Methods for modulating human L1 retrotransposons RNA and compositions for use therein

Abstract

Compositions and methods for upregulating L1 RNA activity in a subject in need thereof are provided. The compositions include nucleic acids encoding L1 RNA or the L1 RNA, alone, or contained in an expression vector and / or further contained within osteogenic progenitor cells, for example, mesenchymal stem cells, genetically engineering to express L1 RNA. In this aspect, the compositions are used to increase L1 RNA levels for example, L1 RNA copy number in subjects in need of increasing their bone mass index. In a preferred embodiment, the bone progenitor cells are autologous cells. Compositions and methods for downregulating L1 RNA levels / activity in a subject in need thereof are also provided. The compositions include one or more agents in effective amounts to knockdown L1 RNA in a cell. The compositions can be used to treat conditions associated with ageing. A preferred agent is a L1 RNA antisense oligonucleotide.

Description

Intradermal injections are the simplest and most direct method for delivering NAs into the skin. Here, the barrier properties of the SC are overcome completely by injecting NAs directly into the viable tissue layers of the skin. Useful intradermal needles include microneedle arrays. Microneedle arrays comprise needles that are only 100-700 pm in length. When placed on the skin, their sharp tips allow easy insertion into the stratum comeum, while the short length ensures adequate penetration into the skin without disrupting nerves in deeper skin tissue. Microneedles can be used for delivery of nucleic acids disclosed herein, for example, plasmid DNA encoding LI RNA, cationic lipid-DNA complexes (-100 nm diameter), siRNA, etc. Microporation is another technique that employs physical disruption of the SC (statun comeum) for delivery of large therapeutics or therapeutic carriers. An array of resistive elements can be placed on the skin. An electric current pulsed through the array results in localized ablation of corneocytes in contact with the array. Alternatively, erbium:yttrium-aluminum-garnet (Er:YAG) laser arrays can be used for localized ablation of the SC and epidermis. This techniques has been used to successfully deliver plamid DNA, CpG oligonucleotides, siRNA, etc., to the skin. Electroporation can be used to permeabilize the skin and enhance passive diffusion of agent. The mechanism of electroporation is quite different from that of electrically-induced microporation. Electrically-induced microporation utilizes electric fields to induce thermal ablation of SC microstructure creating pores in the skin. On the other hand, electroporation is the application of short duration (< 0.5 s) and high intensity (< 100 V) electric pulses to the skin which result in transient permeabilization of the lipid bilayers in the skin and concurrently permeabilize cell membranes of epidermal keratinocytes. Electroporation is also expected to create aqueous pores through the skin. Efficient delivery of nucleic acid molecules into skin by combined use of microneedle roller and flexible interdigitated electroporation array is disclosed in Huang, et al., Theranostics 2018; 8(9):2361-2376. Iontophoresis can be used to drive transport of charged drugs like NAs. Applying a continuous low intensity (< 10 V) electric field at a constant current. Liposomes have also been studied extensively for nucleic acid delivery for the treatment of skin disease. Highly ordered spherical complexes of nucleic acids (spherical nucleic acids) have shown potential for treating skin disease due to their enhanced delivery into skin, internalization into skin cells, and protection of NAs from degradation. Specifically, gold nanoparticles coated with a dense layer of highly-ordered and covalently bound siRNA resulted in passive transport through intact mouse SC and localized exclusively in the dermis and epidermis. The formulations can include known skin penetration enhancers. Several peptides have been identified which possess the ability to enhance transport of NAs into the skin and elicit a therapeutic response. The first of these peptides discovered using phage-display screening was TD-1 (ACSSSPSKHCG) (SEQ ID NO:55). Hsu and Mitragotri identified another peptide using phage-display screening, SPACE peptide (ACTGSTQHQCG) (SEQ ID NO:56), with the ability to not only enhance delivery of siRNA across the skin but also enhance intracellular uptake (Hsu T, Mitragotri S Proc Natl Acad Sci USA. 2011 108(38):15816-21). The present invention will be further understood by means of the following non-limiting examples. EXAMPLES I. LINE-1 RETROTRANSPOSON RNA DELIVERY TO OSTEOPOROTIC PATIENTS DERIVED MESENCHYMAL STEM CELLS STIMULATES OSTEOGENIC DIFFERENTIATION AND BONE MATRIX PRODUCTION Materials and Methods Participants From 103 Norwegian women (50-86 years) with highly variable BMD, 30 were selected according to age, weight and key serum parameters and divided into two groups: Osteoporotic (T-score < -2.5) and healthy (Tscore >-l). The procedures for patient registration, transiliacal bone biopsies and blood sampling were described previously. (47)(48) The participants were recruited through advertisements in newspapers and / or included via Lovisenberg Diaconal Hospital outpatient clinic. The study was approved by the Norwegian Regional Ethical Committee (REK no: 2010 / 2539) and conducted according to the Declaration of Helsinki. Human MSC differentiation Bone marrow-derived MSC (#C-12974, PromoCell GmbH, Heidelberg, Germany) were grown in 0.1% gelatin solution (#07903, StemCell)-coated plates until passage 4. Growth medium (#PT-3001, Lonza) was changed every 3 days. Osteogenic differentiation was induced by replacing growth medium with Osteogenic Differentiation Medium (#PT-3002, Lonza) on 70% confluent cells seeded on 1:50 Matrigel (#356237, Corning)-coated plates. Adipogenic differentiation was induced by three cycles of induction / maintenance Adipogenic Differentiation Medium (#PT-3004, Lonza) on post-confluent cells seeded on 1:50 MatMatrigel (#356237, Corning)-coated plates. Genomic DNA extraction and TaqMan qPCR-based LI CNV assay High molecular weight genomic DNA (HMW-gDNA) was isolated using MagAttract HMW DNA Kit (#67563, Qiagen), following the manufacturer’s instructions. During lysis, the samples were treated with RNase H and proteinase K (both provided in the kit) for at least 1 hour at 37 °C to remove RNA / DNA substrates and protein contamination, respectively. Isolated HMW-gDNA was finally treated with Exonuclease I (#M0568, NEB) for 30 min at 37 C and then deactivated for 15 min at 80 C to remove free ssDNA. HMW-gDNA was then analyzed for LI copy number using a 7900HT Fast Real Time PCR (Applied Biosystems). All copy number assays for LI were normalized on human centromeric alpha satellite (SATA) as repetitive endogenous control for DNA input concentration. Each sample was analyzed in triplicate. For each reaction, a 20pl mix of gDNA (25pg), target specific primers (0.2pM), target specific FAM-labeled probe (0.4pM), ROX passive reference dye (0.4pl, #1725858, Bio-Rad) and IQ Multiplex Powermix (lOpl, #1725849, Bio-Rad) was incubated at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 45 seconds and primer annealing / extension at 59°C for 45 seconds. TaqMan probes and primers sequences for active, retrotransposition-competent, LI used for CNV study are published (Coufal, et al. Nature (2009), doi:10.1038 / nature08248; Goodier, et al. DNA (2014), doi: 10.1186 / 1759-8753-5-11) and shown below, and are the primers and probes used in this study. LI 5'UTR-ORF1 Forward primer: 5’-GAATGATTTTGACGAGCTGAGAGAA-3’ (SEQ ID NO:2); Reverse primer: 5’-GTCCTCCCGTAGCTCAGAGTAATT-3’ (SEQ ID NOG); Probe sequence: 5’-AAGGCTTCAGACGATC-3’ (30’37) (SEQ ID NO:4); LI ORF2 Forward primer: 5’-TGCGGAGAAATAGGAACACTTTT-3’ (SEQ ID NOG); Reverse primer: 5’-TGAGGAATCGCCACACTGACT-3’ (SEQIDNO:6); Probe sequence: 5’-CTGTAAACTAGTTCAACCATT-3’ (30’37) (SEQ ID NOG). SATA Forward primer: 5’-GGTCAATGGCAGAAAAGGAAAT-3’ (SEQ ID NOG); Reverse primer: 5’-CGCAGTTTGTGGGAATGATTC-3’ (SEQ ID NO:9); Probe sequence: 5’-TCTTCGTTTCAAAACTAG-3’ (30’37) (SEQ ID NOTO); RPL13A Forward primer: 5’-GAAAGCCAAGATCCACTACC-3’(SEQ ID NO: 11); Reverse primer: 5’-TGGGTCTTGAGGACCTCTGT-3’(SEQ ID NO: 12); RUNX2 Forward primer: 5’-TCAACGATCTGAGATTTGTGGG-3’ (SEQ ID NO: 13); Reverse primer: 5'-GGGGAGGATTTGTGAAGACGG-3' (SEQ ID NO: 14); OCN Forward primer: 5’-GGCGCTACCTGTATCAATGG-3’ (SEQ ID NO: 15); Reverse primer: 5’-GTGGTCAGCCAACTCGTCA-3’(SEQ ID NO:16); OPN Forward primer: 5’-GAAGTTTCGCAGACCTGACAT-3’ (SEQ ID NO: 17); Reverse primer: 5’-GTATGCACCATTCAACTCCTCG-3’(SEQ ID NO:18); BSP Forward primer: CACTGGAGCCAATGCAGAAGA(SEQ ID NO: 19); Reverse primer: 5’-TGGTGGGGTTGTAGGTTCAAA-3’(SEQ ID NO:20); osx Forward primer: 5’-CCTCTGCGGGACTCAACAAC-3’ (SEQ ID NO:21); Reverse primer: 5’-AGCCCATTAGTGCTTGTAAAGG-3’(SEQ ID NO:22); TBP Forward primer: 5’-GCTGGCCCATAGTGATCTTT-3’ (SEQ ID NO:23); Reverse primer: 5’-CTTCACACGCCAAGAAACAGT-3’(SEQ ID NO:24); PPARy Forward primer: 5’-ACCAAAGTGCAATCAAAGTGGA-3’ (SEQ ID NO:25); Reverse primer: 5’-ATGAGGGAGTTGGAAGGCTCT-3’(SEQ ID NO:26); FABP4 Forward primer: 5’-ACTGGGCCAGGAATTTGACG-3’(SEQ ID NO:27); Reverse primer: 5’-CTCGTGGAAGTGACGCCTT-3’(SEQ ID NO:28); FASN Forward primer: 5’-AAGGACCTGTCTAGGTTTGATGC-3’ (SEQ ID NO:29); Reverse primer: 5’-TGGCTTCATAGGTGACTTCCA-3’(SEQ ID NO:30); LPL Forward primer: 5’-AGGATGTGGCCCGGTTTATC-3’ (SEQ ID NO:31); Reverse primer: 5’-CCAAGGCTGTATCCCAAGAGAT-3’(SEQ ID NO:32); GFP-968 / 1013 Forward primer: 5’-GCACCATCTTCTTCAAGGACGAC-3’ (SEQ ID NO:33); Reverse primer: 5’-TCTTTGCTCAGGGCGGACTG-3’(SEQ ID NO:34); LI TaqMan primers and probes specificity analysis was performed: Ll-5’-ORFl primers and probe set matches 309 sequences (246 LIHS-Tal; 1 LIHS-TaO; 1 LIHS-preTa; 61 L1PA2), L1-ORF2 primers and probe set matches 181 sequences (161 LIHS-Tal; 3 Ll-HS-TaO; 4 LIHS-preTa; 6 L1PA2; 1 L1PA3; 5 L1PA4). Lamivudine 3TC treatment Lamivudine 3TC (#L1295, Sigma) was resuspended in DMSO and added to cell medium every 24 hours in a 150pM final concentration. Mineralization assay Cells were washed in PBS and fixed with 4% Paraformaldehyde for 15 minutes. Mineralization was assessed by using the Osteolmage Mineralization Assay (#LOPA503, Lonza) according to manufacturer’s indication. Mineralization was quantitatively assayed with GloMax discover plate reader (Promega) with appropriate excitation (492) / emission (520) wavelengths. Lipid content assay Cells were washed once in PBS and incubated for 10 minutes with AdipoRed Assay reagent (#LOPT7009, Lonza). Lipid content was quantitatively assayed with GloMax discover plate reader (Promega) with appropriate excitation (485) / emission (572) wavelengths. RNA extraction and cDNA preparation Cells were harvested and resuspended in 1ml of QIAzol Lysis reagent (#79306, Qiagen). Total RNA was then purified with RNeasy Plus Mini kit (#74134, Qiagen) with minimal modifications to manufacturer’s instructions. DNase treatment (RNase free DNase set, #79254, Qiagen) was performed to remove any residual DNA. RNA quality and concentration were checked using a Nanodrop 2000 spectrophotometer (ThermoFisher). cDNA was synthesized from 200ng of each RNA sample using a Superscript III first-strand cDNA synthesis system (#18080051, ThermoFisher) according to manufacturer’s protocol. LI RNA transfection The vector human-Ll_pBluescript II sk (+) carrying the full length LI sequence was custom-prepared by GenScript, USA. Large-scale human LI mRNA was in vitro transcribed, modified and purified by TriLink Biotechnologies, USA, (ARCA capped and 2’0methymalted (CapI), fully substituted with 5-methyl-C, 25% substitution of Cyanine-5-U and 75% substitution of Pseudo-U, enzymatically polyadenylated, DNase and phosphatase treated, silica membrane purified). LI RNA was transfected in differentiating osteoblasts at day 7 using Lipofectamine™ MessengerMAX™ (Invitrogen, USA, Cat. No. LMRNA003) with a modified protocol were a lower RNA amount (10 times less) than recommended was transfected. RFP mRNA (System Bioscience, USA, Cat. No. MR800A-1) was used as negative control. 3 days after transfection, bone matrix was quantified with Osteolmage Mineralization Assay (Lonza, Basel, Switzerland, Cat. No. LOPA503). Alizarin Red staining Osteoblasts were washed with lx PBS (Kantonsapotheke Zurich, Switzerland, Cat. No. A171012) and fixed with 4% (v / v) formaldehyde (Sigma, USA, Cat. No. F8775) in lx PBS for 30 min. After washing twice with ddH2O, Alizarin Red staining solution (0-7 g Alizarin Red S (Sigma, USA, Cat. No. A5533) diluted in 50 ml ddH2O at pH = 4.2) was added for 20 min. Afterwards, cells were washed four times with ddH2O, dried, and stored in the dark until image acquisition. For absorbance measurement, Alizarin Red S was eluted from stained osteoblasts with 300 pl 10% (w / v) cetylpyridinium chloride in an aqueous 0.01 M Na2HPO4 / NaH2PO4 solution at pH = 7 for 1 h. One hundred fifty microliters were transferred on a 96-well plate, and absorbance was measured at 560 nm. Ten percent (w / v) cetylpyridinium chloride in an aqueous 0.01 M Na2HPO4 / NaH2PO4 solution was used as blank. Images were acquired, processed and analysed as previously described (Eggerschwiler et al., Stem Cell Res. Ther. (2019). doi: 10.1186 / s 13287-019-1170-8). Gene expression analysis in differentiating osteoblasts and adipocytes Real time quantitative polymerase chain reaction (qPCR) was performed with 7900HT Fast Real Time PCR system (Applied Biosystems). Each sample was analyzed in triplicate and normalized with the endogenous control, Ribosomal Protein L13A (RPL13A) for osteogenesis and Tata Binding Protein (TBP) for adipogenesis, for cDNA input concentration. No template and no RT were included as negative controls. For each 15pl reaction, lOng (Ing for LI) of cDNA was mixed with IpM specific primers mix and 7.5pl of Sybr Select Master mix (#4472908, Life Technologies). The reaction was incubated at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds and elongation at 72°C for 30 seconds. Ct values were calculated by 7900HT Fast Real Time PCR RQ manager software (Applied Biosystems) and then normalized as DCt between the gene of interest and the endogenous calibrator. Primers used in this study for gene expression analysis were designed using Primer3 (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). In all primer pairs each primer matches a different exon. Amplicons length was 80-130 nucleotides. Primers sequences are reported in Table 1. In vitro retrotransposition assay 150 x 103 MSC were incubated with 3 pg of LRE3-EGFP plasmid (kindly provided by Prof. Fred Gage) and electroporated with Neon transfection system (ThermoFisher). Cells were subjected to one pulse of 990V for 40 ms, recovered for 48 hours and then induced to differentiate into mature osteoblasts for two weeks. Cells were harvest and DNA was isolated. 50ng of DNA was used as template to amplify the EGFP sequence with intron flanking oligos to discriminate between the intron containing RC-L1 sequence earned by the plasmid (1243bp, not retrotransposed) and the spliced newly inserted one (343bp, retrotransposed). PCR reaction was performed with 0.5pM of each primer and lOpl of Hot start premix Taq DNA polymerase (#R028A, Takara) in a final volume of 20pl and incubated at 94°C for 30 seconds for denaturation, at 58°C for 30 seconds for primers annealing and at 72°C for 1 minute for primers extension. The cycle was repeated 30 times. GFP primers sequences are published (38) and reported in Table 1. Cell cycle analysis 2x105 MSCs were trypsinized for 5 min at 37°C, washed with PBS and 2% BSA, passed through a 70pM strainer (#352350, Corning) and then fixed at -20°C for 30 min in 70% ethanol. After washing with PBS and 4% BSA, cells were resuspended in PBS and incubated 1 hour at 37°C with RNAse. Cells were then washed and resuspended in lOOpl of Flow Cytometry Staining Buffer (R&D System, #FC001). lOpl of Img / ml Propidium iodide (PI) staining solution (#P3566) was added to the single cell solution, gently mixed, and incubated 5 min in the dark. Cell cycle analysis was performed on BD FACSCanto II Flow Cytometry System, using BD FACSDiva Software. Antisense oligonucleotides delivery For LI knock-down experiments, FANA (2-deoxy-2-fluoroarabinonucleic acids) modified ASOs specific for 5 different LINE-1 ORF1 RNA regions, and one scrambled (SCR) used as negative control, were delivered by gymnosis according to producer’s instructions (AUMbiotech). Lyophilized oligonucleotides were resuspended in Nuclease free water at a concentration of 500pM and then diluted to 5pM in cell medium every three days. Statistical analysis To determine the significance between two mean values, comparisons were made by appropriated Student’s t test where the 0.05 level of confidence was accepted for statistical significance. *= P-value < 0.05; **= P value < 0.005; ***= P-value < 0.0005; ****= P-value < 0.00005. In correlation analysis, p-value and coefficient of determination (R-squared, R2) were calculated using GraphPad (https: / / www.graphpad.com / quickcalcs / ). The number of biological replicates (N) is indicated in the plots or in figure legends. RESULTS LI DNA copy number is expanded in the genome of healthy bone Variation in the copy number of active, retrotransposition-competent, LI, was analyzed in genomic DNA of 30 transiliac biopsies from age matched postmenopausal women classified as healthy (CTR, n=14, BMD t-score >-l) or osteoporotic (OP, n=16, BMD t-score < -2.5) (data not shown). In brief: all donors were on standard Norwegian diet and had similar nutritional supplements and life style factors, including physical engagement. They had normal endocrine, clinical, biochemical and nutritional status and had been postmenopausal without estrogen medication for at least 2 years. They received no drug treatment known to affect bone turnover and were free of other skeletal primary or secondary diseases. No resorption markers (serum TRAP5B, 1CTP, urine NTX or urine DPD) differed between patients and healthy, and they were all within normal laboratory ranges according to international standards. Of bone formation markers, serum osteocalcin was in normal range and did not differ between groups while bone specific alkaline phosphatase (ALP), although within normal variation, was significantly elevated in osteoporosis (p<0.019). To estimate variations in LI genomic copy number TaqMan qPCR coupled to isolation of high molecular weight genomic DNA, ssDNA (e.g. reversed transcribed but not integrated LI cDNA) and RNA / DNA substrates removal by Exonuclease I and RNase H treatment respectively, as reported in the methods, was used. This procedure is state of the art to exclude the detection of LI sequences that are not integrated into the genome and, therefore, to avoid overestimation of their genomic copy number as previously anticipated (Goodier, et al. DNA (2014), doi: 10.1186 / 1759-8753-511; Goodier, et al. DNA (2016),doi:10.1186 / sl3100-016-0070-z) and recently reported (34). Using TaqMan qPCR, two different regions of LI DNA sequence (5’UTR-ORF1 and ORF2) were amplified in copy number variation (CNV) assays. The variation of LI copy number between the two groups was highly significant for both of the sequences, showing a strong reduction in patients (Fig. 1A). Two sets of validated TaqMan pnmers and probes specific for potentially active, retrotranspositions-competent LI (see methods for TaqMan primers and probes specificity analysis) were used (Coufal, et al. Nature (2009), doi:10.1038 / nature08248; Muotri, et al. Nature (2010), doi:10.1038 / nature09544). Consistently, the observed relative variation in LI copy number between healthy and patients represents a difference limited to the small portion of potentially active LIHS-Tal family. The data shows that LI 5’UTR-ORF1 copy number in bone genome correlates positively with BMD at all sites measured: head (R2=0.275; p=0.006) (Fig. IB), total hip (R2=0.355; p=0.0005) (Fig. IC), and spine (R2=0.347; p=0.0006) Fig. ID). In contrast, no statistically significant correlation was observed with individual parameters not strictly related to skeleton metabolism, such as body weight (R2=0.012; p=0.565) (Fig. IE), body mass index (R2=0.031; p=0.356) (Fig. IF) parathyroid hormone level in the serum (R2=0.041; p=0.282) (Fig. 1G) and age (R2=0.028; p=0.375) (Fig. 1H). Consistent results were obtained when clinical parameters were correlated to LI ORF2 copy number using defined primers and probes (Fig. 2A-G). To assess whether the variation in LI copy number between CTR and OP women was specific for bone tissue, copy number variation (CNV) assay was performed on the genome of peripheral blood mononuclear cells (PBMC) taken from the same donors. In PBMC genome, LI copy number was markedly lower than in healthy bone but, most importantly, no variation was observed between CTR and OP groups (Fig. 2H). These results suggest that when comparing osteoporotic patients with healthy donors, quantitative variation in LI genomic copy number is detected specifically in bone and not in other mesoderm-derived tissues not affected by the pathology, demonstrating the bone specificity of LI dynamics alteration in osteoporosis. The osteogenic differentiation ofMSC triggers LI genomic expansion The genetic cause of osteoporosis is unknown, but it is associated with a faulty differentiation of MSC toward the osteogenic lineage in the bone marrow niche. The observed reduced number of LI copies in the genome of postmenopausal osteoporotic bone indicated a potential association between LI mobilization and bone development and that a failure in LI reactivation could be involved in defective bone formation. Therefore, additional studies investigated whether LI retrotransposons activation and expansion does occur during physiological osteogenesis of adult MSC. Bone marrow-derived MSC isolated from the iliac bone of healthy donors were differentiated into mature osteoblasts for three weeks (Fig. 3A). Bone-like nodules deposited by mature osteoblasts were detected with optical microscope (Fig. 3A). The increase in calcified matrix deposition and osteogenic genes expression indicated that bone differentiation occurred successfully ex vivo (data not shown, and Fig. 3C-D). Moreover, as the onset of mineralization may differ between MSC donors, age-matched donors were chosen (about same age as the cohorts studied) presenting similar mineralization dynamics (Fig. 3C) as well as similar marker genes expression (Fig. 3D), in order to ensure a consistent behavior of the cell system. First, Real Time qPCR was used to monitor the timeline of LI expression in developing osteoblasts and found that soon after osteogenic induction, the intracellular levels of LI RNA gradually increased, and then decreased at the end of differentiation (Fig. 3B). Using TaqMan qPCR-based CNV assay on HMW-gDNA, studies investigated whether the differentiation-induced LI expression was accompanied by changes in LI de novo genomic integrations. As shown in Fig. 3B, LI copy number increased significantly in mature osteoblasts (day 21) compared to undifferentiated cells (day 7). An engineered LI retrotransposition GFP-reporter based assay, previously used in several studies (Coufal, et al. Nature (2009), doi:10.1038 / nature08248; Ostertag, et al. Nucleic Acids Res (2000), doi:gkd248 [pii]; Macla, et al. Genome Res. (2017), doi:10.1101 / gr.206805.116), confirmed that LI propagation accompanies bone cells differentiation (Fig. 3E). Impairment of LI dynamics is detrimental for osteoblasts maturation To understand whether LI reactivation and genomic expansion in developing osteoblasts affect the osteogenic phenotype, LI RNA was knocked down by using fluoroarabinonucleic acids (FANA) modified ASOs specific for L1-ORF1 RNA sequence. FANA ASOs bind the target sequence and act as docking elements for RNAseH-mediated cleavage (Fig. 4A), thereby avoiding any off-target effects of RNA-induced silencing complex (RISC). Importantly, LI sequences are frequently present in the introns of genes and, consequently, in the nuclear precursors of many RNAs that possibly may become targets of anti-Ll ASOs. The ASOs that were used for knocking-down LI RNAs are mostly excluded from the nucleus of the cells (data not shown). This further reduces the possibility of off-targeting. A mix of five FANA ASOs was delivered every three days to differentiating osteoblasts and analyzed the expression of bone related genes by Real Time qPCR. Somewhat surprisingly, a moderate depletion of LI RNA (Fig. 4F) was sufficient to induce a significant reduction in the expression of the osteoblasts-related transcription factors Osterix (OSX, -43%) and Runt-related transcription factor 2 (RUNX2, -23%), analyzed 16 days after the induction of bone formation. Moreover, similar observations were made for the osteoblasts-specific gene Osteocalcin (OCN or BGLAP, -10%) and two of the main non-collagenous components of bone tissue Osteopontin (OPN, -40%) and Bone Sialoprotein (BSP, - 44%) (Fig. 4B). The results indicated that somatic LI RNA depletion undermined the cells ability to activate osteogenic program and to produce mineralized bone. NRTI-mediated inhibition of LI genomic expansion reduces maturation and impairs mineralization of developing osteoblasts Further, initial studies investigated whether block of ORF2-mediated LI retrotranspsosition by NRTI Lamivudine 3TC (3TC) preventing the expansion of LI copy number in developing osteoblasts, was affecting bone cells maturation and function. Differentiating osteoblasts were treated with and without 3TC every day for three weeks, and LI copy number was measured at three different time points of differentiation. As expected, the drug efficiently prevented LI DNA expansion during osteoblasts maturation (Fig. 4C). To assess the possible phenotypic effects of 3TC on osteogenic markers, expression of marker genes with (3TC) and without (DMSO) 3TC-treatment was analyzed in differentiating osteoblasts. In terminally differentiated cells (day 21) a highly significant reduced expression of OPN (-23%), OSX (-50%) and BSP (-60%) was observed (Fig. 4D). Coherently, mineral matrix deposition was significantly reduced (-60%) (Fig. 4E). Potential detrimental effects of the drug on cell viability, were excluded by Propidium Iodide staining followed by cell cycle FACS analysis on 3TC treated osteoblasts. Results of FACS cell cycle analysis of human mesenchymal stem cells treated (3TC) or not treated (DMSO) with lamivudine 3TC and measurement of apoptotic cell number in sub-Gl peak showed no significant differences (data not shown). These results corroborate the hypothesis of LI genomic expansion inhibition representing a tight link between NRTI treatment and mineralization loss in patients under ART. MSC differentiating into adipocytes lack LI mobilization Our findings uniformly demonstrate that MSC are unable to efficiently differentiate into functional osteoblasts when LI reactivation is inhibited. In postmenopausal osteoporosis red bone marrow changes from red to white as the fat content increases (Devlin, et al. Lancet Diabetes Endocrinol. (2015), doi:10.1016 / S2213-8587(14)70007-5; Ambrosi, et al. Cell Stem Cell (2017), doi:10.1016 / j.stem.2017.02.009). When mesodermal progenitors were differentiated ex vivo into fat cells (Fig. 5A) lipid droplets accumulated by adipocytes were easily detected with optical microscope (Fig. 5A). The increase of intracellular fatty acid content and adipogenic genes expression indicated that adipogenesis occurred successfully ex vivo (Fg. 9A-B). The expression and the copy number (Fig. 5B) of LI was monitored without observing significant changes upon differentiation. This is consistent with a previous report demonstrating that MSCs differentiating into adipocytes are not competent for retrotransposition (Macla, et al. Genome Res. (2017), doi:10.1101 / gr.206805.116). Finally, as shown in five different donors, 3TCmediated inhibition of LI expansion in MSC did not significantly affect adipogenic marker genes expression (Fig. 5C) and accumulation of intracellular lipid was unaltered (Fig. 5D). These studies led to a conclusion that in developing MSC somatic LI reactivation appears to be lineage-specific and required for osteogenic program, while it is not involved in the formation of fat cells, the prevalent cell type in the marrow niche of osteoporotic patients. LINE-1 retrotransposon RNA delivery to mesenchymal stem cells stimulates osteogenic differentiation and bone matrix production BONE LI COPY NUMBER CORRELATES WITH MATURE OSTEOBLASTS AND OSTEOCYTES ACTIVITY. Figures 6A-F show the correlation between LI copy numbers and the expression of osteoblast, osteocyte and osteoclast specific genes in the biopsies of the 30 selected participants. The RUNX2 transcript levels in osteoblasts were marginally significant for 5’UTR-ORF1 region (Figure 6A and 6B). Of four osteocyte markers, two were positively correlated with LI copy number: SOST (p=0.005 for 5’UTR-ORF1; p=0.0002 for ORF2) (Figure 6A, C and D) and MEPE (p=0.007 for 5’UTR-ORF1; p=0.0006 for ORF2) (Figure 6A, E and F). Significant correlation was also found between SPP1, commonly expressed in both mature osteoblasts and osteocytes, and 5’UTR-ORF1 region copy number (p=0.009) (Figure 6A and G), but not for the osteoclast specific markers ACP5 and CALCR (Figure 6A). These data strongly associate the reduced LI copy number in bone of osteoporotic patients with the impaired anabolic activity of osteoblast / osteocyte within the same tissue. Synthetic 11 RNA delivery toMSCfrom steoporotic patients triggers matrix mineralization in culture Osteoporotic bone shows a clear defect in LI reactivation in vivo possibly with negative consequences for osteoblastic bone formation. Thus, additional studies sought to test if direct LI RNA delivery to MSC differentiating to osteoblasts, obtained from osteoporotic donors, and could improve maturation and osteogenic capability. MSC were isolated from femur of four healthy donors and four patients and tested for their ability to support osteogenic differentiation (Figure 7B). A low dose (Figure 8A-G) of Cy5-conjugated synthetic full-length LI RNA was transfected to these differentiating osteoblasts, with high efficiency (Figure 7B). As expected, the exogenous lipofectamine-mediated RNA delivery resulted in the formation of intracellular vesicles (Figure 7B, red foci) where LI RNA was released from slowly over time (Kirschman, J. L. et al Nucleic Acids Res. 2017; doi:10.1093 / nar / gkx290). While cells from patients showed a markedly delayed and reduced mineralization (Figure 7A), transfected cells with LI RNA showed restored bone matrix production (Figure 7C). Of note, capping, 2’-O-Methylation of 5’ end, polyadenylation (200 adenosines), full substitution with 5-methylcytidine (m5C) and 75% substitution with pseudouridine were used to stabilize RNA and to bypass the intracellular innate immune system (Koski et al., J.Immunol 2004; doi:10.4049 / jimmunol. 172.7.3989; Pardi et al., Methods Mol. Biol. (2013). doi:10.1007 / 978-l-62703-260-5_2; Ludwig, J. et al. Nat. Struct. Mol. Biol. (2010). doi:10.1038 / nsmb.l863; Kariko et al., Immunity (2005). doi:10.1016 / j.immuni.2005.06.008; Anderson, B. R. et al. Nucleic Acids Res. (2010). doi:10.1093 / nar / gkq347; Kormann, et al. Nat. Biotechnol. (2011) doi:10.1038 / nbt.l733). Accordingly, neither apoptosis nor Interferon response genes were induced upon LI RNA transfection (Figure 8G). The results show that in all patients tested, the delivery of LI RNA to in vitro differentiating MSC greatly enhanced osteoblasts maturation and fully rescued the production of mineralized matrix. DISCUSSION Primary osteoporosis is one of the most common and costly diseases worldwide in relation to societal expenses and human incapacitation (Cunningham, et al. Osteoporos. Int. (2016), doi:10.1007 / s00198-016-3620-9). Secondary osteoporosis frequently occurring due to other diseases, medication and insufficient nutrition may be even more frequent, but receives less attention, especially patients under NRTLbased antiretroviral treatment. These studies report LI genomic structural variations are associated with bone density of 30 postmenopausal women, where higher amount of LI DNA copies was observed in healthy compared to osteoporotic bone (Fig. 1A). Notably, this structural LI-driven genomic variation between CTR and OP women was specifically observed in bone, but not in peripheral blood (Fig. 2H), also representing cells of mesenchymal origin, and obtained from the same donors. This in vivo observation in well-defined postmenopausal healthy versus osteoporotic women suggested that the expansion of LI elements may represent a genomic record of normal bone development and / or structural maintenance. Using mesenchymal stem cell progenitors from human marrow, adult bone formation ex vivo was recapitulated and the studies demonstrated a developmentally regulated reactivation and mobilization of LI accompanying maturation of osteoblasts (Fig. 3A-B). The ASOs-mediated degradation of LI RNA as well as the NRTI-mediated inhibition of LI retrotransposition during bone formation severely affected osteoblasts maturation with deleterious impact on mineralization (Fig. 4A-E). The dramatic phenotypic effect was not due to general cellular toxic effects (Fig. 5A-B) but appear to be lineage and osteogenic developmental program specific as shown also by the lack of significant effects of LI loss of function on adipogenesis (Fig. 5A-D). Notably, NRTI-mediated inhibition of LI genomic expansion did not alter the expression of key adipogenic genes nor lipid accumulation in developing adipocytes. Our findings that reduced LI activity in differentiating MSC leads to defective osteogenesis and reduced osteoblast dependent mineralization, but does not limit lipid accumulation in developing adipocytes, is coherent with the bone loss and the increased marrow fat tissue characterizing the primary osteoporosis disorder (Hawkes, et al. Bone (2018), doi:10.1016 / j.bone.2018.03.012). Moreover, it has been recently demonstrated that in vivo Lamivudine treatment increases marrow fat tissue in mice (Cecco, et al. Nature 566, 73-78 (2019). Our data are in accordance with a well-documented association between NRTLbased therapies and bone loss in patients (Grigsby, et al. Osteoporos. Int. (2004), doi:10.1007 / s00198-004-1627-0; Brown, et al. AIDS (2006), doi:10.1097 / QAD.0b013e32801022eb; Madeddu, et al, QJNuclMedMol Imaging (2004), and with the fact that ORF2 is an established and recognized target of NRTIs (Jones, et al. PLoS One (2008), doi:10.1371 / joumal.pone.0001547; Bachiller, et al. Brain. Behav. Immun. (2017), doi:10.1016 / j.bbi.2016.12.018). A possible contribution by osteoclasts was also considered. However, all the serum markers of bone resorption and osteoclast activity were similar in osteoporotic and healthy postmenopausal women (data not shown). Possible osteoclast involvement was especially examined by measuring tartrate resistant phosphatase 5b (TRAP5b) in serum of an extended cohort of 99 postmenopausal women of varying BMD (Fig. 10). There was small, but insignificant inverse correlation (p=0.13, R2=0.026) between BMD and serum TRAP5b. Also, no difference was observed between healthy and patients (p=0.31, data not shown). Thus, it is unlikely that an unnoticed effect of LI mediated action on osteoclasts can alter the present results. The higher levels of serum ALP in patients (p=0.019), although the values were within normal range, suggest a compensatory, but insufficient, bone formation to counteract the primary osteoporotic process. The functional significance of LI reactivation in non-pathological contexts like bone development as well as early embryogenesis (Kano, et al. Genes Dev. (2009), doi:10.1109 / TLA.2016.7459581; van den Hurk, et al. Hum. Mol. Genet. (2007), doi:10.1093 / hmg / ddml08; Fadloun, Nat. Struct. Mol. Biol. (2013), doi:10.1038 / nsmb.2495; Jachowicz, et al. Nat. Genet. (2017), doi:10.1038 / ng.3945) and developing brain (Coufal, et al. Nature (2009), doi:10.1038 / nature08248; Bedrosian, et al., doi:10.1126 / science.aah3378) remains to be understood. Indeed, LI and other transposons activity is a complex phenomenon involving several steps from long non-coding RNA (IncRNA) production, to controlled DNA damage and repair, chromatin remodeling and locus specific in cis effects at integration sites. Therefore, it is conceivable that more than one mechanism triggered by LI reactivation would contribute to tissue specific phenotype expression. Therefore, future studies will be required to shed light whether the inhibition of LI retrotransposons dynamics may be either a causal or a concomitant event to osteoporosis development. However, the reported facts that LI dynamics supports osteogenesis and that Ll-associated genomic structural variations distinguish healthy and osteoporotic bone in vivo, may suggest a previously unforeseen front of research for the development of strategies to mitigate bone loss in postmenopausal women and patients under antiretroviral regimen. II. LI RNA SUPPRESSION PRESERVES H3K9M3 HETEROCHROMATIN PREVENTING TISSUE DEGENERATION IN MURINE PROGERIA MODEL LINE-1 (LI) elements can cause cellular toxicity by activating a proinflammatory response due to the accumulation of LI RNA / cDNA in the cytoplasm independently of their retrotransposition. These studies investigated LI expression in the LAKI mice to find a correlation between transcription of interspersed repetitive sequences and the onset of the ageing phenotypes. MATERIALS AND METHODS Animals and in vivo treatments: All animal procedures were performed according to NIH guidelines and approved by the Committee on Animal Care at the Salk Institute. The mouse model of Hutchinson-Gilford progeria syndrome (HGPS) carrying the LMNA mutation G609G (LAKI) was generated by Carlos Lopez-Otm at the University of Oviedo, Spain and kindly donated by Brian Kennedy at the Buck Institute. Experiments with WT and LAKI mice were performed with mice of both genders at 8 weeks of age. For lifespan experiments, mice of both genders from a litter were randomly assigned to control and experimental groups. Any animals that appeared unhealthy before the start of experiments were excluded. No inclusion criterion was used. The mice were housed with a 12 hr light / dark cycle between 06:00 and 18:00 in a temperature-controlled room (22 ± 1 °C) with free access to water and food. LINE-1 specific or scramble 2'-deoxy-2'fluoro-P-d-arabinonucleotides (FANA ASO) were delivered by intraperitoneal or subcutaneous injection at the dose of 2-10 mg / Kg once every two weeks. Tail Tip Fibroblasts isolation and culture: Tail tip fibroblasts (TTFs) were isolated from WT and LAKI mice and cultured at 37 °C in DMEM (Invitrogen) containing Gluta-MAX, nonessential amino acids, and 10% fetal bovine serum (FBS). For LINE-1 Knockdown, TTFs has been incubated with 1 pM FANA ASO dissolved in culture medium every 2 days and collected after one week for senescent marker expression or immunohistochemistry. Histological analysis: For histological analysis, tissue samples were collected at 16 weeks of age after 8 weeks of FANA-ASO injection. Mice were perfused with PBS and 10% buffered formalin solution. Subsequently, tissues were fixed overnight at 4°C in 10% buffered formalin solution, cryopreserved overnight with 30% sucrose in PBS, embedded in OCT matrix (Kaltek) and flash frozen in liquid nitrogen. 7 pm cryosections were used for hematoxylin and eosin staining (H&E) or for immunohistochemistry. Immunohistochemistry: Cells were fixed with 4% formaldehyde in PBS at room temperature (RT) for 10 min. After fixation, cells were treated with 0.5% Triton X-100 in PBS for 5 min at RT. After blocked with 4% BSA in PBS for 30 min, cells were incubated at 4°C overnight with the primary antibody, followed by washing in PBS and incubation at RT for 1 hr with the corresponding secondary antibody. Cells were mounted using DAPI-Fluoromount-G (SouthernBiotech). Confocal image acquisition was performed using a Zeiss LSM 780 laser-scanning microscope (Carl Zeiss Jena). Images were taken at z sections of 0.25 pm intervals using the adequate lasers (488-nm, 568-nm, 633-nm and 405-nm). The laser intensity was typically set to 3%-5% transmission of the maximum intensity, and the settings were established to avoid signal saturation for any of the lasers. Tissues sections underwent permeabilization and antigen retrieval using HistoVT One (Nacalai Tesque). Subsequently, tissue sections were blocked with 5% fraction V BSA in PBS (Sigma-Aldrich) and immunoglobulin masking reagent (Vector laboratories) and incubated overnight with primary antibody. Finally, tissue sections were incubated with secondary antibody in blocking buffer at room temperature for 60 min (invitrogen). Tissue sections were mounted with DAPI Fluoromount G mounting medium (Southern Biotech.). Fluorescent in situ Hybridization: RNA-FISH or immuno-RNA FISH in TTFs and Tissue sections was performed according to the manufacturer’s standard protocol (Biosearch Technologies). Fixation was performed in 3% paraformaldehyde (PFA) for 15 min, followed by permeabilization with 1% triton X-100 for 5 minutes at room temperature prior to hybridization. Hybridization was performed at 38 degrees overnight, using 48 single-molecule probes designed to span the length of the active mouse LI spa element recognizing the majority of transcribed LINE-1 RNAs. The probe set was designed and produced by Biosearch Technologies. Custom Stellaris® FISH Probes labeled with CalFluor610 were designed against LI spa by utilizing the Stellaris® FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com / stellarisdesigner. LINE-1 RNA in vitro transcription and SUV39 enzymatic activity assay: LINE-1 RNA was in vitro transcribed using MAXIscript transcription Kit (Invitrogen) using pTNC7 plasmid containing the Llspa element as a template. Before reaction pTNC7 has been linearized with Notl restriction enzyme to transcribe the full-length sense LINE-1 RNA or Xhol restriction enzyme for antisense LINE-1 RNA. Transcribed RNA was purified with RNAeasy mini kit (qiagen) following the RNA clean up protocol. Recombinant Suv39Hl (Activemotif) Histone methyltransferase (HMT) activity was assayed using EpiQuik™ Histone Methyltransferase Activity / Inhibition Assay Kit (Epigentek) following manufacturer instructions. Briefly, 1 pg of recombinant SUV39H1 was incubated with lOng or 50ng of in vitro transcribed sense LINE-1 RNA. Antisense LINE-1 RNA was used as negative control as in Camacho et al. elife 2017. 1 pg of SUV39H1 alone or complexed with RNA were used for the assay in parallel with 1 pl of positive control enzyme. Absorbance was read at 450 nm on a microplate reader and HMT activity was calculated as: HMT activity = OD (sample - blank) / incubation time (Hr). RNA extraction and realtime qPCR: Total RNA was extracted from cells and tissues, using RNAeasy Plus mini kit (Qiagen) followed by cDNA synthesis using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad). qPCR was performed using SsoAdvanced SYBR Green Supermix or iQ Multiplex Powermix (Bio-Rad). mpl6-Fwd CGTGAACATGTTGTTGAGGC (SEQ ID NO:35); mpl6-Rev GCAGAAGAGCTGCTACGTGA (SEQ ID NO:36); mp21-Fwd CGGTGTCAGAGTCTAGGGGA (SEQ ID NO:37); mp21-Rev ATCACCAGGATTGGACATGG (SEQ ID NO:38); mAtf3-Fwd CTCTGGCCGTTCTCTGGA (SEQ ID NO:39); mAtf3-Rev GGTCGCACTGACTTCTGAGG (SEQ ID NO:40); mGadd45b-Fwd CGGCCAAACTGATGAATGT (SEQ ID NO:41); mGadd45b-Rev TCTGCAGAGCGATATCATCC (SEQ ID NO:42); mBtg2-Fwd GCGAGCAGAGACTCAAGGTT (SEQ ID NO:43); mBtg2-Rev TAGCCAGAACCTTTGGATGG (SEQ ID NO:44); mMMP13-Fwd TGATGAAACCTGGACAAGCA (SEQ ID NO:45); mMMP13-Rev GGTCCTTGGAGTGATCCAGA (SEQ ID NO:46); mIL6-Fwd TGATGCACTTGCAGAAAACA (SEQ ID NO:47); mIL6-Rev ACCAGAGGAAATTTTCAATAGGC (SEQ ID NO:48); mLap2a-Fwd TTCTCGAGCGACGAGGAG (SEQ ID NO:49); mLap2a-Rev AGCCTGGGCTTATCAGTTTT (SEQ ID NO:50); mGapdh-Fwd GGCAAATTCAACGGCACAGT (SEQ ID NO:51); mGapdh-Rev GTCTCGCTCCTGGAAGATGG (SEQ ID NO:52); mLl - Fwd GCGGTTCCTCAGAAAATTGG (SEQ ID NO:53); mLl - Rev TGCCCAGGAGAGGTATTGCT (SEQ ID NO:54); Senescence-associated beta-galactosidase enzymatic activity assay: Senescence-associated beta-galactosidase (SA-Pgal) assay was performed as described herein, briefly. Briefly, first, the cells were fixed in 4% paraformaldehyde for 5 min at room temperature. Next, the cells were washed twice with PBS and incubated overnight 37°C in staining solution containing 40 mM citric acid / Na phosphate buffer, 5 mM K4[Fe(CN)e] 3H2O, 5 mM K3[Fe(CN)e], 150 mM sodium chloride, 2 mM magnesium chloride and 1 mg / ml X-gal. Finally, the cells were washed twice with PBS and once with methanol. The plate was dried and pictures of cells were taken using bright field microscopy. Results and Discussion Using a multiplexed TaqMan assay, the expression of the three-active murine LI subfamilies (Ll-Tf, Ll-Gf and Ll-Af) was measured in tail tip fibroblasts (TTFs) isolated from wild-type (WT) and LAKI mice. In LAKI TTFs, a 3 to 6 times higher expression of LI elements was observed (Fig. 11 A). LI expression was further confirmed using an RNA Fluorescent in situ hybridization assay (FISH) and strikingly, a strong accumulation of LI RNA inside the nucleus was noticed (Fig. 11B). To Knock Down LI RNA from both cytosolic and nuclear compartment LI specific 2’F-ANA modified AON (LI-AON) was used. LI RNA depletion was confirmed by qPCR and RNA FISH (Fig. 11C-D). Interestingly, LAKI TTFs treated with Ll-AON showed a significantly lower expression of stress response genes in p53 tumor suppressor pathway (pl6, p21, Atf3 and Gadd45b), senescent-associated metalloprotease Mmpl3 and proinflammatory interleukin ILla (Fig. HE). Consistently, the number of cells positive for active senescence-associated P-galactosidase enzyme (SA-B-gal) is reduced in LAKI TTFs treated with Ll-AON (Fig. 11F). LAKI mice are characterized by significantly low levels of H3K9me3 and decondensed heterochromatin. Upon Ll-AON treatment, the intensity of H3K9me3 heterochromatin foci increased in LAKI cells compared to scramble treated control cells and closer to the levels in WT (wild type) cells (data not shown, and Fig. 12A). Consequently, the number of cells with abnormal nuclei structure was also reduced (data not shown and Fig. 12B) SUV39H1 / 2 enzyme, the chromatin modifier responsible for the trimethylation of H3K9, is able to bind repetitive RNAs, specifically LI RNA transcribed from the “sense” DNA strand. RNA Immuno-Precipitation (RIP) was performed and the results showed that both the 5’ end and the 3’ end of the LI RNA is bound by SUV39H1 / 2 (right bar for each pair of bars) protein in LAKI TTFs (Fig. 12C). Moreover, SUV39H1 / 2 foci colocalized with LI RNA spots in LAKI TTFs (data not shown). Considering that Ll-ASO treatment restored the heterochromatin and reduced the expression of senescence-associated genes, further studies were conducted to determine if LI RNA plays an inhibitory role on SUV39H1 / 2 accumulated in the nucleus of LAKI cells. AnH3K9 specific Histone Methyl Transferase assay was performed using a recombinant SUV39H1 / 2 protein in the presence of the LI sense-oriented transcript. LI antisense transcript was used as a negative control. LI sense RNA exerted a strong inhibitory effect on SUV39H1 / 2 enzymatic activity compared to the activity of the protein alone or LI antisense RNA (Fig. 12D). To test whether LI RNA depletion in vivo could have any beneficial effect on LAKI mice in preventing the onset of the senescent phenotype, LAKI mice were treated with both scramble and Ll-AON starting at 8 weeks of age. Mice were subjected to intraperitoneal injection of AON (T.B.D.). Ll-AON treated LAKI mice were sacrificed at 16 weeks of age for molecular and histological analysis. The knockdown of LI RNA in several tissues including skin, tibialis anterior skeletal muscle, liver, kidney, spleen and stomach was confirmed by qPCR (Fig. 13A). Importantly, 8 weeks of LI-AON treatment restored the levels of the H3K9me3 heterochromatin mark compared to scramble AON injected mice (data not shown). Moreover, LI-AON treatment reduced the expression of SASP genes in different tissues analyzed (Fig. 13B). The beneficial effects of LI FANA oligos in human cells from Progeria patients (HGPS) or recapitulating Werner Syndrome (WRN - / -) were also investigated. Consistently with data obtained in mice, both Progeria and Werner syndrome human cells are characterized by a higher expression of LI RNA (Fig.l4A). Using human specific Ll-AON cells shows a reduced SA-B-Gal activity and a reduced expression of senescent associate genes (FIG.14B-D). Further even in the human system LI RNA depletion is associated to the restoration of H3K9me3 heterochromatin (FIG.14E-F). To assess the efficacy of the treatment in preserving the organs from pathological changes associated with premature ageing a histological analysis of tissues that are compromised in Progeria syndrome (Cesta, 2006; Khanna et al. 1988; Kurbanand Bhawan, 1990; Zhou et al., 2008; Osorio et al., 2011) was performed. Hematoxylin-Eosin staining revealed that mice injected with Ll-AON have an improved histological profile of skin, spleen, stomach and kidney (data not shown. In particular, skin is characterized by a thicker epidermal layer, germinal nuclei are wider in spleen, the volume of the epithelial layer of the stomach is higher and the diameter of the kidney glomeruli is increased (Fig. 13C). Altogether, these results confirm that a stable reduction of LI RNA improved age-associated histological changes in multiple organs of LAKI mice. Lastly, the bodyweight and the lifespan of treated mice was monitored. Consistently with the histological analysis, Ll-AON treatment prevents the gradual loss of body weight typical of LAKI mice (Fig. 13D) and an increase of (15-25%) in the median lifespan was observed, compared to control and untreated mice (Fig. 13E). Endogenous LI elements are transcriptionally active in both physiologically (cit.) and pathologically (HGPS, Fig. 11A-11E) aged cells. This study shows that in a model of accelerated ageing like Progeria syndrome the accumulation of LI RNA in the nucleus results in the loss of heterochromatin and increased expression of SASP related genes. Here the data show that the knockdown of this repetitive RNA using AON prevented H3K9me3 heterochromatin de-condensation and reduced the expression of age-associated genes. Furthermore, LI RNA depletion in vivo in LAKI mice delayed the onset of the premature ageing phenotype in different tissues, loss of body weight and increased the lifespan of treated mice. Additionally, a novel function for LI RNA as a negative regulator of SUV39H1 / 2 was demonstrated In summary, in this study, for the first time shows that an antisense oligonucleotide-based therapy against a repetitive RNA is sufficient to ameliorate the ageing-associated phenotypes in LAKI mice. Therefore, AON based intervention specifically, or other interventions reducing the levels of LI RNA in vivo, can be an attractive treatment option to devastating disease like progeria syndrome. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

2020365129   24 Aug 20261. A composition for increasing L1HS-Ta1 copy number, comprising an expression vector encoding L1HS-Ta1 or a functional fragment thereof, in pharmaceutically acceptable carrier in an effective amount to increase expression of L1HS-Ta1 and one or more osteoblast-related transcription factors, wherein the L1HS-Ta1 comprises SEQ ID NO:1.

2. The composition of claim 1, wherein the expression vector encodes the ORF1 or ORF2 of the L1HS-Ta1.

3. The composition of claim 1 or 2, wherein the expression vector is selected from the group consisting of a plasmid, minicircle DNA (mcDNA) and viral vector.

4. The composition of claim 3, wherein the expression vector is selected from the group consisting of bacteriophage, baculoviruses, tobacco mosaic virus, herpes virus, cytomegalo virus, retrovirus, vaccinia virus, adenovirus and adeno-associated virus.

5. The composition of claim 3 or 4, wherein the expression vector is in a bone progenitor cell.

6. The composition of claim 5, wherein the bone progenitor cell is a bone marrow derived mesenchymal stem cell.

7. The composition of claim 5 or 6, wherein the expression vector is an adeno-associated virus.

8. A method of increasing L1HS-Ta1 expression in a subject in need thereof, comprising administering to the subject, the composition of any one of claims 1-7, in an effective amount to increase L1HS-Ta1 expression in one or more cells in the subject.

9. The method of claim 8 wherein the composition comprises bone progenitor cells genetically engineered to express L1HS-Ta1 or a functional fragment thereof, wherein the composition is administered to a site in the subject, in need thereof.

10. The method of claim 9, wherein the cells are autologous cells.

11. The method of claim 9 or 10, comprising administering the cells to a site in need of bone growth or repair.

12. The method of any one of claims 9-11, wherein the site is a spinal fusion site or a bone fracture site.

13. The method of any one of claims 9-12, wherein the composition is effective increase bone mass index at a fracture site, or at a spinal fusion site in a subject diagnosed with a condition selected from the group consisting of degenerative disk disease, spondylolisthesis, spinal stenosis, scoliosis, Fractured vertebra, Infection, herniated disk and tumor.

14. The method of any one of claims 8-13, wherein the L1HS-Ta1 comprises SEQ ID NO:2020365129   24 Aug 20261.

15. A composition for reducing L1 RNA, comprising one or more agents for inhibiting L1 RNA expression, in pharmaceutically acceptable carrier wherein the one or more compositions for inhibiting L1 RNA are selected from the group consisting of a L1 RNA antisense oligonucleotide (ASO), a L1 RNA ORF1 ASO and a L1 RNA ORF2 ASO.

16. The composition of claim 15, wherein the ASO is complementary to a fragment of L1 RNA, L1 RNA ORF1 or a L1 RNA ORF2, and optionally, wherein the ASO is no more than 24 nucleotides in length.

17. A method of reducing L1 RNA copy number in a subject in need thereof, comprising administering the composition of any one of claims 15-16, to the subject.

18. The method of claim 17, wherein the composition is administered by injection.

19. The method of claim 18, comprising subcutaneously administering the composition to the subject.

20. The method of any one of claims 15-19, wherein the composition alleviates one or more symptoms of progeria syndrome.

21. The method of any one of claims 15-19, wherein the composition alleviates one or more symptoms of skin aging.

Images