Methods and compositions for editing nucleotide sequences

Abstract

The present disclosure provides new prime editor guide RNAs for prime editing, constructs for prime editing, and methods for using same. In addition, the present disclosure provides compositions and methods for conducting prime editing of a target DNA molecule (e.g., a genome) that enables the incorporation of a nucleotide change and / or targeted mutagenesis (e.g., insertion or deletion). The nucleotide change can include a single-nucleotide change (e.g., any transition or any transversion), an insertion of one or more nucleotides, or a deletion of one or more nucleotides. More in particular, the disclosure provides fusion proteins comprising nucleic acid programmable DNA binding proteins (napDNAbp) and a polymerase (e.g., reverse transcriptase), which is guided to a specific DNA sequence by a prime editor RNA (PEgRNA). The prime editor guide RNA comprises an extension arm that provides a DNA synthesis template sequence which encodes a single strand DNA flap, which is homologous to an endogenous DNA sequence, but which contains the desired one or more nucleotide changes and which, following synthesis by the polymerase (e.g., reverse transcriptase), becomes incorporated into the target DNA molecule.

Description

[0876] Described herein is a series of PEgRNA designs that are envisioned to improve the efficacy of PE. These designs take advantage of a number of previously published approaches for improving sgRNA efficacy and / or stability, as well as utilize a number of novel strategies. These improvements can belong to one or more of a number of different categories: i) designs to enable efficient expression of functional PEgRNA from non-polymerase III (pol III) promoters, which would enable the expression of longer PEgRNA without burdensome sequence requirements; ii) improvements to the core, Cas9-binding PEgRNA scaffold, which could improve efficacy; iii) modifications to the PEgRNA to improve RT processivity, enabling the insertion of longer sequences at targeted genomic loci; iv) addition of RNA motifs to the 5' or 3' termini of the PEgRNA that improve PEgRNA stability, enhance RT processivity, prevent misfolding of the PEgRNA , or recruit additional factors important for genome editing. Described herein are a number of potential such PEgRNA designs in each category. Several of these designs have been previously described for improving sgRNA activity with Cas9 and are indicated as such. Also described herein is a platform for the evolution of PEgRNA for given sequence targets that would enable the polishing of the PEgRNA scaffold and enhance PE activity (v). Notably, these designs could also be readily applied to improve PEgRNA recognized by any Cas9 or evolved variant thereof. (i) Expression of PEgRNA from non-pol III promoters

[0877] sgRNAs are typically expressed from the U6 snRNA promoter. This promoter recruits pol III to express the associated RNA and is useful for expression of short RNAs that are retained within the nucleus. However, pol III is not highly processive and is unable to express RNAs longer than a few hundred nucleotides in length at the levels required for efficient genome editing183. Additionally, pol III can stall or terminate at stretches of U’s, potentially limiting the sequence diversity that could be inserted using a PEgRNA . Other promoters that recruit polymerase II (such as pCMV) or polymerase I (such as the U1 snRNA promoter) have been examined for their ability to express longer sgRNAs183. However, these promoters are typically partially transcribed, which would result in extra sequence 5' of the spacer in the expressed PEgRNA , which has been shown to result in markedly reduced Cas9:sgRNA activity in a sitedependent manner. Additionally, while pol III-transcribed PEgRNA can simply terminate in a run of 6-7 U’s, PEgRNA transcribed from pol II or pol I would require a different termination signal. Often such signals also result in polyadenylation, which would result in undesired transport of the PEgRNA from the nucleus. Similarly, RNAs expressed from pol II promoters such as pCMV are typically 5'-capped, also resulting in their nuclear export.

[0878] Previously, Rinn and coworkers screened a variety of expression platforms for the production of long-noncoding RNA- (IncRNA) tagged sgRNAs183. These platforms include RNAs expressed from pCMV and that terminate in the ENE element from the MALAT1 ncRNA from humans184, the PAN ENE element from KSHV185, or the 3' box from U1 snRNA186. Notably, the MALAT1 ncRNA and PAN ENEs form triple helices protecting the polyA-tail184, 187. It is anticipated that, in addition to enabling expression of RNAs, these constructs could also enhance RNA stability (see section iv). Using the promoter from the UI snRNA to enable expression of these longer sgRNAs183 was also explored. It is anticipated that these expression systems will also enable the expression of longer PEgRNA . In addition, a series of methods have been designed for the cleavage of the portion of the pol II promoter that would be transcribed as part of the PEgRNA , adding either a self-cleaving ribozyme such as the hammerhead188, pistol189, hatchet189, hairpin190, VS191, twister192, or twister sister192 ribozymes, or other self-cleaving elements to process the transcribed guide, or a hairpin that is recognized by Csy4193 and also leads to processing of the guide. Also, is hypothesized that incorporation of multiple ENE motifs could lead to improved PEgRNA expression and stability, as previously demonstrated for the KSHV PAN RNA and element185. It is also anticipated that circularizing the PEgRNA in the form of a circular intronic RNA (ciRNA) could also lead to enhanced RNA expression and stability, as well as nuclear localization194. Sequences:

[0879] PEgRNA expression platform consisting of pCMV, Csy4 hairing, the PEgRNA , and MALAT1 ENE TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTT ACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTA TTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTA CATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTC AATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCC CATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGT GAACCGTCAGATCGTTCACTGCCGTATAGGCAGGGCCCAGACTGAGCACGTGAGTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTC CTCTGCCATCAAAGCGTGCTCAGTCTGTTTTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAA CAACACGTATTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAGC AAAAGATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAATCCCTGCGGCGTCTTT GCTTTGACT (SEQ ID NO: 1361567)

[0880] PEgRNA expression platform consisting of pCMV, Csy4 hairing, the PEgRNA , and PAN ENE TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTT ACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTA TTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTA CATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTC AATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCC CATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGT GAACCGTCAGATCGTTCACTGCCGTATAGGCAGGGCCCAGACTGAGCACGTGAGTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTC CTCTGCCATCAAAGCGTGCTCAGTCTGTTTTGTTTTGGCTGGGTTTTTCCTTGTTCGCACCGGA CACCTCCAGTGACCAGACGGCAAGGTTTTTATCCCAGTGTATATTGGAAAAACATGTTATACTT TTGACAATTTAACGTGCCTAGAGCTCAAATTAAACTAATACCATAACGTAATGCAACTTACAAC ATAAATAAAGGTCAATGTTTAATCCATAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 1361568)

[0881] PEgRNA expression platform consisting of pCMV, Csy4 hairing, the PEgRNA , and 3xPAN ENE TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTT ACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTA TTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTA CATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTC AATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCC CATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGT GAACCGTCAGATCGTTCACTGCCGTATAGGCAGGGCCCAGACTGAGCACGTGAGTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTC CTCTGCCATCAAAGCGTGCTCAGTCTGTTTTGTTTTGGCTGGGTTTTTCCTTGTTCGCACCGGA CACCTCCAGTGACCAGACGGCAAGGTTTTTATCCCAGTGTATATTGGAAAAACATGTTATACTT TTGACAATTTAACGTGCCTAGAGCTCAAATTAAACTAATACCATAACGTAATGCAACTTACAAC ATAAATAAAGGTCAATGTTTAATCCATAAAAAAAAAAAAAAAAAAAACACACTGTTTTGGCTGG GTTTTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTTTTATCCCAGTGTAT ATTGGAAAAACATGTTATACTTTTGACAATTTAACGTGCCTAGAGCTCAAATTAAACTAATACC ATAACGTAATGCAACTTACAACATAAATAAAGGTCAATGTTTAATCCATAAAAAAAAAAAAAAA AAAATCTCTCTGTTTTGGCTGGGTTTTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGG CAAGGTTTTTATCCCAGTGTATATTGGAAAAACATGTTATACTTTTGACAATTTAACGTGCCTA GAGCTCAAATTAAACTAATACCATAACGTAATGCAACTTACAACATAAATAAAGGTCAATGTTT AATCCATAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 1361569)

[0882] PEgRNA expression platform consisting of pCMV, Csy4 hairing, the PEgRNA , and 3' box TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTT ACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTA TTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTA CATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTC AATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCC CATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGT GAACCGTCAGATCGTTCACTGCCGTATAGGCAGGGCCCAGACTGAGCACGTGAGTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTC CTCTGCCATCAAAGCGTGCTCAGTCTGTTTGTTTCAAAAGTAGACTGTACGCTAAGGGTCATAT CTTTTTTTGTTTGGTTTGTGTCTTGGTTGGCGTCTTAAA (gEQ ID N0; 1361570)

[0883] PEgRNA expression platform consisting of pUl, Csy4 hairpin, the PEgRNA , and 3' box CTAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGA CGTCACTTCCCCTTGGCGGCTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGG GACTGGGCAAGGCACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGC AGAGGCTGCTGCTTCGCCACTTGCTGCTTCACCACGAAGGAGTTCCCGTGCCCTGGGAGCGGGT TCAGGACCGCTGATCGGAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGT GCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCC CAAGATCTCAGTTCACTGCCGTATAGGCAGGGCCCAGACTGAGCACGTGAGTTTTAGAGCTAGA AATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCCTC TGCCATCAAAGCGTGCTCAGTCTGTTTCAGCAAGTTCAGAGAAATCTGAACTTGCTGGATTTTT GGAGCAGGGAGATGGAATAGGAGCTTGCTCCGTCCACTCCACGCATCGACCTGGTATTGCAGTA CCTCCAGGAACGGTGCACCCACTTTCTGGAGTTTCAAAAGTAGACTGTACGCTAAGGGTCATAT CTTTTTTTGTTTGGTTTGTGTCTTGGTTGGCGTCTTAAA (SEq ID N0; 13g1571) (ii) Improvements to the PEgRNA scaffold

[0884] The core, Cas9-binding PEgRNA scaffold can likely be improved to enhance PE activity. Several such approaches have already been demonstrated. For instance, the first pairing element of the scaffold (Pl) contains a GTTTT-AAAAC pairing element. Such runs of Ts have been shown to result in pol III pausing and premature termination of the RNA transcript. Rational mutation of one of the T-A pairs to a G-C pair in this portion of Pl has been shown to enhance sgRNA activity, suggesting this approach would also be feasible for PEgRNA 195. Additionally, increasing the length of Pl has also been shown to enhance sgRNA folding and lead to improved activity195, suggesting it as another avenue for the improvement of PEgRNA activity. Finally, it is likely the polishing of the PEgRNA scaffold through directed evolution of PEgRNA on a given DNA target would also result in improved activity. This is described in section (v). Sequences:

[0885] PEgRNA containing a 6 nt extension to Pl GGCCCAGACTGAGCACGTGAGTTTTAGAGCTAGCTCATGAAAATGAGCTAGCAAGTTAAAATAA GGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCCTCTGCCATCAAAGCGTGCTC AGTCTGTTTTTTT (SEQ ID NO: 1361572)

[0886] PEgRNA containing a T-A to G-C mutation within Pl GGCCCAGACTGAGCACGTGAGTTTGAGAGCTAGAAATAGCAAGTTTAAATAAGGCTAGTCCGTT ATCAACTTGAAAAAGTGGGACCGAGTCGGTCCTCTGCCATCAAAGCGTGCTCAGTCTGTTTTTT T (SEQ ID NO: 1361573) (iii) Improvement of RT processivity via modifications to the template region of the PEgRNA

[0887] As the size of the insertion templated by the PEgRNA increases, it is more likely to be degraded by endonucleases, undergo spontaneous hydrolysis, or fold into secondary structures unable to be reverse-transcribed by the RT or that disrupt folding of the PEgRNA scaffold and subsequent Cas9-RT binding. Accordingly, it is likely that modification to the template of the PEgRNA might be necessary to affect large insertions, such as the insertion of whole genes. Some strategies to do so include the incorporation of modified nucleotides within a synthetic or semi-synthetic PEgRNA that render the RNA more resistant to degradation or hydrolysis or less likely to adopt inhibitory secondary structures196. Such modifications could include 8-aza-7-deazaguanosine, which would reduce RNA secondary structure in G-rich sequences; locked-nucleic acids (LNA) that reduce degradation and enhance certain kinds of RNA secondary structure; 2’-O-methyl, 2’-fluoro, or 2’-O-methoxy ethoxy modifications that enhance RNA stability. Such modifications could also be included elsewhere in the PEgRNA to enhance stability and activity. Alternatively or additionally, the template of the PEgRNA could be designed such that it both encodes for a desired protein product and is also more likely to adopt simple secondary structures that are able to be unfolded by the RT. Such simple structures would act as a thermodynamic sink, making it less likely that more complicated structures that would prevent reverse transcription would occur. Finally, one could also imagine splitting the template into two, separate PEgRNA . In such a design, a PE would be used to initiate transcription and also recruit a separate template RNA to the targeted site via an RNA-binding protein fused to Cas9 or an RNA recognition element on the PEgRNA itself such as the MS2 aptamer. The RT could either directly bind to this separate template RNA, or initiate reverse transcription on the original PEgRNA before swapping to the second template. Such an approach could enable long insertions by both preventing misfolding of the PEgRNA upon addition of the long template and also by not requiring dissociation of Cas9 from the genome for long insertions to occur, which could possibly be inhibiting PE-based long insertions. (iv) Installation of additional RNA motifs at the 5' or 3' termini

[0888] PEgRNA designs could also be improved via the installation of additional motifs at either end of the terminus of the RNA. Several such motifs - such as the PAN ENE from KSHV and the ENE from MALAT1 were discussed earlier in part (i)184,185 as possible means to terminate expression of longer PEgRNA from non-pol III promoters. These elements form RNA triple helices that engulf the polyA tail, resulting in their being retained within the nucleus184,187. However, by forming complex structures at the 3' terminus of the PEgRNA that occlude the terminal nucleotide, these structures would also likely help prevent exonuclease-mediated degradation of PEgRNA . Other structural elements inserted at the 3' terminus could also enhance RNA stability, albeit without enabling termination from non-pol III promoters. Such motifs could include hairpins or RNA quadruplexes that would occlude the 3' terminus197, or self-cleaving ribozymes such as HDV that would result in the formation of a 2’-3'-cyclic phosphate at the 3' terminus and also potentially render the PEgRNA less likely to be degraded by exonucleases198. Inducing the PEgRNA to cyclize via incomplete splicing - to form a ciRNA - could also increase PEgRNA stability and result in the PEgRNA being retained within the nucleus194.

[0889] Additional RNA motifs could also improve RT processivity or enhance PEgRNA activity by enhancing RT binding to the DNA-RNA duplex. Addition of the native sequence bound by the RT in its cognate retroviral genome could enhance RT activity199. This could include the native primer binding site (PBS), polypurine tract (PPT), or kissing loops involved in retroviral genome dimerization and initiation of transcription199. Addition of dimerization motifs - such as kissing loops or a GNRA tetraloop / tetraloop receptor pair200 - at the 5' and 3' termini of the PEgRNA could also result in effective circularization of the PEgRNA, improving stability. Additionally, it is envisioned that addition of these motifs could enable the physical separation of the PEgRNA spacer and primer, prevention occlusion of the spacer which would hinder PE activity. Short 5' extensions to the PEgRNA that form a small toehold hairpin in the spacer region could also compete favorably against the annealing region of the PEgRNA binding the spacer. Finally, kissing loops could also be used to recruit other template RNAs to the genomic site and enable swapping of RT activity from one RNA to the other (section iii). Sequences

[0890] PEgRNA -HDV fusion GGCCCAGACTGAGCACGTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT ATCAACTTGAAAAAGTGGGACCGAGTCGGTCCTCTGCCATCAAAGCGTGCTCAGTCTGGGCCGG CATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTT TTTTT (SEQ ID NO: 1361574)

[0891] PEgRNA -MMLV kissing loop GGTGGGAGACGTCCCACCGGCCCAGACTGAGCACGTGAGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCCTCTGCCATCAAAGC TTCGACCGTGCTCAGTCTGGTGGGAGACGTCCCACCTTTTTTT (SEQ ID NO: 1361575)

[0892] PEgRNA -VS ribozyme kissing loop GAGCAGCATGGCGTCGCTGCTCACGGCCCAGACTGAGCACGTGAGTTTTAGAGCTAGAAATAGC AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCCTCTGCCAT CAAAGCTTCGACCGTGCTCAGTCTCCATCAGTTGACACCCTGAGGTTTTTTT (SEQ ID NO: 1361576)

[0893] PEgRNA -GNRA tetraloop / tetraloop receptor GCAGACCTAAGTGGUGACATATGGTCTGGGCCCAGACTGAGCACGTGAGTTTTAGAGCTAUACG TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTUACGAAGTGGGACCGAGTCGGTCCTCTG CCATCAAAGCTTCGACCGTGCTCAGTCTGCATGCGATTAGAAATAATCGCATGTTTTTTT (SEQ ID NO: 1361577)

[0894] PEgRNA template switching secondary RNA-HDV fusion TCTGCCATCAAAGCTGCGACCGTGCTCAGTCTGGTGGGAGACGTCCCACCGGCCGGCATGGTCC CAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTTTTTTT (SEQ ID NO: 1361578) (v) Evolution of PEgRNA

[0895] It is likely that the PEgRNA scaffold can be further improved via directed evolution, in an analogous fashion to how SpCas9 and base editors have been improved201. Directed evolution could enhance PEgRNA recognition by Cas9 or evolved Cas9 variants. Additionally, it is likely that different PEgRNA scaffold sequences would be optimal at different genomic loci, either enhancing PE activity at the site in question, reducing off-target activities, or both. Finally, evolution of PEgRNA scaffolds to which other RNA motifs have been added would almost certainly improve the activity of the fused PEgRNA relative to the unevolved, fusion RNA. For instance, evolution of allosteric ribozymes composed of c-di-GMP-I aptamers and hammerhead ribozymes led to dramatically improved activity202, suggesting that evolution would improve the activity of hammerhead-PEgRNA fusions as well. In addition, while Cas9 currently does not generally tolerate 5' extension of the sgRNA, directed evolution will likely generate enabling mutations that mitigate this intolerance, allowing additional RNA motifs to be utilized. Competing Approaches

[0896] As described herein, a number of these approaches have already been described for use with Cas9:sgRNA complexes, but no designs for improving PEgRNA activity have been reported. Other strategies for the installation of programmable mutations into the genome include base-editing, homology-directed recombination (HDR), precise microhomology-mediated end joining (MMEJ), or transposase-mediated editing. However, all of these approaches have significant drawbacks when compared to PEs. Current base editors, while more efficient than existing PEs, can only install certain classes of genomic mutations and can result in additional, undesired nucleotide conversions at the site of interest. HDR is only feasible in a very small minority of cell types and results in comparably high rates of random insertion and deletion mutations (indels). Precise MMEJ can lead to predictable repair of double-strand breaks, but is largely limited to installation of deletions, is very site-dependent, and can also have comparably high rates of undesired indels. Transposase-mediated editing has to date only been shown to function in bacteria. As such improvements to PE represent possibly the best path forward for the therapeutic correction of a wide-swatch of genomic mutations. EXAMPLE 4. INCORPORATION OF 3' TOE LOOP IN THE PRIMER BINDING SITE (PBS) IMPROVES PEgRNA ACTIVITY

[0897] In order to further improve PE activity, the inventors contemplated adding a toeloop sequence at the 3' end of a PEgRNA having a 3' extension arm. FIG. 37A provides an example of a generic SpCas9 PEgRNA having a 3' extension arm (top molecule). The 3' extension arm, in turn, comprises an RT template (that includes that the desired edit) and a primer binding site (PBS) at the 3' end of the molecule. The molecule terminates with a poly(U) sequence comprising three U nucleobases (i.e., 5'-UUU-3').

[0898] By contrast, the bottom portion of FIG. 37A shows the same PEgRNA molecule as the top portion of FIG. 37A, but wherein a 9-nucleobase sequence of 5'-GAAANNNNN-3' has been inserted between the 3' end of the primer binding site and the 5' end of the terminal poly(U) sequence. This structure folds back on itself by 180° to form a “toeloop” RNA structure, wherein the sequences of 5'-NNNNN-3' of the 9-nucleobase insertion anneals with a complementary sequence in the primer binding site, and wherein the 5'-GAAA-3' portion forms the 180° turn. The features of the toeloop sequence depicted in FIG. 37A is not intended to limit or narrow the scope of possible toeloops that could be used in its place. Further, the sequence of the toeloop will depend upon the complementary sequence of the primer binding site. Essentially though, the toeloop sequence, in various embodiments, may have a first sequence portion that forms a 180°, and a second sequence portion that has a sequence that is complementary to a portion of the primer binding site.

[0899] Without being bound by theory, the toeloop sequence is thought to enable PEgRNA the use of PEgRNAs with increasingly longer primer binding sites than would otherwise be possible. Longer PBS sequences, in turn, are thought to improve PE activity. PEgRNA More in particular, the likely function of the toeloop is to occlude or at least minimize the PBS from interacting with the spacer. Stable hairpin formation between the PBS and the spacer can lead to an inactive PEgRNA. Without a toeloop, this interaction may require restricting the length of the PBS. Blocking or minimizing the interaction between the spacer and the PBS using a 3’ end toeloop may lead to an improvement in PE activity.

[0900] FIG. 37B shows the results of Example 4, which demonstrates that the efficiency of prime editing in HEK cells or EMX cells is increased using PEgRNA containing toeloop elements, whereas the percent of indel formation is largely unchanged. EMBODIMENTS

[0901] The following embodiments are within the scope of the present disclosure. Furthermore, the disclosure encompasses all variations, combinations, and permutations of these embodiments in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed embodiments is introduced into another listed embodiment in this section. For example, any listed embodiment that is dependent on another embodiment can be modified to include one or more limitations found in any other listed embodiment in this section that is dependent on the same base embodiment. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the disclosure, or aspects of the disclosure, is / are referred to as comprising particular elements and / or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and / or features. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. 1. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs: 1-135514, or a sequence having at least 90% sequence identity with any of SEQ ID NOs: 1-135514. 2. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the spacer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 - 271028, or a spacer having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 135515 - 271028. 3. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 271029 - 406542, or an extension arm having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 271029 - 406542. 4. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises (i) a primer binding site, (ii) an edit template, and (iii) a homology arm. 5. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises an primer binding site having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 406543 - 542056, or a primer binding site having a nucleotide sequence that is at least 90% sequence identical to any of SEQ ID NOs: 406543 - 542056. 6. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises an edit template comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 542057 - 677570, or an edit template having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 542057 - 677570. 7. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises a homology arm having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 677571 - 813084, or a homology arm having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 677571 - 813084. 8. A guide RNA comprising: (i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 - 271028, or a spacer having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 135515 - 271028, and (ii) an extension arm selected from the group consisting of SEQ ID NOs: 271029 -406542, or an extension arm having a nucleotide sequence having least 90% sequence identity with SEQ ID NOs: 271029 - 406542. 9. A guide RNA comprising: (i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 -271028, ora spacer having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 135515 - 271028, and (ii) a primer binding site selected from the group consisting of SEQ ID NOs: 406543 - 542056, or a primer binding site having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 406543 - 542056. 10. A guide RNA comprising: (i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 - 271028, or a spacer having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 135515 - 271028, and (ii) an edit template having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 542057 - 677570, or an edit template having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 542057 - 677570. 11.   A guide RNA comprising: (i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 -271028, ora spacer having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 135515 - 271028, and (ii) a homology arm having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 677571 - 813084, or a spacer having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 677571 - 813084. 12. The guide RNA of any of embodiments 1-11 further comprising an termination signal of SEQ ID NO: 813086, or a termination signal having at least 90% sequence identity with SEQ ID NO: 813086. 13. The guide RNA of any of embodiments 1-12 further comprising a 5' end modifier region comprising a hairpin sequence, a stem / loop sequence, or a toeloop sequence. 14. The guide RNA of any of embodiments 1-13 further comprising a 3' end modifier region comprising a hairpin sequence, a stem / loop sequence, or a toeloop sequence. 15. The guide RNA of any of embodiments 1-14 further comprising a gRNA core comprising SEQ ID NO: 813085, or a gRNA core having at least 90% sequence identity with SEQ ID NO: 813085. 16. The guide RNA of any of embodiments 1-15, wherein the guide RNA is capable of binding to a napDNAbp suitable for prime editing and directing the napDNAbp to a target DNA sequence. 17. The guide RNA of embodiment 16, wherein the target nucleic acid sequence comprises a target strand (or PAM strand) and a complementary non-target strand (or non-PAM strand), wherein the spacer of the guide RNA hybridizes to the complementary non-target strand (nonPAM strand) to form an RNA-DNA hybrid and an R-loop. 18. The guide RNA of any of embodiments 1-17, wherein the primer binding site is between approximately 8 and approximately 20 nucleotides in length. 19. The guide RNA of any of embodiments 1-18, wherein the primer binding site is 8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. 20. The guide RNA of any of the above embodiments, wherein the primer binding site is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides in length. 21. The guide RNA of any of embodiments 1-19, wherein the homology arm is complementary to a strand of the target DNA. 22. The guide RNA of any of embodiments 1-10, wherein the extension arm is between approximately 7 and approximately 500 nucleotides in length. 23. The guide RNA of any of the above embodiments, wherein the extension arm is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, or at least 100 nucleotides in length. 24. The guide RNA of any of the above embodiments, wherein the edit template is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides or, at least 100 nucleotides in length. 25. The guide RNA of any of the above embodiments, wherein the homology arm is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, or at least 30 nucleotides. 26. The guide RNA of any of the above embodiments, wherein the edit template and homology arm can be used by a reverse transcriptase as a template sequence for the synthesis of a corresponding single-strand DNA flap having a 3' end, wherein the DNA flap is complementary to a strand of the endogenous target DNA sequence adjacent to a nick site, and wherein the single-strand DNA flap comprises a nucleotide change encoded by the edit template. 27. The guide RNA of embodiment 25, wherein the single-strand DNA flap displaces an endogenous single-strand DNA having a 5' end in the target DNA sequence that has been nicked. 28. The guide RNA of embodiment 26, wherein the endogenous single-strand DNA having the free 5' end is excised by the cell. 29. The guide RNA of embodiment 27, whereby cellular repair of the single-strand DNA flap results in installation of the nucleotide change, thereby forming a desired product. 30.    The guide RNA of embodiment 28, wherein the desired nucleotide change is an insertion. 31.    The guide RNA of embodiment 29, wherein in the insertion is at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, or at least 100 nucleotides in length. 32. The guide RNA of embodiment 29, wherein the insertion is a sequence encoding a polypeptide. 33. A prime editing complex comprising a napDNAbp, a reverse transcriptase, and any one of the guide RNAs of embodiments 1-32. 34. The prime editing complex of embodiment 32, wherein the napDNAbp and the reverse transcriptase are formed as a fusion protein. 35.   The prime editing complex of embodiment 32, wherein the napDNAbp is a Cas9. 36.    The prime editing complex of embodiment 34, wherein the Cas9 is selected from the group consisting of Cas9 nickases or variants thereof. 37. The prime edting complex of embodiment 34, wherein the Cas9 has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514. 38. The prime editing complex of embodiment 33, wherein the fusion protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514. 39. The prime editing complex of embodiment 33, wherein the fusion protein comprises a linker joining the napDNAbp and reverse transcriptase. 40. The prime editing complex of embodiment 38, wherein the linker has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514. 41. One or more polynucleotides encoding the prime editing complex of any of embodiments 32-39. 42. A vector comprising the polynucleotide of embodiment 41 and one or more promoters that drive the expression of the guide RNA and the fusion protein of the prime editing complex. 43. A cell comprising the a vector of embodiment 41. 44.   A cell comprising a prime editing complex of any of embodiments 32-39. 45. A pharmaceutical composition comprising: (i) a guide RNA of any of embodiments 1-31, a prime editing complex of embodiments 32-39, a polynucleotide of embodiment 40, or a vector of embodiment 41; and (ii) a pharmaceutically acceptable excipient. 46. A method for installing a nucleotide change in a nucleic acid sequence, the method comprising: contacting the nucleic acid sequence with a complex comprising a fusion protein and a guide RNA of any of embodiments 1-31 or any of embodiments 83-85, wherein the fusion protein comprises a napDNAbp and a polymerase, and wherein the guide RNA comprises a spacer, gRNA core, and an extension arm that comprises an edit template encoding a nucleotide change; thereby (i) nicking the double-stranded DNA sequence on the target strand (or the PAM strand), and generating a free single-strand DNA having a 3' end; (ii) hybridizing the 3' end of the free single-strand DNA to the guide RNA at the primer binding site, thereby priming the polymerase; (iii) polymerizing a strand of DNA from the 3' end, thereby generating a single-strand DNA flap comprising the nucleotide change; and (iv) replacing the endogenous DNA strand immediately adjacent downstream of the cut site on the target strand (or PAM strand) with the single-strand DNA flap, thereby installing the desired nucleotide change in the double-stranded DNA sequence. 47. The method of embodiment 46, wherein the nucleotide change is a single nucleotide substitution, a deletion, an insertion, or a combination thereof. 48. The method of embodiment 46, wherein the single nucleotide substitution is a transition or a transversion. 49. The method of embodiment 46, wherein the nucleotide change is (1) a G to T substitution, (2) a G to A substitution, (3) a G to C substitution, (4) a T to G substitution, (5) a T to A substitution, (6) a T to C substitution, (7) a C to G substitution, (8) a C to T substitution, (9) a C to A substitution, (10) an A to T substitution, (11) an A to G substitution, or (12) an A to C substitution. 50. The method of embodiment 46, wherein the nucleoid change converts (1) a G:C basepair to a T:A basepair, (2) a G:C basepair to an A:T basepair, (3) a G:C basepair to C:G basepair, (4) a T:A basepair to a G:C basepair, (5) a T:A basepair to an A:T basepair, (6) a T:A basepair to a C:G basepair, (7) a C:G basepair to a G:C basepair, (8) a C:G basepair to a T:A basepair, (9) a C:G basepair to an A:T basepair, (10) an A:T basepair to a T:A basepair, (11) an A:T basepair to a G:C basepair, or (12) an A:T basepair to a C:G basepair. 51. The method of embodiment 46, wherein the nucleotide change is an insertion or deletion of 1,2, 3, 4, 5, 6, 7, 8, 9,10,11,12,13,14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. 52. The method of embodiment 46, wherein the nucleotide change is an insertion of a polypeptide-encoding sequence. 53. The method of embodiment 46, wherein the nucleotide change corrects a disease-associated gene. 54. The method of embodiment 46, wherein the disease-associated gene is associated with a monogentic disorder selected from the group consisting of: Adenosine Deaminase (ADA) Deficiency; Alpha-1 Antitrypsin Deficiency; Cystic Fibrosis; Duchenne Muscular Dystrophy; Galactosemia; Hemochromatosis; Huntington’s Disease; Maple Syrup Urine Disease; Marfan Syndrome; Neurofibromatosis Type 1; Pachyonychia Congenita; Phenylkeotnuria; Severe Combined Immunodeficiency; Sickle Cell Disease; Smith-Lemli-Opitz Syndrome; and Tay-Sachs Disease. 55. The method of embodiment 46, wherein the disease-associated gene is associated with a polygenic disorder selected from the group consisting of: heart disease; high blood pressure; Alzheimer’s disease; arthritis; diabetes; cancer; and obesity. 56. A computerized method for determining a prime editor guide RNA (PEgRNA ) structure, the method comprising using at least one computer hardware processor to perform: accessing data indicative of: an input allele; an output allele; and a fusion protein comprising a nucleic acid programmable DNA binding protein and a polymerase (e.g., a reverse transcriptase); and determining the PEgRNA structure based on the input allele, the output allele, and the fusion protein, wherein the PEgRNA structure is designed to be associated with the fusion protein to change the input allele to the output allele, comprising determining for the PEgRNA structure one or more of the following features: a spacer complementary to a target nucleotide sequence in the input allele; a gRNA backbone for interacting with the fusion protein; and an extension comprising one or more of: a DNA synthesis template sequence comprising a desired nucleotide change to change the input allele to the output allele; an primer binding site; optionally, a termination signal adjacent to the DNA synthesis template; optionally, a first modifier adjacent to the termination signal; and optionally, a second modifier adjacent to the primer binding site. 57. The method of embodiment 56 further comprising determining the spacer and the extension, and determining the spacer is at the 5' end of the PEgRNA structure, and the extension is at the 3' end of the PEgRNA structure. 58. The method of embodiment 56 further comprising determining the spacer and the extension, wherein the spacer is at the 5' end of the PEgRNA structure, and the extension is 3' to the spacer. 59. The method of embodiment 56, wherein accessing data indicative of the input allele and the output allele comprises accessing a database comprising a set of input alleles and associated output alleles. 60. The method of embodiment 59, wherein accessing the database comprises accessing a ClinVar database comprising a plurality of entries, wherein each entry comprises an input allele from the set of input alleles and an output allele from the set of output alleles. 61. The method of embodiment 59, wherein determining the PEgRNA structure comprises determining one or more PEgRNA structures for each input allele and associated output allele in the set. 62. The method of embodiment 56, wherein accessing data indicative of the fusion protein comprises determining the fusion protein from a plurality of fusion proteins. 63.    The method of embodiment 56, wherein the fusion protein comprises a Cas9 protein. 64.   The method of embodiment 63, wherein the fusion protein comprises a Cas9-NG protein or a SpCas9 protein. 65. The method of embodiment 56, wherein changing the input allele to the output allele comprises a single nucleotide change, an insertion of one or more nucleotides, a deletion of one or more nucleotides, or a combination thereof. 66. The method of embodiment 56, further comprising determining the spacer, wherein the spacer comprises a nucleotide sequence of approximately 20 nucleotides. 67. The method of embodiment 66, further comprising determining the spacer based on the position of the change in a corresponding protospacer nucleotide sequence. 68. The method of embodiment 67, wherein the change is installed in an editing window that is between about protospacer position -3 to protospacer position +27. 69. The method of embodiment 67 further comprising: determining a set of initial candidate protospacers based on the input allele and the fusion protein, wherein each initial candidate protospacer comprises a PAM of the fusion protein in the input allele; determining one or more initial candidate protospacers from the set of initial candidate protospacers, wherein each comprises an incompatible nick position; removing the determined one or more initial candidate protospacers from the set to generate a set of remaining candidate protospacers; and wherein determining the PEgRNA structure comprises determining a plurality of PEgRNA structures, wherein each of the PEgRNA structure comprises a different spacer determined based on a corresponding protospacer from the set of remaining candidate protospacers. 70. The method of embodiment 55, further comprising determining the extension and the DNA synthesis template (e.g., RT template sequence), wherein the DNA synthesis template (e.g., RT template sequence) comprises approximately 7 nucleotides to approximately 34 nucleotides. 71. The method of embodiment 56, wherein determining the PEgRNA comprises: determining the spacer based on the input allele and / or the fusion protein; and determining the DNA synthesis template (e.g., RT template sequence) based on the spacer. 72. The method of embodiment 56, wherein the DNA synthesis template (e.g., RT template sequence) encodes a single-strand DNA flap that is complementary to an endogenous DNA sequence adjacent to a nick site, wherein the single-strand DNA flap comprises the desired nucleotide change. 73. The method of embodiment 72, wherein the single-strand DNA flap is capable of hybridizing to the endogenous DNA sequence adjacent to the nick site, thereby leading to the installation of the desired nucleotide change. 74. The method of embodiment 72, wherein the single-stranded DNA flap is capable of displacing the endogenous DNA sequence adjacent to the nick site. 75. The method of embodiment 72, whereby cellular repair of the single-strand DNA flap results in installation of the desired nucleotide change, thereby forming a desired product. 76. The method of embodiment 56, wherein the fusion protein when complexed with the PEgRNA is capable of binding to a target DNA sequence. 77. The method of embodiment 76, wherein the target DNA sequence comprises a target strand in which the change occurs and a complementary non-target strand. 78. The method of embodiment 56, wherein the input allele comprises a pathogenic DNA mutation, and the output allele comprises a corrected DNA sequence. 79. The method of embodiment 56, wherein the input allele is any one of the disease alleles ofSEQIDNOs: 1217353-1289387. 80. The method of embodiment 56, wherein the output allele is any one of the healthy alleles ofSEQIDNOs: 1289388-1361420. 81. A system comprising: at least one processor; and at least one computer-readable storage medium having encoded thereon instructions which, when executed, cause the at least one processor to perform the method of any of embodiments 56-81. 82. At least one computer-readable storage medium having encoded thereon instructions which, when executed, cause at least one processor to perform the method of any of embodiments 56-81. 83.    A method of base editing using the PEgRNA structure determined according to the method of any of embodiments 56-81. 84.   A PEgRNA determined according to the method of any one of embodiments 56-81. 85.    A guide RNA for use in prime editing to correct a disease allele at a target DNA sequence to form a healthy allele, said guide comprising a spacer, a gRNA core, and an extension arm, wherein the spacer is capable of binding to a ~20 nucleotide region within SEQ ID NOs: 1217353-1289387 or the complement strand thereof. 86. A guide RNA comprising a spacer, gRNA core, and an extension arm, wherein the extension arm comprises a DNA synthesis template and a primer binding site effective to conduct prime editing. 87. The guide RNA of embodiment 85, wherein the edit site in any of the nucleotide sequences of SEQ ID NOs: 1217353-1289387 begins at position 201 in the 5' to 3' orientation. 88. A guide RNA for prime editing comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises a primer binding site and a DNA synthesis template. 89. The guide RNA of embodiment 88, wherein the primer binding site has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 406543 - 542056 (primer binding site), or a nucleotide sequence that has at least 90% sequence identity with any of SEQ ID NOs: 406543 - 542056. 90. The guide RNA of embodiment 88, wherein the DNA synthesis template comprises a nucleotide sequence of SEQ ID NOs: 542057 - 677570 (edit template), or a nucleotide sequence that has at least 90% sequence identity with any of SEQ ID NOs: 542057 - 677570. 91. The guide RNA of embodiment 88, wherein the DNA synthesis template comprises a nucleotide sequence of SEQ ID NOs: 677571 - 813084 (homology arm), or a nucleotide sequence that has at least 90% sequence identity with any of SEQ ID NOs: 677571 - 813084. 92. The guide RNA of embodiment 88, wherein the DNA synthesis template comprises an edit template and a homology arm, wherein the edit template comprises a nucleotide sequence of SEQ ID NOs: 542057 - 677570, and the homology arm comprises a nucleotide sequence of SEQ ID NOs: 677571 -813084. 93. The guide RNA of any of embodiments 86-92 further comprising an termination signal of SEQ ID NO: 813086, or a termination signal having at least 90% sequence identity with SEQ ID NO: 813086. 94. The guide RNA of any of embodiments 86-93 further comprising a 5' end modifier region comprising a hairpin sequence, stem / loop sequence, or a toeloop sequence. 95. The guide RNA of any of embodiments 86-94 further comprising a 3' end modifier region comprising a hairpin sequence, stem / loop sequence, or a toeloop sequence. 96. The guide RNA of any of embodiments 86-95, further comprising a gRNA core comprising SEQ ID NO: 813085, or a gRNA core having at least 90% sequence identity with SEQIDNO: 813085. 97. The guide RNA of any of embodiments 86-96, wherein the guide RNA is capable of binding to a napDNAbp suitable for prime editing and directing the napDNAbp to a target DNA sequence. 98. The guide RNA of embodiment 97, wherein the target nucleic acid sequence comprises a target strand (or PAM or edit strand) and a complementary non-target strand (or non-PAM or non-edit strand) wherein the spacer of the guide RNA hybridizes to the non-PAM strand to form an RNA-DNA hybrid and an R-loop. 99. The guide RNA of any of embodiments 86-98, wherein the primer binding site is between approximately 8 and approximately 20 nucleotides in length. 100. The guide RNA of any of embodiments 86-99, wherein the primer binding site is 8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. 101. The guide RNA of any of embodiments 86-100, wherein the extension arm is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length. 102. The guide RNA of any of embodiments 86-101, wherein the primer binding site is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides in length. 103. The guide RNA of any of embodiments 86-102, wherein the DNA synthesis template is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length. 104. The guide RNA of any of embodiments 86-103, wherein the DNA synthesis template can be used by an RNA-dependent DNA polymerase (e.g., reverse transcriptase) as a template for the synthesis of a corresponding single-strand DNA flap having a 3' end, wherein the DNA flap is complementary to a strand of the endogenous target DNA sequence adjacent to a nick site, and wherein the single-strand DNA flap comprises a desired nucleotide change encoded by the DNA synthesis template. 105. The guide RNA of embodiment 104, wherein the single-strand DNA flap displaces an endogenous single-strand DNA having a 5" end in the target DNA sequence that has been nicked. 106. The guide RNA of embodiment 105, wherein the endogenous single-strand DNA having the free 5" end is excised by the cell. 107. The guide RNA of embodiment 105, whereby cellular repair of the single-strand DNA flap results in installation of the nucleotide change, thereby forming an edited DNA product. 108. The guide RNA of embodiment 107, wherein the nucleotide change is an insertion. 109. The guide RNA of embodiment 108, wherein in the insertion is at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length. 110. The guide RNA of embodiment 108, wherein the insertion is a sequence encoding a polypeptide. 111. A prime editing complex comprising a napDNAbp, an RNA-dependent DNA polymerase, and any one of the guide RNA of embodiments 86-110. 112. The prime editing complex of embodiment 111, wherein the napDNAbp and the RNA-dependent DNA polymerase are formed as a fusion protein. 113. The prime editing complex of embodiment 111, wherein the napDNAbp is a Cas9. 114. The prime editing complex of embodiment 113, wherein the Cas9 is a Cas9 nickase or variant thereof. 115. The prime editing complex of embodiment 113, wherein the Cas9 has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514. 116. The prime editing complex of embodiment 112, wherein the fusion protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514. 117. The prime editing complex of embodiment 112, wherein the fusion protein comprises a linker joining the napDNAbp and RNA-dependent DNA polymerase. 118. The prime editing complex of embodiment 117, wherein the linker has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514. 119. One or more polynucleotides encoding the prime editing complex of any of embodiments 111-118. 120. A vector comprising the polynucleotide of embodiment 119 and one or more promoters that drive the expression of the guide RNA and the fusion protein of the prime editing complex. 121.   A cell comprising the vector of embodiment 120. 122.  A cell comprising a prime editing complex of any of embodiments 111-118. 123.  A pharmaceutical composition comprising: (i) a guide RNA of any of embodiments 84 110, a prime editing complex of embodiments 111-118, a polynucleotide of embodiment 119 , or a vector of embodiment 120; and (ii) a pharmaceutically acceptable excipient. 124. A method for installing a nucleotide change in a nucleic acid sequence, the method comprising: contacting the nucleic acid sequence with a complex comprising a fusion protein and a guide RNA of any of embodiments 109-116, wherein the fusion protein comprises a napDNAbp and an RNA-dependent DNA polymerase, wherein the guide RNA comprises a spacer, gRNA core, and an extension arm that comprises a DNA synthesis template and primer binding site, said DNA synthesis template encoding a nucleotide change, and wherein the spacer is capable of annealing to the non-PAM strand proximal to an available PAM and protospacer, thereby (i) nicking the double-stranded DNA sequence on the PAM strand, thereby generating a free single-strand DNA having a 3' end; (ii) hybridizing the 3' end of the free single-strand DNA to the guide RNA at the primer binding site, thereby priming the RNA-dependent DNA polymerase; (iii) polymerizing a strand of DNA from the 3' end of DNA, coding from the DNA synthesis template, thereby generating a single-strand DNA flap extended from the 3' end of the DNA, wherein the flap comprises the nucleotide change; (iv) replacing an endogenous DNA strand adjacent immediately downstream of the cut site on the PAM strand with the single-strand DNA flap, thereby installing the nucleotide change in the double-stranded DNA sequence. 125. The method of embodiment 124, wherein when step (v) is completed within a cell, the cell repairs the non-edited strand through cellular DNA repair and / or replication. 126. The method of embodiment 124, wherein the nucleotide change is a single nucleotide substitution, a deletion, an insertion, or a combination thereof. 127. The method of embodiment 124, wherein the single nucleotide substitution is a transition or a transversion. 128. The method of embodiment 124, wherein the single nucleotide substitution is (1) a G to T substitution, (2) a G to A substitution, (3) a G to C substitution, (4) a T to G substitution, (5) a T to A substitution, (6) a T to C substitution, (7) a C to G substitution, (8) a C to T substitution, (9) a C to A substitution, (10) an A to T substitution, (11) an A to G substitution, or (12) an A to C substitution. 129. The method of embodiment 124, wherein the single nucleotide substitution converts (1) a G:C basepair to a T:A basepair, (2) a G:C basepair to an A:T basepair, (3) a G:C basepair to C:G basepair, (4) a T:A basepair to a G:C basepair, (5) a T:A basepair to an A:T basepair, (6) a T:A basepair to a C:G basepair, (7) a C:G basepair to a G:C basepair, (8) a C:G basepair to a T:A basepair, (9) a C:G basepair to an A:T basepair, (10) an A:T basepair to a T:A basepair, (11) an A:T basepair to a G:C basepair, or (12) an A:T basepair to a C:G basepair. 130. The method of embodiment 124, wherein the nucleotide change is an insertion or deletion of 1,2, 3, 4, 5, 6, 7, 8, 9,10,11,12,13,14,15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. 131. The method of embodiment 124, wherein the nucleotide change is an insertion of a polypeptide-encoding sequence. 132. The method of embodiment 124, wherein the nucleotide change corrects a disease-associated gene. 133. The method of embodiment 132, wherein the disease-associated gene is associated with a monogenetic disorder selected from the group consisting of: Adenosine Deaminase (ADA) Deficiency; Alpha-1 Antitrypsin Deficiency; Cystic Fibrosis; Duchenne Muscular Dystrophy; Galactosemia; Hemochromatosis; Huntington’s Disease; Maple Syrup Urine Disease; Marfan Syndrome; Neurofibromatosis Type 1; Pachyonychia Congenita; Phenylkeotnuria; Severe Combined Immunodeficiency; Sickle Cell Disease; Smith-Lemli-Opitz Syndrome; and Tay-Sachs Disease. 134. The method of embodiment 132, wherein the disease-associated gene is associated with a polygenic disorder selected from the group consisting of: heart disease; high blood pressure; Alzheimer’s disease; arthritis; diabetes; cancer; and obesity. 135. A guide RNA for use in prime editing to alter the nucleotide sequence of a target DNA molecule with an insertion, deletion, inversion, substitution, or combination thereof to produce a corresponding edited DNA molecule, wherein: (i) the guide RNA is capable of forming a complex with a fusion protein comprising a napDNAbp and a domain comprising an RNA-dependent DNA polymerase activity; (ii) the guide RNA comprises (a) a spacer that is capable of annealing to the nonPAM strand proximal to an available PAM and protospacer on the PAM strand on the target DNA molecule, and (b) a gRNA core; (iii) the guide RNA further comprises an extension arm at the 5' or 3' end of the guide RNA; (iv) the extension arm comprises (a) a primer binding site and (b) a DNA synthesis template, wherein the DNA synthesis template codes for a single-strand DNA flap that includes an edit to be integrated in place of the endogenous strand immediately downstream of the cut site on the PAM strand; (v) the target DNA molecule is selected from the group consisting of SEQ ID NOs: SEQ ID NOs: 1217353-1289387; and (vi) the corresponding edited DNA molecule is selected from the group consisting of SEQ ID NOs: 1289388-1361420. 136. The guide RNA of embodiment 135, wherein the target DNA molecule is a Clinvar variant sequence. 137. The guide RNA of embodiment 135, wherein the napDNAbp is Cas9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, or Argonaute, or a variant of Cas9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, or Argonaute. 138. The guide RNA of embodiment 135, wherein the napDNAbp domain comprises nickase activity. 139. The guide RNA of embodiment 135, wherein the napDNAbp is a Cas9 or variant thereof. 140. The guide RNA of embodiment 135, wherein the napDNAbp is a nuclease active Cas9, a nuclease inactive Cas9 (dCas9), or a Cas9 nickase (nCas9). 141. The guide RNA of embodiment 135, wherein the napDNAbp is Cas9 nickase (nCas9). 142. The guide RNA of embodiment 135, wherein the napDNAbp comprises the amino acid 143. The guide RNA of embodiment 135, wherein the napDNAbp is SpCas9 wild type or a variant thereof of any one of amino acid sequences 1361421-1361428, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361421-1361428. 144. The guide RNA of embodiment 135, wherein the napDNAbp is an SpCas9 ortholog of any one of amino acid sequences 1361429-1361442, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361429-1361442. 145. The guide RNA of embodiment 135, wherein the napDNAbp is any one of amino acid sequences 1361421-1361484, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361421-1361484. 146. The guide RNA of embodiment 135, wherein the domain comprising an RNA-dependent DNA polymerase activity is a reverse transcriptase. 147. The guide RNA of embodiment 146, wherein the reverse transcriptase is a naturally occurring wild type reverse transcriptase having an amino acid sequence of any one of SEQ ID NOs: 1361485-1361496, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361485-1361496. 148. The guide RNA of embodiment 146, wherein the reverse transcriptase is a variant reverse transcriptase having an amino acid sequence of any one of SEQ ID NOs: 1361497-1361514, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361497-1361514. 149. The guide RNA of embodiment 135, wherein the fusion protein comprises an amino acid sequence of any one of SEQ ID NOs: 1361515-1361519, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361515-1361519. 150. The guide RNA of embodiment 135, wherein the fusion protein comprises an amino acid sequence of SEQ ID NO: 1361515 (PEI) or 1361516 (PE2), or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361515 or 1361516. 151. The guide RNA of embodiment 135, wherein the available PAM sequence is a function of the napDNAbp used in step (i). 152. The guide RNA of embodiment 135, wherein the available PAM sequence is selected from the group consisting of: (a) 5 -NGG-3' (the canonical PAM sequence), (b) 5'-NNG-3', (c) 5'-NNA-3 \ (d) 5'-NNC-3', (e) 5'-NNT-3', (f) 5 -NGT-3', (g) 5'-NGA-3', (h) 5'-NGC-3', (i) 5'-NAA-3', (j) 5'-NAC-3 ', (k) 5'-NAG-3', and (1) 5'-NAT-3', the selection of which is a function of the choice of napDNAbp. 153. The guide RNA of embodiment 135, wherein the edit site in any of the nucleotide sequences of SEQ ID NOs: 1217353-1289387 of step (v) begins at position 201 in the 5' to 3' orientation. 154. The guide RNA of embodiment 135, wherein the nucleotide change is a nucleotide substitution, a deletion, an insertion, or a combination thereof. 155. The guide RNA of embodiment 135, wherein the nucleotide substitution is a transition or a transversion. 156. The guide RNA of embodiment 135, wherein the single nucleotide substitution is (1) a G to T substitution, (2) a G to A substitution, (3) a G to C substitution, (4) a T to G substitution, (5) a T to A substitution, (6) a T to C substitution, (7) a C to G substitution, (8) a C to T substitution, (9) a C to A substitution, (10) an A to T substitution, (11) an A to G substitution, or (12) an A to C substitution. 157. The guide RNA of embodiment 135, wherein the single nucleotide substitution converts (1) a G:C basepair to a T:A basepair, (2) a G:C basepair to an A:T basepair, (3) a G:C basepair to C:G basepair, (4) a T:A basepair to a G:C basepair, (5) a T:A basepair to an A:T basepair, (6) a T:A basepair to a C:G basepair, (7) a C:G basepair to a G:C basepair, (8) a C:G basepair to a T:A basepair, (9) a C:G basepair to an A:T basepair, (10) an A:T basepair to a T:A basepair, (11) an A:T basepair to a G:C basepair, or (12) an A:T basepair to a C:G basepair. 158. The guide RNA of embodiment 135, wherein the desired nucleotide change is an insertion or deletion of 1, 2, 3,4, 5, 6,7, 8,9, 10, 11, 12, 13, 14, 15,16,17,18,19,20,21,22, 23,24, or 25 nucleotides. 159. The guide RNA of embodiment 135, wherein the nucleotide change is an insertion of a polypeptide-encoding sequence. 160. The guide RNA of embodiment 135, wherein the nucleotide change corrects a disease-associated gene. 161. The guide RNA of embodiment 160, wherein the disease-associated gene is associated with a monogenetic disorder selected from the group consisting of: Adenosine Deaminase (ADA) Deficiency; Alpha-1 Antitrypsin Deficiency; Cystic Fibrosis; Duchenne Muscular Dystrophy; Galactosemia; Hemochromatosis; Huntington’s Disease; Maple Syrup Urine Disease; Marfan Syndrome; Neurofibromatosis Type 1; Pachyonychia Congenita; Phenylkeotnuria; Severe Combined Immunodeficiency; Sickle Cell Disease; Smith-Lemli-Opitz Syndrome; and Tay-Sachs Disease. 162. The guide RNA of embodiment 160, wherein the disease-associated gene is associated with a polygenic disorder selected from the group consisting of: heart disease; high blood pressure; Alzheimer’s disease; arthritis; diabetes; cancer; and obesity. 163. A method for installing a nucleotide change in a nucleic acid sequence, the method comprising: contacting the nucleic acid sequence with a complex comprising a fusion protein and a guide RNA of any of embodiments 1-32 or 135-162. 164. The method of embodiment 163, wherein the fusion protein comprises a napDNAbp and an RNA-dependent DNA polymerase. 165. The method of embodiment 163, wherein the guide RNA comprises a spacer, gRNA core, and an extension arm that comprises a DNA synthesis template and primer binding site. 166. The method of embodiment 165, wherein the DNA synthesis template encodes a nucleotide change. 167. The method of any of embodiments 163-166, wherein the guide RNA is capable of binding to a napDNAbp suitable for prime editing and directing the napDNAbp to a target DNA sequence. 168. The method of embodiment 167, wherein the target nucleic acid sequence comprises a target strand (or PAM or edit strand) and a complementary non-target strand (or non-PAM or non-edit strand) wherein the spacer of the guide RNA hybridizes to the non-PAM strand to form an RNA-DNA hybrid and an R-loop. 169. The method of embodiment 165, wherein the primer binding site is between approximately 8 and approximately 20 nucleotides in length. 170. The method of embodiment 165, wherein the primer binding site is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. 171. The method of embodiment 165, wherein the extension arm is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length. 172. The method of embodiment 165, wherein the primer binding site is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides in length. 173. The method of embodiment 165, wherein the DNA synthesis template is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length. 174. The method of embodiment 165, wherein the DNA synthesis template can be used by an RNA-dependent DNA polymerase (e.g., reverse transcriptase) as a template for the synthesis of a corresponding single-strand DNA flap having a 3' end, wherein the DNA flap is complementary to a strand of the endogenous target DNA sequence adjacent to a nick site, and wherein the single-strand DNA flap comprises a desired nucleotide change encoded by the DNA synthesis template. 175. The method of embodiment 174, wherein the single-strand DNA flap displaces an endogenous single-strand DNA having a 5' end in the target DNA sequence that has been nicked. 176. The method of embodiment 175, wherein the endogenous single-strand DNA having the free 5' end is excised by the cell. 177. The method of embodiment 175, whereby cellular repair of the single-strand DNA flap results in installation of the nucleotide change, thereby forming an edited DNA product. 178.   The method of embodiment 177, wherein the nucleotide change is an insertion. 179.   The method of embodiment 178, wherein in the insertion is at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length. 180. The method of embodiment 178, wherein the insertion is a sequence encoding a polypeptide. REFERENCES

[0902] The following references are each incorporated herein by reference in their entireties. 1. Jinek, M. etal. A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 337, 816-821 (2012). 2. Cong, L. etal. Multiplex Genome Engineering Using CRISPR / Cas Systems. Science 339, 819-823 (2013). 3. Komor, A. C., Badran, A. H. & Liu, D. R. CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell 168,20-36 (2017). 4. Komor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. & Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420-424 (2016). 5. Nishida, K. et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353, aaf8729 (2016). 6. Gaudelli, N. M. et al. Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017). 7. Stenson, P. D. etal. The Human Gene Mutation Database: towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Hum. Genet. 136, 665-677 (2017). 8.     Dunbar, C. E. et al. Gene therapy comes of age. Science 359, eaan4672 (2018). 9.     Cox, D. B. T., Platt, R. J. & Zhang, F. Therapeutic genome editing: prospects and challenges. Nat. Med. 21,121-131 (2015). 10. Adli, M. The CRISPR tool kit for genome editing and beyond. Nat. Commun. 9, 1911 (2018). 11. Kleinstiver, B. P. etal. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 523, 481-485 (2015). 12. Kleinstiver, B. P. etal. High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature 529,490—495 (2016). 13. Hu, J. H. et aL Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature 556, 57-63 (2018). 14. Nishimasu, H. etal. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361, 1259-1262(2018). 15. Jasin, M. & Rothstein, R. Repair of strand breaks by homologous recombination. Cold Spring Harb. Perspect. Biol. 5, a012740 (2013). 16. Paquet, D. et al. Efficient introduction of specific homozygous and heterozygous mutations using CRISPR / Cas9. Nature 533,125-129 (2016). 17. Kosicki, M., Tomberg, K. & Bradley, A. Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements. Nat. Biotechnol. 36, 765— 771 (2018). 18. Haapaniemi, E., Botla, S., Persson, J., Schmierer, B. & Taipale, J. CRISPR-Cas9 genome editing induces a p53-mediated DNA damage response. Nat. Med. 24,927-930 (2018). 19. Ihry, R. J. etal. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells. Nat. Med. 24, 939-946 (2018). 20. Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L. & Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat. Biotechnol. 34,339-344 (2016). 21. Srivastava, M. etal. An Inhibitor of Nonhomologous End-Joining Abrogates DoubleStrand Break Repair and Impedes Cancer Progression. Cell 151,1474-1487 (2012). 22. Chu, V. T. et al. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat. Biotechnol. 33, 543-548 (2015). 23. Maruyama, T. etal. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat. Biotechnol. 33, 538-542 (2015). 24. Kim, Y. B. et al. Increasing the genome-targeting scope and precision of base editing with engineered Cas9-cytidine deaminase fusions. Nat. Biotechnol. 35, 371-376 (2017). 25. Li, X. et al. Base editing with a Cpfl-cytidine deaminase fusion. Nat. Biotechnol. 36, 324-327 (2018). 26. Gehrke, J. M. et al. An APOBEC3A-Cas9 base editor with minimized bystander and off-target activities. Nat. Biotechnol. (2018). doi:10.1038 / nbt.4199 27. Rees, H. A. & Liu, D. R. Base editing: precision chemistry on the genome and transcriptome of living cells. Nat. Rev. Genet. 1 (2018). doi: 10.1038 / s41576-018-0059-l. 28. Ostertag, E. M. & Kazazian Jr, H. H. Biology of Mammalian LI Retrotransposons. Annu. Rev. Genet. 35, 501-538 (2001). 29. Zimmerly, S., Guo, H., Perlman, P. S. & Lambowltz, A. M. Group II intron mobility occurs by target DNA- primed reverse transcription. Cell 82, 545-554 (1995). 30. Luan, D. D., Korman, M. H., Jakubczak, J. L. & Eickbush, T. H. Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition. Cell 72, 595-605 (1993). 31. Feng, Q., Moran, J. V., Kazazian, H. H. & Boeke, J. D. Human LI retrotransposon encodes a conserved endonuclease required for retrotransposition. Cell 87, 905-916 (1996). 32. Jinek, M. et al. Structures of Cas9 Endonucleases Reveal RNA-Mediated Conformational Activation. Science 343,1247997 (2014). 33. Jiang, F. et al. Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. Science aad8282 (2016). doi:10.1126 / science.aad8282 34. Qi, L. S. et al. Repurposing CRISPR as an RNA-Guided Platform for SequenceSpecific Control of Gene Expression. Cell 152,1173-1183 (2013). 35. Tang, W., Hu, J. H. & Liu, D. R. Aptazyme-embedded guide RNAs enable ligand-responsive genome editing and transcriptional activation. Nat. Commun. 8,15939 (2017). 36. Shechner, D. M., Hacisuleyman, E., Younger, S. T. & Rinn, J. L. Multiplexable, locusspecific targeting of long RNAs with CRISPR-Display. Nat. Methods 12, 664-670 (2015). 37. Anders, C. & Jinek, M. Chapter One - In Vitro Enzymology of Cas9. in Methods in Enzymology (eds. Doudna, J. A. & Sontheimer, E. J.) 546, 1-20 (Academic Press, 2014). 38. Briner, A. E. etal. Guide RNA Functional Modules Direct Cas9 Activity and Orthogonality. Mol. Cell 56, 333-339 (2014). 39. Nowak, C. M., Lawson, S., Zerez, M. & Bleris, L. Guide RNA engineering for versatile Cas9 functionality. Nucleic Acids Res. 44, 9555-9564 (2016). 40. Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C. & Doudna, J. A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62-67 (2014). 41. Mohr, S. etal. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing. RNA 19, 958-970 (2013). 42. Stamos, J. L., Lentzsch, A. M. & Lambowitz, A. M. Structure of a Thermostable Group II Intron Reverse Transcriptase with Template-Primer and Its Functional and Evolutionary Implications. Mol. Cell 68, 926- 939.e4 (2017). 43. Zhao, C. & Pyle, A. M. Crystal structures of a group II intron maturase reveal a missing link in spliceosome evolution. Nat. Struct. Mol. Biol. 23,558-565 (2016). 44. Zhao, C., Liu, F. & Pyle, A. M. An ultraprocessive, accurate reverse transcriptase encoded by a metazoan group II intron. RNA 24,183-195 (2018). 45. Ran, F. A. etal. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281-2308 (2013). 46. Liu, Y., Kao, H.-I. & Bambara, R. A. Flap endonuclease 1: a central component of DNA metabolism. Annu. Rev. Biochem. 73,589-615 (2004). 47. Krokan, H. E. & Bjpras, M. Base Excision Repair. Cold Spring Harb. Perspect. Biol. 5, (2013). 48. Kelman, Z. PCNA: structure, functions and interactions. Oncogene 14,629-640 (1997). 49. Choe, K. N. & Moldovan, G.-L. Forging Ahead through Darkness: PCNA, Still the Principal Conductor at the Replication Fork. Mol. Cell 65, 380-392 (2017). 50. Li, X., Li, J., Harrington, J., Lieber, M. R. & Burgers, P. M. Lagging strand DNA synthesis at the eukaryotic replication fork involves binding and stimulation of FEN-1 by proliferating cell nuclear antigen. J. Biol. Chem. 270,22109-22112 (1995). 51. Tom, S., Henricksen, L. A. & Bambara, R. A. Mechanism whereby proliferating cell nuclear antigen stimulates flap endonuclease 1. J. Biol. Chem. 275,10498-10505 (2000). 52. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S. & Vale, R. D. A proteintagging system for signal amplification in gene expression and fluorescence imaging. Cell 159, 635-646 (2014). 53. Bertrand, E. et al. Localization of ASH1 mRNA particles in living yeast. Mol. Cell 2, 437-445 (1998). 54. Dahlman, J. E. etal. Orthogonal gene knockout and activation with a catalytically active Cas9 nuclease. Nat. Biotechnol. 33,1159-1161 (2015). 55. Tsai, S. Q. etal. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat. Biotechnol. 33,187-197 (2015). 56. Tsai, S. Q. et al. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off-targets. Nat. Methods 14, 607-614 (2017). EQUIVALENTS AND SCOPE

[0903] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0904] Furthermore, the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is / are referred to as comprising particular elements and / or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and / or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0905] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.

[0906] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.

Claims

1. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs: 1135514, or a sequence having at least 90% sequence identity with any of SEQ ID NOs: 1135514.

2. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the spacer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 - 271028, or a spacer having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 135515 - 271028.

3. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 271029 - 406542, or an extension arm having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 271029 - 406542.

4. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises (i) a primer binding site, (ii) an edit template, and (iii) a homology arm.

5. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises an primer binding site having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 406543 - 542056, or a primer binding site having a nucleotide sequence that is at least 90% sequence identical to any of SEQ ID NOs: 406543 - 542056.

6. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises an edit template comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 542057 - 677570, or an edit template havinga nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 542057 -677570.

7. A guide RNA comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises a homology arm having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 677571 - 813084, or a homology arm having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 677571 -813084.

8. A guide RNA comprising:(i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 - 271028, or a spacer having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 135515 - 271028, and(ii) an extension arm selected from the group consisting of SEQ ID NOs: 271029 -406542, or an extension arm having a nucleotide sequence having least 90% sequence identity with SEQ ID NOs: 271029 - 406542.

9. A guide RNA comprising:(i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 -271028, ora spacer having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 135515 - 271028, and(ii) a primer binding site selected from the group consisting of SEQ ID NOs: 406543 - 542056, or a primer binding site having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 406543 - 542056.

10. A guide RNA comprising:(i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 - 271028, or a spacer having a nucleotide sequence having at least 90% sequence identity with any of SEQ ID NOs: 135515 - 271028, and(ii) an edit template having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 542057 - 677570, or an edit template having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 542057 - 677570.

11. A guide RNA comprising:(i) a spacer having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 135515 -271028, ora spacer having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 135515 - 271028, and(ii) a homology arm having a nucleotide sequence selected from the group consisting of SEQ ID NOs: 677571 - 813084, or a spacer having a nucleotide sequence that is at least 90% identical to any of SEQ ID NOs: 677571 - 813084.

12. The guide RNA of any of the above claims further comprising an termination signal ofSEQ ID NO: 813086, or a termination signal having at least 90% sequence identity with SEQ ID NO: 813086.

13. The guide RNA of any of the above claims further comprising a 5' end modifier regioncomprising a hairpin sequence, a stem / loop sequence, or a toeloop sequence.

14. The guide RNA of any of the above claims further comprising a 3' end modifier regioncomprising a hairpin sequence, a stem / loop sequence, or a toeloop sequence.

15. The guide RNA of any of the above claims further comprising a gRNA core comprisingSEQ ID NO: 813085, or a gRNA core having at least 90% sequence identity with SEQ ID NO: 813085.

16. The guide RNA of any of the above claims, wherein the guide RNA is capable of bindingto a napDNAbp suitable for prime editing and directing the napDNAbp to a target DNA sequence.

17. The guide RNA of claim 16, wherein the target nucleic acid sequence comprises a target strand (or PAM strand) and a complementary non-target strand (or non-PAM strand), wherein the spacer of the guide RNA hybridizes to the complementary non-target strand (non-PAM strand) to form an RNA-DNA hybrid and an R-loop.

18. The guide RNA of any of the above claims, wherein the primer binding site is betweenapproximately 8 and approximately 20 nucleotides in length.

19. The guide RNA of any of the above claims, wherein the primer binding site is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,19, or 20 nucleotides in length.

20. The guide RNA of any of the above claims, wherein the primer binding site is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides in length.

21. The guide RNA of any of the above claims, wherein the homology arm is complementary to a strand of the target DNA.

22. The guide RNA of any of the above claims, wherein the extension arm is between approximately 7 and approximately 500 nucleotides in length.

23. The guide RNA of any of the above claims, wherein the extension arm is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, or at least 100 nucleotides in length.

24. The guide RNA of any of the above claims, wherein the edit template is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides or, at least 100 nucleotides in length.

25. The guide RNA of any of the above claims, wherein the homology arm is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, or at least 30 nucleotides.

26. The guide RNA of any of the above claims, wherein the edit template and homology arm can be used by a reverse transcriptase as a template sequence for the synthesis of a corresponding single-strand DNA flap having a 3' end, wherein the DNA flap is complementary to a strand of the endogenous target DNA sequence adjacent to a nick site, and wherein the single-strand DNA flap comprises a nucleotide change encoded by the edit template.

27. The guide RNA of claim 26, wherein the single-strand DNA flap displaces an endogenous single-strand DNA having a 5' end in the target DNA sequence that has been nicked.

28. The guide RNA of claim 27, wherein the endogenous single-strand DNA having the free 5' end is excised by the cell.

29. The guide RNA of claim 27, whereby cellular repair of the single-strand DNA flap results in installation of the nucleotide change, thereby forming a desired product.

30. The guide RNA of claim 29, wherein the desired nucleotide change is an insertion.

31. The guide RNA of claim 30, wherein in the insertion is at least 1 nucleotide, at least 2nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, or at least 100 nucleotides in length.

32. The guide RNA of claim 30, wherein the insertion is a sequence encoding a polypeptide.

33. A prime editing complex comprising a napDNAbp, a reverse transcriptase, and any oneof the guide RNAs of claims 1-32.

34. The prime editing complex of claim 33, wherein the napDNAbp and the reverse transcriptase are formed as a fusion protein.

35. The prime editing complex of claim 33, wherein the napDNAbp is a Cas9.

36. The prime editing complex of claim 35, wherein the Cas9 is selected from the groupconsisting of Cas9 nickases or variants thereof.

37. The prime edting complex of claim 35, wherein the Cas9 has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514.

38. The prime editing complex of claim 34, wherein the fusion protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514.

39. The prime editing complex of claim 34, wherein the fusion protein comprises a linker joining the napDNAbp and reverse transcriptase.

40. The prime editing complex of claim 39, wherein the linker has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514.

41. One or more polynucleotides encoding the prime editing complex of any of claims 33-40.

42. A vector comprising the polynucleotide of claim 41 and one or more promoters that drive the expression of the guide RNA and the fusion protein of the prime editing complex.

43. A cell comprising the a vector of claim 42.

44. A cell comprising a prime editing complex of any of claims 33-40.

45. A pharmaceutical composition comprising: (i) a guide RNA of any of claims 1-32, aprime editing complex of claims 33-40, a polynucleotide of claim 41, or a vector of claim 42; and (ii) a pharmaceutically acceptable excipient.

46. A method for installing a nucleotide change in a nucleic acid sequence, the method comprising: contacting the nucleic acid sequence with a complex comprising a fusion protein and a guide RNA of any of claims 1-32 or any of claims 56-81, wherein the fusion protein comprises a napDNAbp and a polymerase, and wherein the guide RNA comprises a spacer, gRNA core, and an extension arm that comprises an edit template encoding a nucleotide change; thereby(i) nicking the double-stranded DNA sequence on the target strand (or the PAM strand), and generating a free single-strand DNA having a 3' end;(ii) hybridizing the 3' end of the free single-strand DNA to the guide RNA at the primer binding site, thereby priming the polymerase;(iii) polymerizing a strand of DNA from the 3' end, thereby generating a single-strand DNA flap comprising the nucleotide change; and(iv) replacing the endogenous DNA strand immediately adjacent downstream of the cut site on the target strand (or PAM strand) with the single-strand DNA flap,thereby installing the desired nucleotide change in the double-stranded DNA sequence.

47. The method of claim 46, wherein the nucleotide change is a single nucleotide substitution, a deletion, an insertion, or a combination thereof.

48. The method of claim 46, wherein the single nucleotide substitution is a transition or a transversion.

49. The method of claim 46, wherein the nucleotide change is (1) a G to T substitution, (2) a G to A substitution, (3) a G to C substitution, (4) a T to G substitution, (5) a T to A substitution, (6) a T to C substitution, (7) a C to G substitution, (8) a C to T substitution, (9) a C to A substitution, (10) an A to T substitution, (11) an A to G substitution, or (12) an A to C substitution.

50. The method of claim 46, wherein the nucleoid change converts (1) a G:C basepair to a T:A basepair, (2) a G:C basepair to an A:T basepair, (3) a G:C basepair to C:G basepair, (4) a T:A basepair to a G:C basepair, (5) a T:A basepair to an A:T basepair, (6) a T:A basepair to a C:G basepair, (7) a C:G basepair to a G:C basepair, (8) a C:G basepair to a T:A basepair, (9) a C:G basepair to an A:T basepair, (10) an A:T basepair to a T:A basepair, (11) an A:T basepair to a G:C basepair, or (12) an A:T basepair to a C:G basepair.

51. The method of claim 46, wherein the nucleotide change is an insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9,10,11,12,13,14,15,16,17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

52. The method of claim 46, wherein the nucleotide change is an insertion of a polypeptide-encoding sequence.

53. The method of claim 46, wherein the nucleotide change corrects a disease-associated gene.

54. The method of claim 46, wherein the disease-associated gene is associated with a monogentic disorder selected from the group consisting of: Adenosine Deaminase (ADA)Deficiency; Alpha-1 Antitrypsin Deficiency; Cystic Fibrosis; Duchenne Muscular Dystrophy; Galactosemia; Hemochromatosis; Huntington’s Disease; Maple Syrup Urine Disease; Marfan Syndrome; Neurofibromatosis Type 1; Pachyonychia Congenita;Phenylkeotnuria; Severe Combined Immunodeficiency; Sickle Cell Disease; Smith-Lemli-Opitz Syndrome; and Tay-Sachs Disease.

55. The method of claim 46, wherein the disease-associated gene is associated with a polygenic disorder selected from the group consisting of: cardiac disease; high blood pressure; neurological disease; autoimmune disorder, arthritis; diabetes; cancer; and obesity.

56. A guide RNA for use in prime editing to correct a disease allele at an edit site in a target DNA sequence to form a healthy allele, said guide comprising a spacer, a gRNA core, and an extension arm, wherein the spacer is capable of binding to a -20 nucleotide region within SEQ ID NOs: 1217353-1289387 or the complement strand thereof.

57. A guide RNA comprising a spacer, gRNA core, and an extension arm, wherein the extension arm comprises a DNA synthesis template and a primer binding site effective to conduct prime editing.

58. The guide RNA of claim 56, wherein the edit site in any of the nucleotide sequences of SEQ ID NOs: 1217353-1289387 begins at position 201 in the 5' to 3' orientation.

59. A guide RNA for prime editing comprising a spacer, a gRNA core, and an extension arm, wherein the extension arm comprises a primer binding site and a DNA synthesis template.

60. The guide RNA of claim 59, wherein the primer binding site has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 406543 - 542056 (primer binding site), or a nucleotide sequence that has at least 90% sequence identity with any of SEQ ID NOs: 406543 - 542056.

61. The guide RNA of claim 59, wherein the DNA synthesis template comprises a nucleotide sequence of SEQ ID NOs: 542057 - 677570 (edit template), or a nucleotide sequence that has at least 90% sequence identity with any of SEQ ID NOs: 542057 - 677570.

62. The guide RNA of claim 59, wherein the DNA synthesis template comprises a nucleotide sequence of SEQ ID NOs: 677571 - 813084 (homology arm), or a nucleotide sequence that has at least 90% sequence identity with any of SEQ ID NOs: 677571 - 813084.

63. The guide RNA of claim 59, wherein the DNA synthesis template comprises an edit template and a homology arm, wherein the edit template comprises a nucleotide sequence of SEQ ID NOs: 542057 - 677570, and the homology arm comprises a nucleotide sequence of SEQ ID NOs: 677571 - 813084.

64. The guide RNA of any of claims 56-63 further comprising an termination signal of SEQ ID NO: 813086, or a termination signal having at least 90% sequence identity with SEQ ID NO: 813086.

65. The guide RNA of any of claims 56-64 further comprising a 5' end modifier region comprising a hairpin sequence, stem / loop sequence, or a toeloop sequence.

66. The guide RNA of any of claims 56-65 further comprising a 3' end modifier region comprising a hairpin sequence, stem / loop sequence, or a toeloop sequence.

67. The guide RNA of any of claims 56-66, further comprising a gRNA core comprisingSEQ ID NO: 813085, or a gRNA core having at least 90% sequence identity with SEQ ID NO: 813085.

68. The guide RNA of any of claims 56-67, wherein the guide RNA is capable of binding to a napDNAbp suitable for prime editing and directing the napDNAbp to a target DNA sequence.

69. The guide RNA of claim 68, wherein the target nucleic acid sequence comprises a target strand (or PAM or edit strand) and a complementary non-target strand (or non-PAM or non-edit strand) wherein the spacer of the guide RNA hybridizes to the non-PAM strand to form an RNA-DNA hybrid and an R-loop.

70. The guide RNA of any of claims 56-69, wherein the primer binding site is between approximately 8 and approximately 20 nucleotides in length.

71. The guide RNA of any of claims 56-70, wherein the primer binding site is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.

72. The guide RNA of any of claims 56-71, wherein the extension arm is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length.

73. The guide RNA of any of claims 56-72, wherein the primer binding site is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides in length.

74. The guide RNA of any of claims 56-73, wherein the DNA synthesis template is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length.

75. The guide RNA of any of claims 56-74, wherein the DNA synthesis template can be used by an RNA-dependent DNA polymerase (e.g., reverse transcriptase) as a template for the synthesis of a corresponding single-strand DNA flap having a 3' end, wherein the DNA flap is complementary to a strand of the endogenous target DNA sequence adjacent to a nick site, and wherein the single-strand DNA flap comprises a desired nucleotide change encoded by the DNA synthesis template.

76. The guide RNA of claim 75, wherein the single-strand DNA flap displaces an endogenous single-strand DNA having a 5' end in the target DNA sequence that has been nicked.

77. The guide RNA of claim 76, wherein the endogenous single-strand DNA having the free 5' end is excised by the cell.

78. The guide RNA of claim 77, whereby cellular repair of the single-strand DNA flap results in installation of the nucleotide change, thereby forming an edited DNA product.

79. The guide RNA of claim 78, wherein the nucleotide change is an insertion.

80. The guide RNA of claim 79, wherein in the insertion is at least 1 nucleotide, at least 2nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least36 nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length.

81. The guide RNA of claim 79, wherein the insertion is a sequence encoding a polypeptide.

82. A prime editing complex comprising a napDNAbp, an RNA-dependent DNApolymerase, and any one of the guide RNA of claims 56-81.

83. The prime editing complex of claim 82, wherein the napDNAbp and the RNA-dependent DNA polymerase are formed as a fusion protein.

84. The prime editing complex of claim 82, wherein the napDNAbp is a Cas9.

85. The prime editing complex of claim 84, wherein the Cas9 is a Cas9 nickase or variantthereof.

86. The prime editing complex of claim 84, wherein the Cas9 has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514.

87. The prime editing complex of claim 83, wherein the fusion protein has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514.

88. The prime editing complex of claim 83, wherein the fusion protein comprises a linker joining the napDNAbp and RNA-dependent DNA polymerase.

89. The prime editing complex of claim 88, wherein the linker has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-135514.

90. One or more polynucleotides encoding the prime editing complex of any of claims 82-89.

91. A vector comprising the polynucleotide of claim 90 and one or more promoters that drive the expression of the guide RNA and the fusion protein of the prime editing complex.

92. A cell comprising the vector of claim 91.

93. A cell comprising a prime editing complex of any of claims 82-89.

94. A pharmaceutical composition comprising: (i) a guide RNA of any of claims 56-81, a prime editing complex of claims 82-89, a polynucleotide of claim 90, or a vector of claim 91; and (ii) a pharmaceutically acceptable excipient.

95. A method for installing a nucleotide change in a nucleic acid sequence, the method comprising: contacting the nucleic acid sequence with a complex comprising a fusion protein and a guide RNA of any of claims 56-81, wherein the fusion protein comprises a napDNAbp and an RNA-dependent DNA polymerase, wherein the guide RNA comprises a spacer, gRNA core, and an extension arm that comprises a DNA synthesis template and primer binding site, said DNA synthesis template encoding a nucleotide change, and wherein the spacer is capable of annealing to the non-PAM strand proximal to an available PAM and proto spacer; thereby(i) nicking the double-stranded DNA sequence on the PAM strand, thereby generating a free single-strand DNA having a 3' end;(ii)    hybridizing the 3' end of the free single-strand DNA to the guide RNA at theprimer binding site, thereby priming the RNA-dependent DNA polymerase;(iii) polymerizing a strand of DNA from the 3' end of DNA, coding from the DNA synthesis template, thereby generating a single-strand DNA flap extended from the 3' end of the DNA, wherein the flap comprises the nucleotide change;(iv) replacing an endogenous DNA strand adjacent immediately downstream of the cut site on the PAM strand with the single-strand DNA flap, thereby installing the nucleotide change in the double-stranded DNA sequence.

96. The method of claim 95, wherein when step (v) is completed within a cell, the cell repairs the non-edited strand through cellular DNA repair and / or replication.

97. The method of claim 95, wherein the nucleotide change is a single nucleotide substitution, a deletion, an insertion, or a combination thereof.

98. The method of claim 97, wherein the single nucleotide substitution is a transition or a transversion.

99. The method of claim 97, wherein the single nucleotide substitution is (1) a G to T substitution, (2) a G to A substitution, (3) a G to C substitution, (4) a T to G substitution, (5) a T to A substitution, (6) a T to C substitution, (7) a C to G substitution, (8) a C to T substitution, (9) a C to A substitution, (10) an A to T substitution, (11) an A to G substitution, or (12) an A to C substitution.

100. The method of claim 97, wherein the single nucleotide substitution converts (1) a G:C basepair to a T:A basepair, (2) a G:C basepair to an A:T basepair, (3) a G:C basepair to C:G basepair, (4) a T:A basepair to a G:C basepair, (5) a T:A basepair to an A:T basepair, (6) a T:A basepair to a C:G basepair, (7) a C:G basepair to a G:C basepair, (8) a C:G basepair to a T:A basepair, (9) a C:G basepair to an A:T basepair, (10) an A:T basepair to a T:A basepair, (11) an A:T basepair to a G:C basepair, or (12) an A:T basepair to a C:G basepair.

101. The method of claim 97, wherein the nucleotide change is an insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9,10,11,12,13,14,15,16,17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

102. The method of claim 97, wherein the nucleotide change is an insertion of a polypeptide-encoding sequence.

103. The method of claim 97, wherein the nucleotide change corrects a disease-associated gene.

104. The method of claim 103 wherein the disease-associated gene is associated with a monogenetic disorder selected from the group consisting of: Adenosine Deaminase (ADA) Deficiency; Alpha-1 Antitrypsin Deficiency; Cystic Fibrosis; Duchenne Muscular Dystrophy; Galactosemia; Hemochromatosis; Huntington’s Disease; Maple Syrup Urine Disease; Marfan Syndrome; Neurofibromatosis Type 1; Pachyonychia Congenita; Phenylkeotnuria; Severe Combined Immunodeficiency; Sickle Cell Disease; Smith-Lemli-Opitz Syndrome; and Tay-Sachs Disease.

105. The method of claim 103, wherein the disease-associated gene is associated with a polygenic disorder selected from the group consisting of: heart disease; high blood pressure; Alzheimer’s disease; arthritis; diabetes; cancer; and obesity.

106. A guide RNA for use in prime editing to alter the nucleotide sequence of a target DNA molecule with an insertion, deletion, inversion, substitution, or combination thereof to produce a corresponding edited DNA molecule, wherein:(i) the guide RNA is capable of forming a complex with a fusion protein comprising a napDNAbp and a domain comprising an RNA-dependent DNA polymerase activity;(ii) the guide RNA comprises (a) a spacer that is capable of annealing to the nonPAM strand proximal to an available PAM and protospacer on the PAM strand on the target DNA molecule, and (b) a gRNA core;(iii) the guide RNA further comprises an extension arm at the 5' or 3' end of the guide RNA;(iv) the extension arm comprises (a) a primer binding site and (b) a DNA synthesis template, wherein the DNA synthesis template codes for a single-strand DNA flap that includes an edit to be integrated in place of the endogenous strand immediately downstream of the cut site on the PAM strand;(v) the target DNA molecule is selected from the group consisting of SEQ ID NOs: SEQ ID NOs: 1217353-1289387; and(vi) the corresponding edited DNA molecule is selected from the group consisting of SEQ ID NOs: 1289388-1361420.

107. The guide RNA of claim 106, wherein the target DNA molecule is a Clinvar variant sequence.

108. The guide RNA of claim 106, wherein the napDNAbp is Cas9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, or Argonaute, or a variant of Cas9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, or Argonaute.

109. The guide RNA of claim 106, wherein the napDNAbp domain comprises nickase activity.

110. The guide RNA of claim 106, wherein the napDNAbp is a Cas9 or variant thereof.

111. The guide RNA of claim 106, wherein the napDNAbp is a nuclease active Cas9, anuclease inactive Cas9 (dCas9), or a Cas9 nickase (nCas9).

112. The guide RNA of claim 106, wherein the napDNAbp is Cas9 nickase (nCas9).

113. The guide RNA of claim 106, wherein the napDNAbp comprises the amino acid114.  The guide RNA of claim 106, wherein the napDNAbp is SpCas9 wild type or a variantthereof of any one of amino acid sequences 1361421-1361428, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361421-1361428.

115. The guide RNA of claim 106, wherein the napDNAbp is an SpCas9 ortholog of any one of amino acid sequences 1361429-1361442, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361429-1361442.

116. The guide RNA of claim 106, wherein the napDNAbp is any one of amino acid sequences 1361421-1361484, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361421-1361484.

117. The guide RNA of claim 106, wherein the domain comprising an RNA-dependent DNA polymerase activity is a reverse transcriptase.

118. The guide RNA of claim 117, wherein the reverse transcriptase is a naturally occurring wild type reverse transcriptase having an amino acid sequence of any one of SEQ ID NOs: 1361485-1361496, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361485-1361496.

119. The guide RNA of claim 117, wherein the reverse transcriptase is a variant reverse transcriptase having an amino acid sequence of any one of SEQ ID NOs: 1361497-1361514, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361497-1361514.

120. The guide RNA of claim 106, wherein the fusion protein comprises an amino acid sequence of any one of SEQ ID NOs: 1361515-1361519, or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361515-1361519.

121. The guide RNA of claim 106, wherein the fusion protein comprises an amino acid sequence of SEQ ID NO: 1361515 (PEI) or 1361516 (PE2), or an amino acid sequence having at least 80% sequence identity with any of SEQ ID NOs: 1361515 or 1361516.

122. The guide RNA of claim 106, wherein the available PAM sequence is a function of the napDNAbp used in step (i).

123. The guide RNA of claim 106, wherein the available PAM sequence is selected from the group consisting of: (a) 5 -NGG-3' (the canonical PAM sequence), (b) 5'-NNG-3', (c) SENNAS', (d) 5'-NNC-3', (e) 5'-NNT-3', (f) 5 -NGT-3', (g) 5'-NGA-3', (h) 5'-NGC-3', (i) 5'-NAA-3', (j) 5'-NAC-3', (k) 5'-NAG-3', and (1) 5'-NAT-3', the selection of which is a function of the choice of napDNAbp.

124. The guide RNA of claim 106, wherein the edit site in any of the nucleotide sequences of SEQ ID NOs: 1217353-1289387 of step (v) begins at position 201 in the 5' to 3' orientation.

125. The guide RNA of claim 106, wherein the nucleotide change is a nucleotide substitution, a deletion, an insertion, or a combination thereof.

126. The guide RNA of claim 106, wherein the nucleotide substitution is a transition or a transversion.

127. The guide RNA of claim 106, wherein the single nucleotide substitution is (1) a G to T substitution, (2) a G to A substitution, (3) a G to C substitution, (4) a T to G substitution, (5) a T to A substitution, (6) a T to C substitution, (7) a C to G substitution, (8) a C to T substitution, (9)a C to A substitution, (10) an A to T substitution, (11) an A to G substitution, or (12) an A to C substitution.

128. The guide RNA of claim 106, wherein the single nucleotide substitution converts (1) a G:C basepair to a T:A basepair, (2) a G:C basepair to an A:T basepair, (3) a G:C basepair to C:G basepair, (4) a T:A basepair to a G:C basepair, (5) a T:A basepair to an A:T basepair, (6) a T:A basepair to a C:G basepair, (7) a C:G basepair to a G:C basepair, (8) a C:G basepair to a T:A basepair, (9) a C:G basepair to an A:T basepair, (10) an A:T basepair to a T:A basepair, (11) an A:T basepair to a G:C basepair, or (12) an A:T basepair to a C:G basepair.

129. The guide RNA of claim 106, wherein the desired nucleotide change is an insertion or deletion of 1,2, 3, 4, 5, 6, 7, 8, 9, 10,11,12,13,14,15,16,17,18,19, 20, 21, 22, 23, 24, or 25 nucleotides.

130. The guide RNA of claim 106, wherein the nucleotide change is an insertion of a polypeptide-encoding sequence.

131. The guide RNA of claim 106, wherein the nucleotide change corrects a disease-associated gene.

132. The guide RNA of claim 131, wherein the disease-associated gene is associated with a monogenetic disorder selected from the group consisting of: Adenosine Deaminase (ADA) Deficiency; Alpha-1 Antitrypsin Deficiency; Cystic Fibrosis; Duchenne Muscular Dystrophy; Galactosemia; Hemochromatosis; Huntington’s Disease; Maple Syrup Urine Disease; Marfan Syndrome; Neurofibromatosis Type 1; Pachyonychia Congenita; Phenylkeotnuria; Severe Combined Immunodeficiency; Sickle Cell Disease; Smith-Lemli-Opitz Syndrome; and Tay-Sachs Disease.

133. The guide RNA of claim 131, wherein the disease-associated gene is associated with a polygenic disorder selected from the group consisting of: heart disease; high blood pressure; Alzheimer’s disease; arthritis; diabetes; cancer; and obesity.

134. A method for installing a nucleotide change in a nucleic acid sequence, the method comprising: contacting the nucleic acid sequence with a complex comprising a fusion protein and a guide RNA of any of claims 56-81.

135. The method of claim 134, wherein the fusion protein comprises a napDNAbp and an RNA-dependent DNA polymerase.

136. The method of claim 134, wherein the guide RNA comprises a spacer, gRNA core, and an extension arm that comprises a DNA synthesis template and primer binding site.

137. The method of claim 136, wherein the DNA synthesis template encodes a nucleotide change.

138. The method of any of claims 134-137, wherein the guide RNA is capable of binding to a napDNAbp suitable for prime editing and directing the napDNAbp to a target DNA sequence.

139. The method of claim 138, wherein the target nucleic acid sequence comprises a target strand (or PAM or edit strand) and a complementary non-target strand (or non-PAM or non-edit strand) wherein the spacer of the guide RNA hybridizes to the non-PAM strand to form an RNA-DNA hybrid and an R-loop.

140. The method of claim 136, wherein the primer binding site is between approximately 8 and approximately 20 nucleotides in length.

141. The method of claim 136, wherein the primer binding site is 8, 9, 10, 11, 12, 13, 14, 15, 16,17,18, 19, or 20 nucleotides in length.

142. The method of claim 136, wherein the extension arm is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides, at least 36nucleotides, at least 37 nucleotides, at least 38 nucleotides, at least 39 nucleotides, at least 40nucleotides, at least 100 nucleotides in length.

143. The method of claim 136, wherein the primer binding site is at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides in length.

144. The method of claim 136, wherein the DNA synthesis template is at least 1 nucleotides, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length.

145. The method of claim 136, wherein the DNA synthesis template can be used by an RNA-dependent DNA polymerase (e.g., reverse transcriptase) as a template for the synthesis of a corresponding single-strand DNA flap having a 3' end, wherein the DNA flap is complementary to a strand of the endogenous target DNA sequence adjacent to a nick site, and wherein the single-strand DNA flap comprises a desired nucleotide change encoded by the DNA synthesis template.

146. The method of claim 145, wherein the single-strand DNA flap displaces an endogenous single-strand DNA having a 5' end in the target DNA sequence that has been nicked.

147. The method of claim 146, wherein the endogenous single-strand DNA having the free 5" end is excised by the cell.

148. The method of claim 145, whereby cellular repair of the single-strand DNA flap results in installation of the nucleotide change, thereby forming an edited DNA product.

149. The method of claim 148, wherein the nucleotide change is an insertion.

150. The method of claim 149, wherein in the insertion is at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34nucleotides, at least 35 nucleotides, at least 36 nucleotides, at least 37 nucleotides, at least 38nucleotides, at least 39 nucleotides, at least 40 nucleotides, at least 100 nucleotides in length.

151. The method of claim 149, wherein the insertion is a sequence encoding a polypeptide.

Images