Treatment of decreased bone mineral density with WNT family member 5b (WNT5b) inhibitors

Abstract

The present disclosure provides methods of treating subjects having decreased bone mineral density or at risk of developing decreased bone mineral density, methods of identifying subjects having an increased risk of developing decreased bone mineral density, methods of detecting Wnt Family Member 5B (WNT5B) variant nucleic acid molecules and variant polypeptides, and WNT5B variant nucleic acid molecules and variant polypeptides.

Description

Various terms relating to aspects of the present disclosure are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-expressed basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification. As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. As used herein, the term "about" means that the recited numerical value is approximate and small variations would not significantly affect the practice of the disclosed embodiments. Where a numerical value is used, unless indicated otherwise by the context, the term "about" means the numerical value can vary by ±10% and remain within the scope of the disclosed embodiments. As used herein, the term "comprising" may be replaced with "consisting" or "consisting essentially of" in particular embodiments as desired. As used herein, the term "isolated", in regard to a nucleic acid molecule or a polypeptide, means that the nucleic acid molecule or polypeptide is in a condition other than its native environment, such as apart from blood and / or animal tissue. In some embodiments, an isolated nucleic acid molecule or polypeptide is substantially free of other nucleic acid molecules or other polypeptides, particularly other nucleic acid molecules or polypeptides of animal origin. In some embodiments, the nucleic acid molecule or polypeptide can be in a highly purified form, i.e., greater than 95% pure or greater than 99% pure. When used in this context, the term "isolated" does not exclude the presence of the same nucleic acid molecule or polypeptide in alternative physical forms, such as dimers or alternatively phosphorylated or derivatized forms. As used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "polynucleotide", or "oligonucleotide" can comprise a polymeric form of nucleotides of any length, can comprise DNA and / or RNA, and can be single-stranded, doublestranded, or multiple stranded. One strand of a nucleic acid also refers to its complement. As used herein, the term "subject" includes any animal, including mammals. Mammals include, but are not limited to, farm animals (such as, for example, horse, cow, pig), companion animals (such as, for example, dog, cat), laboratory animals (such as, for example, mouse, rat, rabbits), and non-human primates (such as, for example, apes and monkeys). In some embodiments, the subject is a human. In some embodiments, the subject is a patient under the care of a physician. A burden of rare, predicted loss-of-function and / or predicted missense variants in WNT5B associated with a decreased risk of developing decreased bone mineral density in humans has been identified in accordance with the present disclosure. For example, a genetic alteration that changes the cytosine at position 56,698 in the WNT5B reference genomic nucleic acid molecule (see, SEQ ID NO:1) to a thymine, or changes the thymine at position 58,170 in the WNT5B reference genomic nucleic acid molecule (see, SEQ ID NO:1) to an adenine, or changes the cytosine at position 65,099 in the WNT5B reference genomic nucleic acid molecule (see, SEQ ID NO:1) to a thymine, or changes the cytosine at position 65,099 in the WNT5B reference genomic nucleic acid molecule (see, SEQ ID NO:1) to an adenine, or deletes the TC dinucleotide at positions 71,313-71,314 in the WNT5B reference genomic nucleic acid molecule (see, SEQ ID NO:1) has been observed to indicate that the subject having such an alteration may have a decreased risk of developing decreased bone mineral density. It is believed that no nonsynonymous variants of the WNT5B gene or protein have any known association with decreased bone mineral density. Altogether, the genetic analyses described herein indicate that the WNT5B gene associates with decreased risk of developing decreased bone mineral density. Therefore, subjects that are WNT5B reference that have an increased risk of developing decreased bone mineral density, such as osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis, may be treated such that the decreased bone mineral density is prevented, the symptoms thereof are reduced, and / or development of symptoms is repressed. Accordingly, the present disclosure provides methods of leveraging the identification of such variants in subjects to identify or stratify risk in such subjects of developing decreased bone mineral density, such as osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis, or to diagnose subjects as having an increased risk of developing decreased bone mineral density, such as osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis, such that subjects at risk or subjects with active disease may be treated accordingly. Additionally, the present disclosure provides isolated WNT5B variant genomic nucleic acid molecules, variant mRNA molecules, and variant cDNA molecules. For purposes of the present disclosure, any particular subject can be categorized as having one of three WNT5B genotypes: i) WNT5B reference; ii) heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide; or iii) homozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. A subject is WNT5B reference when the subject does not have a copy of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. A subject is heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide when the subject has a single copy of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. As used herein, a WNT5B variant nucleic acid molecule is any WNT5B nucleic acid molecule (such as, a genomic nucleic acid molecule, an mRNA molecule, or a cDNA molecule) encoding a WNT5B polypeptide having a partial loss-of-function, a complete loss-of-function, a predicted partial loss-of-function, or a predicted complete loss-of-function. A subject who has a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide having a partial loss-of-function (or predicted partial loss-of-function) is hypomorphic for WNT5B. The WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be any nucleic acid molecule encoding a WNT5B Cys83Stop-LG, Cys83Stop-Sht, Cysll4Stop, Argl34Cys-LG, Argl34Cys-Sht, Argl34Ser-LG, Argl34Ser-Sht, or Val266fs. A subject is homozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide when the subject has two copies of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. For subjects that are genotyped or determined to be WNT5B reference, such subjects have an increased risk of developing decreased bone mineral density, such as osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis. For subjects that are genotyped or determined to be either WNT5B reference or heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, such subjects can be treated with a WNT5B inhibitor. In any of the embodiments described throughout the present disclosure, the WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be any WNT5B nucleic acid molecule (such as, for example, genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) encoding a WNT5B polypeptide having a partial loss-of-function, a complete loss-of-function, a predicted partial loss-of-function, ora predicted complete loss-of-function. For example, the WNT5B variant nucleic acid molecule can be any nucleic acid molecule encoding WNT5B Cys83Stop-LG, Cys83Stop-Sht, Cysll4Stop, Argl34Cys-LG, Argl34Cys-Sht, Argl34Ser-LG, Argl34Ser-Sht, or Val266fs. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Cys83Stop-LG. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Cys83Stop-Sht. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Cysll4Stop. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Argl34Cys-LG. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Argl34Cys-Sht. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Argl34Ser-LG. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Argl34Ser-Sht. In some embodiments, the WNT5B variant nucleic acid molecule encodes WNT5B Val266fs. In any of the embodiments described throughout the present disclosure, the WNT5B predicted loss-of-function polypeptide can be any WNT5B polypeptide having a partial loss-of-function, a complete loss-of-function, a predicted partial loss-of-function, ora predicted complete loss-of-function. In any of the embodiments described throughout the present disclosure, the WNT5B predicted loss-of-function polypeptide can be any of the WNT5B polypeptides described herein including, for example, WNT5B Cys83Stop-LG, Cys83Stop-Sht, Cysll4Stop, Argl34Cys-LG, Argl34Cys-Sht, Argl34Ser-LG, Argl34Ser-Sht, or Val266fs. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Cys83Stop-LG. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Cys83Stop-Sht. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Cysll4Stop. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Argl34Cys-LG. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Argl34Cys-Sht. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Argl34Ser-LG. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Argl34Ser-Sht. In some embodiments, the WNTB5 predicted loss-of-function polypeptide is Val266fs. In any of the embodiments described throughout the present disclosure, the decreased bone mineral density is osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis. In any of the embodiments described throughout the present disclosure, the decreased bone mineral density is osteopenia. In any of the embodiments described throughout the present disclosure, the decreased bone mineral density is Type I osteoporosis. In any of the embodiments described throughout the present disclosure, the decreased bone mineral density is Type II osteoporosis. In any of the embodiments described throughout the present disclosure, the decreased bone mineral density is secondary osteoporosis. Symptoms of decreased bone mineral density include, but are not limited to, increased bone fragility (manifesting as bone fracture as a result of a mild to moderate trauma), reduced bone density, localized bone pain and weakness in an area of a broken bone, loss of height or change in posture, such as stooping over, high levels of serum calcium or alkaline phosphatase on a blood test, vitamin D deficiency, and joint or muscle aches, or any combination thereof. The present disclosure provides methods of treating a subject having decreased bone mineral density or at risk of developing decreased bone mineral density, the methods comprising administering a WNT5B inhibitor to the subject. The present disclosure also provides methods of treating a subject having osteopenia or at risk of developing osteopenia, the methods comprising administering a WNT5B inhibitor to the subject. The present disclosure also provides methods of treating a subject having Type I osteoporosis or at risk of developing Type I osteoporosis, the methods comprising administering a WNT5B inhibitor to the subject. The present disclosure also provides methods of treating a subject having Type II osteoporosis or at risk of developing Type II osteoporosis, the methods comprising administering a WNT5B inhibitor to the subject. The present disclosure also provides methods of treating a subject having secondary osteoporosis or at risk of developing secondary osteoporosis, the methods comprising administering a WNT5B inhibitor to the subject. In some embodiments, the WNT5B inhibitor comprises an inhibitory nucleic acid molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an antisense molecule, a small interfering RNA (siRNA) molecule, or a short hairpin RNA (shRNA) molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an antisense molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an siRNA molecule. In some embodiments, the inhibitory nucleic acid molecule comprises an shRNA molecule. Such inhibitory nucleic acid molecules can be designed to target any region of a WNT5B nucleic acid molecule, such as an mRNA molecule. In some embodiments, the inhibitory nucleic acid molecule hybridizes to a sequence within a WNT5B genomic nucleic acid molecule or mRNA molecule and decreases expression of the WNT5B polypeptide in a cell in the subject. In some embodiments, the WNT5B inhibitor comprises an antisense molecule that hybridizes to a WNT5B genomic nucleic acid molecule or mRNA molecule and decreases expression of the WNT5B polypeptide in a cell in the subject. In some embodiments, the WNT5B inhibitor comprises an siRNA that hybridizes to a WNT5B genomic nucleic acid molecule or mRNA molecule and decreases expression of the WNT5B polypeptide in a cell in the subject. In some embodiments, the WNT5B inhibitor comprises an shRNA that hybridizes to a WNT5B genomic nucleic acid molecule or mRNA molecule and decreases expression of the WNT5B polypeptide in a cell in the subject. The inhibitory nucleic acid molecules can comprise RNA, DNA, or both RNA and DNA. The inhibitory nucleic acid molecules can also be linked or fused to a heterologous nucleic acid sequence, such as in a vector, or a heterologous label. For example, the inhibitory nucleic acid molecules can be within a vector or as an exogenous donor sequence comprising the inhibitory nucleic acid molecule and a heterologous nucleic acid sequence. The inhibitory nucleic acid molecules can also be linked or fused to a heterologous label. The label can be directly detectable (such as, for example, fluorophore) or indirectly detectable (such as, for example, hapten, enzyme, or fluorophore quencher). Such labels can be detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Such labels include, for example, radiolabels, pigments, dyes, chromogens, spin labels, and fluorescent labels. The label can also be, for example, a chemiluminescent substance; a metal-containing substance; or an enzyme, where there occurs an enzyme-dependent secondary generation of signal. The term "label" can also refer to a "tag" or hapten that can bind selectively to a conjugated molecule such that the conjugated molecule, when added subsequently along with a substrate, is used to generate a detectable signal. For example, biotin can be used as a tag along with an avidin or streptavidin conjugate of horseradish peroxidate (HRP) to bind to the tag, and examined using a calorimetric substrate (such as, for example, tetramethylbenzidine (TMB)) or a fluorogenic substrate to detect the presence of HRP. Exemplary labels that can be used as tags to facilitate purification include, but are not limited to, myc, HA, FLAG or 3XFLAG, 6XHis or polyhistidine, glutathione-S-transferase (GST), maltose binding protein, an epitope tag, or the Fc portion of immunoglobulin. Numerous labels include, for example, particles, fluorophores, haptens, enzymes and their calorimetric, fluorogenic and chemiluminescent substrates and other labels. The inhibitory nucleic acid molecules can comprise, for example, nucleotides or nonnatural or modified nucleotides, such as nucleotide analogs or nucleotide substitutes. Such nucleotides include a nucleotide that contains a modified base, sugar, or phosphate group, or that incorporates a non-natural moiety in its structure. Examples of non-natural nucleotides include, but are not limited to, dideoxynucleotides, biotinylated, aminated, deaminated, alkylated, benzylated, and fluorophor-labeled nucleotides. The inhibitory nucleic acid molecules can also comprise one or more nucleotide analogs or substitutions. A nucleotide analog is a nucleotide which contains a modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety include, but are not limited to, natural and synthetic modifications of A, C, G, and T / U, as well as different purine or pyrimidine bases such as, for example, pseudouridine, uracil-5-yl, hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. Modified bases include, but are not limited to, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioaIkyI, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (such as, for example, 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine. Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety include, but are not limited to, natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include, but are not limited to, the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-z S- or N-a I ky ny I; or O-a lkyl-0-al ky I, wherein the a I kyl, alkenyl, and alkynyl may be substituted or unsubstituted Cnoalkyl or C2 ioalkenyl, and C2 ioalkynyl. Exemplary 2' sugar modifications also include, but are not limited to, -O[(CH2)nO]mCH3, -O(CH2)nOCH3, -O(CH2)nNH2, -O(CH2)nCH3, -O(CH2)n-ONH2, and -O(CH2)nON[(CH2)nCH3)]2, where n and m, independently, are from 1 to about 10. Other modifications at the 2' position include, but are not limited to, Cuoalkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars can also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs can also have sugar mimetics, such as cyclobutyl moieties in place of the pentofuranosyl sugar. Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include, but are not limited to, those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. These phosphate or modified phosphate linkage between two nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. Nucleotide substitutes also include peptide nucleic acids (PNAs). In some embodiments, the antisense nucleic acid molecules are gapmers, whereby the first one to seven nucleotides at the 5' and 3' ends each have 2'-methoxyethyl (2'-MOE) modifications. In some embodiments, the first five nucleotides at the 5' and 3' ends each have 2'-MOE modifications. In some embodiments, the first one to seven nucleotides at the 5' and 3' ends are RNA nucleotides. In some embodiments, the first five nucleotides at the 5' and 3' ends are RNA nucleotides. In some embodiments, each of the backbone linkages between the nucleotides is a phosphorothioate linkage. In some embodiments, the siRNA molecules have termini modifications. In some embodiments, the 5' end of the antisense strand is phosphorylated. In some embodiments, 5'-phosphate analogs that cannot be hydrolyzed, such as 5'-(E)-vinyl-phosphonate are used. In some embodiments, the siRNA molecules have backbone modifications. In some embodiments, the modified phosphodiester groups that link consecutive ribose nucleosides have been shown to enhance the stability and in vivo bioavailability of siRNAs The non-ester groups (-OH, =0) of the phosphodiester linkage can be replaced with sulfur, boron, or acetate to give phosphorothioate, boranophosphate, and phosphonoacetate linkages. In addition, substituting the phosphodiester group with a phosphotriester can facilitate cellular uptake of siRNAs and retention on serum components by eliminating their negative charge. In some embodiments, the siRNA molecules have sugar modifications. In some embodiments, the sugars are deprotonated (reaction catalyzed by exo- and endonucleases) whereby the 2'-hydroxyl can act as a nucleophile and attack the adjacent phosphorous in the phosphodiester bond. Such alternatives include 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluoro modifications. In some embodiments, the siRNA molecules have base modifications. In some embodiments, the bases can be substituted with modified bases such as pseudouridine, 5'-methylcytidine, N6-methyladenosine, inosine, and N7-methylguanosine. In some embodiments, the siRNA molecules are conjugated to lipids. Lipids can be conjugated to the 5' or 3' termini of siRNA to improve their in vivo bioavailability by allowing them to associate with serum lipoproteins. Representative lipids include, but are not limited to, cholesterol and vitamin E, and fatty acids, such as palmitate and tocopherol. In some embodiments, a representative siRNA has the following formula: Sense: mN*mN* / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / *mN* / 32FN / Antisense: / 52FN / * / i2FN / *mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN / i2FN / mN*N*N wherein: "N" is the base; "2F" is a 2'-F modification; "m" is a 2'-O-methyl modification, "i" is an internal base; and is a phosphorothioate backbone linkage. The present disclosure also provides vectors comprising any one or more of the inhibitory nucleic acid molecules. In some embodiments, the vectors comprise any one or more of the inhibitory nucleic acid molecules and a heterologous nucleic acid. The vectors can be viral or nonviral vectors capable of transporting a nucleic acid molecule. In some embodiments, the vector is a plasmid or cosmid (such as, for example, a circular double-stranded DNA into which additional DNA segments can be ligated). In some embodiments, the vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Expression vectors include, but are not limited to, plasmids, cosmids, retroviruses, adenoviruses, adeno-associated viruses (AAV), plant viruses such as cauliflower mosaic virus and tobacco mosaic virus, yeast artificial chromosomes (YACs), Epstein-Barr (EBV)-derived episomes, and other expression vectors known in the art. The present disclosure also provides compositions comprising any one or more of the inhibitory nucleic acid molecules. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the compositions comprise a carrier and / or excipient. Examples of carriers include, but are not limited to, poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid cochleates, and lipid microtubules. A carrier may comprise a buffered salt solution such as PBS, HBSS, etc. In some embodiments, the WNT5B inhibitor comprises a nuclease agent that induces one or more nicks or double-strand breaks at a recognition sequence(s) or a DNA-binding protein that binds to a recognition sequence within a WNT5B genomic nucleic acid molecule. The recognition sequence can be located within a coding region of the WNT5B gene, or within regulatory regions that influence the expression of the gene. A recognition sequence of the DNA-binding protein or nuclease agent can be located in an intron, an exon, a promoter, an enhancer, a regulatory region, or any non-protein coding region. The recognition sequence can include or be proximate to the start codon of the WNT5B gene. For example, the recognition sequence can be located about 10, about 20, about 30, about 40, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides from the start codon. As another example, two or more nuclease agents can be used, each targeting a nuclease recognition sequence including or proximate to the start codon. As another example, two nuclease agents can be used, one targeting a nuclease recognition sequence including or proximate to the start codon, and one targeting a nuclease recognition sequence including or proximate to the stop codon, wherein cleavage by the nuclease agents can result in deletion of the coding region between the two nuclease recognition sequences. Any nuclease agent that induces a nick or double-strand break into a desired recognition sequence can be used in the methods and compositions disclosed herein. Any DNA-binding protein that binds to a desired recognition sequence can be used in the methods and compositions disclosed herein. Suitable nuclease agents and DNA-binding proteins for use herein include, but are not limited to, zinc finger protein or zinc finger nuclease (ZFN) pair, Transcription Activator-Like Effector (TALE) protein or Transcription Activator-Like Effector Nuclease (TALEN), or Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) / CRISPR-associated (Cas) systems. The length of the recognition sequence can vary, and includes, for example, recognition sequences that are about 30-36 bp for a zinc finger protein or ZFN pair, about 15-18 bp for each ZFN, about 36 bp for a TALE protein or TALEN, and about 20 bp for a CRISPR / Cas guide RNA. In some embodiments, CRISPR / Cas systems can be used to modify a WNT5B genomic nucleic acid molecule within a cell. The methods and compositions disclosed herein can employ CRISPR-Cas systems by utilizing CRISPR complexes (comprising a guide RNA (gRNA) complexed with a Cas protein) for site-directed cleavage of WNT5B nucleic acid molecules. Cas proteins generally comprise at least one RNA recognition or binding domain that can interact with gRNAs. Cas proteins can also comprise nuclease domains (such as, for example, DNase or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. Suitable Cas proteins include, for example, a wild type Cas9 protein and a wild type Cpfl protein (such as, for example, FnCpfl). A Cas protein can have full cleavage activity to create a double-strand break in a WNT5B genomic nucleic acid molecule or it can be a nickase that creates a single-strand break in a WNT5B genomic nucleic acid molecule. Additional examples of Cas proteins include, but are not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csxl2), CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966, and homologs or modified versions thereof. Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, a Cas protein can be fused to a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Cas proteins can be provided in any form. For example, a Cas protein can be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternately, a Cas protein can be provided in the form of a nucleic acid molecule encoding the Cas protein, such as an RNA or DNA. In some embodiments, targeted genetic modifications of a WNT5B genomic nucleic acid molecules can be generated by contacting a cell with a Cas protein and one or more gRNAs that hybridize to one or more gRNA recognition sequences within a target genomic locus in the WNT5B genomic nucleic acid molecule. For example, a gRNA recognition sequence can be located within a region of SEQ ID NO:1. The gRNA recognition sequence can also include or be proximate to a position corresponding to: position 56,698, position 58,170, position 65,099, position 65,099, or positions 71,313-71,314 according to SEQ ID NO:1. For example, the gRNA recognition sequence can be located from about 1000, from about 500, from about 400, from about 300, from about 200, from about 100, from about 50, from about 45, from about 40, from about 35, from about 30, from about 25, from about 20, from about 15, from about 10, or from about 5 nucleotides of a position corresponding to: position 56,698, position 58,170, position 65,099, position 65,099, or positions 71,313-71,314 according to SEQ ID NO:1. The gRNA recognition sequence can include or be proximate to the start codon of a WNT5B genomic nucleic acid molecule or the stop codon of a WNT5B genomic nucleic acid molecule. For example, the gRNA recognition sequence can be located from about 10, from about 20, from about 30, from about 40, from about 50, from about 100, from about 200, from about 300, from about 400, from about 500, or from about 1,000 nucleotides of the start codon or the stop codon. The gRNA recognition sequences within a target genomic locus in a WNT5B genomic nucleic acid molecule are located near a Protospacer Adjacent Motif (PAM) sequence, which is a 2-6 base pair DNA sequence immediately following the DNA sequence targeted by the Cas9 nuclease. The canonical PAM is the sequence 5'-NGG-3' where "N" is any nucleobase followed by two guanine ("G") nucleobases. gRNAs can transport Cas9 to anywhere in the genome for gene editing, but no editing can occur at any site other than one at which Cas9 recognizes PAM. In addition, 5'-NGA-3' can be a highly efficient non-canonical PAM for human cells. Generally, the PAM is about 2 to about 6 nucleotides downstream of the DNA sequence targeted by the gRNA. The PAM can flank the gRNA recognition sequence. In some embodiments, the gRNA recognition sequence can be flanked on the 3' end by the PAM. In some embodiments, the gRNA recognition sequence can be flanked on the 5' end by the PAM. For example, the cleavage site of Cas proteins can be about 1 to about 10 base pairs, about 2 to about 5 base pairs, or 3 base pairs upstream or downstream of the PAM sequence. In some embodiments (such as when Cas9 from S. pyogenes or a closely related Cas9 is used), the PAM sequence of the non-complementary strand can be 5'-NGG-3', where N is any DNA nucleotide and is immediately 3' of the gRNA recognition sequence of the non-complementary strand of the target DNA. As such, the PAM sequence of the complementary strand would be 5'-CCN-3', where N is any DNA nucleotide and is immediately 5' of the gRNA recognition sequence of the complementary strand of the target DNA. A gRNA is an RNA molecule that binds to a Cas protein and targets the Cas protein to a specific location within a WNT5B genomic nucleic acid molecule. An exemplary gRNA is a gRNA effective to direct a Cas enzyme to bind to or cleave a WNT5B genomic nucleic acid molecule, wherein the gRNA comprises a DNA-targeting segment that hybridizes to a gRNA recognition sequence within the WNT5B genomic nucleic acid molecule that includes or is proximate to a position corresponding to: position 56,698, position 58,170, position 65,099, position 65,099, or positions 71,313-71,314 according to SEQ ID NO:1. For example, a gRNA can be selected such that it hybridizes to a gRNA recognition sequence that is located about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides from a position corresponding to: position 56,698, position 58,170, position 65,099, position 65,099, or positions 71,313-71,314 according to SEQ ID NO:1. Other exemplary gRNAs comprise a DNA-targeting segment that hybridizes to a gRNA recognition sequence present within a WNT5B genomic nucleic acid molecule that includes or is proximate to the start codon or the stop codon. For example, a gRNA can be selected such that it hybridizes to a gRNA recognition sequence that is located about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides of the start codon or located about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides of the stop codon. Suitable gRNAs can comprise from about 17 to about 25 nucleotides, from about 17 to about 23 nucleotides, from about 18 to about 22 nucleotides, or from about 19 to about 21 nucleotides. In some embodiments, the gRNAs can comprise 20 nucleotides. Examples of suitable gRNA recognition sequences located within the WNT5B reference gene are set forth in Table 1 as SEQ ID NQs:104-123. Table 1: Guide RNA Recognition Sequences Near WNT5B Variation(s) Strand gRNA Recognition Sequence SEQIDNO: + AAGAAGTG CACG GAG ATCGTG 104 + AAG CTTGAG CTGCTG CTGTCA 105 + AAGGAATGCCAGCACCAGTTC 106 + AAGTTCCACTGGTGCTGCTTC 107 + AAGTG CACG GAGATCGTG GAC 108 + AAG CTGTG CCAATTGTACCAG 109 + AAGACTGGCATCAAGGAATGC 110 + AAGAGACGCTGGAGATCTCTG 111 + AAGGAGAAGTACGACAGCGCG 112 + AAGTCTAGAGTC1 1 1G1 1GGT 113 + GTGCAGAGACCCGAGATGTTT 114 + G A AG CTGTG CCAATTGTACCA 115 + GTG CTGCTTCGTCAG GTGTA A 116 + GCTGCGTGGACGTTATACTGT 117 + ACCCTACTCTGGAAACTGT 118 + AGAGGAAGCTGTGCCAATT 119 + GGAGGAGATGATCTTGTCT 120 + GCTTCAACCTCGATGTCTT 121 + GCGAGAAI ICI ICATCCTC 122 + GAGAGAAGAACI 1 IGCCAA 123 The Cas protein and the gRNA form a complex, and the Cas protein cleaves the target WNT5B genomic nucleic acid molecule. The Cas protein can cleave the nucleic acid molecule at 5 a site within or outside of the nucleic acid sequence present in the target WNT5B genomic nucleic acid molecule to which the DNA-targeting segment of a gRNA will bind. For example, formation of a CRISPR complex (comprising a gRNA hybridized to a gRNA recognition sequence and complexed with a Cas protein) can result in cleavage of one or both strands in or near (such as, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the nucleic acid sequence present in the WNT5B genomic nucleic acid molecule to which a DNA-targeting segment of a gRNA will bind. Such methods can result, for example, in a WNT5B genomic nucleic acid molecule in which a region of SEQ ID NO:1 is disrupted, the start codon is disrupted, the stop codon is disrupted, or the coding sequence is disrupted or deleted. Optionally, the cell can be further contacted with one or more additional gRNAs that hybridize to additional gRNA recognition sequences within the target genomic locus in the WNT5B genomic nucleic acid molecule. By contacting the cell with one or more additional gRNAs (such as, for example, a second gRNA that hybridizes to a second gRNA recognition sequence), cleavage by the Cas protein can create two or more double-strand breaks or two or more single-strand breaks. In some embodiments, the WNT5B inhibitor comprises a small molecule. In some embodiments, the WNT5B inhibitor is KY02111. In some embodiments, the methods of treatment further comprise detecting the presence or absence of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide in a biological sample obtained from the subject. As used throughout the present disclosure, "a WNT5B variant nucleic acid molecule" is any WNT5B nucleic acid molecule (such as, for example, genomic nucleic acid molecule, mRNA molecule, or cDNA molecule) encoding a WNT5B polypeptide having a partial loss-of-function, a complete loss-of-function, a predicted partial loss-of-function, ora predicted complete loss-of-function. The present disclosure also provides methods of treating a subject with a therapeutic agent that treats or prevents decreased bone mineral density. In some embodiments, the subject has decreased bone mineral density or is at risk of developing decreased bone mineral density. In some embodiments, the subject has decreased bone mineral density. In some embodiments, the subject is at risk of developing decreased bone mineral density. In some embodiments, the methods comprise determining whether the subject has a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide by obtaining or having obtained a biological sample from the subject, and performing or having performed a sequence analysis on the biological sample to determine if the subject has a genotype comprising the WNT5B variant nucleic acid molecule. When the subject is WNT5B reference, the therapeutic agent that treats or prevents decreased bone mineral density is administered or continued to be administered to the subject in a standard dosage amount, and / or a WNT5B inhibitor is administered to the subject. When the subject is heterozygous for a WNT5B variant nucleic acid molecule, the therapeutic agent that treats or prevents decreased bone mineral density is administered or continued to be administered to the subject in an amount that is the same as or less than a standard dosage amount, and / or a WNT5B inhibitor is administered to the subject. The presence of a genotype having the WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide indicates the subject has a decreased risk of developing decreased bone mineral density. In some embodiments, the subject is WNT5B reference. In some embodiments, the subject is heterozygous for the WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. For subjects that are genotyped or determined to be either WNT5B reference or heterozygous for the WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, such subjects can be treated with a WNT5B inhibitor, as described herein. Detecting the presence or absence of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide in a biological sample from a subject and / or determining whether a subject has a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be carried out by any of the methods described herein. In some embodiments, these methods can be carried out in vitro. In some embodiments, these methods can be carried out in situ. In some embodiments, these methods can be carried out in vivo. In any of these embodiments, the WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be present within a cell obtained from the subject. In some embodiments, when the subject is WNT5B reference, the subject is administered a therapeutic agent that treats or prevents decreased bone mineral density in a standard dosage amount. In some embodiments, when the subject is heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, the subject is administered a therapeutic agent that treats or prevents decreased bone mineral density in a dosage amount that is the same as or less than a standard dosage amount. In some embodiments, the treatment methods further comprise detecting the presence or absence of a WNT5B predicted loss-of-function polypeptide in a biological sample from the subject. In some embodiments, when the subject does not have a WNT5B predicted loss-of-function polypeptide, the subject is administered a therapeutic agent that treats or prevents decreased bone mineral density in a standard dosage amount. In some embodiments, when the subject has a WNT5B predicted loss-of-function polypeptide, the subject is administered a therapeutic agent that treats or prevents decreased bone mineral density in a dosage amount that is the same as or less than a standard dosage amount. The present disclosure also provides methods of treating a subject with a therapeutic agent that treats or prevents decreased bone mineral density. In some embodiments, the subject has decreased bone mineral density or is at risk of developing decreased bone mineral density. In some embodiments, the subject has decreased bone mineral density. In some embodiments, the subject is at risk of developing decreased bone mineral density. In some embodiments, the method comprises determining whether the subject has a WNT5B predicted loss-of-function polypeptide by obtaining or having obtained a biological sample from the subject, and performing or having performed an assay on the biological sample to determine if the subject has a WNT5B predicted loss-of-function polypeptide. When the subject does not have a WNT5B predicted loss-of-function polypeptide, the therapeutic agent that treats or prevents decreased bone mineral density is administered or continued to be administered to the subject in a standard dosage amount, and / or a WNT5B inhibitor is administered to the subject. When the subject has a WNT5B predicted loss-of-function polypeptide, the therapeutic agent that treats or prevents decreased bone mineral density is administered or continued to be administered to the subject in an amount that is the same as or less than a standard dosage amount, and / or a WNT5B inhibitor is administered to the subject. The presence of a WNT5B predicted loss-of-function polypeptide indicates the subject has a decreased risk of developing decreased bone mineral density. In some embodiments, the subject has a WNT5B predicted loss-of-function polypeptide. In some embodiments, the subject does not have a WNT5B predicted loss-of-function polypeptide. Detecting the presence or absence of a WNT5B predicted loss-of-function polypeptide in a biological sample from a subject and / or determining whether a subject has a WNT5B predicted loss-of-function polypeptide can be carried out by any of the methods described herein. In some embodiments, these methods can be carried out in vitro. In some embodiments, these methods can be carried out in situ. In some embodiments, these methods can be carried out in vivo. In any of these embodiments, the WNT5B predicted loss-of-function polypeptide can be present within a cell obtained from the subject. Examples of therapeutic agents that treat or prevent decreased bone mineral density include, but are not limited to: calcium and vitamin D supplementation (vitamin D2, vitamin D3, and cholecalciferol), bisphosphonate medications, such as FOSAMAX®, (alendronate), BONIVA® (ibandronate), RECLAST® (zoledronate), ACTONEL® (risedronate), MIACALCIN®, FORTICAL®, and CALCIMAR® (calcitonin), FORTEO® (teriparatide), PROLIA® (denosumab), hormone replacement therapy with estrogen and progesterone as well as EVISTA® (raloxifene). In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is vitamin D2, vitamin D3, cholecalciferol, alendronate, ibandronate, zoledronate, risedronate, calcitonin, teriparatide, denosumab, or raloxifene. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is vitamin D2. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is vitamin D3. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is cholecalciferol. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is alendronate. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is ibandronate. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is zoledronate. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is risedronate. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is calcitonin. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is teriparatide. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is denosumab. In some embodiments, the therapeutic agent that treats or prevents decreased bone mineral density is raloxifene. In some embodiments, the dose of the therapeutic agents that treat or prevents decreased bone mineral density can be reduced by about 10%, by about 20%, by about 30%, by about 40%, by about 50%, by about 60%, by about 70%, by about 80%, or by about 90% for subjects that are heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide (i.e., a less than the standard dosage amount) compared to subjects that are WNT5B reference (who may receive a standard dosage amount). In some embodiments, the dose of the therapeutic agents that treat or prevent decreased bone mineral density can be reduced by about 10%, by about 20%, by about 30%, by about 40%, or by about 50%. In addition, the dose of therapeutic agents that treat or prevent decreased bone mineral density in subjects that are heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be administered less frequently compared to subjects that are WNT5B reference. Administration of the therapeutic agents that treat or prevents decreased bone mineral density and / or WNT5B inhibitors can be repeated, for example, after one day, two days, three days, five days, one week, two weeks, three weeks, one month, five weeks, six weeks, seven weeks, eight weeks, two months, or three months. The repeated administration can be at the same dose or at a different dose. The administration can be repeated once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, or more. For example, according to certain dosage regimens a subject can receive therapy for a prolonged period of time such as, for example, 6 months, 1 year, or more. In addition, the therapeutic agents that treat or prevent decreased bone mineral density and / or WNT5B inhibitors can be administered sequentially or at the same time. In addition, the therapeutic agents that treat or prevent decreased bone mineral density and / or WNT5B inhibitors can be administered in separate compositions or can be administered together in the same composition. Administration of the therapeutic agents that treat or prevent decreased bone mineral density and / or WNT5B inhibitors can occur by any suitable route including, but not limited to, parenteral, intravenous, oral, subcutaneous, intra-arterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. Pharmaceutical compositions for administration are desirably sterile and substantially isotonic and manufactured under GMP conditions. Pharmaceutical compositions can be provided in unit dosage form (i.e., the dosage for a single administration). Pharmaceutical compositions can be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients or auxiliaries. The formulation depends on the route of administration chosen. The term "pharmaceutically acceptable" means that the carrier, diluent, excipient, or auxiliary is compatible with the other ingredients of the formulation and not substantially deleterious to the recipient thereof. The terms "treat", "treating", and "treatment" and "prevent", "preventing", and "prevention" as used herein, refer to eliciting the desired biological response, such as a therapeutic and prophylactic effect, respectively. In some embodiments, a therapeutic effect comprises one or more of a decrease / reduction in decreased bone mineral density, a decrease / reduction in the severity of decreased bone mineral density (such as, for example, a reduction or inhibition of development of decreased bone mineral density), a decrease / reduction in symptoms and decreased bone mineral density-related effects, delaying the onset of symptoms and decreased bone mineral density-related effects, reducing the severity of symptoms of decreased bone mineral density-related effects, reducing the severity of an acute episode, reducing the number of symptoms and decreased bone mineral density-related effects, reducing the latency of symptoms and decreased bone mineral density-related effects, an amelioration of symptoms and decreased bone mineral density-related effects, reducing secondary symptoms, reducing secondary infections, preventing relapse to decreased bone mineral density, decreasing the number or frequency of relapse episodes, increasing latency between symptomatic episodes, increasing time to sustained progression, expediting remission, inducing remission, augmenting remission, speeding recovery, or increasing efficacy of or decreasing resistance to alternative therapeutics, and / or an increased survival time of the affected host animal, following administration of the agent or composition comprising the agent. A prophylactic effect may comprise a complete or partial avoidance / inhibition or a delay of decreased bone mineral density development / progression (such as, for example, a complete or partial avoidance / inhibition or a delay), and an increased survival time of the affected host animal, following administration of a therapeutic protocol. Treatment of decreased bone mineral density encompasses the treatment of subjects already diagnosed as having any form of decreased bone mineral density at any clinical stage or manifestation, the delay of the onset or evolution or aggravation or deterioration of the symptoms or signs of decreased bone mineral density, and / or preventing and / or reducing the severity of decreased bone mineral density. The present disclosure also provides methods of identifying a subject having an increased risk of developing decreased bone mineral density. In some embodiments, the methods comprise determining or having determined the presence or absence of a WNT5B variant nucleic acid molecule (such as a genomic nucleic acid molecule, mRNA molecule, and / or cDNA molecule) encoding a WNT5B predicted loss-of-function polypeptide in a biological sample obtained from the subject. When the subject lacks a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide (i.e., the subject is genotypically categorized as WNT5B reference), then the subject has an increased risk of developing decreased bone mineral density. When the subject has a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide (i.e., the subject is heterozygous or homozygous for a WNT5B variant nucleic acid molecule), then the subject has a decreased risk of developing decreased bone mineral density compared to a subject that is WNT5B reference. Having a single copy of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide is more protective of a subject from developing decreased bone mineral density than having no copies of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. Without intending to be limited to any particular theory or mechanism of action, it is believed that a single copy of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide (i.e., heterozygous for a WNT5B variant nucleic acid molecule) is protective of a subject from developing decreased bone mineral density, and it is also believed that having two copies of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide (i.e., homozygous for a WNT5B variant nucleic acid molecule) may be more protective of a subject from developing decreased bone mineral density, relative to a subject with a single copy. Thus, in some embodiments, a single copy of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide may not be completely protective, but instead, may be partially or incompletely protective of a subject from developing decreased bone mineral density. While not desiring to be bound by any particular theory, there may be additional factors or molecules involved in the development of decreased bone mineral density that are still present in a subject having a single copy of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, thus resulting in less than complete protection from the development of decreased bone mineral density. Detecting the presence or absence of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide in a biological sample from the subject and / or determining whether a subject has a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be carried out by any of the methods described herein. In some embodiments, these methods can be carried out in vitro. In some embodiments, these methods can be carried out in situ. In some embodiments, these methods can be carried out in vivo. In any of these embodiments, the WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide can be present within a cell obtained from the subject. ln some embodiments, when a subject is identified as having an increased risk of developing decreased bone mineral density, the subject is further treated with a therapeutic agent that treats or prevents decreased bone mineral density and / or a WNT5B inhibitor, as described herein. For example, when the subject is WNT5B reference, and therefore has an increased risk of developing decreased bone mineral density, the subject is administered a WNT5B inhibitor. In some embodiments, such a subject is also administered a therapeutic agent that treats or prevents decreased bone mineral density. In some embodiments, when the subject is heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, the subject is administered the therapeutic agent that treats or prevents decreased bone mineral density in a dosage amount that is the same as or less than a standard dosage amount, and is also administered a WNT5B inhibitor. In some embodiments, the subject is WNT5B reference. In some embodiments, the subject is heterozygous for a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. The present disclosure also provides methods of detecting the presence or absence of a WNT5B variant genomic nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide in a biological sample obtained from a subject, and / or a WNT5B variant mRNA molecule encoding a WNT5B predicted loss-of-function polypeptide in a biological sample obtained from a subject, and / or a WNT5B variant cDNA molecule encoding a WNT5B predicted loss-of-function polypeptide produced from an mRNA molecule in a biological sample obtained from a subject. It is understood that gene sequences within a population and mRNA molecules encoded by such genes can vary due to polymorphisms such as single-nucleotide polymorphisms. The sequences provided herein for the WNT5B variant genomic nucleic acid molecule, WNT5B variant mRNA molecule, and WNT5B variant cDNA molecule are only exemplary sequences. Other sequences for the WNT5B variant genomic nucleic acid molecule, variant mRNA molecule, and variant cDNA molecule are also possible. The biological sample can be derived from any cell, tissue, or biological fluid from the subject. The biological sample may comprise any clinically relevant tissue such as, for example, a bone marrow sample, a tumor biopsy, a fine needle aspirate, or a sample of bodily fluid, such as blood, gingival crevicular fluid, plasma, serum, lymph, ascitic fluid, cystic fluid, or urine. In some embodiments, the biological sample comprises a buccal swab. The biological sample used in the methods disclosed herein can vary based on the assay format, nature of the detection method, and the tissues, cells, or extracts that are used as the sample. A biological sample can be processed differently depending on the assay being employed. For example, when detecting any WNT5B variant nucleic acid molecule, preliminary processing designed to isolate or enrich the biological sample for the WNT5B variant nucleic acid molecule can be employed. A variety of techniques may be used for this purpose. When detecting the level of any WNT5B variant mRNA molecule, different techniques can be used enrich the biological sample with mRNA molecules. Various methods to detect the presence or level of an mRNA molecule or the presence of a particular variant genomic DNA locus can be used. The present disclosure also provides methods of detecting a WNT5B variant nucleic acid molecule, or the complement thereof, encoding a WNT5B predicted loss-of-function polypeptide in a subject. The methods comprise assaying a biological sample obtained from the subject to determine whether a nucleic acid molecule in the biological sample is a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the WNT5B variant nucleic acid molecule encoding the WNT5B predicted loss-of-function polypeptide, or the complement thereof, is a genomic nucleic acid molecule having a nucleotide sequence comprising: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof. In some embodiments, the WNT5B variant nucleic acid molecule encoding the WNT5B predicted loss-of-function polypeptide, or the complement thereof, is an mRNA molecule having a nucleotide sequence comprising: a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NO:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof. In some embodiments, the WNT5B variant nucleic acid molecule encoding the WNT5B predicted loss-of-function polypeptide, or the complement thereof, is a cDNA molecule produced from an mRNA molecule in the biological sample having a nucleotide sequence comprising: a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof. In some embodiments, the WNT5B variant nucleic acid molecule has a nucleotide sequence comprising: i) a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2 (for genomic nucleic acid molecules); ii) a uracil at a position corresponding to position 242 according to SEQ ID NO:15; a uracil at a position corresponding to position 145 according to SEQ ID NO:16; a uracil at a position corresponding to position 198 according to SEQ ID NO:17; a uracil at a position corresponding to position 40 according to SEQ ID NO:18; a uracil at a position corresponding to position 145 according to SEQ ID NO:19; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20; or a uracil at a position corresponding to position 543 according to SEQ ID NO:21 (for mRNA molecules); or iii) a thymine at a position corresponding to position 242 according to SEQ ID NO:58; a thymine at a position corresponding to position 145 according to SEQ ID NO:59; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60; a thymine at a position corresponding to position 40 according to SEQ ID NO:61; a thymine at a position corresponding to position 145 according to SEQ ID NO:62; a thymine at a position corresponding to position 183 according to SEQ ID NO:63; or a thymine at a position corresponding to position 543 according to SEQ ID NO:64 (for cDNA molecules obtained from mRNA molecules). In some embodiments, the WNT5B variant nucleic acid molecule has a nucleotide sequence comprising: i) an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3 (for genomic nucleic acid molecules); ii) an adenine at a position corresponding to position 491 according to SEQ ID NO:22; an adenine at a position corresponding to position 394 according to SEQ ID NO:23; an adenine at a position corresponding to position 447 according to SEQ ID NO:24; an adenine at a position corresponding to position 289 according to SEQ ID NO:25; an adenine at a position corresponding to position 394 according to SEQ ID NO:26; an adenine at a position corresponding to position 432 according to SEQ ID NO:27; an adenine at a position corresponding to position 792 according to SEQ ID NO:28; or an adenine at a position corresponding to position 254 according to SEQ ID NO:29; or iii) an adenine at a position corresponding to position 491 according to SEQ ID NO:65; an adenine at a position corresponding to position 394 according to SEQ ID NO:66; an adenine at a position corresponding to position 447 according to SEQ ID NO:67; an adenine at a position corresponding to position 289 according to SEQ ID NO:68; an adenine at a position corresponding to position 394 according to SEQ ID NO:69; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70; an adenine at a position corresponding to position 792 according to SEQ ID NO:71; or an adenine at a position corresponding to position 254 according to SEQ ID NO:72 (for cDNA molecules obtained from mRNA molecules). In some embodiments, the WNT5B variant nucleic acid molecule has a nucleotide sequence comprising: i) a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4 (for genomic nucleic acid molecules); ii) a uracil at a position corresponding to position 642 according to SEQ ID NQ:30; a uracil at a position corresponding to position 545 according to SEQ ID NO:31; a uracil at a position corresponding to position 598 according to SEQ ID NO:32; a uracil at a position corresponding to position 545 according to SEQ ID NO:33; a uracil at a position corresponding to position 583 according to SEQ ID NO:34; a uracil at a position corresponding to position 943 according to SEQ ID NO:35; or a uracil at a position corresponding to position 405 according to SEQ ID NO:36; or iii) a thymine at a position corresponding to position 642 according to SEQ ID NO:73; a thymine at a position corresponding to position 545 according to SEQ ID NO:74; or a thymine at a position corresponding to position 598 according to SEQ ID NO:75; a thymine at a position corresponding to position 545 according to SEQ ID NO:76; a thymine at a position corresponding to position 583 according to SEQ ID NO:77; a thymine at a position corresponding to position 943 according to SEQ ID NO:78; or a thymine at a position corresponding to position 405 according to SEQ ID NO:79 (for cDNA molecules obtained from mRNA molecules). In some embodiments, the WNT5B variant nucleic acid molecule has a nucleotide sequence comprising: i) an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5 (for genomic nucleic acid molecules); ii) an adenine at a position corresponding to position 642 according to SEQ ID NO:37; an adenine at a position corresponding to position 545 according to SEQ ID NO:38; an adenine at a position corresponding to position 598 according to SEQ ID NO:39; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40; an adenine at a position corresponding to position 583 according to SEQ ID NO:41; an adenine at a position corresponding to position 943 according to SEQ ID NO:42; or an adenine at a position corresponding to position 405 according to SEQ ID NO:43; or iii) an adenine at a position corresponding to position 642 according to SEQ ID NQ:80; an adenine at a position corresponding to position 545 according to SEQ ID NO:81; an adenine at a position corresponding to position 598 according to SEQ ID NO:82; an adenine at a position corresponding to position 545 according to SEQ ID NO:83; an adenine at a position corresponding to position 583 according to SEQ ID NO:84; an adenine at a position corresponding to position 943 according to SEQ ID NO:85; or an adenine at a position corresponding to position 405 according to SEQ ID NO:86 (for cDNA molecules obtained from mRNA molecules). In some embodiments, the WNT5B variant nucleic acid molecule has a nucleotide sequence comprising: i) a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6 (for genomic nucleic acid molecules); ii) a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49; or iii) a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92 (for cDNA molecules obtained from mRNA molecules). In some embodiments, the biological sample comprises a cell or cell lysate. Such methods can further comprise, for example, obtaining a biological sample from the subject comprising a WNT5B genomic nucleic acid molecule or mRNA molecule, and if mRNA, optionally reverse transcribing the mRNA into cDNA. Such assays can comprise, for example determining the identity of these positions of the particular WNT5B nucleic acid molecule. In some embodiments, the method is an in vitro method. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of the nucleotide sequence of the WNT5B genomic nucleic acid molecule, the WNT5B mRNA molecule, or the WNT5B cDNA molecule produced from the mRNA molecule in the biological sample, wherein the sequenced portion comprises one or more variations that cause a loss-of-function (partial or complete) or are predicted to cause a loss-of-function (partial or complete). In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of: i) the nucleotide sequence of the WNT5B genomic nucleic acid molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; ii) the nucleotide sequence of the WNT5B mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NO:20, or the complement thereof; or position 543 according to SEQ ID NO:21, or the complement thereof; and / or iii) the nucleotide sequence of the WNT5B cDNA molecule produced from the mRNA in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NQ:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; or position 183 according to SEQ ID NO:63, or the complement thereof; position 543 according to SEQ ID NO:64, or the complement thereof. When the sequenced portion of the WNT5B nucleic acid molecule in the biological sample comprises: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of: i) the nucleotide sequence of the WNT5B genomic nucleic acid molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; ii) the nucleotide sequence of the WNT5B mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; or position 254 according to SEQ ID NO:29, or the complement thereof; and / or iii) the nucleotide sequence of the WNT5B cDNA molecule produced from the mRNA in the biological sample. wherein the sequenced portion comprises a position corresponding to: position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NQ:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; or position 254 according to SEQ ID NO:72, or the complement thereof. When the sequenced portion of the WNT5B nucleic acid molecule in the biological sample comprises: an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, an adenine at a position corresponding to position 491 according to SEQ corresponding to position 394 according to SEQ corresponding to position 447 according to SEQ corresponding to position 289 according to SEQ corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ corresponding to position 491 according to SEQ corresponding to position 394 according to SEQ corresponding to position 447 according to SEQ corresponding to position 289 according to SEQ corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ D NO:22, an adenine at a position D NO:23, an adenine at a position D NO:24, an adenine at a position D NO:25, an adenine at a position D NO:26, an adenine at a position D NO:27, an adenine at a position D NO:28, an adenine at a position D NO:29, an adenine at a position D NO:65, an adenine at a position D NO:66, an adenine at a position D NO:67, an adenine at a position D NO:68, an adenine at a position D NO:69, an adenine at a position D NQ:70, an adenine at a position D NO:71, or an adenine at a position D NO:72, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of: i) the nucleotide sequence of the WNT5B genomic nucleic acid molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; ii) the nucleotide sequence of the WNT5B mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 642 according to SEQ ID NO:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; or position 405 according to SEQ ID NO:36, or the complement thereof; and / or iii) the nucleotide sequence of the WNT5B cDNA molecule produced from the mRNA in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; or position 405 according to SEQ ID NO:79, or the complement thereof. When the sequenced portion of the WNT5B nucleic acid molecule in the biological sample comprises: a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of: i) the nucleotide sequence of the WNT5B genomic nucleic acid molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; ii) the nucleotide sequence of the WNT5B mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; or position 405 according to SEQ ID NO:43, or the complement thereof; and / or iii) the nucleotide sequence of the WNT5B cDNA molecule produced from the mRNA in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, or the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, or the complement thereof; or position 405 according to SEQ ID NO:86, or the complement thereof. When the sequenced portion of the WNT5B nucleic acid molecule in the biological sample comprises: an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ ID NO:39, an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, an adenine at a position corresponding to position 583 according to SEQ ID NO:41, an adenine at a position corresponding to position 943 according to SEQ ID NO:42, an adenine at a position corresponding to position 405 according to SEQ ID NO:43, an adenine at a position corresponding to position 642 according to SEQ ID NO:80, an adenine at a position corresponding to position 545 according to SEQ ID NO:81, an adenine at a position corresponding to position 598 according to SEQ ID NO:82, an adenine at a position corresponding to position 545 according to SEQ ID NO:83, an adenine at a position corresponding to position 583 according to SEQ ID NO:84, an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of: i) the nucleotide sequence of the WNT5B genomic nucleic acid molecule in the biological sample, wherein the sequenced portion comprises positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; ii) the nucleotide sequence of the WNT5B mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; positions 980-981 according to SEQ ID NO:48, or the complement thereof; or positions 802-803 according to SEQ ID NO:49, or the complement thereof; and / or iii) the nucleotide sequence of the WNT5B cDNA molecule produced from the mRNA in the biological sample, wherein the sequenced portion comprises a position corresponding to: positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, or the complement thereof. When the sequenced portion of the WNT5B nucleic acid molecule in the biological sample comprises: a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,0391,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of the nucleotide sequence of the WNT5B genomic nucleic acid molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 56,698 according to SEQ ID NO:2, or the complement thereof; position 58,170 according to SEQ ID NO:3, or the complement thereof; position 65,099 according to SEQ ID NO:4, or the complement thereof; position 65,099 according to SEQ ID NO:5, or the complement thereof; or positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof. When the sequenced portion of the WNT5B nucleic acid molecule in the biological sample comprises: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant genomic nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of the nucleotide sequence of the WNT5B mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NQ:20, or the complement thereof; position 543 according to SEQ ID NO:21, or the complement thereof; position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; position 254 according to SEQ ID NO:29, or the complement thereof; position 642 according to SEQ ID NQ:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; position 405 according to SEQ ID NO:36, or the complement thereof; position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; position 405 according to SEQ ID NO:43, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; positions 980-981 according to SEQ ID NO:48, or the complement thereof; or positions 802-803 according to SEQ ID NO:49, or the complement thereof, or the complement thereof. When the sequenced portion of the WNT5B mRNA molecule in the biological sample comprises: a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NO:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, an adenine at a position corresponding to position 491 according to SEQ ID NO:22, an adenine at a position corresponding to position 394 according to SEQ ID NO:23, an adenine at a position corresponding to position 447 according to SEQ ID NO:24, an adenine at a position corresponding to position 289 according to SEQ ID NO:25, an adenine at a position corresponding to position 394 according to SEQ ID NO:26, an adenine at a position corresponding to position 432 according to SEQ ID NO:27, an adenine at a position corresponding to position 792 according to SEQ ID NO:28, an adenine at a position corresponding to position 254 according to SEQ ID NO:29, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ ID NO:39, an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, an adenine at a position corresponding to position 583 according to SEQ ID NO:41, an adenine at a position corresponding to position 943 according to SEQ ID NO:42, an adenine at a position corresponding to position 405 according to SEQ ID NO:43, a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant mRNA molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises sequencing at least a portion of the nucleotide sequence of the WNT5B cDNA molecule produced from the mRNA molecule in the biological sample, wherein the sequenced portion comprises a position corresponding to: position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NQ:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; position 183 according to SEQ ID NO:63, or the complement thereof; position 543 according to SEQ ID NO:64, or the complement thereof; position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NQ:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; position 254 according to SEQ ID NO:72, or the complement thereof; position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; position 405 according to SEQ ID NO:79, or the complement thereof; position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, or the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, or the complement thereof; position 405 according to SEQ ID NO:86, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942-943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, or the complement thereof. When the sequenced portion of the WNT5B cDNA molecule in the biological sample comprises: a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, a thymine at a position corresponding to position 543 according to SEQ ID NO:64, an adenine at a position corresponding to position 491 according to SEQ ID NO:65, an adenine at a position corresponding to position 394 according to SEQ ID NO:66, an adenine at a position corresponding to position 447 according to SEQ ID NO:67, an adenine at a position corresponding to position 289 according to SEQ ID NO:68, an adenine at a position corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ corresponding to position 642 according to SEQ corresponding to position 545 according to SEQ corresponding to position 598 according to SEQ corresponding to position 545 according to SEQ corresponding to position 583 according to SEQ corresponding to position 943 according to SEQ corresponding to position 405 according to SEQ corresponding to position 642 according to SEQ corresponding to position 545 according to SEQ corresponding to position 598 according to SEQ corresponding to position 545 according to SEQ corresponding to position 583 according to SEQ corresponding to position 943 according to SEQ corresponding to position 405 according to SEQ D NO:69, an adenine at a position D NQ:70, an adenine at a position D NO:71, an adenine at a position D NO:72, a thymine at a position D NO:73, a thymine at a position D NO:74, a thymine at a position D NO:75, a thymine at a position D NO:76, a thymine at a position D NO:77, a thymine at a position D NO:78, a thymine at a position D NO:79, an adenine at a position D NQ:80, an adenine at a position D NO:81, an adenine at a position D NO:82, an adenine at a position D NO:83, an adenine at a position D NO:84, an adenine at a position D NO:85, an adenine at a position D NO:86, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, then the WNT5B nucleic acid molecule in the biological sample is a WNT5B variant cDNA molecule encoding a WNT5B predicted loss-of-function polypeptide. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, that is proximate to a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; ii) mRNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NQ:20, or the complement thereof; or position 543 according to SEQ ID NO:21, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NQ:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; position 183 according to SEQ ID NO:63, or the complement thereof; position 543 according to SEQ ID NO:64, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; ii) mRNA molecule, or the complement thereof, corresponding to: position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NQ:20, or the complement thereof; or position 543 according to SEQ ID NO:21, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, corresponding to: position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NO:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; position 183 according to SEQ ID NO:63, or the complement thereof; or position 543 according to SEQ ID NO:64, or the complement thereof; and c) determining whether the extension product of the primer comprises: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, that is proximate to a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; ii) mRNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; or position 254 according to SEQ ID NO:29, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NQ:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; or position 254 according to SEQ ID NO:72, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; ii) mRNA molecule, or the complement thereof, corresponding to: position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; or position 254 according to SEQ ID NO:29, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, corresponding to: position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NQ:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; or position 254 according to SEQ ID NO:72, or the complement thereof; and c) determining whether the extension product of the primer comprises: an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; or an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, that is proximate to a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; ii) mRNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 642 according to SEQ ID NQ:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; or position 405 according to SEQ ID NO:36, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; or position 405 according to SEQ ID NO:79, the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; ii) mRNA molecule, or the complement thereof, corresponding to: position 642 according to SEQ ID NQ:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; or position 405 according to SEQ ID NO:36, the complement thereof; and / or iii) cDNA molecule, or the complement thereof, corresponding to: position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; or position 405 according to SEQ ID NO:79, the complement thereof; and c) determining whether the extension product of the primer comprises: a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, that is proximate to a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; ii) mRNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; or position 405 according to SEQ ID NO:43, the complement thereof; and / or iii) cDNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, or the complement thereof; or position 405 according to SEQ ID NO:86, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; ii) mRNA molecule, or the complement thereof, corresponding to: position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; or position 405 according to SEQ ID NO:43, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, corresponding to: position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, or the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, the complement thereof; or position 405 according to SEQ ID NO:86, or the complement thereof; and c) determining whether the extension product of the primer comprises: an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, that is proximate to positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; ii) mRNA molecule, or the complement thereof, that is proximate to a position corresponding to: positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942-943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; or positions 980-981 according to SEQ ID NO:48, or the complement thereof; and / or iii) cDNA molecule, or the complement thereof, that is proximate to a position corresponding to: positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942-943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B: i) genomic nucleic acid molecule, or the complement thereof, corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; ii) mRNA molecule, or the complement thereof, corresponding to: positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; positions 980-981 according to SEQ ID NO:48, or the complement thereof; or positions 802-803 according to SEQ ID NO:49, or the complement thereof; and / iii) cDNA molecule, or the complement thereof, corresponding to: positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942-943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, or the complement thereof; and c) determining whether the extension product of the primer comprises: a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B genomic nucleic acid molecule, or the complement thereof, that is proximate to a position corresponding to: position 56,698 according to SEQ ID NO:2, or the complement thereof; position 58,170 according to SEQ ID NO:3, or the complement thereof; position 65,099 according to SEQ ID NO:4, or the complement thereof; position 65,099 according to SEQ ID NO:5, or the complement thereof; or positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B genomic nucleic acid molecule, or the complement thereof, corresponding to: position 56,698 according to SEQ ID NO:2, or the complement thereof; position 58,170 according to SEQ ID NO:3, or the complement thereof; position 65,099 according to SEQ ID NO:4, or the complement thereof; position 65,099 according to SEQ ID NO:5, or the complement thereof; or positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; and c) determining whether the extension product of the primer comprises: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B mRNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NQ:20, or the complement thereof; position 543 according to SEQ ID NO:21, or the complement thereof; position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; position 254 according to SEQ ID NO:29, or the complement thereof; position 642 according to SEQ ID NQ:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; position 405 according to SEQ ID NO:36, or the complement thereof; position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; position 405 according to SEQ ID NO:43, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942-943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; positions 980-981 according to SEQ ID NO:48, or the complement thereof; or positions 802-803 according to SEQ ID NO:49, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B mRNA molecule corresponding to: position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NO:20, or the complement thereof; position 543 according to SEQ ID NO:21, or the complement thereof; position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; position 254 according to SEQ ID NO:29, or the complement thereof; position 642 according to SEQ ID NQ:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; position 405 according to SEQ ID NO:36, or the complement thereof; position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; position 405 according to SEQ ID NO:43, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942-943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; positions 980-981 according to SEQ ID NO:48, or the complement thereof; or positions 802-803 according to SEQ ID NO:49, or the complement thereof; and c) determining whether the extension product of the primer comprises: a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) contacting the biological sample with a primer hybridizing to a portion of the nucleotide sequence of the WNT5B cDNA molecule, or the complement thereof, that is proximate to a position corresponding to: position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NQ:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; position 183 according to SEQ ID NO:63, or the complement thereof; position 543 according to SEQ ID NO:64, or the complement thereof; position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NQ:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; position 254 according to SEQ ID NO:72, or the complement thereof; position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; position 405 according to SEQ ID NO:79, or the complement thereof; position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, or the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, or the complement thereof; position 405 according to SEQ ID NO:86, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942-943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, or the complement thereof; b) extending the primer at least through the position of the nucleotide sequence of the WNT5B cDNA molecule corresponding to: position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NQ:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; position 183 according to SEQ ID NO:63, or the complement thereof; position 543 according to SEQ ID NO:64, or the complement thereof; position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NQ:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; position 254 according to SEQ ID NO:72, or the complement thereof; position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; position 405 according to SEQ ID NO:79, or the complement thereof; position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, or the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, or the complement thereof; position 405 according to SEQ ID NO:86, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942-943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, the complement thereof; and c) determining whether the extension product of the primer comprises: a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof. In some embodiments, the entire nucleic acid molecule is sequenced. In some embodiments, only a WNT5B genomic nucleic acid molecule is analyzed. In some embodiments, only a WNT5B mRNA is analyzed. In some embodiments, only a WNT5B cDNA obtained from WNT5B mRNA is analyzed. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample, wherein the amplified portion comprises: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; or a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; or a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample, wherein the amplified portion comprises: an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; or an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; or an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample, wherein the amplified portion comprises: a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample, wherein the amplified portion comprises: an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample, wherein the amplified portion comprises: a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B genomic nucleic acid molecule, or the complement thereof, in the biological sample, wherein the portion comprises: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B mRNA molecule, or the complement thereof, in the biological sample, wherein the portion comprises: a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, the complement thereof; and d) detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: a) amplifying at least a portion of the WNT5B cDNA molecule, or the complement thereof, in the biological sample, wherein the portion comprises: a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof; b) labeling the amplified nucleic acid molecule with a detectable label; c) contacting the labeled nucleic acid molecule with a support comprising an alteration-specific probe, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleic acid sequence of the amplified nucleic acid molecule comprising: a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, the complement thereof; and d) detecting the detectable label. In some embodiments, the nucleic acid molecule is mRNA and the determining step further comprises reverse-transcribing the mRNA into a cDNA prior to the amplifying step. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B nucleic acid molecule, or the complement thereof, comprising: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; or a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B nucleic acid molecule, or the complement thereof, in the biologicaI sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B nucleic acid molecule, or the complement thereof, comprising: an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; or an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B nucleic acid molecule, or the complement thereof, comprising: a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NO:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B nucleic acid molecule, or the complement thereof, comprising: an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B nucleic acid molecule, or the complement thereof, in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B nucleic acid molecule, or the complement thereof, comprising: a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B genomic nucleic acid molecule, or the complement thereof, in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B genomic nucleic acid molecule, or the complement thereof, comprising: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, or the complement thereof; an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, or the complement thereof; a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, or the complement thereof; an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B mRNA molecule, or the complement thereof, in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B mRNA molecule, or the complement thereof, comprising: a uracil at a position corresponding to position 242 according to SEQ ID NO:15, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:16, or the complement thereof; a uracil at a position corresponding to position 198 according to SEQ ID NO:17, or the complement thereof; a uracil at a position corresponding to position 40 according to SEQ ID NO:18, or the complement thereof; a uracil at a position corresponding to position 145 according to SEQ ID NO:19, or the complement thereof; a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, or the complement thereof; a uracil at a position corresponding to position 543 according to SEQ ID NO:21, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:22, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:23, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:24, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:25, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:26, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NO:27, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:28, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:29, or the complement thereof; a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:31, or the complement thereof; a uracil at a position corresponding to position 598 according to SEQ ID NO:32, or the complement thereof; a uracil at a position corresponding to position 545 according to SEQ ID NO:33, or the complement thereof; a uracil at a position corresponding to position 583 according to SEQ ID NO:34, or the complement thereof; a uracil at a position corresponding to position 943 according to SEQ ID NO:35, or the complement thereof; a uracil at a position corresponding to position 405 according to SEQ ID NO:36, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NO:37, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:38, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:39, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:41, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:42, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:43, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, or the complement thereof; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, or the complement thereof; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, or the complement thereof; and detecting the detectable label. In some embodiments, the determining step, detecting step, or sequence analysis comprises: contacting the WNT5B cDNA molecule, or the complement thereof, produced from an mRNA molecule in the biological sample with an alteration-specific probe comprising a detectable label, wherein the alteration-specific probe comprises a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of the WNT5B cDNA molecule, or the complement thereof, comprising: a thymine at a position corresponding to position 242 according to SEQ ID NO:58, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:59, or the complement thereof; a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, or the complement thereof; a thymine at a position corresponding to position 40 according to SEQ ID NO:61, or the complement thereof; a thymine at a position corresponding to position 145 according to SEQ ID NO:62, or the complement thereof; a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or the complement thereof; a thymine at a position corresponding to position 543 according to SEQ ID NO:64, or the complement thereof; an adenine at a position corresponding to position 491 according to SEQ ID NO:65, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:66, or the complement thereof; an adenine at a position corresponding to position 447 according to SEQ ID NO:67, or the complement thereof; an adenine at a position corresponding to position 289 according to SEQ ID NO:68, or the complement thereof; an adenine at a position corresponding to position 394 according to SEQ ID NO:69, or the complement thereof; an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, or the complement thereof; an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or the complement thereof; an adenine at a position corresponding to position 254 according to SEQ ID NO:72, or the complement thereof; a thymine at a position corresponding to position 642 according to SEQ ID NO:73, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:74, or the complement thereof; a thymine at a position corresponding to position 598 according to SEQ ID NO:75, or the complement thereof; a thymine at a position corresponding to position 545 according to SEQ ID NO:76, or the complement thereof; a thymine at a position corresponding to position 583 according to SEQ ID NO:77, or the complement thereof; a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or the complement thereof; a thymine at a position corresponding to position 405 according to SEQ ID NO:79, or the complement thereof; an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:81, or the complement thereof; an adenine at a position corresponding to position 598 according to SEQ ID NO:82, or the complement thereof; an adenine at a position corresponding to position 545 according to SEQ ID NO:83, or the complement thereof; an adenine at a position corresponding to position 583 according to SEQ ID NO:84, or the complement thereof; an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or the complement thereof; an adenine at a position corresponding to position 405 according to SEQ ID NO:86, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, or the complement thereof; a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or the complement thereof; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or the complement thereof; and detecting the detectable label. In some embodiments, the WNT5B nucleic acid molecule is present within a cell obtained from the subject. Alteration-specific polymerase chain reaction techniques can be used to detect mutations such as SNPs in a nucleic acid sequence. Alteration-specific primers can be used because the DNA polymerase will not extend when a mismatch with the template is present. In some embodiments, the determining step, detecting step, or sequence analysis comprises contacting the biological sample with a primer or probe, such as an alterationspecific primer or alteration-specific probe, that specifically hybridizes to a WNT5B variant genomic sequence, variant mRNA sequence, or variant cDNA sequence and not the corresponding WNT5B reference sequence under stringent conditions, and determining whether hybridization has occurred. In some embodiments, the assay comprises RNA sequencing (RNA-Seq). In some embodiments, the assays also comprise reverse transcribing mRNA into cDNA, such as by the reverse transcriptase polymerase chain reaction (RT-PCR). In some embodiments, the methods utilize probes and primers of sufficient nucleotide length to bind to the target nucleotide sequence and specifically detect and / or identify a polynucleotide comprising a WNT5B variant genomic nucleic acid molecule, variant mRNA molecule, or variant cDNA molecule. The hybridization conditions or reaction conditions can be determined by the operator to achieve this result. The nucleotide length may be any length that is sufficient for use in a detection method of choice, including any assay described or exemplified herein. Such probes and primers can hybridize specifically to a target nucleotide sequence under high stringency hybridization conditions. Probes and primers may have complete nucleotide sequence identity of contiguous nucleotides within the target nucleotide sequence, although probes differing from the target nucleotide sequence and that retain the ability to specifically detect and / or identify a target nucleotide sequence may be designed by conventional methods. Probes and primers can have about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity or complementarity with the nucleotide sequence of the target nucleic acid molecule. In some embodiments, to determine whether a WNT5B nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule), or complement thereof, within a biological sample comprises a nucleotide sequence comprising a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64, the biological sample can be subjected to an amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64, and a second primer derived from the 3' flanking sequence adjacent to a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64 to produce an amplicon that is indicative of the presence of the SNP at positions encoding a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64. In some embodiments, the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. Optionally, the primer pair flanks a region including positions comprising a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64 and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of positions comprising a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2, a uracil at a position corresponding to position 242 according to SEQ ID NO:15, a uracil at a position corresponding to position 145 according to SEQ ID NO:16, a uracil at a position corresponding to position 198 according to SEQ ID NO:17, a uracil at a position corresponding to position 40 according to SEQ ID NO:18, a uracil at a position corresponding to position 145 according to SEQ ID NO:19, a uracil at a position corresponding to position 183 according to SEQ ID NQ:20, a uracil at a position corresponding to position 543 according to SEQ ID NO:21, a thymine at a position corresponding to position 242 according to SEQ ID NO:58, a thymine at a position corresponding to position 145 according to SEQ ID NO:59, a thymine at a position corresponding to position 198 according to SEQ ID NQ:60, a thymine at a position corresponding to position 40 according to SEQ ID NO:61, a thymine at a position corresponding to position 145 according to SEQ ID NO:62, a thymine at a position corresponding to position 183 according to SEQ ID NO:63, or a thymine at a position corresponding to position 543 according to SEQ ID NO:64. In some embodiments, to determine whether a WNT5B nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule), or complement thereof, within a biological sample comprises a nucleotide sequence comprising an adenine at a position corresponding to position 58,170 accord corresponding to position 491 according corresponding to position 394 according corresponding to position 447 according corresponding to position 289 according corresponding to position 394 according corresponding to position 432 according corresponding to position 792 according corresponding to position 254 according corresponding to position 491 according corresponding to position 394 according corresponding to position 447 according corresponding to position 289 according corresponding to position 394 according corresponding to position 432 according corresponding to position 792 according corresponding to position 254 according ing to SEQ ID NO:3, an adenine at a position to SEQ ID NO:22, an adenine at a position to SEQ ID NO:23, an adenine at a position to SEQ ID NO:24, an adenine at a position to SEQ ID NO:25, an adenine at a position to SEQ ID NO:26, an adenine at a position to SEQ ID NO:27, an adenine at a position to SEQ ID NO:28, an adenine at a position to SEQ ID NO:29, an adenine at a position to SEQ ID NO:65, an adenine at a position to SEQ ID NO:66, an adenine at a position to SEQ ID NO:67, an adenine at a position to SEQ ID NO:68, an adenine at a position to SEQ ID NO:69, an adenine at a position to SEQ ID NQ:70, an adenine at a position to SEQ ID NO:71, or an adenine at a position to SEQ ID NO:72, the biological sample can be subjected to an amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, an adenine at a position corresponding to position 491 according to SEQ ID NO:22, an adenine at a position corresponding to position 394 according to SEQ ID NO:23, an adenine at a position corresponding to position 447 according to SEQ ID NO:24, an adenine at a position corresponding to position 289 according to SEQ ID NO:25, an adenine at a position corresponding to position 394 according to SEQ ID NO:26, an adenine at a position corresponding to position 432 according to SEQ ID NO:27, an adenine at a position corresponding to position 792 according to SEQ ID NO:28, an adenine at a position corresponding to position 254 according to SEQ ID NO:29, an adenine at a position corresponding to position 491 according to SEQ ID NO:65, an adenine at a position corresponding to position 394 according to SEQ ID NO:66, an adenine at a position corresponding to position 447 according to SEQ ID NO:67, an adenine at a position corresponding to position 289 according to SEQ ID NO:68, an adenine at a position corresponding to position 394 according to SEQ ID NO:69, an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or an adenine at a position corresponding to position 254 according to SEQ ID NO:72, and a second primer derived from the 3' flanking sequence adjacent to an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, an adenine at a position corresponding to position 491 according to SEQ ID NO:22, an adenine at a position corresponding to position 394 according to SEQ ID NO:23, an adenine at a position corresponding to position 447 according to SEQ ID NO:24, an adenine at a position corresponding to position 289 according to SEQ ID NO:25, an adenine at a position corresponding to position 394 according to SEQ ID NO:26, an adenine at a position corresponding to position 432 according to SEQ ID NO:27, an adenine at a position corresponding to position 792 according to SEQ ID NO:28, an adenine at a position corresponding to position 254 according to SEQ ID NO:29, an adenine at a position corresponding to position 491 according to SEQ ID NO:65, an adenine at a position corresponding to position 394 according to SEQ ID NO:66, an adenine at a position corresponding to position 447 according to SEQ ID NO:67, an adenine at a position corresponding to position 289 according to SEQ ID NO:68, an adenine at a position corresponding to position 394 according to SEQ ID NO:69, an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or an adenine at a position corresponding to position 254 according to SEQ ID NO:72 to produce an amplicon that is indicative of the presence of the SNP at positions encoding an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, an adenine at a position corresponding to position 491 according to SEQ corresponding to position 394 according to SEQ corresponding to position 447 according to SEQ corresponding to position 289 according to SEQ corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ corresponding to position 491 according to SEQ corresponding to position 394 according to SEQ corresponding to position 447 according to SEQ corresponding to position 289 according to SEQ corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ may range in length from the combined length c to any length of amplicon producible by a DNA z ID NO:22, an adenine at a position ID NO:23, an adenine at a position ID NO:24, an adenine at a position ID NO:25, an adenine at a position ID NO:26, an adenine at a position ID NO:27, an adenine at a position ID NO:28, an adenine at a position ID NO:29, an adenine at a position ID NO:65, an adenine at a position ID NO:66, an adenine at a position ID NO:67, an adenine at a position ID NO:68, an adenine at a position ID NO:69, an adenine at a position ID NQ:70, an adenine at a position ID NO:71, or an adenine at a position ID NO:72. In some embodiments, the amplicon >f the primer pairs plus one nucleotide base pair implification protocol. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. Optionally, the primer pair flanks a region including positions comprising an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, an adenine at a position corresponding to position 491 according to SEQ ID NO:22, an adenine at a position corresponding to position 394 according to SEQ ID NO:23, an adenine at a position corresponding to position 447 according to SEQ ID NO:24, an adenine at a position corresponding to position 289 according to SEQ ID NO:25, an adenine at a position corresponding to position 394 according to SEQ ID NO:26, an adenine at a position corresponding to position 432 according to SEQ ID NO:27, an adenine at a position corresponding to position 792 according to SEQ ID NO:28, an adenine at a position corresponding to position 254 according to SEQ ID NO:29, an adenine at a position corresponding to position 491 according to SEQ ID NO:65, an adenine at a position corresponding to position 394 according to SEQ ID NO:66, an adenine at a position corresponding to position 447 according to SEQ ID NO:67, an adenine at a position corresponding to position 289 according to SEQ ID NO:68, an adenine at a position corresponding to position 394 according to SEQ ID NO:69, an adenine at a position corresponding to position 432 according to SEQ ID NQ:70, an adenine at a position corresponding to position 792 according to SEQ ID NO:71, or an adenine at a position corresponding to position 254 according to SEQ ID NO:72, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9,10, or more nucleotides on each side of positions comprising an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3, an adenine at a position corresponding to position 491 according to SEQ corresponding to position 394 according to SEQ corresponding to position 447 according to SEQ corresponding to position 289 according to SEQ corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ corresponding to position 491 according to SEQ corresponding to position 394 according to SEQ corresponding to position 447 according to SEQ corresponding to position 289 according to SEQ corresponding to position 394 according to SEQ corresponding to position 432 according to SEQ corresponding to position 792 according to SEQ corresponding to position 254 according to SEQ D NO:22, an adenine at a position D NO:23, an adenine at a position D NO:24, an adenine at a position D NO:25, an adenine at a position D NO:26, an adenine at a position D NO:27, an adenine at a position D NO:28, an adenine at a position D NO:29, an adenine at a position D NO:65, an adenine at a position D NO:66, an adenine at a position D NO:67, an adenine at a position D NO:68, an adenine at a position D NO:69, an adenine at a position D NQ:70, an adenine at a position D NO:71, or an adenine at a position D NO:72. In some embodiments, to determine whether a WNT5B nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule), or complement thereof, within a biological sample comprises a nucleotide sequence comprising a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, the biological sample can be subjected to an amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, and a second primer derived from the 3' flanking sequence adjacent to a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, to produce an amplicon that is indicative of the presence of the SNP at positions encoding a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79. In some embodiments, the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. Optionally, the primer pair flanks a region including positions comprising a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9,10, or more nucleotides on each side of positions comprising a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4, a uracil at a position corresponding to position 642 according to SEQ ID NQ:30, a uracil at a position corresponding to position 545 according to SEQ ID NO:31, a uracil at a position corresponding to position 598 according to SEQ ID NO:32, a uracil at a position corresponding to position 545 according to SEQ ID NO:33, a uracil at a position corresponding to position 583 according to SEQ ID NO:34, a uracil at a position corresponding to position 943 according to SEQ ID NO:35, a uracil at a position corresponding to position 405 according to SEQ ID NO:36, a thymine at a position corresponding to position 642 according to SEQ ID NO:73, a thymine at a position corresponding to position 545 according to SEQ ID NO:74, a thymine at a position corresponding to position 598 according to SEQ ID NO:75, a thymine at a position corresponding to position 545 according to SEQ ID NO:76, a thymine at a position corresponding to position 583 according to SEQ ID NO:77, a thymine at a position corresponding to position 943 according to SEQ ID NO:78, or a thymine at a position corresponding to position 405 according to SEQ ID NO:79. In some embodiments, to determine whether a WNT5B nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule), or complement thereof, within a biological sample comprises a nucleotide sequence comprising an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ ID NO:39, an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, an adenine at a position corresponding to position 583 according to SEQ ID NO:41, an adenine at a position corresponding to position 943 according to SEQ ID NO:42, an adenine at a position corresponding to position 405 according to SEQ ID NO:43,, an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, an adenine at a position corresponding to position 545 according to SEQ ID NO:81, an adenine at a position corresponding to position 598 according to SEQ ID NO:82, an adenine at a position corresponding to position 545 according to SEQ ID NO:83, an adenine at a position corresponding to position 583 according to SEQ ID NO:84, an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, the biological sample can be subjected to an amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ ID NO:39, an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, an adenine at a position corresponding to position 583 according to SEQ ID NO:41, an adenine at a position corresponding to position 943 according to SEQ ID NO:42, an adenine at a position corresponding to position 405 according to SEQ ID NO:43, an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, an adenine at a position corresponding to position 545 according to SEQ ID NO:81, an adenine at a position corresponding to position 598 according to SEQ ID NO:82, an adenine at a position corresponding to position 545 according to SEQ ID NO:83, an adenine at a position corresponding to position 583 according to SEQ ID NO:84, an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, and a second primer derived from the 3' flanking sequence adjacent to an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ ID NO:39, an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, an adenine at a position corresponding to position 583 according to SEQ ID NO:41, an adenine at a position corresponding to position 943 according to SEQ ID NO:42, an adenine at a position corresponding to position 405 according to SEQ ID NO:43, an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, an adenine at a position corresponding to position 545 according to SEQ ID NO:81, an adenine at a position corresponding to position 598 according to SEQ ID NO:82, an adenine at a position corresponding to position 545 according to SEQ ID NO:83, an adenine at a position corresponding to position 583 according to SEQ ID NO:84, an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or an adenine at a position corresponding to position 405 according to SEQ ID NO:86, to produce an amplicon that is indicative of the presence of the SNP at positions encoding an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ corresponding to position 545 according to SEQ corresponding to position 598 according to SEQ corresponding to position 545 according to SEQ corresponding to position 583 according to SEQ corresponding to position 943 according to SEQ corresponding to position 405 according to SEQ corresponding to position 642 according to SEQ corresponding to position 545 according to SEQ corresponding to position 598 according to SEQ corresponding to position 545 according to SEQ corresponding to position 583 according to SEQ corresponding to position 943 according to SEQ corresponding to position 405 according to SEQ ID NO:37, an adenine at a position ID NO:38, an adenine at a position ID NO:39, an adenine at a position ID NQ:40, an adenine at a position ID NO:41, an adenine at a position ID NO:42, an adenine at a position ID NO:43, an adenine at a position ID NQ:80, an adenine at a position ID NO:81, an adenine at a position ID NO:82, an adenine at a position ID NO:83, an adenine at a position ID NO:84, an adenine at a position ID NO:85, or an adenine at a position ID NO:86. In some embodiments, the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. Optionally, the primer pair flanks a region including positions comprising an adenine at a position corresponding to position 65,099 according to SEQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ corresponding to position 545 according to SEQ corresponding to position 583 according to SEQ corresponding to position 943 according to SEQ corresponding to position 405 according to SEQ corresponding to position 642 according to SEQ corresponding to position 545 according to SEQ corresponding to position 598 according to SEQ corresponding to position 545 according to SEQ corresponding to position 583 according to SEQ corresponding to position 943 according to SEQ corresponding to position 405 according to SEQ or more nucleotides on each side of positions cc corresponding to position 65,099 according to S ID NO:39, an adenine at a position ID NQ:40, an adenine at a position ID NO:41, an adenine at a position ID NO:42, an adenine at a position ID NO:43, an adenine at a position ID NQ:80, an adenine at a position ID NO:81, an adenine at a position ID NO:82, an adenine at a position ID NO:83, an adenine at a position ID NO:84, an adenine at a position ID NO:85, or an adenine at a position ID NO:86, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, imprising an adenine at a position EQ ID NO:5, an adenine at a position corresponding to position 642 according to SEQ ID NO:37, an adenine at a position corresponding to position 545 according to SEQ ID NO:38, an adenine at a position corresponding to position 598 according to SEQ ID NO:39, an adenine at a position corresponding to position 545 according to SEQ ID NQ:40, an adenine at a position corresponding to position 583 according to SEQ ID NO:41, an adenine at a position corresponding to position 943 according to SEQ ID NO:42, an adenine at a position corresponding to position 405 according to SEQ ID NO:43, an adenine at a position corresponding to position 642 according to SEQ ID NQ:80, an adenine at a position corresponding to position 545 according to SEQ ID NO:81, an adenine at a position corresponding to position 598 according to SEQ ID NO:82, an adenine at a position corresponding to position 545 according to SEQ ID NO:83, an adenine at a position corresponding to position 583 according to SEQ ID NO:84, an adenine at a position corresponding to position 943 according to SEQ ID NO:85, or an adenine at a position corresponding to position 405 according to SEQ ID NO:86. In some embodiments, to determine whether a WNT5B nucleic acid molecule (genomic nucleic acid molecule, mRNA molecule, or cDNA molecule), or complement thereof, within a biological sample comprises a nucleotide sequence comprising a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, the biological sample can be subjected to an amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, and a second primer derived from the 3' flanking sequence adjacent to a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, to produce an amplicon that is indicative of the presence of the SNP at positions encoding a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,0391,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92. In some embodiments, the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. Optionally, the primer pair flanks a region including positions comprising a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NQ:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of positions comprising a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6, a deletion of a UC dinucleotide at positions corresponding to positions 1,0391,040 according to SEQ ID NO:44, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45, a deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46, a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47, a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48, a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49, a deletion of a TC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:87, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:88, a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89, a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:90, a deletion of a TC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:91, or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92, or a deletion of a TC dinucleotide at a position corresponding to position. Similar amplicons can be generated from the mRNA and / or cDNA sequences. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose, such as the PCR primer analysis tool in Vector NTI version 10 (Informax Inc., Bethesda Md.); PrimerSelect (DNASTAR Inc., Madison, Wis.); and Primer3 (Version 0.4.0.COPYRGT., 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Additionally, the sequence can be visually scanned and primers manually identified using known guidelines. Illustrative examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Other methods involve nucleic acid hybridization methods other than sequencing, including using labeled primers or probes directed against purified DNA, amplified DNA, and fixed cell preparations (fluorescence in situ hybridization (FISH)). In some methods, a target nucleic acid molecule may be amplified prior to or simultaneous with detection. Illustrative examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA). Other methods include, but are not limited to, ligase chain reaction, strand displacement amplification, and thermophilic SDA (tSDA). In hybridization techniques, stringent conditions can be employed such that a probe or primer will specifically hybridize to its target. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target sequence to a detectably greater degree than to other non-target sequences, such as, at least 2-fold, at least 3-fold, at least 4fold, or more over background, including over 10-fold over background. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence to a detectably greater degree than to other nucleotide sequences by at least 2-fold. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence to a detectably greater degree than to other nucleotide sequences by at least 3-fold. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence to a detectably greater degree than to other nucleotide sequences by at least 4-fold. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target nucleotide sequence to a detectably greater degree than to other nucleotide sequences by over 10-fold over background. Stringent conditions are sequence-dependent and will be different in different circumstances. Appropriate stringency conditions which promote DNA hybridization, for example, 6X sodium chloride / sodium citrate (SSC) at about 45°C., followed by a wash of 2X SSC at 50°C, are known or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (such as, for example, 10 to 50 nucleotides) and at least about 60°C for longer probes (such as, for example, greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium. The present disclosure also provides methods of detecting the presence of a WNT5B predicted loss-of-function polypeptide comprising performing an assay on a biological sample obtained from the subject to determine whether a WNT5B polypeptide in the biological sample contains one or more variations that causes the polypeptide to have a loss-of-function (partial or complete) or predicted loss-of-function (partial or complete). The WNT5B predicted loss-of-function polypeptide can be any of the WNT5B predicted loss-of-function polypeptides described herein. In some embodiments, the methods detect the presence of WNT5B Cys83Stop-LG, Cys83Stop-Sht, Cysll4Stop, Argl34Cys-LG, Argl34Cys-Sht, Argl34Ser-LG, Argl34Ser-Sht, or Val266fs. In some embodiments, the methods comprise performing an assay on a biological sample obtained from a subject to determine whether a WNT5B polypeptide in the biological sample comprises a truncation at a position corresponding to position 83 according to SEQ ID NO:96, a truncation at a position corresponding to position 83 according to SEQ ID NO:97, or a truncation at a position corresponding to position 113 according to SEQ ID NO:98. In some embodiments, the methods comprise performing an assay on a biological sample obtained from a subject to determine whether a WNT5B polypeptide in the biological sample comprises a cysteine at a position corresponding to position 134 according to SEQ ID NO:99, or a cysteine at a position corresponding to position 134 according to SEQ ID NQ:100. In some embodiments, the methods comprise performing an assay on a biological sample obtained from a subject to determine whether a WNT5B polypeptide in the biological sample comprises a serine at a position corresponding to position 134 according to SEQ ID NQ:101, or a serine at a position corresponding to position 134 according to SEQ ID NQ:102. In some embodiments, the methods comprise performing an assay on a biological sample obtained from a subject to determine whether a WNT5B polypeptide in the biological sample comprises a frameshift mutation at a position corresponding to position 266 according to SEQ ID NQ:103. In some embodiments, the detecting step comprises sequencing at least a portion of the WNT5B polypeptide that comprises a position corresponding to: position 83 according to SEQ ID NO:96, position 83 according to SEQ ID NO:97, or position 113 according to SEQ ID NO:98, or SEQ ID NO:93, SEQ ID NO:94, or SEQ ID NO:95. In some embodiments, the detecting step comprises sequencing at least a portion of the WNT5B polypeptide that comprises a position corresponding to: position 134 according to SEQ ID NO:99, or position 134 according to SEQ ID NQ:100, position, or SEQ ID NO:93 or SEQ ID NO:95. In some embodiments, the detecting step comprises sequencing at least a portion of the WNT5B polypeptide that comprises a position corresponding to: position 134 according to SEQ ID NQ:101, or position 134 according to SEQ ID NQ:102, or SEQ ID NO:93, or SEQ ID NO:95. In some embodiments, the detecting step comprises sequencing at least a portion of the WNT5B polypeptide that comprises a position corresponding to: position 266 according to SEQ ID NQ:103, or SEQ ID NO:93. In some embodiments, the detecting step comprises an immunoassay for detecting the presence of a WNT5B polypeptide that comprises a position corresponding to: position 83 according to SEQ ID NO:96, position 83 according to SEQ ID NO:97, or position 113 according to SEQ ID NO:98, or SEQ ID NO:93, SEQ ID NO:94, or SEQ ID NO:95. In some embodiments, the detecting step comprises an immunoassay for detecting the presence of a WNT5B polypeptide that comprises a position corresponding to: position 134 according to SEQ ID NO:99, or position 134 according to SEQ ID NQ:100, or SEQ ID NO:93, or SEQ ID NO:95. In some embodiments, the detecting step comprises an immunoassay for detecting the presence of a WNT5B polypeptide that comprises a position corresponding to: position 134 according to SEQ ID NQ:101, or position 134 according to SEQ ID NO:102, or SEQ ID NO:93, or SEQ ID NO:95. In some embodiments, the detecting step comprises an immunoassay for detecting the presence of a WNT5B polypeptide that comprises a position corresponding to: position 266 according to SEQ ID NQ:103, or SEQ ID NO:93. In some embodiments, when the subject does not have a WNT5B predicted loss-of-function polypeptide, the subject has an increased risk of developing decreased bone mineral density or any of osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis. In some embodiments, when the subject has a WNT5B predicted loss-of-function polypeptide, the subject has a decreased risk of developing decreased bone mineral density or any of osteopenia, Type I osteoporosis, Type II osteoporosis, and secondary osteoporosis. The present disclosure also provides isolated nucleic acid molecules that hybridize to WNT5B variant genomic nucleic acid molecules, WNT5B variant mRNA molecules, and / or WNT5B variant cDNA molecules (such as any of the genomic variant nucleic acid molecules, mRNA variant molecules, and cDNA variant molecules disclosed herein). In some embodiments, such isolated nucleic acid molecules hybridize to WNT5B variant nucleic acid molecules under stringent conditions. Such nucleic acid molecules can be used, for example, as probes, primers, alteration-specific probes, or alteration-specific primers as described or exemplified herein. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of the WNT5B nucleic acid molecule that includes a position corresponding to: position 56,698 according to SEQ ID NO:2, position 242 according to SEQ ID NO:15, position 145 according to SEQ ID NO:16, position 198 according to SEQ ID NO:17, position 40 according to SEQ ID NO:18, position 145 according to SEQ ID NO:19, position 183 according to SEQ ID NQ:20, position 543 according to SEQ ID NO:21, position 242 according to SEQ ID NO:58, position 145 according to SEQ ID NO:59, position 198 according to SEQ ID NQ:60, position 40 according to SEQ ID NO:61, position 145 according to SEQ ID NO:62, position 183 according to SEQ ID NO:63, or position 543 according to SEQ ID NO:64. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of the WNT5B nucleic acid molecule that includes a position corresponding to: position 58,170 according to SEQ ID NO:3, position 491 according to SEQ ID NO:22, position 394 according to SEQ ID NO:23, position 447 according to SEQ ID NO:24, position 289 according to SEQ ID NO:25, position 394 according to SEQ ID NO:26, position 432 according to SEQ ID NO:27, position 792 according to SEQ ID NO:28, position 254 according to SEQ ID NO:29, position 491 according to SEQ ID NO:65, position 394 according to SEQ ID NO:66, position 447 according to SEQ ID NO:67, position 289 according to SEQ ID NO:68, position 394 according to SEQ ID NO:69, position 432 according to SEQ ID NQ:70, position 792 according to SEQ ID NO:71, or position 254 according to SEQ ID NO:72. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of the WNT5B nucleic acid molecule that includes a position corresponding to: position 65,099 according to SEQ ID NO:4, position 642 according to SEQ ID NQ:30, position 545 according to SEQ ID NO:31, position 598 according to SEQ ID NO:32, position 642 according to SEQ ID NO:73, position 545 according to SEQ ID NO:74, position 598 according to SEQ ID NO:75, position 545 according to SEQ ID NO:76, position 583 according to SEQ ID NO:77, position 943 according to SEQ ID NO:78, or position 405 according to SEQ ID NO:79. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of the WNT5B nucleic acid molecule that includes a position corresponding to: position 65,099 according to SEQ ID NO:5, position 642 according to SEQ ID NO:37, position 545 according to SEQ ID NO:38, position 598 according to SEQ ID NO:39, position 545 according to SEQ ID NQ:40, position 583 according to SEQ ID NO:41, position 943 according to SEQ ID NO:42, position 405 according to SEQ ID NO:43, position 642 according to SEQ ID NQ:80, position 545 according to SEQ ID NO:81, position 598 according to SEQ ID NO:82, position 545 according to SEQ ID NO:83, position 583 according to SEQ ID NO:84, position 943 according to SEQ ID NO:85, or position 405 according to SEQ ID NO:86. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of the WNT5B nucleic acid molecule that includes a position corresponding to: positions 71,31371,314 according to SEQ ID NO:6, positions 1,039-1,040 according to SEQ ID NO:44, positions 942-943 according to SEQ ID NO:45, positions 995-996 according to SEQ ID NO:46, positions 942-943 according to SEQ ID NO:47, positions 980-981 according to SEQ ID NO:48, positions 802-803 according to SEQ ID NO:49, positions 1,039-1,040 according to SEQ ID NO:87, positions 942-943 according to SEQ ID NO:88, positions 995-996 according to SEQ ID NO:89, positions 942-943 according to SEQ ID NQ:90, positions 980-981 according to SEQ ID NO:91, or positions 802-803 according to SEQ ID NO:92. In some embodiments, such isolated nucleic acid molecules comprise or consist of at least about 5, at least about 8, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 2000, at least about 3000, at least about 4000, or at least about 5000 nucleotides. In some embodiments, such isolated nucleic acid molecules comprise or consist of at least about 5, at least about 8, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, or at least about 25 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least about 18 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consists of at least about 15 nucleotides. In some embodiments, the isolated nucleic acid molecules consist of or comprise from about 10 to about 35, from about 10 to about 30, from about 10 to about 25, from about 12 to about 30, from about 12 to about 28, from about 12 to about 24, from about 15 to about 30, from about 15 to about 25, from about 18 to about 30, from about 18 to about 25, from about 18 to about 24, or from about 18 to about 22 nucleotides. In some embodiments, the isolated nucleic acid molecules consist of or comprise from about 18 to about 30 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least about 15 nucleotides to at least about 35 nucleotides. In some embodiments, the isolated nucleic acid molecules hybridize to at least about 15 contiguous nucleotides of a nucleic acid molecule that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to WNT5B variant genomic nucleic acid molecules, WNT5B variant mRNA molecules, and / or WNT5B variant cDNA molecules. In some embodiments, the isolated nucleic acid molecules consist of or comprise from about 15 to about 100 nucleotides, or from about 15 to about 35 nucleotides. In some embodiments, the isolated nucleic acid molecules consist of or comprise from about 15 to about 100 nucleotides. In some embodiments, the isolated nucleic acid molecules consist of or comprise from about 15 to about 35 nucleotides. In some embodiments, the isolated alteration-specific probes or alteration-specific primers comprise at least about 15 nucleotides, wherein the alteration-specific probe or alteration-specific primer comprises a nucleotide sequence which is complementary to the nucleotide sequence of a portion of a WNT5B nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, or the complement thereof. In some embodiments, the portion comprises a position corresponding to: position 56,698 according to SEQ ID NO:2, or the complement thereof; position 242 according to SEQ ID NO:15, or the complement thereof; position 145 according to SEQ ID NO:16, or the complement thereof; position 198 according to SEQ ID NO:17, or the complement thereof; position 40 according to SEQ ID NO:18, or the complement thereof; position 145 according to SEQ ID NO:19, or the complement thereof; position 183 according to SEQ ID NQ:20, or the complement thereof; position 543 according to SEQ ID NO:21, or the complement thereof; position 242 according to SEQ ID NO:58, or the complement thereof; position 145 according to SEQ ID NO:59, or the complement thereof; position 198 according to SEQ ID NQ:60, or the complement thereof; position 40 according to SEQ ID NO:61, or the complement thereof; position 145 according to SEQ ID NO:62, or the complement thereof; position 183 according to SEQ ID NO:63, or the complement thereof; or position 543 according to SEQ ID NO:64, or the complement thereof. In some embodiments, the isolated alteration-specific probes or alteration-specific primers comprise at least about 15 nucleotides, wherein the alteration-specific probe or alteration-specific primer comprises a nucleotide sequence which is complementary to the nucleotide sequence of a portion of a WNT5B nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, or the complement thereof, wherein the portion comprises a position corresponding to: position 58,170 according to SEQ ID NO:3, or the complement thereof; position 491 according to SEQ ID NO:22, or the complement thereof; position 394 according to SEQ ID NO:23, or the complement thereof; position 447 according to SEQ ID NO:24, or the complement thereof; position 289 according to SEQ ID NO:25, or the complement thereof; position 394 according to SEQ ID NO:26, or the complement thereof; position 432 according to SEQ ID NO:27, or the complement thereof; position 792 according to SEQ ID NO:28, or the complement thereof; position 254 according to SEQ ID NO:29, or the complement thereof; position 491 according to SEQ ID NO:65, or the complement thereof; position 394 according to SEQ ID NO:66, or the complement thereof; position 447 according to SEQ ID NO:67, or the complement thereof; position 289 according to SEQ ID NO:68, or the complement thereof; position 394 according to SEQ ID NO:69, or the complement thereof; position 432 according to SEQ ID NO:70, or the complement thereof; position 792 according to SEQ ID NO:71, or the complement thereof; or position 254 according to SEQ ID NO:72, or the complement thereof. In some embodiments, the portion comprises positions corresponding to: positions 58,168-58,170 according to SEQ ID NO:3, or the complement thereof; positions 489491 according to SEQ ID NO:22, or the complement thereof; positions 392-394 according to SEQ ID NO:23, or the complement thereof; positions 445-447 according to SEQ ID NO:24, or the complement thereof; positions 287-289 according to SEQ ID NO:25, or the complement thereof; positions 392-394 according to SEQ ID NO:26, or the complement thereof; positions 430-432 according to SEQ ID NO:27, or the complement thereof; positions 790-792 according to SEQ ID NO:28, or the complement thereof; positions 252-254 according to SEQ ID NO:29, or the complement thereof; positions 489-491 according to SEQ ID NO:65, or the complement thereof; positions 392-394 according to SEQ ID NO:66, or the complement thereof; positions 445-447 according to SEQ ID NO:67, or the complement thereof; positions 287-289 according to SEQ ID NO:68, or the complement thereof; positions 392-394 according to SEQ ID NO:69, or the complement thereof; positions 430-432 according to SEQ ID NQ:70, or the complement thereof; positions 790-792 according to SEQ ID NO:71, or the complement thereof; or positions 252-254 according to SEQ ID NO:72, or the complement thereof. In some embodiments, the isolated alteration-specific probes or alteration-specific primers comprise at least about 15 nucleotides, wherein the alteration-specific probe or alteration-specific primer comprises a nucleotide sequence which is complementary to the nucleotide sequence of a portion of a WNT5B nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, or the complement thereof, wherein the portion comprises a position corresponding to: position 65,099 according to SEQ ID NO:4, or the complement thereof; position 642 according to SEQ ID NQ:30, or the complement thereof; position 545 according to SEQ ID NO:31, or the complement thereof; position 598 according to SEQ ID NO:32, or the complement thereof; position 545 according to SEQ ID NO:33, or the complement thereof; position 583 according to SEQ ID NO:34, or the complement thereof; position 943 according to SEQ ID NO:35, or the complement thereof; position 405 according to SEQ ID NO:36, or the complement thereof; position 642 according to SEQ ID NO:73, or the complement thereof; position 545 according to SEQ ID NO:74, or the complement thereof; position 598 according to SEQ ID NO:75, or the complement thereof; position 545 according to SEQ ID NO:76, or the complement thereof; position 583 according to SEQ ID NO:77, or the complement thereof; position 943 according to SEQ ID NO:78, or the complement thereof; or position 405 according to SEQ ID NO:79, or the complement thereof. In some embodiments, the portion comprises positions corresponding to: positions 65,099-65,101 according to SEQ ID NO:4, or the complement thereof; positions 642-644 according to SEQ ID NQ:30, or the complement thereof; positions 545-547 according to SEQ ID NO:31, or the complement thereof; positions 598-600 according to SEQ ID NO:32, or the complement thereof; positions 545-547 according to SEQ ID NO:33, or the complement thereof; positions 583-585 according to SEQ ID NO:34, or the complement thereof; positions 943-945 according to SEQ ID NO:35, or the complement thereof; positions 405-407 according to SEQ ID NO:36, or the complement thereof; positions 642-644 according to SEQ ID NO:73, or the complement thereof; positions 545-547 according to SEQ ID NO:74, or the complement thereof; positions 598-600 according to SEQ ID NO:75, or the complement thereof; positions 545-547 according to SEQ ID NO:76, or the complement thereof; positions 583-585 according to SEQ ID NO:77, or the complement thereof; positions 943-945 according to SEQ ID NO:78, or the complement thereof; or positions 405-407 according to SEQ ID NO:79, or the complement thereof. In some embodiments, the isolated alteration-specific probes or alteration-specific primers comprise at least about 15 nucleotides, wherein the alteration-specific probe or alteration-specific primer comprises a nucleotide sequence which is complementary to the nucleotide sequence of a portion of a WNT5B nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, or the complement thereof, wherein the portion comprises a position corresponding to: position 65,099 according to SEQ ID NO:5, or the complement thereof; position 642 according to SEQ ID NO:37, or the complement thereof; position 545 according to SEQ ID NO:38, or the complement thereof; position 598 according to SEQ ID NO:39, or the complement thereof; position 545 according to SEQ ID NQ:40, or the complement thereof; position 583 according to SEQ ID NO:41, or the complement thereof; position 943 according to SEQ ID NO:42, or the complement thereof; position 405 according to SEQ ID NO:43, or the complement thereof; position 642 according to SEQ ID NQ:80, or the complement thereof; position 545 according to SEQ ID NO:81, or the complement thereof; position 598 according to SEQ ID NO:82, or the complement thereof; position 545 according to SEQ ID NO:83, or the complement thereof; position 583 according to SEQ ID NO:84, or the complement thereof; position 943 according to SEQ ID NO:85, or the complement thereof; or position 405 according to SEQ ID NO:86, or the complement thereof. In some embodiments, the portion comprises positions corresponding to: positions 65,099-65,101 according to SEQ ID NO:5, or the complement thereof; positions 642-644 according to SEQ ID NO:37, or the complement thereof; positions 545-547 according to SEQ ID NO:38, or the complement thereof; positions 598-600 according to SEQ ID NO:39, or the complement thereof; positions 545-547 according to SEQ ID NQ:40, or the complement thereof; positions 583-585 according to SEQ ID NO:41, or the complement thereof; positions 943-945 according to SEQ ID NO:42, or the complement thereof; positions 405-407 according to SEQ ID NO:43, or the complement thereof; positions 642-644 according to SEQ ID NQ:80, or the complement thereof; positions 545-547 according to SEQ ID NO:81, or the complement thereof; positions 598-600 according to SEQ ID NO:82, or the complement thereof; positions 545-547 according to SEQ ID NO:83, or the complement thereof; positions 583-585 according to SEQ ID NO:84, or the complement thereof; positions 943-945 according to SEQ ID NO:85, or the complement thereof; or positions 405-407 according to SEQ ID NO:86, or the complement thereof. In some embodiments, the isolated alteration-specific probes or alteration-specific primers comprise at least about 15 nucleotides, wherein the alteration-specific probe or alteration-specific primer comprises a nucleotide sequence which is complementary to the nucleotide sequence of a portion of a WNT5B nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide, or the complement thereof, wherein the portion comprises a position corresponding to: positions 71,313-71,314 according to SEQ ID NO:6, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:44, or the complement thereof; positions 942-943 according to SEQ ID NO:45, or the complement thereof; positions 995-996 according to SEQ ID NO:46, or the complement thereof; positions 942-943 according to SEQ ID NO:47, or the complement thereof; positions 980-981 according to SEQ ID NO:48, or the complement thereof; positions 802-803 according to SEQ ID NO:49, or the complement thereof; positions 1,039-1,040 according to SEQ ID NO:87, or the complement thereof; positions 942-943 according to SEQ ID NO:88, or the complement thereof; positions 995-996 according to SEQ ID NO:89, or the complement thereof; positions 942-943 according to SEQ ID NQ:90, or the complement thereof; positions 980-981 according to SEQ ID NO:91, or the complement thereof; or positions 802-803 according to SEQ ID NO:92, or the complement thereof. In some embodiments, the alteration-specific probes and alteration-specific primers comprise DNA. In some embodiments, the alteration-specific probes and alteration-specific primers comprise RNA. In some embodiments, the probes and primers described herein (including alterationspecific probes and alteration-specific primers) have a nucleotide sequence that specifically hybridizes to any of the nucleic acid molecules disclosed herein, or the complement thereof. In some embodiments, the probes and primers specifically hybridize to any of the nucleic acid molecules disclosed herein under stringent conditions. In some embodiments, the primers, including alteration-specific primers, can be used in second generation sequencing or high throughput sequencing. In some instances, the primers, including alteration-specific primers, can be modified. In particular, the primers can comprise various modifications that are used at different steps of, for example, Massive Parallel Signature Sequencing (MPSS), Polony sequencing, and 454 Pyrosequencing. Modified primers can be used at several steps of the process, including biotinylated primers in the cloning step and fluorescently labeled primers used at the bead loading step and detection step. Polony sequencing is generally performed using a paired-end tags library wherein each molecule of DNA template is about 135 bp in length. Biotinylated primers are used at the bead loading step and emulsion PCR. Fluorescently labeled degenerate nonamer oligonucleotides are used at the detection step. An adaptor can contain a 5'-biotin tag for immobilization of the DNA library onto streptavidin-coated beads. The probes and primers described herein can be used to detect a nucleotide variation within any of the WNT5B variant genomic nucleic acid molecules, WNT5B variant mRNA molecules, and / or WNT5B variant cDNA molecules disclosed herein. The primers described herein can be used to amplify the WNT5B variant genomic nucleic acid molecules, WNT5B variant mRNA molecules, or WNT5B variant cDNA molecules, or a fragment thereof. The present disclosure also provides pairs of primers comprising any of the primers described above. For example, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 56,698 according to SEQ ID NO:1 (rather than a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference genomic nucleic acid molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2 (rather than a cytosine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant genomic nucleic acid molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 56,698 according to SEQ ID NO:2 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 242 according to SEQ ID NO:7 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 242 according to SEQ ID NO:15 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 242 according to SEQ ID NO:15 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 145 according to SEQ ID NO:8 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 145 according to SEQ ID NO:16 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 145 according to SEQ ID NO:16 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 198 according to SEQ ID NO:9 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 198 according to SEQ ID NO:17 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 198 according to SEQ ID NO:17 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 40 according to SEQ ID NQ:10 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 40 according to SEQ ID NO:18 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 40 according to SEQ ID NO: 18 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 145 according to SEQ ID NO:11 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 145 according to SEQ ID NO:19 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 145 according to SEQ ID NO:19 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 183 according to SEQ ID NO:12 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 183 according to SEQ ID NQ:20 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 183 according to SEQ ID NQ:20 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 543 according to SEQ ID NO:13 (rather than a uracil) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference mRNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 543 according to SEQ ID NO:21 (rather than a cytosine) in a particular WNT5B mRNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant mRNA molecule. In some embodiments, the nucleotide of the primer complementary to the uracil at a position corresponding to position 543 according to SEQ ID NO:21 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 242 according to SEQ ID NO:50 (rather than a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 242 according to SEQ ID NO:58 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 242 according to SEQ ID NO:58 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 145 according to SEQ ID NO:51 (ratherthan a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 145 according to SEQ ID NO:59 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 145 according to SEQ ID NO:59 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 198 according to SEQ ID NO:52 (ratherthan a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 198 according to SEQ ID NQ:60 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 198 according to SEQ ID NQ:60 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 40 according to SEQ ID NQ:50 (rather than a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 40 according to SEQ ID NO:61 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 40 according to SEQ ID NO:61 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 145 according to SEQ ID NO:54 (rather than a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 145 according to SEQ ID NO:62 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 145 according to SEQ ID NO:62 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 183 according to SEQ ID NO:55 (rather than a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 183 according to SEQ ID NO:63 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 183 according to SEQ ID NO:63 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a cytosine at a position corresponding to position 543 according to SEQ ID NO:56 (ratherthan a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference cDNA molecule. Conversely, if one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 543 according to SEQ ID NO:64 (rather than a cytosine) in a particular WNT5B cDNA molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant cDNA molecule. In some embodiments, the nucleotide of the primer complementary to the thymine at a position corresponding to position 543 according to SEQ ID NO:64 can be at the 3' end of the primer. If one of the primers' 3'-ends hybridizes to a thymine at a position corresponding to position 58,170 according to SEQ ID NO:1 (rather than an adenine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B reference genomic nucleic acid molecule. Conversely, if one of the primers' 3'-ends hybridizes to an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3 (rather than a thymine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of the WNT5B variant genomic nucleic acid molecule. In some embodiments, the nucleotide of the primer complementary to the adenine at a position corresponding to position 58,170 according to SEQ ID NO:3 can be at the 3' end of the primer. In addition, if one of the primers' 3'-ends hybridizes to a uracil at a position corresponding to position 491 according to SEQ ID NO:7 (rather than an adenine) in a particular WNT5B nucleic acid molecule, then the presence of the amplified fragment would indicate the presence of a WNT5B referen...

Claims

1. A method of treating a subject having decreased bone mineral density or at risk of developing decreased bone mineral density, the method comprising administering a Wnt Family Member 5B inhibitor to the subject.5   2. A method of treating a subject having osteopenia or at risk of developing osteopenia,the method comprising administering a Wnt Family Member 5B inhibitor to the subject.

3. A method of treating a subject having Type I osteoporosis or at risk of developing Type I osteoporosis, the method comprising administering a Wnt Family Member 5B inhibitor to the subject.0   4. A method of treating a subject having Type II osteoporosis or at risk of developing TypeII osteoporosis, the method comprising administering a Wnt Family Member 5B inhibitor to the subject.

5. A method of treating a subject having secondary osteoporosis or at risk of developing secondary osteoporosis, the method comprising administering a Wnt Family Member 5B15 inhibitor to the subject.

6. The method according to any one of claims 1 to 5, wherein the WNT5B inhibitor comprises an inhibitory nucleic acid molecule.

7. The method according to claim 6, wherein the inhibitory nucleic acid molecule comprises an antisense nucleic acid molecule, a small interfering RNA (siRNA), or a short hairpin20 RNA (shRNA) that hybridizes to a WNT5B nucleic acid molecule.

8. The method according to any one of claims 1 to 5, wherein the WNT5B inhibitor comprises a Cas protein and guide RNA (gRNA) that hybridizes to a gRNA recognition sequence within a WNT5B genomic nucleic acid molecule.

9. The method according to claim 8, wherein the Cas protein is Cas9 or Cpf1.25   10.     The method according to claim 8 or claim 9, wherein the gRNA recognition sequenceincludes or is proximate to a position corresponding to: position 56,698 according to SEQ ID NO:1, position 58,170 according to SEQ ID NO:1, position 65,099 according to SEQ ID NO:1, position 65,099 according to SEQ ID NO:1, or positions 71,313-71,314 according to SEQ ID NO:1.

11. The method according to claim 8 or claim 9, wherein a Protospacer Adjacent Motif30 (PAM) sequence is about 2 to about 6 nucleotides downstream of the gRNA recognitionsequence.2022302084   23 Sep 202612. The method according to any one of claims 1 to 11, further comprising detecting the presence or absence of a WNT5B variant nucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide in a biological sample obtained from the subject.

13. The method according to claim 12, further comprising administering a therapeutic5 agent that treats or prevents decreased bone mineral density in a standard dosage amount to a subject wherein the WNT5B variant nucleic acid molecule is absent from the biological sample.

14. The method according to claim 12, further comprising administering a therapeutic agent that treats or prevents decreased bone mineral density in a dosage amount that is the same as or less than a standard dosage amount to a subject that is heterozygous for the WNT5B 0 variant nucleic acid molecule.

15. The method according to any one of claims 12 to 14, wherein the WNT5B variant nucleic acid molecule encodes Cys83Stop-LG, Cys83Stop-Sht, Cys114Stop, Arg134Cys-LG, Arg134Cys-Sht, Arg134Ser-LG, Arg134Ser-Sht, or Val266fs.

16. The method according to any one of claims 12 to 14, wherein the WNT5B variant15 nucleic acid molecule is:a genomic nucleic acid molecule having a nucleotide sequence comprising: a thymine at a position corresponding to position 56,698 according to SEQ ID NO:2; an adenine at a position corresponding to position 58,170 according to SEQ ID NO:3; a thymine at a position corresponding to position 65,099 according to SEQ ID NO:4; an adenine at a position20 corresponding to position 65,099 according to SEQ ID NO:5; or a deletion of a TC dinucleotide at positions corresponding to positions 71,313-71,314 according to SEQ ID NO:6;an mRNA molecule having a nucleotide sequence comprising: a uracil at a position corresponding to position 242 according to SEQ ID NO:15; a uracil at a position corresponding to position 145 according to SEQ ID NO:16; a uracil at a position corresponding to position 19825 according to SEQ ID NO:17; a uracil at a position corresponding to position 40 according to SEQ ID NO:18; a uracil at a position corresponding to position 145 according to SEQ ID NO:19; a uracil at a position corresponding to position 183 according to SEQ ID NO:20; a uracil at a position corresponding to position 543 according to SEQ ID NO:21; an adenine at a position corresponding to position 491 according to SEQ ID NO:22; an adenine at a position30 corresponding to position 394 according to SEQ ID NO:23; an adenine at a positioncorresponding to position 447 according to SEQ ID NO:24; an adenine at a positioncorresponding to position 289 according to SEQ ID NO:25; an adenine at a position2022302084   23 Sep 2026corresponding to position 394 according to SEQ ID NO:26; an adenine at a positioncorresponding to position 432 according to SEQ ID NO:27; an adenine at a positioncorresponding to position 792 according to SEQ ID NO:28; an adenine at a positioncorresponding to position 254 according to SEQ ID NO:29; a uracil at a position corresponding5 to position 642 according to SEQ ID NO:30; a uracil at a position corresponding to position 545 according to SEQ ID NO:31; a uracil at a position corresponding to position 598 according to SEQ ID NO:32; a uracil at a position corresponding to position 545 according to SEQ ID NO:33; a uracil at a position corresponding to position 583 according to SEQ ID NO:34; a uracil at a position corresponding to position 943 according to SEQ ID NO:35; a uracil at a position0   corresponding to position 405 according to SEQ ID NO:36; an adenine at a positioncorresponding to position 642 according to SEQ ID NO:37; an adenine at a positioncorresponding to position 545 according to SEQ ID NO:38; an adenine at a positioncorresponding to position 598 according to SEQ ID NO:39; an adenine at a positioncorresponding to position 545 according to SEQ ID NO:40; an adenine at a position15   corresponding to position 583 according to SEQ ID NO:41; an adenine at a positioncorresponding to position 943 according to SEQ ID NO:42; an adenine at a positioncorresponding to position 405 according to SEQ ID NO:43; a deletion of a UC dinucleotide at positions corresponding to positions 1,039-1,040 according to SEQ ID NO:44; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:45; a20 deletion of a UC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:46; a deletion of a UC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:47; a deletion of a UC dinucleotide at positions corresponding to positions 980-981 according to SEQ ID NO:48; or a deletion of a UC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:49; or25           a cDNA molecule having a nucleotide sequence comprising: a thymine at a positioncorresponding to position 242 according to SEQ ID NO:58; a thymine at a positioncorresponding to position 145 according to SEQ ID NO:59; a thymine at a positioncorresponding to position 198 according to SEQ ID NO:60; a thymine at a positioncorresponding to position 40 according to SEQ ID NO:61; a thymine at a position corresponding30 to position 145 according to SEQ ID NO:62; a thymine at a position corresponding to position 183 according to SEQ ID NO:63; a thymine at a position corresponding to position 543 according to SEQ ID NO:64; an adenine at a position corresponding to position 491 according to2022302084   23 Sep 2026SEQ ID NO:65; an adenine at a position corresponding to position 394 according to SEQ IDNO:66; an adenine at a position corresponding to position 447 according to SEQ ID NO:67; anadenine at a position corresponding to position 289 according to SEQ ID NO:68; an adenine at aposition corresponding to position 394 according to SEQ ID NO:69; an adenine at a position5 corresponding to position 432 accordingcorresponding to position 792 accordingcorresponding to position 254 accordingcorresponding to position 642 accordingcorresponding to position 545 according0 corresponding to position 598 accordingcorresponding to position 545 accordingcorresponding to position 583 accordingcorresponding to position 943 accordingcorresponding to position 405 according15 corresponding to position 545 accordingcorresponding to position 598 accordingcorresponding to position 545 accordingcorresponding to position 583 accordingcorresponding to position 943 according20 corresponding to position 405 accordingto SEQ ID NO:70; an adenine at a positionto SEQ ID NO:71; an adenine at a positionto SEQ ID NO:72; a thymine at a positionto SEQ ID NO:73; a thymine at a positionto SEQ ID NO:74; a thymine at a positionto SEQ ID NO:75; a thymine at a positionto SEQ ID NO:76; a thymine at a positionto SEQ ID NO:77; a thymine at a positionto SEQ ID NO:78; a thymine at a positionto SEQ ID NO:79; an adenine at a positionto SEQ ID NO:81; an adenine at a positionto SEQ ID NO:82; an adenine at a positionto SEQ ID NO:83; an adenine at a positionto SEQ ID NO:84; an adenine at a positionto SEQ ID NO:85; an adenine at a positionto SEQ ID NO:86; a deletion of a TC dinucleotide atpositions corresponding to positions 942-943 according to SEQ ID NO:88; a deletion of a TC dinucleotide at positions corresponding to positions 995-996 according to SEQ ID NO:89; a deletion of a TC dinucleotide at positions corresponding to positions 942-943 according to SEQ ID NO:90; a deletion of a TC dinucleotide at positions corresponding to positions 980-98125 according to SEQ ID NO:91; or a deletion of a TC dinucleotide at positions corresponding to positions 802-803 according to SEQ ID NO:92.

17. A method of treating a subject with a therapeutic agent that treats or prevents decreased bone mineral density, wherein the subject has decreased bone mineral density or is at risk of developing decreased bone mineral density, the method comprising:30           determining whether the subject has a Wnt Family Member 5B (WNT5B) variantnucleic acid molecule encoding a WNT5B predicted loss-of-function polypeptide by:2022302084   23 Sep 2026obtaining or having obtained a biological sample from the subject; andperforming or having performed a sequence analysis on the biological sample to determine if the subject has a genotype comprising the WNT5B5                 variant nucleic acid molecule encoding the WNT5B predicted loss-of-functionpolypeptide; andadministering or continuing to administer the therapeutic agent that treats or prevents decreased bone mineral density in a standard dosage amount to a subject that is WNT5B reference, and / or administering a WNT5B inhibitor to the subject; and0            administering or continuing to administer the therapeutic agent that treats or preventsdecreased bone mineral density in an amount that is the same as or less than a standard dosage amount to a subject that is heterozygous for the WNT5B variant nucleic acid molecule, and / or administering a WNT5B inhibitor to the subject;wherein the presence of a genotype having the WNT5B variant nucleic acid molecule15 encoding the WNT5B predicted loss-of-function polypeptide indicates the subject has a reduced risk of developing decreased bone mineral density.

18. The method according to claim 17, wherein the subject is WNT5B reference, and the subject is administered or continued to be administered the therapeutic agent that treats or prevents decreased bone mineral density in a standard dosage amount, and is administered a 20 WNT5B inhibitor.

19. The method according to claim 17, wherein the subject is heterozygous for a WNT5B variant nucleic acid molecule, and the subject is administered or continued to be administered the therapeutic agent that treats or prevents decreased bone mineral density in an amount that is the same as or less than a standard dosage amount, and is administered a WNT5B25 inhibitor.

20. The method according to any one of claims 17 to 19, wherein the WNT5B variant nucleic acid molecule encodes Cys83Stop-LG, Cys83Stop-Sht, Cys114Stop, Arg134Cys-LG, Arg134Cys-Sht, Arg134Ser-LG, Arg134Ser-Sht, or Val266fs.

21. The method according to claim 7, wherein the inhibitory nucleic acid molecule30 comprises an antisense nucleic acid molecule that hybridizes to a WNT5B nucleic acid molecule.

22. The method according to claim 7, wherein the inhibitory nucleic acid molecule comprises a small interfering RNA (siRNA) that hybridizes to a WNT5B nucleic acid molecule.2022302084   23 Sep 202623. The method according to claim 7, wherein the inhibitory nucleic acid molecule comprises a short hairpin RNA (shRNA) that hybridizes to a WNT5B nucleic acid molecule.

24. Use of a Wnt Family Member 5B inhibitor in the manufacture of a medicament for (i) treating a subject having decreased bone mineral density or at risk of developing decreased5 bone mineral density; (ii) treating a subject having osteopenia or at risk of developing osteopenia; (iii) treating a subject having Type I osteoporosis or at risk of developing Type I osteoporosis; (iv) treating a subject having Type II osteoporosis or at risk of developing Type II osteoporosis; or (v) treating a subject having secondary osteoporosis or at risk of developing secondary osteoporosis.