Upland cotton fiber strength gene GhUBX and use thereof

Abstract

Provided are the fiber strength gene GhUBX from tetraploid upland cotton (Gossypium hirsutum), wherein the nucleotide sequence of this gene in tetraploid upland cotton Prema is as shown in SEQ ID NO. 1 and the nucleotide sequence of this gene in tetraploid upland cotton 86-1 is as shown in SEQ ID NO. 2. Also provided is the fiber strength gene GhUBX as shown in SEQ ID NO. 1 and the use of a super-expression vector and antisense expression vector of the gene in improving the strength of cotton fibers. The super-expression vector can be used for increasing the spiral degree of the cotton fibers and improving the strength of the cotton fibers. The antisense expression vector can be used for thickening the secondary walls of the cotton fibers and improving the strength of the cotton fibers.

Description

TECHNICAL FIELD The present invention relates to an upland cotton fiber strength gene (GhUBX) that is a gene sequence obtained from upland cotton Prema and belongs to the field of biotechnology application. BACKGROUND Cotton (Gossypium) is an important economic crop and widely planted worldwide. Cotton fibers, as a natural fiber, are an important raw material in textile industry. Although the cotton fibers have different use and different varieties to be cultivated, fiber quality is an only invariable important selection indicator. Cotton fiber measurement criteria mainly include: fiber length, breaking strength, elongation, Micronaire value, etc. The breaking strength of the cotton fibers is an important indicator for evaluating the cotton fiber quality and also a main indicator for determining whether the cotton fibers can be processed. Therefore, genes related to fiber strength are separated and identified, and a molecular mechanism of cell development regulation and control determining the fiber strength is systematically clarified, which have important theoretical value and practical significance for fully utilizing a gene resource of cotton to improve the fiber quality (Zhang Tianzhen, 2000; Guo Wangzhen, 2003; Zhang Hui, et al, 2007; Shangguan Xiaoxia, et al, 2008; Lai Tongfei, et al, 2008). Fiber strength is defined as a breaking load of a single fiber divided by a cross-sectional area of the single fiber, i.e., the strongest force that can be withstood per cross-sectional area of the fiber, and is a measure of a relative attraction of cotton fibers. Fabric woven by a fiber material with good fiber strength is firm and durable. With innovation of a textile technology, requirements on the quality of the cotton fibers are higher and requirements on the strength of the cotton fibers are more severe. Therefore, how to improve the strength of the cotton fibers is a major goal of current breeding. Previous studies have shown that the fiber strength is expressed in different ways and affected by different factors. A zero-gauge strength is mainly affected by the form of cotton fibers and mainly depends on three factors cellulose content, fiber polymerization degree and fiber supermolecular structure. A 3.2 mm gauge strength depends on the zero-gauge strength and the number of reverse spirals of the cotton fibers. The 3.2 mm gauge strength and the fineness of the fiber determine the strength of the single fiber together (Yao Mu, et al, 1998; Liu Jiuhua, 1989). It can be seen that the breaking strength of the fibers is mainly determined by a supramolecular structure and deposition of cellulose. UBX proteins are ubiquitous in eukaryotes as a key link for intracellular ubiquitination. Ubiquitination modification in eukaryotic cells involves a series of reactions including a ubiquitin activating enzyme E1, a ubiquitin conjugating enzyme E2, and a ubiquitin ligase E3. Under ATP supply, the enzyme E1 adheres to a Cys residue in the tail of a ubiquitin molecule to activate ubiquitin, then the E1 transfers the activated ubiquitin molecule to the E2 enzyme, and then the E2 enzyme and some different E3 enzymes recognize a target protein together to carry out ubiquitination modification. The target protein can be subjected to mono-ubiquitination modification and poly-ubiquitination modification according to a relative proportion of the E3 to the target protein. Ubiquitination of substrates by the E1, the E2, the E3 can form several different ubiquitinated substrates. Some substrate proteins can only be mono-ubiquinated, such as H2B; some substrate proteins have a plurality of lysine residues and can be mono-ubiquinated at multiple sites under proper conditions; and other proteins form a polyubiquitin chain at a single lysine site and such a polyubiquitin chain can be divided into single, mixed and dendritic structures depending on the lysine sites attached to the ubiquitin chain. SUMMARY The present invention aims to provide a cotton UBX-Domain Containing 10 gene (GhUBX) sequence and its genome sequences in upland cotton 86-1 and Prema and Gossypium raimondii, designs a pair of specific primers for GhUBX to detect its spatiotemporal expression in upland cotton Prema and 86-1, and use the gene as a target gene to verify a transgenic function through genetic engineering, so as to cultivate and use new germplasm lines in production. The object of the present invention can be achieved through the following technical solutions: A tetraploid upland cotton fiber (Gossypium hirsutum) strength gene GhUBX has a nucleotide sequence as set forth in SEQ ID NO. 1 in tetraploid upland cotton (G. hirsutum) Prema and has a nucleotide sequence as set forth in SEQ ID NO. 2 in tetraploid upland cotton (G. hirsutum) 86-1. The cotton UBX gene (GhUBX) of the present invention has a 6-bp InDel difference between Prema (high fiber strength) and 86-1 (low fiber strength). The 6-bp difference is an SSR (CCTCCG). The InDel is missing in the high fiber strength parent Prema. The number of repeats of SSR motifs in a GhUBX gene sequence is different in different upland cotton varieties. A repeat type formula of the SSR motifs in the upland cotton is (CTCGGC)1CTCTG(CCTCCG)n=2 / 5 / 6. Only SSR (CCTCCG) has a number difference. The repeats of the number (n) of SSR motifs in a UBX gene sequence is 2 in a subgroup A in an upland cotton variety, is 5 or 6 in a subgroup D, is 5 in Prema and is 6 in 86-1. Through a correlation analysis between materials of different genotypes and fiber strength in 281 varieties of upland cotton, it is found that: The GhUBX gene is significantly correlated with the fiber strength, but is easily affected by the environment to a certain extent. As shown in Table 3, genotypes of 33 varieties in group A are all consistent with Prema and genotypes of 235 varieties in group B are all consistent with 86-1. The varieties in group A have a larger average fiber breaking strength than those in group B, and significant differences in the fiber strength are detected at multiple points over the years. An overexpression vector of the tetraploid upland cotton fiber strength gene GhUBX set forth in SEQ ID NO. 1. The overexpression vector is preferably obtained by cloning the tetraploid upland cotton fiber strength gene GhUBX set forth in SEQ ID NO. 1 between restriction sites SmaI and BamHI of an eGFP4 expression vector by gene recombination. An antisense expression vector of the tetraploid upland cotton fiber strength gene GhUBX set forth in SEQ ID NO. 1. Use of the tetraploid upland cotton fiber strength gene GhUBX set forth in SEQ ID NO. 1 in improving strength of cotton fibers. Preferably, in the use, a genetic engineering means of overexpressing the tetraploid upland cotton fiber strength gene GhUBX set forth in SEQ ID NO. 1 increases a spiral degree to improve fiber strength; or a genetic engineering means of inhibiting an expression of the tetraploid upland cotton fiber strength gene GhUBX set forth in SEQ ID NO. 1 thickens secondary walls of cotton fibers to improve fiber strength. The use of the overexpression vector of the present invention in increasing a spiral degree of cotton fibers to improve cotton fiber strength. The use of the antisense expression vector of the present invention in thickening secondary walls of cotton fibers to improve cotton fiber strength. Beneficial effects: The advantages of the present invention are as follows: (1) The gene cloned in the present invention is directly related to the quality of cotton 2020348612   08 May 2026 fibers. GhUBX proteins are key proteins in a ubiquitination pathway and closely related to degradation of the key proteins during cotton fiber development. Mature fibers of GhUBX transgenic plants are observed through scanning electron microscopy (FIG. 4) and transmission electron microscopy (FIG. 5). It is found that compared with a transgenic receptor W0, secondary walls of an overexpression plant become thinner and secondary walls of an antisense expression plant become thicker; and compared with a control, the transgenic plants have a fiber breaking strength increased by 6.4-11.4% and most of the transgenic plants show significant differences (Table 2). (2) A structural variation of the GhUBX gene found in this study (6-bp base deletion as shown in FIG. 7) exists at a N-terminus of a gene sequence. It is speculated that a fiber high-strength material Prema cannot specifically bind to AAA-ATPase due to the lack of a 6-bp sequence at the N-terminal, thereby enhancing the activity of the AAA-ATPase and accelerating a metabolic process in cells. However, 86-1 can produce functional GhUBX to regulate the activity of the AAA-ATPase and the cells maintain a normal metabolic process. (3) A full-length genome sequence of the present invention is directly amplified by a PCR technology. The technology has the advantages of small initial template amount and simple and easy test steps. (4) The gene cloned in the present invention is more similar to UBX10 of plants in the structure and has not been reported in cotton. Through a sequence alignment obtained in parents, differences are mainly in a N-terminal simple sequence repeats (SSR) (FIG. 7) and there were also differences in individual amino acids. The gene structure has been comprehensively displayed and analyzed for the first time. (5) Quantitative PCR results show that the expression of the gene is different at different stages of fiber development as shown in FIG. 1: there are large differences in expression between Prema and 86-1 in a critical period of fiber secondary wall thickening (20-25 days after anthesis, DPA). In an early stage of secondary wall thickening, the GhUBX has a significantly higher expression level in 86-1 than Prema. It is speculated that UBX proteins form multimers to degrade proteins involved in secondary wall synthesis in plant cells, resulting in thinning of fiber secondary walls of 86-1. (6) The constructed plant antisense expression vector and overexpression vector are used for transgenic research on upland cotton W0. The results show that the increase of UBX protein content will lead to increase of fiber spirals and the decrease of the UBX protein will lead to weakening of fiber spirals. 2020348612   08 May 2026 Throughout this specification, unless the context requires otherwise, the word “comprise” or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. It is also noted that in this disclosure and particularly in the claims and / or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows constitutive expression analysis. Quantitative PCR is used to detect spatiotemporal distribution of cotton fiber strength gene (GhUBX) expression in different cotton tissues (root, stem, leaf and 15 DPA (days after anthesis) fiber, 20 DPA fiber and 25 DPA fiber). FIG. 2 shows quantitative PCR detection of GhUBX gene transcription level expressions in GhUBX gene overexpressing cotton plants and antisense GhUBX gene cotton plants, where 120, 141, 145 and 153 are overexpressing plants, W0 is a control group, and 159, 163, 177 and 181 are antisense plants. Samples are 15 DPA fiber, 20 DPA fiber and 25 DPA fiber. FIG. 3A and B are Western blot detection of UBX gene overexpressing transgenic cotton plants and antisense UBX vector transgenic cotton plants, where 120, 141, 145 and 153 are different lines of overexpressing plants, W0 is a control group, and 159, 163, 177 and 181 are different lines of antisense plants. C and D are gray scale scanning statistics of Western Blot hybridization bands and the samples are 15 DPA fiber, 20 DPA fiber and 25 DPA fiber. P-actin is an internal reference protein. * means p < 0.05; ** means p < 0.01 by Student's t-test. FIG. 4 shows electron microscopy of transgenic fiber and spiral conditions of overexpressing and antisense transgenic cotton fibers. (A): (a)-(d) are mature fibers of overexpressing plants, (e)-(h) are mature fibers of antisense plants, and (i) and (j) are mature fibers of a control group. A scanning electron microscope having a model of GEMINI 300, a magnification of 200 times and a scale bar of 50 pm is used. (B): Statistics of the spiral distance of mature fibers of the overexpressing lines and the antisense lines. The overexpressing lines and a wild-type plant show significant or extremely significant differences. * means p < 0.05; ** means p < 0.01 by Student's t-test. FIG. 5 shows transmission electron microscopy of transgenic fiber resin slices, showing thickening of secondary walls of overexpressing and antisense transgenic mature fibers. (A): 120, 141, 145 and 153 are different lines of overexpressing plants and W0 is a control group; (B): 159, 163, 177 and 181 are different lines of antisense plants; and a statistical bar graph of cell wall thickness is shown in (C) and the overexpressing and antisense plants exhibit significant differences compared to a wild-type plant W0. Samples are naturally mature dry fibers. * means p < 0.05; ** means p < 0.01 by Student's t-test. An electron microscope has a model of Hitachi H-9500 and a scale bar of 0.5 pm. FIG. 6 Phylogenetic tree based on UBX homologous genes of different species. UBX10 amino acid sequences of Camellia sinensis, Citrus clementina, Citrus sinensis, Coffea arabica, Cucumis melo, Cucurbita maxima, Cucurbita moschata, Cucurbita pepo subsp. pepo, Durio zibethinus, Gossypium arboreum, Gossypium raimondii, Hevea brasiliensis, Juglans regia, Morus notabilis, Populus trichocarpa, Prunus avium, Prunus mume, Prunus persica, Quercus suber, Rosa chinensis, Theobroma cacao, Vitis vinifera, Ziziphus jujuba, Ricinus communis, Glycine max are extracted for phylogenetic tree analysis. ubx represents a post-translational amino acid sequence of SEQ ID NO. 1. FIG. 7 shows GhUBX domains in Prema and 86-1. As shown in the figure, amino acid sequences of GhUBX in Prema and 86-1 are listed. The amino acid sequence of Prema is two amino acids less than the amino acid sequence of 86-1 since a N-terminal simple sequence repeats (SSR) is 6 bases less and the six bases encode two amino acids alanine (Ala) and serine (Ser). Therefore, Prema has 470 amino acids and 86-1 has 472 amino acids. DETAILED DESCRIPTION Embodiment 1 (A) Obtaining of full-length sequence of cotton fiber strength gene 1. According to an expression level, 15 DPA fiber samples of parents (86-1 and Prema) were taken, RNA was extracted and reverse transcribed to obtain cDNA, specific primers and recombinant primers were designed (a Sma I restriction site at a N-terminal and a BamH I restriction site at a C-terminal), a fragment of about 1,400 bp was amplified from the cDNA template by PCR and ligated to an eGFP vector, an obtained product was transformed into DH5a, 12 h later, single colony was picked, shaken for detection and sent for sequencing, and returned sequences were repeatedly compared to obtain differences in UBX gene sequences of the parents. Table 1 PCR recombinant primers Primer type Primer F Primer R Recombinant Primer 5'-GAACGATAGGGTACCCCCGGG ATGGTTGATGTAACCGATAAATT GG -3' (SEQ ID NO.3) 5'-GCCCTTGCTCACCATGGATCC GTTTAGCTCCACAAAGAGGCTG G -3' (SEQ ID NO.4) (2) Preliminary analysis of structure and bioinformatics of GhUBX gene The gene consists of 4 exons and 3 introns with a total length of 1,413 bp. Preliminary analysis of bioinformatics: amino acid sequences were compared by BLAST (http: / / www.ncbi.nlm.nih.gov / blast). It was found that the amino acid sequence of GhUBX has the highest homology of 88% with that of Durio zibethinus UBX10 and the highest homology of 87% with that of Theobroma cacao UBX10. The gene consists of UBA-like, UAS and UBX domains (FIG. 7). The results of phylogenetic tree analysis (ftp: / / ftp-igbme.u-strasbg.fr / pub / ClustalX / ) are shown in FIG. 6. (3) Quantitative PCR analysis of cotton GhUBX gene Specific primers were designed: F: 5'-GGTGATGAACCTGAGAAAGG-3' (SEQ ID NO.5) and R: 5'-TTAGTGCAGTACTGTGAAACC-3' (SEQ ID NO.6). A quantitative PCR detection was conducted and results showed that the gene was constitutively expressed in each tissue (root, stem and leaf) and different stages of fiber development (15, 20 and 25 DPA) (FIG. 1), but the expression levels were different. Except for a lower expression level in root, stem and leaf, there were also differences in different stages of fiber development. The expression level was higher in an early stage (15 DPA) and was lower in a period of rapid thickening of secondary walls of fibers (20 and 25 DPA). The result reflected that the gene of the present invention was closely related to secondary wall thickening and played a crucial role in controlling development of cotton fibers. Embodiment 2 (1) Verification of transgenic function of cotton GhUBX gene eGFP4 is a traditional plant binary expression vector and has a 35S promoter. The vector was cut with Sma I and BamH I and ligated with a PCR product of GhUBX recombinant primer at 37°C to obtain the eGFP4 vector containing a complete expression fragment of the GhUBX gene. A plant overexpression vector was constructed with a full-length sequence of SEQ NO ID.1 of the gene of the present invention and a specific process was as follows: Recombinant                   primers                   F:                   5'- GAACGATAGGGTACCCCCGGGATGGTTGATGTAACCGATAAATTGG-3' (SEQ ID NO.3) and R: 5'-GCCCTTGCTCACCATGGATCCGTTTAGCTCCACAAAGAGGCTGG-3' (SEQ ID NO.4) were designed, and PCR was conducted with a T vector plasmid containing a 1,410 bp target fragment as a template ; and the eGFP4 expression vector was digested with SmaI and BamH I, and after gel running, identification and cutting, an obtained product was inactivated at 85°C for 15 min and placed on ice for later use. Recombination was conducted according to requirements of a kit system and a recombined plasmid was transferred into E. coli competent DH5a, and the bacteria were picked for detection after 12 h. PBI121 is a traditional plant binary expression vector and has a 35S promoter. An antisense plant expressing vector was constructed with a specific fragment of a length of 426 bp from 745 bp to 1,171 bp of SEQ NO ID.1 of the gene of the present invention and a specific process was as follows: PCR was conducted with a T vector plasmid containing the 1,410 bp target fragment as a template, primers F: 5’- GGGGATATCAGGTTCCCGTTTTGTGCAGT-3’ (SEQ ID NO.7) and R: 5’- GGGGAGCTCTAGGTCCTTTCTCAGGTTCA-3’ (SEQ ID NO.8) were used, and an amplified fragment of 426 bp (745 bp-1,171 bp of SEQ NO ID.1) was cloned. An amplified product was digested with EcoRV and SacI, and a small fragment was recovered; and a pBI 121 expression vector was digested with SmaI and SacI, a Gus gene was cut, and a large fragment (about 13 kb) was recovered. Since EcoR V and SmaI have blunt ends, the 426 bp target fragment was ligated with the large fragment of the pBI 121 expression vector recovered by enzyme digestion to construct an antisense fragment into the pBI 121 vector. Cotton was transformed by an Agrobacterium-mediated method for functional verification and 35S promoter overexpressing transgenic plants and 35S promoter antisense transgenic plants were obtained respectively. 4 overexpressing and 4 antisense transgenic plants were all identified by transgenic molecules (FIG. 2). The overexpressing and antisense transgenic plants had average fiber strength stronger than that of the control, such that the function of the gene related to cotton fiber strength was directly verified. (2) Western blot detection of cotton GhUBX 15, 20, and 25 DPA fibers of transgenic plants and w0 were taken, total protein was extracted, SDS-PAGE electrophoresis running and membrane transfer were conducted, a prepared ubx antibody was used to detect GhUBX protein, and P-actin was used as an internal reference. Results were shown in FIG. 3. (3) Scanning electron microscope observation of mature fibers Mature fibers of overexpressing 120, 141, 145 and 153, control group W0 and antisense transgenic 159, 163, 177 and 181 were taken respectively, the fibers were fixed on an aluminum table with special double-sided tape, twisting of the fibers was observed by scanning electron microscope after metal shadowing, and the spiral distance was obtained by dividing the total length of the fibers by the total number of spirals. Results were shown in FIG. 4. (4) Transmission electron microscope observation of mature fibers Mature fibers of overexpressing 120, 141, 145 and 153, control group W0 and antisense transgenic 159, 163, 177 and 181 were taken respectively, the fibers were put into a 2.5% glutaraldehyde fixative and rinsed three times with PBS, 15 min each time, and the fibers were fixed with 1 % osmic acid for 2 h and washed three times with a PBS buffer, 15 min each time. The samples were treated with 50%, 70%, 90% and 100% ethanol respectively for 15 min to dehydrate, the dehydrated samples were embedded with a resin embedding agent, after solidification, the embedded samples were cut into thin slices with a thickness of less than 0.1 ^m by using an ultra-thin microtome, and the thin slices were fixed with a copper screen and placed under a transmission electron microscope for microscopic examination. Results were shown in FIG. 4. Table 2 Detection of transgenic cotton fibers Sample No. Average length of upper half (mm) Uniformit Micronaire Breaking strength Elongatio y (%)       value         (cN / tex)        n (%) 120 28.7 85.0 5.0 30.61±0.71 6.7 141 27.7 85.4 5.0 * 31.07±0.59* 6.7 149 28.4 85.9 4.1 * 31.00±0.48* 6.7 153 27.6 83.7 5.3 30.71±0.54* 6.6 w0 27.5 84.2 5.4 28.35±0.56 6.6 159 28.4 85.5 4.7 29.69±0.45 6.7 163 29.6 86.0 5.0 * 30.15±0.16* 6.7 177 28.9 85.5 4.7 * 31.00±0.33* 6.7 181 28.5 84.4 4.9 * 31.59±0.92 6.7 120, 141, 149 and 153 were overexpressing materials, 159, 163, 177 and 181 were antisense materials, and w0 was a control. Table 3 Association of multi-year and multi-site fiber strength with SSR sites Year 2007 2008 2009 Site Anyang Kuche Nanjing Anyang Kuche Nanjing Anyang Kuche Nanjing Group A 29.1540.30*   28.804018* FS 30.0340.07 29.1440.34** 29.7840.16* 29.0940.69 28.5740.20* 29.1340.86 27.9540.53 Group B 28.4510.26    28.32 it. 13 29.7640.07   28.36 »0.11 29.3010.22 28.7440.29 28.05» 0.10 28.8240.66 28.4340.23 Group A contained 33 varieties and n of SSR was 5, which was the same as Prema; and Group B contained 235 varieties and n of SSR was 6, which was the same as 86-1.

Claims

1. Use of an antisense expression vector comprising a cotton fiber strength gene GhUBX of a tetraploid upland cotton (Gossypium hirsutum), said cotton fiber strength gene GhUBX having a nucleotide sequence as set forth in SEQ ID NO. 1, in a method to thicken the secondary walls of cotton fibers to improve cotton fiber strength.

Images