immune effector cells necessary to comprise a therapeutically effective amount.

240. The method of claim 239, wherein the number of modified immune effector cells necessary to comprise a therapeutically effective amount is at least 1 x 10°, 5 x 10%, 1x 10%, 5x 10%, 1x 10%, 5x 10% 1x 10% 2x 10%, 3x 10%, 4x 10% 5x 10% or 1 x 107, 5x 107, 1 x 108, 5x 10% 1 x 10° cells.

Images