Method for construction of nucleic acid self-assembly-mediated ADC drug and use thereof

Abstract

The present invention relates to the field of biotechnology drugs. In particular, provided in the present invention is an antibody-drug conjugate (ADC) complex based on a complementary and paired nucleic acid skeleton. The ADC complex is a polymer formed by means of compounding n monomers having complementary and paired nucleic acid skeletons, wherein the polymer contains: m "targeting monomers", which are cell-surface-targeting antibodies or proteins linked to nucleic acid single strands, and k "drug monomers", which are drugs (toxin payload) linked to nucleic acid single strands, n is a positive integer of 2-8, m is a positive integer of 1-3 and m < n, and k is a positive integer of 1-(n-m). In the polymer, each nucleic acid single strand of the monomer is complemented with a nucleic acid single strand of the other 1-3 monomers to form a complementary and paired double strand by means of base complementation, so that a complementary and paired nucleic acid skeleton structure is formed.

Description

Construction methods and applications of ADC drugs mediated by nucleic acid self-assembly Technical Field

[0001] The present invention relates to the field of biotechnology drugs, and in particular to a method for constructing and applying an ADC (antibody-drug conjugate) mediated by nucleic acid polymerization, i.e., an antibody-drug conjugate. Background Art

[0002] ADCs are targeted drugs developed for cancer treatment that can specifically deliver highly cytotoxic chemotherapy drugs to cancer cells, reducing nonspecific cell damage in the body. ADCs work by binding antibodies to receptors on the surface of cancer cells, leading to cellular internalization. The drug is then released within the lysosome, escapes the lysosome, and enters the cytoplasm, causing cell death. The concept of ADCs was proposed long ago, but due to various limitations in knowledge and technical conditions, the development of related drugs was slow and arduous. However, with technological advances and the accumulation of clinical research experience, ADC drugs have gradually emerged from their slump in recent years and have become a mainstream topic in biopharmaceutical development.

[0003] Currently in the field, the preparation of ADC molecules focuses on the coupling between the compound composed of a chemical linker and a small molecule payload (linker-payload) and the monoclonal antibody molecule. The classic method is to site-specifically couple the linker to the lysine or cysteine ​​site on the surface of the antibody molecule through a specific chemical reaction. However, since there are usually multiple lysine or cysteine ​​sites on the antibody molecule, and the steric hindrance effect near each amino acid is not exactly the same, this leads to the number of linker-payloads actually coupled to the antibody molecule, namely the DAR (Drug-Antibody Ratio) being uneven, which in turn brings great uncertainty to the analysis of various aspects such as the efficacy, pharmacokinetics, biodistribution, and toxicology of the ADC, and also leads to high production costs of ADC. However, since the uneven DAR situation is due to the inherent defects of the traditional coupling method, even for ADC molecules that have been approved by the FDA, the DAR is highly uneven.

[0004] Therefore, there is an urgent need in this field to develop a simple, flexible, efficient and modular method for preparing ADC drugs, which can enable ADCs to have completely uniform DAR.

[0005] Summary of the Invention

[0006] The main purpose of the present invention is to provide a simple, flexible, efficient and modular method for preparing ADC drugs, which can make ADC have completely uniform DAR.

[0007] In the first aspect of the present invention, an antibody-drug conjugate (ADC) based on a complementary nucleic acid backbone is provided. The antibody-drug conjugate is a multimer formed by the complexation of n monomers having complementary nucleic acid backbones. Among them, the multimer comprises: m targeting monomers, where the "targeting monomer" is an antibody or protein targeting the cell surface linked to a nucleic acid single strand, and k drug monomers, where the "drug monomer" is a drug (toxin payload) linked to a nucleic acid single strand. And n is a positive integer from 2 to 8, m is a positive integer from 1 to 3 and m < n, k is a positive integer from 1 to (n - m); in the multimer, the nucleic acid single strand of each monomer forms a complementary double strand with the nucleic acid single strands of 1 - 3 other monomers through base complementarity, thereby forming a complementary nucleic acid backbone structure.

[0008] In another preferred example, n = 3 - 8.

[0009] In another preferred example, the targeting monomer has the structure of formula I:

[0010] A–W-D0 (I)

[0011] And the drug monomer has the structure of formula II:

[0012] D1–W–D2 (II)

[0013] In the formula,

[0014] A is an antibody or protein;

[0015] W is a nucleic acid single strand sequence;

[0016] D0 is none or a drug;

[0017] D1 is none or a drug

[0018] D2 is none or a drug

[0019] “–” is a linker or bond,

[0020] At least one of D0, D1 and D2 is a drug.

[0021] In another preferred example, “–” is a covalent bond or a linker or a combination of both.

[0022] In another preferred example, A is an antibody or protein that specifically binds to a cell surface receptor and causes endocytosis.

[0023] In another preferred example, the antibody or protein is selected from the group consisting of: anti-HER2 antibody, anti-HSA antibody, anti-PD-L1 antibody or a combination thereof.

[0024] In another preferred embodiment, the antibody or protein is an anti-HER2 nanobody, and its amino acid sequence is shown in SEQ ID NO: 1.

[0025] In another preferred embodiment, D1 / D2 is a small molecule or polypeptide toxin used to kill cells.

[0026] In another preferred embodiment, the nucleic acid chain is resistant to degradation and is selected from the group consisting of left-handed nucleic acid, peptide nucleic acid, locked nucleic acid, morpholinophosphate nucleic acid, thio-modified nucleic acid, 2'-fluoro-modified nucleic acid, 5-hydroxymethylcytosine nucleic acid, or a combination thereof.

[0027] In another preferred embodiment, in the multimer, the component A of each targeting monomer is the same or different.

[0028] In another preferred embodiment, in the multimer, the component D1 of each drug monomer is the same or different, and the component D2 of each drug monomer is the same or different.

[0029] In another preferred embodiment, in the multimer, W of each monomer is different.

[0030] In another preferred embodiment, the nucleotides at both ends and / or in the middle of W can be linked to drugs D1 or D2 through chemical modification.

[0031] In another preferred embodiment, the nucleic acid single-stranded sequence W in the targeting monomer (Formula I) and the drug monomer (Formula II) has a structure shown in Formula III:

[0032] X1–R1–X2–R2–X3 (III)

[0033] in,

[0034] R1 is base complementary pairing region 1;

[0035] R2 is base complementary pairing region 2;

[0036] X1, X2 and X3 are each independently a null or redundant nucleic acid;

[0037] “–” is a key.

[0038] In another preferred embodiment, the lengths of R1 and R2 are independently 10-20 bases, preferably 14-16 bases.

[0039] In another preferred embodiment, the length of X1 is 0-5 bases.

[0040] In another preferred embodiment, the length of X3 is 0-5 bases.

[0041] In another preferred embodiment, the length of X2 is 0-3 bases.

[0042] In another preferred embodiment, the sequence of X2 is selected from the group consisting of A, AA, AGA or AAA.

[0043] In another preferred embodiment, R1 of each monomer forms a base complementary pairing structure with R2 of the left adjacent (or left side) monomer; and R2 forms a base complementary pairing structure with R1 of the right adjacent (or right side) monomer.

[0044] In a second aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0045] (a) the antibody-drug conjugate based on a compatible nucleic acid backbone as described in the first aspect,

[0046] wherein the targeting monomer is selected from a targeting monomer library; the drug monomer is selected from a drug monomer library; and

[0047] (b) a pharmaceutically acceptable carrier.

[0048] In another preferred embodiment, the pharmaceutical composition comprises a 2-8-mer complex.

[0049] In another preferred embodiment, the assembly units in the targeted monomer library contain antibodies or proteins that can specifically bind to cancer cell surface receptors and cause them to be internalized.

[0050] In another preferred embodiment, the assembly units in the drug monomer library contain small molecule or polypeptide drug moieties that kill cells.

[0051] In another preferred embodiment, the targeting monomers and drug monomers in the pharmaceutical composition can be selected according to personalized treatment needs, and the multimeric ADC drug can be prepared by instant self-assembly.

[0052] In another preferred embodiment, the ratios of A / (D1+D2) and D1 / D2 in the pharmaceutical composition can be selected according to individual treatment needs.

[0053] In the third aspect of the present invention, a nucleic acid sequence library is provided, wherein the nucleic acid library comprises nucleic acid sequences for forming the antibody-drug conjugate based on the compatible nucleic acid backbone as described in the first aspect.

[0054] In another preferred embodiment, the nucleic acid sequence W has a structure shown in Formula III:

[0055] X1–R1–X2–R2–X3 (III)

[0056] in,

[0057] R1 is base complementary pairing region 1;

[0058] R2 is base complementary pairing region 2;

[0059] X1, X2 and X3 are each independently a null or redundant nucleic acid;

[0060] “–” is a key.

[0061] In a fourth aspect of the present invention, there is provided a use of the nucleic acid sequence library described in the third aspect for preparing an antibody-drug conjugate with a compatible nucleic acid backbone as described in the first aspect.

[0062] In a fifth aspect of the present invention, a method for preparing the antibody-drug conjugate described in the first aspect is provided, comprising the steps of:

[0063] (1) A nucleic acid single strand is chemically coupled to a cytotoxic drug through site-specific coupling to form a nucleic acid-drug assembly unit;

[0064] (2) site-specific coupling of the antibody to the complementary nucleic acid single strand to form an antibody-nucleic acid assembly unit;

[0065] (3) The antibody-nucleic acid assembly unit and the complementary nucleic acid-drug assembly units rapidly self-assemble to form the antibody-drug conjugate through the nucleic acid complementary sequence.

[0066] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 shows a schematic diagram of ADC drug self-assembly mediated by nucleic acid chain interaction

[0068] Figure 2 shows the electrophoresis gel of nickel column affinity purification of anti-HER2 nanobody

[0069] Figure 3 shows the electrophoresis gel of the coupling efficiency of anti-HER2 nanobody and L-DNA

[0070] Figure 4 shows the ion exchange purification of anti-HER2 nanobody-L-DNA conjugate

[0071] Figure 5 shows the coupling efficiency of DM4-L-DNA1 identified by negative ion mode ESI ion trap LC / MS / MS.

[0072] Figure 6 shows the separation results of DM4-L-DNA1 phenyl-agarose hydrophobic purification column

[0073] Figure 7 shows the coupling efficiency of MMAE-L-DNA1 identified by negative ion mode ESI ion trap LC / MS / MS.

[0074] Figure 8 shows the electrophoresis gel images of the self-assembly of nanoantibody drug conjugates. a. SDS-PAGE; b. 2% agarose DNA gel

[0075] Figure 9 shows the in vitro cell killing activity evaluation of Nanobody drug conjugates.

[0076] Figure 10 shows the in vitro killing activity evaluation of Nanobody Drug Conjugates in different tumor cell lines.

[0077] Figure 11 shows the changes in tumor volume in BALB / c-nu mice inoculated subcutaneously with BT474 human breast cancer model in different dosing groups. Data are presented as Mean ± SEM. N = 3-6 mice / group.

[0078] Figure 12 shows endpoint tumor weights in BALB / c-nu mice subcutaneously inoculated with BT474 human breast cancer in a different dosing group. Data are presented as mean ± SEM. Independent-samples T-test was used for comparison with the PBS group. N = 3-6 mice / group.

[0079] Figure 13 shows the body weight changes of BALB / c-nu mice inoculated subcutaneously with the BT474 human breast cancer model in different dosing groups. Average body weight is expressed as mean ± SEM. N = 3-6 mice / group. DETAILED DESCRIPTION

[0080] After extensive and in-depth research, the inventors unexpectedly developed an ADC complex based on the self-assembly of nucleic acid chains, as well as its preparation method and application. Leveraging this self-assembly feature, the inventors developed a library of ADC drug assembly units for the immediate preparation of ADC complexes. Using this preparation method, the assembly unit library can rapidly, efficiently, cost-effectively, and with high yields prepare ADC drugs with highly specific, targeted, and highly uniform DARs, tailored to the needs of personalized treatment. This is the basis for the present invention.

[0081] Specifically, the present invention provides a multivalent protein drug comprising n protein drug units, wherein each drug unit comprises a single drug component and a different nucleic acid component connected to the drug component; n is a positive integer ≥ 2; the n different nucleic acid components form n polymers through nucleic acid base complementarity, thereby constituting the multivalent protein drug; the multivalent protein drug of the present invention forms a stable nucleic acid base complementary pairing structure through rapid assembly (e.g., 1 minute) (rather than complex peptide bonds or other chemical modifications). Experiments have shown that the drug of the present invention can increase its molecular weight by increasing its valency, thereby extending its half-life in animals.

[0082] Specifically, the present invention provides an ADC conjugate based on a complementary nucleic acid backbone, which comprises n units that can precisely self-assemble to form an n-mer complex; n is a positive integer of 2. Among them, m targeting monomers are antibodies or proteins that target cells and are linked to nucleic acid single strands, k drug monomers are drugs (toxin payloads) linked to nucleic acid single strands, and n is a positive integer of 3-8, m (<n) is a positive integer of 1-4, and k is a positive integer of 1-(n-m); in the said multimer, the nucleic acid single strand of each monomer forms a complementary double strand with the nucleic acid single strands of 1-3 other monomers through base complementarity, thereby constituting the n-mer ADC conjugate; the ADC conjugate of the present invention can form a stable nucleic acid base complementary pairing structure only through rapid assembly (such as 1 minute), and at the same time has a uniform DAR (while the ADC drugs obtained by random chemical modification). Experiments show that the ADC conjugate of the present invention can specifically target cells to cause endocytosis, thereby killing the cells.

[0083] Term

[0084] As used herein, the terms "antibody-drug conjugate of the present invention", "antibody-drug conjugate of the present invention", "conjugate of the present invention", "antibody-conjugated drug of the present invention", "multimer ADC drug", "ADC conjugate based on a complementary nucleic acid backbone of the present invention", "ADC of the present invention" or "ADC drug of the present invention" are used interchangeably and refer to an ADC complex having the structure shown in Formula I.

[0085] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention

[0086] belongs. As used herein, when referring to a specifically recited numerical value, the term "about" means that the value can vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0087] ADC

[0088] In the present invention, the ADC refers to an antibody-drug conjugate (Antibody-drug conjugates), which includes an antibody that can specifically target cell surface molecules, a drug with cytotoxicity, and a linker that connects the antibody and the drug.

[0089] Typically, the antibodies in the ADC include, but are not limited to, nanobodies, single-chain antibodies, Fabs, monoclonal antibodies, etc.

[0090] Typically, the drugs in the ADC include but are not limited to MMAE / MMAF, DM1 / DM4, Calicheamicin, Duocarmycin, PBD, amanitin, SN38, DXd, PNU-159682, etc.

[0091] In a preferred embodiment of the present invention, the antibody is an anti-HER2 single-domain antibody, the drug is DM4 or MMAE, and the linker is a complementary nucleic acid single chain.

[0092] Targeted Antibodies / Protein A

[0093] In the present invention, the antibody / protein element portion can specifically target cell surface molecules and induce endocytosis.

[0094] Typically, the antibodies / proteins include but are not limited to nanobodies, single-chain antibodies, Fab, monoclonal antibodies, cytokines, hormones (such as insulin, growth hormone, etc.), and polypeptides.

[0095] In a preferred embodiment of the present invention, the antibody component is an anti-HER2 single domain antibody for targeting the HER2 receptor on BT474 cells. The amino acid sequence of the anti-HER2 single domain antibody is shown in SEQ ID NO: 1.

[0096] In another preferred embodiment of the present invention, the antibody component further comprises an anti-HSA antibody, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0097] SEQ ID NO: 2, amino acid sequence of anti-HSA nanobody mutant:

[0098]

[0099] Drug D

[0100] In the present invention, the drug element portion is a small molecule or polypeptide drug payload commonly used in ADC drugs, which can enter the lysosome after the targeting monomer-drug monomer complex is endocytosed by the cell and then be released into the cytoplasm.

[0101] Typically, the drug element portion includes but is not limited to microtubule toxins such as auristatins, maytansinoids, epothilone, toxoids, tubulysins, vinorelbine, etc.; DNA toxins such as calicheamicins, duocarmycins and analogs, PBD-dimers, doxorubicin, topotecan, blemycin A2, dactinomycin, mitomycin C, etc.; transcription toxins such as amatoxins, thailanstatin A, etc.; inhibitors such as oligomycins, ipatasertib, etc.

[0102] In a preferred embodiment of the present invention, the drug component is MMAE, which acts on tubulin and destroys the microtubule network of cells, leading to cell cycle arrest and cell apoptosis.

[0103] Nucleic acid chain W

[0104] As used herein, the terms "nucleic acid chain," "single-stranded nucleic acid," "single-stranded nucleic acid," and "nucleic acid element portion" are used interchangeably and refer to a nucleic acid sequence that is connected to an antibody, protein, or drug (toxin payload) and constitutes the compatible nucleic acid backbone structure of the antibody-drug conjugate of the present invention.

[0105] In the present invention, the nucleic acid chain is resistant to degradation in vivo and does not induce a strong natural immune response.

[0106] Typically, the nucleic acid element portion includes, but is not limited to, left-handed nucleic acid, peptide nucleic acid, locked nucleic acid, morpholinophosphate nucleic acid, thioate-modified nucleic acid, 2'-fluoro-modified nucleic acid, and 5-hydroxymethylcytosine nucleic acid.

[0107] In a preferred embodiment of the present invention, the nucleic acid element is composed of four strands of left-handed DNA of different sequences, which can precisely self-assemble into a stable tetrameric nucleic acid backbone. Left-handed nucleic acids are mirror images of naturally occurring right-handed nucleic acids (D-nucleic acids) and can be divided into left-handed DNA (L-DNA) and left-handed RNA (L-RNA). Left-handedness (chiral centers) are primarily found in the deoxyribose or ribose moieties of nucleic acids, appearing as mirror images. Therefore, left-handed nucleic acids cannot be degraded by ubiquitous nucleases (such as exonucleases and endonucleases) in plasma.

[0108] Preparation method

[0109] The present invention also provides a method for preparing an ADC (antibody-drug conjugate) complex based on a compatible nucleic acid backbone, comprising the steps of:

[0110] 1. Design and preparation of L-nucleic acid chain framework

[0111] According to the present invention, the L-nucleic acid chain framework is formed by base pairing of two or more L-nucleic acid single chains. The 5' or 3' end of each L-nucleic acid single chain is activated to a group (such as NH2, etc.) for subsequent modification, and then one end of a connector (such as SMCC, SBAP, etc.) is coupled to the activated group on the L-nucleic acid single chain. The L-nucleic acid with a connector can be assembled into the desired L-nucleic acid chain framework. In another preferred embodiment, the activated functional group (such as aldehyde, maleimide, etc.) at the 5' or 3' end of the L-nucleic acid single chain is already included in the nucleic acid synthesis. After determining that the L-nucleic acid with a connector can successfully self-assemble into a framework, the L-nucleic acid single chains with the connector can be coupled to antibodies for subsequent assembly. The L-nucleic acid framework of the present invention can basically be prepared by the following steps.

[0112] 1.1 Design of L-nucleic acid single strands capable of rapid self-assembly

[0113] The desired polyvalent number n (e.g., trimer, tetramer) is determined; based on the polyvalent number n, the desired number of L-nucleic acid single strands n is determined; and the corresponding number of L-nucleic acid single strand sequences is designed to optimize base pairing to regulate the stability of the target nucleic acid framework and reduce the possibility of nonspecific pairing between nucleic acid strands. Details of nucleic acid sequence design are described in detail in the Summary of the Invention and Examples.

[0114] In a preferred embodiment of the present invention, the following L-DNA is prepared:

[0115] L-DNA1: 5'AGGCGATCACAATCCAAATGAGCGTGTTACGG 3' (SEQ ID NO: 4)

[0116] L-DNA2: 5'ACCGTAACACGCTCAAAACCGAAGTGCCAATT 3'(SEQ ID NO:5)

[0117] L-DNA3: 5'AAATTGGCACTTCGGAAAACTATGCGGCTGCT 3' (SEQ ID NO: 6)

[0118] L-DNA4: 5'AAGCAGCCGCATAGTAAAGGATTGTGATCGCC 3' (SEQ ID NO:7)

[0119] 1.2 Activation of L-DNA or L-RNA

[0120] Activation of L-nucleic acids involves modification of their 5' (X1) or 3' (X3) ends with reactive groups and subsequent coupling with linkers. Reactive group modification can be custom-made by nucleic acid synthesis companies; linkers typically possess bifunctional groups, meaning one end can couple to the reactive group of the nucleic acid and the other end can connect to a specific site on the protein (e.g., NH3, SH).

[0121] According to a preferred embodiment of the present invention, all L-nucleic acids constituting the framework are modified with NH2 at the 5' end, thereby completing the activation of the L-nucleic acid and can be subsequently coupled to the sulfhydryl group on the cysteine ​​of the protein.

[0122] 2. Preparation of Protein-L-Nucleic Acid Complex

[0123] First, the 5' or 3' end of the L-nucleic acid is modified with an active group (such as NH2), and then another active group is introduced at a specific site of the protein (such as introducing a cysteine ​​mutation at the C-terminus of the protein). Then, a double linker molecule (such as SMCC) is used to bridge the L-nucleic acid and protein, and the protein-L-nucleic acid complex is purified by affinity chromatography, ion exchange chromatography, etc.

[0124] 3. Preparation of Drug-L-Nucleic Acid Complex

[0125] The L-nucleic acid is modified with NH2 at the 5' end for activation and subsequent ligation. The drug typically contains a -SuO / -NHS reactive group that can couple to the reactive group of the nucleic acid.

[0126] The main advantages of the present invention include:

[0127] (1) The present invention can flexibly and efficiently prepare multimeric ADC compound drugs, and can prepare personalized ADC drugs in a short time according to the combination of target requirements and drug payload for personalized treatment;

[0128] (2) The ADC drug prepared by the present invention can easily achieve highly uniform DAR;

[0129] (3) The present invention utilizes the modular and precise self-assembly characteristics to easily realize bispecific and even trispecific ADC drugs while ensuring highly uniform DAR;

[0130] (4) The present invention utilizes the modular and precise self-assembly characteristics to easily realize ADC drugs with two different drug payloads while ensuring highly uniform DAR, which is used to solve the problem of ADC resistance.

[0131] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0132] Example 1: Preparation of Anti-HER2 Nanobodies

[0133] A His tag and a double Strep tag were added to the amino terminus of the Nanobody for protein purification, and a cysteine ​​mutation was introduced at the carboxyl terminus of the Nanobody for site-directed nucleic acid conjugation. The gene sequence of the anti-HER2 Nanobody was optimized to the codons preferred by E. coli and then subcloned into the pET-28b(+) plasmid. The amino acid sequence of the anti-HER2 Nanobody is SEQ ID NO: 1.

[0134] SEQ ID NO: 1, amino acid sequence of anti-HER2 nanobody mutant:

[0135]

[0136] Transform E. coli shuffle T7 with 1 µl of the constructed expression vector. A single colony of the transformed shuffle T7 was transferred to LB medium (containing 50 µg / mL kanamycin) and cultured at 37°C until an OD600 of 0.6-0.8 was reached. Expression was induced by adding IPTG to a final concentration of 0.1 mM. Culture was continued at 16°C for 18 to 20 hours. After expression, the cells were harvested by centrifugation and resuspended in Tris buffer (20 mM Tris-HCl, 200 mM NaCl, pH 7.4) supplemented with a small amount of reducing agent (e.g., 10 µM TCEP) and a protease inhibitor cocktail (Sigma). The cells were disrupted by sonication and the supernatant was collected after centrifugation at 17,000 rpm for 30 minutes. The nanoantibodies in the supernatant were purified using a His-tag affinity column. After the supernatant passed through the column, the column was washed with Tris buffer (50mM Tris-HCl, 200mM NaCl, 10μM TCEP, pH 7.4) containing 10mM, 30mM, and 50mM imidazole, respectively, until the impurities no longer flowed out (the flow-through was collected and the A280 absorption of the flow-through was detected by UV to determine whether the impurities were completely removed). The nanoantibodies bound to the column were eluted with Tris buffer (50mM Tris-HCl, 200mM NaCl, 10μM TCEP, pH 7.4) containing 250mM imidazole, and finally a nanoantibody with higher purity was obtained (Figure 2).

[0137] Example 2: Coupling and purification of nanobody-nucleic acid conjugates

[0138] The purified anti-HER2 nanobody in Example 1 was mixed with a 1- to 2-fold molar excess of SMCC-L-DNA single strand (the molar ratio can be determined through preliminary experiments) and placed at 4°C for overnight coupling reaction. The coupling efficiency can reach over 90% ( FIG3 ).

[0139] Unreacted SMCC-L-DNA single strands were removed using a Strep affinity column, and the nanoantibody and nanoantibody-L-DNA mixture were collected. The buffer was replaced with the loading buffer of the anion exchange column. Taking advantage of the negatively charged property of DNA, an anion exchange column (HiTrap Q HP column) was used to further separate and purify the nanoantibody-L-DNA to remove unreacted nanoantibodies. The separation process was achieved by gradient elution. The loading buffer was 20mM Tris-HCl, 15mM NaCl, pH 8.5, and the elution buffer was 20mM Tris-HCl, 1M NaCl, pH 8.5. The elution buffer was 0-100% for gradient elution. Unreacted nanoantibodies and nanoantibody-L-DNA peaks appeared one after another. Since DNA has multiple conformations in the elution buffer, three elution peaks of nanoantibody-L-DNA conjugates appeared during gradient elution (Figure 4). Nanobody-L-DNA was collected, concentrated, and then the buffer was replaced with 50 mM NaH2PO4, 150 mM NaCl, pH 7.4 using a PD-10 desalting column.

[0140] Example 3: Conjugation of toxin DM4-nucleic acid conjugates

[0141] Take the DM4-L-DNA1 coupling as an example. First, SPDB-DM4 powder is dissolved in 100% dimethylacetamide to obtain a 10mM SPDB-DM4 solution. L-DNA1 is dissolved in 100% phosphate buffer to obtain a 1mM L-DNA1 solution. The 1mM L-DNA1 solution, 10mM SPDB-DM4 solution, and phosphate reaction solution are then mixed in a volume ratio of 2:5:3 and allowed to react overnight. The coupling efficiency can reach approximately 70%. The reaction products can be detected and analyzed by negative ion ESI ion trap liquid chromatography-mass spectrometry (Figure 5).

[0142] Example 4: Purification of toxin DM4-nucleic acid conjugate

[0143] Taking the purification of DM4-L-DNA1 as an example, the DM4-L-DNA1 reaction product was loaded onto a phenyl-agarose hydrophobic purification column and eluted in a single step with 20% ethanol, completely separating L-DNA1 from DM4-L-DNA1 (Figure 6). The separated products were then identified by negative ion ESI ion trap liquid chromatography-mass spectrometry.

[0144] Example 5: Conjugation of toxin MMAE-nucleic acid conjugates

[0145] Take the MMAE-L-DNA1 coupling as an example. First, SuO-vc-PAB-MMAE powder was dissolved in 100% dimethylacetamide to obtain a SuO-vc-PAB-MMAE solution with a final concentration of 10 mM. L-DNA1 was then dissolved in 100% phosphate buffer to obtain a L-DNA1 solution with a final concentration of 1 mM. The 1 mM L-DNA1 solution, 10 mM SuO-vc-PAB-MMAE solution, and phosphate reaction solution were then mixed in a volume ratio of 2:5:3 and allowed to react overnight. Detection and analysis were performed by negative ion mode ESI ion trap liquid chromatography-mass spectrometry (LC-MS / MS), demonstrating a coupling efficiency of 100% (Figure 7). The reaction product was precipitated with 100% ethanol to completely separate it from unreacted SuO-vc-PAB-MMAE. After four washes with 75% ethanol, the precipitate was dissolved in phosphate buffer.

[0146] Example 6: Self-assembly of Nanobody Drug Conjugates

[0147] Next, we use NAPPA4-DM4, a dual-antibody and dual-toxin (1,2) -HER2 (3,4) The self-assembly process of nanobody drug conjugates is described using molecular structures as an example: DM4 is conjugated to DNA Nos. 1 and 2, and the anti-HER2 nanobody (prepared in Example 1) is conjugated to DNA Nos. 3 and 4.

[0148] The concentrations of DM4-L-DNA1, DM4-L-DNA2, anti-HER2Nb-L-DNA3 conjugate, and anti-HER2Nb-L-DNA4 conjugate were measured respectively. Take appropriate amount of the above components and preheat them at 37 degrees for 5 minutes, then mix them at a 1:1 molar ratio at 37 degrees and incubate them for 1 minute to complete the NAPPA4-DM4 (1,2) -HER2 (3,4) Molecular structure of the self-assembled nanobody drug conjugate (Figure 8).

[0149] Example 7: In vitro cell killing experiment based on L-nucleic acid framework-mediated antibody drug conjugates

[0150] To further analyze the in vitro cell-killing activity of L-nucleic acid framework-based antibody drug conjugates, NAPPA4-MMAE was assembled. (1,2) -HER2 (3,4) , NAPPA4-MMAE (1,2) -PD-L1 (3,4) ,NAPPA4-MMAE (1,2) , NAPPA4-HER2 (3,4)Four drug molecules were evaluated for in vitro cytotoxicity using the HER2-positive cell line BT474 as a cell model. The anti-HER2 nanobody used was the anti-HER2 nanobody prepared in the Example, and the amino acid sequence of the anti-PD-L1 antibody used was shown in SEQ ID NO: 3.

[0151] SEQ ID NO: 3, amino acid sequence of anti-PD-L1 nanobody mutant:

[0152]

[0153] BT474 cells were seeded into 96-well plates at a cell density of 20,000 cells / well, and triplicate wells were set up and incubated in a 37°C incubator; fresh culture medium was replaced after 24 hours, and drugs in a specific concentration gradient were added, and the cells were incubated in a 37°C incubator; fresh culture medium was replaced after 48-72 hours, and 10% CCK8 solution was added, and the cells were incubated in the dark at 37°C; after 2-4 hours, the absorbance of each sample at 450 nm was measured using a microplate reader, and the cell-killing effect of the drugs was calculated.

[0154] The experimental results showed that compared with the control group NAPPA4-MMAE (1,2) -PD-L1 (3,4) , target drug NAPPA4-MMAE (1,2) -HER2 (3,4) It has a more obvious killing effect on the HER2-positive cell line BT474. (1,2) , NAPPA4-HER2 (3,4) There is almost no killing effect (Figure 9).

[0155] In order to further verify the in vitro killing effect of antibody drug conjugates based on L-nucleic acid framework on different tumor cell lines, NAPPA4-MMAE was selected (1,2) -HER2 (3) -HSA (4) and NAPPA4-MMAE (1,2) -HSA (4) The two drug molecules were tested for in vitro cell killing against BT474, SK-BR-3, NCI-N87, HCC1954, SKOV-3 and Calu-3 tumor cell lines. The detection kit used was CellTiter-Glo (Promega, G7572). The absorbance of each sample at 450 nm was measured using a microplate reader, and the cell killing effect of the drug was calculated.

[0156] The experimental results show that compared with NAPPA4-MMAE (1,2) -HSA(4) , NAPPA4-MMAE (1,2) -HER2 (3) -HSA (4) It had a more obvious killing effect in all six tumor cell lines, and the killing effect was positively correlated with the reported HER2 expression level on the tumor cell surface ( Figure 10 ).

[0157] Example 8: In vivo tumor inhibition experiment of L-nucleic acid framework-mediated antibody drug conjugates

[0158] To test the in vivo tumor inhibitory activity of L-nucleic acid framework-based antibody drug conjugates, a BT474 human breast cancer tumor-bearing nude mouse model was constructed to evaluate the drug NAPPA4-MMAE. (1,2) -HER2 (3,4) and NAPPA4-MMAE (1,2) -HER2 (3) -HSA (4) The in vivo tumor suppressor activity of NAPPA4-MMAE was established. (1,2) , NAPPA4-HER2 (3,4) The PBS group served as the control.

[0159] BT474 cells were cultured in DMEM medium containing 10% FBS and maintained in a humidified incubator at 37°C with 5% CO2. BT474 cells in the logarithmic growth phase were collected, resuspended in DMEM basal medium, and Matrigel was added at a 1:1 ratio. Under sterile conditions, 0.2 mL of the cell suspension was inoculated subcutaneously on the right side of the back of nude mice at a seeding concentration of 1 × 10 7 cells / 0.2mL / mouse. Use a vernier caliper to measure the diameter of the transplanted tumor. When the tumor grows to 100-300mm 3 The animals were randomly divided into groups of 6. The day of grouping was defined as D0, and the mice were injected intravenously with the test drug NAPPA4-MMAE once. (1,2) -HER2 (3,4) , NAPPA4-MMAE (1,2) -HER2 (3) -HSA (4) , NAPPA4-MMAE (1,2) , NAPPA4-HER2 (3,4) The mice were treated with PBS at a dose of 125 nmol / kg. Tumor sizes were measured with a vernier caliper and the mice were weighed on days D0, D3, D5, D7, D10, D12, D14, D17, D19, D21, D24, D26, and D28 after the start of treatment.

[0160] Tumor volume was calculated as follows: tumor volume (mm 3) = 0.5 × tumor long diameter × tumor short diameter 2 .

[0161] The results of the average tumor volume changes of mice in different groups during the administration period (Figure 11) and the average tumor weights of mice in different groups at the end of the experiment (Figure 12) showed that compared with the PBS control group, NAPPA4-MMAE (1,2) -HER2 (3,4) and NAPPA4-MMAE (1,2) -HER2 (3) -HSA (4) NAPPA4-MMAE, a drug containing anti-HSA antibodies, has a significant in vivo tumor suppression effect (1,2) -HER2 (3) -HSA (4) The tumor suppression effect in vivo was better than that of NAPPA4-MMAE, a drug without anti-HSA antibody. (1,2) -HER2 (3,4) , the drug NAPPA4-MMAE (1,2) , NAPPA4-HER2 (3,4) During the entire experimental observation period, the average body weight changes of mice in different groups remained within the normal fluctuation range (Figure 13), indicating that under the condition of a single administration of 125nmol / kg, the test drugs had no significant effect on the body weight of mice.

[0162] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. An antibody-drug conjugate (ADC) based on a mutually compatible nucleic acid backbone, characterized in that, The antibody-drug conjugate described is a polymer formed by the complexation of n monomers with complementary nucleic acid backbones. Among them, the polymer comprises: m targeting monomers, where the "targeting monomer" is an antibody or protein targeting the cell surface that links a nucleic acid single strand, and k drug monomers, where the "drug monomer" is a drug (toxin payload) that links a nucleic acid single strand, and n is a positive integer from 2 to 8, m is a positive integer from 1 to 3 and m < n, k is a positive integer from 1 to (n - m); in the polymer, the nucleic acid single strand of each monomer forms a complementary double strand with the nucleic acid single strands of 1 - 3 other monomers through base complementarity, thereby forming a complementary nucleic acid backbone structure.

2. The antibody-drug conjugate as described in claim 1, characterized in that, The targeting monomer described has the structure of formula I: A–W–D0 (I) And the drug monomer has the structure of formula II: D1–W–D2 (II) In the formula, A is an antibody or protein; W is a nucleic acid single strand sequence; D0 is none or a drug; D1 is none or a drug D2 is none or a drug "–" is a linker or bond, and at least one of D0, D1, and D2 is a drug.

3. [Amended according to Rule 26, 01.06.2022] The antibody-drug conjugate as described in claim 2, characterized in that, A is an antibody or protein that specifically binds to a cell surface receptor and causes endocytosis.

4. [Amended according to Rule 26, 01.06.2022] The antibody-drug conjugate as described in claim 2, characterized in that, D1 / D2 is a small molecule or polypeptide toxin for killing cells.

5. [Amended according to Rule 26, 01.06.2022] The antibody-drug conjugate as described in claim 2, characterized in that, The nucleic acid single strand is degradation-resistant and is selected from the group consisting of: LNA, PNA, LNA, morpholino phosphate nucleic acid, thiol-modified nucleic acid, 2'-fluoro-modified nucleic acid, 5-hydroxymethylcytosine nucleic acid, or a combination thereof.

6. [Amended according to Rule 26, 01.06.2022] The antibody-drug conjugate as described in claim 2, characterized in that, The nucleic acid single strand sequence W in the targeting monomer (formula I) and the drug monomer (formula II) has the structure shown in formula III: X1–R1–X2–R2–X3 (III) Wherein, R1 is base complementary pairing region 1; R2 is base complementary pairing region 2; X1, X2, and X3 are each independently none or redundant nucleic acid; "–" is a bond.

7. [Amended according to Rule 26, 01.06.2022] The antibody-drug conjugate as described in claim 6, characterized in that, The lengths of R1 and R2 are each independently 10 - 20 bases, preferably 14 - 16 bases.

8. [Amended according to Rule 26, 01.06.2022] The antibody-drug conjugate as described in claim 6, characterized in that, The R1 of each monomer forms a base complementary pairing structure with the R2 of the left adjacent (or left side) monomer; and R2 forms a base complementary pairing structure with the R1 of the right adjacent (or right side) monomer.

9. [Amended according to Rule 26, 01.06.2022] A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises: (a) The antibody-drug conjugate based on complementary nucleic acid backbone described in claim 1, where the targeting monomer is selected from a targeting monomer library; the drug monomer is selected from a drug monomer library; and (b) a pharmaceutically acceptable carrier; wherein, the assembly units in the targeting monomer library hold antibodies or proteins that can specifically bind to cancer cell surface receptors and cause endocytosis; the assembly units in the drug monomer library hold small molecule or polypeptide drug moieties for killing cells.

10. [Revised according to Rule 26, 01.06.2022] A nucleic acid sequence library, characterized in that, The nucleic acid library comprises nucleic acid sequences for forming the antibody-drug conjugate based on complementary nucleic acid backbone described in claim 1.

11. [Amended according to Rule 26, 01.06.2022] The nucleic acid sequence library as described in claim 10, characterized in that, The nucleic acid sequence has the structure shown in formula III: X1–R1–X2–R2–X3 (III) Wherein, R1 is base complementary pairing region 1; R2 is base complementary pairing region 2; X1, X2, and X3 are each independently none or redundant nucleic acid; "–" is a bond.

12. [Amended according to Rule 26, 01.06.2022] The use of the nucleic acid sequence library as described in claim 10, characterized in that, Antibody-drug conjugates for use in the preparation of the intermatched nucleic acid backbones of claim 1.

13. [Amended according to Rule 26 01.06.2022] A method for preparing the antibody-drug conjugate of claim 1, characterized in that, Including the following steps: (1) Nucleic acid single strands are chemically coupled with cytotoxic drugs to form nucleic acid-drug assembly units; (2) Antibodies are site-specifically coupled with complementary nucleic acid single strands to form antibody-nucleic acid assembly units; (3) The antibody-nucleic acid assembly unit and multiple complementary nucleic acid-drug assembly units rapidly self-assemble through complementary nucleic acid sequences to form the antibody-drug conjugate.

Images