Gene-editing systems for modifying a SCN9A or SCN10A gene and methods of use thereof
Patent Information
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- VERTEX PHARMACEUTICALS INC
- Filing Date
- 2020-04-10
- Publication Date
- 2026-08-06
AI Technical Summary
Current gene editing strategies using RNA-guided endonucleases do not achieve high efficiency in modifying specific genes, such as SCN9A and SCN10A, due to variable effectiveness of RNA-guided endonuclease and guide RNA pairs, leading to off-target occurrences.
Development of gene editing systems comprising specific pairs of RNA-guided endonucleases like SpCas9 and SaCas9 paired with guide RNAs, optimized to efficiently modify SCN9A and SCN10A genes with low off-target effects, utilizing nucleotide sequences and scaffold sequences to enhance targeting specificity.
The gene editing systems achieve high editing rates, with indel rates exceeding 20% and high cell survival rates, effectively modifying voltage-gated sodium channel genes with reduced off-target occurrences, potentially treating pain-related disorders.
Smart Images

Figure 00000001_0000 
Figure 00000080_0000 
Figure 00000080_0001
Abstract
Description
GENE-EDITING SYSTEMS FOR MODIFYING A SCN9A OR SCN10A GENE AND METHODS OF USE THEREOF RELATED APPLICATION This application claims the benefit under 35 U.S.C. § 119(e) of U.S. provisional application number 62 / 833,523, filed April 12, 2019, the entire contents of which are incorporated herein by reference. BACKGROUND Gene editing (including genomic editing) is a type of genetic engineering in which nucleotide(s) / nucleic acid(s) is / are inserted, deleted, and / or substituted in a DNA sequence, such as in the genome of a targeted cell. Recent gene editing strategies which utilize RNA-guided endonucleases, such as Cas9, enable site-specific DNA modification; however, it has been found that not all RNA-guided endonuclease, gnide RNA pairs edit with high efficiency. Therefore, there still remains a critical need for identifying effective RNA-gnided endonuclease, guide RNA pairs that effectively modify a gene of interest. SUMMARY The present disclosure is based, at least in part, on the development of efficient gene editing systems for modifying a voltage-gated sodium channel gene, such as sodium voltage- gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCNI0A). In some embodiments, the gene editing system relies on the identification of pairs of effective RNA-gunided endonuclease and guide RNAs (e.g., those disclosed herein) for effective modification of a voltage-gated sodium channel gene with low off target occurrence. As such, in some aspects, the disclosure relates to gene-editing systems for modifying a voltage-gated sodium channel gene, such as SCN9A or SCN10A. Such a gene-editing system may comprise: (a) a first polynucleotide moiety, which comprises a first nucleotide sequence encoding a RNA-guided DNA endonuclease, or the RNA-guided DNA endonuclease; and (b) a second polynucleotide moiety, which comprises a second nucleotide sequence encoding a guide RNA (gRNA). In some embodiments, the gene-editing system may modify a SCN9A gene and comprise: (a) a first polynucleotide moiety, which comprises a first nucleotide sequence encoding a RNA- guided DNA endonuclease, or the RNA-guided DNA endonuclease; and (b) a second polynucleotide moiety, which comprises a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 1- 20. A polynucleotide moiety as used herein can be an independent nucleic acid molecule. Alternatively, a polynucleotide moiety can be a portion of a nucleic acid molecule, which may contain one or more additional polynucleotide moieties. A RNA-guided endonuclease of such a gene-editing system may be Staphylococcus pyogenes (SpCas9), which may be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1-10. Alternatively or in addition, a RNA-guided endonuclease of such a gene-editing system may be Staphylococcus aureus Cas9 (SaCas9), which may be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 11-20. In some embodiments, the gene-editing system may modify a SCNI0A gene and comprise: (a) a first polynucleotide moiety, which comprises a first nucleotide sequence encoding a RNA-guided DNA endonuclease, or the RNA-guided DNA endonuclease; and (b) a second polynucleotide moiety, which comprises a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 21-40. A RNA-guided endonuclease of such a gene-editing system may be SpCas9, which may be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 21- 30. Alternatively or in addition, a RNA-guided endonuclease of such a gene-editing system may be SaCas9, which may be paired with a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 31-40. In some embodiments, the first nucleotide sequence encoding the RNA-guided DNA endonuclease in (a) may further comprise a nucleotide sequence encoding a nuclear localization signal (NLS), which is fused in-frame with the RNA-guided DNA endonuclease. In some embodiments, the NLS is a SV40Q NLS. In some embodiments, the second nucleotide sequence in (b) may further comprise a scaffold sequence. In some examples, the scaffold sequence may be recognizable by SaCas9. Such a scaffold sequence may comprise the nucleotide sequence of GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUA UCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). In other examples, the scaffold sequence may be recognizable by SpCas9. It should be understood that because the second nucleotide sequence encoding the gRNA can be either a DNA sequence or a RNA sequence, any of the uracils (U) in this sequence may be replaced with a thymine (T). In some embodiments, the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b) are different polynucleotides, at least one of which may be a vector. A vector may be a viral vector, for example an adeno-associated viral (AAV) vector. In some embodiments, the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b) are different AAV vectors. In some embodiments, a single polynucleotide comprises the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b). The single polynucleotide may be a vector, which may be a viral vector such as an AAV vector. In some embodiments, the AAV is AAV. Also within the scope of the present disclosure are nucleic acids and viral particles or sets of viral particles, which collectively comprise any of the gene-editing systems disclosed herein. In some embodiments, the viral particle is, or set of viral particles are, AAV particle(s). In yet other aspects, the disclosure relates to methods of editing a voltage-gated sodium channel gene, such as SCN9A or SCN10A, the method comprises contacting a cell with: (i) any of the gene-editing systems disclosed herein; (ii) a nucleic acid comprising the gene-editing system; or (iii) a viral particle or a set of viral particles, which collectively comprise the gene- editing system. In some embodiments, the contacting step is performed by administering the gene- editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof. In some embodiments, the subject is a human patient having pain. In some embodiments, the cell is an autologous cell. Alternatively a cell may be a heterologous cell. In some embodiments, the cell is a stem cell, for example an iPSC cell or mesenchymal stem cell. In some examples, the method may further comprise administering the cell with the edited gene to a subject in need thereof (e.g., a human patient having pain). Also within the scope of the present disclosure are uses of any of the gene-editing systems described herein or components thereof for treating pain, as well as uses thereof for manufacturing a medicament for the intended medical treatment. The details of one or more embodiments of the disclosure are set forth in the description below. Other features or advantages of the present disclosure will be apparent from the detailed description of several embodiments and also from the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure. FIGs. 1A-1D depict on target editing efficiency of 40 prioritized gRNAs in different cell models. Prioritized gRNAs included (FIG. 1A) ten gRNAs for SpCas9 targeting SCN9A, (FIG. 1B) ten gRNAs for SpCas9 targeting SCN10A, (FIG. 1C) ten gRNAs for SaCas9 targeting SCNYA, and (FIG. 1D) ten gRNAs for SaCas9 targeting SCNIOA. These gRNAs were screened in iPSCs, iPSCs stably expressing Cas9, and iPSC-derived sensory neurons. Values represent mean + standard deviation. DETAILED DESCRIPTION Gene editing (including genomic editing) is a type of genetic engineering in which nucleotide(s) / nucleic acid(s) is / are inserted, deleted, and / or substituted in a DNA sequence, such as in the genome of a targeted cell. Targeted gene editing enables insertion, deletion, and / or substitution at pre-selected sites in the genome of a targeted cell (e.g., in a targeted gene or targeted DNA sequence). When a sequence of an endogenous gene is edited, for example by deletion, insertion or substitution of nucleotide(s nucleic acid(s), the endogenous gene comprising the affected sequence may be knocked-out or knocked-down due to the sequence alteration. Therefore, targeted editing may be used to disrupt endogenous gene expression. Alternatively or in addition, a desired nucleic acid may be inserted into a target site in a DNA sequence (e.g., in an endogenous gene), which is known as targeted integration. “Targeted integration” refers to a process involving insertion of one or more exogenous sequences, with or without deletion of an endogenous sequence at the insertion site. Targeted integration can result from targeted gene editing when a donor template containing an exogenous sequence is present. The present disclosure is based, at least in part, on the development of efficient gene editing systems for modifying a voltage-gated sodium channel gene, such as sodium voltage- gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCNI10A). Sodium channels are integral membrane proteins that form ion channels through a cell’s membrane. Voltage-gated sodium channels are sodium channels that are “opened” (i.e., allow the flow of sodium ions through the channel) in response to a voltage change. An alpha subunit of a sodium channel forms the core of the channel and is functional on its own (i.e., in the absence of any corresponding beta subunits or other accessory proteins). The family of sodium voltage-gated channels has nine members. The alpha subunits of these channels are Nayl.1, Nay1.2, Nay1.3, Nay1.4, Na,1.5, Na.1.6, Na,1.7, Na,1.8, and Na,1.9, encoded by SCNIA, SCN2A, SCN3A, SCN4A, SCN5A, SCNSA, SCN9A, SCNIOA, and SCN11A, respectively. Nav1.7 (encoded by SCN9A) is expressed, for example, in the dorsal root ganglion, the trigeminal ganglion, and the sympathetic ganglion neurons. Nav1.8 (encoded by SCN10A) is expressed, for example, in the dorsal root ganglion, in unmyelinated small-diameter sensory neurons called C-fibres. Both Nay1.7 and Nay1.8 are involved in nociception (i.e., a sensory mechanism that provides signals that lead to the sensation of pain). Editing the SCN9A and / or SCNI0A gene using any of the methods described herein may be used to treat, prevent and / or mitigate the symptoms of diseases and disorders such as, but not limited to, Congenital Pain Insensitivity, Anosmia, As If Personality, Borderline Personality Disorder, Malignant neoplasm of breast, Non-Small Cell Lung Carcinoma, Cold intolerance, Febrile Convulsions, Diabetes, Diabetes Mellitus, Dissociative disorder, Epilepsy, Erythromelalgia, Primary Erythermalgia, Facial Pain, Herpesviridae Infections, Hereditary Sensory Autonomic Neuropathy Type 5, Hyperplasia, Neuralgia, Hereditary Sensory and Autonomic Neuropathies, Degenerative polyarthritis, Pain, Pain in limb, Postoperative Pain, Parkinson Disease, Postherpetic neuralgia, Prostatic Neoplasms, Pruritus, Seizures, Somatoform Disorder, Tobacco Use Disorder, Trigeminal Neuralgia, Synovial Cyst, Chronic pain, Acute onset pain, Paramyotonia Congenita (disorder), Malaise, Sensory Discomfort, Burning Pain, Indifference to pain, Inflammatory pain, Mechanical pain, Scalp pain, Hereditary Motor and Sensory Neuropathy Type II, Common Migraine, Absence of pain sensation, Malignant neoplasm of prostate, Pain Disorder, Knee Osteoarthritis, Neuropathy, Complex Regional Pain Syndromes, Tonic-clonic seizures, Inherited neuropathies, Prostate carcinoma, Breast Carcinoma, Infantile Severe Myoclonic Epilepsy, Myxoid cyst, Channelopathies, Paroxysmal Extreme Pain Disorder, Painful Neuropathy, Compressive Neuropathies, Congenital Indifference to Pain Autosomal Recessive, Generalized Epilepsy With Febrile Seizures Plus Type 2, Generalized Epilepsy With Febrile Seizures Plus 7, Febrile Seizures Familial 3B, and Small Fiber Neuropathy (Adult-onset is referred to as small fiber neuropathy). Mutations in the SCN9A gene are known to cause pain perception disorders, including Primary Erythermyalgia, Paroxysmal Extreme Pain Disorder, Congenital Insensitivity to Pain, and Small Fiber Neuropathy. Gain-of-function mutations in the SCN9A gene result in spontaneous pain as observed in Primary Erythermyalgia and Paroxysmal Extreme Pain Disorder. Thus, knock-out or knock-down of the SCN9A gene in patients having Primary Erythermyalgia or Paroxysmal Pain Disorder can be used to treat, prevent and / or mitigate the associated symptoms. Primary Erythromelalgia is a rare autosomal dominant disorder characterized by episodes of burning pain in the feet and hands in response to heat and movement. Affected individuals typically develop signs and symptoms in early childhood, although in milder cases symptoms can appear later in life. Management of this condition is mainly symptomatic. Besides avoidance of pain triggers (such as heat, exercise, and alcohol), treatment options include cooling and elevating the extremity, use of anesthetics such as lidocaine and mexilitine, and use of opioid drugs in extreme cases. Paroxysmal Extreme Pain Disorder is another rare disorder characterized by severe episodic pain in rectal, ocular, and mandibular regions as well as skin redness. Symptoms of this condition often begin in the neonatal period or in the early childhood, and can retain throughout life. Agents for treating chronic neuropathic pain disorders are often used to alleviate the pain episodes caused by the disease. Carbamazepine, a sodium channel blocker, has proven most effective of these treatments. Mutations in the SCNI0A gene are also known to cause pain perception disorders, including Familial Episodic Pain Syndrome Type 2 and Small Fiber Neuropathy. Thus, knock- out or knock-down of the SCNI0A gene in patients having Familial Episodic Pain Syndrome Type 2 or Small Fiber Neuropathy can be used to treat, prevent and / or mitigate the associated symptoms. Familial Episodic Pain Syndrome Type 2 is a rare autosomal dominant neurologic disorder characterized by adult-onset of paroxysmal pain in the feet region. The episodes are generally triggered by heat, cold, chemicals and certain surfaces. Patients may also develop hypersensitivity to touch and elevated response to pain stimulus. Currently no treatment is available for this disease. Warmth has been shown to relieve the pain episodes. Small Fiber Neuropathy is a condition characterized by severe pain attacks and insensitivity to pain. The pain attacks are usually described as numbness, stabbing or burning, or abnormal skin sensations such as tingling or itchiness. Currently, there is no cure for small fiber peripheral neuropathy. Treatment options include intravenous immunoglobulin (IVIG) and plasmapheresis. As described herein, indel rates and indel patterns were determined for gene editing systems comprising pairs of RNA-guided endonuclease (e.g., SpCas9 or SaCas9) and specific guide RNAs. The gene-editing systems described herein rely on the identification of specific pairs of effective RNA-guided endonuclease and guide RNAs pairs (e.g., those disclosed herein) that facilitate effective modification of a voltage-gated sodium channel gene, such as SCN9A or SCN10A, with low off target occurrence. Accordingly, provided herein are gene-editing systems for efficient modification of voltage-gated sodium channel genes and uses thereof. Components of the gene-editing systems and genetically modified cells resulting from application of the gene-editing systems are also within the scope of the present disclosure. 1. Gene-Editing Systems for Genetic Modification of a Voltage-Gated Sodium Channel Gene In some aspects, the disclosure relates to gene-editing systems for modifying a voltage- gated sodium channel gene, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCNI0A). A “gene-editing system” refers to a combination of components for editing a target gene (e.g., SCN9A or SCN10A), or one or more agents for producing such components. For example, a gene-editing system may comprise: (a) a nuclease, or an agent for producing such (e.g., a nucleic acid encoding the nuclease); and / or (b) a guide RNA (gRNA), or an agent for producing such (e.g., a vector capable of expressing the gRNA). The gene-editing systems as described herein may exhibit one or more advantageous in modifying a voltage-gated sodium channel gene, such as SCN9A or SCNI0A. For example, it would achieve a high gene editing rate, such as frameshift-causing indel rates (e.g., at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, or at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% as assessed by methods described herein or known in the art) or such as total indel rates (e.g., at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 30%, at least 35%, or at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% as assessed by methods described herein or known in the art). Further, cells edited by the gene-editing system disclosed herein may have a high survival rate (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 85%, at least 90%, at least 95%, or at least 99%) relative to an unedited control. In one exemplary embodiment, a gene-editing system as described herein may comprise: (a) an endonuclease (e.g., a RNA-guided DNA endonuclease) or an agent producing such (e.g., a polynucleotide coding for the endonuclease); and (b) a gRNA or an agent producing such (e.g., a vector for expressing the gRNA). Moreover, any of the gene editing systems described herein may further comprise a polynucleotide sequence encoding a donor template. In some examples, the gene-editing system described herein comprises an endonuclease, a gRNA, and optionally a donor template. Such a gene-editing system may comprise one polynucleotide that provides the donor template and produces the gRNA. Alternatively, the gene-editing system may comprise the donor template and a separate nucleic acid, which can be the gRNA per se, or a polynucleotide that produces the gRNA. In other examples, the gene-editing system may comprise one or more polynucleotides, which collectively produces the endonuclease, the gRNA, and optionally the donor template. In some examples, the gene-editing system may comprise a polynucleotide comprising a first polynucleotide sequence encoding an endonuclease and a second polynucleotide sequence encoding a gRNA. Alternatively, the gene-editing system may comprise two polynucleotides: the first comprising a first polynucleotide sequence encoding an endonuclease and the second comprising a second polynucleotide sequence encoding a gRNA. A. RNA-Guided Endonucleases RNA-guided endonucleases are enzymes that utilize RNA:DNA base-pairing to target and cleave a polynucleotide. RNA-guided endonuclease may cleave single-stranded polynucleic acids or at least one strand of a double-stranded polynucleotide. A gene editing-system may comprise one RNA-guided endonuclease. Alternatively, a gene-editing system may comprise at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more than ten) RNA-guided endonucleases. The CRISPR-Cas9 system is a naturally-occurring defense mechanism in prokaryotes that has been repurposed as a RNA-guided DNA-targeting platform used for gene editing. It relies on the DNA nuclease Cas9, and two noncoding RNAs — crisprRNA (crRNA) and trans- activating RNA (tractRNA) — to target the cleavage of DNA. crRNA drives sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing typically with a 20 nucleotide (nt) sequence in the target DNA. Changing the sequence of the 5° 20nt in the crRNA allows targeting of the CRISPR-Cas9 complex to specific loci. The CRISPR- Cas9 complex only binds DNA sequences that contain a sequence match to the first 20 nt of the crRNA if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM). TracrRNA hybridizes with the 3’ end of crRNA to form a RNA-duplex structure that is bound by the Cas9 endonuclease to form the catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA. Once the CRISPR-Cas9 complex is bound to DNA at a target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB) where both strands of the DNA terminate in a base pair (a blunt end). A gene-editing system may comprise a CRISPR endonuclease (e.g., a CRISPR associated protein 9 or Cas9 nuclease). In some embodiments, the endonuclease is from Streptococcus aureus (e.g., saCas9) or Streptococcus pyogenes (e.g., spCas9), although other CRISPR homologs may be used. It should be understood that a Cas9 may be substituted with another RNA-guided endonuclease known in the art, such as Cpfl. Finally, it should be understood, that a wild-type RNA-guided endonuclease may be used or modified versions may be used (e.g., evolved versions of Cas9, Cas9 orthologues, Cas9 chimeric / fusion proteins, or other Cas9 functional variants). For example, in some embodiments, the RNA-guided endonuclease is modified to comprise a nuclear localization signal (NLS), such as an SV40 NLS or a NucleoPlasmine NLS. Examples of other nuclear localization signals are known to those having skill in the art. In some embodiments, the NLS comprises an SV40 NLS and a NucleoPlasmine NLS. B. Guide RNA The present disclosure provides a genome-targeting nucleic acid, or an agent for producing such (e.g., a polynucleotide comprising a nucleotide sequence encoding a gRNA), that can direct the activities of an associated polypeptide (e.g., a RNA-guided endonuclease) to a specific target sequence within a target nucleic acid. The genome-targeting nucleic acid can be a RNA. A genome-targeting RNA is referred to as a “guide RNA” or “gRNA” herein. In some embodiments, a gene-editing system comprises one gRNA. In other embodiments, a gene- editing system comprises at least two gRNAs (e.g., two, three, four, five, six, seven, eight, nine, ten, or more than ten gRNAs). A gRNA of a gene-editing system may be provided in a synthesized form. For example, a guide RNA may be synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and / or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and / or enhance other attributes, as described in the art. Alternatively, a gene-editing system may comprise an agent for the production of a gRNA. For example, a gene-editing system may comprise a nucleotide sequence encoding the nucleotide sequence of a gRNA and an additional nucleotide sequence that facilitates expression / production of the gRNA. A gRNA may be a double-molecule guide RNA. A double-molecule gRNA comprises two strands of RNA. The first strand may comprise in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a scaffold sequence comprising a minimum CRISPR repeat sequence. The second strand comprises a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tractRNA sequence, and an optional tracrRNA extension sequence. Alternatively, a gRNA may be a single-molecule guide RNA (sgRNA) comprising a spacer sequence and a scaffold sequence. The scaffold sequence may comprise a tracrRNA sequence as described herein. A sgRNA (e.g., in a Type II system) may comprise, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension may comprise elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker links the minimum CRISPR repeat and the minimum tractRNA sequence to form a hairpin structure. The optional tracrRNA extension comprises one or more hairpins. Alternatively, a sgRNA (e.g., in a Type V system) may comprises, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence. The single-molecule gRNA can comprise no uracil at the 3” end of the gRNA sequence. Alternatively, the gRNA can comprise one or more uracil at the 3’ end of the gRNA sequence. For example, the gRNA can comprise 1 uracil (U) at the 3” end of the gRNA sequence. The gRNA can comprise 2 uracil (UU) at the 3’ end of the gRNA sequence. The gRNA can comprise 3 uracil (UUU) at the 3’ end of the gRNA sequence. The gRNA can comprise 4 uracil (UUUU) at the 3’ end of the gRNA sequence. The gRNA can comprise 5 uracil (UUUUU) at the 3’ end of the gRNA sequence. The gRNA can comprise 6 uracil (UUUUUU) at the 3’ end of the gRNA sequence. The gRNA can comprise 7 uracil (UUUUUUU) at the 3’ end of the gRNA sequence. The gRNA can comprise 8 uracil (UUUUUUUU) at the 3’ end of the gRNA sequence. It is further understood that the nucleotides of the gRNAs described above may comprise modified nucleic acids at any nucleotide position. Accordingly, a gRNA can be unmodified or modified. For example, modified gRNAs can comprise one or more 2'-O-methyl phosphorothioate nucleotides. Examples of additional modified nucleic acids are known to those having skill in the art. See, e.g., W02018007976 and W02018007980, the relevant disclosures of each of which are incorporated by reference for the purpose and / or subject matter referenced herein. (i) gRNA Spacer As is understood by the person of ordinary skill in the art, each gRNA is designed to include a spacer sequence complementary to its genomic target sequence. See Jinek ez al., Science, 337, 816-821 (2012) and Deltcheva er al., Nature, 471, 602-607 (2011). A spacer sequence is a nucleotide sequence that defines the target sequence (e.g., a DNA target sequences, such as a genomic target sequence) of a target nucleic acid of interest. The gRNA can comprise a variable length spacer sequence with 17-30 nucleotides at the 5’ end of the gRNA sequence. In some embodiments, the spacer sequence is 15 to 30 nucleotides. In some embodiments, the spacer sequence is 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, a spacer sequence is 20 nucleotides. The “target sequence” is adjacent to a PAM sequence and is the sequence modified by a RNA-guided nuclease (e.g., Cas9). The “target nucleic acid” is a double-stranded molecule: one strand comprises the target sequence and is referred to as the “PAM strand,” and the other complementary strand is referred to as the “non-PAM strand.” One of skill in the art recognizes that the gRNA spacer sequence hybridizes to the reverse complement of the target sequence, which is located in the non-PAM strand of the target nucleic acid of interest. Thus, the gRNA spacer sequence is the RNA equivalent of the target sequence. For example, if the target sequence is 5-~AGAGCAACAGTGCTGTGGCC-3" (SEQ ID NO: 498), then the gRNA spacer sequence is 5-AGAGCAACAGUGCUGUGGCC-3’ (SEQ ID NO: 499). The spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer thus varies depending on the target sequence of the target nucleic acid of interest. The spacer sequence is designed to hybridize to a region of the target nucleic acid that is located 5' of a PAM of the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have mismatches. Each Cas9 enzyme has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes Cas9 recognizes in a target nucleic acid a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence. The canonical PAM for §. pyogenes Cas9 is 5'-NGG-3', but as indicated in the preceding sentence, S. pyogenes Cas9 can also recognize the non-canonical PAM 5-NAG-3'. Similarly, for S. aureus Cas9 the PAM comprises the sequence 5°-NNGRRT-3". In some embodiments, the target nucleic acid sequence comprises 20-22 nucleotides. In some embodiments, the target nucleic acid comprises less than 20 nucleotides. In some embodiments, the target nucleic acid comprises more than 20 nucleotides. In some embodiments, the target nucleic acid comprises at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid comprises at most: 5,10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence comprises 20-22 bases immediately 5' of the first nucleotide of the PAM. For example, in a sequence comprising 5-NNNNNNNNNNNNNNNNNNNNNRG- 3' (SEQ ID NO: 489) or 5-“NNNNNNNNNNNNNNNNNNNNNNNNGRRT-3' (SEQ ID NO: 490), the target nucleic acid comprises the sequence that corresponds to the Ns lacking an underscore, wherein N is any nucleotide, and the underlined NRG sequence and NNGRRT sequence is the S. pyogenes PAM and the S. aureus PAM, respectively. In some embodiments, a gRNA used herein may comprise a spacer sequence of 20 nucleotides. In some embodiments, such a gRNA is used with a SpCas9. In other embodiments, a gRNA used herein may comprise a spacer sequence of 22 nucleotides. In some embodiments, such a gRNA is used with a SaCas9. In some embodiments, a gRNA used herein may comprise a spacer sequence listed in Tables 1-4. In some examples, a gRNA used herein may comprise a spacer sequence listed in Table 1 in combination with SpCas9 for editing SCN9A. In some examples, a gRNA used herein may comprise a spacer sequence listed in Table 2 in combination with SaCas9 for editing SCNOA. In some examples, a gRNA used herein may comprise a spacer sequence listed in Table 3 in combination with SpCas9 for editing SCN10A. In some examples, a gRNA used herein may comprise a spacer sequence listed in Table 4 in combination with SaCas9 for editing SCN10A. Any of these gRNAs may comprise a spacer sequence listed in any of Tables 1 and 3 (in combination with SpCas9 enzyme) with greater than 40% (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, or greater) mean total Indel percentage and / or with greater than 40% (e.g., 50%, 55%, 60%, 65%, 10%, 75%, or greater) mean frameshift-causing Indel percentage. Alternatively, any of these gRNAs may comprise a spacer sequence listed in any of Tables 2 and 4 (in combination with SaCas9 enzyme) with greater than 15% (e.g., 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or greater) mean total Indel percentage and / or with greater than 15% (e.g., 20%, 25%, 30%, 35%, 40%, 45%, or greater) mean frameshift-causing Indel percentage. Exemplary gRNAs may comprise one of the following spacer sequences: CAAUUUGGGUGGUACCUGAU (SEQ ID NO: 1); GCUUCGCCUUGCAGAAAACA (SEQ ID NO: 2); GCCUAUGCCCUUCGACACCA (SEQ ID NO: 3); AUAGGCGAGCACAUGAAAAG (SEQ ID NO: 4); CGGCUGAAUAUACAAGUAUU (SEQ ID NO: 5); GGAACACCACCCAAUGACUG (SEQ ID NO: 6); CAGGCCUGAAGACAAUUGUA (SEQ ID NO: 7); GGAAUGUCCCCAUAGAUGAA (SEQ ID NO: 8); CCACCAAUGCUGCCGGUGAA (SEQ ID NO: 9); CAGUCACCACUCAGCAUUCG (SEQ ID NO: 10); AAGCAGAAUUAUGGGCCUCUCA (SEQ ID NO: 11); GCCUUGCAGAAAACAAGGAGCC (SEQ ID NO: 12); ACGACAAAAUCCAGCCAGUUCC (SEQ ID NO: 13); CUGGGAAAACCUUUACCAACAG (SEQ ID NO: 14); UCCCAACCUCAGACAGAGAGCA (SEQ ID NO: 15); GAUGUUACUGCUGCGUCGCUCC (SEQ ID NO: 16); CAUGAUCCUGACUGUGUUCUGU (SEQ ID NO: 17); CUCGUGUGUAGUCAGUGUCCAG (SEQ ID NO: 18); AAACUGAUUGCCAUGGAUCCAU (SEQ ID NO: 19); AGAAAACAAGGAGCCACGAAUG (SEQ ID NO: 20); GCUCCCCGAUCAGUUCUGCU (SEQ ID NO: 21); UGUAGUCACCAUGGCGUAUG (SEQ ID NO: 22); GGAAGCUCCGCAGCACAGAC (SEQ ID NO: 23); UCCUUACAACCAGCGCAGGA (SEQ ID NO: 24); ACUUCUGACCCCUUACUGUG (SEQ ID NO: 25); GAGCUCCCAGCAGAACUGAU (SEQ ID NO: 26); CCGAGACAUCGACAGCUCCA (SEQ ID NO: 27); AUCCGUUCUACAGCACACAC (SEQ ID NO: 28); UCACGUACCUGAGAGAUCCU (SEQ ID NO: 29); CGCAGGUGCUAGCAGCACUA (SEQ ID NO: 30); CCCUGGAGCUGUCGAUGUCUCG (SEQ ID NO: 31); UAGAUCCGUUCUACAGCACACA (SEQ ID NO: 32); AGUGAGAGGAAAGCCCAAGCAA (SEQ ID NO: 33); ACCUUUCCGGGCCCAAAGGGCA (SEQ ID NO: 34); CUUUGACUGCAUCAUCGUCACU (SEQ ID NO: 35); CACUUCUUCUGGAAAUAAUAGU (SEQ ID NO: 36); AUUUUAGCGUCAUUACCCUGGC (SEQ ID NO: 37); AACAACUUCCGUCGCUUUACUC (SEQ ID NO: 38); GCCGAGAUAUCUCACUCCCUGA (SEQ ID NO: 39); UGGUGUUCAUCUUCUCCAUGCC (SEQ ID NO: 40). (ii) gRNA Scaffold In some embodiments, the gRNA further comprises a scaffold sequence. A scaffold sequence may comprise the sequence of a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence, and / or an optional tractRNA extension sequence. Exemplary scaffold sequences for various CRISPR proteins are known to those of ordinary skill in the art. Selection of a scaffold sequence may depend on the RNA-guided DNA endonuclease to be used in the gene editing system as used herein, e.g., SaCas9 or SpCas9, which is known to those skilled in the art. For example, if SpCas9 is to be used, a scaffold sequence recognizable by SpCas9 can be selected. Examples of SpCas9 scaffold sequences are known in the art. See, e.g., Zhang et al., Plant Mol Biol. 2018; 96(4): 445-456; www.addgene.org. One exemplary scaffold sequence in a single-molecule guide RNA may comprise the nucleotide sequence of GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 42) Alternatively, if a SaCas9 endonuclease is to be used, a scaffold sequence recognizable by the SaCas9 can be selected. A scaffold sequence in a single-molecule guide RNA for SaCas9 may comprise the nucleic acid sequence of GUUUUAGUACUCUGGAAACAGAAUCUACUAAA ACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). A single-molecule guide RNA may further comprise an optional spacer extension. It should be understood that because the nucleotide sequence encoding a gRNA can be either a DNA sequence or a RNA sequence, any of the uracils (U) in the sequences describing a gRNA may be replaced with a thymine (T). Likewise, any T (thymine) in a sequence referring to gRNAs would refer to U (or uracil) in the context of RNA molecules. Sequences containing T (thymine) herein would encompass both DNA molecules and RNA molecules (wherein T refers to U). (iii) Exemplary RNA-Guided Endonuclease-gRNA Pairs In some embodiments, the gene editing system relies on the identification of effective RNA-guided endonuclease, guide RNAs pairs (e.g., those disclosed herein) for effective modification of a voltage-gated sodium channel gene. For example, a gene editing system for modifying a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene may comprise a Staphylococcus pyogenes (SpCas9) and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 1-10. Alternatively or in addition, a gene editing system for modifying a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene may comprises a Staphylococcus aureus (SaCas9) and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 11-20. In another example, a gene editing system for modifying a sodium voltage-gated channel alpha subunit 10 (SCN10A) gene may comprise a SpCas9 and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 21-30. Alternatively or in addition, a gene editing system for modifying a sodium voltage-gated channel alpha subunit 10 (SCN10A) gene may comprise a SaCas9 and a gRNA comprising the nucleotide sequence of any one of SEQ ID NOs: 31-40. (iv) Ribonucleoprotein Complexes In some instances, the gene-editing system disclosed herein may comprise a ribonucleoprotein complex (RNP), in which a gRNA and a nuclease (e.g., as described above) form a complex. As used herein, the term “ribonucleoprotein” or “RNP” refers to a protein that is structurally associated with a nucleic acid (either DNA or RNA). For example, in some embodiments, a Cas9 RNA-guided endonuclease and a gRNA of a gene-editing system are in the form of an RNP. C. Donor Template A donor template comprises a nucleic acid sequence that is to be inserted into a target site in a DNA sequence (e.g., in an endogenous gene). A donor template of a gene-editing system may be provided in a synthesized form. Alternatively, a gene-editing system may comprise an agent (e.g., a nucleic acid such as a vector) for the production of a donor template. For example, a gene-editing system may comprise a nucleic acid (e.g., a vector) for producing the donor template. A donor template may comprise one or more homologous arms to allow for efficient homology dependent recombination (HDR) at a genomic location of interest. The length of a homologous arm may vary. For example, a homologous arm may be at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 nucleotides in length. Likewise, a homologous arm may be 50 to 100, 50 to 200, 50 to 300, 50 to 400, 50 to 500, 50 to 600, 50 to 700, 50 to 800, 50 to 900, 50 to 1000, 100 to 200, 100 to 300, 100 to 400, 100 to 500, 100 to 600, 100 to 700, 100 to 800, 100 to 900, 100 to 1000, 200 to 300, 200 to 400, 200 to 500, 200 to 600, 200 to 700, 200 to 800, 200 to 900, 200 to 1000, 300 to 400, 300 to 500, 300 to 600, 300 to 700, 300 to 800, 300 to 900, 300 to 1000, 400 to 500, 400 to 600, 400 to 700, 400 to 800, 400 to 900, 400 to 1000, 500 to 600, 500 to 700, 500 to 800, 500 to 900, 500 to 1000, 600 to 700, 600 to 800, 600 to 900, 600 to 1000, 700 to 800, 700 to 900, 700 to 1000, 800 to 900, 800 to 1000, or 900 to 1000 nucleotides in length. In particular, a homologous arm may be 500 nucleotides in length. For example, in some embodiments a donor template comprises a 5’ homologous arm (i.e., positioned upstream to the first nucleotide sequence) and a 3’ homologous arm (i.e., positioned downstream to the first nucleotide sequence), wherein the 5° homologous arm comprises a nucleic acid sequence that is homologous to a region upstream to the genomic location of interest, and wherein the 3’ homologous arm comprises a nucleic acid sequence that is homologous to a region downstream to the genomic location of interest. In other embodiments, the donor template may comprise a 5° homologous arm and lack a 3’ homologous arm. In yet other embodiments, the donor template may comprise a 3’ homologous arm and lack a 5° homologous arm. Alternatively, a donor template may lack homologous arms. For example, in some instances, a donor template may be integrated by NHEJ-dependent end joining following cleavage at the target site. A donor template may also comprise a polynucleotide sequence encoding a gene of interest, or a portion thereof (e.g., SCN9A, SCNI0A, or a portion thereof). Alternatively or in addition, a donor template may comprise a polynucleotide sequence encoding a regulatory element (e.g., a regulatory element of SCN9A or SCN10A) A donor template can be DNA or RNA, single-stranded and / or double-stranded, and can be introduced into a cell in linear or circular form. If introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and / or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al., (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues. A donor template can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. Moreover, a donor template can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)). A donor template, in some embodiments, is inserted so that its expression is driven by the endogenous promoter, such as the promoter that drives expression of the endogenous gene into which the donor is inserted. Furthermore, exogenous sequences may also include transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals. It is understood that the nucleotides of the donor templates described above may comprise modified nucleic acids at any nucleotide position. D. Viral Vector / Viral Particle-Based Gene-Editing System In some embodiments, the gene-editing system disclosed herein may comprise polynucleic acids (e.g., vectors such as viral vectors) or viral particles comprising such. The polynucleic acid(s) produces the components (e.g., a nuclease and a gRNA) for editing a voltage-gated sodium channel gene as described herein. In some examples, the gene-editing system comprises one polynucleic acid capable of producing all components of the gene-editing system, including a nuclease and a gRNA. In other examples, the gene-editing system comprises two polynucleic acids, one encoding the nuclease and the other encoding the gRNA. The nucleic acid (or at least one nucleic acid in the set of nucleic acids) may be a vector such as a viral vector, such as a retroviral vector, an adenovirus vector, an adeno-associated viral (AAV) vector, and a herpes simplex virus (HSV) vector. In some examples, the gene-editing system may comprise one or more viral particles that carry genetic materials for producing the components of the gene-editing system as disclosed herein. A viral particle (e.g., AAV particle) may comprise one or more components (or agents for producing one or more components) of a gene-editing system (e.g., as described herein). A viral particle (or virion) comprises a nucleic acid, which encodes the viral genome, and an outer shell of protein (i.e., a capsid). In some instances, a viral particle further comprises an envelope of lipids that surround the protein shell. In some examples, a viral particle comprises a polynucleic acid capable of producing all components of the gene-editing system, including a nuclease and a gRNA. In other examples, a viral particle comprises a polynucleic acid capable of producing one or more components of the gene-editing system. For example a viral particle may comprise a polynucleic acid capable of producing the nuclease. Alternatively, a viral particle may comprise a polynucleic acid capable of producing the gRNA. The viral particles described herein may be derived from any viral particle known in the art including, but not limited to, a retroviral particle, an adenovirus particle, an adeno-associated viral (AAV) particle, or a herpes simplex virus (HSV) particle. In some embodiments, the viral particle is an AAV particle. In some embodiments, the AAV particle is an AAV particle. In some embodiments, a set of viral particles comprises more than one gene-editing system. In some embodiments, each viral particle in the set of viral particles is an AAV particle. In other embodiments, a set of viral particles comprises more than one type of viral particle (e.g., a retroviral particle, an adenovirus particle, an adeno-associated viral (AAV) particle, or a herpes simplex virus (HSV) particle). E. Additional Exemplary Gene-Editing Systems In addition, the gene-editing system disclosed herein may comprise a nuclease (e.g., a Cas9 enzyme) as disclosed herein. Such a gene-editing system may further comprise the gRNA. The nuclease and the gRNA may form an RNP for delivery. Further, the gene-editing system may further comprise the gRNA and a polynucleic acid (e.g., a vector as those described herein) for producing the donor template. The nuclease and the gRNA may form an RNP complex. Alternatively, the gene-editing system may further comprise one or more polynucleic acids for producing the gRNA and the donor template. Alternatively, the gene-editing system disclosed herein may comprise an agent for produce the nuclease, for example, an expression vector such as a viral vector as disclosed herein capable of expressing the nuclease. Such a gene-editing system may further comprise the gRNA or agents for producing such. Any other format of the gene-editing system comprising the components as disclosed herein for modifying a voltage-gated sodium channel gene or agents producing such are within the scope of the present disclosure. II. Methods of Editing a Voltage-Gated Sodium Channel Gene In some aspects, the disclosure relates to methods of editing a voltage-gated sodium channel gene, such as sodium voltage-gated channel alpha subunit 9 (SCN9A) or sodium voltage-gated channel alpha subunit 10 (SCNI0A), using any of the gene-editing systems disclosed herein. An editing event may introduce a mutation or correct a mutation in a sodium voltage-gated channel (e.g., SCN9A or SCN10A). One or more copies (i.e., alleles) of a gene (e.g., SCN9A or SCN10A) may be corrected and / or mutated. A method of editing a voltage-gated sodium channel gene may comprise contacting a cell with: a gene-editing system as described herein; a viral particle or set of viral particles comprising a gene-editing system as described herein; and / or a nucleic acid or set of nucleic acids comprising a gene-editing system as described herein. These methods may be performed, for example, on one or more cells existing within a living subject (e.g., in vivo). Alternatively or in addition, these methods may be performed on one or more cells existing in culture (e.g., ex vivo). In some instances, a cell edited in culture is then administered to a subject (categorized herein as “cell-based therapy”). A. Delivery Methods The contacting of the cell (or subject) with the gene-editing system, viral particle or set of viral particles, and / or nucleic acid or set of nucleic acids may be performed via various delivery methods. For example, nucleases and / or gRNAs may be delivered using a vector system, including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno- associated virus vectors, and combinations thereof. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding nucleases and gRNAs in cells. Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. Methods of non-viral delivery of nucleic acids include, but are not limited to, electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Methods for delivery of proteins (e.g., RNA-guided endonucleases) include, but are not limited to, the use of cell-penetrating peptides and nanovehicles. (i) Adeno-Associated Viral Delivery One or more components of a gene editing system may be delivered to a cell using an adeno-associated virus (AAV). AAVs are small viruses which integrate site-specifically into the host genome and can therefore deliver a transgene. Inverted terminal repeats (ITRs) are present flanking the AAV genome and / or the transgene of interest and serve as origins of replication. Also present in the AAV genome are rep and cap proteins which, when transcribed, form capsids which encapsulate the AAV genome for delivery into target cells. Surface receptors on these capsids confer AAV serotype, which determines which target organs the capsids will primarily bind and thus what cells the AAV will most efficiently infect. There are twelve currently known human AAV serotypes. In some embodiments, the AAV is AAV serotype 6 (AAV6). In some embodiments, the AAV is AAV serotype 1 (AAV). Adeno-associated viruses are among the most frequently used viruses for gene therapy for several reasons. First, AAVs do not provoke an immune response upon administration to mammals, including humans. Second, AAV are effectively delivered to target cells, particularly when consideration is given to selecting the appropriate AAV serotype. Finally, AAVs have the ability to infect both dividing and non-dividing cells because the genome can persist in the host cell without integration. This trait makes them an ideal candidate for gene therapy. (ii) Homology-Directed Repair (HDR) One or more components of a gene editing system may be inserted into the target genomic region of the edited cell by homology directed repair (HDR). Both strands of the DNA at the target genomic region are cut by a CRISPR Cas9 enzyme. HDR then occurs to repair the double-strand break (DSB) and insert the donor DNA. For this to occur correctly, the donor sequence is designed with flanking residues which are complementary to the sequence surrounding the DSB site in the target gene (hereinafter “homology arms”). These homology arms serve as the template for DSB repair and allow HDR to be an essentially error-free mechanism. The rate of homology directed repair (HDR) is a function of the distance between the mutation and the cut site so choosing overlapping or nearby target sites is important. Templates can include extra sequences flanked by the homologous regions or can contain a sequence that differs from the genomic sequence, thus allowing sequence editing. (iii) Non-Homologous End Joining (NHEJ) The NHEJ pathway may also produce, at very low frequency, inserts containing exons 11-27. Such repair should correct expression when the insert is in the sense strand orientation. III. Therapeutic Applications The gene-editing methods disclosed herein may be applied for treating a patient with pain. In some embodiments, provided herein are ex vivo cell-based therapy. In other embodiments, provided herein are in vivo gene therapy. (i) Cells-Based Therapy Genetically-edited cells may be produced using any of the methods described herein. In some embodiments, one or more gene edits within a population of edited cells results in a phenotype associated with changes in voltage-gated sodium channel functionality. In some embodiments, genetically-edited cells of the present disclosure exhibit decreased voltage-gated sodium channel activity (e.g., decreased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%) relative to the unedited control. For example, the levels of Nay1.7 and / or Nay1.8 activity may be decreased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 10%, 80%, 90%, 95%, or 100% relative to control unedited cells. In some embodiments, the levels of Nay1.7 and / or Nay1.8 activity may be decreased by 5%-10%, 5%- 20%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-170%, 5%-80%, 5%-90%, 10%-20%, 10%- 30%, 10%-40%, 10%-50%, 10%-60%, 10%-70%. 10%-80%, 10%-90%., 20%-30%, 20%-40%, 20%-50%, 20%-60%, 20%-70%, 20%-80%, 20%-90%, 30%-40%, 30%-50%, 30%-60%, 30%- 70%, 30%-80%, 30%-90%, 40%-50%, 40%-60%, 40%-70%, 40%-80%, 40%-90%, 50%-50%, 50%-70%, 50%-80%, or 50%-90%, relative to control T cells. In other embodiments, genetically-edited cells of the present disclosure exhibit increased voltage-gated sodium channel activity (e.g., by at least 30%, 50%, 100%, 2-fold, 5-fold, or 10- fold) relative to the unedited control. For example, the levels of Nay1.7 and / or Nav1.8 activity may be increased by at least 30%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000% relative to control unedited cells. In some embodiments, the levels of Nay1.7 and / or Nay1.8 activity may be increased by 30%-50%, 30%-100%, 30%-200%, 30%-500%, 30%- 1000%, 50%-100%, 50%-200%, 50%-500%, 50%-1000%, 100%-200%, 100%-500%, 100%- 1000%, 200%-500%, 200%-1000%, or 500%-1000% relative to control unedited cells. In some embodiments, a biopsy of the patient’s peripheral nerves can be performed. The nerve tissue can be isolated from the patient’s skin or leg. Then, a cell of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) is isolated from the biopsied material. Then, the chromosomal DNA of the cell of the peripheral nervous system (e.g., a neuron, or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) can be edited using the materials and methods described herein. Finally, the edited cell of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) is implanted into the patient. Any source or type of cell may be used as the progenitor cell. In other embodiments, a patient specific induced pluripotent stem cell (IPSC) can be created. Then, the chromosomal DNA of these iPSC cells can be edited using the materials and methods described herein. Next, the genome-edited iPSCs can be differentiated into cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia). Finally, the differentiated cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) are implanted into the patient. Alternatively, a mesenchymal stem cell can be isolated from the patient, which can be isolated from the patient’s bone marrow or peripheral blood. Next, the chromosomal DNA of these mesenchymal stem cells can be edited using the materials and methods described herein. Next, the genome-edited mesenchymal stem cells can be differentiated into cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia). Finally, the differentiated cells of the peripheral nervous system (e.g., a neuron or a glial cell such as Schwann cell in nerves or satellite glial cell in ganglia) are implanted into the patient. Any of the genetically edited cells may be administered to a subject. The step of administering may include the placement (e.g., transplantation) of genetically engineered cells into a subject, by a method or route that results in at least partial localization of the introduced cells at a desired site, such that a desired effect(s) is produced and where at least a portion of the implanted cells or components of the cells remain viable. The period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, or even the life time of the subject, i.e., long-term engraftment. In some embodiments, the administration is to the respiratory tract of the subject. Modes of administration include injection, infusion, instillation, or ingestion. Injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. In some embodiments, genetically engineered cells are administered systemically, which refers to the administration of a population of cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject's circulatory system and, thus, is subject to metabolism and other like processes. For use in the various aspects described herein, an effective amount of genetically engineered cells comprises at least 10? cells, at least 5 X 10? cells, at least 10° cells, at least 5 X 10° cells, at least 10% cells, at least 5 X 10° cells, at least 10° cells, at least 2 X 10° cells, at least 3 X 10° cells, at least 4 X 10° cells, at least 5 X 10° cells, at least 6 X 10° cells, at least 7 X 10° cells, at least 8 X 10° cells, at least 9 X 10° cells, at least 1 X 10° cells, at least 2 X 10° cells, at least 3 X 10° cells, at least 4 X 10° cells, at least 5 X 10° cells, at least 6 X 10° cells, at least 7 X 109 cells, at least 8 X 10° cells, at least 9 X 10° cells, or multiples thereof. In some examples described herein, the cells are expanded in culture prior to administration to a subject in need thereof. (ii) In vivo Gene Therapy Alternatively, the gene-editing methods and materials disclosed herein can be applied to genetically modifying the target gene (SCN9A or SCN10A) in vivo. Chromosomal DNA of the cells in a patient can be edited using the materials and methods described herein. In some aspects, the target cell in an in vivo based therapy can be a neuron of the peripheral nervous system. Although certain cells present an attractive target for ex vivo treatment and therapy, increased efficacy in delivery may permit direct in vivo delivery to such cells. Ideally the targeting and editing would be directed to the relevant cells. Cleavage in other cells can also be prevented by targeted delivery and / or the use of promoters only active in certain cells and or developmental stages. Additional promoters are inducible, and therefore can be temporally controlled if the nuclease is delivered as a plasmid. The amount of time that delivered RNA and protein remain in the cell can also be adjusted using treatments or domains added to change the half-life. In vivo treatment would eliminate a number of treatment steps, but a lower rate of delivery can require higher rates of editing. In vivo treatment can eliminate problems and losses from ex vivo treatment and engraftment and post-engraftment integration of neurons and glial cells appropriately into existing brain circuits. In some aspects, the disclosure relates to methods of administering an effective amount of a gene-editing system as descried herein, a viral particle or set of viral particles comprising a gene-editing system as described herein, a nucleic acid or set of nucleic acids comprising a gene- editing system as described herein, or a composition of edited cells as described herein to a subject in need thereof. A subject may be any subject for whom diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a human patient having pain. In some embodiments, the human patient is a child. An effective amount refers to the amount of a gene-editing system, a viral particle or set of viral particles comprising a gene-editing system, a nucleic acid or set of nucleic acids comprising a gene-editing system, or a population of genetically engineered cells needed to prevent or alleviate at least one or more signs or symptoms of a medical condition (i.e., pain), and relates to a sufficient amount of a composition to provide the desired effect (i.e., to treat a subject having pain). An effective amount also includes an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation. The efficacy of a treatment comprising a composition for the treatment of a medical condition can be determined by the skilled clinician. A treatment is considered an "effective treatment," if any one or all of the signs or symptoms of, as but one example, levels of functional target are altered in a beneficial manner (e.g., increased by at least 10%), or other clinically accepted symptoms or markers of disease (e.g., pain) are improved or ameliorated. Efficacy can also be measured by failure of a subject to worsen as assessed by hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in subject and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms. IV. Kits for Therapeutic Use The present disclosure also provides kits for use of the compositions described herein. For example, the present disclosure provides kits comprising a gene-editing system as described herein; a viral particle or set of viral particles comprising a gene-editing system as described herein; a nucleic acid or set of nucleic acids comprising a gene-editing system as described herein; and / or a population of genetically-edited cells as described herein. In some embodiments, the kit can additionally comprise instructions for use in any of the methods described herein. The included instructions may comprise a description of: (i) the delivery of a gene-editing system as described herein; a viral particle or set of viral particles comprising a gene-editing system as described herein; and / or a nucleic acid or set of nucleic acids comprising a gene-editing system as described herein; and / or (ii) the administration of a population of genetically-edited cells as described herein. The kit may further comprise a description of selecting a subject suitable for treatment based on identifying whether the subject is in need of the treatment. The instructions may include information as to dosage, dosing schedule, and route of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages) or sub- unit doses. Instructions supplied in the kits of the disclosure are typically written instructions on a label or package insert. The label or package insert indicates that the pharmaceutical compositions are used for treating, delaying the onset, and / or alleviating a disease or disorder in a subject. The kits provided herein are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, and the like. Also contemplated are packages for use in combination with a specific device, such as an inhaler, nasal administration device, or an infusion device. A kit may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The container may also have a sterile access port. Kits optionally may provide additional components such as buffers and interpretive information. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container. In some embodiment, the disclosure provides articles of manufacture comprising contents of the kits described above. General Techniques The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J. E. Cellis, ed., 1989) Academic Press; Animal Cell Culture (R. I. Freshney, ed. 1987); Introduction to Cell and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985»; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984»; Animal Cell Culture (R.L Freshney, ed. (1986»; Immobilized Cells and Enzymes (IRL Press, (1986»; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.). ‘Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein. EXAMPLES Example 1. Efficacy screening of SpCas9 and SaCas9 gRNAs targeted to SCN94 and SCNI10A in iPSCs. Methods Guide RNA design and synthesis In silico guide RNA design was completed by CRISPR Therapeutics. SpCas9 and SaCas9 guide RNAs targeting exons 2-15 of SCN9A and Exons 1-14 of SCN10A were designed in silico and evaluated using an off-target prediction algorithm. Guide RNAs with a favorable off-target profile were selected for synthesis and further on target evaluation. Selected gRNAs included 99 SpCas9 gRNAs (Table 1) and 68 SaCas9 gRNAs targeting SCN9A (Table 2) and 166 SpCas9 gRNAs (Table 3) and 73 SaCas9 gRNAs targeting SCN10A (Table 4). Guide RNAs were custom ordered for synthesis by Synthego Corporation. Guide RNAs were ordered with standard chemical modifications which include 2'-O-methyl 3' phosphorothioate modifications in the first and last 3 nucleotides. For SpCas9 gRNAs, the 20- nucleotide genome targeting sequences are listed in Tables 1 and 3, and a standard 80-mer SpCas9 scaffold sequence was added to create a guide RNA. For SaCas9 gRNAs, 22-nucleotide genome targeting sequences are listed in Tables 2 and 4 and were used for synthesis with the following SaCas9 scaffold sequence to generate guide RNAs: GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAA GGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU (SEQ ID NO: 41). Nucleofection of iPSCs using 4D-Nucleofector® System Wildtype iPSCs, as well as engineered iPSCs stably expressing Cas9, were used for different steps of gRNA screening. iPSCs expressing SpCas9 or SaCas9 under the control of doxycycline were generated from wildtype iPSCs by inserting a targeting construct into the AAVS-1 locus. In this construct, two cassettes are expressed in opposing directions separated by an IS2 insulator element. The first expression cassette is a TetOn3G protein-2A-Puro under the control of the CASI promoter, and the second expression cassette is either SpCas9 or SaCas9 under the control of the TRE3G promoter. iPSCs were electroporated using the Lonza 4D-Nucleofector® System together with the P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, Cat: V4SP-3096) with program CM137. iPSCs were cultured in mTeSR1 (Stemcell Technologies, Cat: 85850). Prior to nucleofection cells were dissociated using Accutase (Stemcell Technologies, Cat: 07920) and resuspended in P3 Nucleofection solution. In 96-well format, 180,000 cells per well were electroporated with 400ng Cas9 mRNA (TriLink) per well and 400ng synthetic gRNA (Synthego) according to manufacturer’s instructions. Following nucleofection iPSCs were maintained in mTeSR1 supplemented with 10uM Y27632 (Stemcell Technologies, Cat: 72308) in 96 well cell culture plates pre-coated with matrigel for 72 hours prior to DNA extraction and next generation sequencing (NGS)-based insertion / deletion (Indel) detection. Two replicates were included in each electroporation experiment and two independent experiments were carried out. For stable SpCas9 and SaCas9 cell line experiments, cells were treated with 1 ug / ul doxycycline for 72 hours prior to Amaxa nucleofection. Nucleofection of iPSC-derived sensory neurons using Lonza 4D-Nucleofector® Y Unit To generate iPSC-derived sensory neuron cultures (iSNs), iPSC cells were differentiated in the presence of a cocktail of small molecule developmental pathway inhibitors in matrigel coated flasks. At DIV11 of differentiation, cells were dissociated and plated into 384 plates and maintained in maturation media which includes a cocktail of growth factors where they matured until DIV26-28. These neurons express canonical markers of nociceptors, including TRPV1, Brn3A, the peripheral marker Isl, neuN and SCN9A (NaV1.7), and can recapitulate functional properties of physiologically relevant neuronal subtypes. iPSC-derived sensory neurons (iSNs) were electroporated using the Lonza 4D- Nucleofector® Y Unit together with the AD1 4D-NucleofectorTM Y Kit (Lonza, Cat: V4YP- 1A24) with program EH158. In 24-well format, cells were electroporated with ribonucleoprotein complexes (RNPs) according to manufacturer’s instructions. RNP complexes were generated by incubating 425pmol SpCas9 or SaCas9 protein (Aldevron) with 531pmol synthetic gRNA (Synthego) at room temperature for 20 minutes. Following nucleofection iSNs were maintained in culture for 72 hours prior to DNA extraction and next generation sequencing (NGS)-based insertion / deletion (Indel) detection. Two replicates were included in each electroporation experiment and two independent experiments were carried out. Transduction of iPSC-derived sensory neurons with AAV In 384-well format, approximately 12,000 iSNs per well were transduced with AAV-1 vectors expressing SaCas9 and a SaCas9 gRNA in a single vector. iSNs were transduced with AAV vectors at a multiplicity of infection (MOI) of 750,000. Following transduction, iSNs were maintained in culture for 7 days prior to DNA extraction and NGS based insertion / deletion (indel) detection. Two replicates were included in each transduction experiment and two independent experiments were carried out. Next Generation Sequencing (NGS) Based Insertion / Deletion (Indel) Detection DNA was extracted from iPSCs 72 hours post electroporation using Lucigen Quick Extract 2X DNA Extraction Solution (Lucigen, Cat: QE09050) according to manufacturer’s instructions. A two-step PCR approach using KAPA2G Robust HotStart ReadyMix (Sigma Aldrich, Cat: KK5702) was then used to generate NGS libraries. The first PCR was used to create amplicons while the second PCR was used to add Nextera DNA Index (i7 / i5) adapter sequences. The reaction for PCR #1 comprised of 1 uL extracted gDNA, 1X KAPA2G Robust HotStart ReadyMix, 0.5 uM forward primer, and 0.5 uM reverse primer. Primer sequences are listed in Tables 5 and 6. The reaction for PCR #2 comprised of 1 ul PCR #1 product, 1X KAPA2G Robust HotStart ReadyMix, 0.5 uM Index 1 N7xx adapter, and 0.5 uM Index 2 N5xx adapter. Cycling conditions for both PCR #1 and PCR #2 were as follows: (1) 95°C for 3 min, (2) 95°C for 15's, (3) 60°C for 15s, (4) 72°C for 15 s, (5) repeat steps (2)-(4) 20 times, (6) 72°C for 1 min, (7) 4°C infinite hold. Samples were then pooled and purified using the Zymo DNA Clean and Concentrator Kit (Zymo, D4034) and quantified on the Agilent 2100 Bioanalyzer (Agilent, Cat: G2939BA). Then, libraries were run on Illumina’s MiSeq to obtain paired-end reads (2x150). For each sample, the reads were then filtered to obtain a minimum Phred33 quality score of 30. Paired-end reads were subsequently merged using FLASH (Fast Length Adjustment of SHort reads) with a requirement of at least 1 bp overlap. The resulting merged reads were then optimally aligned to the corresponding reference amplicon sequences using the Needleman- ‘Wunsch algorithm. Reads that aligned with indels within 3bp of the expected cut site were counted, and then filtered for frame-shifting indels only, where the indel length is not a multiple of 3. An estimate of total editing was calculated as the proportion of reads with indels proximal to the cut site, while productive editing was calculated as the proportion of reads with frame- shifting indel reads proximal to the cut site for each sample. Once each sample was analyzed, quality control of the samples was then performed by requiring each sample to have at least 90% of sequenced reads successfully merged, and 70% of sequenced reads successfully aligned. Additionally, samples were required to have at least 1000 reads successfully aligned. Lastly, quality control was performed in a batch-aware manner, by dropping any samples whose final aligned read count was more than 2 standard deviations away from the mean of its corresponding batch of samples. Passing samples were averaged with the standard deviation calculated. Positive and negative controls were included, where the negative control was required to exhibited less than 2% indel rates, indicating a low level of background noise, and while the positive control samples had to show levels of editing above background. Further, reproducibility was confirmed by comparing corresponding samples between our two technical replicates; a strong linear fit was observed with a high R? of 0.85. Off-target evaluation of SpCas9 gRNAs targeted to SCN9A and SCN10A in iPSCs For an initial off-target evaluation, an in silico nomination step was performed where candidate off-target sequences were predicted based on sequence similarity. Then, these sites were directly evaluated via targeted Next-Generation Sequencing to identify which sites, if any, showed evidence of CRISPR-Cas-induced off-target editing. a) Computational prediction of off-target sites Off-target sites were predicted based on sequence similarity using three computational algorithms. Specifically, CCTop and COSMID were each used to identify candidate off-target sites with up to 3 mismatches or up to 2 mismatches with 1 DNA or RNA bulge from the on- target sequence. The PAM sequence used for identifying off-target sites was NRG for SpCas9 guides and NNGRRT for SaCas9 guides. Guides identified from the two algorithms were then merged together, including de-duplication of sites with identical genomic coordinates. The total list of 1,471 putative off-target sites predicted across the 40 guides is provided in Table 7. b) Hybrid capture of iPSCs iPSC transfections using two different wildtype donors were performed using the Lonza conditions described above. Two biological replicates were used, and genomic DNA pooled to obtain the necessary amount for hybrid capture. DNA was extracted from iPSCs 72 hours post electroporation using the DNeasy 96 Blood and Tissue Kit (Qiagen, Cat: 69581). Samples were quantified using the Qubit 1x dsDNA HS Assay (ThermoFisher, Cat: Q33231) and EnVision plate reader with 4PL calculation. A minimum of 200ng of each sample was obtained and processed for hybrid capture using the SureSelect XT Reagent Kit (Aglient, Cat: G9704A). Briefly, samples were fragmented to 150-200bp using the Covaris LE220 and end repaired, dA- tailed, and adapter ligated. Libraries were then amplified using Herculase II Fusion DNA polymerase using the following cycle conditions: (1) 98°C for 2 min, (2) 98°C for 30s, (3) 65°C for 30's, (4) 72°C for 1 min, (5) repeat steps (2)-(4) 10 times, (6) 72°C for 5 min, (7) 4°C infinite hold. A bead-based clean-up was used to purify libraries, AMPure XP (Beckman Coulter, Cat: A63881). Libraries were hybridized to the target-specific Capture Library and target molecules captures with Steptavidin-coated magnetic beads. Captured libraries were then amplified and purified using the same conditions above. Samples were QC’d using the DNA High Sensitivity kits on the TapeStation (Agilent, Cat: 5067-5584) and / or Bioanalyer (Aglient, Cat: 5067-1504) and sequenced on the Illumina HiSeq platform to a median sequencing coverage of 2,272x per candidate off-target site. c) Computational analysis of targeted next-generation sequencing For each putative off-target site included in this study, the following analysis was performed to determine strength of evidence for CRISPR-Cas-treatment-induced off-target editing. First, next-generation sequencing reads were aligned to the hg38 human reference genome using the alignment tool bwa in the mem mode with default parameters, followed by conversion and sorting of the SAM and BAM files with read duplicate removal performed by samtools. Then, the indel formation rate was measured by piling up reads with an indel within 3bp of the expected cut site using the Python package pysam and dividing the number of indel reads by the total number of reads covering that site. Then, the indel rate measured at each predicted off-target site was compared between the treated sample of each iPSC donor and the untreated (electroporated only) negative control sample matched for that same iPSC donor. If an indel rate at the site was observed to be >0.2% greater than the negative control sample, the data for that candidate site entered statistical testing. The only exception was for candidate sites that were observed to have a germline indel genetic variant, where an indel rate of ~50% or ~100% is observed in both the matched untreated and treated sample of one or more donors. For sites that entered statistical testing, a paired t-test was performed across both donors for the treated and untreated indel rates at that site. Any tested site that resulted in a p-value of less than .05 was considered to have confirmed off-target editing. Substantial on-target editing (average indel rate of 9.35%-52.25%) was confirmed across guides as a positive control for this study. Table 1: Names and sequences of SpCas9 guide RNAs targeted to the SCN9A gene (Navl.7) Nav1.7 SpCas9 gRNAs gRNA Name spacer sequence (5'-3") 43 44 45 46 47 48 49 50 43 Scn9%a Sp Exon 2_T1 AuCuAUGGGGACAuCCuCC “44 "| Scn9aSpExon2_12 CAGCAAUGCGuuGuUCAAUG 45 Scn9a Sp Exon 2_T3 46 Scn9a Sp Exon 2_T4 UGGGGACAuWCCuCCCGGCA "47 "| Scn%aSpExon2_15 GuAGGGGUCCAAGUCCuCCA 48 Scn9a Sp Exon 2_T6 "49 | Scn9aSpExon2_T7 AuGGCAAuGuuGCCuCCCCC “s50 Scn9a Sp Exon 2_T8 751 | Scn9a Sp Exon 2_T9 AACAGCuGCCCuuCAuCuAu 31 Nav1.7 SpCas9 gRNAs ID NO: gRNA Name spacer sequence (5'-3") R Sen9a Sp Exon 2 T10 GGAAUGUCCCCAUAGAUG! 52 53 54 55 56 57 58 50 60 61 62 63 64 65 66 67 68 69 70 7 71 72 73 74 75 76 -y 78 79 80 81 82 83 84 Rs 86 R7 8]8 R]0 90 91 92 93 Tg 04 32 Nav1.7 SpCas9 gRNAs ) ID NO: gRNA Name spacer sequence (5'-3") Scn9a Sp Exon 11_T9 CAAuUGGGUGGUACCUGA 95 Sen9a Sp Exon 11 T10 GuuuCCACCuuGGuGuCGA / 96 97 5 Cl [+13 99 100 101 102 103 104 401 105 402 106 9 107 108 403 109 10 494 110 111 112 113 114 115 iE) 116 495 496 6 117 118 119 120 121 122 123 124 Table 2: Names and sequences of SaCas9 guide RNAs targeted to the SCN9A gene (Navl.7) Nayl.7 SaCas9 gRNAs rl En ine the Es frat erat ots FI SEQ ID NO: gRNA Name . spacer sequence (5'-3") 125 126 127 128 129 130 131 132 133 134 135 136 137 138 130 13 140 141 142 17 143 144 145 146 147 148 149 150 151 152 18 14 153 154 155 156 157 158 11 159 160 161 16 34 Nav1.7 SaCas9 gRNAs 12 20 162 163 164 165 15 166 167 168 169 170 171 172 173 174 175 176 177 178 19 179 180 181 182 SEQ ID NO: “gRNA Name | spacer sequence (5-3) E Tm Te Te “164 CuAuCUCCuuuCAGAGGAUAUG “165 CuCAwGCuCuCuGuCuGAGGu TE “166 uwGuAGuuCCuAuCuCCuuuCA Te “168 AuAUGGAGAGCAAuCCAGAUC “169 uGAUCUGGAAWGCUCUCCAUA 170 AuGGUAAUGCAAGAUCUACAA Tm uGCuunuuuCuCCCAGAACuUG Tim AuuCCuAuAGCAAGUACAuuU “17 ACAuuuuGAAwCCuCAGuCA “174 AuGCACACAAAWCWGAUC 175 AAAGuGuAuCuAuuuuAuUGUA “176 UACAAUAAAAUAGAUACACuUL TT AAUGGUAWAAAACUGAWGCC “178 AuAUGAGUAUIUCCAAGUAGGC 1 AAACUGAWGCCAUGGAUCCAU 179 ACCuuAGuuuAuGuuuACCAGU “180 CAGCCuACWGGAAAUACUCAU Tis GAGCuCunuCuAGCAGAUGUGG “182 uuuCuCACuAGGUCuuuAC Table 3: Names and sequences of SpCas9 guide RNAs targeted to the SCN10A gene (Navl.8) Navy1.8 SpCas9 gRNAs TT am a WY TT a gRNA Name spacer sequence (5'-3') 183 184 185 186 187 188 180 190 191 192 193 194 21 195 gRNA Name spacer sequence (5'-3") 183 GACGGAAGUUGWUAGUUUCG “184 CAACuCCGUCGCuuuACuC “185 uCGCutuACuUCCGGAGUCAC “186 GAACGGAUCUAGAUCCuCCA 187 ACGGAAGUUGUUAGuUUCGA “188 AACGGAUCUAGAUCCUCCAG “189 AGAACGGAUCUAGAUCCuCC 0 CI WAGuUUCGAGGGAUCCAAU IC GuuAGUUUCGAGGGAUCCAA 193 GGCuCCCCGAUCAGuCuGC 194 uAGuuCGAGGGAUCCAAUG a GCuCCCCGAUCAGuuCuGCu 5 28 AuCCGuuCuACAGCACACAC 35 Nav1.8 SpCas9 gRNAs Q ID NO: gRNA Name spacer sequence (5'-3') 196 Senl0a Sp Exon l TI1R ACCCGGUGUGUGCUGUAGA 197 198 199 200 201 202 203 204 205 206 207 26 208 200 210 211 212 213 214 215 216 217 218 29 219 220 221 222 223 224 A534 226 227 228 229 230 231 232 233 234 235 236 237 25 238 36 Nav1.8 SpCas9 gRNAs Q ID NO: gRNA Name spacer sequence (5'-3') 230 Senl0a Sp Exon 8 T1 ACuGuuCCGCCuCAuGACA 240 241 242 243 244 245 246 247 248 249 22 250 251 252 253 254 255 256 257 258 250 260 261 262 263 30 264 265 266 24 267 268 269 270 271 272 273 274 275 276 497 277 57 278 279 37 Nav1.8 SpCas9 gRNAs Q ID NO: gRNA Name spacer sequence (5'-3') 280 Senl0a Sp Exon ll T13 | GGGAGUGAGAUAUCUCGG( 281 282 283 284 285 286 287 288 289 290 291 292 203 204 205 206 297 208 290 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 310 320 321 322 323 324 325 38 Nav1.8 SpCas9 gRNAs gRNA Name spacer sequence (5'-3') 326 327 328 320 330 331 332 333 334 335 23 336 “gRNAName | spacer sequence (5-3) BE: BE GAUGuUGCCuAuCUGGAGCA EC WCAUGGCCAUGGAGCACCA 39 uCuuGAGCuuCACCCACAUG “330 CuGGGAuGCUGCCCCAUGU Br uGuCuGAGCuuCACCCACA 32 GuGAuGGUGAGCUCuGCAAA 333 GGuGAUGGUGAGCuCuGCAA 33d uGuGCuGCGGAGCuuCCGCu 35 GAAAUAAUAGUAUGGGUCGA Ee 7336 ACuGUGAGUCUGCuAGAGCu 337 CACuGuGAGuCuGCuAGAGC Table 4: Names and sequences of SaCas9 guide RNAs targeted to the SCN10A gene (Navl.8) Nav1.8 SaCas9 gRNAs 338 38 339 340 341 32 342 343 344 345 346 347 348 349 350 351 37 352 353 354 355 356 357 358 359 360 SEQ ID NO: TgRNA Name | spacer sequence (5-3) 338 Scnl0a Sa Exon 1_T1 GCGACGGAAGuuGuUUAGuuuCG 38 Scnl0a Sa Exon 1_T3 AACAACuuCCGuCGCuuuACuC 339 Scnl0a Sa Exon 1_T4 GuuAGuuuCGAGGGAuCCAAUG 340 Scnl0a Sa Exon 1_T5 CunACCCGGUGUGUGCUGUAGA “3a ScnlQa Sa Exon 1_T6 BE Scnl0a Sa Exon 1_T7 UAGAUCCGuUCUACAGCACACA 342 Scnl0a Sa Exon 1_T8 uCuCuAuCuCCACCAGUGACuC 33 Scnl0a Sa Exon 1_T9 AAUGAGAAGAUGGAAUUCCCCA ET ScnlQa Sa Exen 2_T1 "345 | Scnl0a SaExon2_T2 uCuutCuGAUCAGGUUGAAAGGA 346 Scnl0a Sa Exen 3_T1 CuGACCuuCCAGAGAAAAWGA ES Scnl0a Sa Exon 3_T2 CAAuuICUCUGGAAGGUCAGU 348 Senl0a Sa Exon 3_13 CGAACUGACCWCCAGAGAAAA 349 Scnl0a Sa Exon 4_T2 CuGGCAAGAGGAuUmUGuUCuAA 350 Scnl0a Sa Exon 4_13 ACGCuAAAAUCCAGCCAGuCC "351 | Scal0aSaExon4_T4 CCuGAGAGAUCCuGGAACUGG "37 | Scnl0aSaExon4_T5S AuuuuAGCGUCAWACCCUGGC 7352 | Scal0aSaExon4_17 GCCuuGAuAAAGAUACUGGCAA 7353 | Scal0aSaExonS_T1 WGGCACAGCAAUAGAUCUCCG "354 | Scal0aSaExon5_T2 GGAuCUCAGGCCuGCGGACAuu “355 Scnl0a Sa Exon 5_T4 uGuuuuuAAUGCuCuAAGAACU 735 | Scal0aSa Exon 6_T1 CuCCACuCACGuuuuCuGuGAG “357 Scnl0a Sa Exon 6_T3 T7358 | Scal0aSa Exon 6_T4 CAuCAGCCAGuuuCuuCACuGA 7359 | Scal0aSaExon6_T5 AACuACUCAuCuCACAGAAAAC "360 | Scal0a Sa Exon 6_T6 GuCACAUCAGCCAGuuuCuuCA 39 Nav1.8 SaCas9 gRNAs SEQ ID NO: gRNA Name spacer sequence (5'-3") 361 Senl0a Sa Exon 6 T7 CAACCuUCAAAAAUAAAUGUC 362 363 364 365 366 367 368 369 370 33 371 372 373 374 375 376 377 378 379 380 31 39 3R1 3R2 40 383 384 385 386 387 34 388 389 390 391 392 303 304 305 306 397 308 35 36 300 40 Nav1.8 SaCas9 gRNAs 400 SEQ ID NO: gRNA Name spacer sequence (5'-3") 400 Scnl0a Sa Exon 14_T4 AuACuAwAuUCCAGAAGAAG Table 5: Names, sequences and targeted exons of primers used for sequencing analysis of CRISPR-mediated editing of the SCN9A gene (Navl.7) Navl.7 NGS Primers Primer Sequence _rrimer oeugUuene 401 1 A en MAA, 21 | . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 4 | Navl-7-Exon-2-1-NGS-R1 | GA TAGATGAAGGGCAGCTGTTIGC 403 | Nav1-7-Exon-2-2.NGs-Fl | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG . 1 a Ns yun 2.3 . . GTCICGTGGGCTCGGAGATGTGTATAAGAGACA i | Navl-7-Exon-22NGS-R1 | Gr TTATACAGAAGGAAGCCAACAG 405 | Nav1-7-Exon-3-NGs.F2 | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | Navl-7-Exon-3-NGS-F2 3 ; GTCTCGIGGGCTCGGAGATGTGTATAAGAGACA 48 | Navl-7-Exon-3-NGS-R2 | GA AAATAGCAAAAATTACACCATAAAGT wr | KeviomconsnGspy | TCGTCGOCAGCGTCAGATGTGTATAAGAGACAG | Navl-7-Exon-4-NGS-F2 4 i GTCTCGIGGGCTCGGAGATGTGTATAAGAGACA 40 | Navl-7-Exon-4-NGS-R2 | G10CCCATCTTCATAAATGCAGTAAC 409 | Nav1-7-Exon-5-NGs.Fl | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | Navl-7-Exon-5-NGS-F1 5 g GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 40 | Navl-7-Exon-5-NGS-Rl | GorGTGCTGCCTGAGATTTTCAT a1 | Navl-7-Exon-6-NGs.F2 | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | Navl-7-Exon-6-NGS-F2 6 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 4% | Navl-7-Exon-6-NGS-R2 | GorecCAAATAGTTGGAGTTATGAGT 413 | Navi-7-Exon-7-1-NGS.F2 | LFCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 1 A A A 7.1 , . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA | | 44 | Navl-7-Exon-7-1-NGSR2 | GororCTAGGGTATTCATTATGCTTICT is even aes | TOOTCGGCAGCGTCAGATGTGTATAAGAGACAG 1 earl LL Lhe PAL Se LL eh 72 : . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA | | 416 | Navl-7-Exon-7-2-NGS-R2 | GGoAACATTTCATTATTAAAAGAGAGCA AT | Navi-7-Exon-8-NGS-F1 | LCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | Navl-7-Exon-8-NGS-F1 8 4 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 4 | Navl-7-Exon-8-NGS-RL | G1TrGCAAACTGACTGAACATTCT vo evinces; | TOOTCGGCAGCGTCAGATGTGTATAAGAGACAG | Nav1-7-Exon-9-NGS-F3 9 y GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 20 Navl-7-Exon-9-NGS-R3 | G0AGGCTCTTAACATACACCAGG or Nav17-Exon-10-1.NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG oc a A TS AA PTAA 10-1 09 Navl-7-Exon-10-1-NGS- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 423 ——————— LL ——————— SEQ ID NO: Primer Sequence [ Exon | . : TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG “ot Navl-7-Exon-2-1-NGS-F1 | 0 ATcCAGGCCTCTTATGTGAGGAG 2 | . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 402 | Navl-7-Exon-2-1-NGS-R1 | GA TAGATGAAGGGCAGCTGTTTGC . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 403 | Nev Bron 2 NGS FL | 3 TOCTGAAAGA 22 | . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 404 | Navl-7-Exon-22NGS-R1 | Gr TTATACAGAAGGAAGCCAACAG . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 45 | Navl-7-Exon-3-NGS-F2 | 4 A CTGCTGATATIGATGTGAAAAA . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 48 | Navl-7-Exon-3-NGS-R2 | GA AAATAGCAAAAATTACACCATAAAGT . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG a | Navl-7-Exon-4-NGS-F2 | 10CTCAAATATTTCAAATICCCACTGT z . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 4 | Navl-7-Exon-4-NGS-R2 | G10CCCATCTTCATAAATGCAGTAAC . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 409 | Navl-7-Exon-5-NGS-Fl | 4 4 AGATTTACATGGTGGTTGTATTCTT 1 : GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 410 | Navl-7-Exon-5S-NGS-RL | GorGTGCTGCCTGAGATTTTCAT . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG eh | Navl-7-Exon-6-NGS-F2. | 4 GeeoCcAAACGTAGAAAATACCT . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 42 | Navl-7-Exon-6-NGS-R2 | GorecCAAATAGTTGGAGTTATGAGT . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 413 | Navl-7-Exon-7-1-NGSF2 | Grr GATTCAGAGGCTTTATGTC i . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA | Ld | Navl-7-Exon-7-1-NGSR2 | GororCTAGGGTATTCATTATGCTTICT . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG “8 | Navl-7-Exon-7-2NGS-F2 | G4 AGCTTTCTGATGTCATGATCC 7 | . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA | | 4s | Navl-7-Exon-7-2NGS-R2 | Gop ACATTTCATTATTAAAAGAGAGCA . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG “a7 | Navl-7-Exon-8-NGS-FL | 56A0CAGGCCTGAATTTGTAG 2 : GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA He | Navl-7-Exon-8-NGS-RL | G1TrGCAAACTGACTGAACATTCT . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 419 | Navl-7-Exon-9-NGS-F3. | GrecrcaacacacTercacet 0 . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 420 Navl-7-Exon-9-NGS-R3 | G0AGGCTCTTAACATACACCAGG on NavI7Exon-10-1.NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Fl TGCTCATGCCTGTCAAATTGAAATA to: | » Navi-7Exon-10-1-NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA RI GACATCTGTTGAAATTCTAATTCITICTGT Pp Navi-7Exon-102.NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 4 CTAGACGCTGCGTGCTGCT 102 2 Navi-7Exon-102.NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA Re GAAGGCCAAGCATATACCGCAGA 8 NavI7-Exon-11-1NGS- | TCGTCGGCAGCGTCAGATGIGTATAAGAGACAG | |, | B ATGTCCIGTCCTAGGGTTTCCT 41 Navl.7 NGS Primers a — Primer Sequence 426 427 or Fl GGCAGCGGCTGAATATACAAGT 112 | 179 Navl-7-Exon-11-2-NGS- | GICTCGTGGGCTCGGAGATGIGTATAAGAGACA 429 7 TTT” | AGAATCAAAAGAAGCTCTCCAGTG 113 | 0 Navl-7-Exonl13-NGS- | GICTCGTGGGCTCGGAGATGIGTATAAGAGACA 431 A A A A 12-1 43 Navl-7-Exon12-1-NGS- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 433 =r F2 AAGCAGCAGAACAAGTCTTTTTAGTT 122 | - Navl-7-Exon-12-2-NGS- | GICTCGTGGGCTCGGAGATGTGTATAAGAGACA 435 = TT | ACAGCATTTTTGGAGACAATGAGA 123 | _ Navl-7-Exonl2-3-NGS- | GICTCGTGGGCTCGGAGATGTGTATAAGAGACA 437 - A AA Se A 13-1 438 Navl-7-Exon-13-1-NGS- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 430 a F4 TCAAATACACAAGAAAAGGCGTTG 132 | wy Navl-7-Exon-13-2-NGS- | GICTCGTGGGCTCGGAGATGTGTATAAGAGACA 441 — — 14-1 442 Navl-7-Exon-14-1-NGS- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 443 hi F2 TCTTGATCTGGAATTGCTCTCCAT 14.2 | a Nav1-7-Exon-14-2-NGS- | GICICGTGGGCICGGAGATGTGTATAAGAGACA 445 ed lel teeeetietieheetieietietetetheied 15-1 446 Navl-7-Exon-15-1-NGS- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 447 SEQ ID NO: Primer Sequence [ Exon | 26 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R3 GTCAGCATCTCCCTTITCCTCTIC 27 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Fl GGCAGCGGCTGAATATACAAGT 12 | 28 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA RI GCTCGCCTATGCCCTTCGAC § TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ae Navl-7-Exonl1-3-NGS-F3 | 4GAATCAAAAGAAGCTCTCCAGTG us | £30 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R3 GTCACTCACTATCCTCTCCCGA y TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ai Navl-7-Exonl2-1-NGS-F6 | 4 G1 GTACTTCTATCAGTAGGTGCTT 13:4 a3 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R6 GGACCTACTGGCTTGGCTGAT 433 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG! F2 AAGCAGCAGAACAAGTCTTTTTAGTT on 434 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R2 GACCAGGGAGACCACACCGT : TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 435 Navl-7-Exonl2-3-NGS-F6 |, 0AGCATTTTTGGAGACAATGAGA Bd 436 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R6 GATGCCTGAGCTATGTAAAACGTC 437 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Fl CCCAGCAATCTAGGCTCTACT 34 | 438 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA RI GCCTTCCACAGTGTTTGITAATATGC 439 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG! F4 TCAAATACACAAGAAAAGGCGTTG v3.2 | 440 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA Ré GACAATTCCATCAGTATCCATTGGT wil TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Fl GGTTAGGAGTGAAACAGACAAATGG val | 242 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA RI GIGGTGTTCCATAGCCATAAATAATGTG 43 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG F2 TCTTGATCTGGAATTGCTCTCCAT i | 444 GTCTCGIGGGCTCGGAGATGTGTATAAGAGACA R2 GACAATGATGACAACTAAAAAGAGAAACT 245 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG F2 ATCATTGTGTTGATTITCCTGTTTTCT - | 246 GTCTCGIGGGCTCGGAGATGTGTATAAGAGACA R2 GCCAGTCTGAATGATCGCAGAAC 447 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG F2 TGCAGCTGAAATGGTATTAAAACTGA 54 | 3 Navl-7-Exon-15-2-NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R2 GTGCAAAACCAAAGAAATACCCCTT Table 6: Names, sequences and targeted exons of primers used for sequencing analysis of CRISPR-mediated editing of the SCN10A gene (Nav1.8) Nav1.8 NGS Primers Primer Sequence _frimer a. sequence —— —————————————— SEQ ID NO: Primer Sequence | Exon | 3 4 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 49 Navl-8-Exon-l-INGSF4 | GorGreaccTCICTGTGGTT | . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA - 450 | Nav-8-Exon-1-1-8Gs-Re | CE GGT 42 Navl.8 NGS Primers a — Primer Sequence 451 452 453 454 455 456 457 458 450 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 ————— LL —————— SEQ ID NO: Primer Sequence . : TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG i Navl-8-Exon-1-2-NGS-FL | 00pAGCAGGGAACAAAGAAA . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA sy | Navl-8-Exon-1-2-NGS-R1 | 6006 AGACTTCCTCTCCAAGA . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 453 | Navl-8-Exon-2-1-NGS-F3 | 500TGAGATAATGCCTCICATGT . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 454 | Navl-8-Exon-2-1-NGS-R3 | 6, CTGGACACAGTAGGCAAGG . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 4 | Navl-8-Exon-3-1-NGS-FL | 1670 ATCATTCAGCATCAAGGTG . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 46 | Navl-8-Exon-3-1-NGS-R1 | GA CAAAGACTGCCAAGTGAAGGA . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG “" | Navl-8-Exon-4-1-NGS-F3 | 0 aroceTOCTOCTOGAAGA . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA as | Nav]-8-Exon-4-1-NGS-R3 | GocoeTCTOCTATCACACATGE . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 9 | Navl-8-Exon-5-1-NGS-F3 | 4 GGCTAATGATACCCCAGGT : : GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 4a | Navl-8-Exon-5-1-NGSR3 | GA GTCTTTGCCCTGGAACCTT . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 461 | Navl-8-Exon-6-L-NGS-F4 | Grar6eTecaTaTaTGCTAC . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 462 | Navl-8-Exon-6-1-NGS-R4 | G4 4 0cCAGACCTTGGTCCCTATG . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG #3 | Navl-8-Exon-6-2NGS-F4 | oprosacaGeaaccTCAAAA . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 40 | Navl-8-Exon-6-2-NGS-R4 | GAT1TCCTTGCAAGAGGGATG . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 45 | Navl-8-Exon-7-1-NGSFL | \prGOATTCACCACACAAGG . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 44 | Navl-8-Exon-7-1-NGS-RL | GA1GOCAAGGACAAGATGGAG . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG i | Navl-8-Exon-8-1-NGS-FL | 1666CTACCTTGTCTGCAAT . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA He | Navl-8-Exon-8-1-NGS-R1 | 64 GoCTCCAACCAAGTCTGE : > TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 4 | Navl-8-Exon-9-1-NGS-F2 | 0 0rGGAGGAGGCTGACTTAAA . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA 470 | Navl-8-Exon-9-1-NGS-R2 | 6 G6GCCTCCTGGAACTTCTT . . TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 471 | Navl-8-Exon-9-2-NGS-F4 | 1604 GACCCTGAGGACTTCT . . GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA ir Navl-8-Exon-9-2-NGS-R4 | 6766GACAGTCTGCAACCTTCT Pp Navl 8 Exon-10-1.NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG FS TCATGCTAAGTCCAAGCAAATACT ” NavI-8-Exon-10-1.NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA RS GGCAGCTGCAATGGTGGGTAA - Navl8-Exon-11-1-NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG F6 TTCCAGCCTTCTIGCTCCTIT 5 Navi-8-Exon-11-1-NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA RS GAGTCAGGGTTGCTGGGTTGA - NavI-8-Exon-112.NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG FB CCCTGAGGGAGTCACAGATG a Navi-8-Exon-112.NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R3 GGCTCAAGGCTTCTAGGTGGA a Nav] BExon-121.NGS- | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG BR TTTGOCATGAAGATGTCAGG 43 Nav1.8 NGS Primers a Raa AT A Primer Sequence 480 481 482 483 484 485 486 487 SEQ ID NO: Primer Sequence 450 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R2 GTGCTCACATGGGAATTCATC 31 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG F2 AGAGGATGACCGCAGAATTG 2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R2 GATGCACAAGGTGATGGTGAG 3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG F4 CTTGACCAGCTTGTCTCAGAAG 454 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA R4 GACTGCACCCTGCCATCAT 485 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Fl ACCCCACAGATCCCACTGT 486 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA Rl GCACAGACAGGCTTCCCTTCTT 487 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Fl TGCTGAAATGGTCTTCAAAATC 20 Navl-8-Exon-14-2-NGS- | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACA Rl GTGAATCTGGGTGGGAGTTTC Table 7: Total list of 1,471 putative off-target sites predicted across the 40 guides 47 75350195 75350217 | 0725v 28652 | 28674 | chré 05286431 05286453 start end chr start end chr start end 61461790 _ 61461811 | ches 32666438 chi? 68363358 68363380 81905722 _ 81905743 | chrs 42894065 chi? 97668279 97668302 73085391 73085412 | ches 42899359 chiX 140493338 140493359 29235109 29235131 | chrs 78720216 chrX 15614904 15614926 45003779 45003802 | ches 8655482 chiX 30782422 30782443 47511671 47511692 | ches 9135657 chrX 31984015 31984036 55085146 55085169 [chr6 113222662 chiX 86190344 86190365 109228516 109228539 | chr 115538457 chry 19917588 19917609 142530467 142539488 | chr6 31688661 chrl 178061425 178061447 156144910 156144931 | chr 43831465 chrl 2402386 2402407 191243209 191243320 | chr6 87701119 chrl 72287683 72287705 196103556 196103579 | chr? 10594397 chrl 76614806 76614827 203787061 203787083 | chr? 12619084 chrl 89901148 89901169 214949817 214949839 [ che? 149003021 chrl0 85000194 _ 85000215 234666709 234666730 | chr? 18335788 chrll 108491260 108491281 28172483 28172506 | che? 24705842 chill 66423974 66423995 3057588 3057611 | chr? 286530 chrl2 71595067 71595090 36232821 36232842 | chu? 36193214 chri3 69934195 69934216 50098904 50098926 | chr? 38601793 chrid 66094377 66094398 73265656 73265678 | che? 47909042 chrl6 14656670 14656691 13432273 13432295 | chr? 748771 chri6 87107991 _ 87108013 18449036 18449057 | chr8 136059616 chil? 353076 353007 29297358 29297379 | chr§ 38318140 chrl9 13768686 13768707 32451442 32451465 | chrs 3984113 chi2 166284580 166284602 38350601 _ 38350622 | chr 113808805 chi3 10226168 10226189 49217595 49217616 | chrd 116737579 chr3 115343892 115343913 64269672 64269693 | chrd 12496083 chi3 134983630 134983660 5738568 5738589 | chr 129327837 chr3 178334452 178334474 5859152 5859173 | ch9 132858640 chi3 45900277 45909299 7585888 7585909 | chro 8978325 chr3 73176881 73176902 8136638 8136650 | chiX 134645573 chrd 81742352 81742373 8319683 8319704 | chrX 24998312 chrd 8245260 8245281 115208357 115208380 | chrX 88238872 chs 168066527 168066548 139072976 139072997 | chrY 15614017 chrs 168085915 168085937 30158407 _ 30158428 | chrl 203223874 chs 6207756 6207778 38760699 38760721 | chrl 43604017 chi6 149489057 149489079 58128755 58128776 [ chrl0 107165027 chr6 151771012 151771033 59247420 59247441 [ chr10 3981954 chi6 154959101 154959124 71889200 71889221 | chrll 12261472 chr6 71153933 71153956 - chri4 - _KI27 75350195 75350217 | 0725v 28632 | 28674 | chs 95286431 95286453 1_ran dom 120368696 129368717 | chris 20303769 chi7 151872799 151872820 138131152 138131173 [chrlS 21149388 chig 135291727 135291748 145211541 145211562 | chrl5 60232485 chrg 142002619 142002641 129368696 129368717 | chrl5 20303769 20303791 | chr? 151872799 151872820 138131152 138131173 | chrl5 21149388 21149410 | chr8 135291727 135291748 145211541 145211562 | chrl5 60232485 60232507 | chr8 142002619 142002641 48 start end chr | start end chr start end 175410598 175410619 | chr1S | 62708764 | 62708787 | chr 22622609 22622632 176012819 176012840 | chr15 | 69844005 | 69844027 | chr 48402295 48402317 23365348 23365370 | chr16 | 32301913 | 32301935 | chr® 50391280 59391312 8051122 8051143 | chr16 | 32860233 | 32860255 | chr8 74353643 74353665 109936561 109936582 | chr16 | 33508183 | 33508205 | chro 127215278 127215301 154754303 154754326 | chr16 | 33546176 | 33546198 | chrX 102000238 102000259 172938372 172938393 | chr16 | 34001286 | 34001308 | chrX = 110824137 110824158 67123377 67123398 | 0728v | 1122344 | 1122366 | chrX 0484434 0484457 1122344 | 1122366 | chrX 115441973 115441996 | 0728v | 1846473 | 1846495 | chrX 05109255 95109277 1846473 | 1846495 | chrX 128605720 128605741 | 0728v | 215852 | 215874 | chrl 163429927 163429948 215852 | 215874 | chrl 155825911 155825933 | chr18 | 12089271 | 12089293 | chrl 168165741 168165762 28497324 28497345 | chr1® | 14172226 | 14172248 | chrl 218399183 218399204 38687945 38687967 | chr19 | 271964 | 271985 | chrl 225001558 225901579 55800478 55890501 | chr19 | 29923127 | 29923148 | chrl 239825074 239825095 62089908 62089929 | chr19 | 39416865 | 39416886 | chrl 246176999 246177020 118119892 118119913 | chr2 75306193 | 75306215 | chrl 66367983 66368005 137243739 137243760 | chr? 821670 | 821691 | chr10 105792310 105792331 14322295 14322316 | chr20 | 61883165 | 61883187 | chrl0 119690965 119690986 152870674 152870695 | chr21 | 14057110 | 14057132 | chrl0 15629626 15629649 55338095 55338117 | chr21 | 41498789 | 41498811 | chrl0Q 20137117 20137140 91189289 91189310 | chr21 | 8657234 | 8657256 | chr10 56925205 56925227 118595807 118595830 | chr22 | 10634363 | 10634385 | chrlQ 71769157 71769178 21920926 21920947 | chr22 | 16529314 | 16529336 | chr10 06692195 96692217 71336124 71336145 | chr22 | 22292514 | 22292536 | chril 11161353 11161374 8444382 8444403 | chr3 154767190 | 154767211 | chrll 16266249 16266271 90937374 90937396 | chr3 38522285 | 38522306 | chrll 41679797 41679819 092334917 92334939 | chr3 38752218 | 38752240 | chrll 01540261 01540283 114450778 114450799 | chr3 62350580 | 62350602 | chr12 18730599 18730622 122134671 122134694 | chrd 149562539 | 149562561 | chr12 31779884 31779905 34403481 34403502 | chr 1547652 | 1547673 | chrl12 51699567 51699588 759902624 75992645 | chrd 1735133 | 1735154 | chri12 66038774 66038795 115546438 115546460 | chrs 168627963 | 168627985 | chr12 83661770 83661791 53085475 53085496 | chr5 23795022 | 23795043 | chr13 56206698 56206720 20804459 20804480 | chré 142507007 | 142507030 | chrl3 02515738 092515759 245125422 245125444 | chré 45418675 | 45418697 | chr13 09030308 09930329 97153588 97153609 | chr7 135558534 | 135558555 | chr14 100709342 100709363 130405683 130405704 | chr8 124041822 | 124041843 | chr14 60048496 60948517 41542249 41542270 | chr8 143306748 | 143306771 | chr14 63458373 63458394 49 60494975 60494996 | chr8 8236128 | 8236151 | chr14 | 91094537 91094558 77987866 77987887 | chr9 127698860 | 127698882 | chrlS | 21654639 21654661 14924924 14924945 | chro 40589872 | 40589894 | chr15 | 22097135 22097157 16323575 16323596 | chr9 63047613 | 63047635 | chr1S | 72236372 72236393 16363575 16363596 | chro 63390838 | 63390860 | chr15 | 99388177 99388200 $l 18345071 18345092 | chr 64717354 | 64717376 | 0727 | 388891 388913 18388585 18388606 | chro 65201663 | 65201685 | chr16 | 47873889 47873910 2112027 2112048 | chro 65820018 | 65820040 | chr17 | 49809267 49809289 50712259 50712280 | chr9 93336083 | 93336105 | chr17 | 55088691 55088714 87750777 87750798 | chro 03515538 | 93515560 | chr17 | 67339549 67339570 87750777 87750799 | chr9 98612376 | 98612398 | chr18 | 32630505 32630528 7139560 7139583 | =<’ 136081 | 136103 | chri8 | S1862106 51862127 136081 | 136103 | chrl8 79173446 79173467 | chrX 134771228 | 134771250 | chr18 | 73818723 73818744 41198803 41198824 | chrY 11438592 | 11438614 | chr19 | 18493880 18493902 156068013 156068034 | chrY 26403323 | 26403345 | chr19 | 44719395 44719417 156548581 156548602 | chrl 114755705 | 114755728 | chr? 125952758 125952779 54177434 54177455 | chrl 80195820 | 80195841 | chr2 139799913 139799936 15214248 15214269 | chr10 46094875 | 46094896 | chr? 165310320 165310342 24606031 24606052 | chrl0 48196282 | 48196304 | chr? 166051970 166051991 50089991 50090013 | chr10 80201966 | 80201989 | chr2 166303283 166303305 30586599 39586620 | chrl0 8311347 | 8311368 | chr? 172323440 172323461 155889542 155889563 | chrl10 95610284 | 95610306 | chr? 179653735 179653756 38755941 38755963 | chrl0 99188037 | 99188058 | chr? 198281873 198281895 30281879 39281900 | chr1l ~~ 111447509 | 111447530 | chr? 206523132 206523155 688590694 68859715 | chr11 116742303 | 116742326 | chr? 211589335 211589356 88823205 88823316 | chrll 117873838 | 117873861 | chr? 223811794 223811815 103540423 103540444 | chrl1 34171625 | 34171647 | chr2 239835025 239835048 84165474 84165495 | chrll 99967904 | 99967925 | chr? 85720060 85720081 08912731 98912753 | chr12 10226257 | 10226278 | chr2 ORR8602 ORR8G24 139451004 139451025 | chr12 1993974 | 1993996 | chr20 | 30613675 30613696 140617217 140617238 | chr12 87701468 | 87701489 | chr21 | 9072499 9072522 144808058 144808079 | chrl13 22987248 | 22987269 | chr22 | 19036400 19036421 42506480 42506501 | chr13 44594630 | 44594651 | chr22 | 19345323 19345344 121268473 121268495 | chrl13 71034293 | 71034316 | chr3 118483785 118483807 125767930 125767952 | chr14 18625660 | 18625681 | chr3 12201058 12201079 15713241 15713262 | chr14 19689363 | 19689384 | chr3 172628542 172628563 75081273 75081294 | chr14 45436755 | 45436777 | chr3 187797026 187797047 20478318 20478339 | chrld 55804739 | 55804761 | chr3 88438945 R88438966 175444473 175444494 | chrl5 27948284 | 27948307 | chr3 09743398 00743421 201448312 201448333 | chrl15 47193064 | 47193085 | chrd 104263476 104263498 start end chr start end chr start end 33405410 33405431 | chr8 3193432 84372203 84372224 60494975 60494996 | chr8 8236128 91094537 91094558 77987866 77987887 [chrd 127698860 21654639 21654661 14924924 14924945 | chrd 40589872 22097135 22097157 16323575 __ 16323596 | chrd 63047613 72236372 72236393 16363575 16363596 | chr9 63390838 99388177 99388200 - cls | _K127 18345071 18345092 | chi 64717354 | 64717376 | 0727v 388891 388913 1_ran _ dom a 18388585 18388606 | chrd 65201663 47873880 47873910 2112027 2112048 | chrd 65820018 49800267 49809289 50712259 50712280 | chd 93336083 55088691 55088714 87750777 87750798 | chrd 93515538 67339540 67339570 87750777 _ 87750799 | chrd 98612376 32630505 32630528 - chrUn ’ - 7139560 7139583 | X27 136081 | 136103 | ents | sise2i06 Sise2127 1 79173446 79173467 [ cheX 134771228 73818723 73818744 41198803 41198824 | chrY 11438592 18493880 18493902 156068013 _ 156068034 | chrY 26403323 44719305 44719417 156548581 156548602 | chrl 114755705 chi? 125952758 125952779 54177434 54177455 | chrl 80195820 chi2 139799913 139799936 15214248 15214269 [chrl0 46094875 chi2 165310320 165310342 24606031 24606052 [ chrl0 48196282 chr2 166051970 166051991 50089991 _ 50090013 | chrl0_ _ 80201966 chi2 166303283 166303305 30586599 39586620 | chrl0 8311347 chi? 172323440 172323461 155889542 155889563 | chrl0 95610284 chi2 179653735 179653756 38755941 38755063 | chrl0 99188037 chr? 198281873 198281895 30281879 39281900 | chrll 111447509 chi2 206523132 206523155 68859604 68850715 | chril 116742303 chr2 211589335 211589356 88823205 _ 88823316 | chrll 117873838 chi2 223811794 223811815 103540423 103540444 | chril 34171625 chr2 230835025 239835048 84165474 _ 84165495 | chrll 99967904 chi2 85720060 85720081 98912731 98912753 | chrl2 10226257 chr2 9888602 9888624 139451004 139451025 | chrl2 1993974 30613675 30613696 140617217 140617238 | chrl2 87701468 9072499 9072522 144808058 144808079 | chrl3 22987248 19036400 19036421 42506480 42506501 [chrl3 44594630 10345323 10345344 121268473 121268495 | chrl3 71034293 chr3 118483785 118483807 125767930 125767952 | chrl4 18625660 chr3 12201058 12201079 15713241 15713262 [ chri4 19689363 chr3 172628542 172628563 75081273 75081294 | chrl4 45436755 chr3 187797026 _ 187797047 20478318 20478339 [chri4 55804739 chr3 88438945 88438066 175444473 175444494 [ chrlS 27948284 chr3 99743398 99743421 201448312 201448333 | chrl5 47193064 chrd 104263476 104263498 83 start end chr start end chr start end 131386169 131386190 | chrl 229761813 chris 149320088 149320109 157848702 157848723 | chrl 236611925 chrs 34543122 34543143 144505858 144505879 | chrl 44003243 chris 38374328 38374349 28106012 _ 28106033 [ chrl 60484489 chrs 51582987 51583008 5261424 5261446 | chrl 77272589 chris 51584136 51584157 56972149 56972171 | chr 99805299 chrs 5684323 5684344 63604777 63604799 [ chr10 7234091 chs 05184977 95184998 11380189 11380210 | chrll 124639215 chr6 10345815 10345837 74835062 74835083 [chrll 128565919 chi6 111939969 111939990 113789694 113789716 | chrll 32183988 chr6 144851102 144851123 151492228 151492250 | chrll 98824964 chi6 169660524 169660545 17434745 17434767 [chrl2 52539784 chi6 44791613 44791636 237232784 237232806 | chrl3 53239100 chr6 54214841 54214862 51343936 51343958 [chrl3 67710449 chi6 85108470 85108493 62060283 62060305 | chrl4 101542861 chr? 101293356 101293377 12202452 12202474 [chrl4 94101963 chi7 101769888 101769909 34500129 34500150 | chrl5 53389064 chi? 71436053 71436074 908595 908617 | chrl5 59609984 chi? 77258325 77258348 97430628 97430649 [chris 83718885 chr8 103188339 103188360 131800586 131800608 | chrl7 13619613 chi8 58208948 58208971 45059654 45059675 | chrig 1302211 chrg 90410702 90410725 46293596 46293618 | chrl8 34382228 hid 16091078 16091101 67532922 67532943 | chr2 136683476 chr9 87763613 _ 87763634 68473701 68473723 [chr2 166280389 chr9 89771805 89771827 76869199 76869221 | chr20 21609437 chrX 114583997 114584020 76891737 76891759 | chr3 15056861 chrX 24592372 24592393 85780949 _ 85780971 | chr3 162472197 chiX 26644776 26644797 88640473 88640495 | chr3 192144038 chrX 55605885 55695906 02366842 _ 92366863 | chr3 193972967 chiX 6695896 6695917 104031167 104031188 | chr3 31318637 chrX 97311438 97311459 131154018 131154039 | chr3 33928700 chiX 9977092 9977114 131507086 131507107 | chr3 66347945 chry 11353457 11353478 22210480 _ 22210502 [chrd 172137983 chrll 9031037 __ 9031063 2412249 2412270 | chrd 37832335 chr2 135142584 135142611 37569101 37569123 | chr 53708420 chi2 166281710 166281737 50209171 _ 50209193 | chs _ 133278354 chi2 166286555 166286581 79672940 79672961 | chs 155337749 chr2 166286555 166286582 93641177 _ 93641198 | ches 39782986 chr4 139864810 139864837 95672692 95672713 | chrs 67714762 chrs 163173454 163173480 21222393 21222415 | chr6 35730038 chrl7 63959375 63959402 24651496 24651519 | chr6 44811459 chr2 166278250 166278277 20651059 29651081 | chr? 149925597 chrd 46082495 46082522 84115549 84115570 | chr? 152767248 chr2 166284785 166284812 34994321 34994343 | chr7 156408013 chs 120440047 120440073 75554232 75554254 | chr? 28741171 chrX 148562427 148562453 36211196 36211217 | chr8 29989405 chrl9 13426131 13426157 Results Screening of SpCas9 and SaCas9 gRNAs targeted to SCN9A and SCN10A in iPSCs Following two rounds of gRNA screening in iPSCs and sequencing analysis, the mean average cutting efficiency was calculated based on four replicates for each sample looking at total percentage of insertions and deletions (indels) at the predicted cut site of each gRNA. For the purposes of knocking out the SCN9A and SCN10A genes, the average percentage of indels that would result in a frameshift mutation was also calculated. Guide RNAs were ranked on both mean total indel percentage and mean frameshift-causing indel percentage. Guide RNAs are listed in rank order based on mean frameshift-causing indel percentages and a scrambled non-targeting gRNA as well as untreated cells were included as negative controls (Tables 8-11). Table 8: Mean total indel percentage and mean frameshift-causing indel percentages generated by SpCas9 gRNAs targeting SCN9A in iPSCs Mean —- a Rank Areal Rank Awaliih | Target | Target Mean total | frameshift- based on based on gRNA name 8 8 Cas9 indel causing frameshift gene exon | pm. total 0 a Reig ciactond Cede 00 total | gene | exon | | percentage | indel a causing ¥ al ih indels oo 11 SpCas R1.86% 76.55% 3 lviean Rank Rank | Target | Target Mean total | frameshift | wasen ol based on gRNA name 8 8 Cas9 indel causing | frameshift gene exon total 2 percentage indel indels -causing ercentage indels Scn9a_Sp_Exon_11_T9 | SCN9A 11 SpCas 81.86% 76.55% 3 * Q 9 12 SpCas RO.50% 76.05% 4 3 9 11 SpCas 78.51% 74.56% 5 3 Zz Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 80.50% 76.05% s 9 Scn9a_Sp_Exon_11_T6 | SCN9A TE SpCas 78.51% 74.56% ' 9 11 SpCas 83.29% 73.18% 4 9 12 SpCas 81.94% 73.08% 32 & 9 11 SpCas 76.90% 72.51% 8 6 9 11 SpCas 78.01% 70.14% 7 7 9 14 SpCas 15.27% 69.46% 9 8 Scn9a_Sp_Exon_11_T1 | SCN9A 11 pCa 83.20% 73.18% SrmTTa SCN9A 12 or 81.94% 73.08% TE 1_T1 | SCN9A 11 or 76.90% TT251% TTT 1_T1 | SCN9A 11 on 7801% 70.14% ST SCN9A 4 Sew 7527% 69.46% 9 7 SpCas 74.45% 69.19% 11 9 = Scn9a_Sp_Exon_7_T5 SCN9A 7 SpCas 74.45% 69.19% ~ 9 2 SpCas 73.68% 69.08% 12 10 =z Scn9a_Sp_Exon_2_T10 | SCN9A 2 SpCas 73.68% 69.08% N 9 12 SpCas 71.34% 69.01% 16 11 9 12 SpCas 75.20% 68.85% 10 12 9 12 SpCas 70.60% 67.13% 17 13 9 9 SpCas 70.41% 66.70% 18 14 Scn9a_Sp_Exon_12_T1 | SCN9A 2 pCa 7134% 69.01% ETE SCN9A 2 oy 75.20% 68.85% ETE SCN9A 2 on 70.60% 67.13% tno SCN9A 9 Soo 7041% 66.70% 9 86 ee—— Mean Rank based on gRNA name | LALLY | adil | Cas9 | indel : causing | Target | Target gene exon ene | exon | [A ed 8 | | | percentage | indel | causing based on | frameshift -causing FE indels 11 SpCas 72.32% 64.90% 15 viean | Target | Target Mean total | frameshift- gRNA name 8 8 Cas9 indel causing gene exon : percentage indel ercentage Scn9a_Sp_Exon_11_T2 | SCN9A 11 SpCas 72.32% 64.90% S 9 15 SpCas 70.07% 64.78% 16 Z Scn9a_Sp_Exon_15_T1 | SCN9A 15 SpCas 70.07% 64.78% 18 9 9 SpCas 66.06% 60.75% 17 Z Scn9a_Sp_Exon_9_T14 | SCN9A 9 SpCas 66.06% 60.75% Es 9 Z Scn9a_Sp_Exon SCN9A 12 SpCas 68.39% 60.72% 18 on ra 12.T28 g ! [3 12 SpCas 64.19% 60.35% 19 Leo Z Scn9a_Sp_Exon_12_T1 | SCN9A 12 SpCas 64.19% 60.35% > a 3 B I I Ig 11 SpCas 71.86% S50 88% 20 = Z Scn9a_Sp_Exon_11_T5 | SCN9A 11 SpCas 71.86% 59.88% 9 12 SpCas 68.22% 58.77% 21 Zz Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 68.22% 58.77% = 4 B I I Ig * Z Scn9a_Sp_Exon_2_T2 | SCN9A 2 SpCas 62.59% 58.70% 22 es 9 12 SpCas 78.19% 58.69% 23 al Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 78.19% 58.69% oy a 9 12 SpCas 67.28% 58.34% 24 s zx Scn9a_Sp_Exon SCN9A 12 SpCas 67.28% 58.34% A ~ 12. T27 ! : IL Tg 9 SpCas 63.22% 57.35% 38 Lat! oe Scn9a_Sp_Exon_9_T11 | SCN9A 9 SpCas 63.22% 57.35% A 9 12 SpCas 61.57% 57.18% 26 — Scn9a_Sp_Exon_12_T1 | SCN9A 12 SpCas 61.57% 57.18% ~ 9 12 SpCas 64.98% 56.37% 27 = Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 64.98% 56.37% - " 3 ! : og 14 SpCas 68.34% 55.35% 28 = = Scn9a_Sp_Exon_14_T3 | SCN9A 14 SpCas 68.34% 55.35% " 9 10 SpCas 64.20% 54.01% 29 = Scn9a_Sp_Exon_10_T2 | SCN9A 10 SpCas 64.20% 54.01% ° 9 12 SpCas 61.66% 53.77% 30 = Scn9a_Sp_Exon_12_T4 | SCN9A 12 SpCas 61.66% 53.77% " 9 12 SpCas 59.99% 53.24% 31 = Scn9a_Sp_Exon_12_T8 | SCN9A 12 SpCas 59.99% 53.24% 5 9 11 SpCas 50.73% 52 88% 32 = Scn9a_Sp_Exon_11_T1 | SCN9A 11 SpCas 59.73% 52.88% x 9 0 B I ? rg 3 SpCas 63.45% 52.60% 33 — = Scn9a_Sp_Exon_2_T14 | SCN9A 2 SpCas 63.45% 52.60% ey 9 Zz Scn9a_Sp_Exon_5_T3 | SCN9A 5 SpCas 56.95% 51.72% 34 En 9 12 SpCas 57.05% 51.39% 35 = Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 57.05% 51.39% x 9 11 SpCas 67.51% 51.11% 36 =z Scn9a_Sp_Exon_11_T1 | SCN9A 11 SpCas 67.51% 51.11% = i 5 B I Ly Ig 11 SpCas 54.46% 50.05% 37 ~ = Scn9a_Sp_Exon_11_T3 | SCN9A 11 SpCas 54.46% 50.05% i. 9 =z Scn9a_Sp_Exon_9_T6 | SCN9A 9 SpCas 63.44% 49.88% 38 A 9 = Scn9a_Sp_Exon 9_T5 | SCN9A 9 SpCas 53.89% 49.71% 39 9 = Scn9a_Sp_Exon_7_T2 | SCN9A 7 SpCas 54.86% 47.44% 40 a 9 = Scn9a_Sp_Exon_2_T4 SCN9A 2 SpCas 57.70% 46.83% 41 - 9 = Scn9a_Sp_Exon_2_T1 SCN9A 2 SpCas 66.37% 45.78% 42 “ 9 87 eneee— Mean Rank based on gRNA name | LALLY | adil | Cas9 | indel : causing | Target | Target gene exon ene | exon | [A ed 8 | | | percentage | indel | causing based on | frameshift -causing FE indels Sen9a_Sp_Exon_9_T2 SCN9A 9 SpCas 58.26% 45.73% 43 viean | Target | Target Mean total | frameshift- gRNA name 8 8 Cas9 indel causing gene exon : percentage indel ercentage Scn9a_Sp_Exon_9_T2 | SCN9A 9 SpCas 58.26% 45.73% S 9 Z Scn9a_Sp_Exon_4_T5 | SCN9A 4 SpCas 49.69% 45.71% 44 18 9 Z Scn9a_Sp_Exon_7_T6 | SCN9A 7 SpCas 60.22% 45.52% 45 Es 9 12 SpCas 53.04% 4527% 46 Z Scn9a_Sp_Exon_12_T1 | SCN9A 12 SpCas 53.94% 45.27% Tn "3 0 B I I Ig ~ Z Scn9a_Sp_Exon_4_T3 | SCN9A 4 SpCas 50.92% 45.04% 47 i 9 11 SpCas 50.05% 43.60% 48 = —_— Scn9a_Sp_Exon_11_T1 | SCN9A 11 SpCas 59.05% 43.60% ~ 2 B I I Ig 9 SpCas 60.77% 43.49% 49 = Zz Scn9a_Sp_Exon_9_T13 | SCN9A 9 SpCas 60.77% 43.49% 9 11 SpCas 50.76% 43.49% 50 Z Scn9a_Sp_Exon_11_T7 | SCN9A 11 SpCas 50.76% 43.49% es 9 15 SpCas 59.54% 43.34% 51 al Scn9a_Sp_Exon_15_T2 | SCN9A 15 SpCas 59.54% 43.34% a 9 12 SpCas 61.29% 42.92% 52 Lal Scn9a_Sp_Exon_12_T1 | SCN9A 12 SpCas 61.29% 42.92% ~ 6 B ! ! 9 12 SpCas 59.59% 42.45% 53 ~ oe Scn9a_Sp_Exon_12_T1 | SCN9A 12 SpCas 59.59% 42.45% o A 9 1] | 9 2 SpCas 44.47% 41.45% 54 2 — Scn9a_Sp_Exon_2_T15 | SCN9A 2 SpCas 44.47% 41.45% ~ 9 14 SpCas 46.19% 40.97% 55 = Scn9a_Sp_Exon_14_T2 | SCN9A 14 SpCas 46.19% 40.97% " 9 2 SpCas 55.38% 40.79% 56 = Scn9a_Sp_Exon_2_T13 | SCN9A 2 SpCas 55.38% 40.79% " 9 9 SpCas 44.16% 39.70% 57 = Scn9a_Sp_Exon_9_T12 | SCN9A 9 SpCas 44.16% 39.70% ° 9 = Scn9a_Sp_Exon_9_T4 | SCN9A 9 SpCas 50.13% 39.54% 58 " 9 3 SpCas 53.70% 39.17% 59 = Scn9a_Sp_Exon_2_T11 | SCN9A 2 SpCas 53.70% 39.17% 5 9 10 SpCas 55.73% 38.73% 60 = Scn9a_Sp_Exon_10_T5 | SCN9A 10 SpCas 55.73% 38.73% 9 9 Zz Scn9a_Sp_Exon_5_T1 | SCN9A 5 SpCas 66.04% 37.17% 61 A 9 12 SpCas 72.23% 37.12% 62 Zz Scn9a_Sp_Exon 12_T7 | SCN9A 12 SpCas 72.23% 37.12% En 9 7 SpCas 50.50% 37.01% 63 = Scn9a_Sp_Exon_7_T1 | SCN9A 7 SpCas 50.50% 37.01% x 9 15 SpCas 54.50% 36.77% 64 = Scn9a_Sp_Exon_15_T3 | SCN9A 15 SpCas 54.50% 36.77% x 9 12 SpCas 42.40% 35.16% 65 =z Scn9a_Sp_Exon_12_T3 | SCN9A 12 SpCas 42.40% 35.16% Rn 9 = Scn9a_Sp_Exon_7_T3 | SCN9A 7 SpCas 46.33% 34.84% 66 3 9 = Scn9a_Sp_Exon_9_T9 SCN9A 9 SpCas 38.80% 34.59% 67 9 = Scn9a_Sp_Exon_5_T2 SCN9A 5 SpCas 39.80% 34.24% 68 0 9 = Scn9a_Sp_Exon_2_T9 | SCN9A 2 SpCas 45.47% 33.41% 69 - 9 12 SpCas 38.68% 33.01% 70 — _— Scn9a_Sp_Exon 12_T9 | SCN9A 12 SpCas 38.68% 33.01% “ 9 s8 ere— Mean Rank based on gRNA name | LALLY | adil | Cas9 | indel : causing | Target | Target gene exon ene | exon | [A ed 8 | | | percentage | indel | causing based on | frameshift -causing FE indels 12 SpCas 33.67% 31.96% 71 viean | Target | Target Mean total | frameshift- gRNA name 8 8 Cas9 indel causing gene exon : percentage indel ercentage Scn9a_Sp_Exon_12_T5 | SCN9A 12 SpCas 33.67% 31.96% S 9 14 SpCas 44.55% 31.78% 72 Z Scn9a_Sp_Exon_14_T5 | SCN9A 14 SpCas 44.55% 31.78% 18 9 Z Scn9a_Sp_Exon_2_T8 | SCN9A 2 SpCas 38.76% 31.73% 73 A 9 9 SpCas 30.08% 31.56% 74 Z Scn9a_Sp_Exon_9_T15 | SCN9A 9 SpCas 39.98% 31.56% 5% 9 Z Scn9a_Sp_Exon SCN9A 12 SpCas 33.90% 31.22% 75 pian di 35 9 2 SpCas 30.76% 31.02% 76 12 SpCas 68.21% 30.76% 77 12 T14 ; ! 3 Scn9a_Sp_Exon_2_T12 | SCN9A 2 SpCas 39.76% 31.02% 9 Scn9a_Sp_Exon SCN9A 12 SpCas 68.21% 30.76% pot. 12. TI8 [ 3 I “9g 12 SpCas 39.07% 30.33% 78 e100 z Scn9a_Sp_Exon SCN9A 12 SpCas 39.07% 30.33% nr 12. TIS [ 3 I “9g 12 SpCas 43.78% 30.13% 79 en al Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 43.78% 30.13% = a 6 B ! ! 9 ~ Lal Scn9a_Sp_Exon_5_T4 | SCN9A 5 SpCas 38.57% 27.51% 80 ~ 9 12 SpCas 31.83% 26.92% 81 oe Scn9a_Sp_Exon_12_T6 | SCN9A 12 SpCas 31.83% 26.92% A 9 — Scn9a_Sp_Exon_9_T1 SCN9A 9 SpCas 40.20% 25.44% 82 ~ 9 = Scn9a_Sp_Exon_2_T7 | SCN9A 2 SpCas 33.06% 25.35% 83 " 9 = Scn9a_Sp_Exon_4_T7 | SCN9A 4 SpCas 26.35% 24.78% 84 " 9 = Scn9a_Sp_Exon_4_T1 SCN9A 4 SpCas 28.34% 23.77% 85 ° 9 = Scn9a_Sp_Exon_2_T3 SCN9A 2 SpCas 44.01% 23.46% 86 " 9 12 SpCas 24.59% 22.80% 87 = Scn9a_Sp_Exon_12_T2 | SCN9A 12 SpCas 24.59% 22.80% 5 2 B I I rg 14 SpCas 27.07% 22.67% 88 “= Zz Scn9a_Sp_Exon_14_T4 | SCN9A 14 SpCas 27.07% 22.67% rn 9 = Scn9a_Sp_Exon_4_T2 SCN9A 4 SpCas 25.94% 22.12% 89 ey 9 = Scn9a_Sp_Exon_4_T4 | SCN9A 4 SpCas 24.59% 19.81% 90 or 9 = Scn9a_Sp_Exon_2_T5 SCN9A 2 SpCas 21.60% 19.28% 91 x 9 =z Scn9a_Sp_Exon_9_T3 | SCN9A 9 SpCas 24.82% 18.98% 92 i 9 = Scn9a_Sp_Exon_9_T8 | SCN9A 9 SpCas 31.39% 18.79% 93 i. 9 10 SpCas 22.68% 16.55% 94 = Scn9a_Sp_Exon_10_T4 | SCN9A 10 SpCas 22.68% 3 9 = Scn9a_Sp_Exon_9_T7 | SCN9A 9 SpCas 24.72% 15.94% 95 9 14 SpCas 17.72% 1291% 96 = Scn9a_Sp_Exon_14_T6 | SCN9A 14 SpCas 17.72% 0 9 = Scn9a_Sp_Exon_4_T6 SCN9A 4 SpCas 9.53% 7.42% 97 - 9 — _— —_— Scn9a_Sp_Exon_2_T6 SCN9A 2 SpCas 7.09% 5.35% 98 “ 9 89 eree— AWA tettr GRNA name | Target | Target Mean total | frameshift- Burk ased 0 gene a Cas9 indel causing based on Kin bit percentage | indel total tn | -causing i bn indels oo 10 SpCas 1.29% 1.22% 909 99 9 N / A | N / A SpCas 0.27% 0.23% N / A N / A Sr— =z N / A | N / A SpCas 0.27% ~ Scrambled control N / A | F 9 Z Untreated N / A N / A N / A 0.18% 0.16% N / A N / A Table 9: Mean total indel percentage and mean frameshift-causing indel percentages generated by SaCas9 gRNAs targeting SCN9A in iPSCs JWELaLr Rank Theil | Target | Targe Mean total | frameshift- | basea on based on gRNA name gene | tevon | Cas9 indel causing total frameshift percentage | indel Lona -causing i LA USILS indels indels 55.50% 49.49% 2 61.96% 49.44% 2 54.10% 42.37% 3 3 48.41% 34.60% 4 4 42.29% 33.08% 5 5 33.66% 28.42% T 6 30.86% 25.30% 8 7 27.99%, 24.43% 11 8 28.33% 23.51% 10 9 41.10% 21.52% 6 10 24.81% 20.49% 16 11 25 26% 20.32% 15 12 20.70% 19.06% 20 13 23.85% 18.85% 18 14 26.58% 17.84% 14 15 27.04% 16.09% 13 16 21.90% 15.56% 19 17 19.09% 15.54% 22 18 28.51% 14.30% 9 19 17.45% 14.16% 23 20 16.87% 13.67% 24 21 14.96% 12.34% 26 22 20.59% 10.46% 21 23 12.55% 9.60% 27 24 27.75% 921% 12 as 16.55% 8.77% 25 26 9.899% 8.22% 30 27 24.15% 6.75% 17 28 9.03% 6.63% 32 29 12.12% 6.59% 29 30 8.74% 6.55% 33 31 60 Scn9a_Sa_ Exon 2 T1 SCN9A SaCas9 Scn9a_Sa_ Exon 5 _T4 Scn9a_Sa_ Exon 4 _T7 'Scn9a_Sa Exon 15 TS 'Scn9a_Sa Exon 5 TS 'Scn9a_Sa Exon 6 TS Scn9a_Sa Exon 5 T7 Scn9a_Sa Exon 4 T6 'Scn9a_Sa Exon 4 TS Scn9a Sa Exon 10 T3 Scn9a_Sa_Exon 8 T1 Scn9a_Sa_Exon_7_T4 Scn9a_Sa_Exon_11_T5 Scn9a_Sa_Exon_15 TI Scn9a_Sa_Exon 3 T1 Scn9a_Sa_Exon_ 2 T3 Scn9a_Sa_Exon 4 _T1 Scn9a_Sa_Exon_6_T2 Scn9a_Sa_Exon_ 7 _T7 'Scn9a_Sa Exon 7 T2 'Scn9a_Sa Exon 7 T8 Scn9a_Sa Exon 14 T8 Scn9a_Sa Exon 14 TI 0 Scn9a_Sa_Exon_8 T3 Scn9a_Sa Exon 14 TS Scrambled control N / A —— Scn9a_Sa_Exon_14_T3 Scn9a_Sa_Exon_2_T4 Scn9a_Sa_Exon_8_T3 Scn9a_Sa_Exon_l4_TS Scn9a_Sa_Exon_14_T9 Scrambled control N / A Untreated N / A N / A Table 10: Mean total indel percentage and mean frameshift-causing indel percentages generated by SpCas9 gRNAs targeting SCN10A in iPSCs Mean =. Rank ASA Rank Aalin Mean total | frameshift based Target | Target | | ased on RNA name | | i eash based on fs 8! Argel | TATESL | Casg | indel | -causing | “poo "| frameshift gene exon | rte | whined. nda | percentage % total LE 8 | indel ' | -causing Mean Rank Rank | Mean total | frameshift based on + = based on p indel -causing total frameshift | percentage | indel indel -causing | indels ay 75.77% 73.46% 70.79% 67.64% 5 3 75.21% 67.26% 3 3 69.16% 66.79% 7 4 69.47% 65.31% 6 5 68.89% 63.21% 8 6 72.63% 62.38% 3 7 64.42% 61.62% 18 8 66.31% 61.10% 12 9 66.83% 60.57% 9 10 66.35% 50.76% ii 11 65.19% 50.51% 15 12 66.52% 59.43% 10 13 62.43% 58. R4% 24 14 64.78% 58.60% 17 15 65.43% 58.01% 14 16 61.86% 57.86% 25 17 63.17% 57.50% 22 18 71.62% 56.93% 4 19 61.76% 55.63% 26 20 60.22% 54.64% 33 21 60.19% 54.34% 34 22 57.14% 53.58% 44 23 58.03% 53.20, 38 24 56.45% 52.36% 48 25 56.62% 51.99% 47 26 63.41% 51.82% 20 37 60.51% 51.36% 32 28 56.11% 50.72% 50 29 57.60% 50.69% 41 30 63.38% 50.51% 21 31 57.69% 49.95% 40 32 59.24% 49.80% 36 33 53.70% 49.80% 67 34 65.73% 49.73% 13 35 56.68% 49.55% 46 36 54.89% 49.53% 60 37 60.11% 40.299, 35 38 62.96% 49.26% 23 39 55.929 48.35% 51 40 57.55% 48.19% 42 41 62 ivicall | Mean total | rameshite indel causing [paso Ree i I sean Mean Rank Target Target | Mean total | frameshift based or 8 8 Cas? indel -causing frameshif gene exon F 3 | percentage | indel ' -causing based on frameshift -causing FE indels 42 43 44 45 46 47 48 60.99% 45.94% | 49 50 51 52 53 54 55 56 57 58 59 60 49.04% 43.14% | 61 62 63 64 65 66 67 68 69 70 71 72 55.09% 41.15% | 73 74 75 76 77 78 79 80 81 82 83 84 45.38% 38.38% 85 63 ivicall | Mean total | rameshite indel causing [paso Ree i I sean Mean Rank Target Target | Mean total | frameshift based or 8 8 Cas? indel -causing frameshif gene exon F 3 | percentage | indel ' -causing based on frameshift -causing FE indels R6 R87 |8 R]0 90 91 92 42.69% 34.85% | 93 94 95 96 97 08 09 100 101 102 103 104 51.23% 32.78% | 105 106 107 108 100 110 111 112 113 114 115 116 49.09% 30.85% | 117 115 119 120 121 122 123 124 125 126 127 128 32.46% 26.95% 129 64 ivicall | Mean total | rameshite indel causing [paso Ree i I sean based on frameshift -causing FE 130 131 132 133 134 135 136 36.77% 24.35% | 137 138 139 140 141 142 143 144 145 146 147 148 33.54% 19.60% | 149 150 151 152 153 154 155 156 157 158 159 160 18.60% 10.73% | 161 162 163 164 6.59% 429% | 165 SCN10A 3.63% 2.42% 166 N / A N / A | SpCasO | 027% 0.23% | N / A N / A N / A N / A 0.18% 0.16% N / A Target | Target | Mean total | frameshift based on gRNA name gene exon | Cas9 indel -causing frameshift | percentage indel -causing percentage indels Scnl0a_Sp_Exon_l1_T12 SCNIOA 11 32.19% 26.77% 130 Scnl0a_Sp_Exon_L1_T7 SCNIOA 29.15% —s0a T 131 ScnlOa_Sp_Exon_I_T29 SCNIOA | | SpCas9 | 46.08% Ser T “132 Scnl0a_Sp_Exon_l0_T13 SCNIOA 33.80% = ET “133 Scnl0a_Sp_Exon_13_T8 SCNIOA 37.57% Sow TT “134 Scnl0a_Sp_Exon_13_T11 SCNIOA 29.76% ise TT “135 Scnl0a_Sp_Exon_5_T2 SCNIOA 31.74% —ZimE TT “136 ScnlOa_Sp_Exon_11_T13 SCNIOA 36.77% =m 137 ScnlOa_Sp_Exon_5_T3 SCNIOA 30.72% an 1 138 ScnlOa_Sp_Exon_ 12 T12 SCNIOA 41.69% sim T 139 ScnlOa_Sp_Exon_9_T5 SCNIOA | 9 | SpCasd | 56.19% zen T “140 ScnlOa_Sp_Exon_2_T1 SCNIOA 30.63% mT 141 ScnlOa_Sp_Exon_11_T26 SCNIOA 28.87% “mwa T “142 ScnlOa Sp Exon 11_T8 SCNIOA 39.80% —isom 1 “143 ScnlOa_Sp_Exon_11_T32 SCNIOA 26.86% 5% 1 “144 ScnlOa_Sp_Exon_13_T14 SCNIOA 25.54% 30% 1 14s Scnl0a Sp Exon I_T27 SCNIOA | | SpCas | 23.64% 0% 1 “146 ScnlOa_Sp_Exon_6_T2 SCNIOA | 6 | SpCasd | 24.45% Toa T 147 Scnl0a_Sp_Exon_13_T21 SCNIOA 26.89% 19.88% 148 Scnl0a_Sp_Exon_L1_T2 SCNIOA 33.54% “Toe T Ta ScnlOa_Sp_Exon_11_T31 SCNIOA 22.87% Tsar “150 ScnlOa_Sp_Exon_11_T20 SCNIOA 28.68% ew T Ti51 Scnl0a_Sp_Exon_1_T2 SCNIOA | | SpCas9 | 21.35% sw T “152 Scnl0a_Sp_Exon_2_T4 SCNI0A 22.73% am 15 ScnlOa_Sp_Exon_14_T5 SCNIOA 26.01% Tem T “154 ScnlOa_Sp_Exon 9_TI0 SCNIOA | 9 | SpCasd | 24.38% Tes “155 Scnl0a_Sp_Exon_11_T6 SCNIOA T1751% Tew T “156 Scn10a_Sp_Exon_9_T6 SCNI0A “16.03% wa T “157 ScnlOa_Sp_Exon_1_T22 SCNIOA = oes 25.18% Tar “158 Scnl0a_Sp_Exon_7_T1 SCNIOA 27.05% Ter T “159 Scnl0a_Sp_Exon_12_T2 SCNIOA 26.39% —sw T “160 Scnl0a Sp Exon O_TI2_ SCNIOA | 9 | SpCas9 | 18.60% oma T “161 ScnlOa_Sp_Exon_13_T6 SCNIOA ToT1% mT “162 Sooi0asp ron ITZ SONIoA| | sees | 82% 600% | 6 Scol0asp Eon oT SOWIoA| 9 | spces | sm aw | Te Scnl0a_Sp_Exon_13_T22 SCNIOA 6.59% 4.29% 165 Scal0a_Sp Fron I LT3 SCNI0A Sen 2m | “Te Tete NA WA “oma om | A Untreated “NA NA VA omw owen T TNA Table 11: Mean total indel percentage and mean frameshift-causing indel percentages generated by SaCas9 gRNAs targeting SCN10A in iPSCs SYA Rank utile Mean total | frameshift- based on T: + + gRNA name rarget | Target | Cas9 | indel | causing | based o R | frameshift 1 bh .. col AHLIGS Sale, | ALES PA gene exon | = total | © percentage indel ed -causing i Biss indels indels 44.86% 42 68% 2 42.84% 40.36% 4 3 37.46% 35.32% 7 3 43.31% 32.36% 3 4 45.19% 31.27% 5 39.18% 27.17% 5 6 33.11% 25.46% 9 7 28.02% 24.67% 13 8 31.11% 23.87% 11 9 29.04% 23.03% 12 10 34.53% 20.42% 8 11 27.38% 19.18% 14 12 31.25% 18.78% 10 13 20.74% 17.76% 20 14 11 SaCas0O 20.36% 17.65% 22 15 19.59% 17.00% 27 16 25 69% 16.98% 16 17 20.06% 16.79% 24 18 19.68% 15.79% 26 19 20.35% 15.76% 23 20 26.38% 15.31% 15 21 22.50% 15.28% 17 22 21.83% 14.52% 18 23 38.57% 13.91% 6 24 20.06% 13.70% 25 25 21.79% 13.40% 19 26 16.95% 13.18% 29 37 18.11% 13.04% 28 28 20.70% 10.65% AN 29 14.58% 10.63% 32 30 13.82% 10.55% 33 31 15.04% 0.94% 31 32 16.61% 8.83% 30 33 12.36% 821% 35 34 10.62% 7.87% 37 35 13.45% 7.63% 34 36 7.75% 6.06% 41 37 6.42% 561% 46 38 7.54% 5.53% 42 39 5.84% 5.42% 48 40 7.45% 5.16% 43 41 Vein Rank SA: | Target | Target Mean total | frameshift | hasedion based on gRNA name gene J Cas9 indel causing total | ramesht percentage indel indels -causing percentage _ indels EN a ce I A SR [Sens Sa Bron 815 | SCWIOA | ¥ | Sacwd | aw mam 7 3 wa nw 3 : wow om 5 ww mim 5 6 : Bow maw 9 7 Eo a i nw mem 1 9 Bow mow 1 10 wesw mam 3 I maw OWE TW 1 TEC Senl0a_Sa_Exon_11_T1 | SCNIOA | 11 | saCas9 | 2036% 17.65% 22 15 0 Scnl0a_Sa_Exon_2_T1 2 19.59% 17.00% 27 16 [Sele So Eon STI | SCVIOR | ® | Scud | meo% Teo 16 17 Wow IewE mI ew EWE % DO mew Tw mm [Sele So Fron LT6_| SCVIOR |__| Sacw9 | 33% Taw 5 3 mew TOE 6 mC mow Te BE ESE LIE BT [Senta Ss Exon 6 T6 | SOMA | | Saad | 70% Toes mm [Senta Ss Bron 115 | SOMA || Sua | we oe 3 0 mee mse mC Sow oem a Tm Gen me Ww 3 EE TS Tew Ev 5 men es Tw % a Sew dm TS ssw mm seh sen mC 0 66 eee— Mean = Rank THLE Pa) RNA name | Target | Target | Caso | Mean total | frameshift- | Bo based on UB BE ‘as! indel ' causing sed. 0 mn | frameshift | Target exon 1 Seiad ml Alagille. | A TIGSYITLE gene exon total | o) percentage indel — , .° -causing 4 dls indels + indels 6.18% 5.14% 47 42 10.64% 4.88% 36 43 8.43% 4.83% 39 44 6.74% 4.64% 44 45 542% 4.53% 49 46 6.56% 4.34% 45 47 8.25% 3.80% 40 48 4.37% 3.72% 51 49 5.02% 3.69% 50 50 4.27% 3.66% 52 51 9.36% 2.84% 38 52 2.67% 2.40% 54 53 2.76% 2.36% 53 54 2.299% 1.87% 55 55 2.16% 1.62% 57 56 2.17% 1.53% 56 27. 2.07% 1.52% 59 58 2.12% 1.42% 58 59 1.69% 1.21% 61 60 1.93% 0.77% 60 61 0.73% 0.53% 64 62 0.79% 0.47% 63 63 0.46% 0.45% 65 64 1.24% 0.33% 62 65 0.28% 0.20% 67 66 0.20% 0.17% 68 67 0.35% 0.17% 66 68 0.18% 0.16% 69 69 0.11% 0.10% 70 70 0.06% 0.06% T1 71 0.03% 0.03% 72 72 0.00% 0.00% 73 73 N / A N / A SaCas9 0.27% 0.23% N / A N / A Avloatl Rank Atl | Target | Target Mean total | frameshift- | base on based on gRNA name 8 8 Cas9 indel causing | frameshift gene exon 3 total o percentage indel indels -causing rcentage indels Scnl0a_Sa_Exon_3_T2 SCNI0A 3 6.18% 5.14% 47 42 Scnl0a_Sa_Exon_4_T4 SCNI0A 10.64% 4.88% 36 43 Scnl0a_Sa_Exon_6_T3 SCNI0A | 6 | SaCas9 | 8.43% 4.83% 39 44 Scnl0a_Sa_Exon_10_T8 | SCNIOA 6.74% 4.64% 44 45 Scnl0a_Sa_Exon_1_T9 SCNI0A |] SaCas9 | 5.42% 4.53% 49 46 Scnl0a_Sa_Exon_13_T1 | SCNIOA 6.56% 4.34% 45 47 Scnl0a_Sa_Exon_6_T8 SCN10A | 6 | SaCas9 | 8.25% 3.89% 40 48 Scnl0a_Sa_Exon_4_T3 | SCNIOA 4.37% 372% 51 49 Scnl0a_Sa_Exon_S_T4 | SCNIOA 5.02% 3.69% 50 50 Scnl0a_Sa Exon 6_ TS | SCNIOA | 6 [SaCas9 | 427% 3.66% 52 51 Scnl0a_Sa_Exon_13_T7 | SCNIOA 9.36% 2.84% 38 52 Scnl0a_Sa_Exon_10_T4 | SCNIOA 2.67% 2.40% 54 53 Scnl0a_Sa_Exon_S_T1 | SCNIOA 2.76% 2.36% 53 54 Scnl0a_Sa_Exon_2_T2 | SCNIOA 2.29% 1.87% 55 55 Scnl0a_Sa_Exon_14_T3 | SCNIOA 2.16% 1.62% 57 56 Scnl0a_Sa_Exon_3_T3 | SCNIOA 2.17% 1.53% 56 57 Scnl0a_Sa_Exon_12_T4 | SCNIOA 2.07% 1.52% 59 58 Scnl0a_Sa_Exon_7_TS | SCNIOA 2.12% 1.42% 58 59 Scnl0a_Sa Exon 6_ TL | SCNIOA | 6 [SaCas) | 1.69% 1.21% 61 60 Scnl0a_Sa_Exon_l1_T3 | SCNI0A 1.93% 0.77% 60 61 Scnl0a_Sa_Exon_6_T4 SCNI0A | 6 | SaCas9 | 0.73% 0.53% 64 62 Senl0a_Sa_ Exon 9_T1 | SCNIOA | 9 [SaCas9 | 079% 0.47% 63 63 Scnl0a_Sa_Exon_10_T1 | SCNIOA 0.46% 0.45% 65 64 Scnl0a_Sa_Exon_l4_T4 | SCNIOA 1.24% 0.33% 62 65 Scnl0a_Sa_Exon_9_T3 SCNI0A 0.28% 0.20% 67 66 Scnl0a_Sa_Exon_1_T1 SCNI0A 0.20% 0.17% 68 67 Scnl0a_Sa_Exon_13_T6 | SCNIOA 035% 0.17% 66 68 Scnl0a_Sa_Exon_12_T1 | SCNIOA 0.18% 0.16% 69 69 Scnl0a_Sa_Exon_8_T2 SCNI0A | 8 | SaCas9 | 0.11% 0.10% 70 70 Scnl0a_Sa_Exon_12_T5 | SCNIOA 0.06% 0.06% 71 71 Scnl0a_Sa_Exon_8_T3 SCNI0A | 8 | SaCas9 | 0.03% 0.03% 72 72 Scnl0a_Sa_Exon_6_T7 | SCNIOA | 6 [SaCas9 | 0.00% 0.00% 73 73 Scrambled control N / A N / A 0.27% 0.23% N / A N / A Untreated N / A N / A N / A 0.18% 0.14% N / A N / A N / A N / A N / A 0.18% 0.14% N / A N / A Screening of top ranked gRNAs targeted to SCN9A and SCNI10A in iPSCs stably expressing SpCas9 or SaCas9, and in iPSC-derived sensory neurons Based on on-target efficacy in initial gRNA screens in iPSCs, 40 guides were prioritized for further on-target editing studies in additional cell models such as iPSCs stably expressing Cas9 and iPSC-derived sensory neurons (iSNs) (FIGs. 1A-1D). Specifically, ten guides from each of four categories were chosen: 1) ten gRNAs for SpCas9 targeting SCN9A, 2) ten gRNAs for SpCas9 targeting SCN10a, 3) ten gRNAs for SaCas9 targeting SCN9A, and 4) ten gRNAs for SaCas9 targeting SCN10a (Tables 12 and 13). These 40 prioritized gRNAs were screened in engineered iPSCs stably expressing either SpCas9 or SaCas9. Synthetic gRNAs were electroporated into the corresponding cell line. These 40 gRNAs were already screened for on-target editing efficiency in iSNs. In iSNs, RNP complexes were electroporated into the adherent neuronal cultures for all 40 gRNAs. In addition, the 20 SaCas9 gRNAs were also delivered to iSNs by all-in-one AAV vectors expressing SaCas9 and a gRNA. Genomic DNA was purified from treated cells for sequencing analysis as described in the methods. In each model, two independent experiments were conducted. The mean average cutting efficiency was calculated based on four replicates for each sample looking at total percentage of insertions and deletions (indels) at the predicted cut site of each gRNA. For the purposes of knocking out the SCN9A and SCN10A genes, the average percentage of indels that would result in a frameshift mutation was also calculated. Guide RNAs were ranked on mean frameshift- causing indel percentage. A summary of the on-target editing efficiencies of these 40 prioritized gRNAs across different cell models can be found in FIGs. 1A-1D, as well as in Tables 12 and 13. = 81 I=lol=fzlolel=nloln] Iol= inl lel] ol-|2|=| ag OR x 24% Ielelolelolelnl-I=[2] [<lelnl-|~l=[=]~[2]- £ Eg Q x 23 |=|ale]t [ole] |=]o|2| [=|v|o]]o|e]] =|] & BE | S Sl |lelelelolelelel else glelelel sles] ele 22% |zizinie|2iein22|8) 218128 002050 008 Le S| FS os 3 SiN 2Ig= Es a [TSE |Z|R|8[S[S|Q[F| RTE [SHER |Z|=|E|8]|=|E 2 8 = - i 4 = FEET EEN EERE EE EEREEEREEHREREEE @ 279 exe lz|g|s|2|xEg a2 RI22R]8|R|BIRIY E EA22ZISIZI8(g 52222522288 9|g|7|q § [808 3% S|d|d|e|g|Zg|2|S|8|e|e|d|d|=|=|S|d|d]e = lo EE Ee Ee Ee El El Ea Ee Ed Ee EE El EE ES Ee RC ® % - g s 2 Zl |g gs 00 Ege gg 8] ggg] S |8lalzalel zz lelsx|22l5 838822 2lQ 8] 2 |ZlZ|S|2 =| 23121222 ERIE ng ale =n & cls |dls|zlzlg|d =| Rss el glglslalz Ze SEEN" |2|8|8|8|8|7|R|b|E 888 |T|T|T|8 Slel<|Clz|0l<| «|< X 2 Z 212185|12123]8|5|8|2 £|3|2|212|E[5|212)2 2151913152181903 5 [522818125 5|8 EEE SE HE EERE EEE EEE FEE 3 IZI212Z121312(818| |2I5|318|%lzI2)3 18 3 g HEERIHEERER SEE EERIE 3 3 4 UlE|E Cl go 252 : 21%15512|2|2 / 8]8|2] |ZI5[381818I8189|8|3 & EEE EEE EE £I8IE|2|3|5| 212 / 81 EISISI13 128138 I2IE| 8I2|8I3|2 HEE] 2 IS(elElIIE Ie 3lE| (BI3ISIE8 281 £151212|812 / 8 / 2|2|9 £138|2||%|3|8|3|8 21215122 28 / 532 2S(<| BERS 2IS SIEI8|3|E 812151513] [2]315)2|%|8 5] 3 / 28 C 33 3|8|<|%|8 ox ag |-|o|n|<||o|n|=|o|2] |5 gag | ~|=lo|2| |=|a|n|x|a|r|x|2|a]=| 0 21818 2|C @ 5515 2 . [EEEEEREER 558 3 41212131121 5]81s EEE EE z =z 2 5 5 ye] 212 BIE IEEE EBS } 23358 Blo 225 DES z 218|2|5515|2 5| 22 lelzl2)s) = dly)E : EEE EEE AEEIEEEEEHE Cd 555152] 5|%| 2] 5) HEHEEHEEEE 5 "Z| I= a & a|a ga {FEE HEHEHE SE gl gles E|&|4lF 512 / 2\2|2 / |5|8|28|2 az aE222s HEE HEHEHE Zle|2|2|2|2|5)2 22 HEHEHE HERE EE a|%lsl8le 2 238 HE %z £2 = 23151522 515 3 | 2 5133555 315 5] +3 3182815] 8|7 £58 / 3|8 S222 Sx 23F Inl[=lel=lelolnlnln] [loll=o]el=]~|<]~] AES 43 E Ex G2E Iel-lololnlol=lolele] [g]olnl=lnl~[=]=|+|| LEE 2 x E31 ldeielelelBlelele| [Bednpelelosfe]el] &e Qa 25 |-[o]o]] eel ]=]ol2| [=|o|n|]n]e]]2|o|2 FI ew 28 % 2]. of ols <lgle * £185828|8 8518] 55)5150818888|8 Sldlzlz12 geld = az 2131818|4]% 812 alSSI2 85 88 = S|e|glgls|= FG H |e 2a] = = o— = = E : we E =| FR www e ws sles elses els A BHHEHEEHEEHBEER HEEHEEE Z GE &|2|2 NE 5| 8280 2S Re 2| ZR (TG % Zz |Z 2 ~E ode] | A|A |e SS [Tfed|ed| =i F| en i £ s ¥ lo ol lsglwlowlwlwlwlmwiwlamlw) [olwlwlelietwliwiolele gl £ A IRENE REESE ERNE ERE RRR ERE HEEEEEEERHENHEREREEE BF ff g|w|e|2|S| wd S| SR g|g|S| =|] q de £ 2 = : — = NES) 8). 8) 8 os |e 2 |e ie slele|elalslelslsls slelslelslselslsls £ [225 |E5|55|5|E|8 5IE|E| |B|5|E|k E|E|E EE] 2 BEY [2[F[S2 9 2g22e =| Be | Rew § 3 EDS ||| Ane SoD] = |i] Fen £ 2 ® lee al 88 r8]e28|8]] eR R] 288] 88) 22225228582 (2282252853558 SSE|I3 C2132 2[3|312]4]8|8|22 24%] |E 83 TFET eel F |v TINE ~~ (F|en|F nnn wn RHEE HEEHHBEEREEEEEREEEEE Z (E2|212513181212 1322 |218151923|8]213| 828 BOIRIZ| FEI 9| Z| QJ G| R09 F488 48S wn ¥ * t Oly < <2 - g CIS|y 212 |o|=|<|S = < SE|28(8|2I2I515| 121215181908 818 3 Clg 2 ICSC | [Qlo||® 3121208 zg [CII EE 5 <|3|8|2|2|S|ol2 SISIEI5I1ZI81 213122] 188121218] 2(2|5 / 8|8 SIZ(E18181%218|R (S| 12|1812|2(8|SI8|E 89 CI<|2 121228181318] 121918|2|8]2|5|8|8|8 8 SISICIEIEIZ||R 28] I8|8I8ISI<|<|SI8IE|E iv] 7 < © 20 o £ CIZSIEIZI|SIS|SIE] IRIZ|8I3|C|<|2]|8 2S 3 2<|Q|E 2 2 | UL Fi== slsl<|2| 23 3 < SIC|2IS|Z|E (08 |Q|3|<|8|<|8|S|RC|d =z 3|<|3|0|< S283 s|Q i) G|e|0|z|8 2 2l<l<|z2|C|E|2|S19 SlEIS|0IB Ele = @ <|G|Z|S|121Z|8|2 512] |B3|el3(Cle|8|ElE|S <1 2222288] |2IBICIB|8|EIR|E|S ERIE EE EE EIR EEE EEE EEE EE <|S|J|5|2|2|S|E8 O29 |E|5|3|S <|O o|B|%(8<|C|e|8|S|<| |B|22|E|8|a|2|S|o|3 Sla|sI8R 2 Z|o<Z| [D5 |C|8|2|1S] 2208 S|LIo|T| |< < < QIE|lx|3|< c =< o |< 5 |< OZ 2(8 Oo 2|8|%|3|8|°|°|C|<|g o|5|18|%|°|9|<|<|8|® Dad o ug ” C1 IE EE EE EE WE EE EEE EI EYE oe mlz] = ole = wlg8Eg|el|ElE =E & ESSE a =F 5 E = a3 S a= 5 Tn % z|g] dl 2g] ele] 12 2122 2 2 2 2 « | 3|d|a 5) §|4 dF 3S QE aaa Eas aa z 3|3|%|4|4|&|4|4|3|8 a4 2|d|d|3| 22 |3|d o glalgldl ggg] |ElS|S|E|E|S|S|S|E|E HEHEIEIEHE EEE BEE EEE HEE @ |v “aa? alan 2la|2|R 332233 Off-target evaluation of SpCas9 and SaCas9 gRNAs targeted to SCN9A and SCN10A in iPSCs Based on on-target efficacy in initial gRNA screens in iPSCs, 40 guides were also prioritized for an off-target evaluation. Specifically, ten guides from each of four categories were chosen: 1) ten gRNAs for SpCas9 targeting SCN9A, 2) ten gRNAs for SpCas9 targeting SCN10a, 3) ten gRNAs for SaCas9 targeting SCN9A, and 4) ten gRNAs for SaCas9 targeting SCN10a. Of the 40 gRNAs included in the study, 29 gRNAs were categorized as “Tier 1” (Table 14), where no off-target sites included in the study entered statistical testing; these 29 gRNAs included 4 gRNAs where no off-target sites were predicted under the sequence similarity criteria. Based on this study, these 29 gRNAs are considered to have no evidence of off-target editing. In addition, seven gRNAs were categorized as “Tier 2” (Table 15), where at least one off-target site associated with that gRNAs may have entered statistical testing, but was not found to be statistically significant. These off-target profile of these gRNAs are considered to be inconclusive from this study. In addition, four gRNAs were categorized as “Tier 3” (Table 16), where at least one off-target site was found to have statistically significant off-target editing. These gRNAs were strongly deprioritized, based on these off-target editing results. All combinations of target genes (SCN9A or SCN10A) and enzymes (SpCas9 or SaCas9) were found to have at least 5 Tier 1 guides. Table 14: 29 gRNAs categorized as Tier 1 with no evidence of off-target editing gRNA Name [ SEQID NO: | ID NO: # tested sites # sites with any evidence of editing Sen9a Sp Exon 11_T9 | 44 . 0 Scn9a Sp Exon 11_Té6 3 42 0 Scn9a Sp Exon 11_T14 4 83 0 Scn9a Sp Exon 11_T13 3 40 0 Scn9a Sp Exen 12_T11 9 42 0 Scnl0a Sp Exon 10_T3 30 42 0 ScnlOa Sp Exon 9_T2 22 54 0 Scnl0a Sp Exon 14_T3 23 104 0 Scnl0a Sp Exon 7_T6 25 117 0 Scn9a Sa Exon 12_T3 20 0 Scn9a Sa Exon 12_T1 16 0 Scn9a Sa Exon 12_T2 12 2 0 Scn9a Sa Exon 5_T6 13 0 Scn9a Sa Exon 9_T3 14 0 Scn9a Sa Exon 13_T3 15 2 0 Scn9a Sa Exon 11_T3 11 9 0 Scn9a Sa Exon 9_T2 18 0 Scn9a Sa Exon 15_T3 19 2 0 il gRNA Name SEQ ID NO: # tested sites # sites with any evidence of editing Scnl0a Sa Exon 11_TS 40 2 0 Scnl0a Sa Exon 8_TS 33 4 0 Scnl0a Sa Exon 14_T1 35 2 0 Scnl0a Sa Exon 14_T2 36 4 0 ScnlOa Sa Exon 4 TS 37 0 Scnl0a Sa Exon 11_T2 39 [1] Scnl0a Sp Exon 10_T7 24 68 1* Scnl0aSaExon 11 _T1 31 1} 0 Scnl0a Sa Exon 1_T7 32 1} 0 Senl0a Sa Exon 12_T2 34 0 0 ScenlQa Sa Exon 1 _T3 38 0 0 *Scnl0a Sp Exon 10_T7 had one site tested due to the 0.2% threshold requirement, but that site was ultimately excluded due to a germline mutation. Table 15: Seven gRNAs categorized as Tier 2 with inconclusive off-target editing profiles neEQ n ireated eRNAname | I | stern | Test | Chisq | PIE Untreated | # # | T-test pval pval | pval | Ce | Te Untreated # # og (Indel %) | mismatch gaps | | see | id i chr8:3193432- | 0.098 ASS AR i Scnl0a Sp Exon chr8:3193432- | 0.098 11.T10 27 TARE ME 5 | em Sen9a Sa Exon yr Le bled a chr2:165162747 | 0.071 3 EI, x chr2:165162747 | 0.071 | 17 | EZ | OT] 0 | oe1e | 000% 7. T1 Sob 165162773 0 5 I=" eel = k Scn9a Sp Exon chr12:51699567 | 0.229 715 7 er 02 0 | oem iE Il LAU SLs ded LG TI IIE | sds 77s 7 | sieo0ses | 3 | 0 | 0.62% | 0.00% 0 Scn9a Sp Exon chr17:49809267 | 0.170 | 715 7 40800289 | 7 | 0.0006 | 0.35% 0.00% 2 DIFC Wp LR CPLA MIOII SIE: | Nr Lan 77s 7 17 4os00289 | 7 | ©0006 | 035% | 0.00% 2 0 Scn9a Sp Exon chr5:139982158 | 0.076 | 12.T25 2 139082180 | 9 | 0 | 0.53% | 0.00% 3 0 well I LAU willl 7704 LQ | AAU 12_T25 2 | -139982180 9 o | 85% | Bz 2 ° Scn9a Sp Exon chr18:34382228 | 0.092 | 14. T1 6 34382250 | 9 | 0.0140 | 0.17% 0.00% 3 0 Scn9a Sp Exon chrd:41330183- | 0.084 | 2 10 Aa | 0% | pons | 016% 0.00% 0 Scn9a Sp Exon 12 T17 Scnl10a Sp Exon 4 Ty "243040 L 2 0 chr4:41330183- | 0.084 ¢ 41330205 z 9 chr1:191298075 | 0.198 ¢ -191298097 9 10a Sp Exon chr1:191298075 | 0.198 ne | » | ill | | 00107 | 015% | 0.00% 3 0 Table 16: Four gRNAs categorized as Tier 3 with off-target editing confirmed (p<.05) at one or more sites | T-test | Co Sry gRNA name Fo | i | Tt i ‘anda | Site ID est Chi-s | Co -Sq (Indel Untreated | # | # ote) o> LF 2 | inde val 1 P pval | % ) | privy Untreated # # % y (Indel %) | mismatch gaps | SEQ Scn9a Sp Exon chr12:51663013 nin g | r2BIS03 | 0020 | asoE8 | 180% | 000% 2 0 Scn9a Sp Exon chr4:64749297- : 8 a ome | 626-116 | 8.50% | 0.00% 3 0 Scnl10a Sp Exon chr15:31179489 ih 21 |SITE 0050 | 1748-13 | 3.90% | 0.00% 3 0 Scnl10a Sp Exon chr16:89566197 | a | | 1.T15 21 89566218 0.080 3.48E-07 0.70% 0.00% 2 T 8 chr12:51663013 0 -51663035 ’ 8 chrd:64749297- 0 64749319 ’ ’ -31179511 ’ | chrI6:89566197 | ’ -89566218 ’ 7 —_— DEQ + Areatea eRNAname | ID | siterp | Test | Chisq | RCC) Untreated | # # I o inde 1 pval pval | %) | T-test | pval | Teas | Untreated | # # %) (Indel %) | mismatch gaps | ScnlOaSpExon ,. | chr2:180785404 | oo | 9a0p07 | 320% | 0.00% 3 0 1._T30 | 9.20807 ScnlOaSpExon ,. | chr5:111925220 | oon | 7508.00 | 0.60% | 0.00% 9 1._T30 | 7.59E-09 | 0.60% ScnlOaSpExon ,o | chrl:17434745- | 00 | 240m as | 610% | 0.00% 2 0 1.T17 ScnlOaSpExon ,o | chr9:134428017 | 00 | 0.0009204 | 0 00 | 00a 3 0 1LT17 “2 | 134428939 | UY | 53 0 | 748875 | 6.10% 0 | 00009204 | 040% |e uw In ID Site ID | No: P - chr2: 180785404 2% | igoresazs | © chrS:111925220 0% | nsaar | © chrl:17434745- CB | ager | © chr9:134428917 2 |" las48030 | © OTHER EMBODIMENTS All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, one of skill in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims. EQUIVALENTS ‘While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms. All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law. As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
Claims
What Is Claimed Is: CLAIMS 1. A gene editing system for modifying a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene, the gene editing system comprising: (a) a RNA-guided DNA endonuclease or a first polynucleotide moiety, which comprises a first nucleotide sequence encoding the RNA-guided DNA endonuclease; and (b) a second polynucleotide moiety, which comprises a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 1-20. 2 The gene editing system of claim 1, wherein: (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus pyogenes Cas9 (SpCas9); and (ii) the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 1-10. 3 The gene editing system of claim 2, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 1, 3-5 and 9.
4. The gene editing system of claim 1, wherein: (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus aureus Cas9 (SaCas9); and (ii) the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 11-20. 5 The gene editing system of claim 4, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 11-16 and 18-20.
6. The gene editing system of any one of claims 1-5, wherein the gRNA of (b) further comprises a scaffold sequence. br The gene editing system of any one of claims 4-6, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 11-20 and the scaffold sequence comprises the nucleotide sequence of SEQ ID NO:
41.
8. The gene editing system of any one of claims 1-7, wherein the first nucleotide sequence encoding the RNA-guided endonuclease in (a) further comprises a nucleotide sequence encoding a nuclear localization signal (NLS), which is fused in-frame with the RNA-guided DNA endonuclease.
9. The gene editing system of claim 8, wherein the NLS is a SV40 NLS.
10. The gene editing system of any one of claims 1-9, wherein the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b) are of different polynucleotides.
11. The gene editing system of claim 10, wherein at least one of the different polynucleotides is a viral vector.
12. The gene editing system of claim 11, wherein the viral vector(s) is an adeno- associated viral (AAV) vector(s).
13. The gene editing system of any one of claims 1-12, wherein a single polynucleotide comprises the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b).
14. The gene editing system of claim 13, wherein the single polynucleotide is a viral vector.
15. The gene editing system of claim 14, wherein the viral vector is an adeno- associated viral (AAV) vector.
16. A nucleic acid comprising the single polynucleotide of claim 14.
17. A viral particle or a set of viral particles, which collectively comprises the gene editing system of any one of claims 1-15.
18. The viral particle or set of viral particles of claim 17, which is an adeno- associated viral (AAV) particle(s).
19. A method of editing a sodium voltage-gated channel alpha subunit 9 (SCN9A) gene, the method comprising contacting a cell with: (a) a gene editing system of any one of claims 1-15; (b) a nucleic acid of claim 16; or (c) a viral particle or a set of viral particles of claim 17 or claim 18.
20. The method of claim 19, wherein the contacting step is performed by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof.
21. The method of claim 20, wherein the subject is a human patient having pain.
22. The method of claim 21, wherein the cell is a neuron of the peripheral nervous system.
23. The method of claim 19, wherein the cell is an autologous cell.
24. The method of claim 19, wherein the cell is a heterologous cell.
25. The method of claim 23 or claim 24, wherein the cell is a stem cell.
26. The method of claim 25, wherein the stem cell is an iPSC cell or a mesenchymal stem cell.
27. The method of any one of claims 23-26, further comprising administering the cell to a subject in need thereof.
28. The method of claim 27, wherein the subject is a human patient having pain.
29. A gene editing system for modifying a sodium voltage-gated channel alpha subunit 10 (SCNA10) gene, the gene editing system comprising: (a) a RNA-guided DNA endonuclease or a first polynucleotide moiety, which comprises a first nucleotide sequence encoding the RNA-guided DNA endonuclease; and (b) asecond polynucleotide moiety, which comprises a second nucleotide sequence encoding a guide RNA (gRNA), wherein the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 21-40.
30. The gene editing system of claim 29, wherein: (i) the RNA-gnided DNA endonuclease of (a) is Staphylococcus pyogenes Cas9 (SpCas9); and (ii) the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 21-30.
31. The gene editing system of claim 30, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 22-25 and 30.
32. The gene editing system of claim 29, wherein: (i) the RNA-guided DNA endonuclease of (a) is Staphylococcus aureus Cas9 (SaCas9); and (iii) the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 31-40.
33. The gene editing system of any one of claims 29-32, wherein the gRNA of (b) further comprises a scaffold sequence.
34. The gene editing system of claim 32 or claim 33, wherein the gRNA of (b) comprises the nucleotide sequence of any one of SEQ ID NOs: 31-40 and the scaffold sequence comprises the nucleotide sequence of SEQ ID NO:
41.
35. The gene editing system of any one of claims 29-34, wherein the first nucleotide sequence encoding the RNA-guided endonuclease in (a) further comprises a nucleotide sequence encoding a nuclear localization signal (NLS), which is fused in-frame with the RNA-guided DNA endonuclease.
36. The gene editing system of claim 35, wherein the NLS is a SV40 NLS.
37. The gene editing system of any one of claims 29-36, wherein the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b) are of different polynucleotides.
38. The gene editing system of claim 37, wherein at least one of the different polynucleotides is a viral vector.
39. The gene editing system of claim 38, wherein the viral vector(s) is an adeno- associated viral (AAV) vector(s).
40. The gene editing system of any one of claims 29-39, wherein a single polynucleotide comprises the first polynucleotide moiety of (a) and the second polynucleotide moiety of (b).
41. The gene editing system of claim 40, wherein the single polynucleotide is a viral vector.
42. The gene editing system of claim 41, wherein the viral vector is an adeno- associated viral (AAV) vector.
43. A nucleic acid comprising the single polynucleotide of claim 41.
44. A viral particle or a set of viral particles, which collectively comprises the gene editing system of any one of claims 29-42.
45. The viral particle or set of viral particles of claim 44, which is an adeno- associated viral (AAV) particle(s).
46. A method of editing a target gene, the method comprising contacting a cell with: (a) a gene editing system of any one of claims 29-42; (b) anucleic acid of claim 43; or (c) a viral particle or a set of viral particles of claim 44 or claim 45.
47. The method of claim 46, wherein the contacting step is performed by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof.
48. The method of claim 47, wherein the subject is a human patient having pain.
49. The method of claim 48, wherein the cell is a neuron of the peripheral nervous system.
50. The method of claim 46, wherein the cell is an autologous cell.
51. The method of claim 46, wherein the cell is a heterologous cell.
52. The method of claim 50 or claim 51, wherein the cell is a stem cell.
53. The method of claim 52, wherein the stem cell is an iPSC cell or a mesenchymal stem cell.
54. The method of any one of claims 50-53, further comprising administering the cell to a subject in need thereof.
55. The method of claim 54, wherein the subject is a human patient having pain.
56. A method of treating a subject having pain, the method comprising administering to the subject: (a) a gene-editing system of any one of claims 1-15 and 29-42; b) a nucleic acid of claim 16 or claim 43; or (©) a viral particle or a set of viral particles of any one of claims 17, 18, 44, and 45.
57. The method of claim 56, wherein the contacting step is performed by administering the gene editing system of (a), the nucleic acid of (b), or the viral particle(s) of (c) to a subject in need thereof.
Citation Information
Patent Citations
Materials and methods for treatment of pain related disorders
WO2018007980A1
Suppression of pain by gene editing
WO2018165504A1