Human antibodies to Ross River virus and methods of use therefor
Patent Information
- Application Number
- AU2020273365
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-11-21
- Filing Date
- 2020-11-20
- Publication Date
- 2026-08-27
Smart Images

Figure 00000157_0000 
Figure 00000157_0001 
Figure 00000157_0002
Abstract
Description
BACKGROUND 1. Field of the Disclosure 5 The present disclosure relates generally to the fields of medicine, infectious disease, and immunology. More particular, the disclosure relates to human antibodies binding to Ross River virus (RRV). 2. Background 0 Ross River virus (RRV) is a positive-sense, single-stranded RNA virus in the Alphavirus genus of the Togaviridae family. RRV circulates in Australia and Papua New Guinea and is transmitted through the bite of Aedes and Culex mosquitos. Typical signs and symptoms of infection include rash, fever, and most prominently, debilitating muscle and joint pain that may persist for 6-12 months or longer (Harley et al., 2001; Tupanceska et al., 2006; Westly-Wise et 5 al., 1996; Flexman et al., 1998). There are an estimated 5,000 cases of RRV every year, and the economic burden, including diagnosis, treatment and lost wages, has been estimated to be as much as 4 million dollars annually (Harley et al., 2001; Knope et al., 2014). RRV was first isolated from human serum using suckling mice in 1972 but was not connected with symptoms until large epidemics in the South Pacific islands in 1979-1980, in which up to 500,000 people were infected :0 (Harley et al., 2001; Doherty et al., 1972; Aaskov et al., 1981). Traditionally, reservoirs of RRV were thought to be maruspials endemic to Australia, such as kangaroos and wallabies (Claflin and Webb, 2015; Stephenson et al., 2019). However, recent evidence indicates that other mammalian species such as rodents, rabbits, and flying foxes can act as reservoirs for the virus and contribute to its spread (Stephenson et al., 2018; Lau et al., 2017). This finding suggests that RRV may have 25 the potential to spread to regions outside of Australia and the Pacific Islands and raises concerns about future epidemic transmission. Currently, there are no approved vaccines or specific therapies targeting RRV. In a previous clinical trial of an experimental inactivated RRV vaccine, immunized individuals produced neutralizing antibodies in serum that conferred protection in mice during 30 subsequent passive transfer studies (Aichinger et al., 2011; Wressnigg et al., 2015; Holzer et al., 2011). However, little is known about the humoral immune response to RRV, and human 2020273365 20 Nov 2020 monoclonal antibodies (mAbs) specific for RRV have not been reported. The mature alphavirus glycoprotein is composed of the El and E2 envelope proteins in a heterodimer, which is expressed as a trimeric spike on the virus surface after cleavage of the E3 protein by furin-like proteases (Snyder and Mukhopadhyay, 2012). Several murine mAbs that bind to RRV have been reported, 5 although functional characterization generally has been limited (Davies et al., 2000; Vrati et al., 1988; Kerr et al., 1992; Fox et al.} Neutralization escape mutants revealed have localized the epitopes of mouse anti-RRV mAbs to the B domain and the flanking region within the E2 glycoprotein (Davies et al., 2000; Vrati et al., 1988; Fox et al., 2015). In comparison, the A and B domains on the E2 glycoprotein and domain II of the El glycoprotein of the related alphavirus 0 chikungunya virus (CHIKV) are important targets of neutralizing antibodies (Smith et al., 2015; Chau et al., 2014; Pal et al., 2013). 2020273365 20 Nov 2020 SUMMARY Thus, in accordance with the present disclosure, there is provided method of detecting a Ross River virus (RRV) infection in a subject comprising (a) contacting a sample from said subject with an antibody or antibody fragment having clone-paired heavy and light chain CDR sequences 5 from Tables 3 and 4, respectively; and (b) detecting RRV in said sample by binding of said antibody or antibody fragment to a RRV antigen in said sample. The sample may be a body fluid, such as blood, sputum, tears, saliva, mucous or serum, semen, cervical or vaginal secretions, amniotic fluid, placental tissues, urine, exudate, transudate, tissue scrapings or feces. Detection may comprise ELISA, RIA, lateral flow assay or Western blot. The method may further comprise 0 performing steps (a) and (b) a second time and determining a change in RRV antigen levels as compared to the first assay. The antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable 5 sequences having 95% identity to clone-paired sequences as set forth in Table 1. The antibody or antibody fragment may comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable sequences having 70%, 80% or 90% identity to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The :0 antibody fragment may be a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment. In another embodiment, there is provided a method of treating a subject infected with Ross River virus (RRV) or reducing the likelihood of infection of a subject at risk of contracting RRV, comprising delivering to said subject an antibody or antibody fragment having clone-paired heavy 25 and light chain CDR sequences from Tables 3 and 4, respectively. The antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set forth in Table 1. The antibody or antibody fragment may 30 comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable sequences having 70%, 80% or 90% identity 2020273365 20 Nov 2020 to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The antibody fragment may be a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment. The antibody may be an IgG, or a recombinant IgG antibody or antibody fragment 5 comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase halflife and / or increase therapeutic efficacy, such as a LALA, N297, GASD / ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern. The antibody may be a chimeric antibody or a bispecific antibody. 0 The antibody or antibody fragment may be administered prior to infection or after infection. The subject may be a pregnant female, a sexually active female, or a female undergoing fertility treatments. Delivering may comprise antibody or antibody fragment administration, or genetic delivery with an RNA or DNA sequence or vector encoding the antibody or antibody fragment. In yet another embodiment, there is provided a monoclonal antibody, wherein the antibody 5 or antibody fragment is characterized by clone-paired heavy and light chain CDR sequences from Tables 3 and 4, respectively. The antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set forth in Table :0 1. The antibody or antibody fragment may comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable sequences having 70%, 80% or 90% identity to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The antibody fragment may be a recombinant scFv (single chain fragment variable) 25 antibody, Fab fragment, F(ab')2 fragment, or Fv fragment. The antibody may be an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase half-life and / or increase therapeutic efficacy, such as a LALA, N297, GASD / ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or 30 expression in a cell line engineered with a defined glycosylating pattern. The antibody may be a 2020273365 20 Nov 2020 chimeric antibody or a bispecific antibody. The antibody or antibody fragment may further comprise a cell penetrating peptide and / or may be an intrabody. In still yet another embodiment, there is provided a hybridoma or engineered cell encoding an antibody or antibody fragment wherein the antibody or antibody fragment is characterized by 5 clone-paired heavy and light chain CDR sequences from Tables 3 and 4, respectively. The hybridoma or engineered cell may encode an antibody or antibody fragment encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set 0 forth in Table 1. The hybridoma or engineered cell may encode an antibody or antibody fragment comprising light and heavy chain variable sequences according to clone-paired sequences from Table 2, light and heavy chain variable sequences having 70%, 80% or 90% identity to clone-paired sequences from Table 2, or light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The hybridoma or engineered cell may encode an antibody 5 fragment that is a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment. The hybridoma or engineered cell may encode and antibody that is an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase half-life and / or increase therapeutic efficacy, such as a LALA, N297, GASD / ALIE, YTE or LS mutation or glycan :0 modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern. The hybridoma or engineered cell may encode an antibody that is a chimeric antibody or a bispecific antibody. The hybridoma or engineered cell may encode an antibody or antibody fragment further comprising a cell penetrating peptide and / or may be an intrabody. 25 In a further embodiment, there is provided a vaccine formulation comprising one or more antibodies or antibody fragments characterized by clone-paired heavy and light chain CDR sequences from Tables 3 and 4, respectively. The one or more antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set 30 forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set forth in Table 1. The one or more antibody or antibody fragment may 2020273365 20 Nov 2020 comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable sequences having 70%, 80% or 90% identity to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The one or more antibody fragment 5 may be a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment. The one or more antibody may be an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase half-life and / or increase therapeutic efficacy, such as a LALA, N297, GASD / ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR 0 interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern. The one or more antibody may be a chimeric antibody or a bispecific antibody. The one or more antibody or antibody fragment may further comprise a cell penetrating peptide and / or may be an intrabody. In yet a further embodiment, there is provided a vaccine formulation comprising one or 5 more expression vectors encoding a first antibody or antibody fragment as described herein. The expression vector(s) may be Sindbis virus or VEE vector(s). The vaccine formulation may be formulated for delivery by needle injection, jet injection, or electroporation. The vaccine formulation may further comprise one or more expression vectors encoding for a second antibody or antibody fragment, such as a distinct antibody or antibody fragment as described herein. :0 In still yet a further embodiment, there is provided a method of protecting the health of a placenta and / or fetus of a pregnant a subject infected with or at risk of infection with Ross River virus (RRV) comprising delivering to said subject an antibody or antibody fragment having clone-paired heavy and light chain CDR sequences from Tables 3 and 4, respectively. The antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by 25 light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set forth in Table 1. The antibody or antibody fragment may comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable sequences having 70%, 80% or 90% identity 30 to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The antibody fragment may be a 2020273365 20 Nov 2020 recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment. The antibody may be an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase halflife and / or increase therapeutic efficacy, such as a LALA, N297, GASD / ALIE, YTE or LS 5 mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern. The antibody may be a chimeric antibody or a bispecific antibody. The antibody or antibody fragment may further comprise a cell penetrating peptide and / or may be an intrabody. 0 The antibody or antibody fragment may be administered prior to infection or after infection. The subject may be a pregnant female, a sexually active female, or a female undergoing fertility treatments. Delivering may comprise antibody or antibody fragment administration, or genetic delivery with an RNA or DNA sequence or vector encoding the antibody or antibody fragment. The antibody or antibody fragment may increase the size of the placenta as compared to an 5 untreated control. The antibody or antibody fragment may reduce viral load and / or pathology of the fetus as compared to an untreated control. In an additional embodiment, there is provided a method of determining the antigenic integrity, correct conformation and / or correct sequence of a Ross River virus (RRV) antigen comprising (a) contacting a sample comprising said antigen with a first antibody or antibody :0 fragment having clone-paired heavy and light chain CDR sequences from Tables 3 and 4, respectively; and (b) determining antigenic integrity, correct conformation and / or correct sequence of said antigen by detectable binding of said first antibody or antibody fragment to said antigen. The sample may comprise recombinantly produced antigen, a vaccine formulation or vaccine production batch. Detection may comprise ELISA, RIA, western blot, a biosensor using surface 25 plasmon resonance or biolayer interferometry, or flow cytometric staining. The first antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set forth in Table 1. 30 The first antibody or antibody fragment may comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable 2020273365 23 Jul 2026 sequences having 70%, 80% or 90% identity to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The first antibody fragment may be a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab‘)2 fragment, or Fv fragment. The method may 5 further comprise performing steps (a) and (b) a second time to determine the antigenic stability of the antigen over time. The method may further comprise (c) contacting a sample comprising said antigen with a second antibody or antibody fragment having clone-paired heavy and light chain CDR sequences from Tables 3 and 4, respectively; and (d) determining antigenic integrity of said 10 antigen by detectable binding of said second antibody or antibody fragment to said antigen. The second antibody or antibody fragment may be encoded by clone-paired variable sequences as set forth in Table 1, by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired variable sequences as set forth in Table 1, or by light and heavy chain variable sequences having 95% identity to clone-paired sequences as set forth in Table 1. The 15 second antibody or antibody fragment may comprise light and heavy chain variable sequences according to clone-paired sequences from Table 2, may comprise light and heavy chain variable sequences having 70%, 80% or 90% identity to clone-paired sequences from Table 2, or may comprise light and heavy chain variable sequences having 95% identity to clone-paired sequences from Table 2. The second antibody fragment may be a recombinant scFv (single 20 chain fragment variable) antibody, Fab fragment, F(ab‘)2 fragment, or Fv fragment. The method may further comprise performing steps (c) and (d) a second time to determine the antigenic stability of the antigen over time. Also provided is a human monoclonal antibody or antibody fragment, or hybridoma or engineered cell producing the same, wherein said antibody binds to Ross River virus E2 25 glycoprotein and neutralizes RRV and at least one of chikungunya virus and Mayarao virus. The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The word “about” means plus or minus 5% of the stated number. 30 It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein. Other aspects, features and advantages of the present disclosure will become apparent from the following detailed description. 2020273365 20 Nov 2020 It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description. 5 By way of clarification and for avoidance of doubt, as used herein and except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additions, components, integers or steps. Reference to any prior art in the specification is not an acknowledgement or suggestion 0 that this prior art forms part of the common general knowledge in any jurisdiction or that this prior art could reasonably be expected to be combined with any other piece of prior art by a skilled person in the art. 2020273365 20 Nov 2020 BRIEF DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. 5 The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. 0 FIGS. 1A-C. Antibodies generated against RRV bind and neutralize RRV. (FIG. 1A) Isotype, subclass, light chain designation (X or k), half maximal inhibitory concentration (IC50) for neutralization, and half maximal effective concentration (EC50) for binding are shown. Binding was measured using ELISA; neutralization was measured using a focus reduction neutralization test (FRNT). Both ELISA and FRNT were 5 performed in triplicate, and 95% credible interval for EC50 and IC50 values are indicated in brackets. Curves and EC50 binding values were obtained using non-linear fit analysis using Prism software version 7 (GraphPad Software). IC50 neutralization values were obtained using 5 parameter logistic curves (Supplemental Methods). Values are color-coded according to binding or neutralization potency, with a stronger binder or neutralization :0 indicated by a darker blue or green color, respectively. > indicates neutralization was not detected, when tested at concentrations up to 10,000 ng / mL. (FIG. IB) Neutralization profiles of mAbs were divided into two groups, based on pattern of activity in a dilutional FRNT assay. Eight antibodies left a resistant fraction of 10 to 40% virus (based on Emax value), indicated by the red dotted lines and (FIG. IC) thirteen antibodies completely 25 eliminated virus. Error bars represent SD, and curves representative of multiple experiments are shown. FIGS. 2A-C. Alanine scanning mutagenesis reveals E2 residues important for mAb binding. (FIG. 2A) Amino acid sequence of E2 from the RRV T48 strain, indicating loss-of-binding residues determined through alanine scanning mutagenesis. Each amino 30 acid residue is numbered according to its position within the E2 protein, with the A, B, and C domains along with the arch regions (Smith et al., 2015; Voss et al., 2010) color coded 2020273365 20 Nov 2020 (grey, arch; dark blue, domain A; green, domain B; magenta, domain C). A circle above the sequence indicates the position of residues for which alanine substitution disrupts mAb binding, with each circle color corresponding to a different mAb. (SEQ ID NO: 275) (FIG. 2B) Summary table with residues disrupted by alanine scanning mutagenesis, including the 5 E2 domain in which they are found and the competition group to which the mAb belongs (see FIGS. 3A-B) Two independent experiments were performed and values were averaged for loss-of-binding determination. A cutoff value of 10% was used, with the requirement that two other mAbs have binding of 50% or greater. (FIG. 2C) Loss-of-binding residues mapped onto the crystal structure of the CHIKV E1 / E2 heterodimer (PDB 3N42), with 0 three heterodimers subunits combined to represent the viral spike trimer. Top and side views of the trimer are shown, with residues important for mAb binding color coded as in FIG. 2A and shown as space-filling forms. The E2 protein is shown in green and the El protein in light brown, and each of the domains is labeled as in FIG. 2A. A side view of a single heterodimer subunit is also shown (bottom). 5 FIGS. 3A-B. Epitope mapping studies to identify groups of mAbs recognizing similar major antigenic sites. (FIG. 3A) An Octet RED96 instrument (Pall ForteBio) was used to perform epitope binning studies using competition binding. RRV-86 was used as a capture antibody and was immobilized onto Fc-specific anti-human IgG biosensors for 2 min. After measuring the baseline signal, the biosensor tips were immersed into wells :0 containing RRV VLPs for two minutes. After another baseline measurement, biosensors then were transferred to wells containing a first mAb at a concentration of 100 pg / mL for 5 min, before immersion in a solution containing a second mAb, also at a concentration of 100 pg / mL for 5 min. The percent competition of the second mAb in the presence of the first mAb was determined by comparing the maximal signal of binding for the second mAb 25 in the presence of the first antibody to the maximal signal of the second mAb in the absence of competition. Competition was defined by reduction of the maximal binding score to <25% of un-competed binding (black boxes). A non-competing mAb was identified when maximal binding was >50% of un-competed binding (white boxes). A 25 to 50% reduction in maximal binding was considered intermediate competition (gray boxes). Some values 30 are negative due to slight dissociation of the first antibody in the presence of the second. The colored boxes denote two overlapping asymmetrical competition groups. The blue 2020273365 20 Nov 2020 dotted boxes highlight antibody self-competition. (FIG. 3B) Residues corresponding to mAbs in each competition group as determined through alanine scanning mutagenesis mapped onto the CHIKV E1 / E2 trimer of heterodimers (PDB 3n42). Space-filling models for loss-of-binding residues in competition group 1 are shown in red, and loss-of-binding 5 residues for competition group 2 in orange. A top view of the trimer is shown (left) as well as a side view (right). FIGS. 4A-E. RRV mAbs neutralize through multiple mechanisms. (FIG. 4A) Preattachment and post-attachment neutralization assays were performed for representative mAbs from each competition group, and a focus-forming assay was used to quantify 0 reduction in infection. In the pre-attachment assay, antibody was incubated with virus at 4°C before addition to Vero cells kept at 4°C. For the post-attachment assay, virus was applied to Vero cell monolayer cultures at 4°C before addition of antibody to cells at 4°C. Two independent experiments were performed in triplicates for each antibody, and representative curves are shown. (FIG. 4B) A fusion from without (FFWO) assay was used 5 to measure antibody inhibition of virus fusion with the cell membrane under low pH conditions. Virus was adsorbed to Vero cell culture monolayers at 4°C for an hour before addition of antibody dilutions, also at 4°C, after removing excess virus. Cells then were exposed to a pH 5.5 medium or a control medium at neutral pH for two minutes and incubated at 37°C. The acidic pH medium was removed and cells were incubated for an :0 additional 14 h before fixing, permeabilizing, and staining for intracellular virus antigens before flow cytometric analysis. Intracellular virus was quantified by measuring percent PE-positive cells relative to a virus-only control. Three separate experiments were performed in triplicates for each antibody (Kruskal-Wallis one-way ANOVA with Dunn’s post-test, with mean ± S.D. compared to virus-only control. (*p < 0.05, **p < 0.01, ***p 25 < 0.001)). (FIG. 4C) Representative flow cytometry contour plots are shown for the FFWO assay. Mock-infected cells under a low-pH condition and cells with no antibody under a neutral pH condition (to ensure that virus only entered the cell through pH-mediated fusion) are shown as negative controls, and cells with a non-specific mAb (ZIKA-117) under a low pH condition are shown as a positive control. (FIG. 4D) Antibody blocking of RRV binding 30 to mouse Mxra8-Fc fusion protein was determined through competition ELISA. Virus was captured on the plate with a human mAb before addition of RRV mAbs followed by 2020273365 20 Nov 2020 Mxra8-mFc (mouse Fc). A loss of signal indicates competition of RRV mAbs with Mxra8-mFc for binding to virus. Three independent experiments were performed in quadruplicate (Kruskal-Wallis one-way ANOVA with Dunn’s post-test, with mean ± S.D. compared to isotype control (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)). (FIG. 4E) Residues 5 that result in loss of Mxra8 binding to cell-surface-displayed chikungunya proteins are mapped onto the CHIKV E1 / E2 trimer of heterodimers (PDB 3J2W) in red, and the alanine footprint of mAbs that block binding of mouse Mxra8-Fc protein to RRV are shown in yellow. Overlapping epitopes of RRV mAbs and Mxra8 contact residues are denoted in orange. 0 FIGS. 5A-B. RRV mAbs increase mice survival rates when administered therapeutically. (FIG. 5A) Mice were given 0.2 mg of anti-Ifnarl mAb, and subsequently inoculated with 103 FFU of RRV in the footpad. At day one post-infection, 100 pg of RRV mAb was administered. Antibodies are grouped according to neutralization profiles, with those exhibiting incomplete neutralization in vitro on the left and those exhibiting complete 5 neutralization in vitro on the right. Two independent experiments were performed, with a total of n = 10 for each antibody group. The isotype control in the two graphs are the same. Statistical analysis was performed using a log rank test with Bonferroni correction: RRV-12, p = 0.0057; RRV-19, p < 0.0001; RRV-34, p < 0.0001; RRV-49, p = 0.0038; RRV-86, p = 0.0021; RRV-92, p = 0.0013; RRV-130, p = 0.0004; RRV-133, p = 0.3771; RRV-135, :0 p < 0.0001; RRV-139, p < 0.0001. (FIG. 5B) 100 pg of RRV-19, RRV-86, or an isotype control were administered 24 h post-infection, and the ipsilateral and contralateral gastrocnemius, quadriceps, ankle, or spleen tissues were collected 3 dpi. Viral RNA was quantified through qRT-PCR. Two independent experiments were performed, with a total of n = 10 mice for each antibody group (one-way ANOVA with a Dunnett’s post-test 25 comparing each group to the isotype control; **p < 0.01, ***p < 0.001, ****p < 0.0001). FIGS. 6A-B. RRV mAbs improve clinical disease and reduce viral RNA burden when given therapeutically in a WT mouse model. (FIG. 6A) Three-week-old WT C57BL / 6 mice were inoculated with 103 FFU of RRV strain T48 before administration of 100 pg antibody by intraperitoneal injection at 24 hpi. Mice were then weighed each day 30 over the course of 18 days and assigned a clinical score based on grip strength, gait, and righting reflex. Blind scoring of mice was performed using the following scoring system: 2020273365 20 Nov 2020 0, no disease; 1, mild defect in ipsilateral hind paw gripping; 2, mild defect in bilateral hind paw gripping; 3, bilateral loss in hind paw gripping; 4, bilateral loss in hind paw gripping with moderate hind limb weakness, observable mild altered gait, and difficulty or failure to right self; 5, bilateral loss in hind paw gripping with severe hind limb weakness, 5 moderate altered gait, and loss of righting reflex; 6, bilateral loss in hind paw gripping with severe hind limb weakness, severely altered gait with possible dragging hind paw, and loss of righting reflex; 7, moribund. Two independent experiments were performed, for a total of n=8 mice in each antibody group. Statistical analysis was performed using a one-way ANOVA of area under the curve test ( ****p < 0.0001). (FIG. 6B) Eighteen days post- 0 infection, the spleen, ipsilateral and contralateral gastrocnemius, quadriceps, and ankle tissues were collected following extensive perfusion with PBS. Viral RNA was quantified through qRT-PCR and statistical analysis was performed using a Kruskal-Wallis multiple comparisons test (*p < 0.05, **p < 0.01; ns = not significant). FIGS. 7A-B. Antibodies generated from donors naturally infected with Ross River 5 (RRV) or chikungunya (CHIKV) virus bind and neutralize RRV, Mayaro (MAYV), CHIKV, Sagiyama (SAGV), Getah (GETV), and O’nyong’nyong (ONNV) viruses. (FIG. 7A) Binding, or (FIG. 7B) neutralization profiles of three broadly neutralizing mAbs, as determined through ELISA or FRNT. Two independent experiments were performed, and representative binding and neutralization curves are shown, with error bars :0 representing mean ± S.D. Binding was measured using a virus ELISA and neutralization was measured using a focus reduction neutralization test (FRNT). Both ELISA and FRNT were performed in triplicate, and curves and IC50 or EC50 binding values were obtained using non-linear fit analysis with top of curve constrained to 100 for neutralization, using Prism software version 7 (GraphPad Software). 25 FIGS. 8A-D. Cross-reactive mAbs compete for the same antigenic site and inhibit binding to Mxra8 receptor protein. (FIG. 8A) An Octet RED96 instrument (Pall ForteBio) was used to perform epitope binning studies using competition binding. After a baseline measurement, Anti-Penta-HIS (HISIK) biosensor tips were used to immbolize either CHIKV or MAYV E2 protein containing a histidine tag. After another baseline 30 measurement, biosensors then were transferred to wells containing a first mAb at a concentration of 50 pg / mL for 5 min, before immersion in a solution containing a second 2020273365 20 Nov 2020 mAb, also at a concentration of 50 pg / mL for 5 min. The percent competition of the second mAb in the presence of the first mAb was determined by comparing the maximal signal of binding for the second mAb in the presence of the first antibody to the maximal signal of the second mAb in the absence of competition. Competition was defined by reduction of 5 the maximal binding score to <25% of un-competed binding (black boxes). A 25 to 50% reduction in maximal binding was considered intermediate competition (gray boxes). (FIG. 8B) Antibody blocking of virus binding to mouse Mxra8-Fc fusion protein was determined through competition ELISA. MAYV, CHIKV, or RRV were captured on the plate with a human mAb before addition of RRV mAbs followed by Mxra8-mFc (mouse Fc). A loss of 0 signal indicates competition of RRV mAbs with Mxra8-mFc for binding to virus. Two independent experiments were performed in quadruplicate. (FIG. 8C) Dose-response curve of mAb inhibition of virus binding to mouse Mxra8-Fc fusion protein through competition ELISA. Two independent experiments were performed in triplicate and representative curves are shown. (FIG. 8D) Half maximal inhibitory values (IC50) values for dose 5 response curves, calculated based on the average of two independent experiments performed in triplicate. FIGS. 9A-F. RRV-12 blocks entry and cell-cell spread of RRV, MAYV, CHIKV, SAGV, GETV, and ONNV. (FIG. 9A) RRV-12 blocks an entry step of RRV, MAYV, CHIKV, SAGV, GETV. Antibody at a concentration of 20 pg / mL was incubated 1:1 with :0 virus for 1 h at 37°C before addition to Vero cells for 1 h, also at 37°C. Antibody then was removed with 3 washes in medium before addition of a methylcellulose overlay. Cells were incubated at 37°C for 18 h before fixing and immunostaining. Foci were imaged and counted with an automated spot counter. Three independent experiments were performed, with triplicate samples in each experiment. Values were normalized to a virus-only control. 25 (One-way ANOVA with Kruskal-Wallis post-test, with mean ± S.D. compared to ZIKV-117 control (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)) (FIG. 9B) RRV-12 blocks cell-to-cell spread of RRV, MAYV, CHIKV, SAGV, GETV, and ONNV as measured through reduction of foci size. Virus was added to Vero cells for 1 h at 37°C before addition of 20 pg / mL of antibody diluted in methylcellulose overlay. After 18 h, 30 cells were fixed, immunostained, and foci size was measured with a CTL Biospot reader. Three independent experiments were performed with triplicate samples in each experiment. 2020273365 20 Nov 2020 Values were normalized to a virus-only control. (One-way ANOVA with Kruskal-Wallis post-test, with mean ± S.D. compared to ZIKV-117 control (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)) (FIGS. 9C-D) Representative images of RRV-12 reduction of foci size for RRV infection as compared to a control antibody, with antibody added to 5 methylcellulose overlay (FIG. 9C) or with antibody in the absence of methylcellulose overlay (FIG. 9D). Antibody concentrations were at 20 pg / mL and immunostaining was performed as in FRNT. (FIG. 9E) Pre-attachment and post-attachment neutralization assay for RRV-12. In the pre-attachment assay, antibody was incubated with virus at 4°C before addition to Vero cells kept at 4°C. For the post-attachment assay, virus was applied to Vero 0 cell monolayer cultures at 4°C before addition of antibody to cells at 4°C. Two independent experiments were performed in triplicate for each antibody, and representative curves are shown. (FIG. 9F) A fusion from without (FFWO) assay was used to measure antibody inhibition of virus fusion with the cell membrane under low pH conditions. Virus was adsorbed to Vero cell culture monolayers at 4°C for an hour before addition of antibody 5 dilutions, also at 4°C, after removing excess virus. Cells then were exposed to a pH 5.5 medium or a control medium at neutral pH for two minutes and incubated at 37°C. The acidic pH medium was removed and cells were incubated for an additional 14 h before fixing, permeabilizing, and staining for intracellular virus antigens before flow cytometric analysis. Intracellular virus was quantified by measuring percent PE-positive cells relative :0 to a virus-only control. Three separate experiments were performed in triplicate for each antibody. FIGS. 10A-C. Structural analysis of Fab RRV-12 binding to RRV, CHIKV, and MAYV by cryo-EM. (FIG. 10A) Cryo EM density maps of RRV, CHIKV, and MAYV bound by Fab RRV-12. Each map was determined by single particle reconstruction and 25 icosahedral averaging. The scale bar represents the radial distance from the particle center by color in Angstroms. The superimposed black triangle represents the asymmetric unit; symmetry axes are indicated by a pentagon for the five-fold axis, a triangle for the icosahedral three-fold axis, and an oval for the two-fold axis. The resolution of each map is 6.3A for RRV and 5.3A for both CHIKV and MAYV. (FIG. 10B) RIVEM road maps of 30 the viral surface. Scale bar, A, is radial distance from the center of the virus. Residues highlighted in yellow on RRV and MAYV E2 B domain, E2 A domain, and P-ribbon, and 2020273365 20 Nov 2020 CHIKV E2 B domain and E3 and are all located within 6 A or less to the backbone of the fitted Fab structure. Highlighted residues indicate the B domain of each i3 and q3 trimer is fully occupied. Residues highlighted in purple indicate residues of the viral surface 6A or less to the position of the backbone structures of Mxra8. Mxra8 occupies only one position 5 per trimer. (FIG. 10C) Cryo-density maps of RRV, CHIKV, and MAYV bound with Fab RRV-12 and native MAYV structure. Fab constant or variable domains are colored blue or red, respectively. The antibody variable domain binds the B domain of one trimer and the antibody constant domain extends to cover an adjacent trimer. The native structure is shown for a comparison with an unoccupied trimer. The remaining density of each 0 structure is colored based on radial distance from the center of the particle, see scale bar in (A). FIGS. 11A-C. Fab RRV-12 variable domain binds the B domain. (FIG. 11A) Ribbon diagrams of E2 ectodomain structure from each virus. Regions of the B domain highlighted in red are the predicted epitope. Highlighted regions span residues RRV 1835 187, 218-221, and 223; CHIKV E2 179-184, 198-200 and 213-219; and MAYV E2 184 187 and 219-221. Residues highlighted in red on the RRV and MAYV A domain and P-ribbon and on CHIKV E3 are predicted to be in close vicinity of the constant domain due to orientation of the Fab to the viral surface. Residues RRV 25-28 and 61-63, CHIKV 2224 and 192, and MAYV 25-27 and 192, shown in purple, are predicted to be the Mxra8 :0 binding site. (FIG. 11B) Surface representations of RRV, CHIKV, and MAYV trimer generated from the fitted asymmetric unit. El and E2 are blue and yellow, respectively. E3 on the CHIKV trimer is shown in green. The surface region highlighted in red on the B domain of each trimer is the predicted epitope. Positions highlighted in red on the RRV and MAYV A domain and P-ribbon are part of the constant domain footprint. Surfaces of 25 CHIKV E3 highlighted in red are part of both the variable and constant domain footprint. Areas highlighted in purple are the predicted position of Mxra8. (FIG. 11C) Amino acid sequence alignment of E2 B-domain residues 178-224 from viruses CHIKV, ONNV, MAYV, RRV, SAGV, GETV, generated using ALINE program (Bond and Schuttelkopf, 2009). Yellow boxes outline semi-conserved regions between the viruses containing 30 residues of the Fab RRV-12 epitope. (Top to bottom: SEQ ID NOS: 279-284) 2020273365 20 Nov 2020 FIGS. 12A-D. Protective activity of RRV-12 in vivo against RRV and MAYV. (FIG. 12A) RRV-12 reduces viral infection in immunocompetent model of RRV infection. RRV-12 (100 pg) was administered at 1 dpi to four-week-old WT C57BL / 6J mice, and ipsilateral and contralateral gastrocnemius, quadriceps, ankle, or spleen tissues were 5 collected 3 dpi for measurement of viral RNA through qRT-PCR. Two independent experiments were performed, with ten mice per antibody for each group (one-way ANOVA with a Dunnett’s post-test comparing each group to the isotype control; **p < 0.01, ***p < 0.001, ****p < 0.0001). (FIG. 12B) RRV-12 LALA mutant and RRV-12 intact mAb have similar therapeutic effect in immunocompetent mouse model of RRV infection. Intact 0 or LALA variant of RRV-12 (100 pg) was administered at 1 dpi to WT mice, and ipsilateral and contralateral gastrocnemius, quadriceps, ankle, or spleen tissues were collected 3 dpi for measurement of viral RNA through qRT-PCR. Two independent experiments were performed, with ten mice per antibody for each group (one-way ANOVA with a Dunnett’s post-test comparing each group to the isotype control; **p < 0.01, ***p < 0.001, ****p < 5 0.0001). (FIG. 12C) RRV-12 increases survival when administered therapeutically after RRV infection in an immunocompromised mouse model. Mice were given 0.2 mg of anti-Ifnarl antibody, and subsequently inoculated with 103 FFU of RRV in the footpad. At 1 dpi, 100 pg of RRV antibody was administered, and mice survival was monitored for three weeks. Two independent experiments were performed, with 10 mice per antibody for each :0 group. Statistical analysis was performed using a log rank test with Bonferroni correction, p = 0.0057. (FIG. 12D) RRV-12 reduces viral burden in an immunocompetent model of MAYV infection in mice. As described above, RRV-12 (100 pg) was administered 1 dpi with 103 FFU of MAYV in WT mice, and ipsilateral and contralateral gastrocnemius, quadriceps, ankle, or spleen tissues were collected 3 dpi for measurement of viral RNA by 25 qRT-PCR. Two independent experiments were performed, with a total of ten mice for each antibody group (one-way ANOVA with a Dunnett’s post-test comparing each group to the isotype control; **p < 0.01, ***p < 0.001, ****p < 0.0001). FIGS. 7A-B. RRV-12 improves RRV-induced clinical disease and reduces viral RNA burden when given therapeutically in WT mice. (FIG. 7A) Three-week-old WT 30 C57BL / 6J mice were inoculated with 103 FFU of RRV strain T48 before administration of 100 pg antibody by intraperitoneal injection at 24 hpi. Mice were then weighed each day 2020273365 20 Nov 2020 over the course of 18 days and assigned a clinical score based on grip strength, gait, and righting reflex. Two independent experiments were performed, for a total of n=7-8 mice in each antibody group. Statistical analysis was performed using a student’s t-test of area under the curve analysis ( ****p < 0.0001). (FIG. 7B) Eighteen days post-infection, the 5 spleen, ipsilateral and contralateral gastrocnemius, quadriceps, and ankle tissues were collected following extensive perfusion with PBS. Viral RNA was quantified through qRT-PCR and statistical analysis was performed using a Mann Whitney test (*p < 0.05, **p < 0.01, ***p< 0.001). FIG. SI. Neutralization activity of RRV mAbs against RRV strain T48. Red circles 0 represent percent neutralization relative to control at different antibody concentrations. Logistic curves are indicated by solid lines, and 95% credible intervals are indicated by dashed lines. A line at 100% neutralization highlights mAbs that completely neutralize. Multiple experiments were performed in triplicate, and the best fit curve is shown. FIG. S2. Neutralization profiles for five clinical isolate strains of RRV tested 5 against four antibodies using a focus reduction neutralization test. RRV strains PW7 and SN11 were isolated from adult patients in 2009. RRV strain 2897601 (QML 2006) was isolated from an adult patient in 2006, and RRV strain O’Regan was isolated from an EP patient. The P7 and P14 isolates have been sequenced, and four mutations in the E2 protein were uncovered in the P7 strain: I76L, D132N, S182P, and R251K; for the P14 strain, there :0 are two mutations in the E2 protein: I67L and R251K (Wressnigg et al., 2015; Aaskov et al., 1997; Liu et al., 2011). Red circles represent percent neutralization relative to control at different antibody concentrations. Logistic curves are indicated by solid lines, and 95% credible intervals are indicated by dashed lines. Multiple experiments were performed in triplicate, and the best fit curve is shown. 25 FIG. S3. Graphs showing percent binding of antibody to mutant residues relative to WT surface-expressed RRV proteins in alanine scanning mutagenesis. A cutoff value of 10% (indicated by red dotted line) was used to determine mAb loss-of-binding at a residue, with the requirement that two other mAbs have binding of 50% or greater (indicated by the green dotted line). The orange colored graphs indicate mAbs meeting this 30 requirement. The bar graphs represent the mean of two experiments, with the values from each individual experiment indicated by the white dots. 2020273365 20 Nov 2020 FIG. S4. E2 protein sequence alignment for six viruses generated using Jalview software (version 2.11.0), related to FIGS. 7A-B. Red shading or font indicates conserved regions of sequence. (Top to bottom: SEQ ID NOS: 285-290) FIG. S5. Phylogenetic tree generated using neighbor-joining tree function in 5 Jalview multiple alignment editor, related to FIGS. 7A-B. Numbers indicate the distances calculated for the amino acid sequences of the E2 protein from six viruses: RRV, SAGV, GETV, MAYV, ONNV, and CHIKV. FIG. S6. Representative binding and neutralization curves, related to FIGS. 9A- F. Results are shown for RRV, MAYV, SAGV, ONNV, GETV, and CHIKV, as 0 determined through virus ELISA and focus reduction neutralization test. FIGS. S7A-B. RRV12 constant domain is near the viral surface, related to FIGS. 10A-C. (FIG. S7A) The density of each Fab bound virus asymmetric unit was extracted with PHENIX (D. Liebschner, P. V. et al. Acta Cryst. (2019). D75, 861-877). Fitted E2 structures are yellow; the Fab variable domains are red and constant domains are blue. The 5 q3 axis of the asymmetric unit, the B domain, and E3 on CHIKV are all labeled. The asterisk on RRV and MAYV indicates space between the constant domain of the Fab and viral surface. (FIG. S7B) RRV-12 and Mxra8 binding potentially occlude one another. The CHIKV E1-E2-E3 ectodomain heterodimer shown with either Mxra8 or RRV-12 bound and both Fab and Mxra8 bound. El is blue, E2 is yellow, E3 is tan, Fab is purple, and :0 Mxra8 is cyan. 2020273365 20 Nov 2020 DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS As discussed above, Ross River fever is a mosquito-transmitted viral disease that is endemic to Australia and the surrounding Pacific Islands. Ross River virus (RRV) belongs to the arthritogenic group of alphaviruses, which largely cause disease characterized by 5 debilitating joint pain, rash, and fever. There is no specific treatment or licensed vaccine available, and the mechanisms of protective humoral immunity are poorly understood. Here, the inventors describe human mAbs isolated from individuals who were naturally infected with RRV. These mAbs neutralized RRV infectivity in cell culture, protected mice when administered therapeutically, and reduced viral burden in multiple tissues. Furthermore, these 0 mAbs bind to multiple domains on the E2 protein, as determined through alanine scanning mutagenesis, and roughly fall into two competition-binding groups, revealing that the A and B domains are the major antigenic targets for the human neutralizing antibody response. These mAbs blocked infection by preventing viral attachment and entry to the cell and also blocked at a later step in the virus life cyle associated with viral fusion. Notably, nearly all of the neutralizing mAbs 5 blocked attachment of RRV to Mxra8, a recently discovered entry receptor for RRV, CHIKV, and other arthritogenic alphaviruses (Zhang et al., 2018). These and other aspects of the disclosure are described in detail below. I. Ross River Virus fi Ross River virus (RRV) is a small encapsulated single-strand RNA Alphavirus endemic to Australia, Papua New Guinea and other islands in the South Pacific. It is responsible for a type of mosquito-borne non-lethal but debilitating tropical disease known as Ross River fever, previously termed "epidemic polyarthritis". The virus is suspected to be enzootic in populations of various native Australian mammals and has been found on occasion in horses. 25 Taxonomically, Ross River virus belongs to the virus genus Alphavirus, which is part of the family Togaviridae. The alphaviruses are a group of small enveloped single-strand positivesense RNA viruses. RRV belongs to a subgroup of "Old World" (Eurasian-African-Australasian) alphaviruses and is considered closely related to Sagiyama virus. The virions (virus particles) themselves contain their genome in a protein capsid 700 A in 30 diameter. They are characterised by the presence of two glycoproteins (El and E2) embedded as trimeric dimers in a host-derived lipid envelope. 2020273365 20 Nov 2020 Because RRV is transmitted by mosquitos, it is considered an arbovirus, a non-taxonomic term for viruses bome by arthropod vectors. In 1928, an outbreak of acute febrile arthritis was recorded in Narrandera and Hay in New South Wales, Australia. In 1943, several outbreaks of arthralgia and arthritis were described in the 5 Northern Territory, Queensland and the Schouten Islands, off the northern coast of Papua New Guinea. The name epidemic polyarthritis was coined for this disease. In 1956, an epidemic occurred in the Murray Valley which was compared to "acute viral polyarthritis" caused by Chikungunya virus. The Australian disease seemed to progress in milder fashion. In 1956, serological testing suggested an unknown new species of alphavirus (group A arbovirus) was the 0 likely culprit. In July and August 1956 and 1957, a virus recovered from mosquitoes collected near Tokyo, Japan, and was dubbed Sagiyama virus. This was considered a separate species for a time, but now is considered conspecific with Ross River virus. In 1959, a new alphavirus was identified in mosquito (Ochlerotatus vigilax) samples 5 trapped near Ross River, near Townsville, Queensland, Australia. Further serological testing showed that patients who had suffered "epidemic polyarthritis" in Queensland had antibodies to the virus. The new virus was named Ross River virus, and the disease Ross River fever. The virus itself was first isolated in 1972 using suckling mice. It was found that RRV isolated from human serum could kill mice. However, the serum containing the virus that was used :0 had come from an Aboriginal boy from Edward River, North Queensland. The child had a fever and a rash but no arthritis making the link between RRV and Ross River fever less than concrete. The largest ever outbreak of the virus was in 1979-1980 and occurred in the western Pacific. The outbreak involved the islands of Fiji, Samoa, the Cook Islands, and New Caledonia. However, RRV was later isolated in humans following a series of epidemic polyarthritis outbreaks 25 in Fiji, Samoa and the Cook Islands during 1979. RRV was isolated in an Australian patient suffering from Ross River fever in 1985. In 2010, Ross River virus was found to have made its way to the Aundh area in Pune, India and spread to other parts of the city. A tourist to Australia probably returned infected with the virus. The RRV infection is characterized by inflammation and pain to multiple joints. 30 Hydration by sufficient fluid intake is recommended to ensure that the fever does not rise to very 2020273365 20 Nov 2020 dangerous levels. It is recommended that a doctor be consulted immediately as regular paracetamol gives only temporary reprieve from the fever. In rural and regional areas of Australia, the continued prevalence of Ross River virus is thought to be supported by natural reservoirs such as large marsupial mammals. Antibodies to 5 Ross River virus have been found in a wide variety of placental and marsupial mammals, and also in a few bird species. It is not presently known what reservoir hosts support Ross River virus in metropolitan areas such as Brisbane. The southern saltmarsh mosquito (Aedes camptorhynchus), which is known to carry the Ross River virus, was discovered in Napier, New Zealand, in 1998. Due to an 11-year program by 0 the New Zealand Ministry of Health, and later the Ministry of Agriculture & Fisheries, the species was declared completely eradicated from New Zealand in July 2010. As of September 2006, there has never been a report of a case of Ross River virus acquired within New Zealand. Separate mosquito species may act as vector, widespread across areas and seasonaFgeographical locations. In southern and northern regions, the Aedes group {camptorhynchus and vigilax) are the main RRV 5 carriers. However, inland the Culex annulirostris is the main carrier with Aedes mosquitoes becoming active during wet seasons. There are several factors that can contribute to an individual's risk for Ross River virus in Australia. These risks were trialed in a study conducted in tropical Australia which illustrate that factors such as camping, light coloured clothing, exposure to certain flora and fauna and specific :0 protective mechanisms are able to increase or decrease the likelihood of contracting the virus. By increasing the frequency of camping the individual's risk increases eight-fold, suggesting that an increased exposure to wildlife increases risk. This is shown by the narrow 95% confidence interval of 1.07-4.35 within the study. For example, an individual's exposure to kangaroos, wallabies and bromeliad plants also increased risk, suggesting that they are reservoirs for infection, breeding 25 sites for mosquitoes and potential vectors of the virus. Although these areas show a higher risk for the virus human should still enjoy the wildlife but consider that preventive mechanisms as increasingly important while camping. Ross River virus can be easily prevented through small behavioural mechanisms which should be of high importance in tropical areas and during participation of outdoor activities. Firstly, 30 insect repellent should be rigorously used as to prevent bites from insects that specifically include mosquitoes which are vectors that carry the disease. A study in tropical Australia shows a very 2020273365 20 Nov 2020 narrow 95% confidence interval of 0.20-1.00 for a decrease in Ross River virus risk as a result of increased use of insect repellent, suggesting a strong correlation between the two. Following, burning citronella candles are based on the same principle, that it repels insects that are vectors of the virus. Burning such candles also show a strong correlation with decreased Ross River virus 5 risk shown in the same study with a narrow 95% confidence interval of 0.10-0.78. Secondly, wearing light coloured clothing decrease the risk of Ross River virus three-fold. This is again based on the repelling of vectors such as mosquitoes through the use of bright colours. Lastly, high risk areas should be minimised by mechanisms of prevention that are applied within households. For example, screens should be fitted to windows and doors to prevent entry of insects carrying the 0 virus and potential breeding areas such as open water containers or water holding plants should be removed. Therefore, specific climatic environments should be assessed for high risk factors and the appropriate precautions should be taken in response. Ross River virus can cause multiple symptoms on someone who is infected, the most common being arthritis or joint pain. Other symptoms include a rash on the limbs of the body, 5 which often occurs roughly 10 days after arthritis begins. Lymph nodes may enlarge, most commonly in the arm pits or groin region, and rarely a feeling of ‘pins and needles’ in the persons hands and feet, but only occurs in a small number of people. The virus also causes moderate symptoms in horses. The symptoms of Ross River virus are important to recognize for early diagnosis and :0 therefore early treatment. Symptoms have been illustrated in a case report of an infected Thuringian traveler returning from South-East Australia. This case showed flu-like symptoms that include fever, chills, headache and pains in the body. Additionally, joint pain arose in which some joints become swollen and joint stiffness was particularly noticeable. A clinical examination of the infected individual shows a significant decrease of specific antibodies despite the normal blood 25 count levels. A rash is a good indication that is likely to occur but usually disappears after ten days. The symptoms of Ross River virus are important to be aware of so that early treatment can be administered before the virus worsens. The time between catching the disease and experiencing symptoms is anywhere between three days to three weeks, usually it takes about 1-2 weeks. A person can be tested for Ross River virus by a blood test, other illnesses may need to be excluded 30 before diagnosis. 2020273365 20 Nov 2020 Testing for Ross River virus should occur in patients who are experiencing acute polyarthritis, tiredness and / or rashes (-90%) with a history of travel within areas prone to infection from the virus. Serology (blood tests) is the appropriate manner by which to diagnose Ross River virus. Within 7 days of infection, the virus produces Immunoglobulin M (IgM) and is a 5 presumptive positive diagnosis. IgM may persist for months or even years and therefore false positives may be triggered by Barmah Forest virus, rubella, Q fever or rheumatoid factor. To completely test for Ross River virus, a second serology test must be conducted 10-14 days after the first. The patient may then be declared positive for Ross River virus infection if there is a 4fold increase of IgM antibody count. 0 II. Monoclonal Antibodies and Production Thereof An "isolated antibody" is one that has been separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, 5 hormones, and other proteinaceous or non-proteinaceous solutes. In particular embodiments, the antibody is purified: (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most particularly more than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues ofN-terminal or internal amino acid sequence by use of a spinning cup sequenator; or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie :0 blue or silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. An IgM antibody consists of 5 basic 25 heterotetramer units along with an additional polypeptide called J chain, and therefore contain 10 antigen binding sites, while secreted IgA antibodies can polymerize to form polyvalent assemblages comprising 2-5 of the basic 4-chain units along with J chain. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide 30 bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N-terminus, a variable region (Vh) followed by three 2020273365 20 Nov 2020 constant domains (Ch) for each of the alpha and gamma chains and four Ch domains for mu and isotypes. Each L chain has at the N-terminus, a variable region (Vl) followed by a constant domain (Cl) at its other end. The Vl is aligned with the Vh and the Cl is aligned with the first constant domain of the heavy chain (Chi). Particular amino acid residues are believed to form an interface 5 between the light chain and heavy chain variable regions. The pairing of a Vh and Vl together forms a single antigen-binding site. For the structure and properties of the different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, Conn., 1994, page 71, and Chapter 6. 0 The L chain from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda based on the amino acid sequences of their constant domains (Cl). Depending on the amino acid sequence of the constant domain of their heavy chains (Ch), immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, having heavy chains designated alpha, delta, 5 epsilon, gamma and mu, respectively. They gamma and alpha classes are further divided into subclasses on the basis of relatively minor differences in Ch sequence and function, humans express the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2. The term "variable" refers to the fact that certain segments of the V domains differ extensively in sequence among antibodies. The V domain mediates antigen binding and defines :0 specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable regions. Instead, the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called "hypervariable regions" that are each 9-12 amino acids long. The variable regions of native heavy and light chains each comprise four FRs, largely 25 adopting a beta-sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, 30 National Institutes of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as 2020273365 20 Nov 2020 participation of the antibody in antibody dependent cellular cytotoxicity (ADCC), antibodydependent cellular phagocytosis (ADCP), antibody-dependent neutrophil phagocytosis (ADNP), and antibody-dependent complement deposition (ADCD). The term "hypervariable region" when used herein refers to the amino acid residues of an 5 antibody that are responsible for antigen binding. The hypervariable region generally comprises amino acid residues from a "complementarity determining region" or "CDR" (e.g., around about residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the Vl, and around about 31-35 (Hl), 50-65 (H2) and 95-102 (H3) in the Vh when numbered in accordance with the Kabat numbering system; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, 0 National Institutes of Health, Bethesda, Md. (1991)); and / or those residues from a "hypervariable loop" (e.g., residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the Vl, and 26-32 (Hl), 52-56 (H2) and 95-101 (H3) in the Vh when numbered in accordance with the Chothia numbering system; Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)); and / or those residues from a "hypervariable loop'VCDR (e.g., residues 27-38 (LI), 56-65 (L2) and 105-120 (L3) in the Vl, and 27-38 (Hl), 565 65 (H2) and 105-120 (H3) in the Vh when numbered in accordance with the IMGT numbering system; Lefranc, M. P. et al. Nucl. Acids Res. 27:209-212 (1999), Ruiz, M. et al. Nucl. Acids Res. 28:219-221 (2000)). Optionally the antibody has symmetrical insertions at one or more of the following points 28, 36 (LI), 63, 74-75 (L2) and 123 (L3) in the Vl, and 28, 36 (Hl), 63, 74-75 (H2) and 123 (H3) in the VsubH when numbered in accordance with AHo; Honneger, A. and :0 Plunkthun, A. J. Mol. Biol. 309:657-670 (2001)). By "germline nucleic acid residue" is meant the nucleic acid residue that naturally occurs in a germline gene encoding a constant or variable region. "Germline gene" is the DNA found in a germ cell (i.e., a cell destined to become an egg or in the sperm). A "germline mutation" refers to a heritable change in a particular DNA that has occurred in a germ cell or the zygote at the 25 single-cell stage, and when transmitted to offspring, such a mutation is incorporated in every cell of the body. A germline mutation is in contrast to a somatic mutation which is acquired in a single body cell. In some cases, nucleotides in a germline DNA sequence encoding for a variable region are mutated (i.e., a somatic mutation) and replaced with a different nucleotide. The term "monoclonal antibody" as used herein refers to an antibody obtained from a 30 population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in 2020273365 20 Nov 2020 minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal 5 antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier "monoclonal" is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies useful in the present disclosure may be prepared by the hybridoma methodology first described by Kohler et al., Nature, 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant 0 cells (see, e.g., U.S. Patent 4,816,567) after single cell sorting of an antigen specific B cell, an antigen specific plasmablast responding to an infection or immunization, or capture of linked heavy and light chains from single cells in a bulk sorted antigen specific collection. The "monoclonal antibodies" may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:5815 597 (1991), for example. A. General Methods It will be understood that monoclonal antibodies binding to RRV will have several applications. These include the production of diagnostic kits for use in detecting and diagnosing :0 RRV infection, as well as for treating the same. In these contexts, one may link such antibodies to diagnostic or therapeutic agents, use them as capture agents or competitors in competitive assays, or use them individually without additional agents being attached thereto. The antibodies may be mutated or modified, as discussed further below. Methods for preparing and characterizing antibodies are well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring 25 Harbor Laboratory, 1988; U.S. Patent 4,196,265). The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. The first step for both these methods is immunization of an appropriate host or identification of subjects who are immune due to prior natural infection or vaccination with a licensed or experimental vaccine. As is well known in the 30 art, a given composition for immunization may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or 2020273365 20 Nov 2020 polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-5 maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimyde and bis-biazotized benzidine. As also is well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Exemplary and preferred adjuvants in animals include complete Freund’s adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete 0 Freund’s adjuvants and aluminum hydroxide adjuvant and in humans include alum, CpG, MFP59 and combinations of immunostimulatory molecules (“Adjuvant Systems”, such as AS01 or AS03). Additional experimental forms of inoculation to induce RRV-specific B cells is possible, including nanoparticle vaccines, or gene-encoded antigens delivered as DNA or RNA genes in a physical delivery system (such as lipid nanoparticle or on a gold biolistic bead), and delivered with needle, 5 gene gun, transcutaneous electroporation device. The antigen gene also can be carried as encoded by a replication competent or defective viral vector such as adenovirus, adeno-associated virus, poxvirus, herpesvirus, or alphavirus replicon, or alternatively a virus like particle. In the case of human antibodies against natural pathogens, a suitable approach is to identify subjects that have been exposed to the pathogens, such as those who have been diagnosed as having :0 contracted the disease, or those who have been vaccinated to generate protective immunity against the pathogen or to test the safety or efficacy of an experimental vaccine. Circulating anti-pathogen antibodies can be detected, and antibody encoding or producing B cells from the antibody-positive subject may then be obtained. The amount of immunogen composition used in the production of polyclonal antibodies 25 varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, also may be given. The process of boosting and titering is repeated until a 30 suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized 2020273365 20 Nov 2020 animal can be bled and the serum isolated and stored, and / or the animal can be used to generate MAbs. Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These 5 cells may be obtained from biopsied spleens, lymph nodes, tonsils or adenoids, bone marrow aspirates or biopsies, tissue biopsies from mucosal organs like lung or GI tract, or from circulating blood. The antibody-producing B lymphocytes from the immunized animal or immune human are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized or human or human / mouse chimeric cells. Myeloma cell lines suited for use 0 in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas). Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984). HMMA2.5 cells or MFP-2 cells are particularly useful 5 examples of such cells. Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2:1 proportion, though the proportion may vary from about 20:1 to about 1:1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. In some cases, :0 transformation of human B cells with Epstein Barr virus (EBV) as an initial step increases the size of the B cells, enhancing fusion with the relatively large-sized myeloma cells. Transformation efficiency by EBV is enhanced by using CpG and a Chk2 inhibitor drug in the transforming medium. Alternatively, human B cells can be activated by co-culture with transfected cell lines expressing CD40 Ligand (CD 154) in medium containing additional soluble factors, such as IL-21 25 and human B cell Activating Factor (BAFF), a Type II member of the TNF superfamily. Fusion methods using Sendai virus have been described by Kohler and Milstein (1975; 1976), and those using polyethylene glycol (PEG), such as 37% (v / v) PEG, by Gefter et al. (1977). The use of electrically induced fusion methods also is appropriate (Goding, pp. 71-74, 1986) and there are processes for better efficiency (Yu et al., 2008). Fusion procedures usually produce viable hybrids 30 at low frequencies, about 1 x 10'6 to 1 x 10'8, but with optimized procedures one can achieve fusion efficiencies close to 1 in 200 (Yu et al., 2008). However, relatively low efficiency of fusion does 2020273365 20 Nov 2020 not pose a problem, as the viable, fused hybrids are differentiated from the parental, infused cells (particularly the infused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture medium. Exemplary and preferred 5 agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis. Where aminopterin or methotrexate is used, the medium is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium). Where azaserine is used, the medium is supplemented with hypoxanthine. Ouabain is added if the B cell source is an EBV-transformed 0 human B cell line, in order to eliminate EBV-transformed lines that have not fused to the myeloma. The preferred selection medium is HAT or HAT with ouabain. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited 5 life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells. When the source of B cells used for fusion is a line of EBV-transformed B cells, as here, ouabain may also be used for drug selection of hybrids as EBV-transformed B cells are susceptible to drug killing, whereas the myeloma partner used is chosen to be ouabain resistant. :0 Culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays dot 25 immunobinding assays, and the like. The selected hybridomas are then serially diluted or singlecell sorted by flow cytometric sorting and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide mAbs. The cell lines may be exploited for MAb production in two basic ways. A sample of the hybridoma can be injected (often into the peritoneal cavity) into an animal (e.g., a mouse). Optionally, the animals are primed with a 30 hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. When human hybridomas are used in this way, it is optimal to inject immunocompromised mice, such as 2020273365 20 Nov 2020 SCID mice, to prevent tumor rejection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide MAbs in high concentration. The individual cell lines could also be cultured in vitro, where the MAbs are naturally secreted into the culture 5 medium from which they can be readily obtained in high concentrations. Alternatively, human hybridoma cells lines can be used in vitro to produce immunoglobulins in cell supernatant. The cell lines can be adapted for growth in serum-free medium to optimize the ability to recover human monoclonal immunoglobulins of high purity. MAbs produced by either means may be further purified, if desired, using filtration, 0 centrifugation and various chromatographic methods such as FPLC or affinity chromatography. Fragments of the monoclonal antibodies of the disclosure can be obtained from the purified monoclonal antibodies by methods which include digestion with enzymes, such as pepsin or papain, and / or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present disclosure can be synthesized using an automated 5 peptide synthesizer. It also is contemplated that a molecular cloning approach may be used to generate monoclonal antibodies. Single B cells labelled with the antigen of interest can be sorted physically using paramagnetic bead selection or flow cytometric sorting, then RNA can be isolated from the single cells and antibody genes amplified by RT-PCR. Alternatively, antigen-specific bulk sorted :0 populations of cells can be segregated into microvesicles and the matched heavy and light chain variable genes recovered from single cells using physical linkage of heavy and light chain amplicons, or common barcoding of heavy and light chain genes from a vesicle. Matched heavy and light chain genes form single cells also can be obtained from populations of antigen specific B cells by treating cells with cell-penetrating nanoparticles bearing RT-PCR primers and barcodes 25 for marking transcripts with one barcode per cell. The antibody variable genes also can be isolated by RNA extraction of a hybridoma line and the antibody genes obtained by RT-PCR and cloned into an immunoglobulin expression vector. Alternatively, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the cell lines and phagemids expressing appropriate antibodies are selected by panning using viral antigens. The advantages of this 30 approach over conventional hybridoma techniques are that approximately 104 times as many antibodies can be produced and screened in a single round, and that new specificities are generated 2020273365 20 Nov 2020 by H and L chain combination which further increases the chance of finding appropriate antibodies. Other U.S. patents, each incorporated herein by reference, that teach the production of antibodies useful in the present disclosure include U.S. Patent 5,565,332, which describes the 5 production of chimeric antibodies using a combinatorial approach; U.S. Patent 4,816,567 which describes recombinant immunoglobulin preparations; and U.S. Patent 4,867,973 which describes antibody-therapeutic agent conjugates. B. Antibodies of the Present Disclosure 0 Antibodies according to the present disclosure may be defined, in the first instance, by their binding specificity. Those of skill in the art, by assessing the binding specificity / affinity of a given antibody using techniques well known to those of skill in the art, can determine whether such antibodies fall within the scope of the instant claims. For example, the epitope to which a given antibody bind may consist of a single contiguous sequence of 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 5 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids located within the antigen molecule (e.g., a linear epitope in a domain). Alternatively, the epitope may consist of a plurality of non-contiguous amino acids (or amino acid sequences) located within the antigen molecule (e.g., a conformational epitope). Various techniques known to persons of ordinary skill in the art can be used to determine :0 whether an antibody “interacts with one or more amino acids” within a polypeptide or protein. Exemplary techniques include, for example, routine cross-blocking assays, such as that described in Antibodies, Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). Crossblocking can be measured in various binding assays such as ELISA, biolayer interferometry, or surface plasmon resonance. Other methods include alanine scanning mutational analysis, peptide 25 blot analysis (Reineke (2004) Methods Mol. Biol. 248: 443-63), peptide cleavage analysis, high-resolution electron microscopy techniques using single particle reconstruction, cryoEM, or tomography, crystallographic studies and NMR analysis. In addition, methods such as epitope excision, epitope extraction and chemical modification of antigens can be employed (Tomer (2000) Prot. Sci. 9: 487-496). Another method that can be used to identify the amino acids within 30 a polypeptide with which an antibody interacts is hydrogen / deuterium exchange detected by mass spectrometry. In general terms, the hydrogen / deuterium exchange method involves deuterium- 2020273365 20 Nov 2020 labeling the protein of interest, followed by binding the antibody to the deuterium-labeled protein. Next, the protein / antibody complex is transferred to water and exchangeable protons within amino acids that are protected by the antibody complex undergo deuterium-to-hydrogen back-exchange at a slower rate than exchangeable protons within amino acids that are not part of the interface. As 5 a result, amino acids that form part of the protein / antibody interface may retain deuterium and therefore exhibit relatively higher mass compared to amino acids not included in the interface. After dissociation of the antibody, the target protein is subjected to protease cleavage and mass spectrometry analysis, thereby revealing the deuterium-labeled residues which correspond to the specific amino acids with which the antibody interacts. See, e.g., Ehring (1999) Analytical 0 Biochemistry 267: 252-259; Engen and Smith (2001) Anal. Chern. 73: 256A-265A. When the antibody neutralizes RRV, antibody escape mutant variant organisms can be isolated by propagating RRV in vitro or in animal models in the presence of high concentrations of the antibody. Sequence analysis of the RRV envelope gene encoding the antigen targeted by the antibody reveals the mutation(s) conferring antibody escape, indicating residues in the epitope or 5 that affect the structure of the epitope allosterically. The term “epitope” refers to a site on an antigen to which B and / or T cells respond. B-cell epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding :0 are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. Modification-Assisted Profiling (MAP), also known as Antigen Structure-based Antibody Profiling (ASAP) is a method that categorizes large numbers of monoclonal antibodies (mAbs) directed against the same antigen according to the similarities of the binding profile of each 25 antibody to chemically or enzymatically modified antigen surfaces (see US 2004 / 0101920, herein specifically incorporated by reference in its entirety). Each category may reflect a unique epitope either distinctly different from or partially overlapping with epitope represented by another category. This technology allows rapid filtering of genetically identical antibodies, such that characterization can be focused on genetically distinct antibodies. When applied to hybridoma 30 screening, MAP may facilitate identification of rare hybridoma clones that produce mAbs having 2020273365 20 Nov 2020 the desired characteristics. MAP may be used to sort the antibodies of the disclosure into groups of antibodies binding different epitopes. The present disclosure includes antibodies that may bind to the same epitope, or a portion of the epitope. Likewise, the present disclosure also includes antibodies that compete for binding 5 to a target or a fragment thereof with any of the specific exemplary antibodies described herein. One can easily determine whether an antibody binds to the same epitope as, or competes for binding with, a reference antibody by using routine methods known in the art. For example, to determine if a test antibody binds to the same epitope as a reference, the reference antibody is allowed to bind to target under saturating conditions. Next, the ability of a test antibody to bind to 0 the target molecule is assessed. If the test antibody is able to bind to the target molecule following saturation binding with the reference antibody, it can be concluded that the test antibody binds to a different epitope than the reference antibody. On the other hand, if the test antibody is not able to bind to the target molecule following saturation binding with the reference antibody, then the test antibody may bind to the same epitope as the epitope bound by the reference antibody. 5 To determine if an antibody competes for binding with a reference anti-RRV envelope protein antibody, the above-described binding methodology is performed in two orientations: In a first orientation, the reference antibody is allowed to bind to the RRV envelope protein antigen under saturating conditions followed by assessment of binding of the test antibody to the RRV envelope protein molecule. In a second orientation, the test antibody is allowed to bind to the RRV :0 envelope protein antigen molecule under saturating conditions followed by assessment of binding of the reference antibody to the RRV envelope protein molecule. If, in both orientations, only the first (saturating) antibody is capable of binding to the RRV envelope protein, then it is concluded that the test antibody and the reference antibody compete for binding to the RRV envelope protein. As will be appreciated by a person of ordinary skill in the art, an antibody that competes for binding 25 with a reference antibody may not necessarily bind to the identical epitope as the reference antibody but may sterically block binding of the reference antibody by binding an overlapping or adjacent epitope. Two antibodies bind to the same or overlapping epitope if each competitively inhibits (blocks) binding of the other to the antigen. That is, a 1-, 5-, 10-, 20- or 100-fold excess of one 30 antibody inhibits binding of the other by at least 50% but preferably 75%, 90% or even 99% as measured in a competitive binding assay (see, e.g., Junghans et al., Cancer Res. 1990 50:1495- 2020273365 20 Nov 2020 1502). Alternatively, two antibodies have the same epitope if essentially all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. Two antibodies have overlapping epitopes if some amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. 5 Additional routine experimentation (e.g., peptide mutation and binding analyses) can then be carried out to confirm whether the observed lack of binding of the test antibody is in fact due to binding to the same epitope as the reference antibody or if steric blocking (or another phenomenon) is responsible for the lack of observed binding. Experiments of this sort can be performed using ELISA, RIA, surface plasmon resonance, flow cytometry or any other 0 quantitative or qualitative antibody-binding assay available in the art. Structural studies with EM or crystallography also can demonstrate whether or not two antibodies that compete for binding recognize the same epitope. In another aspect, there are provided monoclonal antibodies having clone-paired CDRs from the heavy and light chains as illustrated in Tables 3 and 4, respectively. Such antibodies may 5 be produced by the clones discussed below in the Examples section using methods described herein. In another aspect, the antibodies may be defined by their variable sequence, which include additional “framework” regions. These are provided in Tables 1 and 2 that encode or represent full variable regions. Furthermore, the antibodies sequences may vary from these sequences, :0 optionally using methods discussed in greater detail below. For example, nucleic acid sequences may vary from those set out above in that (a) the variable regions may be segregated away from the constant domains of the light and heavy chains, (b) the nucleic acids may vary from those set out above while not affecting the residues encoded thereby, (c) the nucleic acids may vary from those set out above by a given percentage, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 25 94%, 95%, 96%, 97%, 98% or 99% homology, (d) the nucleic acids may vary from those set out above by virtue of the ability to hybridize under high stringency conditions, as exemplified by low salt and / or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C, (e) the amino acids may vary from those set out above by a given percentage, e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 30 or 99% homology, or (f) the amino acids may vary from those set out above by permitting 2020273365 20 Nov 2020 conservative substitutions (discussed below). Each of the foregoing applies to the nucleic acid sequences set forth as Table 1 and the amino acid sequences of Table 2. When comparing polynucleotide and polypeptide sequences, two sequences are said to be "identical" if the sequence of nucleotides or amino acids in the two sequences is the same when 5 aligned for maximum correspondence, as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A "comparison window" as used herein, refers to a segment of at least about 20 contiguous positions, usually 30 to about 75, 40 to about 50, in which a sequence may be compared to a reference sequence of the same number of contiguous positions 0 after the two sequences are optimally aligned. Optimal alignment of sequences for comparison may be conducted using the Megalign program in the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wis.), using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, M. O. (1978) A model of evolutionary change in proteins—Matrices 5 for detecting distant relationships. In Dayhoff, M. O. (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington D.C. Vol. 5, Suppl. 3, pp. 345-358; Hein J. (1990) Unified Approach to Alignment and Phylogeny pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, Calif; Higgins, D. G. and Sharp, P. M. (1989) CABIOS 5:151-153; Myers, E. W. and Muller W. (1988) CABIOS 4:11-17; Robinson, E. D. (1971) Comb. :0 Theor 11:105; Santou, N. Nes, M. (1987) Mol. Biol. Evol. 4:406-425; Sneath, P. H. A. and Sokal, R. R. (1973) Numerical Taxonomy—the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, Calif; Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad., Sci. USA 80:726-730. Alternatively, optimal alignment of sequences for comparison may be conducted by the 25 local identity algorithm of Smith and Waterman (1981) Add. APL. Math 2:482, by the identity alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity methods of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 30 Science Dr., Madison, Wis.), or by inspection. 2020273365 20 Nov 2020 One particular example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nucl. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. BLAST and BLAST 2.0 can be used, for example, with the parameters 5 described herein, to determine percent sequence identity for the polynucleotides and polypeptides of the disclosure. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The rearranged nature of an antibody sequence and the variable length of each gene requires multiple rounds of BLAST searches for a single antibody sequence. Also, manual assembly of different genes is difficult and error-prone. The 0 sequence analysis tool IgBLAST (world-wide-web at ncbi.nlm.nih.gov / igblast / ) identifies matches to the germline V, D and J genes, details at rearrangement junctions, the delineation of Ig V domain framework regions and complementarity determining regions. IgBLAST can analyze nucleotide or protein sequences and can process sequences in batches and allows searches against the germline gene databases and other sequence databases simultaneously to minimize the chance of 5 missing possibly the best matching germline V gene. In one illustrative example, cumulative scores can be calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum :0 achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. 25 Natl. Acad. Sci. USA 89:10915) alignments, (B) of 50, expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, a scoring matrix can be used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or 30 below, due to the accumulation of one or more negative-scoring residue alignments; or the end of 2020273365 20 Nov 2020 either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. In one approach, the "percentage of sequence identity" is determined by comparing two optimally aligned sequences over a window of comparison of at least 20 positions, wherein the 5 portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residues occur in both 0 sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e., the window size) and multiplying the results by 100 to yield the percentage of sequence identity. Yet another way of defining an antibody is as a “derivative” of any of the below-described antibodies and their antigen-binding fragments. The term “derivative” refers to an antibody or 5 antigen-binding fragment thereof that immunospecifically binds to an antigen but which comprises, one, two, three, four, five or more amino acid substitutions, additions, deletions or modifications relative to a “parental” (or wild-type) molecule. Such amino acid substitutions or additions may introduce naturally occurring (z.e., DNA-encoded) or non-naturally occurring amino acid residues. The term “derivative” encompasses, for example, as variants having altered CHI, :0 hinge, CH2, CH3 or CH4 regions, so as to form, for example, antibodies, etc., having variant Fc regions that exhibit enhanced or impaired effector or binding characteristics. The term “derivative” additionally encompasses non-amino acid modifications, for example, amino acids that may be glycosylated (e.g., have altered mannose, 2-N-acetylglucosamine, galactose, fucose, glucose, sialic acid, 5-N-acetylneuraminic acid, 5-glycolneuraminic acid, etc. content), acetylated, 25 pegylated, phosphorylated, amidated, derivatized by known protecting / blocking groups, proteolytic cleavage, linked to a cellular ligand or other protein, etc. In some embodiments, the altered carbohydrate modifications modulate one or more of the following: solubilization of the antibody, facilitation of subcellular transport and secretion of the antibody, promotion of antibody assembly, conformational integrity, and antibody-mediated effector function. In a specific 30 embodiment, the altered carbohydrate modifications enhance antibody mediated effector function relative to the antibody lacking the carbohydrate modification. Carbohydrate modifications that 2020273365 20 Nov 2020 lead to altered antibody mediated effector function are well known in the art (for example, see Shields, R. L. et al. (2002), J. Biol. Chern. 277(30): 26733-26740; Davies J. et al. (2001), Biotechnology & Bioengineering 74(4): 288-294). Methods of altering carbohydrate contents are known to those skilled in the art, see, e.g., Wallick, S. C. et al. (1988), J. Exp. Med. 168(3): 10995 1109; Tao, M. H. et al. (1989), J. Immunol. 143(8): 2595-2601; Routledge, E. G. et al. (1995), Transplantation 60(8):847-53; Elliott, S. et al. (2003), Nature Biotechnol. 21:414-21; Shields, R. L. et al. (2002), J. Biol. Chern. 277(30): 26733-26740). A derivative antibody or antibody fragment can be generated with an engineered sequence or glycosylation state to confer preferred levels of activity in antibody dependent cellular 0 cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), antibody-dependent neutrophil phagocytosis (ADNP), or antibody-dependent complement deposition (ADCD) functions as measured by bead-based or cell-based assays or in vivo studies in animal models. A derivative antibody or antibody fragment may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical 5 cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc. In one embodiment, an antibody derivative will possess a similar or identical function as the parental antibody. In another embodiment, an antibody derivative will exhibit an altered activity relative to the parental antibody. For example, a derivative antibody (or fragment thereof) can bind to its epitope more tightly or be more resistant to proteolysis than the parental antibody. :o C. Engineering of Antibody Sequences In various embodiments, one may choose to engineer sequences of the identified antibodies for a variety of reasons, such as improved expression, improved cross-reactivity or diminished off-target binding. Modified antibodies may be made by any technique known to those of skill in the 25 art, including expression through standard molecular biological techniques, or the chemical synthesis of polypeptides. Methods for recombinant expression are addressed elsewhere in this document. The following is a general discussion of relevant goals techniques for antibody engineering. Hybridomas may be cultured, then cells lysed, and total RNA extracted. Random hexamers 30 may be used with RT to generate cDNA copies of RNA, and then PCR performed using a multiplex mixture of PCR primers expected to amplify all human variable gene sequences. PCR product can 2020273365 20 Nov 2020 be cloned into pGEM-T Easy vector, then sequenced by automated DNA sequencing using standard vector primers. Assay of binding and neutralization may be performed using antibodies collected from hybridoma supernatants and purified by FPLC, using Protein G columns. Recombinant full-length IgG antibodies can be generated by subcloning heavy and light 5 chain Fv DNAs from the cloning vector into an IgG plasmid vector, transfected into 293 (e.g., Freestyle) cells or CHO cells, and antibodies can be collected and purified from the 293 or CHO cell supernatant. Other appropriate host cells systems include bacteria, such as E. coli, insect cells (S2, Sf9, Sf29, High Five), plant cells (e.g., tobacco, with or without engineering for human-like glycans), algae, or in a variety of non-human transgenic contexts, such as mice, rats, goats or cows. 0 Expression of nucleic acids encoding antibodies, both for the purpose of subsequent antibody purification, and for immunization of a host, is also contemplated. Antibody coding sequences can be RNA, such as native RNA or modified RNA. Modified RNA contemplates certain chemical modifications that confer increased stability and low immunogenicity to mRNAs, thereby facilitating expression of therapeutically important proteins. For instance, Nl-methyl-5 pseudouridine (N1 mf ) outperforms several other nucleoside modifications and their combinations in terms of translation capacity. In addition to turning off the immune / eIF2a phosphorylationdependent inhibition of translation, incorporated NlmT nucleotides dramatically alter the dynamics of the translation process by increasing ribosome pausing and density on the mRNA. Increased ribosome loading of modified mRNAs renders them more permissive for initiation by :0 favoring either ribosome recycling on the same mRNA or de novo ribosome recruitment. Such modifications could be used to enhance antibody expression in vivo following inoculation with RNA. The RNA, whether native or modified, may be delivered as naked RNA or in a delivery vehicle, such as a lipid nanoparticle. Alternatively, DNA encoding the antibody may be employed for the same purposes. The 25 DNA is included in an expression cassette comprising a promoter active in the host cell for which it is designed. The expression cassette is advantageously included in a replicable vector, such as a conventional plasmid or minivector. Vectors include viral vectors, such as poxviruses, adenoviruses, herpesviruses, adeno-associated viruses, and lentiviruses are contemplated. Replicons encoding antibody genes such as alphavirus replicons based on VEE virus or Sindbis 30 virus are also contemplated. Delivery of such vectors can be performed by needle through 2020273365 20 Nov 2020 intramuscular, subcutaneous, or intradermal routes, or by transcutaneous electroporation when in vivo expression is desired. The rapid availability of antibody produced in the same host cell and cell culture process as the final cGMP manufacturing process has the potential to reduce the duration of process 5 development programs. Lonza has developed a generic method using pooled transfectants grown in CDACF medium, for the rapid production of small quantities (up to 50 g) of antibodies in CHO cells. Although slightly slower than a true transient system, the advantages include a higher product concentration and use of the same host and process as the production cell line. Example of growth and productivity of GS-CHO pools, expressing a model antibody, in a disposable 0 bioreactor: in a disposable bag bioreactor culture (5 L working volume) operated in fed-batch mode, a harvest antibody concentration of 2 g / L was achieved within 9 weeks of transfection. Antibody molecules will comprise fragments (such as F(ab'), F(ab')2) that are produced, for example, by the proteolytic cleavage of the mAbs, or single-chain immunoglobulins producible, for example, via recombinant means. F(ab') antibody derivatives are monovalent, while F(ab')2 5 antibody derivatives are bivalent. In one embodiment, such fragments can be combined with one another, or with other antibody fragments or receptor ligands to form “chimeric” binding molecules. Significantly, such chimeric molecules may contain substituents capable of binding to different epitopes of the same molecule. In related embodiments, the antibody is a derivative of the disclosed antibodies, e.g., an :0 antibody comprising the CDR sequences identical to those in the disclosed antibodies (e.g., a chimeric, or CDR-grafted antibody). Alternatively, one may wish to make modifications, such as introducing conservative changes into an antibody molecule. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the 25 art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. It also is understood in the art that the substitution of like amino acids can be made 30 effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity 2020273365 20 Nov 2020 of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ± 1), glutamate (+3.0 ± 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic 5 amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (-0.5 ± 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (2.3). 0 It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those that are within ± 1 are particularly preferred, and those within ±0.5 are even more particularly preferred. As outlined above, amino acid substitutions generally are based on the relative similarity 5 of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. The present disclosure also contemplates isotype modification. By modifying the Fc region :0 to have a different isotype, different functionalities can be achieved. For example, changing to IgGi can increase antibody dependent cell cytotoxicity, switching to class A can improve tissue distribution, and switching to class M can improve valency. Alternatively or additionally, it may be useful to combine amino acid modifications with one or more further amino acid modifications that alter Clq binding and / or the complement 25 dependent cytotoxicity (CDC) function of the Fc region of an IL-23pl9 binding molecule. The binding polypeptide of particular interest may be one that binds to Clq and displays complement dependent cytotoxicity. Polypeptides with pre-existing Clq binding activity, optionally further having the ability to mediate CDC may be modified such that one or both of these activities are enhanced. Amino acid modifications that alter Clq and / or modify its complement dependent 30 cytotoxicity function are described, for example, in WO / 0042072, which is hereby incorporated by reference. 2020273365 20 Nov 2020 One can design an Fc region of an antibody with altered effector function, e.g., by modifying Clq binding and / or FcyR binding and thereby changing CDC activity and / or ADCC activity. “Effector functions” are responsible for activating or diminishing a biological activity (e.g., in a subject). Examples of effector functions include, but are not limited to: Clq binding; 5 complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor; BCR), etc. Such effector functions may require the Fc region to be combined with a binding domain (e.g., an antibody variable domain) and can be assessed using various assays (e.g., Fc binding assays, ADCC assays, CDC assays, etc.). 0 For example, one can generate a variant Fc region of an antibody with improved Clq binding and improved FcyRIII binding (e.g., having both improved ADCC activity and improved CDC activity). Alternatively, if it is desired that effector function be reduced or ablated, a variant Fc region can be engineered with reduced CDC activity and / or reduced ADCC activity. In other embodiments, only one of these activities may be increased, and, optionally, also the other activity 5 reduced (e.g., to generate an Fc region variant with improved ADCC activity, but reduced CDC activity and vice versa). FcRn binding. Fc mutations can also be introduced and engineered to alter their interaction with the neonatal Fc receptor (FcRn) and improve their pharmacokinetic properties. A collection of human Fc variants with improved binding to the FcRn have been described (Shields et al., :0 (2001). High resolution mapping of the binding site on human IgGl for FcyRI, FcyRII, FcyRIII, and FcRn and design of IgGl variants with improved binding to the FcyR, (J. Biol. Chern. 276:6591-6604). A number of methods are known that can result in increased half-life (Kuo and Aveson, (2011)), including amino acid modifications may be generated through techniques including alanine scanning mutagenesis, random mutagenesis and screening to assess the binding 25 to the neonatal Fc receptor (FcRn) and / or the in vivo behavior. Computational strategies followed by mutagenesis may also be used to select one of amino acid mutations to mutate. The present disclosure therefore provides a variant of an antigen binding protein with optimized binding to FcRn. In a particular embodiment, the said variant of an antigen binding protein comprises at least one amino acid modification in the Fc region of said antigen binding 30 protein, wherein said modification is selected from the group consisting of 226, 227, 228, 230, 231, 233, 234, 239, 241, 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 2020273365 20 Nov 2020 288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305, 307, 308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400,401 403, 404,408,411, 412,414, 415, 416, 418,419, 420, 421, 5 422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and 447 of the Fc region as compared to said parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index in Kabat. In a further aspect of the disclosure the modifications are M252Y / S254T / T256E. Additionally, various publications describe methods for obtaining physiologically active 0 molecules whose half-lives are modified, see for example Kontermann (2009) either by introducing an FcRn-b inding polypeptide into the molecules or by fusing the molecules with antibodies whose FcRn-b inding affinities are preserved but affinities for other Fc receptors have been greatly reduced or fusing with FcRn binding domains of antibodies. Derivatized antibodies may be used to alter the half-lives (e.g., serum half-lives) of parental 5 antibodies in a mammal, particularly a human. Such alterations may result in a half-life of greater than 15 days, preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months. The increased half-lives of the antibodies of the present disclosure or fragments thereof in a mammal, preferably a human, results in a higher :0 serum titer of said antibodies or antibody fragments in the mammal, and thus reduces the frequency of the administration of said antibodies or antibody fragments and / or reduces the concentration of said antibodies or antibody fragments to be administered. Antibodies or fragments thereof having increased in vivo half-lives can be generated by techniques known to those of skill in the art. For example, antibodies or fragments thereof with increased in vivo half-lives can be generated by 25 modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fc domain and the FcRn receptor. Beltramello et al. (2010) previously reported the modification of neutralizing mAbs, due to their tendency to enhance dengue virus infection, by generating in which leucine residues at positions 1.3 and 1.2 of CH2 domain (according to the IMGT unique numbering for C-domain) 30 were substituted with alanine residues. This modification, also known as “LALA” mutation, abolishes antibody binding to FcyRI, FcyRII and FcyRIIIa, as described by Hessell et al. (2007). 2020273365 20 Nov 2020 The variant and unmodified recombinant mAbs were compared for their capacity to neutralize and enhance infection by the four dengue virus serotypes. LALA variants retained the same neutralizing activity as unmodified mAb but were completely devoid of enhancing activity. LALA mutations of this nature are therefore contemplated in the context of the presently disclosed 5 antibodies. Altered glycosylation. A particular embodiment of the present disclosure is an isolated monoclonal antibody, or antigen binding fragment thereof, containing a substantially homogeneous glycan without sialic acid, galactose, or fucose. The monoclonal antibody comprises a heavy chain variable region and a light chain variable region, both of which may be attached to 0 heavy chain or light chain constant regions respectively. The aforementioned substantially homogeneous glycan may be covalently attached to the heavy chain constant region. Another embodiment of the present disclosure comprises a mAb with a novel Fc glycosylation pattern. The isolated monoclonal antibody, or antigen binding fragment thereof, is present in a substantially homogenous composition represented by the GNGN or G1 / G2 glycoform. 5 Fc glycosylation plays a significant role in anti-viral and anti-cancer properties of therapeutic mAbs. The disclosure is in line with a recent study that shows increased anti-lentivirus cell-mediated viral inhibition of a fucose free anti-HIV mAb in vitro. This embodiment of the present disclosure with homogenous glycans lacking a core fucose, showed increased protection against specific viruses by a factor greater than two-fold. Elimination of core fucose dramatically improves :0 the ADCC activity of mAbs mediated by natural killer (NK) cells but appears to have the opposite effect on the ADCC activity of polymorphonuclear cells (PMNs). The isolated monoclonal antibody, or antigen binding fragment thereof, comprising a substantially homogenous composition represented by the GNGN or G1 / G2 glycoform exhibits increased binding affinity for Fc gamma RI and Fc gamma RIII compared to the same antibody 25 without the substantially homogeneous GNGN glycoform and with GO, GIF, G2F, GNF, GNGNF or GNGNFX containing glycoforms. In one embodiment of the present disclosure, the antibody dissociates from Fc gamma RI with a Kd of 1 x IO'8 M or less and from Fc gamma RIII with a Kd of 1 x IO'7 M or less. Glycosylation of an Fc region is typically either N-linked or O-linked. N-linked refers to 30 the attachment of the carbohydrate moiety to the side chain of an asparagine residue. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or 2020273365 20 Nov 2020 xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used. The recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain peptide sequences are asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. Thus, the presence of either of 5 these peptide sequences in a polypeptide creates a potential glycosylation site. The glycosylation pattern may be altered, for example, by deleting one or more glycosylation site(s) found in the polypeptide, and / or adding one or more glycosylation site(s) that are not present in the polypeptide. Addition of glycosylation sites to the Fc region of an antibody is conveniently accomplished by altering the amino acid sequence such that it contains one or more 0 of the above-described tripeptide sequences (for N-linked glycosylation sites). An exemplary glycosylation variant has an amino acid substitution of residue Asn 297 of the heavy chain. The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original polypeptide (for O-linked glycosylation sites). Additionally, a change of Asn 297 to Ala can remove one of the glycosylation sites. 5 In certain embodiments, the antibody is expressed in cells that express beta (1,4)-N- acetylglucosaminyltransferase III (GnT III), such that GnT III adds GlcNAc to the IL-23pl9 antibody. Methods for producing antibodies in such a fashion are provided in WO / 9954342, WO / 03011878, patent publication 20030003097A1, and Umana et al., Nature Biotechnology, 17:176-180, February 1999. Cell lines can be altered to enhance or reduce or eliminate certain :0 post-translational modifications, such as glycosylation, using genome editing technology such as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). For example, CRISPR technology can be used to eliminate genes encoding glycosylating enzymes in 293 or CHO cells used to express recombinant monoclonal antibodies. Elimination of monoclonal antibody protein sequence liabilities. It is possible to 25 engineer the antibody variable gene sequences obtained from human B cells to enhance their manufacturability and safety. Potential protein sequence liabilities can be identified by searching for sequence motifs associated with sites containing: 1) Unpaired Cys residues, 2) N-linked glycosylation, 30 3) Asn deamidation, 4) Asp isomerization, 2020273365 20 Nov 2020 5) SYE truncation, 6) Met oxidation, 7) Trp oxidation, 8) N-terminal glutamate, 5 9) Integrin binding, 10) CD 11c / CD 18 binding, or 11) F ragmentation Such motifs can be eliminated by altering the synthetic gene for the cDNA encoding recombinant antibodies. 0 Protein engineering efforts in the field of development of therapeutic antibodies clearly reveal that certain sequences or residues are associated with solubility differences (Fernandez-Escamilla et al., Nature Biotech., 22 (10), 1302-1306, 2004; Chennamsetty et al.,PNAS, 106 (29), 11937-11942, 2009; Voynov et al., Biocon. Chem., 21 (2), 385-392, 2010) Evidence from solubility-altering mutations in the literature indicate that some hydrophilic residues such as 5 aspartic acid, glutamic acid, and serine contribute significantly more favorably to protein solubility than other hydrophilic residues, such as asparagine, glutamine, threonine, lysine, and arginine. Stability. Antibodies can be engineered for enhanced biophysical properties. One can use elevated temperature to unfold antibodies to determine relative stability, using average apparent melting temperatures. Differential Scanning Calorimetry (DSC) measures the heat capacity, Cp, of :0 a molecule (the heat required to warm it, per degree) as a function of temperature. One can use DSC to study the thermal stability of antibodies. DSC data for mAbs is particularly interesting because it sometimes resolves the unfolding of individual domains within the mAb structure, producing up to three peaks in the thermogram (from unfolding of the Fab, Ch2, and Ch3 domains). Typically unfolding of the Fab domain produces the strongest peak. The DSC profiles and relative 25 stability of the Fc portion show characteristic differences for the human IgGi, IgG2, IgGs, and IgG4 subclasses (Garber and Demarest, Biochem. Biophys. Res. Commun. 355, 751-757, 2007). One also can determine average apparent melting temperature using circular dichroism (CD), performed with a CD spectrometer. Far-UV CD spectra will be measured for antibodies in the range of 200 to 260 nm at increments of 0.5 nm. The final spectra can be determined as averages 30 of 20 accumulations. Residue ellipticity values can be calculated after background subtraction. Thermal unfolding of antibodies (0.1 mg / mL) can be monitored at 235 nm from 25-95 °C and a 2020273365 20 Nov 2020 heating rate of 1 °C / min. One can use dynamic light scattering (DLS) to assess for propensity for aggregation. DLS is used to characterize size of various particles including proteins. If the system is not disperse in size, the mean effective diameter of the particles can be determined. This measurement depends on the size of the particle core, the size of surface structures, and particle 5 concentration. Since DLS essentially measures fluctuations in scattered light intensity due to particles, the diffusion coefficient of the particles can be determined. DLS software in commercial DLA instruments displays the particle population at different diameters. Stability studies can be done conveniently using DLS. DLS measurements of a sample can show whether the particles aggregate over time or with temperature variation by determining whether the hydrodynamic 0 radius of the particle increases. If particles aggregate, one can see a larger population of particles with a larger radius. Stability depending on temperature can be analyzed by controlling the temperature in situ. Capillary electrophoresis (CE) techniques include proven methodologies for determining features of antibody stability. One can use an iCE approach to resolve antibody protein charge variants due to deamidation, C-terminal lysines, sialylation, oxidation, glycosylation, and 5 any other change to the protein that can result in a change in pl of the protein. Each of the expressed antibody proteins can be evaluated by high throughput, free solution isoelectric focusing (IEF) in a capillary column (cIEF), using a Protein Simple Maurice instrument. Whole-column UV absorption detection can be performed every 30 seconds for real time monitoring of molecules focusing at the isoelectric points (pls). This approach combines the high resolution of traditional :0 gel IEF with the advantages of quantitation and automation found in column-based separations while eliminating the need for a mobilization step. The technique yields reproducible, quantitative analysis of identity, purity, and heterogeneity profiles for the expressed antibodies. The results identify charge heterogeneity and molecular sizing on the antibodies, with both absorbance and native fluorescence detection modes and with sensitivity of detection down to 0.7 pg / mL. 25 Solubility. One can determine the intrinsic solubility score of antibody sequences. The intrinsic solubility scores can be calculated using CamSol Intrinsic (Sormanni et al., J Mol Biol 427,478-490,2015). The amino acid sequences for residues 95-102 (Kabat numbering) in HCDR3 of each antibody fragment such as a scFv can be evaluated via the online program to calculate the solubility scores. One also can determine solubility using laboratory techniques. Various 30 techniques exist, including addition of lyophilized protein to a solution until the solution becomes saturated and the solubility limit is reached, or concentration by ultrafiltration in a 2020273365 20 Nov 2020 microconcentrator with a suitable molecular weight cut-off. The most straightforward method is induction of amorphous precipitation, which measures protein solubility using a method involving protein precipitation using ammonium sulfate (Trevino et al., J Mol Biol, 366: 449-460, 2007). Ammonium sulfate precipitation gives quick and accurate information on relative 5 solubility values. Ammonium sulfate precipitation produces precipitated solutions with well-defined aqueous and solid phases and requires relatively small amounts of protein. Solubility measurements performed using induction of amorphous precipitation by ammonium sulfate also can be done easily at different pH values. Protein solubility is highly pH dependent, and pH is considered the most important extrinsic factor that affects solubility. 0 Autoreactivity. Generally, it is thought that autoreactive clones should be eliminated during ontogeny by negative selection, however it has become clear that many human naturally occurring antibodies with autoreactive properties persist in adult mature repertoires, and the autoreactivity may enhance the antiviral function of many antibodies to pathogens. It has been noted that HCDR3 loops in antibodies during early B cell development are often rich in positive 5 charge and exhibit autoreactive patterns (Wardemann et al., Science 301, 1374-1377, 2003). One can test a given antibody for autoreactivity by assessing the level of binding to human origin cells in microscopy (using adherent HeLa or HEp-2 epithelial cells) and flow cytometric cell surface staining (using suspension Jurkat T cells and 293S human embryonic kidney cells). Autoreactivity also can be surveyed using assessment of binding to tissues in tissue arrays. :0 Preferred residues (“Human Likeness”). B cell repertoire deep sequencing of human B cells from blood donors is being performed on a wide scale in many recent studies. Sequence information about a significant portion of the human antibody repertoire facilitates statistical assessment of antibody sequence features common in healthy humans. With knowledge about the antibody sequence features in a human recombined antibody variable gene reference database, the 25 position specific degree of “Human Likeness” (HL) of an antibody sequence can be estimated. HL has been shown to be useful for the development of antibodies in clinical use, like therapeutic antibodies or antibodies as vaccines. The goal is to increase the human likeness of antibodies to reduce potential adverse effects and anti-antibody immune responses that will lead to significantly decreased efficacy of the antibody drug or can induce serious health implications. One can assess 30 antibody characteristics of the combined antibody repertoire of three healthy human blood donors of about 400 million sequences in total and created a novel “relative Human Likeness” (rHL) score 2020273365 20 Nov 2020 that focuses on the hypervariable region of the antibody. The rHL score allows one to easily distinguish between human (positive score) and non-human sequences (negative score). Antibodies can be engineered to eliminate residues that are not common in human repertoires. 5 D. Single chain antibodies A single chain variable fragment (scFv) is a fusion of the variable regions of the heavy and light chains of immunoglobulins, linked together with a short (usually serine, glycine) linker. This chimeric molecule retains the specificity of the original immunoglobulin, despite removal of the constant regions and the introduction of a linker peptide. This modification usually leaves the 0 specificity unaltered. These molecules were created historically to facilitate phage display where it is highly convenient to express the antigen binding domain as a single peptide. Alternatively, scFv can be created directly from subcloned heavy and light chains derived from a hybridoma or B cell. Single chain variable fragments lack the constant Fc region found in complete antibody molecules, and thus, the common binding sites (e.g., protein A / G) used to purify antibodies. These 5 fragments can often be purified / immobilized using Protein L since Protein L interacts with the variable region of kappa light chains. Flexible linkers generally are comprised of helix- and tum-promoting amino acid residues such as alanine, serine and glycine. However, other residues can function as well. Tang et al. (1996) used phage display as a means of rapidly selecting tailored linkers for single-chain antibodies :0 (scFvs) from protein linker libraries. A random linker library was constructed in which the genes for the heavy and light chain variable domains were linked by a segment encoding an 18-amino acid polypeptide of variable composition. The scFv repertoire (approx. 5 x 106 different members) was displayed on filamentous phage and subjected to affinity selection with hapten. The population of selected variants exhibited significant increases in binding activity but retained considerable 25 sequence diversity. Screening 1054 individual variants subsequently yielded a catalytically active scFv that was produced efficiently in soluble form. Sequence analysis revealed a conserved proline in the linker two residues after the Vh C terminus and an abundance of arginines and prolines at other positions as the only common features of the selected tethers. The recombinant antibodies of the present disclosure may also involve sequences or 30 moieties that permit dimerization or multimerization of the receptors. Such sequences include those derived from IgA, which permit formation of multimers in conjunction with the J-chain. 2020273365 20 Nov 2020 Another multimerization domain is the Gal4 dimerization domain. In other embodiments, the chains may be modified with agents such as biotin / avidin, which permit the combination of two antibodies. In a separate embodiment, a single-chain antibody can be created by joining receptor light 5 and heavy chains using a non-peptide linker or chemical unit. Generally, the light and heavy chains will be produced in distinct cells, purified, and subsequently linked together in an appropriate fashion (i.e., the N-terminus of the heavy chain being attached to the C-terminus of the light chain via an appropriate chemical bridge). Cross-linking reagents are used to form molecular bridges that tie functional groups of two 0 different molecules, e.g., a stabilizing and coagulating agent. However, it is contemplated that dimers or multimers of the same analog or heteromeric complexes comprised of different analogs can be created. To link two different compounds in a step-wise manner, hetero-bifunctional crosslinkers can be used that eliminate unwanted homopolymer formation. An exemplary hetero-bifunctional cross-linker contains two reactive groups: one reacting 5 with primary amine group (e.g., N-hydroxy succinimide) and the other reacting with a thiol group (e.g., pyridyl disulfide, maleimides, halogens, etc.). Through the primary amine reactive group, the cross-linker may react with the lysine residue(s) of one protein (e.g., the selected antibody or fragment) and through the thiol reactive group, the cross-linker, already tied up to the first protein, reacts with the cysteine residue (free sulfhydryl group) of the other protein (e.g., the selective :0 agent). It is preferred that a cross-linker having reasonable stability in blood will be employed. Numerous types of disulfide-bond containing linkers are known that can be successfully employed to conjugate targeting and therapeutic / preventative agents. Linkers that contain a disulfide bond that is sterically hindered may prove to give greater stability in vivo, preventing release of the 25 targeting peptide prior to reaching the site of action. These linkers are thus one group of linking agents. Another cross-linking reagent is SMPT, which is a bifunctional cross-linker containing a disulfide bond that is “sterically hindered” by an adjacent benzene ring and methyl groups. It is believed that steric hindrance of the disulfide bond serves a function of protecting the bond from 30 attack by thiolate anions such as glutathione which can be present in tissues and blood, and thereby 2020273365 20 Nov 2020 help in preventing decoupling of the conjugate prior to the delivery of the attached agent to the target site. The SMPT cross-linking reagent, as with many other known cross-linking reagents, lends the ability to cross-link functional groups such as the SH of cysteine or primary amines (e.g., the 5 epsilon amino group of lysine). Another possible type of cross-linker includes the heterobifunctional photoreactive phenylazides containing a cleavable disulfide bond such as sulfosuccinimidyl-2-(p-azido salicylamido) ethyl-1,3'-dithiopropionate. The N-hydroxy-succinimidyl group reacts with primary amino groups and the phenylazide (upon photolysis) reacts non-selectively with any amino acid residue. 0 In addition to hindered cross-linkers, non-hindered linkers also can be employed in accordance herewith. Other useful cross-linkers, not considered to contain or generate a protected disulfide, include SATA, SPDP and 2-iminothiolane (Wawrzynczak & Thorpe, 1987). The use of such cross-linkers is well understood in the art. Another embodiment involves the use of flexible linkers. 5 U.S. Patent 4,680,338, describes bifunctional linkers useful for producing conjugates of ligands with amine-containing polymers and / or proteins, especially for forming antibody conjugates with chelators, drugs, enzymes, detectable labels and the like. U.S. Patents 5,141,648 and 5,563,250 disclose cleavable conjugates containing a labile bond that is cleavable under a variety of mild conditions. This linker is particularly useful in that the agent of interest may be :0 bonded directly to the linker, with cleavage resulting in release of the active agent. Particular uses include adding a free amino or free sulfhydryl group to a protein, such as an antibody, or a drug. U.S. Patent 5,856,456 provides peptide linkers for use in connecting polypeptide constituents to make fusion proteins, e.g., single chain antibodies. The linker is up to about 50 amino acids in length, contains at least one occurrence of a charged amino acid (preferably arginine 25 or lysine) followed by a proline, and is characterized by greater stability and reduced aggregation. U.S. Patent 5,880,270 discloses aminooxy-containing linkers useful in a variety of immunodiagnostic and separative techniques. E. Multispecific antibodies 30 In certain embodiments, antibodies of the present disclosure are bispecific or multispecific. Bispecific antibodies are antibodies that have binding specificities for at least two different 2020273365 20 Nov 2020 epitopes. Exemplary bispecific antibodies may bind to two different epitopes of a single antigen. Other such antibodies may combine a first antigen binding site with a binding site for a second antigen. Alternatively, an anti-pathogen arm may be combined with an arm that binds to a triggering molecule on a leukocyte, such as a T-cell receptor molecule (e.g., CD3), or Fc receptors 5 for IgG (FcyR), such as FcyRI (CD64), FcyRII (CD32) and Fc gamma RIII (CD16), so as to focus and localize cellular defense mechanisms to the infected cell. Bispecific antibodies may also be used to localize cytotoxic agents to infected cells. These antibodies possess a pathogen-binding arm and an arm that binds the cytotoxic agent (e.g., saporin, anti-interferon-a, vinca alkaloid, ricin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies can be prepared as full-0 length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies). WO 96 / 16673 describes a bispecific anti-ErbB2 / anti-Fc gamma RIII antibody and U.S. Patent 5,837,234 discloses a bispecific anti-ErbB2 / anti-Fc gamma RI antibody. A bispecific anti-ErbB2 / Fc alpha antibody is shown in WO98 / 02463. U.S. Patent 5,821,337 teaches a bispecific anti-ErbB2 / anti-CD3 antibody. 5 Methods for making bispecific antibodies are known in the art. Traditional production of full-length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305:537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody :0 molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93 / 08829, and in Traunecker et al., EMBO J., 10:3655-3659 (1991). According to a different approach, antibody variable regions with the desired binding 25 specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. Preferably, the fusion is with an Ig heavy chain constant domain, comprising at least part of the hinge, Ch2, and Ch3 regions. It is preferred to have the first heavy-chain constant region (Chi) containing the site necessary for light chain bonding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light 30 chain, are inserted into separate expression vectors, and are co-transfected into a suitable host cell. This provides for greater flexibility in adjusting the mutual proportions of the three polypeptide 2020273365 20 Nov 2020 fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yield of the desired bispecific antibody. It is, however, possible to insert the coding sequences for two or all three polypeptide chains into a single expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when 5 the ratios have no significant effect on the yield of the desired chain combination. In a particular embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific 0 compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94 / 04690. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121:210 (1986). According to another approach described in U.S. Patent 5,731,168, the interface between 5 a pair of antibody molecules can be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture. The preferred interface comprises at least a part of the Ch3 domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the :0 interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers. Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Such 25 antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Patent 4,676,980), and for treatment of HIV infection (WO 91 / 00360, WO 92 / 200373, and EP 03089). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Patent 4,676,980, along with a number of cross-linking techniques. 30 Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical 2020273365 20 Nov 2020 linkage. Brennan et al., Science, 229: 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intennolecular disulfide formation. The Fab’ fragments generated are then converted to 5 thionitrobenzoate (TNB) derivatives. One of the Fab’-TNB derivatives is then reconverted to the Fab’-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab’-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes. Techniques exist that facilitate the direct recovery of Fab'-SH fragments from E. coli, 0 which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) describe the production of a humanized bispecific antibody F(ab’)2 molecule. Each Fab’ fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity 5 of human cytotoxic lymphocytes against human breast tumor targets. Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described (Merchant et al., Nat. Biotechnol. 16, 677681 (1998). doi:10.1038 / nbt0798-677pmid:9661204). For example, bispecific antibodies have been produced using leucine zippers (Kostelny et al., J. Immunol., 148(5):1547-1553, 1992). The :0 leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993) has provided an alternative 25 mechanism for making bispecific antibody fragments. The fragments comprise a Vh connected to a Vl by a linker that is too short to allow pairing between the two domains on the same chain. Accordingly, the Vh and Vl domains of one fragment are forced to pair with the complementary Vl and Vh domains of another fragment, thereby forming two antigen-binding sites. Another 2020273365 20 Nov 2020 strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al., J. Immunol., 152:5368 (1994). In a particular embodiment, a bispecific or multispecific antibody may be formed as a DOCK-AND-LOCK™ (DNL™) complex (see, e.g., U.S. Patents 7,521,056; 7,527,787; 5 7,534,866; 7,550,143 and 7,666,400, the Examples section of each of which is incorporated herein by reference.) Generally, the technique takes advantage of the specific and high-affinity binding interactions that occur between a dimerization and docking domain (DDD) sequence of the regulatory (R) subunits of cAMP-dependent protein kinase (PKA) and an anchor domain (AD) sequence derived from any of a variety of AKAP proteins (Baillie et al., FEBS Letters. 2005; 579: 0 3264; Wong and Scott, Nat. Rev. Mol. Cell Biol. 2004; 5: 959). The DDD and AD peptides may be attached to any protein, peptide or other molecule. Because the DDD sequences spontaneously dimerize and bind to the AD sequence, the technique allows the formation of complexes between any selected molecules that may be attached to DDD or AD sequences. Antibodies with more than two valencies are contemplated. For example, trispecific 5 antibodies can be prepared (Tutt et al., J. Immunol. 147: 60, 1991; Xu et al., Science, 358(6359):85-90, 2017). A multivalent antibody may be internalized (and / or catabolized) faster than a bivalent antibody by a cell expressing an antigen to which the antibodies bind. The antibodies of the present disclosure can be multivalent antibodies with three or more antigen binding sites (e.g., tetravalent antibodies), which can be readily produced by recombinant :0 expression of nucleic acid encoding the polypeptide chains of the antibody. The multivalent antibody can comprise a dimerization domain and three or more antigen binding sites. The preferred dimerization domain comprises (or consists of) an Fc region or a hinge region. In this scenario, the antibody will comprise an Fc region and three or more antigen binding sites aminoterminal to the Fc region. The preferred multivalent antibody herein comprises (or consists of) 25 three to about eight, but preferably four, antigen binding sites. The multivalent antibody comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain(s) comprise two or more variable regions. For instance, the polypeptide chain(s) may comprise VDl-(Xl)n-VD2-(X2)n-Fc, wherein VD1 is a first variable region, VD2 is a second variable region, Fc is one polypeptide chain of an Fc region, XI and X2 represent an amino acid 30 or polypeptide, and n is 0 or 1. For instance, the polypeptide chain(s) may comprise: VH-CH1-flexible linker-VH-CHl-Fc region chain; or VH-CHl-VH-CHl-Fc region chain. The multivalent 2020273365 20 Nov 2020 antibody herein preferably further comprises at least two (and preferably four) light chain variable region polypeptides. The multivalent antibody herein may, for instance, comprise from about two to about eight light chain variable region polypeptides. The light chain variable region polypeptides contemplated here comprise a light chain variable region and, optionally, further 5 comprise a Cl domain. Charge modifications are particularly useful in the context of a multispecific antibody, where amino acid substitutions in Fab molecules result in reducing the mispairing of light chains with non-matching heavy chains (Bence-Jones-type side products), which can occur in the production of Fab-based bi- / multispecific antigen binding molecules with a VH / VL exchange in 0 one (or more, in case of molecules comprising more than two antigen-binding Fab molecules) of their binding arms (see also PCT publication no. WO 2015 / 150447, particularly the examples therein, incorporated herein by reference in its entirety). Accordingly, in particular embodiments, an antibody comprised in the therapeutic agent comprises 5 (a) a first Fab molecule which specifically binds to a first antigen (b) a second Fab molecule which specifically binds to a second antigen, and wherein the variable domains VL and VH of the Fab light chain and the Fab heavy chain are replaced by each other, wherein the first antigen is an activating T cell antigen and the second antigen is a target :0 cell antigen, or the first antigen is a target cell antigen and the second antigen is an activating T cell antigen; and wherein i) in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by a positively charged amino acid (numbering according to Kabat), and 25 wherein in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (numbering according to Kabat EU index); or ii) in the constant domain CL of the second Fab molecule under b) the amino acid at position 124 is substituted by a positively charged amino acid (numbering according to 30 Kabat), and wherein in the constant domain CHI of the second Fab molecule under b) the 2020273365 20 Nov 2020 amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (numbering according to Kabat EU index). The antibody may not comprise both modifications mentioned under i) and ii). The constant domains CL and CHI of the second Fab molecule are not replaced by each other (i.e., remain 5 unexchanged). In another embodiment of the antibody, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)), and in the constant domain CHI of the first Fab molecule under a) the 0 amino acid at position 147 or the amino acid at position 213 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index). In a further embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat), and in the constant domain CHI of the first Fab molecule under 5 a) the amino acid at position 147 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index). In a particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or :0 arginine (R)) and the amino acid at position 123 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted 25 independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index). In a more particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by lysine (K) (numbering according to Kabat) and the amino acid at position 123 is substituted by lysine (K) or arginine (R) (numbering according to Kabat), and in the constant domain CHI of the first Fab molecule under a) the amino acid at 30 position 147 is substituted by glutamic acid (E) (numbering according to Kabat EU index) and the 2020273365 20 Nov 2020 amino acid at position 213 is substituted by glutamic acid (E) (numbering according to Kabat EU index). In an even more particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by lysine (K) (numbering according 5 to Kabat) and the amino acid at position 123 is substituted by arginine (R) (numbering according to Kabat), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 is substituted by glutamic acid (E) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted by glutamic acid (E) (numbering according to Kabat EU index). 0 F. Chimeric Antigen Receptors Artificial T cell receptors (also known as chimeric T cell receptors, chimeric immunoreceptors, chimeric antigen receptors (CARs)) are engineered receptors, which graft an arbitrary specificity onto an immune effector cell. Typically, these receptors are used to graft the 5 specificity of a monoclonal antibody onto a T cell, with transfer of their coding sequence facilitated by retroviral vectors. In this way, a large number of target-specific T cells can be generated for adoptive cell transfer. Phase I clinical studies of this approach show efficacy. The most common form of these molecules are fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta transmembrane and endodomain. :0 Such molecules result in the transmission of a zeta signal in response to recognition by the scFv of its target. An example of such a construct is 14g2a-Zeta, which is a fusion of a scFv derived from hybridoma 14g2a (which recognizes disialoganglioside GD2). When T cells express this molecule (usually achieved by oncoretroviral vector transduction), they recognize and kill target cells that express GD2 (e.g., neuroblastoma cells). To target malignant B cells, investigators have 25 redirected the specificity of T cells using a chimeric immunoreceptor specific for the B-lineage molecule, CD 19. The variable portions of an immunoglobulin heavy and light chain are fused by a flexible linker to form a scFv. This scFv is preceded by a signal peptide to direct the nascent protein to the endoplasmic reticulum and subsequent surface expression (this is cleaved). A flexible spacer 30 allows to the scFv to orient in different directions to enable antigen binding. The transmembrane 2020273365 20 Nov 2020 domain is a typical hydrophobic alpha helix usually derived from the original molecule of the signaling endodomain which protrudes into the cell and transmits the desired signal. Type I proteins are in fact two protein domains linked by a transmembrane alpha helix in between. The cell membrane lipid bilayer, through which the transmembrane domain passes, acts 5 to isolate the inside portion (endodomain) from the external portion (ectodomain). It is not so surprising that attaching an ectodomain from one protein to an endodomain of another protein results in a molecule that combines the recognition of the former to the signal of the latter. Ectodomain. A signal peptide directs the nascent protein into the endoplasmic reticulum. This is essential if the receptor is to be glycosylated and anchored in the cell membrane. Any 0 eukaryotic signal peptide sequence usually works fine. Generally, the signal peptide natively attached to the amino-terminal most component is used (e.g., in a scFv with orientation light chain - linker - heavy chain, the native signal of the light-chain is used The antigen recognition domain is usually an scFv. There are however many alternatives. An antigen recognition domain from native T-cell receptor (TCR) alpha and beta single chains 5 have been described, as have simple ectodomains (e.g., CD4 ectodomain to recognize HIV infected cells) and more exotic recognition components such as a linked cytokine (which leads to recognition of cells bearing the cytokine receptor). In fact, almost anything that binds a given target with high affinity can be used as an antigen recognition region. A spacer region links the antigen binding domain to the transmembrane domain. It should :0 be flexible enough to allow the antigen binding domain to orient in different directions to facilitate antigen recognition. The simplest form is the hinge region from IgGl. Alternatives include the CH2CH3 region of immunoglobulin and portions of CD3. For most scFv based constructs, the IgGl hinge suffices. However, the best spacer often has to be determined empirically. Transmembrane domain. The transmembrane domain is a hydrophobic alpha helix that 25 spans the membrane. Generally, the transmembrane domain from the most membrane proximal component of the endodomain is used. Interestingly, using the CD3-zeta transmembrane domain may result in incorporation of the artificial TCR into the native TCR a factor that is dependent on the presence of the native CD3-zeta transmembrane charged aspartic acid residue. Different transmembrane domains result in different receptor stability. The CD28 transmembrane domain 30 results in a brightly expressed, stable receptor. 2020273365 20 Nov 2020 Endodomain. This is the "business-end" of the receptor. After antigen recognition, receptors cluster and a signal is transmitted to the cell. The most commonly used endodomain component is CD3-zeta which contains 3 ITAMs. This transmits an activation signal to the T cell after antigen is bound. CD3-zeta may not provide a fully competent activation signal and additional 5 co-stimulatory signaling is needed. "First-generation" CARs typically had the intracellular domain from the CD3 chain, which is the primary transmitter of signals from endogenous TCRs. "Second-generation" CARs add intracellular signaling domains from various costimulatory protein receptors (e.g., CD28, 4IBB, ICOS) to the cytoplasmic tail of the CAR to provide additional signals to the T cell. 0 Preclinical studies have indicated that the second generation of CAR designs improves the antitumor activity of T cells. More recent, "third-generation" CARs combine multiple signaling domains, such as CD3z-CD28-41BB or CD3z-CD28-OX40, to further augment potency. G. ADCs 5 Antibody Drug Conjugates or ADCs are a new class of highly potent biopharmaceutical drugs designed as a targeted therapy for the treatment of people with infectious disease. ADCs are complex molecules composed of an antibody (a whole mAb or an antibody fragment such as a single-chain variable fragment, or scFv) linked, via a stable chemical linker with labile bonds, to a biological active cytotoxic / anti-viral payload or drug. Antibody Drug Conjugates are examples :0 of bioconjugates and immunoconjugates. By combining the unique targeting capabilities of monoclonal antibodies with the cancerkilling ability of cytotoxic drugs, antibody-drug conjugates allow sensitive discrimination between healthy and diseased tissue. This means that, in contrast to traditional systemic approaches, antibody-drug conjugates target and attack the infected cell so that healthy cells are less severely 25 affected. In the development ADC-based anti-tumor therapies, an anticancer drug (e.g., a cell toxin or cytotoxin) is coupled to an antibody that specifically targets a certain cell marker (e.g., a protein that, ideally, is only to be found in or on infected cells). Antibodies track these proteins down in the body and attach themselves to the surface of cancer cells. The biochemical reaction between 30 the antibody and the target protein (antigen) triggers a signal in the tumor cell, which then absorbs or internalizes the antibody together with the cytotoxin. After the ADC is internalized, the 2020273365 20 Nov 2020 cytotoxic drug is released and kills the cell or impairs viral replication. Due to this targeting, ideally the drug has lower side effects and gives a wider therapeutic window than other agents. A stable link between the antibody and cytotoxic / anti-viral agent is a crucial aspect of an ADC. Linkers are based on chemical motifs including disulfides, hydrazones or peptides 5 (cleavable), or thioethers (noncleavable) and control the distribution and delivery of the cytotoxic agent to the target cell. Cleavable and noncleavable types of linkers have been proven to be safe in preclinical and clinical trials. Brentuximab vedotin includes an enzyme-sensitive cleavable linker that delivers the potent and highly toxic antimicrotubule agent Monomethyl auristatin E or MMAE, a synthetic antineoplastic agent, to human specific CD30-positive malignant cells. 0 Because of its high toxicity MMAE, which inhibits cell division by blocking the polymerization of tubulin, cannot be used as a single-agent chemotherapeutic drug. However, the combination of MMAE linked to an anti-CD30 monoclonal antibody (cAClO, a cell membrane protein of the tumor necrosis factor or TNF receptor) proved to be stable in extracellular fluid, cleavable by cathepsin and safe for therapy. Trastuzumab emtansine, the other approved ADC, is a combination 5 of the microtubule-formation inhibitor mertansine (DM-1), a derivative of the Maytansine, and antibody trastuzumab (Herceptin® / Genentech / Roche) attached by a stable, non-cleavable linker. The availability of better and more stable linkers has changed the function of the chemical bond. The type of linker, cleavable or noncleavable, lends specific properties to the cytotoxic (anti-cancer) drug. For example, a non-cleavable linker keeps the drug within the cell. As a result, the entire :0 antibody, linker and cytotoxic agent enter the targeted cancer cell where the antibody is degraded to the level of an amino acid. The resulting complex - amino acid, linker and cytotoxic agent -now becomes the active drug. In contrast, cleavable linkers are catalyzed by enzymes in the host cell where it releases the cytotoxic agent. Another type of cleavable linker, currently in development, adds an extra molecule 25 between the cytotoxic / anti-viral drug and the cleavage site. This linker technology allows researchers to create ADCs with more flexibility without worrying about changing cleavage kinetics. Researchers are also developing a new method of peptide cleavage based on Edman degradation, a method of sequencing amino acids in a peptide. Future direction in the development of ADCs also include the development of site-specific conjugation (TDCs) to further improve 30 stability and therapeutic index and a emitting immunoconjugates and antibody-conjugated nanoparticles. 2020273365 20 Nov 2020 H. BiTES Bi-specific T-cell engagers (BiTEs) are a class of artificial bispecific monoclonal antibodies that are investigated for the use as anti-cancer drugs. They direct a host's immune 5 system, more specifically the T cells' cytotoxic activity, against infected cells. BiTE is a registered trademark of Micromet AG. BiTEs are fusion proteins consisting of two single-chain variable fragments (scFvs) of different antibodies, or amino acid sequences from four different genes, on a single peptide chain of about 55 kilodaltons. One of the scFvs binds to T cells via the CD3 receptor, and the other to 0 an infected cell via a specific molecule. Like other bispecific antibodies, and unlike ordinary monoclonal antibodies, BiTEs form a link between T cells and target cells. This causes T cells to exert cytotoxic / anti-viral activity on infected cells by producing proteins like perforin and granzymes, independently of the presence of MHC I or co-stimulatory molecules. These proteins enter infected cells and initiate the cell's 5 apoptosis. This action mimics physiological processes observed during T cell attacks against infected cells. I. Intrabodies In a particular embodiment, the antibody is a recombinant antibody that is suitable for :0 action inside of a cell - such antibodies are known as “intrabodies.” These antibodies may interfere with target function by a variety of mechanism, such as by altering intracellular protein trafficking, interfering with enzymatic function, and blocking protein-protein or protein-DNA interactions. In many ways, their structures mimic or parallel those of single chain and single domain antibodies, discussed above. Indeed, single-transcript / single-chain is an important feature that permits 25 intracellular expression in a target cell, and also makes protein transit across cell membranes more feasible. However, additional features are required. The two major issues impacting the implementation of intrabody therapeutic are delivery, including cell / tissue targeting, and stability. With respect to delivery, a variety of approaches have been employed, such as tissue-directed delivery, use of cell-type specific promoters, viral-based 30 delivery and use of cell-permeability / membrane translocating peptides. With respect to the stability, the approach is generally to either screen by brute force, including methods that involve phage display and may include sequence maturation or development of consensus sequences, or 2020273365 20 Nov 2020 more directed modifications such as insertion stabilizing sequences (e.g., Fc regions, chaperone protein sequences, leucine zippers) and disulfide replacement / modification. An additional feature that intrabodies may require is a signal for intracellular targeting. Vectors that can target intrabodies (or other proteins) to subcellular regions such as the cytoplasm, 5 nucleus, mitochondria and ER have been designed and are commercially available (Invitrogen Corp.; Persic et al., 1997). By virtue of their ability to enter cells, intrabodies have additional uses that other types of antibodies may not achieve. In the case of the present antibodies, the ability to interact with the MUC1 cytoplasmic domain in a living cell may interfere with functions associated with the MUC1 0 CD, such as signaling functions (binding to other molecules) or oligomer formation. In particular, it is contemplated that such antibodies can be used to inhibit MUC1 dimer formation. J. Purification In certain embodiments, the antibodies of the present disclosure may be purified. The term 5 “purified,” as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein is purified to any degree relative to its naturally-obtainable state. A purified protein therefore also refers to a protein, free from the environment in which it may naturally occur. Where the term “substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting :0 about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition. Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and nonpolypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of 25 interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. Other methods for protein purification include, precipitation with ammonium sulfate, PEG, antibodies and the like or 30 by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques. 2020273365 20 Nov 2020 In purifying an antibody of the present disclosure, it may be desirable to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. The polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. As is generally known in the 5 art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide. Commonly, complete antibodies are fractionated utilizing agents (i.e., protein A) that bind the Fc portion of the antibody. Alternatively, antigens may be used to simultaneously purify and 0 select appropriate antibodies. Such methods often utilize the selection agent bound to a support, such as a column, filter or bead. The antibodies are bound to a support, contaminants removed (e.g., washed away), and the antibodies released by applying conditions (salt, heat, etc.). Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, 5 determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS / PAGE analysis. Another method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity. The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the :0 purification and whether or not the expressed protein or peptide exhibits a detectable activity. It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS / PAGE (Capaldi et al., 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary. 25 III. Active / Passive Immunization and Treatment / Prevention of RRV Infection A. Formulation and administration The present disclosure provides pharmaceutical compositions comprising anti-RRV antibodies and antigens for generating the same. Such compositions comprise a prophylactically 30 or therapeutically effective amount of an antibody or a fragment thereof, or a peptide immunogen, and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically 2020273365 20 Nov 2020 acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and 5 oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a particular carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Other suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, 0 rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. Oral 5 formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical agents are described in “Remington's Pharmaceutical Sciences.” Such compositions will contain a prophylactically or therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier so as to :0 provide the form for proper administration to the patient. The formulation should suit the mode of administration, which can be oral, intravenous, intraarterial, intrabuccal, intranasal, nebulized, bronchial inhalation, intra-rectal, vaginal, topical or delivered by mechanical ventilation. Active vaccines are also envisioned where antibodies like those disclosed are produced in vivo in a subject at risk of RRV infection. Such vaccines can be formulated for parenteral 25 administration, e.g., formulated for injection via the intradermal, intravenous, intramuscular, subcutaneous, or even intraperitoneal routes. Administration by intradermal and intramuscular routes are contemplated. The vaccine could alternatively be administered by a topical route directly to the mucosa, for example, by nasal drops, inhalation, by nebulizer, or via intrarectal or vaginal delivery. Pharmaceutically acceptable salts include the acid salts and those which are formed with 30 inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups may also 2020273365 20 Nov 2020 be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like. Passive transfer of antibodies, known as artificially acquired passive immunity, generally 5 will involve the use of intravenous or intramuscular injections. The forms of antibody can be human or animal blood plasma or serum, as pooled human immunoglobulin for intravenous (IVIG) or intramuscular (IG) use, as high-titer human IVIG or IG from immunized or from donors recovering from disease, and as monoclonal antibodies (MAb). Such immunity generally lasts for only a short period of time, and there is also a potential risk for hypersensitivity reactions, and 0 serum sickness, especially from gamma globulin of non-human origin. However, passive immunity provides immediate protection. The antibodies will be formulated in a carrier suitable for injection, i.e., sterile and syringeable. Generally, the ingredients of compositions of the disclosure are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free 5 concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. :0 The compositions of the disclosure can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. 25 2. ADCC Antibody-dependent cell-mediated cytotoxicity (ADCC) is an immune mechanism leading to the lysis of antibody-coated target cells by immune effector cells. The target cells are cells to which antibodies or fragments thereof comprising an Fc region specifically bind, generally via the 30 protein part that is N-terminal to the Fc region. By “antibody having increased / reduced antibody 2020273365 20 Nov 2020 dependent cell-mediated cytotoxicity (ADCC)” is meant an antibody having increased / reduced ADCC as determined by any suitable method known to those of ordinary skill in the art. As used herein, the term “increased / reduced ADCC” is defined as either an increase / reduction in the number of target cells that are lysed in a given time, at a given 5 concentration of antibody in the medium surrounding the target cells, by the mechanism of ADCC defined above, and / or a reduction / increase in the concentration of antibody, in the medium surrounding the target cells, required to achieve the lysis of a given number of target cells in a given time, by the mechanism of ADCC. The increase / reduction in ADCC is relative to the ADCC mediated by the same antibody produced by the same type of host cells, using the same standard 0 production, purification, formulation and storage methods (which are known to those skilled in the art), but that has not been engineered. For example, the increase in ADCC mediated by an antibody produced by host cells engineered to have an altered pattern of glycosylation (e.g., to express the glycosyltransferase, GnTIII, or other glycosyltransferases) by the methods described herein, is relative to the ADCC mediated by the same antibody produced by the same type of non-engineered 5 host cells. 3. CDC Complement-dependent cytotoxicity (CDC) is a function of the complement system. It is the processes in the immune system that kill pathogens by damaging their membranes without the :0 involvement of antibodies or cells of the immune system. There are three main processes. All three insert one or more membrane attack complexes (MAC) into the pathogen which cause lethal colloid-osmotic swelling, i.e., CDC. It is one of the mechanisms by which antibodies or antibody fragments have an anti-viral effect. 25 IV. Antibody conjugates Antibodies of the present disclosure may be linked to at least one agent to form an antibody conjugate. In order to increase the efficacy of antibody molecules as diagnostic or therapeutic agents, it is conventional to link or covalently bind or complex at least one desired molecule or moiety. Such a molecule or moiety may be, but is not limited to, at least one effector or reporter 30 molecule. Effector molecules comprise molecules having a desired activity, e.g., cytotoxic activity. Non-limiting examples of effector molecules which have been attached to antibodies include 2020273365 20 Nov 2020 toxins, anti-tumor agents, therapeutic enzymes, radionuclides, antiviral agents, chelating agents, cytokines, growth factors, and oligo- or polynucleotides. By contrast, a reporter molecule is defined as any moiety which may be detected using an assay. Non-limiting examples of reporter molecules which have been conjugated to antibodies include enzymes, radiolabels, haptens, 5 fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, photoaffinity molecules, colored particles or ligands, such as biotin. Antibody conjugates are generally preferred for use as diagnostic agents. Antibody diagnostics generally fall within two classes, those for use in in vitro diagnostics, such as in a variety of immunoassays, and those for use in vivo diagnostic protocols, generally known as 0 "antibody-directed imaging." Many appropriate imaging agents are known in the art, as are methods for their attachment to antibodies (see, for e.g., U.S. Patents 5,021,236, 4,938,948, and 4,472,509). The imaging moieties used can be paramagnetic ions, radioactive isotopes, fluorochromes, NMR-detectable substances, and X-ray imaging agents. In the case of paramagnetic ions, one might mention by way of example ions such as 5 chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and / or erbium (III), with gadolinium being particularly preferred. Ions useful in other contexts, such as X-ray imaging, include but are not limited to lanthanum (III), gold (III), lead (II), and especially bismuth (III). :0 In the case of radioactive isotopes for therapeutic and / or diagnostic application, one might mention astatine211,14carbon, 51chromium, 36chlorine, 57cobalt, 58cobalt, copper67, 152Eu, gallium67, 3hydrogen, iodine123, iodine125, iodine131, indium111,59iron, 32phosphorus, rhenium186, rhenium188, 75selenium, 35sulphur, technicium99m and / or yttrium90.125I is often being preferred for use in certain embodiments, and technicium99m and / or indium111 are also often preferred due to their low energy 25 and suitability for long range detection. Radioactively labeled monoclonal antibodies of the present disclosure may be produced according to well-known methods in the art. For instance, monoclonal antibodies can be iodinated by contact with sodium and / or potassium iodide and a chemical oxidizing agent such as sodium hypochlorite, or an enzymatic oxidizing agent, such as lactoperoxidase. Monoclonal antibodies according to the disclosure may be labeled with 30 technetium99™ by ligand exchange process, for example, by reducing pertechnate with stannous solution, chelating the reduced technetium onto a Sephadex column and applying the antibody to 2020273365 20 Nov 2020 this column. Alternatively, direct labeling techniques may be used, e.g., by incubating pertechnate, a reducing agent such as SNCh, a buffer solution such as sodium-potassium phthalate solution, and the antibody. Intermediary functional groups which are often used to bind radioisotopes which exist as metallic ions to antibody are diethylenetriaminepentaacetic acid (DTPA) or ethylene 5 diaminetetracetic acid (EDTA). Among the fluorescent labels contemplated for use as conjugates include Alexa 350, Alexa 430, AMCA, BODIPY 630 / 650, BODIPY 650 / 665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5,6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, 0 Rhodamine Red, Renographin, ROX, TAMRA, TET, Tetramethylrhodamine, and / or Texas Red. Additional types of antibodies contemplated in the present disclosure are those intended primarily for use in vitro, where the antibody is linked to a secondary binding ligand and / or to an enzyme (an enzyme tag) that will generate a colored product upon contact with a chromogenic substrate. Examples of suitable enzymes include urease, alkaline phosphatase, (horseradish) 5 hydrogen peroxidase or glucose oxidase. Preferred secondary binding ligands are biotin and avidin and streptavidin compounds. The use of such labels is well known to those of skill in the art and are described, for example, in U.S. Patents 3,817,837, 3,850,752, 3,939,350, 3,996,345,4,277,437, 4,275,149 and 4,366,241. Yet another known method of site-specific attachment of molecules to antibodies :0 comprises the reaction of antibodies with hapten-based affinity labels. Essentially, hapten-based affinity labels react with amino acids in the antigen binding site, thereby destroying this site and blocking specific antigen reaction. However, this may not be advantageous since it results in loss of antigen binding by the antibody conjugate. Molecules containing azido groups may also be used to form covalent bonds to proteins 25 through reactive nitrene intermediates that are generated by low intensity ultraviolet light (Potter and Haley, 1983). In particular, 2- and 8-azido analogues of purine nucleotides have been used as site-directed photoprobes to identify nucleotide binding proteins in crude cell extracts (Owens & Haley, 1987; Atherton et al., 1985). The 2- and 8-azido nucleotides have also been used to map nucleotide binding domains of purified proteins (Khatoon et al., 1989; King et al., 1989; Dholakia 30 et al., 1989) and may be used as antibody binding agents. 2020273365 20 Nov 2020 Several methods are known in the art for the attachment or conjugation of an antibody to its conjugate moiety. Some attachment methods involve the use of a metal chelate complex employing, for example, an organic chelating agent such a diethylenetriaminepentaacetic acid anhydride (DTPA); ethylenetriaminetetraacetic acid; N-chloro-p-toluenesulfonamide; and / or 5 tetrachloro-3a-6a-diphenylglycouril-3 attached to the antibody (U.S. Patents 4,472,509 and 4,938,948). Monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothiocyanate. In U.S. Patent 4,938,948, imaging of breast tumors is achieved using monoclonal antibodies and the 0 detectable imaging moieties are bound to the antibody using linkers such as methyl-p-hydroxybenzimidate or N-succinimidyl-3-(4-hydroxyphenyl)propionate. In other embodiments, derivatization of immunoglobulins by selectively introducing sulfhydryl groups in the Fc region of an immunoglobulin, using reaction conditions that do not alter the antibody combining site are contemplated. Antibody conjugates produced according to 5 this methodology are disclosed to exhibit improved longevity, specificity and sensitivity (U.S. Patent 5,196,066, incorporated herein by reference). Site-specific attachment of effector or reporter molecules, wherein the reporter or effector molecule is conjugated to a carbohydrate residue in the Fc region have also been disclosed in the literature (O’Shannessy et al., 1987). This approach has been reported to produce diagnostically and therapeutically promising antibodies which are :0 currently in clinical evaluation. V. Immunodetection methods In still further embodiments, the present disclosure concerns immunodetection methods for binding, purifying, removing, quantifying and otherwise generally detecting RRV and its 25 associated antigens. While such methods can be applied in a traditional sense, another use will be in quality control and monitoring of vaccine and other virus stocks, where antibodies according to the present disclosure can be used to assess the amount or integrity (i.e., long term stability) of antigens in viruses. Alternatively, the methods may be used to screen various antibodies for appropriate / desired reactivity profiles. 30 Other immunodetection methods include specific assays for determining the presence of RRV in a subject. A wide variety of assay formats are contemplated, but specifically those that 2020273365 20 Nov 2020 would be used to detect RRV in a fluid obtained from a subject, such as saliva, blood, plasma, sputum, semen or urine. In particular, semen has been demonstrated as a viable sample for detecting viruses (Purpura et al., 2016; Mansuy et al., 2016; Barzon et al., 2016; Gomet et al., 2016; Duffy et al., 2009; CDC, 2016; Halfon et al., 2010; Elder et al. 2005). The assays may be 5 advantageously formatted for non-healthcare (home) use, including lateral flow assays (see below) analogous to home pregnancy tests. These assays may be packaged in the form of a kit with appropriate reagents and instructions to permit use by the subject of a family member. Some immunodetection methods include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay, fluoroimmunoassay, chemiluminescent 0 assay, bio luminescent assay, and Western blot to mention a few. In particular, a competitive assay for the detection and quantitation of RRV antibodies directed to specific parasite epitopes in samples also is provided. The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Doolittle and Ben-Zeev (1999), Gulbis and Galand (1993), De Jager et al. (1993), and Nakamura et al. (1987). In general, the immunobinding 5 methods include obtaining a sample suspected of containing RRV and contacting the sample with a first antibody in accordance with the present disclosure, as the case may be, under conditions effective to allow the formation of immunocomplexes. These methods include methods for purifying RRV or related antigens from a sample. The antibody will preferably be linked to a solid support, such as in the form of a column matrix, and :0 the sample suspected of containing the RRV or antigenic component will be applied to the immobilized antibody. The unwanted components will be washed from the column, leaving the RRV antigen immunocomplexed to the immobilized antibody, which is then collected by removing the organism or antigen from the column. The immunobinding methods also include methods for detecting and quantifying the 25 amount of RRV or related components in a sample and the detection and quantification of any immune complexes formed during the binding process. Here, one would obtain a sample suspected of containing RRV or its antigens and contact the sample with an antibody that binds RRV or components thereof, followed by detecting and quantifying the amount of immune complexes formed under the specific conditions. In terms of antigen detection, the biological sample analyzed 30 may be any sample that is suspected of containing RRV or RRV antigen, such as a tissue section 2020273365 20 Nov 2020 or specimen, a homogenized tissue extract, a biological fluid, including blood and serum, or a secretion, such as feces or urine. Contacting the chosen biological sample with the antibody under effective conditions and for a period of time sufficient to allow the formation of immune complexes (primary immune 5 complexes) is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to RRV or antigens present. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or Western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies 0 specifically bound within the primary immune complexes to be detected. In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any of those radioactive, fluorescent, biological and enzymatic tags. Patents concerning the use of such labels include U.S. Patents 3,817,837, 5 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149 and 4,366,241. Of course, one may find additional advantages through the use of a secondary binding ligand such as a second antibody and / or a biotin / avidin ligand binding arrangement, as is known in the art. The antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune :0 complexes in the composition to be determined. Alternatively, the first antibody that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the antibody. In these cases, the second binding ligand may be linked to a detectable label. The second binding ligand is itself often an antibody, which may thus be termed a “secondary” antibody. The primary immune complexes are contacted with the labeled, 25 secondary binding ligand, or antibody, under effective conditions and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected. Further methods include the detection of primary immune complexes by a two-step 30 approach. A second binding ligand, such as an antibody that has binding affinity for the antibody, is used to form secondary immune complexes, as described above. After washing, the secondary 2020273365 20 Nov 2020 immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under effective conditions and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus 5 formed. This system may provide for signal amplification if this is desired. One method of immunodetection uses two different antibodies. A first biotinylated antibody is used to detect the target antigen, and a second antibody is then used to detect the biotin attached to the complexed biotin. In that method, the sample to be tested is first incubated in a solution containing the first step antibody. If the target antigen is present, some of the antibody 0 binds to the antigen to form a biotinylated antibody / antigen complex. The antibody / antigen complex is then amplified by incubation in successive solutions of streptavidin (or avidin), biotinylated DNA, and / or complementary biotinylated DNA, with each step adding additional biotin sites to the antibody / antigen complex. The amplification steps are repeated until a suitable level of amplification is achieved, at which point the sample is incubated in a solution containing 5 the second step antibody against biotin. This second step antibody is labeled, for example, with an enzyme that can be used to detect the presence of the antibody / antigen complex by histoenzymology using a chromogen substrate. With suitable amplification, a conjugate can be produced which is macroscopically visible. Another known method of immunodetection takes advantage of the immuno-PCR :0 (Polymerase Chain Reaction) methodology. The PCR method is similar to the Cantor method up to the incubation with biotinylated DNA, however, instead of using multiple rounds of streptavidin and biotinylated DNA incubation, the DNA / biotin / streptavidin / antibody complex is washed out with a low pH or high salt buffer that releases the antibody. The resulting wash solution is then used to carry out a PCR reaction with suitable primers with appropriate controls. At least in theory, 25 the enormous amplification capability and specificity of PCR can be utilized to detect a single antigen molecule. A. ELISAs Immunoassays, in their most simple and direct sense, are binding assays. Certain preferred 30 immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs) and radioimmunoassays (RIA) known in the art. Immunohistochemical detection using tissue sections 2020273365 20 Nov 2020 is also particularly useful. However, it will be readily appreciated that detection is not limited to such techniques, and western blotting, dot blotting, FACS analyses, and the like may also be used. In one exemplary ELISA, the antibodies of the disclosure are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test 5 composition suspected of containing the RRV or RRV antigen is added to the wells. After binding and washing to remove non-specifically bound immune complexes, the bound antigen may be detected. Detection may be achieved by the addition of another anti-RRV antibody that is linked to a detectable label. This type of ELISA is a simple “sandwich ELISA.” Detection may also be achieved by the addition of a second anti-RRV antibody, followed by the addition of a third 0 antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label. In another exemplary ELISA, the samples suspected of containing the RRV or RRV antigen are immobilized onto the well surface and then contacted with the anti-RRV antibodies of the disclosure. After binding and washing to remove non-specifically bound immune complexes, 5 the bound anti-RRV antibodies are detected. Where the initial anti-RRV antibodies are linked to a detectable label, the immune complexes may be detected directly. Again, the immune complexes may be detected using a second antibody that has binding affinity for the first anti-RRV antibody, with the second antibody being linked to a detectable label. Irrespective of the format employed, ELISAs have certain features in common, such as :0 coating, incubating and binding, washing to remove non-specifically bound species, and detecting the bound immune complexes. These are described below. In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any 25 remaining available surfaces of the wells are then “coated” with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein or solutions of milk powder. The coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface. 30 In ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding of a protein or antibody to the well, coating with 2020273365 20 Nov 2020 a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with the biological sample to be tested under conditions effective to allow immune complex (antigen / antibody) formation. Detection of the immune complex then requires a labeled secondary binding ligand or antibody, and a secondary binding 5 ligand or antibody in conjunction with a labeled tertiary antibody or a third binding ligand. “Under conditions effective to allow immune complex (antigen / antibody) formation” means that the conditions preferably include diluting the antigens and / or antibodies with solutions such as BSA, bovine gamma globulin (BGG) or phosphate buffered saline (PBS) / Tween. These added agents also tend to assist in the reduction of nonspecific background. 0 The “suitable” conditions also mean that the incubation is at a temperature or for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours or so, at temperatures preferably on the order of 25°C to 27°C, or may be overnight at about 4°C or so. Following all incubation steps in an ELISA, the contacted surface is washed so as to 5 remove non-complexed material. A preferred washing procedure includes washing with a solution such as PBS / Tween, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined. To provide a detecting means, the second or third antibody will have an associated label to :0 allow detection. Preferably, this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, one will desire to contact or incubate the first and second immune complex with a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 hours at 25 room temperature in a PBS-containing solution such as PBS-Tween). After incubation with the labeled antibody, and subsequent to washing to remove unbound material, the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea, or bromocresol purple, or 2,2'-azino-di-(3-ethyl-benzthiazoline-6-sulfonic acid (ABTS), or H2O2, in the case of peroxidase as the enzyme label. Quantification is then achieved by 30 measuring the degree of color generated, e.g., using a visible spectra spectrophotometer. 2020273365 20 Nov 2020 In another embodiment, the present disclosure contemplates the use of competitive formats. This is particularly useful in the detection of RRV antibodies in sample. In competition-based assays, an unknown amount of analyte or antibody is determined by its ability to displace a known amount of labeled antibody or analyte. Thus, the quantifiable loss of a signal is an indication of 5 the amount of unknown antibody or analyte in a sample. Here, the inventor proposes the use of labeled RRV monoclonal antibodies to determine the amount of RRV antibodies in a sample. The basic format would include contacting a known amount of RRV monoclonal antibody (linked to a detectable label) with RRV antigen or particle. The RRV antigen or organism is preferably attached to a support. After binding of the labeled 0 monoclonal antibody to the support, the sample is added and incubated under conditions permitting any unlabeled antibody in the sample to compete with, and hence displace, the labeled monoclonal antibody. By measuring either the lost label or the label remaining (and subtracting that from the original amount of bound label), one can determine how much non-labeled antibody is bound to the support, and thus how much antibody was present in the sample. 5 B. Western blot The Western blot (alternatively, protein immunoblot) is an analytical technique used to detect specific proteins in a given sample of tissue homogenate or extract. It uses gel electrophoresis to separate native or denatured proteins by the length of the polypeptide :0 (denaturing conditions) or by the 3-D structure of the protein (native / non-denaturing conditions). The proteins are then transferred to a membrane (typically nitrocellulose or PVDF), where they are probed (detected) using antibodies specific to the target protein. Samples may be taken from whole tissue or from cell culture. In most cases, solid tissues are first broken down mechanically using a blender (for larger sample volumes), using a 25 homogenizer (smaller volumes), or by sonication. Cells may also be broken open by one of the above mechanical methods. However, it should be noted that bacteria, virus or environmental samples can be the source of protein and thus Western blotting is not restricted to cellular studies only. Assorted detergents, salts, and buffers may be employed to encourage lysis of cells and to solubilize proteins. Protease and phosphatase inhibitors are often added to prevent the digestion of 30 the sample by its own enzymes. Tissue preparation is often done at cold temperatures to avoid protein denaturing. 2020273365 20 Nov 2020 The proteins of the sample are separated using gel electrophoresis. Separation of proteins may be by isoelectric point (pl), molecular weight, electric charge, or a combination of these factors. The nature of the separation depends on the treatment of the sample and the nature of the gel. This is a very useful way to determine a protein. It is also possible to use a two-dimensional 5 (2-D) gel which spreads the proteins from a single sample out in two dimensions. Proteins are separated according to isoelectric point (pH at which they have neutral net charge) in the first dimension, and according to their molecular weight in the second dimension. In order to make the proteins accessible to antibody detection, they are moved from within the gel onto a membrane made of nitrocellulose or polyvinylidene difluoride (PVDF). The 0 membrane is placed on top of the gel, and a stack of filter papers placed on top of that. The entire stack is placed in a buffer solution which moves up the paper by capillary action, bringing the proteins with it. Another method for transferring the proteins is called electroblotting and uses an electric current to pull proteins from the gel into the PVDF or nitrocellulose membrane. The proteins move from within the gel onto the membrane while maintaining the organization they had 5 within the gel. As a result of this blotting process, the proteins are exposed on a thin surface layer for detection (see below). Both varieties of membrane are chosen for their non-specific protein binding properties (i.e., binds all proteins equally well). Protein binding is based upon hydrophobic interactions, as well as charged interactions between the membrane and protein. Nitrocellulose membranes are cheaper than PVDF but are far more fragile and do not stand up well to repeated :0 probings. The uniformity and overall effectiveness of transfer of protein from the gel to the membrane can be checked by staining the membrane with Coomassie Brilliant Blue or Ponceau S dyes. Once transferred, proteins are detected using labeled primary antibodies, or unlabeled primary antibodies followed by indirect detection using labeled protein A or secondary labeled antibodies binding to the Fc region of the primary antibodies. 25 C. Lateral flow assays Lateral flow assays, also known as lateral flow immunochromatographic assays, are simple devices intended to detect the presence (or absence) of a target analyte in sample (matrix) without the need for specialized and costly equipment, though many laboratory-based applications exist 30 that are supported by reading equipment. Typically, these tests are used as low resources medical 2020273365 20 Nov 2020 diagnostics, either for home testing, point of care testing, or laboratory use. A widely spread and well-known application is the home pregnancy test. The technology is based on a series of capillary beds, such as pieces of porous paper or sintered polymer. Each of these elements has the capacity to transport fluid (e.g., urine) 5 spontaneously. The first element (the sample pad) acts as a sponge and holds an excess of sample fluid. Once soaked, the fluid migrates to the second element (conjugate pad) in which the manufacturer has stored the so-called conjugate, a dried format of bio-active particles (see below) in a salt-sugar matrix that contains everything to guarantee an optimized chemical reaction between the target molecule (e.g., an antigen) and its chemical partner (e.g., antibody) that has 0 been immobilized on the particle's surface. While the sample fluid dissolves the salt-sugar matrix, it also dissolves the particles and in one combined transport action the sample and conjugate mix while flowing through the porous structure. In this way, the analyte binds to the particles while migrating further through the third capillary bed. This material has one or more areas (often called stripes) where a third molecule has been immobilized by the manufacturer. By the time the sample-5 conjugate mix reaches these strips, analyte has been bound on the particle and the third 'capture' molecule binds the complex. After a while, when more and more fluid has passed the stripes, particles accumulate and the stripe-area changes color. Typically there are at least two stripes: one (the control) that captures any particle and thereby shows that reaction conditions and technology worked fine, the second contains a specific capture molecule and only captures those particles onto :0 which an analyte molecule has been immobilized. After passing these reaction zones, the fluid enters the final porous material - the wick - that simply acts as a waste container. Lateral Flow Tests can operate as either competitive or sandwich assays. Lateral flow assays are disclosed in U.S. Patent 6,485,982. 25 D. Immunohistochemistry The antibodies of the present disclosure may also be used in conjunction with both fresh-frozen and / or formalin-fixed, paraffin-embedded tissue blocks prepared for study by immunohistochemistry (IHC). The method of preparing tissue blocks from these particulate specimens has been successfully used in previous IHC studies of various prognostic factors and is 2020273365 20 Nov 2020 well known to those of skill in the art (Brown et al., 1990; Abbondanzo et al., 1990; Allred et al., 1990). Briefly, frozen-sections may be prepared by rehydrating 50 ng of frozen “pulverized” tissue at room temperature in phosphate buffered saline (PBS) in small plastic capsules; pelleting 5 the particles by centrifugation; resuspending them in a viscous embedding medium (OCT); inverting the capsule and / or pelleting again by centrifugation; snap-freezing in -70°C isopentane; cutting the plastic capsule and / or removing the frozen cylinder of tissue; securing the tissue cylinder on a cryostat microtome chuck; and / or cutting 25-50 serial sections from the capsule. Alternatively, whole frozen tissue samples may be used for serial section cuttings. 0 Permanent-sections may be prepared by a similar method involving rehydration of the 50 mg sample in a plastic microfuge tube; pelleting; resuspending in 10% formalin for 4 hours fixation; washing / pelleting; resuspending in warm 2.5% agar; pelleting; cooling in ice water to harden the agar; removing the tissue / agar block from the tube; infiltrating and / or embedding the block in paraffin; and / or cutting up to 50 serial permanent sections. Again, whole tissue samples 5 may be substituted. E. Immunodetection kits In still further embodiments, the present disclosure concerns immunodetection kits for use with the immunodetection methods described above. As the antibodies may be used to detect RRV :0 or RRV antigens, the antibodies may be included in the kit. The immunodetection kits will thus comprise, in suitable container means, a first antibody that binds to RRV or RRV antigen, and optionally an immunodetection reagent. In certain embodiments, the RRV antibody may be pre-bound to a solid support, such as a column matrix and / or well of a microtiter plate. The immunodetection reagents of the kit may take 25 any one of a variety of forms, including those detectable labels that are associated with or linked to the given antibody. Detectable labels that are associated with or attached to a secondary binding ligand are also contemplated. Exemplary secondary ligands are those secondary antibodies that have binding affinity for the first antibody. Further suitable immunodetection reagents for use in the present kits include the two-30 component reagent that comprises a secondary antibody that has binding affinity for the first antibody, along with a third antibody that has binding affinity for the second antibody, the third 2020273365 20 Nov 2020 antibody being linked to a detectable label. As noted above, a number of exemplary labels are known in the art and all such labels may be employed in connection with the present disclosure. The kits may further comprise a suitably aliquoted composition of the RRV or RRV antigens, whether labeled or unlabeled, as may be used to prepare a standard curve for a detection 5 assay. The kits may contain antibody-label conjugates either in fully conjugated form, in the form of intermediates, or as separate moieties to be conjugated by the user of the kit. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which the antibody may be placed, or preferably, 0 suitably aliquoted. The kits of the present disclosure will also typically include a means for containing the antibody, antigen, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. 5 F. Vaccine and antigen quality control assays The present disclosure also contemplates the use of antibodies and antibody fragments as described herein for use in assessing the antigenic integrity of a viral antigen in a sample. Biological medicinal products like vaccines differ from chemical drugs in that they cannot normally be characterized molecularly; antibodies are large molecules of significant complexity :0 and have the capacity to vary widely from preparation to preparation. They are also administered to healthy individuals, including children at the start of their lives, and thus a strong emphasis must be placed on their quality to ensure, to the greatest extent possible, that they are efficacious in preventing or treating life-threatening disease, without themselves causing harm. The increasing globalization in the production and distribution of vaccines has opened new 25 possibilities to better manage public health concerns but has also raised questions about the equivalence and interchangeability of vaccines procured across a variety of sources. International standardization of starting materials, of production and quality control testing, and the setting of high expectations for regulatory oversight on the way these products are manufactured and used, have thus been the cornerstone for continued success. But it remains a field in constant change, 30 and continuous technical advances in the field offer a promise of developing potent new weapons against the oldest public health threats, as well as new ones - malaria, pandemic influenza, and 2020273365 20 Nov 2020 HIV, to name a few - but also put a great pressure on manufacturers, regulatory authorities, and the wider medical community to ensure that products continue to meet the highest standards of quality attainable. Thus, one may obtain an antigen or vaccine from any source or at any point during a 5 manufacturing process. The quality control processes may therefore begin with preparing a sample for an immunoassay that identifies binding of an antibody or fragment disclosed herein to a viral antigen. Such immunoassays are disclosed elsewhere in this document, and any of these may be used to assess the structural / antigenic integrity of the antigen. Standards for finding the sample to contain acceptable amounts of antigenically correct and intact antigen may be established by 0 regulatory agencies. Another important embodiment where antigen integrity is assessed is in determining shelflife and storage stability. Most medicines, including vaccines, can deteriorate over time. Therefore, it is critical to determine whether, over time, the degree to which an antigen, such as in a vaccine, degrades or destabilizes such that is it no longer antigenic and / or capable of generating 5 an immune response when administered to a subject. Again, standards for finding the sample to contain acceptable amounts of antigenically intact antigen may be established by regulatory agencies. In certain embodiments, viral antigens may contain more than one protective epitope. In these cases, it may prove useful to employ assays that look at the binding of more than one :0 antibody, such as 2, 3, 4, 5 or even more antibodies. These antibodies bind to closely related epitopes, such that they are adjacent or even overlap each other. On the other hand, they may represent distinct epitopes from disparate parts of the antigen. By examining the integrity of multiple epitopes, a more complete picture of the antigen’s overall integrity, and hence ability to generate a protective immune response, may be determined. 25 Antibodies and fragments thereof as described in the present disclosure may also be used in a kit for monitoring the efficacy of vaccination procedures by detecting the presence of protective RRV antibodies. Antibodies, antibody fragment, or variants and derivatives thereof, as described in the present disclosure may also be used in a kit for monitoring vaccine manufacture with the desired immunogenicity. 30 2020273365 20 Nov 2020 VI. Examples The following examples are included to demonstrate preferred embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of embodiments, 5 and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. 0 Example 1 - Materials and Methods Source of human B cells. The first research subject was a 50-year old woman living in the U.S. who had a history of laboratory-confirmed infection in Australia in 1987. The second subject was a 32-year old male who was exposed to the virus during childhood in Australia in a clinically diagnosed but non-laboratory confirmed case of infection. Peripheral blood was obtained 5 from the first donor in 2015 (28 years after infection) and from the second donor in 2017 (approximately 20 years after infection) with written informed consent following approval of the study by the Vanderbilt University Medical Center Institutional Review Board. Peripheral blood mononuclear cells (PBMCs) were isolated from both donors using density gradient centrifugation on Ficoll and were cryopreserved in liquid nitrogen until used in the experiments. :0 Generation of human hybridomas. Approximately 10 million cryopreserved PBMCs were thawed and transformed with Epstein-Barr virus obtained from the supernatant of B95.8 cells in a suspension also containing a Chk2 inhibitor, cyclosporin A, and CpG, and the mixture was plated in a 384-well cell culture plate. After 7 days, transformed cells in each well were transferred to a well in 96-well plates containing a feeder layer of irradiated cells that were PBMCs obtained 25 from discarded leukofiltration devices (Nashville Red Cross). After an additional 5 days, the supernatants of expanded cells were screened for the presence of RRV-reactive antibodies using an enzyme-linked immunosorbent assay (ELISA), described below. Transformed B cells from wells containing supernatant with antibodies reactive to RRV were fused to the HMMA2.5 nonsecreting myeloma cell line using an established electro fusion technique (Smith and Crowe, 2015). 30 After fusion, the resulting mixture of hybridoma cells was resuspended in medium containing 2020273365 20 Nov 2020 hypoxanthine, aminopterin, thymidine and oubain to select for hybrids of B cells and myeloma cells. RRV ELISA screen. RRV strain T48 was propagated in monolayer cultures of Vero cells. The cell line was authenticated and tested monthly during culture for the presence of mycoplasma 5 and found to be negative in all cases. Infected cell supernatants containing virus with a titer of approximately 5 x 106 FFU / mL were harvested when cytopathic effect was maximal, filtered through a 0.45 pm filter, then frozen and stored at -80°C until use. 384-well ELISA plates were coated with 25 pL of RRV strain T48 diluted 1:100 in PBS and incubated for 1 h at 37°C. Plates were washed 5 times with PBS containing Tween (PBST) using an EL406 combination washer 0 dispenser instrument (BioTek) and blocked for 1 h at room temperature with 5% milk powder and 2% goat serum, diluted in PBS. After washing 2 times with PBST, 25 pL of supernatants from hybridoma cultures or EBV-transformed cell lines were added to plates, which then were incubated for 1 h at room temperature. Plates were washed 4 times, and 25 pL of goat anti-human alkaline phosphatase-conjugated secondary antibodies (Meridian Life Science) diluted 1:5,000 in PBS was 5 added to plates. After a 45-min incubation period, plates were washed 5 times and 25 pL of alkaline phosphatase substrate tablets (Sigma) diluted in Tris buffer with IM MgCh was added. Optical density was read at 405 nm after 1 h using a Biotek plate reader. Biolayer interferometry (BLI) competition-binding studies. An Octet RED96 BLI instrument (Pall ForteBio) was used to perform epitope binning studies using competition binding. :0 One of the human antibodies obtained in early experiments (RRV-86) was used as a capture antibody and was immobilized onto Fc-specific anti-human IgG biosensors for 2 min. After measuring the baseline signal, the biosensor tips were immersed into wells containing RRV VLPs for 2 min. After another baseline measurement, biosensors then were transferred to wells containing a first mAb at a concentration of 100 pg / mL for 5 min, before immersion in a solution 25 containing a second mAb, also at a concentration of 100 pg / mL for 5 min. The percent competition of the second mAb in the presence of the first mAb was determined by comparing the maximal signal of binding for the second mAb in the presence of the first antibody to the maximal signal of that mAb alone when separately tested uncompeted. Competition was defined by reduction of the maximal binding score to <20% of un-competed binding. A non-competing mAb was identified 30 when maximal binding was >50% of un-competed binding. A 25 to 50% reduction in maximal binding was considered intermediate competition. 2020273365 20 Nov 2020 Generation of virus-like particles (VLPs). RRV structural genes, capsid-E3-E2-6K-El, encoding 3,783 bp with the addition of a Kozak sequence, were cloned into the pcDNA3.1(+) mammalian cell expression plasmid (GenScript). 293T cells (American Type Culture Collection Cat. No. CRL-11268) were transfected with 4 pg per 5 xlO5 cells of the plasmid using the 5 Lipofectamine 2000 method according to the protocol of the manufacturer (Thermo Fisher Scientific). Transfection was allowed to proceed for 48-72 h before supernatant was harvested and filtered through a 0.45 pm filter. VLPs were concentrated by ultracentrifugation at 110,000 g in a SW28 rotor for 2 h at 4°C through a 20% sucrose cushion using a Sorvall Discovery 90SE ultracentrifuge. The resulting pellet was resuspended in 250 pL of TNE buffer (0.01 M Tris-HCl, 0 pH 7.2, 0.1 M NaCl, 0.001 M EDTA) and stored at 4°C. Hybridoma cell line clone production. Two weeks after fusion, hybridoma cell lines were cloned by single-cell sorting using fluorescence-activated cell sorting on a BD FACSAria™ III sorting cytometer with aerosol containment, in the Vanderbilt University Medical Center Flow Cytometry Core. Approximately 2 weeks later, an ELISA screen was performed, and wells 5 containing cloned cells secreting antibodies reactive to RRV were selected for expansion. Purification of mAb IgG protein. Clonal cells secreting mAbs were grown in 75 cm2 flasks to 70% confluency in hybridoma growth medium (ClonaCell-HY medium E from STEMCELL Technologies, 03805). The cells were expanded equally to four 225 cm2 flasks for antibody expression in serum-free medium (GIBCO Hybridoma-SFM, Invitrogen, 12045084). The :0 supernatant was harvested after 3 weeks and purified by affinity chromatography using protein G columns (GE Life Sciences, Protein G HP Columns). Purified IgG from hybridoma cell expression was used for all assays. Focus reduction neutralization test. Vero cells (American Type Culture Collection Cat. No. CCL-81) were seeded in 96-well plates at 30,000 cells / well the day before use. Antibodies 25 were diluted in 96-well U-bottom plates, with a 1:3 dilution series across the plate and a virus-only control in the left column. A solution containing infectious RRV was diluted to a concentration of 100 focus-forming units (FFU) / mL and mixed 1:1 by volume in a 96-well plate with antibody suspensions. The virus / antibody mixture was incubated for 1 h at 37°C before transfer to Vero cell monolayer cultures. Infection was allowed to proceed for 1.5 h and then 1% methylcellulose 30 overlay prepared in DMEM with 2% FBS was added to cells. After 18 h, 1% paraformaldehyde (PFA) prepared in PBS was used to fix cells for at least one hour. Plates were washed 3 times with 2020273365 20 Nov 2020 PBS before addition of a 1:6,000 dilution of anti-RRV mouse ascites fluid (ATCC Cat. No. VR-1246AF) prepared in cell permeabilizing buffer (PBS with 0.1% saponin and 0.1% bovine serum albumin). After incubation for at least 2 h at room temperature, plates were washed 3 times in permeabilizing buffer, and anti-mouse HRP-conjugated secondary (Kirkegaard & Perry 5 Laboratories) was added at a 1:2,000 dilution in permeabilizing buffer. Plates were incubated for 1 h at room temperature and washed 3 times before addition of TrueBlue Peroxidase substrate (KPL) for 20 min. Plates were rinsed with dH2O, and then plates were imaged with an ImmunoSpot® plate reader (Cellular Technology Limited). Foci were counted with BioSpot 5.1 software (CTL), and the percent relative infection was calculated based on the virus-only control. 0 Triplicate tests were performed for each antibody, and the results were averaged. Fusion from without (FFWO) assay. Vero cells were seeded at 30,000 cells / well in 96-well plates the day before use in the assay. Before the start of assay, cells were washed once with binding medium (RPMI 1640, 0.2% BSA, 10 mM HEPES pH 7.4, and 20 mM NH4CI) at 4°C, and incubated for 15 min at 4°C. The T48 strain of RRV was concentrated to 108FFU / mL using 100 5 kDa centrifugal filters (Amicon) Centricon. Virus was prepared in binding medium and added to cells at a multiplicity of infection (MOI) of 15 for 1 h at 4°C. Any remaining free virus was removed with two washes in binding medium. Antibodies were prepared in DMEM containing 2% FBS at 10 pg / mL concentrations and added to cells for 1 h at 4°C. Antibody was removed and fusion with the plasma membrane was initiated by the addition of fusion media (RPMI 1640, 0.2% :0 BSA, 10 mM HEPES, and 30 mM succinic acid at pH 5.5) for 2 min at 37°C. Binding medium (RPMI 1640, 0.2% BSA, 10 mM HEPES at pH 7.4) was used in place of low pH fusion medium in controls wells to ensure that virus entry into cells only occurred due to pH-dependent plasma membrane fusion. After a 2-min incubation, medium was removed and cells were incubated in DMEM supplemented with 5% FBS, 10 mM HEPES, and 20 mM NH4CI (pH 7.4). Fourteen hours 25 later, cells were detached with trypsin, fixed with 1% PFA in PBS for 1 hour, and permeabilized with 0.1% saponin detergent solution. For staining prior to flow cytometry analysis, cells were incubated sequentially with RRV mouse ascites fluid (1:6000 dilution ATCC Cat. No. VR-1246AF) for 1 h and PE conjugated goat anti-mouse IgG secondary antibody for 1 h (ThermoFisher). Cells were analyzed on BD Fortessa flow cytometer with FlowJo software. 30 Alanine scanning mutagenesis for epitope mapping. The same construct used to generate virus-like particles (see above) was used to construct an alanine mutation library for 2020273365 20 Nov 2020 mapping of antibody epitopes. The first 300 residues in the RRV E2 protein were mutated to alanine, and alanine codons were mutated to serine and synthesized as cDNA (Twist Bioscience). Each mutant was sequence verified and expressed on the surface of 293F cells for screening using an iQue high-throughput flow cytometer (Intellicyt). Loss of binding for each mAb was 5 determined by measuring reduction in fluorescent signal as compared to signal in cells expressing WT protein. To differentiate loss of binding from absence of protein expression, at least two control antibodies with binding at greater than 50% were required for each residue. A cutoff value of less than 10% binding when normalized to WT was set to determine a loss of binding at each residue. An untransfected cell control for each antibody also was used to ensure specificity of 0 binding. ELISA-based Mxra8-Fc competition binding assay. RRV-86 (2 pg / mL) was diluted in PBS and immobilized onto a 384-well ELISA plate before incubation for 1 h at 37°C. The plate was washed four times with PBS containing Tween (PBST) using an EL406 combination washer dispenser instrument (BioTek) and blocked for 1 h at room temperature with 5% milk powder and 5 2% goat serum, diluted in PBS. RRV T48 strain was diluted to 4 x 107 FFU / mL in PBS and 25 pL per well was added for 1 h at room temperature. After washing five times with PBST, RRV mAbs were diluted to 20 pg / mL in PBS and 25 pL of mAb was added to each well, except for control wells where just PBS was added. Blocking mAbs were incubated for 30 min at room temperature and were left in when 25 pL of Mxra8-Fc (mouse Fc region) (Zhang et al., 2018) fusion protein at :0 a concentration of 10 pg / mL was added to each well. After incubation at room temperature for an hour, the plate was washed four times with PBST and 25 pL per well of a goat anti-mouse HRP-conjugated anti-mouse Fc secondary antibody (SeraCare) was added at a 1:2,000 dilution. After five washes with PBST, plates were developed with TMB Substrate (ThermoFisher Scientific) and the reaction was stopped with H2SO4. Absorbance was read at 450 nm with a Biotek plate reader. 25 A similarly prepared human mAb specific for Zika virus (ZIKV-117; Sapparapu et al., 2016) was included as a negative control antibody. Mouse studies. All animal experiments and procedures were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use 30 Committee at the Washington University School of Medicine (Assurance number A3381-01). Injections were performed under anesthesia that was induced and maintained with ketamine 2020273365 20 Nov 2020 hydrochloride and xylazine, and all efforts were made to minimize animal suffering. Survival studies: Four-week-old male WT C57BL / 6 mice were treated with 0.2 mg of MARI-5A3 (anti-Ifinarl mAh, Leinco) prior to inoculation with 103 FFU of WT RRV T48 strain in the footpad. The following day, 100 pg of RRV antibody or an isotype control was administered to mice by 5 intraperitoneal inj ection. Mice were observed over the course of 21 days for survival and moribund mice were euthanized. Virological studies: Four-week-old WT C57BL / 6 mice were inoculated with 103 FFU of RRV strain T48 and given 100 pg antibody 24 hpi by intraperitoneal injection. Three days post-infection, the ipsilateral and contralateral gastrocnemius, quadriceps, and ankle tissues were collected as well as the spleen following extensive perfusion with PBS. 0 Logistic curve analysis used to calculate IC so values for neutralization assays. The logistic growth curve the inventors considered for concentration x includes five parameters pi, p2, p3, P4, and Ps. The function follows the following form: f(x) = / ?i + ^2 — / 31 1 + 9x exp where _ 1 9x 1 + exp - x)) is a logistic weighting function varying smoothly between 0 and 1, centered about the 50% reduction point. If P4 and ps are the same sign, then the mean curvature of g was determined by the reciprocal of the mean 2 IA + ft I 2020273365 20 Nov 2020 Pi is the lower asymptote; P2 is the upper asymptote; P3 is inflection point of the function which corresponds to a 50% reduction point; P4 and Ps controls the relative steepness or shallowness of the logistic curve (note that this parameterization does not assume symmetry). 5 Example 2 - Results Isolation of RRV-reactive human mAbs. The inventors isolated a panel of mAbs from two subjects, one with a previous laboratory-confirmed case of RRV that was acquired in Australia in 1987, and the other with a clinical history of childhood infection in Australia in the 1990s. Blood samples were obtained after written informed consent with approval from the Vanderbilt 0 University Medical Center Institutional Review Board from the first donor in 2016 and from the second donor in 2017, and peripheral blood mononuclear cells (PBMCs) were isolated. The inventors transformed B cells with Epstein-Barr virus (EBV) before screening for secretion of RRV-reactive antibodies in cell supernatants through direct virus binding ELISA. They established stable hybridoma cell lines from B cells secreting antibody reactive with the virus and purified 21 5 mAbs after cloning the cell lines by single-cell flow cytometric sorting. All but one of the mAbs isolated were of IgGl subclass, and the antibody clonotypes identified by the recombined antibody variable genes were distinct. Two antibodies, designated RRV-130 and RRV-135, had identical variable (V) gene region sequences, but used a different joining (J) gene in the heavy chain (Table SI). :0 Assessment of mAb binding and neutralization activity. The 21 RRV-reactive mAbs were identified by binding to infectious RRV particles in a direct ELISA. Fifteen of these mAbs had half maximal effective concentration (EC50) values for binding to RRV of less than 100 ng / mL (FIG. 1A). When tested for neutralization against the prototype strain RRV T48 in a focus reduction neutralization test (FRNT), five mAbs had half maximal inhibitory concentration (IC50) 25 values less than 15 ng / mL, indicating highly potent neutralization in cell culture, whereas nine other mAbs had neutralization IC50 values less than 100 ng / mL (FIG. 1A, Table S2). Two distinct neutralization profiles were observed for these mAbs: one group of seven mAbs left a residual fraction of non-neutralized virus with a 60 to 90% maximal reduction of infection (FIG. IB, FIG. SI), whereas the second group of fourteen antibodies completely eliminated virus infection (FIG. 30 IC, FIG. SI). Four antibodies also were tested in neutralization assays using a representative panel 2020273365 20 Nov 2020 of five diverse clinical isolates of RRV and had comparable neutralization potencies compared to the T48 strain (FIG. S2, Table S2). Epitope mapping using alanine scanning mutagenesis and competition-binding assays. To identify the antigenic regions recognized by these neutralizing mAbs, the inventors first 5 performed alanine scanning mutagenesis using cell-surface expression of RRV proteins and flow cytometric screening to identify critical binding residues in the E2 glycoprotein. Their library consisted of the first 300 residues of the E2 protein individually mutated to alanine, with alanine residues mutated to serine. The inventors observed a loss of binding for eight mAbs, with residues spread across the A, B, and C domains, as well as arch region of the E2 protein (FIG. 2A, FIG. 0 S3). RRV-196 had loss-of-binding residues within the A domain alone, whereas RRV-92 and RRV-210 lost binding when residues were changed in the A, B and C domains, as well as arch region, of E2 (FIGS. 2A-B). Seven of the eight mAbs targeted regions within the B domain, and of those, three mAbs had loss-of-binding residues within the B domain alone. Within the B domain, residues 189, 206, and 221 showed decreased binding for two mAbs, and mutation of residue 211 5 resulted in loss-of-binding for six mAbs: RRV-86, RRV-92, RRV-130, RRV-205, RRV-210, and RRV-221 (FIGS. 2A-B). When the inventors mapped these residues onto the surface of the structure of the related CHIKV E1 / E2 heterodimer (PDB 3N42) (Voss et al., 2010), they found that most residues clustered within the surface-exposed region of the viral glycoprotein, with only a few located at the base of the heterodimer subunit in the C domain (FIG. 2C). :0 As another method to distinguish antibody epitopes, the inventors performed a quantitative competition-binding assay using biolayer interferometry (BLI). They used RRV-86 immobilized on Fc-specific anti-human IgG biosensor to capture virus-like particles (VLPs) expressing the full set of structural proteins (C-E3-E2-6K-E1). They then added two antibodies sequentially, and the percent binding of the second antibody in the presence of saturating concentrations of the first 25 antibody was determined. Five out of twenty-one mAbs were excluded from the analysis due to undectable or weak binding to VLPs in this format, or because they did not compete well with themselves in this assay. Antibodies in the panel binned roughly into two competition-binding groups, with seven mAbs in the first group (red box), seven in the second group (blue boxes), and two in an overlapping group (grey boxes) (FIG. 3A). The order of antibody addition made a 30 difference in the competition profile, as in some cases the first antibody blocked binding of the second antibody, but the reverse was not true, as in the case of RRV-200 and RRV-34. This effect 2020273365 20 Nov 2020 may be due in part to steric hindrance mediated by Fc regions in the full-length antibody during binding to the VLP. While there was no correlation between whether mAbs were completely neutralizing or not and their competition group, the inventors did observe a correlation between the inventors’ alanine scanning mutagenesis data and competition data. MAbs in the first 5 competition group (red) showed predominant epitopes within the B domain (green) and C domain (magenta) when overlaid on the CHIKV E1 / E2 trimer, whereas those in the second group (orange) mapped primarily to the A domain (dark blue) and arch regions (grey) (FIG. 3B). Two mAbs had a competition profile that overlapped between the two groups, and additionally, some residues uncovered through the alanine scanning mutagenesis were targeted by mAbs within both 0 competition groups (grey) (FIG. 3B). Mechanisms of virus neutralization. To gain insight into the mechanism(s) of neutralization used by these mAbs, the inventors performed pre- and post-attachment neutralization assays with representative mAbs from each of the competition-binding groups. RRV-19, RRV-133, and RRV-139 were chosen from group 1, and RRV-12, RRV-130, and RRV-5 135 were chosen from group 2. These mAbs have a range of neutralization potencies, and at least one mAb (RRV-12) neutralizes incompletely. In the pre-attachment assay, virus was incubated with antibody at 4°C before addition to Vero cell monolayers, also at 4°C. Virus not attached to the cells and unbound antibody were washed out, and then attached virus was allowed to internalize during a brief incubation period at 37°C. Cell monolayers were stained 18 h later, as in the FRNT. :0 All six mAbs neutralized in the pre-attachment assay, indicating that these mAbs block either cell adherence or entry of virus (FIG. 4A). In the post-attachment assay, which detects effects both on viral entry and on downstream steps such as fusion from the endosome, virus was adsorbed first to cells at 4°C. Excess virus was washed out before mAb was added, also at 4°C. After a brief incubation period at 37°C to allow virus internalization, cells were overlaid with methylcellulose, 25 incubated, and then fixed and stained 18 h later. All mAbs also blocked at post-attachment steps, although post-attachment neutralization was slightly less potent than pre-attachment for RRV-130, RRV-133, RRV-135, and RRV-139 (FIG. 4A). As in the FRNT described previously, RRV-12, the only incompletely neutralizing mAb chosen for further characterization, did not completely eliminate viral foci in either of these mechanistic neutralization assays, leaving a residual fraction 30 of -25% compared to untreated virus. 2020273365 20 Nov 2020 To determine if some of the inhibitory activity in post-attachment neutralization was due to antibody-mediated prevention of RRV fusion to cell membranes after entering the endosome, the inventors performed a fusion from without (FFWO) assay. This assay, which measures fusion of virus with the plasma membrane under low pH conditions, has been used as a surrogate assay 5 for determining antibody inhibition of alphavirus fusion in endosomes (Smith et al., 2015; Pal et al., 2013; Jin et al., 2015). Virus was absorbed first to cells at 4°C before mAbs were added. Subsequently, after removing unbound virus and antibody, cells were pulsed at 37°C in a low-pH medium to promote plasma membrane-mediated viral fusion. Virus that entered the cells was stained with fluorescent antibodies 14 h later and detected by flow cytometry. At a concentration 0 of 10 pg / mL, RRV-133, RRV-130, RRV-135, RRV-139, and RRV-19 significantly reduced virus entry to cells under low-pH conditions (FIGS. 4B-C). RRV-12 did not inhibit fusion, with virus levels comparable to those of the negative control antibodies. Antibodies in both competitionbinding groups inhibited fusion, so inhibition of fusion by mAbs does not seem to correlate with mapping to the A or B domain. 5 Recently, the cell surface protein Mxra8 was identified as a receptor for CHIKV and several other arthritogenic alphaviruses, including RRV, Mayaro, and o’nyong’nyong viruses (Zhang et al., 2018). To determine whether the RRV mAbs can block attachment of virus to this receptor, the inventors performed a competition ELISA in which RRV particles were captured onto the plate, and then mAbs were bound to the virus before addition of a purified recombinant :0 mouse Mxra8-Fc fusion protein. MAbs from each of the competition-binding groups blocked binding of Mxra8-Fc binding to RRV (FIG. 4D). All mAbs that poorly blocked binding to Mxra8 had IC50 values of greater than 100 ng / mL, suggesting that neutralization potency might be related to effectiveness of Mxra8 blocking. However, the inventors did not observe a difference in potency of Mxra8 blocking for those mAbs that did or did not leave a resistant fraction of virus in the 25 neutralization assay. Based on the inventors’ alanine mutagenesis data, the mAbs that blocked binding to Mxra8 contacted residues 60, 66, 69 and 75 in the A domain and residues 172,207,211, and 221 in the arch and B domain. They overlaid these residues (yellow) on the CHIKV E1 / E2 heterodimer along with the known Mxra8 contact residues on E2: 5-6, 18, 26-29, 62-64, 71-72, 74-76, 119-121, 123, 144, 150, 157-160 178-182, 189, 191-193, 212-214, 221-223, 263-265, 30 267 (red) (Zhang et al., 2018; Basore et al., 2019; Song et al., 2019), showing that the footprint 2020273365 20 Nov 2020 for these Mxra8-blocking mAbs indeed was in close proximity to the binding footprint for the Mxra8 receptor (FIG. 4E). Therapeutic activity of mAbs in vivo. The inventors selected ten antibodies with neutralization IC50 values below 100 ng / mL to test for protection in a highly susceptible, 5 immunocompromised mouse model of RRV infection and disease. Four-week old male wild-type (WT) C57BL / 6 mice were treated with 0.2 mg of MARI-5A3 (a blocking anti-Ifnarl mAb) (Sheehan et al., 2006) prior to inoculation with 103 FFU of RRV, and 100 pg of RRV mAb was administered via the intraperitoneal route 24 h after virus inoculation. When given a control mAb for treatment, all mice died after 7 days. In contrast, when given an RRV mAb, mortality was 0 delayed over the course of three weeks (FIG. 5A). The most effective mAb, RRV-19, protected 80% of mice, followed by RRV-139 at 70% protection, and RRV-86, at 60% protection. The inventors did not detect a difference in protection between those mAbs that left a resistant fraction of virus (left) and those that neutralized completely (right), although the two most protective mAbs neutralized completely (FIG. 5A). 5 Since RRV infection in humans is rarely fatal, the inventors tested RRV-19 and RRV-86, representing mAbs from different competition-binding groups, in an immunocompetent mouse model of RRV-induced myositis where infection results in high viral burden in muscles and joint-associated tissues (Morrison et al., 2006). Four-week old male WT C57BL / 6 mice were treated with mAbs 24 hpi with 103 FFU of RRV. The gastrocnemius (calf muscle), ankle, spleen, and :0 quadriceps were harvested 3 dpi and viral RNA burden was measured by qRT-PCR. Although both mAbs significantly reduced viral RNA in all tissues, RRV-19 was more effective in the ipsilateral and contralateral gastrocnemius, as well as the ipsilateral ankle and quadriceps (FIG. 5B). RRV-19 and RRV-86 were equally effective in the contralateral ankle and quadriceps as well as the spleen. While there was less than a 10-fold decrease in viral RNA burden in the ipsilateral 25 ankle, this difference was significant (FIG. 5B). In addition to measuring viral RNA burden in select tissues, the inventor also measured severity of RRV disease in the immunocompetent model using a clinical scoring system. In this study, three-week-old WT C57BL / 6 mice were inoculated with 103 FFU of RRV strain T48 before intraperitoneal administration of 100 pg of RRV-19, RRV-86, or an isotype control mAb at 24 hpi. 30 Mice were then weighed and a clinical score was assigned based on grip strength, gait, and righting reflex, as previously described (Haist et al., 2017). All mice receiving the anti-RRV mAbs were 2020273365 20 Nov 2020 protected from weight loss and clinical disease, as compared to mice given the isotype control (FIG. 6A). In addition, viral RNA was quantified after harvest of the spleen, ipsilateral and contralateral gastrocnemius, quadriceps, and ankle tissues 18 dpi. A significant reduction in viral RNA was observed for administration of all mAbs except for RRV-19 in the contralateral calf and 5 quad (FIG. 6B). 2020273365 20 Nov 2020 Table SI - Antibody variable gene region sequence features for RRV antibodies* Name V-GENE and allele J-GENE and allele D-GENE and allele CDR-IMGT lengths AA JUNCTION RRV 6-HC IGHV3-23*04 F, or IGHV3-23D*02F IG HI 5*01 F, or IGHJ5*02 F (see comment) IGHD6-13*01 F 8.8.11 CANLYISSWYLYW (SEQID NO: 231) RRV 6-LC IGKV3-15*01 F IGKJ1 *01 F 6.3.11 CQQYNDWPPGGTF (SEQID NO: 232) RRV 12-HC IGHV4-31*03 F IGHJ3*02 F IGHD5-24*01 ORF 10.7.15 CARVGGDGNNRDAFDIW (SEQID NO: 233) RRV 12-LC IGLV3-1 *01 F IGU3*02 F 6.3.9 CQAWDSTTGVF (SEQID NO: 234) RRV 19-HC IGHV3-21*01 F IGHI6*02 F IGHD2-15*01 F 8.8.18 CARDDCSGSSCYYYYGMD VW (SEQID NO: 235) RRV 19-LC IGKV2-28*01 F, or IGKV2D-28*01 F IGKJ3*01 F 10.3.11 CMQALQTPRSFTF (SEQID NO: 236) RRV 34-HC IGHV3-7*01 F IGHJ4*02 F IGHD6-19*01 F 8.8.13 CARDFDSSGWFPAYW (SEQID NO: 237) RRV 34-LC IGLV8-61*01 F IGLJ3*02 F 9.3.X CLLYMISVLS#VF (SEQID NO: 238) RRV 49-HC IGHV4-61*01 F IGHJ4*02 F IGHD3-22*01 F 10.7.14 CARGTRGYPQGYPDSW (SEQID NO: 239) RRV 49-LC IGLV3-10*01 F IGLJ3*02 F 6.3.10 CYSTDSSGTPLF (SEQID NO: 240) RRV 86-HC IGHV2-70*01 F IGHJ4*02 F IGHD6-13*01 F 10.7.11 CTGGSSWYVPDYW (SEQID NO: 241) RRV 86-LC IGLV1-44*O1 F IGLJ2*01 F, or IGU3*01 F 8.3.12 CAVWDNSLNGRVVF (SEQID NO: 242) RRV 92-HC IGHV3-15*01 F IGHJ4*02 F IGHD3-10*01 F 8.10.19 CVNEAYYYGSGSYWEYYF DYW (SEQID NO: 243) RRV 92-LC IGLV3-19*01 F IGLJ2*01 F, or IGU3*01 F 6.3.10 CNSRDTSGNHLF (SEQID NO: 244) RRV 130-HC IGHV1- 24*01 F IGHJ2*01 F IGHD3-10*01 F 8.8.21 CTTGSYYHGWGSYSGRN WYFDLW (SEQID NO: 245) RRV 130-LC IGLV3-19*01 F IGLJ2*01 F, or IGU3*01 F 6.3.6 CNSRDSGF (SEQID NO: 246) RRV 133-HC IGHV3-30*03 F, or IGHV3-30*18 F or IGHV3-30-5*01 F IGHJ6*02 F IGHD3-3*02 F 8.8.23 CARDQGLEVAFSQWSHY DYYGMDVW (SEQID NO: 247) RRV 133-LC IGLV2-14*01 F IGLJ2*01 F, or IGU3*01 F 9.3.11 CSSYTSISTSVLF (SEQID NO: 248) 2020273365 20 Nov 2020 RRV 135-HC IGHV1- 24*01 F IGHJ4*02 F IGHD3-10*01 F 8.8.19 CATVAHYHGSDSYYNFYF DFW (SEQID NO: 249) RRV 135-LC IGLV3-19*01 F IGLJ2*01 F, or IGU3*01 F 6.3.12 CTSRDSSSSDLVIF (SEQID NO: 250) RRV 136-HC IGHV3- 15*01 F IGHJ5*02 F IGHD2-8*01 F 8.10.10 CMTESDMTFDPW (SEQID NO: 251) RRV 136-LC IGKV2-28*01 F, or IGKV2D-28*01 F IG KJ 3*01 F 11.3.9 CMQALQTPYTF (SEQID NO: 252) RRV 139-HC IGHV3-23*04F IGHJ6*02 F IGHD4-17*01 F 8.8.16 C ATATTVTYYYYYG M D V W (SEQID NO: 253) RRV 139-LC IGKV2-28*01 F, or IGKV2D-28*01 F IG KJ 3*01 F 11.3.10 CMQALQPPRFTF (SEQID NO: 254) RRV-191 HC IGHV4-38-2*01 F IGHJ6*02 F IGHD2- 21 *02 F 9.7.15 CVRERVGVTSYFGMDVW (SEQID NO: 255) RRV-191 LC IGKV-39*01 F or IGKV1D-39*01 F IGKJ4*01 F 6.8.8 CHQSYTGNTF (SEQID NO: 256) RRV-196 HC IGHV3-15*01 F IGHJ1 *01 F IGHD3-3*01 F 8.8.22 CTTISYYDFWSGHYMGRE EYFQHW (SEQID NO: 257) RRV-196 LC IGLV3-19*01 F IGLJ2*01 F or IGLJ3*01 F 6.3.12 CNSRDSSGDPHVVF (SEQID NO: 258) RRV-199 HC IGHV3-33*01 F, or IGHV3-33*05 or IGHV3- 33*06F IGHJ6*202 F IGHD6-19*01 RRV-199 LC IGLV2-8*01 F IGLJ2*01 F, or IGLJ3*01 F 9.3.11 CSSYADNNNFVVF (SEQID NO: 259) RRV-200 HC IGHV3-21*01 F, or IGHV3-21*02 F IGHJ6*02 F IGHD3-22*01 F 8.8.28 CAREIVSYGDYGDSSGTSK YFYYYYGVDVW (SEQID NO: 260) RRV-200 LC IGKV1-12*O1 F, or IGKV1-12*02, or IGKV1D-12*02F IG KJ 3*01 F 6.3.11 CQQANSFPPGFTF (SEQID NO: 261) 2020273365 20 Nov 2020 RRV-201 HC IGHV3-33*01 F, or IGHV3-33*05 F, or IGHV3-33*06F IG HI6*02 IGHD6-19*01 F 8.8.18 CARDQGQWLVRPGWYG MD VW (SEQ. ID NO: 262) RRV-201 LC IGLV2-8*01 F IGLJ2*01 F, or IGU3*01 F 9.3.11 CSSYADNNNFVVF (SEQ ID NO: 263) RRV-205 HC IGHV3-73*02F IGHJ6*02 IGHD5-12*01 F 8.10.16 CLGNSGYDPEYFYGMDV W (SEQ ID NO: 264) RRV-205 LC IGLV6-57*01 F, or IGLV6-57*02 F IGLJ2*01 F, or IGU3*01 F 8.3.9 CQSYDRSNVVF (SEQ ID NO: 265) RRV-207 HC IGHV4- 34*01 F IGHJ4*02 F IGHD6-13*01 F 8.7.13 CARYVLGSSWPFDYW (SEQ ID NO: 266) RRV-207 LC IGKV1-39*O1 F, or IGKV1D-39*01 IGKJ4*01 F 6.3.9 CQQSSSTPLTF (SEQ ID NO: 267) RRV-210 HC IGHV3- ll*01F IGHJ5*02 F IGHD1- 26*01 F 8.8.16 CARSVMGGTTMGEWFD PW (SEQ ID NO: 268) RRV 210 LC IGLVl-40*01 F IGU2*01 F, or IGU3*01 F 9.3.12 CQSYDSSLSGSVVF (SEQ ID NO: 269) RRV-221 HC IGHV1- 18*01 F IGHJ6*02 F IGHD3-10*01 F 8.8.22 CAREEGITLVRGTSNYYYY GMDVW (SEQ ID NO: 270) RRV-221 LC IGKV2-28*01 F, or IGKV2D-28*01 F IG KJ 2*01 F 11.3.9 CMQALQTPHTF (SEQ ID NO: 271) * - mRNA was isolated from clonal hybridoma cells, and cDNA was synthesized for Sanger automated DNA sequence analysis. The specific gene, allele, CDR length, and V-D and D-J junctions were determined through use of the 1MGT program. 5 2020273365 20 Nov 2020 Table S2 - Summary of neutralization of different RRV strains* RRV strain MAb Neutralization ICso (ng / mL) [95% credible interval] R2 Emax T48 RRV-6 2,294 [509- 12,228] 0.59 66 RRV-12 63 [8.3 - > 2E5] 0.73 70 RRV-19 16 [13-23] 0.92 99 RRV-34 286 [16 - > 2E5] 0.48 61 RRV-49 58 [26- 128] 0.90 99 RRV-86 174 [55 - 636] 0.72 65 RRV-92 11 [2.7 - 57] 0.95 91 RRV-130 5.7 [2.9 - 10] 0.78 101 RRV-133 29 [21 -41] 0.94 101 RRV-135 10 [6.3 - 14] 0.88 93 RRV-136 988 [157->2E5] 0.73 67 RRV-139 47 [14 - 135] 0.80 96 RRV-191 334 [142 -905] 0.79 96 RRV-196 75 [23 - 205] 0.85 96 RRV-199 6.7 [2.8 - 18] 0.86 95 RRV-200 27 [18-42] 0.94 100 RRV-201 49 [21 - 112] 0.86 93 RRV-205 334 70 - 2,288] 0.56 70 RRV-207 1,487 [901 -2,429] 0.92 92 RRV-210 13 [7.8 - 22] 0.87 100 RRV-221 33 [6.8-217] 0.87 90 PW7 RRV-19 12 [8.2 - 16] 0.93 97 RRV-92 18 [8.6 - 43] 0.81 81 RRV-130 4.1 [1.3 - 8.4] 0.77 100 RRV-135 12 [6.9 - 19] 0.85 94 SN11 RRV-19 10 [7 - 14] 0.92 96 RRV-92 17 [H-34] 0.88 80 RRV-130 9.0 [5.9- 13] 0.9 99 2020273365 20 Nov 2020 RRV-135 8.7 [5.9- 13] 0.86 94 PW14 RRV-19 13 [6.9 - 28] 0.65 86 RRV-92 70 [29 - 202] 0.86 74 RRV-130 11 [8.5 - 14] 0.94 96 RRV-135 14 [10-23] 0.89 92 2897601 RRV-19 12 [9.9- 15] 0.95 95 RRV-92 41 [16 - 147] 0.85 79 RRV-130 13 [7.4 - 24] 0.84 98 RRV-135 15 [8 - 38] 0.72 82 O’Regan RRV-19 12 [9.2 - 14] 0.94 94 RRV-92 105 [41 -313] 0.79 81 RRV-130 12 [9.5 - 16] 0.94 97 RRV-135 17 [12-25] 0.94 96 * - The IC50, or concentration that gives a 50% reduction with accompanying 95% credible intervals, is listed along with R2, or percent of the variability explained by the regression fit, and Emax, the estimated percentage maximum neutralization. Table S3 - Primers used for qRT-PCR viral RNA quantification in mice studies* Primer Name Sequence RRVFor GTGTTCTCCGGAGGTAAAGATAG (SEQ ID NO: 272) RRVRev TCGCGGCAATAGATGACTAC (SEQ ID NO: 273) RRV_probe 5' 6-FAM / ACCTGTTTA / ZEN / CCGCAATGGAC ACCA / 3' lABkFQ (SEQ ID NO: 274) * - One-step qRT-PCR was performed using RRV-specific forward and reverse primers in addition to a probe with 6FAM 5' dye. 2020273365 20 Nov 2020 Example 3 - Discussion These studies provide insight into the antibody response for the emerging pathogen RRV, using human mAbs isolated from naturally infected donors. The isolated mAbs recognize epitopes within the E2 glycoprotein, potently neutralize the RRV laboratory prototype strain in addition to 5 five clinical isolates and treat infection in vivo in a mouse model by reducing viral dissemination. The inventors showed that a subset of mAbs neutralize at both pre-attachment and post-attachment stages, indicating that there are multiple mechanisms of neutralization for these mAbs. Additionally, nearly all neutralizing antibodies blocked binding of the receptor Mxra8 to RRV in vitro, and many also inhibited viral fusion with cell membranes. The majority of these mAbs had 0 neutralization IC50 values less than 100 ng / mL, and several exhibited highly potent (< 15 ng / mL neutralizing activity, which is similar in range to the best-in-class human neutralizing antibodies for the related CHIKV (Smith et al., 2015). For nearly half of these RRV mAbs, a 10 to 40% residual fraction of virus was not inhibited in neutralization assays. The molecular basis for this residual fraction of infectious virus remains unclear but could reflect particle heterogeneity due to 5 maturation or incomplete release of the E3 precursor protein (Heidner et al., 1996; Zhang et al., 2011). Through alanine scanning mutagenesis, the inventors discovered multiple epitopes for these mAbs scattered across the A and B domains and the arch region, of the E2 protein. Because their alanine library only consisted of residues within the E2 protein, the inventors did not test :0 whether some mAbs contact the El protein. Two main antigenic regions emerged between residues 60-75 in the A domain of E2 and 206-221 of the B domain. A major antigenic region has been suggested previously for RRV using three murine mAbs (Davies et al., 2000; Vrati et al., 1988). These antibodies were localized to the B domain and the adjacent arch region of the E2 protein, between residues 200 and 262, the position of two N-linked glycosylation sites (Nelson et al., 25 2016). The epitope for one of these mouse mAbs is at position 216 of the B domain, which is within five residues of 221 and 211, two residues that were targeted by two or more of the inventors ’ human mAbs (Vrati et al., 1988). Additionally, residues 206 and 207 within the B domain appeared important for binding in the alanine scanning mutagenesis study. Residue 244, which is close to a mouse mAb epitope at position 246 within the arch region connecting domains B and C, also 30 emerged as a recognition site for one of the inventors’ mAbs. Based on competition-binding studies, the inventors assigned neutralizing antibodies into two major groups with similar profiles. 2020273365 20 Nov 2020 Some asymmetry of competition was present in these groups, and the profiles of two mAbs overlapped between the two groups. This asymmetry may be due to the use of VLPs in competition-binding assays, which better mimic the conformation of the virus than recombinant proteins. While these two competition groups did not correlate perfectly with the inventors’ alanine 5 mutagenesis data, the majority of the mAbs in group 1 corresponded to residues within the B or C domains, whereas those in group 2 mapped mostly to domain A or the arch region between domains A and B. Although the C domain is not surface-exposed, it is probable that residues within this region may stabilize the B domain, since the B domain undergoes a conformational change to uncover the fusion loop on the El protein after virus entry into the endosome (Kielian et al., 2010; 0 Fields and Kielian, 2013; Li et al., 2010). Thus, mutating residues in this “hinge” region of domain C could affect mAb binding to domain B allosterically. Previously, neutralizing CHIKV antibodies have been shown to target analogous sites within the A, B, and arch regions of the E2 protein (Fox et al., 2015; Smith et al., 2015; Jin et al., 2015). The inventors’ results indicate that both the A and B domains also are important antigenic sites for the human neutralizing antibody response directed 5 against RRV. The knowledge of immunodominant sites on the virus recognized by potent neutralizing antibodies to RRV has implications for immunogen design, as there is currently no licensed vaccine available. RRV is thought to have several possible receptors, including aipi integrin, which is nearly universally expressed on adherent cells, and Mxra8, a recently discovered receptor for multiple :0 arthritogenic alphaviruses (Zhang et al., 2018; La Linn et al., 2005). A candidate receptor binding site could span across surface-exposed regions of both the A and B domains, as is hypothesized for Mxra8 (Zhang et al., 2018). The fact that mAbs from both competition groups with epitopes in the A and B domains of the E2 protein inhibited binding to Mxra8 protein, supports this hypothesis. Several regions of the E2 protein that resulted in loss of Mxra8 binding to cell-surface-displayed 25 CHIKV proteins are residues 62-64, 71-72, and 74-76 (Zhang et al., 2018; Basore et al., 2019; Song et al., 2019), which are close to loss-of-binding residues 66, 69, and 75, determined for Mxra8-blocking mAbs RRV-92 and RRV-196. Additionally, residues 207, 211, and 221 in the B domain of the E2 protein, which were revealed in the inventors’ alanine scanning mutagenesis as important for binding of RRV-19, RRV-86, RRV-92, RRV-130, and RRV-221, are in close 30 proximity to residues 212-214 and 221-223 that are additional contact sites for Mxra8 (Zhang et al., 2018; Basore et al., 2019; Song et al., 2019). 2020273365 20 Nov 2020 In addition to attachment / entry inhibition and blockage of binding to Mxra8 receptor, the inventors also observed post-attachment inhibition activity for a subset of mAbs tested, although in most cases, neutralization appeared to be slightly more potent in the pre-attachment assays. During alphavirus infection of a cell under normal conditions, a decrease in pH within the 5 endosome exposes the fusion loop on the El protein, which is usually shielded by the B domain of E2 (Kielian et al., 2010; Fields and Kielian, 2013; Li et al., 2010). While specific alanine scanning mapping data was not obtained for all of the inventors’ fusion blocking mAbs, it is possible that these antibodies, which are from multiple competition-binding groups, stabilize the B domain to prevent uncovering of the fusion loop. 0 Therapeutic studies in mice with an acquired deficiency of type IIFN signaling revealed that all mAbs increased survival of the mice to some degree, and administration of each of three mAbs resulted in a greater than 50% survival rate. In a separate experiment using WT mice, analysis of total amount of viral RNA present in tissues showed that both mAbs tested reduced viral RNA burden significantly in all tissues examined. The least reduction of viral RNA was 5 observed in the ipsilateral ankle as compared to the other tissues, suggesting that therapeutic administration of mAbs prevents spread through the bloodstream but does not necessarily prevent local spread or rapidly clear infection at or near the site of inoculation. As combination mAb therapy has proven efficacious for CHIKV (Pal et al., 2013), it is possible that pairing antibodies such as RRV-19 and RRV-86, which are from different competition-binding groups, could reduce :0 viral burden to a greater degree and prevent emergence of resistance. Additionally, since these mAbs have therapeutic benefit, they likely will have a protective effect when administered prophylactically, as was seen with CHIKV mAb studies (Smith et al., 2015; Pal et al., 2013; 2014). Further study is warranted with these RRV mAbs to understand how they could best be used for treatment or prevention of the disease and to inform rational vaccine design. 25 Example 4 - Materials and Methods Data and Code Availability. The cryoEM structures are deposited at the Electron Microscopy Data Bank (EMDB). The ID numbers of Fab bound structures are RRV: EMD 21473 PDB 6VYV, CHIKV: EMD 21496 PDB 6W09, MAYV: EMD 21509 PDB 6WIC and the native 30 is MAYV: EMD 21532 PDB 6W2U. All other data needed to evaluate the conclusions in the paper 2020273365 20 Nov 2020 are present in the paper or the Supplemental Information. The CHIKV antibodies in this study are available by Material Transfer Agreement with Vanderbilt University Medical Center. Source of human B cells. The RRV-immune subject was a 50-year old woman living in the U.S. who had a history of laboratory-confirmed infection in Australia in 1987, as described in 5 Powell et al (in submission). Peripheral blood was obtained from this subject in the U.S. in 2015 (28 years after infection) after written informed consent with approval from the Vanderbilt University Medical Center Institutional Review Board. Peripheral blood mononuclear cells (PBMCs) were isolated using density gradient centrifugation on Ficoll and were cryopreserved in liquid nitrogen until used in the experiments. The other blood sample was collected in 2015 from 0 an adult subject in Colombo, Sri Lanka with serological evidence of prior CHIKV infection (>1 / 5,000 serum neutralizing antibody titer to CHIKV using virus replicon particles based on the Sri Lankan strain SL15649 (Morrison et al., 2011). CHIKV infection was common in Colombo during the years 2006 to 2008. The studies in Sri Lanka were approved by the Ethics Review Committee of the Medical Faculty, University of Colombo, Sri Lanka [serving as the National 5 Institutes of Health (NIH)-approved Institutional Review Board (IRB) for Genetech Research Institute] and the IRB of Vanderbilt University Medical Center. The blood sample was a discarded buffy coat from a routine blood donation at the National Blood Center in Colombo, Sri Lanka. The sample was de-identified before removal from the National Blood Center. PBMCs and a plasma sample were separated at Genetech Research Institute by density gradient centrifugation and then :0 cryopreserved and stored on liquid nitrogen until transfer to Vanderbilt using a liquid nitrogen dry shipper. Cell lines. Vero (monkey, sex unspecified), cell lines were obtained from the American Type Culture Collection (ATCC CCL-81). Vero cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (ThermoFisher Scientific) supplemented with 5% fetal bovine serum (FBS; 25 HyClone) at 5% CO2, 37°C. BHK21 cell lines were obtained from (ATCC CCL-10) and cultured in 10% FBS (Sigma) and Minimal Essential Media (MEM, ThermoFisher Scientific). Viruses. Ross River virus strain T48, chikungunya virus strain 181 / 25, O’nyong’nyong virus strain MP30, Mayaro virus strain TR VL-4675, Sagiyama virus strain M6-Mag 132, and Getah virus strain MM 2021 were obtained from the World Reference Center for Emerging 30 Viruses and Arboviruses at UTMB. 2020273365 20 Nov 2020 Mouse models. Three-week-old male and female WT C57BL / 6J were used for clinical disease model studies and four-week-old male WT C57BL / 6J mice were used for acute virological and survival studies. Mice were housed in microisolator cages and provided food and water ad libitum. All animal experiments and procedures were carried out in accordance with the 5 recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381-01). Injections were performed under anesthesia that was induced and maintained with ketamine hydrochloride (80 mg / kg) and xylazine (15 mg / kg), and all efforts were made to minimize animal 0 suffering. Generation of human hybridomas. Approximately 107 cryopreserved PBMCs were thawed and transformed with Epstein-Barr virus obtained from the supernatant of B95.8 cells in a suspension also containing a Chk2 inhibitor, cyclosporin A, and CpG, and the mixture was plated in a 384-well cell culture plate. After 7 days, transformed cells were transferred to 96-well plates 5 containing a feeder layer of irradiated cells that were PBMCs obtained from discarded leukofiltration devices (Nashville Red Cross). After an additional 5 days, the supernatants of expanded cells were screened for the presence of RRV- or MAYV-reactive antibodies using an enzyme-linked immunosorbent assay (ELISA), described below. Transformed B cells from wells containing supernatant with antibodies reactive to RRV or MAYV were fused to the HMMA2.5 :0 non-secreting myeloma cell line using an established electrofusion technique (Smith and Crowe, 2015). Subsequently, the resulting mixture of hybridoma cells was resuspended in medium containing hypoxanthine, aminopterin, thymidine and oubain to select for hybrids of B cells and myeloma cells. Virus ELISA screen. RRV strain T48 was propagated in monolayer cultures of Vero cells. 25 The cell line was authenticated and tested monthly during culture for the presence of mycoplasma and found to be negative in all cases. Infected cell supernatants containing virus with a titer of approximately 5 x 106 FFU / mL were harvested when cytopathic effect was maximal, filtered through a 0.45 pm filter, then frozen and stored at -80°C until use. 384-well ELISA plates were directly coated with 25 pL of RRV strain T48 harvested directly from cell supernatants, diluted 30 1:100 in PBS, and incubated for 1 h at 37°C. Plates were washed 5 times with PBS containing Tween (PBST) using an EL406 combination washer dispenser instrument (BioTek) and blocked 2020273365 20 Nov 2020 for 1 h at room temperature with 5% milk powder and 2% goat serum, diluted in PBS. After washing 2 times with PBST, 25 pL of supernatants from hybridoma cultures or EBV-transformed cell lines were added to plates, which then were incubated for 1 h at room temperature. Plates were washed 4 times, and 25 pL of goat anti-human alkaline phosphatase-conjugated secondary 5 antibodies (Meridian Life Science) diluted 1:5,000 in PBS was added to plates. After a 45-min incubation period, plates were washed 5 times and 25 pL of alkaline phosphatase substrate tablets (Sigma) diluted in Tris buffer with IM MgCh was added. Optical density was read at 405 nm after 1 h using a Biotek plate reader. BLI competition-binding studies. An Octet RED96 BLI instrument (Pall ForteBio) was 0 used to perform epitope binning studies using competition binding. Anti-Penta-HIS (HISIK) biosensor tips were used to immbolize either CHIKV or MAYV E2 protein containing a hexahistidine tag. After measuring the baseline signal, the biosensor tips were immersed into wells containing mAb for 2 min. After another baseline measurement, biosensors then were transferred to wells containing a first mAb at a concentration of 50 pg / mL for 5 min, before immersion in a 5 solution containing a second mAb, also at a concentration of 50 pg / mL for 5 min. The percent competition of the second mAb in the presence of the first mAb was determined by comparing the maximal signal of binding for the second mAb in the presence of the first antibody to the maximal signal of that mAb alone when separately tested uncompeted. Competition was defined by reduction of the maximal binding score to <25% of un-competed binding. An intermediate :0 competing mAb was identified when a 25 to 50% reduction in maximal binding was observed. Hybridoma cell line clone production. Two weeks after fusion, hybridoma cell lines were cloned by single-cell sorting using fluorescence-activated cell sorting on a BD FACSAria™ III sorting cytometer with aerosol containment, in the Vanderbilt University Medical Center Flow Cytometry Core. Approximately 2 weeks later, an ELISA screen was performed, and wells 25 containing cloned cells secreting antibodies reactive to RRV or MAYV were selected for expansion. Purification of mAb IgG protein. Clonal cells secreting mAbs were grown in 75 cm2 flasks to 70% confluency in hybridoma growth medium (ClonaCell-HY medium E from STEMCELL Technologies, 03805). The cells were expanded equally to four 225 cm2 flasks for 30 antibody expression in serum-free medium (GIBCO Hybridoma-SFM, Invitrogen, 12045084). The supernatant was harvested after 3 weeks and purified by affinity chromatography using protein G 2020273365 20 Nov 2020 columns (GE Life Sciences, Protein G HP Columns). Purified IgG from hybridoma cell expression was used for all assays. Focus reduction neutralization test. Vero cells (American Type Culture Collection (ATCC) Cat. No. CCL-81) were seeded in 96-well plates at 30,000 cells / well the day before use. 5 Antibodies were diluted in 96-well U-bottom plates, with a 1:3 dilution series across the plate and a virus-only control in the left column. A solution containing infectious virus (RRV, MAYV, CHIKV, ONNV, SAGV, or GETV) was diluted to a concentration of 100 focus-forming units (FFU) / mL and mixed 1:1 by volume in a 96-well plate with antibody suspensions. The virus / antibody mixture was incubated for 1 h at 37°C before transfer to Vero cell monolayer 0 cultures. Infection was allowed to proceed for 1 h and then 1% methylcellulose overlay prepared in DMEM with 2% FBS was added to cells. After 18 h, 1% paraformaldehyde (PFA) prepared in PBS was used to fix cells for at least one hour. Plates were washed 3 times with PBS before addition of a 1:6,000 dilution of anti-RRV mouse ascites fluid (ATCC Cat. No. VR-1246AF), anti-MAYV mouse ascites fluid (ATCC Cat. No. V-507-701-562) or anti-CHIKV mouse ascites fluid 5 (ATCC Cat. No. V-548-701-562), prepared in cell permeabilizing buffer (PBS with 0.1% saponin and 0.1% bovine serum albumin). After incubation for at least 2 h at room temperature, plates were washed 3 times in permeabilizing buffer, and anti-mouse HRP-conjugated secondary (Kirkegaard & Perry Laboratories; KPL) was added at a 1:2,000 dilution in permeabilizing buffer. Plates were incubated for 1 h at room temperature and washed 3 times before addition of TrueBlue Peroxidase :0 substrate (KPL) for 20 min. Plates were rinsed with dH2O, and then plates were imaged with an ImmunoSpot® plate reader (Cellular Technology Limited (CTL)). Foci were counted with BioSpot 5.1 software (CTL), and the percent relative infection was calculated based on the virus-only control. Triplicate tests were performed for each antibody, and the results were averaged. Entry and fusion inhibition, and foci reduction assays. Entry inhibition was performed 25 as a variation of the FRNT. As described above, Vero cells were seeded in 96-well plates at 30,000 cells / well the day before use. Virus and antibody at a concentration of 20 pg / mL were mixed 1:1 and incubated together for 1 h at 37°C before transfer to Vero cell monolayer cultures. Infection was allowed to proceed for 1 h and importantly, antibody and virus were removed with three washes in medium. A 1% methylcellulose overlay prepared in DMEM with 2% FBS was then 30 added to cells and staining was performed similarly to the FRNT. Plates were imaged with an ImmunoSpot® plate reader (Cellular Technology Limited (CTL)). Foci were counted with 2020273365 20 Nov 2020 BioSpot 5.1 software (CTL), and the percent relative infection was calculated based on the virus-only control. Triplicate tests were performed for each antibody and each virus, and the results were averaged. A fusion from without (FFWO) assay was performed in which Vero cells were seeded at 5 30,000 cells / well in 96-well plates the day before use in the assay. Cells were washed once with binding medium (RPMI 1640, 0.2% BSA, 10 mM HEPES pH 7.4, and 20 mM NH4CI) at 4°C, and incubated for 15 min at 4°C. The T48 strain of RRV was concentrated to 108FFU / mL using 100 kDa centrifugal filters (Amicon) Centricon. Virus was prepared in binding medium and added to cells at an multiplicity of infection (MOI) of 15 for 1 h at 4°C. Any remaining free virus was 0 removed with two washes in binding medium. Antibodies were prepared in DMEM containing 2% FBS at 10 pg / mL concentrations and added to cells for 1 h at 4°C. Antibody was removed and fusion with the plasma membrane was initiated by the addition of fusion media (RPMI 1640, 0.2% BSA, 10 mM HEPES, and 30 mM succinic acid at pH 5.5) for 2 min at 37°C. Binding medium (RPMI 1640, 0.2% BSA, 10 mM HEPES at pH 7.4) was used in place of low pH fusion medium 5 in controls wells to ensure that virus entry into cells only occurred due to pH-dependent plasma membrane fusion. After a 2-min incubation, medium was removed and cells were incubated in DMEM supplemented with 5% FBS, 10 mM HEPES, and 20 mM NH4CI (pH 7.4). Fourteen hours later, cells were detached with trypsin, fixed with 1% PFA in PBS for 1 hour, and permeabilized with 0.1% saponin detergent solution. For staining prior to flow cytometry analysis, cells were :0 incubated sequentially with RRV mouse ascites fluid (1:6000 dilution ATCC Cat. No. VR-1246AF) for 1 h and PE conjugated goat anti-mouse IgG secondary antibody for 1 h (ThermoFisher). Cells were analyzed on BD Fortessa flow cytometer with FlowJo software. An FRNT was performed in which antibody was added at a concentration of 20 pg / mL to the methylcellulose semisolid overlay. Virus first was allowed to infect cells for 1 h at 37°C before 25 addition of antibody in the overlay. Staining was performed 18 h later, as in the FRNT. A variation of this assay also was performed in which antibody was added after viral infection of cells for 1 h at 37°C. Virus was washed out with 3 washes in medium, and mAb at a concentration of 20 pg / mL was added to cells without the addition of methylcellulose. Images were taken post-staining using the CTL reader. 30 Virus purification and cryo-EM. RRV, CHIKV, and MAYV were propagated in BHK21 cell cultures. For each purification, approximately 2 x 108 BHK21 cells were inoculated with a 2020273365 20 Nov 2020 MOI of approximately 0.1. Infected cell supernatant medium was collected between 24 and 36 h after inoculation, and was clarified by centrifugation at 2,744 x g for 30 min at 4°C. Virions were concentrated through a 28% sucrose cushion in TNE buffer (50 mM Tris pH 7.4, 200 mM NaCl, 1.0 mM EDTA) by ultra-centrifugation at 178,305 x g for 2 h at 4°C. Particles were resuspended 5 in residual supernatant by rocking gently for 1 h at room temperature. Virus particles were concentrated further and purified based on size and density with a 5 to 55% continuous OptiPrep gradient (Sigma, catalog number D1655) and ultracentrifugation was performed at 178,305 x g for 2 h at 4°C. The virus-containing band was extracted, buffer exchanged, and concentrated into TNE buffer with an Amicon Ultra-4 100 kDa molecular weight cutoff centrifugal filter (Millipore-0 Sigma, catalog number Z648043-24EA) to a final volume of 0.05 mL. Fab fragments of mAb RRV-12 IgG were generated with the Pierce Fab Preparation Kit (ThermoFisher, catalog number 44985) according to the manufacturer’s recommendations. Purified virus and Fab fragment complexes were incubated at a 2:1 molar ratio of Fab to E2 glycoprotein overnight at 4°C. Virus-Fab samples and native MAYV samples were flash frozen on Ultrathin carbon Lacey grids, 400 5 mesh copper (Ted Pella, catalog number 01824) in liquid ethane with a Gatan CP3 cryo-plunge. Virus-Fab complexes and native MAYV were imaged with a ThermoFisher Scientific Titan Krios, magnification 18,000x, and a pixel size of 1.6A for RRV and 0.81 A for CHIKV, and both native and Fab bound MAYV. Images were collected with a Gatan K2 Summit direct electron detector and Leginon software package (Suloway et al., 2005). Micrographs were processed with :0 MotionCor2 (Zheng et al., 2017), and the CTF function was calculated with CTFFIND4 (Rohou and Grigorieff, 2015). Template-based particle selection was done with FindEM (Roseman, 2004), and non-reference 2D classification was performed with RELION. The final particle numbers used in single particle reconstructions were as follows: 9,559 RRV-Fab, 10,395 CHIKV-Fab, 18,410 MAYV-Fab and 20,592 native MAYV. Single particle reconstructions were performed according 25 to the ‘gold standard’ method using jspr (Guo and Jiang, 2014). Briefly, particles were divided equally into two randomly selected independent particle sets. Two de novo models were generated from random sets of 1,000 particles. One de novo model was assigned to one of the particle sets. The other de novo model was assigned to the other particle set. Each independent dataset was refined iteratively assuming icosahedral symmetry. Refinement resulted in two independent 30 models that converge on the same structure. Following corrections for astigmatism, elliptical distortion, defocus and the masking of the disordered nucleocapsid core, the final models of each 2020273365 20 Nov 2020 independent data set were combined into a single final model. The average resolution of each map calculated at 0.143 from FSC curves was 6.3A for RRV, 5.3A for CHIKV, 5.3A for MAYV, and 4.8 A for native MAYV. Based upon resolution values between 5-6A for all three of the Fab bound virus density 5 maps, the alpha carbon backbone of the alphavirus El, E2 structural glycoproteins and the Fab model CHK-265 (Fox et al., 2015) were used to identify and interpret the maps. The crystal structure of the CHIKV E1 / E2 dimer, RCSB PDB 3N42, (Voss et al., 2010) was used to analyze the CHIKV Fab-bound model. Homology models of both RRV and MAYV El and E2 glycoproteins generated with I-TASSER (Roy et al., 2010; Yang et al., 2015; Zhang et al., 2008), 0 were used to analyze the RRV and MAYV Fab-bound models. The alpha carbon backbone of the RRV and MAYV El and E2 structures were aligned to the alpha carbon backbone of the CHIKV El and E2 crystal structures. The RMSD calculated in PyMOL for each alignment is 1.6 A3 for El RRV:CHIKV and 2.0 A3 for E2 RRV:CHIKV. The RMSD values for MAYV El and E2 aligned to CHIKV El and E2 are 1.6 A3for El and 2.1 A3 for E2. The alpha carbon backbone of a model 5 of both the constant and variable domains of Fab CHK-265 was fitted to all three virus-Fab complexes. Homology models of the variable light (VL) and variable heavy (VH) domains of RRV-12 were generated from the primary amino acid sequence of each domain with I-TASSER. In order to confirm Fab CHK-265 was a suitable substitute for RRV-12, the alpha carbon backbone of the RRV-12 variable domains were aligned to the Fab CHK-265 alpha carbon variable domain :0 backbone with PyMOL. The RMSD is 0.94A3 for the VH domain alignment and 0.51 A3 for the VL domain alignment. The constant region of RRV-12 was not available at the time of this study. The protein structures of E1, E2, E3 and Fab were fit to the density maps sequentially using Chimera (Pettersen et al., 2004) and EMfit (Rossmann et al., 2001). Based upon the domain structures defined for the CHIKV E1 / E2 dimer crystal structure (Voss et al., 2010), El was fit as 25 a three-domain structure: domains I, II, and III, and E2 was fit as a four-domain structure using domains A, B, C and P-ribbon. Fab CHK-265 was fit as a four-domain structure using heavy chain constant and variable domains, and light chain constant and variable domains. Fitting was performed assuming icosahedral symmetry for a T= 4 virus particle. Goodness of fit of each domain of each protein was analyzed by average density heights, sumf, at each T number 1-4 and 30 average sumf value for all T numbers. Each fitting produced a difference map and coordinates of the protein structure’s position relative to the density. The backbone of CHIKV E3 structure was 2020273365 20 Nov 2020 positioned in the CHIKV RRV-12 bound density map using a backbone E2-E3 structure from PDB 6NK7 aligned to the EMfit CHIKV E2 structure with Chimera and Coot. The RMSD, calculated in PYMOL, of the E2 region of the E2-E3 structure aligned to the CHIKV density map is 1.6A3. Using the fitted coordinates of the Fab and E2 relative to one another for RRV and MAYV and E2 5 and E3 for CHIKV, residues of E2 for RRV and MAYV and residues of E2 and E3 for CHIKV located 6A or less from the Fab structure were identified with PyMOL. The residues in this region of the E2 B domain were mapped to the surface of each of the three viruses with RIVEM (Xiao and Rossmann, 2007) and predicted to be the epitope. The position of Mxra8 was mapped to the RRV-12 bound structures of RRV, MAYV, and 0 CHIKV based upon its position in the asymmetric unit in PDB 6NK7 and EMDB 9395 (Basore et al., 2019). A combined E2, E3, and Mxra8 model was extracted from the asymmetric unit of the CHIKV virus structure bound with Mxra8. The combined structure was converted to backbone atoms only with PyMOL. The position of Mxra8 from that virus structure was mapped to the asymmetric unit of RRV-12 bound viruses RRV and MAYV relative to CHIKV with Chimera, 5 PyMOL, and COOT. An asymmetric unit of each virus with both Mxra8 and RRV-12 bound was generated and used as the template for determining and mapping the residues of the virus surface within 6A of either the Fab or Mxra8 with RIVEM. ELISA-based Mxra8-Fc competition-binding assay. RRV-12 (2 pg / mL) was diluted in PBS and immobilized onto a 384-well ELISA plate before incubation for 1 h at 37°C. The plate :0 was washed four times with PBS containing Tween (PBST) using an EL406 combination washer dispenser instrument (BioTek) and blocked for 1 h at room temperature with 5% milk powder and 2% goat serum, diluted in PBS. RRV, MAYV, or CHIKV were diluted to approximately 107 FFU / mL in PBS and 25 pL per well was added for 1 h at room temperature. After washing five times with PBST, RRV mAbs were diluted to 20 pg / mL in PBS and 25 pL of mAb was added to 25 each well, except for control wells where just PBS was added. Blocking mAbs were incubated for 30 min at room temperature and 25 pL of Mxra8-Fc (mouse Fc region) (Zhang et al., 2018) fusion protein at a concentration of 10 pg / mL was then added to each well. After incubation at room temperature for an hour, the plate was washed four times with PBST and 25 pL per well of a goat anti-mouse HRP-conjugated anti-mouse Fc secondary antibody (SeraCare) was added at a 1:2,000 30 dilution. After five washes with PBST, plates were developed with TMB Substrate (ThermoFisher Scientific) and the reaction was stopped with H2SO4. Absorbance was read at 450 nm with a Biotek 2020273365 20 Nov 2020 plate reader. A similarly prepared human mAb specific for Zika virus (ZIKV-117 (Sapparapu et al., 2016) was included as a negative control antibody. Titration curves for antibody blockage of Mxra8 were generated similarly. Mouse studies. Survival studies. Four-week-old male WT C57BL / 6J mice were treated 5 with 0.2 mg of MAR1-5A3 (anti-Ifnarl antibody) prior to inoculation with 103 FFU of WT RRV T48 strain in the footpad. The following day, 100 pg of RRV antibody or an isotype control antibody to an unrelated viral target was administered to mice by intraperitoneal injection. Mice were observed over the course of 21 days for survival and moribund mice were euthanized. Virological studies. Four-week-old male WT C57BL / 6J mice were inoculated with 103 0 FFU of RRV strain T48 or MAYV strain BeH407 and then 24 hours post-infection were given 100 pg antibody by intraperitoneal injection. Three days post-infection, the ipsilateral and contralateral gastrocnemius and quadriceps muscles, and ankle tissues were collected as well as the spleen following extensive perfusion with PBS. RNA was isolated from tissues using the RNeasy mini kit (Qiagen). Viral RNA was quantified by qRT-PCR using the TaqMan RNA to Ct one-step kit 5 (Applied Biosystems) with RRV nsp3 specific primers (Forward: 5'- GTG TTC TCC GGA GGT AAA GAT AG -3', Reverse: 5'- TCG CGG CAA TAG ATG ACT AC -3') and probe (5'- / 56-FAM / ACC TGT TTA / ZEN / CCG CAA TGG ACA CCA / 3IABkFQ / -3') or MAYV specific primers and probe (Earnest et al., 2019) and compared to RNA isolated from viral stocks as a standard curve to determine FFU equivalents. :0 Clinical scoring studies. Three-week-old male and female WT C57BL / 6J mice were inoculated with 103 FFU of RRV strain T48 and then 24 hpi were given 100 pg antibody by intraperitoneal injection. Mice were weighed and assigned a clinical score based on grip strength, gait, and righting reflex, as previously described (Haist et al., 2017). Mice were scored blinded and as follows: 0, no disease; 1, mild defect in ipsilateral hind paw gripping; 2, mild defect in 25 bilateral hind paw gripping; 3, bilateral loss in hind paw gripping; 4, bilateral loss in hind paw gripping with moderate hind limb weakness, observable mild altered gait, and difficulty or failure to right self; 5, bilateral loss in hind paw gripping with severe hind limb weakness, moderate altered gait, and loss of righting reflex; 6, bilateral loss in hind paw gripping with severe hind limb weakness, severely altered gait with possible dragging hind paw, and loss of righting reflex; 7, 30 moribund. No mice received a score of 7 throughout the course of the experiment. Eighteen days post-infection, the spleen, ipsilateral and contralateral gastrocnemius, quadriceps, and ankle tissues 2020273365 20 Nov 2020 were collected following extensive perfusion with PBS. Viral RNA was quantified as described above. Quantification and Statistical Analysis. Statistical analyses are described in the figure legends. All analyses were performed using Prism software (GraphPad Software). For 5 quantification of viral RNA in RRV and MAYV WT mouse models, statistical analysis was performed using a one-way ANOVA with a Dunnett’s post-test comparing each group to the isotype control (**p < 0.01, ***p < 0.001, ****p < 0.0001). Two independent experiments were performed, with ten mice per antibody for each group. For clinical disease studies in mice, two independent experiments were performed, with a total of n=7-8 mice in each antibody group. 0 Statistical analysis was performed using a student’s t-test of area under the curve analysis (****p < 0.0001) for clinical disease scoring, and a Mann Whitney test (*p < 0.05, **p < 0.01, ***p < 0.001) for analysis of viral RNA. For the lethal challenge immunocompromised RRV mouse model, two independent experiments were performed, with n=10 mice per antibody for each group, and statistical analysis was performed using a log rank test with Bonferroni correction, p = 0.0057. 5 For mechanistic assays determining reduction in foci number and size due to RRV-12, three independent experiments were performed with triplicate samples in each experiment. A oneway ANOVA with Kruskal-Wallis post-test was used for statistical analysis, with mean±S.D. compared to a ZIKV-117 control (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). :0 Example 5 - Results Isolation of human mAbs with broad cross-reactivity for multiple alphaviruses. The inventor isolated a panel of human mAbs from two subjects. The first subject had a history of a laboratory-confirmed case of RRV that was acquired in Australia and the second subject came from Colombo, Sri Lanka with serological evidence of prior natural CHIKV infection. The 25 inventor screened supernatants of Epstein-Barr virus (EBV) transformed B cells from these donors for direct binding to RRV or MAYV by ELISA. B cells that secreted antibody reactive with either RRV or MAYV were fused to a myeloma line to establish stable hybridoma cell lines, which then were cloned through single cell flow cytometric sorting. Binding and neutralization profiles for mAbs. RRV-12, which was isolated from cells 30 from the RRV-immune subject, and five mAbs isolated from the CHIKV-immune subject, were tested for binding and neutralization of six alphaviruses: CHIKV, RRV, ONNV, MAYV, GETV, 2020273365 20 Nov 2020 and SAGV, chosen based on close evolutionary distance and virus availability (FIG. S4 and FIG. S5). Each of the six mAbs studied was genetically distinct from the others (Table S4). Binding was tested with both direct virus and protein ELISAs using CHIKV and MAYV E2 proteins. While most half maximal binding (EC50) values were between 4 and 100 ng / mL for the virus ELISAs, 5 the mAbs bound less well to recombinant soluble forms of the viral proteins, with EC50 values ranging from 27 to 1,259 ng / mL (Table A). Notably, mAbs did not bind to ONNV in ELISA, although each of the mAbs neutralized this virus (Table A, FIGS. 7A-B and FIG. S6). The inventor used a focus reduction neutralization test (FRNT) to assess more quantitatively the inhibitory activity of mAbs against these six viruses, and found reasonable correspondence between binding 0 and neutralization activity, as measured by half maximal inhibitory concentration (IC50). However, whereas CHKV-70 bound to CHIKV, MAYV, and RRV in a virus ELISA, it did not neutralize these viruses efficiently (Table A and FIGS. 7A-B). As described previously (Heidner et al., 1996; Zhang et al., 2011), some mAbs were unable to neutralize infection completely and left a resistant fraction of infectious virus even when tested at high concentrations (FIG. 7B and Table A). In 5 general, ONNV was the most potently neutralized, with only a small amount of unneutralized virus remaining (FIG. 7B and Table A). Biolayer interferometry competition-binding assays. To determine if these crossreactive mAbs recognized a similar antigenic site, the inventor performed competition-binding biolayer interferometry (BLI) assay using recombinant protein containing a histidine tag. He first :0 immobilized either CHIKV E2 or MAYV E3E2 recombinant protein on Anti-Penta-HIS (HIS 1K) biosensors before adding two antibodies sequentially. The percent binding of the second antibody in the presence of saturating concentrations of the first antibody was compared to non-competed binding. As expected, each antibody competed with itself. A binding value of less than 25% was considered completely blocking, whereas values between 25 and 50% were considered partially 25 blocking. CHKV-66 was excluded from the analysis because it did not bind avidly enough to E2 protein to assess competition. Virtually all of the cross-reactive mAbs competed for binding to a common antigenic site on CHIKV and MAYV E2 protein (FIG 8A). Blockade of Mxra8 binding. Recently, mAbs against multiple alphaviruses have been shown to block binding to the Mxra8 receptor (Basore et al., 2019; Zhang et al., 2018). To begin 30 to determine if the cross-reactive human mAbs also blocked attachment to the Mxra8 receptor, the inventor performed a competition-binding ELISA with three of the viruses, RRV, MAYV, and 2020273365 20 Nov 2020 CHIKV. Viral particles were captured onto an ELISA plate, and mAbs were allowed to attach to virus before the addition of purified recombinant mouse Mxra8-Fc fusion protein. At a concentration of 10 pg / mL, RRV-12 and CHKV-70 substantially inhibited each of the three viruses from binding to Mxra8-Fc protein, as compared to a control antibody (FIG. 8B). In 5 comparison, CHKV-77 reduced Mxra8-Fc binding only slightly. The inventor also performed titration curves to test various concentrations of mAb and found that RRV-12 and CHKV-70 maximally blocked binding of RRV to Mxra8-Fc protein at a concentration of ~2 pg / mL, whereas for CHIKV, maximal inhibition occurred at < 1 pg / mL, and for MAYV, maximal inhibition was observed at a higher concentration of ~7 pg / mL (FIG. 6C). All mAbs tested more potently blocked 0 Mxra8 binding to CHIKV, as evidenced by IC50 values and inhibition curves (FIG. 8D). RRV-12 mechanism of neutralization. The inventor chose one of the receptor-blocking mAbs for further testing to gain insight into the mechanism of neutralization. To determine if RRV-12 blocked a step in the viral entry pathway, he performed a variation on the FRNT in which virus was incubated with antibody at 37°C before addition to Vero cell monolayers, also at 37°C. 5 Virus and antibody then were removed from cells with three washes before addition of a methylcellulose semisolid overlay. Eighteen hours later, the overlay was removed and cell monolayers were stained for viral antigen. Entry of RRV, MAYV, CHIKV, SAGV, GETV, and ONNV was reduced significantly compared to the isotype control mAb (FIG. 9A). The inventor then quantified viral foci size using another variation on the FRNT in which antibody was added :0 directly to the methylcellulose layer after cells were incubated with virus at 37°C. When an ImmunoSpot® plate reader was used to calculate viral foci area after staining, the inventor found that RRV-12 significantly reduced foci size for each of the viruses except ONNV (FIGS. 9B-C). In the absence of the methylcellulose overlay, viral spread occurred more substantially in the presence of the control antibody, whereas only individual antigen-positive cells were observed 25 when RRV-12 was applied (FIG. 9C, right). To further probe the mechanism of neutralization, he evaluated the inhibitory activity of RRV-12 against RRV, in pre- and post-attachment assays. In the pre-attachment assay, virus was incubated with antibody at 4°C before addition to Vero cell monolayers, also at 4°C. Unbound virus and antibody were washed out, and attached virus was allowed to internalize during a brief incubation period at 37°C. The post-attachment assay was 30 performed similarly, except excess virus was washed out before mAb was added, also at 4°C. For both assays, after virus internalization, cells were overlaid with methylcellulose, incubated, and 2020273365 20 Nov 2020 then fixed and stained 18 h later. RRV-12 blocked at both pre- and post-attachment steps (FIG. 9D). While the pre-attachment inhibition results supported the finding that RRV-12 blocks viral binding to Mxra8, the inventor next tested if the observed post-attachment blockade could include steps downstream from entry, such as fusion. He accomplished this testing by performing a fusion 5 from without (FFWO) assay, which has been used previously to measure alphavirus fusion with the plasma membrane under low pH conditions as a surrogate assay for endosomal fusion (Jin et al., 2015; Pal et al., 2013; Smith et al., 2015). Virus was absorbed first to cells at 4°C before mAbs were added. After removing unbound virus and antibody, cells were pulsed at 37°C in a low-pH medium to promote plasma membrane-mediated viral fusion. Virus that entered the cells was 0 stained with antibodies 14 h later and detected by flow cytometry. At a concentration of 10 pg / mL, RRV-12 did not inhibit fusion, with virus levels comparable to those of the negative control antibodies (FIG. 9E). This result indicates that attachment, entry, and viral spread are the most likely mechanisms of inhibition used by RRV-12. RRV-12 targets a partially conserved E2 B domain epitope. To gain structural insight 5 into the cross-reactivity of RRV-12, Fab fragments of RRV-12 were bound to RRV, CHIKV, or MAYV virions and analyzed by cryo-EM and single-particle reconstruction. Cryo-EM micrographs of each virus incubated with Fab RRV-12 demonstrated intact particles suitable for further analysis. Following single-particle reconstruction, structures for each virus / Fab RRV-12 complex were determined to a resolution of 6.3A for RRV, 5.3A for CHIKV, 5.3A for MAYV, :0 and 4.8 A for native MAYV (FIG. 10A). The location of Fab RRV-12 binding sites on each virus was determined from the fitted coordinates of viral glycoprotein E2 structures and the Fab CHK-265 model (Fox et al., 2015). The position of CHIKV E3 was determined by alignment of a CHIKV E2-E3 structure derived from PDB 6NK7 (Basore et al., 2019) to the E2 ectodomain structure fit of the RRV-12 bound 25 CHIKV density map. In comparison with the other RRV-12 bound viruses, E3 was only found to be present in the CHIKV structure. The positions of RRV and MAYV E2, and CHIKV E2, E3 and Fab structures relative to each other in the context of the density maps were analyzed to map regions of the virus surface within 6A of the Fab structure (FIG. 10B). These results revealed that the RRV-12 Fab bound to similar regions of the E2 B domain 3...
Claims
1. A monoclonal antibody, wherein the antibody or antibody fragment comprises clone-paired heavy chain (CDRH) and light chain CDR (CDRL) sequences, wherein: the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96, the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97, the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166, the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167.
2. A method of detecting a Ross River virus (RRV) infection in a subject comprising:(a) contacting a sample from said subject with an antibody or antibody fragment having clone-paired heavy and light chain CDR sequences, wherein:the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96,the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97,the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166,the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167; and(b) detecting RRV in said sample by binding of said antibody or antibody fragment to a RRV antigen in said sample.
3. The method of claim 2, wherein said sample is a body fluid.
4. The method of claim 2 or 3, wherein said sample is blood, sputum, tears, saliva, mucousor serum, semen, cervical or vaginal secretions, amniotic fluid, placental tissues, urine, exudate, transudate, tissue scrapings or feces.
5. The method of any one of claims 2-4, wherein detection comprises ELISA, RIA,lateral flow assay or Western blot.2020273365 23 Jul 20266. The method of any one of claims 2-5, further comprising performing steps (a) and (b)a second time and determining a change in RRV antigen levels as compared to the first assay.
7. A method of treating a subject infected with Ross River virus (RRV) or reducing thelikelihood of infection of a subject at risk of contracting RRV, comprising delivering to said subject an antibody or antibody fragment having clone-paired heavy and light chain CDR sequences, wherein:the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96,the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97,the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166,the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167.
8. Use of an antibody or antibody fragment having clone-paired heavy and light chainCDR sequences, wherein:the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96,the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97,the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166, the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167in the manufacture of a medicament for the treatment of Ross River virus (RRV).
9. A method of protecting the health of a placenta and / or fetus of a pregnant subjectinfected with or at risk of infection with Ross River virus (RRV) comprising delivering to said subject an antibody or antibody fragment having clone-paired heavy and light chain CDR sequences, wherein:the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96,the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97,the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166,2020273365 23 Jul 2026the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167.
10. Use of an antibody or antibody fragment having clone-paired heavy and light chain CDR sequences, wherein:the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96,the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97,the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166,the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167in the manufacture of a medicament for protecting the health of a placenta and / or fetus of a pregnant a subject infected with or at risk of infection with Ross River virus (RRV).
11. A vaccine formulation comprising an antibody or antibody fragment comprising clone-paired heavy and light chain CDR sequences, wherein:the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96,the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97,the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98,the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165,the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166, the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167.
12. The monoclonal antibody of claim 1, the method of claim 2, 7 or 9, the use of claim 8 or 10, or the vaccine formulation of claim 11, wherein said antibody or antibody fragment is encoded by light and heavy chain variable sequences according to clone-paired sequences of SEQ ID NOs: 3 and 4.
13. The monoclonal antibody of claim 1, the method of claim 2, 7 or 9, the use of claim 8 or 10, or the vaccine formulation of claim 11, wherein said antibody or antibody fragment is encoded by light and heavy chain variable sequences having 70%, 80%, or 90% identity to clone-paired sequences of SEQ ID NOs: 3 and 4.
14. The monoclonal antibody of claim 1, the method of claim 2, 7 or 9, the use of claim 8 or 10, or the vaccine formulation of claim 11, wherein said antibody or antibody2020273365 23 Jul 2026fragment is encoded by light and heavy chain variable sequences having 95% identity to clone-paired sequences of SEQ ID NOs: 3 and 4.
15. The monoclonal antibody of claim 1, the method of claim 2, 7 or 9, the use of claim 8 or 10, or the vaccine formulation of claim 11, wherein said antibody or antibody fragment comprises light and heavy chain variable sequences according to clone-paired sequences of SEQ ID NOs: 49 and 50.
16. The monoclonal antibody of claim 1, the method of claim 2, 7 or 9, the use of claim 8 or 10, or the vaccine formulation of claim 11, wherein said antibody or antibody fragment comprises light and heavy chain variable sequences having 70%, 80% or 90% identity to clone-paired sequences of SEQ ID NOs: 49 and 50.
17. The monoclonal antibody of claim 1, the method of claim 2, 7 or 9, the use of claim 8 or 10, or the vaccine formulation of claim 11, wherein said antibody or antibody fragment comprises light and heavy chain variable sequences having 95% identity to clone-paired sequences of SEQ ID NOs: 49 and 50.
18. The monoclonal antibody of any one of claims 1 and 12-17, the method of any one of claims 2, 7, 9 and 12-17, the use of any one of claims 8, 10 and 12-17, or the vaccine formulation of any one of claims 11-17, wherein said antibody fragment is a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab‘)2 fragment, or Fv fragment.
19. The monoclonal antibody of any one of claims 1 and 12-18, the method of any one of claims 2, 7, 9 and 12-18, the use of any one of claims 8, 10 and 12-18, or the vaccine formulation of any one of claim 11-18, wherein said antibody is a chimeric antibody, or is a bispecific antibody.
20. The monoclonal antibody of any one of claims 1 and 12-19, the method of any one of claims 2, 7, 9 and 12-19, the use of any one of claims 8, 10 and 12-19, or the vaccine formulation of any one of claims 11-19, wherein said antibody is an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to2020273365 23 Jul 2026alter (eliminate or enhance) FcR interactions, to increase half-life and / or increase therapeutic efficacy, such as a LALA, N297, GASD / ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern.
21. The monoclonal antibody of any one of claims 1 and 12-20, wherein said antibody or antibody fragment further comprises a cell penetrating peptide and / or is an intrabody.
22. The method or use of any one of claims 7-10 and 12-20, wherein said antibody or antibody fragment is, or is to be, administered prior to infection or after infection.
23. The method or use of any one of claims 7-10, 12-20 and 22, wherein said subject is a pregnant female, a sexually active female, or a female undergoing fertility treatments.
24. The method or use of any one of claims 7-10, 12-20 and 22-23, wherein delivering comprises antibody or antibody fragment administration, or genetic delivery with an RNA or DNA sequence or vector encoding the antibody or antibody fragment.
25. The vaccine formulation of any one of claims 11 and 12-20, wherein at least one of said antibodies or antibody fragments further comprises a cell penetrating peptide and / or is an intrabody.
26. A vaccine formulation comprising one or more expression vectors encoding the antibody or antibody fragment according to any one of claims 1 and 12-20.
27. The vaccine formulation of claim 26, wherein said expression vector(s) is / are Sindbis virus or VEE vector(s).
28. The vaccine formulation of claim 26 or 27, formulated for delivery by needle injection, jet injection, or electroporation.2020273365 23 Jul 202629. A method of determining the antigenic integrity, correct conformation and / or correct sequence of a Ross River virus (RRV) antigen comprising:(a) contacting a sample comprising said antigen with a first antibody or antibody fragment having clone-paired heavy and light chain CDR sequences, wherein: the CDRH1 comprises the amino acid sequence of SEQ ID NO: 96, the CDRH2 comprises the amino acid sequence of SEQ ID NO: 97, the CDRH3 comprises the amino acid sequence of SEQ ID NO: 98, the CDRL1 comprises the amino acid sequence of SEQ ID NO: 165, the CDRL2 comprises the amino acid sequence of SEQ ID NO: 166, the CDRL3 comprises the amino acid sequence of SEQ ID NO: 167; and(b) determining antigenic integrity, correct conformation and / or correct sequence of said antigen by detectable binding of said first antibody or antibody fragment to said antigen.
Citation Information
Patent Citations
PAT1008517
Compositions and Methods Related to Adenovirus Based Delivery of Antigens
US20100209451A1
Pseudotyped retroviruses and stable cell lines for their production
US7033595B1
Pseudotyped retroviruses and stable cell lines for their production
WO2000008131A2
Compositions and methods for inhibition of alphavirus infection
WO2019136316A1