Novel schizochytrium sp. strain for producing biomass containing high protein content, antioxidant pigments and omega-3 fatty acids, and use thereof

Abstract

The present invention relates to a novel Schizochytrium sp. strain containing a high protein content, antioxidant pigments and omega-3 fatty acids, and a method for producing a biomass containing a high protein content, antioxidant pigments and omega-3 fatty acids by using the strain. The novel Schizochytrium sp. strain of the present invention simultaneously contains, in the cells thereof, a high content of protein ingredients including amino acids such as glutamic acid, arginine and aspartic acid, antioxidant pigments of beta-carotene and canthaxanthin, and omega-3 unsaturated fatty acid ingredients including eicosapentaenoic acid and docosahexaenoic acid, and thus the strain itself or the biomass and bio-oil produced by culturing and fermenting the strain can be effectively used as a feed composition or a food composition and the like.

Description

Novel strain of the genus Schizochytrium producing biomass containing high content of protein, antioxidant pigments and omega-3 fatty acids and its use

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2022-0103398, filed August 18, 2022, the entire contents of which are incorporated herein by reference.

[0003] The present invention relates to a novel Schizochytrium sp. strain producing biomass containing high contents of protein, antioxidant pigments and omega-3 fatty acids, and a method for producing biomass containing high contents of protein, antioxidant pigments and omega-3 fatty acids using the same.

[0004] To sustain life, grow, and develop, organisms must ingest and utilize various nutrients from the outside world. Nutrients can be broadly categorized into carbohydrates and lipids, which are primarily used for energy; proteins, minerals, and regulatory nutrients, such as vitamins. Among these, proteins play a crucial role in many aspects, including serving as a structural component of living organisms, acting as an enzyme catalyst for various chemical reactions within cells, and forming antibodies to support immunity. Therefore, their supply and consumption within the body are particularly crucial.

[0005] Animal-based protein sources, known for their nutritional quality, have long been the largest market and consumed. However, plant-based protein sources are attracting significant attention due to recent global social changes, including population growth, environmental issues like greenhouse gas reduction, and the promotion of animal welfare. The most well-known plant-based protein source is soybeans, which are utilized as food proteins in their own right or as animal feed using soybean meal, the residue left over from the extraction of edible oil. However, the growing demand for soy protein poses challenges, including a lack of biodiversity due to intensive soybean cultivation, resulting in damage to other plants, and the proliferation of genetically modified (GMO) seeds. Furthermore, when used as feed, the high carbohydrate content leads to low digestibility, and the high phytic acid content hinders protein absorption and mineral utilization. Furthermore, the issue of residual pesticides used during soybean cultivation and contamination by harmful microorganisms such as molds persist.

[0006] As an alternative, single-cell protein (SCP) derived from microalgae, a type of phytoplankton, is gaining attention. Spirulina and chlorella are particularly well-known. While they offer nutritionally superior protein, containing a diverse amino acid profile, including essential amino acids, they also suffer from a characteristic odor and unpalatable taste derived from chlorophyll, and their photosynthetic cultivation and production method increases their supply cost.

[0007] In this study, we aimed to develop a new plant-based protein source derived from a strain of the marine microalga Schizochytrium sp. to overcome the shortcomings of existing plant-based protein sources. Schizochytrium sp. strains are marine microalgae that lack chlorophyll and can be cultured in a fermenter using conventional sub-fermentation methods. This allows them to be free from residual pesticides and other pollutants, and to be mass-produced with consistent quality. Furthermore, they possess intracellular unsaturated fatty acids, including omega-3 fatty acids DHA and EPA, offering the advantage of providing additional essential fatty acids, unlike conventional soybean meal or other microbial-derived SCPs. Furthermore, they possess a protein-based cell membrane without a cell wall, which also offers the advantage of high digestibility in the body.

[0008] Based on these advantages, research and industrialization on the production of polyunsaturated fatty acids, including omega-3 unsaturated fatty acids such as docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), arachidonic acid (ARA), docosapentaenoic acid (DPA), and α-linolenic acid, using microalgae has been progressing very rapidly. For example, U.S. Patent No. 5,130,242 discloses a method for producing omega-3 polyunsaturated fatty acids using Schizochytrium sp. ATCC20888 and Schizochytrium sp. PTA10208, which are microorganisms of the genus Schizochytrium.

[0009] The present invention provides a novel mutant strain of the genus Schizochytrium that simultaneously contains and / or produces antioxidant pigments in addition to high protein and omega-3 fatty acids, thereby suggesting the possibility of mass production of a new plant-based protein material.

[0010] An example of the present application provides a novel Schizochytrium sp. CD03-7004 strain (accession number KCTC15006BP).

[0011] Another example of the present application provides a biomass comprising a strain of the genus Schizochytrium, a culture of the strain, a dried product of the culture, or a crushed product of the dried product.

[0012] Another example of the present application provides a feed composition comprising the above-described Schizochytrium spp. strain, a culture solution of the strain, a dried product of the culture solution, or a crushed product of the dried product.

[0013] Another example of the present application provides a food composition comprising the above-described Schizochytrium spp. strain, a culture solution of the strain, a dried product of the culture solution, or a crushed product of the dried product.

[0014] Another example of the present application provides an antioxidant composition comprising a strain of the genus Schizochytrium, a culture solution of the strain, a dried product of the culture solution, or a crushed product of the dried product.

[0015] Another example of the present application is a step of culturing a strain of the genus Schizochytrium; and

[0016] A method for producing an antioxidant pigment is provided, comprising: a step of extracting an antioxidant pigment of the carotenoid series from a culture of the above strain.

[0017] Each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions set forth below. Furthermore, those skilled in the art will recognize or be able to ascertain, through routine experimentation alone, numerous equivalents to the specific embodiments of this application described in this application. Furthermore, such equivalents are intended to be encompassed by this application.

[0018]

[0019] An example of the present application provides a novel strain of microalgae, Schizochytrium sp. CD03-7004 (accession number KCTC15006BP).

[0020] As used herein, the term "Thraustochytrid" refers to microalgae of the order Thraustochytriales. In addition, the term "Schizochytrium sp." as used herein is one of the genera belonging to the family Thraustochytriaceae of the order Thraustochytriales, and may be used interchangeably with the term "genusSchizochytrium." In addition, the term "microalgae" may be used interchangeably with "strain" in this specification, and refers to organisms that are so small that they cannot be seen with the naked eye and can only be seen through a microscope, floating freely in water. There are various types of microalgae, and even strains that are incapable of photosynthesis and grow only heterotrophically.

[0021] In this application, as an example, a wild-type Schizochytrium sp. CD01-5000 strain was irradiated with gamma rays to induce a mutation, and a strain having antioxidant pigment production ability was selected among the mutant strains, which was named Schizochytrium sp. CD03-7004, and deposited on June 20, 2022, with the Korean Collection for Type Cultures (KCTC), an international depository institution under the Budapest Treaty, and assigned the accession number KCTC15006BP.

[0022] The above-mentioned CD03-7004 strain of the genus Schizochytrium produces and / or contains a carotenoid series antioxidant pigment having high antioxidant, anti-inflammatory, etc. effects, or has the ability to produce a carotenoid series antioxidant pigment.

[0023] The antioxidant pigment of the carotenoid series may be, but is not limited to, beta-carotene or canthaxanthin.

[0024] As used herein, “productivity” includes an increase in the total protein amount per unit of microalgae or per unit of dry weight, an increase in the amount of polyunsaturated fatty acids, an increase in omega-3 polyunsaturated fatty acids, or an increase in the amount of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), or an increase in the relative proportion of polyunsaturated fatty acids among the fatty acids produced, an increase in the relative proportion of omega-3 polyunsaturated fatty acids among the total fatty acids or polyunsaturated fatty acids produced, or an increase in the relative proportion of docosahexaenoic acid and eicosapentaenoic acid; or an increase in the total biomass amount per unit of microalgae or per unit of dry or wet weight, or an increase in the amount of antioxidant pigments of the total carotenoid series, an increase in the amount of beta-carotene and canthaxanthin, or an increase in the relative proportion of beta-carotene and canthaxanthin among the antioxidant pigments of the carotenoid series produced. Any of the above can lead to increased production of the desired useful substance, for example, if the relative ratio increases, not only will the desired useful substance increase, but its concentration will also increase, making separation easier.

[0025] The term "carotenoid" as used herein refers to C40 isoprenoid compounds with antioxidant activity, which exist in various colors such as yellow, red, and orange depending on their molecular structure. Carotenoids are known to have antioxidant effects that can prevent damage caused by oxidation, effects that prevent or treat diseases including cancer, and effects that reduce skin damage from ultraviolet exposure or inhibit melanin production, and are therefore used in health foods, food colorings, and animal feed.

[0026] The term "beta-carotene" in this specification refers to a carotenoid antioxidant pigment and is the precursor of almost all carotenoids. Beta-carotene is a yellow precursor of vitamin A, which is converted to vitamin A in the body and has little pigmentation effect on egg yolk or skin. Beta-carotene is widely used as a food additive due to its antioxidant effect that prevents damage caused by oxidation, its high nutritional value, and its unique color. In addition, it can prevent adult diseases such as cancer, arteriosclerosis, arthritis, and cataracts caused by harmful oxygen, and can be usefully used as an anticancer agent, a vascular disease agent, an eye disease agent, and an antioxidant related to skin aging.

[0027] “Canthaxanthin” in this specification refers to a type of carotenoid pigment produced by the oxidation of beta-carotene, which has an orange color and is also called 4,4'-diketo-beta-carotene. Canthaxanthin is used as a cosmetic and food coloring agent; an antioxidant (Palozza, P et al., Arch. Biochem. Biophys., 297, 291-295, 1992; Palozza, P et al., Arch. Biochem. Biophys., 325, 145-151, 1996); It is used as an anticancer agent (Tanaka, T. et al., Cancer Res., 55, 4059-4064, 1995; Tanaka, T. et al., Carcinogenesis, 16, 2957-2963, 1995; Grubbs, CJ et al., 48, 239-245, 1991; Katsumura, N. et al., Nutr. Cancer, 26, 203-208, 1996).

[0028] The above Schizochytrium genus strain produces and / or contains high amounts of omega-3 polyunsaturated fatty acids.

[0029] The above omega-3 polyunsaturated fatty acid may be, but is not limited to, docosahexaenoic acid (DHA) or eicosapentaenoic acid (EPA).

[0030] As used herein, the term "docosahexaenoic acid (DHA)" means C 22 H 32 It is one of the polyunsaturated fatty acids with the chemical formula O2, and is an omega-3 fatty acid along with alpha-linolenic acid (ALA) and eicosapentaenoic acid (EPA). Its common name is cervonic acid, and it can also be abbreviated as 22:6 n-3.

[0031] As used herein, the term "eicosapentaenoic acid (EPA)" refers to C 20 H 30 It is one of the polyunsaturated fatty acids with the chemical formula O2, and is an omega-3 fatty acid along with ALA and DHA, and can also be abbreviated as 20:5 n-3.

[0032] In one example of the present application, the Schizochytrium spp. strain may produce and / or comprise 35 to 60 wt% of docosahexaenoic acid based on the total weight of fatty acids. Specifically, the Schizochytrium spp. strain may produce and / or comprise 35 to 60 wt%, 40 to 60 wt%, 42 to 60 wt%, 45 to 60 wt%, 49 to 60 wt%, 35 to 55 wt%, 40 to 55 wt%, 42 to 55 wt%, 45 to 55 wt%, 35 to 50 wt%, 40 to 50 wt%, 42 to 50 wt%, 45 to 50 wt%, or 48 to 52 wt% of docosahexaenoic acid based on the total weight of fatty acids.

[0033] In one example of the present application, the Schizochytrium spp. strain may produce and / or contain 0.1 to 5 wt% of eicosapentaenoic acid based on the total weight of fatty acids. Specifically, the Schizochytrium spp. strain may produce and / or include 0.1 to 5 wt%, 0.5 to 5 wt%, 0.7 to 5 wt%, 1 to 5 wt%, 1.5 to 5 wt%, 2 to 5 wt%, 0.1 to 3 wt%, 0.5 to 3 wt%, 1 to 3 wt%, 1.5 to 3 wt%, 2 to 3 wt%, 0.1 to 2.5 wt%, 0.5 to 2.5 wt%, 1 to 2.5 wt%, 1.5 to 2.5 wt%, 1.7 to 2.5 wt%, 2 to 2.5 wt%, or 1.8 to 2.4 wt% of eicosapentaenoic acid based on the total weight of fatty acids.

[0034] The genomic DNA of the CD03-7004 strain of the above Schizochytrium genus may include a sequence including the base sequence of sequence number 5 (tgcttgcttgctttt) twice in succession.

[0035] The genomic DNA of the above Schizochytrium CD03-7004 strain may include a base sequence in which 15 nucleotides are added to the base sequence of sequence number 2 of the wild-type Schizochytrium CD01-5000 strain (the parent strain of the Schizochytrium CD03-7004 mutant strain), and the 15 nucleotides may be “tgcttgcttgctttt (SEQ ID NO: 5)”.

[0036] In this specification, the base sequence of sequence number 1 can be confirmed using a primer set, a probe, etc., and specifically, can be confirmed using a primer set, and more specifically, can be confirmed using a primer set including a primer consisting of sequence number 3 and a primer consisting of sequence number 4.

[0037] The above-mentioned Schizochytrium genus CD03-7004 strain can be identified (selected, chosen) from a wild type strain using a primer set including a primer consisting of sequence number 3 and a primer consisting of sequence number 4.

[0038] In one specific example of the present invention, as a result of comparing the entire genome sequences of the novel Schizochytrium genus mutant strain of the present invention and the wild-type strain, it was confirmed that the Schizochytrium genus CD03-7004 strain has a portion in which 15 bp of nucleotides are added to the genome of the wild-type CD01-5000 strain, which is the parent strain, and using this, it was confirmed that the wild-type strain, which is the parent strain, and the Schizochytrium genus CD03-7004 strain can be distinguished (confirmed, selected, chosen) as a result of PCR using a primer set capable of amplifying a DNA fragment including the portion.

[0039]

[0040] The present application provides a primer set for identifying (selecting) the strain CD03-7004 of the genus Schizochytrium.

[0041] The above primer set may be a primer set including a primer consisting of sequence number 3 and a primer consisting of sequence number 4.

[0042] The base sequence amplified by the above primer set may be the base sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0043] By comparing the sizes of the DNA fragments amplified using the above primer set, the Schizochytrium spp. CD03-7004 strain can be distinguished (identified, screened, selected) from the wild type Schizochytrium spp. CD01-5000 strain.

[0044]

[0045] In addition, the present application provides biomass or bio-oil comprising the strain of the genus Schizochytrium, a culture of the strain, a dried product of the culture, or a crushed product of the dried product.

[0046] The above-mentioned Schizochytrium strains are as described above.

[0047] The term "biomass" as used herein refers to living organisms such as plants, animals, and microorganisms that can be used as chemical energy, i.e., the energy source of bioenergy, and ecologically, it also refers to the weight or energy amount of a specific organism existing within a unit of time and space. In addition, the biomass includes, but is not limited to, compounds secreted by cells, and may contain cells and / or intracellular contents as well as extracellular substances. In the present application, the biomass may be, but is not limited to, a strain of the genus Schizochytrium itself, a culture thereof, a dried product thereof, a lysate thereof, or a product produced by culturing or fermenting the strain, or may be, but is not limited to, a concentrate or dried product of the biomass.

[0048] The "culture" of the above Schizochytrium spp. strain refers to a product produced by culturing the strain, and specifically, may be a culture solution containing the strain or a culture filtrate from which the strain has been removed, but is not limited thereto. The "dry product" of the Schizochytrium spp. strain culture refers to a culture of the strain from which moisture has been removed, and may be, for example, in the form of dried mycelia of the strain, but is not limited thereto. In addition, the "crushed product" of the dried product refers to a general term for the result of crushing the dried product from which moisture has been removed from the culture of the strain, and may be, for example, in the form of dried mycelia powder, but is not limited thereto. The culture of the Schizochytrium spp. strain can be prepared by inoculating the strain into a microalgae culture medium and according to a culturing method known in the art, and the dried product of the culture and the crushed product thereof can also be prepared according to a method for treating or drying a strain or culture solution known in the art.

[0049] The term "bio-oil" as used herein means oil obtained from biomass by biological, thermochemical and physicochemical extraction processes, and the bio-oil produced in the present application may contain polyunsaturated fatty acids, and specifically may contain DHA and EPA, but is not limited thereto.

[0050] In the present specification, the bio-oil may include an extract of biomass.

[0051] As a method for producing the above bio-oil extract, a method utilizing enzymes such as protease, cellulase, pectinase, or chitinase depending on the method of crushing or dissolving the cell membrane or cell wall component, a method physically crushing the cell membrane or cell wall component using a homogenizer, an ultrasonic grinder, or bead treatment, a method of directly adding a solvent to penetrate the cell and extract it, a solvent-free extraction process that separates through a centrifugation process after various crushing processes, etc. may be used, but is not limited thereto.

[0052] The biomass derived from the above Schizochytrium genus strain may contain a carotenoid series antioxidant pigment.

[0053] In one example of the present application, the biomass derived from the Schizochytrium spp. strain has an amount of 10 mg / kg or more, 20 mg / kg or more, 30 mg / kg or more, 40 mg / kg or more, 50 mg / kg or more, 60 mg / kg or more, 70 mg / kg or more, 80 mg / kg or more, 90 mg / kg or more, 100 mg / kg or more, 110 mg / kg or more, 10 to 200 mg / kg, 30 to 200 mg / kg, 50 to 200 mg / kg, 70 to 200 mg / kg, 90 to 200 mg / kg, 100 to 200 mg / kg, 110 to 200 mg / kg, 10 to 150 mg / kg, 30 to 150 mg / kg, 50 to 150 mg / kg, 70 to It may comprise 150 mg / kg, 90 to 150 mg / kg, 100 to 150 mg / kg, 110 to 150 mg / kg, 10 to 120 mg / kg, 30 to 120 mg / kg, 50 to 120 mg / kg, 70 to 120 mg / kg, 90 to 120 mg / kg, 100 to 120 mg / kg, or 110 to 120 mg / kg of a carotenoid series antioxidant pigment.

[0054] The antioxidant pigment of the carotenoid series may be, but is not limited to, beta-carotene or canthaxanthin.

[0055] In one example of the present application, the biomass derived from the Schizochytrium spp. strain has an amount of 0.1 mg / kg or more, 0.5 mg / kg or more, 1 mg / kg or more, 1.5 mg / kg or more, 2 mg / kg or more, 2.5 mg / kg or more, 0.1 to 5 mg / kg, 0.5 to 5 mg / kg, 1 to 5 mg / kg, 1.5 to 5 mg / kg, 2 to 5 mg / kg, 2.5 to 5 mg / kg, 0.1 to 4 mg / kg, 0.5 to 4 mg / kg, 1 to 4 mg / kg, 1.5 to 4 mg / kg, 2 to 4 mg / kg, 2.5 to 4 mg / kg, 0.1 to 3 mg / kg, 0.5 to 3 mg / kg, 1 to 3 mg / kg, 1.5 to 3 mg / kg, based on the total weight of the biomass. It may contain 2 to 3 mg / kg, or 2.5 to 3 mg / kg of beta-carotene.

[0056] In one example of the present application, the biomass derived from the Schizochytrium spp. strain has an amount of 10 mg / kg or more, 20 mg / kg or more, 30 mg / kg or more, 40 mg / kg or more, 50 mg / kg or more, 60 mg / kg or more, 70 mg / kg or more, 80 mg / kg or more, 90 mg / kg or more, 100 mg / kg or more, 110 mg / kg or more, 10 to 200 mg / kg, 30 to 200 mg / kg, 50 to 200 mg / kg, 70 to 200 mg / kg, 90 to 200 mg / kg, 100 to 200 mg / kg, 110 to 200 mg / kg, 10 to 150 mg / kg, 30 to 150 mg / kg, 50 to 150 mg / kg, 70 to It may comprise 150 mg / kg, 90 to 150 mg / kg, 100 to 150 mg / kg, 110 to 150 mg / kg, 10 to 120 mg / kg, 30 to 120 mg / kg, 50 to 120 mg / kg, 70 to 120 mg / kg, 90 to 120 mg / kg, 100 to 120 mg / kg, or 110 to 120 mg / kg of canthaxanthin.

[0057] The biomass derived from the above Schizochytrium genus strain may contain a high protein content.

[0058] In one example of the present application, the biomass derived from the Schizochytrium spp. strain may comprise crude protein in an amount of 60 wt% or more, 70 wt% or more, 75 wt% or more, 60 to 90 wt%, 65 to 90 wt%, 70 to 90 wt%, 75 to 90 wt%, 60 to 85 wt%, 65 to 85 wt%, 70 to 85 wt%, 75 to 85 wt%, 60 to 80 wt%, 65 to 80 wt%, 70 to 80 wt%, or 75 to 80 wt%, based on the total weight of the biomass.

[0059] The biomass derived from the above Schizochytrium genus strain may contain a high content of omega-3 unsaturated fatty acids.

[0060] In one example of the present application, the biomass derived from the strain of the genus Schizochytrium may comprise 42 wt% or more, 45 wt% or more, 50 wt% or more, 52 wt% or more, 55 wt% or more, 60 wt% or more, 65 wt% or more, 70 wt% or more, 42 to 70 wt%, 45 to 70 wt%, 50 to 70 wt%, 52 to 70 wt%, 55 to 70 wt%, 42 to 65 wt%, 45 to 65 wt%, 50 to 65 wt%, 52 to 65 wt%, 55 to 65 wt%, 42 to 60 wt%, 45 to 60 wt%, 50 to 60 wt%, 52 to 60 wt%, or 55 to 60 wt% of omega-3 unsaturated fatty acids based on the total weight of fatty acids. there is.

[0061] The above omega-3 polyunsaturated fatty acid may be, but is not limited to, docosahexaenoic acid (DHA) or eicosapentaenoic acid (EPA).

[0062] In one example of the present application, the biomass derived from the Schizochytrium spp. strain may comprise 5 to 60 wt%, 40 to 60 wt%, 42 to 60 wt%, 45 to 60 wt%, 49 to 60 wt%, 35 to 55 wt%, 40 to 55 wt%, 42 to 55 wt%, 45 to 55 wt%, 35 to 50 wt%, 40 to 50 wt%, 42 to 50 wt%, 45 to 50 wt%, or 48 to 52 wt% of docosahexaenoic acid based on the total weight of fatty acids.

[0063] In one example of the present application, the biomass derived from the Schizochytrium spp. strain may comprise 0.1 to 5 wt%, 0.5 to 5 wt%, 0.7 to 5 wt%, 1 to 5 wt%, 1.5 to 5 wt%, 2 to 5 wt%, 0.1 to 3 wt%, 0.5 to 3 wt%, 1 to 3 wt%, 1.5 to 3 wt%, 2 to 3 wt%, 0.1 to 2.5 wt%, 0.5 to 2.5 wt%, 1 to 2.5 wt%, 1.5 to 2.5 wt%, 1.7 to 2.5 wt%, 2 to 2.5 wt%, or 1.8 to 2.4 wt% of eicosapentaenoic acid based on the total weight of fatty acids.

[0064]

[0065] Another aspect of the present application provides a composition comprising a strain of Schizochytrium sp. CD03-7004, a culture of the strain, a dried product of the culture, and a lysate of the dried product.

[0066] The composition may comprise a strain of the genus Schizochytrium, a biomass derived from the strain, a bio-oil derived from the strain, or a combination thereof.

[0067] The composition may be in the form of a solution, powder, or suspension, but is not limited thereto. The composition may be, for example, a food composition, a feed composition, or a feed additive composition.

[0068] As used herein, the term "feed composition" refers to food fed to animals. The feed composition refers to a substance that supplies organic or inorganic nutrients necessary for sustaining the life of an animal or producing meat, milk, etc. The feed composition may additionally contain nutrients necessary for sustaining the life of an animal or producing meat, milk, etc. The feed composition may be manufactured using various types of feed known in the art, and specifically may include concentrate feed, roughage, and / or special feed.

[0069] The term "feed additive" as used herein includes substances added to feed for various purposes such as nutrient supplementation and weight loss prevention, increasing the digestibility and availability of fiber in feed, improving milk quality, preventing reproductive disorders and improving conception rates, and preventing summer heat stress. The feed additive of the present application corresponds to supplementary feed under the Feed Management Act, and may additionally include mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysine; protected fatty acids such as fatty acid calcium salts; probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

[0070] The term "food composition" as used herein includes all forms of functional food, nutritional supplement, health food, and food additives, and the above types of food compositions can be manufactured in various forms according to conventional methods known in the art.

[0071] There is no particular limitation on the type of the above food. Preferably, the food may be in a form containing the Schizochytrium sp. CD03-7004 strain, and may also be used as an additive to other foods. Examples of foods to which the above substance may be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all health foods in the conventional sense.

[0072] The composition of the present application may further include grains, such as ground or shredded wheat, oats, barley, corn and rice; plant-based protein feeds, such as feeds mainly composed of soybeans and sunflower; animal-based protein feeds, such as blood meal, meat meal, bone meal and fish meal; dry ingredients composed of sugars and dairy products, such as various types of milk powder and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters and the like.

[0073] The composition of the present invention may be administered to animals alone or in combination with other feed additives in an edible carrier. Furthermore, the composition may be readily administered to animals as a top dressing, by mixing it directly into feed, or as an oral formulation separate from the feed. When administered separately from feed, the composition may be prepared as an immediate-release or sustained-release formulation by combining it with a pharmaceutically acceptable edible carrier, as is well known in the art. Such edible carriers may be solid or liquid, such as cornstarch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, and propylene glycol. When a solid carrier is used, the composition may be in the form of a tablet, capsule, powder, troche, or sugar tablet, or as a top dressing in the form of a microdispersible. When a liquid carrier is used, the composition may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.

[0074] The composition of the present application may contain, for example, a preservative, a stabilizer, a wetting agent or emulsifier, a cryoprotectant, or an excipient. The cryoprotectant may be at least one selected from the group consisting of glycerol, trehalose, maltodextrin, skimmed milk powder, and starch.

[0075] The preservative, stabilizer, or excipient may be included in the composition in an effective amount sufficient to reduce the deterioration of the Schizochytrium spp. strain included in the composition. Additionally, the cryoprotectant may be included in the composition in an effective amount sufficient to reduce the deterioration of the Schizochytrium spp. strain included in the composition when the composition is in a dried state.

[0076] The above composition can be used by adding it to animal feed by immersion, spraying, or mixing.

[0077] The composition of the present application can be applied to a number of animal diets, including, but not limited to, mammals, birds, fish, crustaceans, cephalopods, reptiles, and amphibians. For example, the mammals can include pigs, cattle, sheep, goats, laboratory rodents, or pets, and the birds can include poultry, including, but not limited to, chickens, turkeys, ducks, geese, pheasants, or quail. Furthermore, the fish can include commercially farmed fish and their fry, ornamental fish, and the crustaceans can include, but are not limited to, shrimp, barnacles, and the like. Furthermore, the composition can be applied to the diet of rotifers, a zooplankton.

[0078]

[0079] Another aspect of the present application provides an antioxidant composition comprising a strain of Schizochytrium sp. CD03-7004, a culture of the strain, a dried product of the culture, and a crushed product of the dried product.

[0080]

[0081] The above antioxidant composition may include a strain of the genus Schizochytrium, a biomass derived from the strain, a bio-oil derived from the strain, or a combination thereof.

[0082] The Schizochytrium sp. CD03-7004 strain of the present invention produces and / or contains a carotenoid-based antioxidant pigment having high antioxidant and anti-inflammatory effects, or has the ability to produce a carotenoid-based antioxidant pigment, and thus can be usefully used as an antioxidant composition.

[0083] The above antioxidant composition may be a pharmaceutical composition, a food composition, a feed composition or a feed additive composition.

[0084] The above food composition may be a functional food composition.

[0085] In addition to the above-mentioned effective ingredients, the functional food of the present invention may additionally contain various auxiliary ingredients as needed. The functional food of the present invention may include vitamins such as vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B12, folic acid, vitamin C, vitamin D3, vitamin E, minerals such as copper, calcium, iron, magnesium, potassium, zinc, or lactic acid bacteria.

[0086] In addition, among the functional foods of the present invention, health drinks may contain various flavoring agents or natural carbohydrates as additional ingredients, just like regular beverages. Flavoring agents include natural sweeteners such as thaumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame. Natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.

[0087]

[0088] Another aspect of the present application provides a method for producing biomass derived from microalgae of the genus Schizochytrium, comprising the steps of culturing a strain of the genus Schizochytrium (Schizochytrium sp.) CD03-7004; and recovering biomass from the strain, a culture of the strain, a dried product of the culture, or a crushed product of the dried product.

[0089] The above-mentioned Schizochytrium spp. strain, biomass, culture of the strain, dried product of the culture, and crushed product of the dried product are as described above.

[0090] As used herein, the term "cultivation" refers to growing the strain under appropriately controlled environmental conditions. The cultivation process of the present application can be performed using appropriate media and culture conditions known in the art. This cultivation process can be easily adjusted and used by those skilled in the art depending on the selected strain.

[0091] Specifically, the cultivation of the Schizochytrium spp. strain of the present application may be performed under heterotrophic conditions, but is not limited thereto.

[0092] The term "heterotrophy" as used herein refers to a nutritional method that relies on organic matter obtained from outside the body as an energy source or nutrient source, and is a term corresponding to autotrophy, and may be used interchangeably with the term "dark culture."

[0093] The step of culturing the above-mentioned Schizochytrium strain is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. The medium and other culture conditions used for culturing the strain of the present application may be any medium used for culturing a conventional strain without particular limitation. Specifically, the strain of the present application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0094] Specifically, the appropriate pH (e.g., pH 5 to 9, specifically pH 6 to 8, and most specifically pH 6.8) can be adjusted using, but is not limited to, a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid).

[0095] In addition, in order to maintain an aerobic state of the culture, oxygen or an oxygen-containing gas may be injected into the culture, or in order to maintain an anaerobic or microaerobic state, no gas may be injected or nitrogen, hydrogen or carbon dioxide gas may be injected, but this is not limited thereto.

[0096] Additionally, the culture temperature can be maintained at 20 to 45°C or 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto. Additionally, during the culture, a defoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation, but is not limited thereto.

[0097] The carbon source included in the medium used in the step of culturing the above-mentioned Schizochytrium strain may be at least one selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol, but is not limited thereto as long as it is a carbon source used for culturing microalgae.

[0098] The nitrogen source included in the medium used in the step of culturing the above-described Schizochytrium strain may be i) at least one organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone, and tryptone, or ii) at least one inorganic nitrogen source selected from the group consisting of ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate, sodium nitrate, urea, and MSG (Monosodium glutamate), but is not limited thereto as long as it is a nitrogen source used for culturing microalgae.

[0099] The medium used in the step of culturing the above-mentioned Schizochytrium strain may individually or mixedly contain potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts as phosphorus sources, but is not limited thereto.

[0100] The step of recovering biomass from the strain, a culture of the strain, a dried product of the culture, or a crushed product of the dried product may be a process of collecting the desired biomass using a suitable method known in the art. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC may be used, and may further include a purification process.

[0101]

[0102] Another aspect of the present application provides a method for producing bio-oil derived from a Schizochytrium sp. strain, comprising the steps of culturing a Schizochytrium sp. CD03-7004 strain; and recovering lipids from the strain, a culture of the strain, a dried product of the culture, or a crushed product of the dried product.

[0103] The above-mentioned Schizochytrium genus strain, bio-oil, culture of the strain, dried product of the culture, and crushed product of the dried product, and the step of culturing the strain are as described above.

[0104] The step of recovering lipids from the strain, a culture of the strain, a dried product of the culture, or a lysate of the dried product may be a method known in the art for collecting the desired lipids. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC may be used, and may further include a purification process.

[0105] For example, lipids and lipid derivatives such as fatty aldehydes, fatty alcohols and hydrocarbons (e.g., alkanes) can be extracted with hydrophobic solvents such as hexane. Lipids and lipid derivatives can also be extracted using methods such as liquefaction, oil liquefaction and supercritical CO2 extraction. In addition, known methods for recovering lipids from microalgae include, for example, i) collecting cells by centrifugation, washing with distilled water and drying by freeze-drying, and ii) pulverizing the obtained cell powder and then extracting lipids with n-hexane (Miao, X and Wu, Q, Biosource Technology (2006) 97:841-846).

[0106]

[0107] Another aspect of the present application is

[0108] A method for producing an antioxidant pigment is provided, comprising: a step of culturing a strain of Schizochytrium sp. CD03-7004; and a step of extracting an antioxidant pigment of the carotenoid series from a culture of the strain.

[0109] The above antioxidant pigment may be, but is not limited to, beta-carotene or canthaxanthin.

[0110] The above-mentioned Schizochytrium genus strain and the steps for culturing the above-mentioned strain are as described above.

[0111] The antioxidant pigments, beta-carotene and canthaxanthin, are as described above.

[0112] The above antioxidant pigment can be extracted or separated and purified by a conventional method in the art. The antioxidant pigment present in the fungus can be extracted using an organic solvent, for example, hexane, acetone, chloroform, ethyl acetate, methyl alcohol, dichloromethane, cyclohexane, ethanol, benzene, carbon disulfide, diethyl ether, or a mixed solvent thereof.

[0113] The present invention relates to a novel Schizochytrium sp. strain producing biomass containing a high content of protein, antioxidant pigment, and omega-3 fatty acid, and a method for producing biomass containing a high content of protein, antioxidant pigment, and omega-3 fatty acid using the same. The novel Schizochytrium sp. strain of the present invention has the characteristic of producing biomass containing a high content of protein components containing amino acids such as intracellular glutamic acid, arginine, and aspartic acid, antioxidant pigments such as beta-carotene and canthaxanthin, and omega-3 unsaturated fatty acid components such as eicosapentaenoic acid and docosahexaenoic acid, and therefore, the biomass and bio-oil produced by the strain itself or by culturing and fermenting the strain can be usefully utilized as a feed composition or a food composition, etc.

[0114] Figure 1 is a diagram showing the difference in color as a result of pure isolation culture of a mutant strain of Schizochytrium sp. CD03-7004 and a wild type strain of Schizochytrium sp. CD01-5000.

[0115] Figure 2 is a diagram showing the sizes of amplified DNA fragments of the wild-type CD01-5000 strain and the mutant CD03-7004 strain, after performing PCR using a primer set that amplifies a DNA fragment containing an additional 15 bp base sequence in the mutant CD03-7004 strain compared to the wild-type CD01-5000 strain.

[0116] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only intended to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0117]

[0118] Example 1. Development of a novel Schizochytrium sp. CD03-7004 mutant strain using gamma irradiation.

[0119] The pure isolated wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) was cultured in modified-GYEP (glucose 10 g / L, yeast extract 1 g / L, peptone 1 g / L, MgSO4·7H2O 2 g / L, H3BO3 5.0 mg / L, MnCl2 3.0 mg / L, CuSO4 0.2 mg / L, NaMo4·2H2O 0.05 mg / L, CoSO4 0.05 mg / L, ZnSO4·7H2O 0.7 mg / L) medium containing 30 g / L glucose for about 24 h to reach the early exponential phase, and then the culture solution sample was centrifuged to harvest the cells. The harvested cells had a cell count of about 10 9 The cells / mL were suspended in 0.1 M Phosphate Buffer Solution containing 1.0% NaCl and used for gamma irradiation.

[0120] Gamma-irradiation experiments were conducted at the Advanced Radiation Research Institute of the Korea Atomic Energy Research Institute, and gamma-ray doses of 2,000–5,000 GY were irradiated. After a recovery process for O / N in a darkroom, gamma-irradiated microalgae culture samples were spread on GYEP medium containing 20 g / L agar and cultured at 30°C for approximately 5 days. The number of growing colonies was counted to determine the mortality rate according to gamma-ray dose.

[0121] [Calculation Formula 1]

[0122] Mortality rate (%) = [{(number of colonies in untreated group) - (number of colonies in treated group)} / (number of colonies in untreated group)] X 100

[0123] Gamma ray dose (kGY) Number of growing colonies (EA) Mortality rate (%) 2.0 ≥ 250- 3.0 ≥ 2390.8 4.0 ≥ 798.2 4.50 100 5.00 100 Non-irradiated group ≥ 2500

[0124] As a result, as shown in Table 1, the appropriate dose was confirmed at which the number of growth colonies and the CFU value of viable cells were reduced by 95% or more according to the gamma-ray irradiation dose. Specifically, at gamma-ray irradiation doses of 2.0, 3.0, 4.0, 4.5, and 5.0 kGY, 0%, 90.8%, 98.2%, 100%, and 100% were killed, respectively. Under the gamma-ray irradiation condition of 4.5 GY or higher, all algae were killed, making it impossible to secure microalgae colonies, and the gamma-ray dose condition of 4.0 kGY, which showed a death rate of 98.2%, was selected.

[0125] In the same way, the novel microalgae strain CD01-5000 was irradiated with 4.0 kGY gamma rays and cultured in GYEP medium. Colonies that could grow during the culture were selected, and passages were performed under the same medium and culture environment conditions. Colonies with a red color morphologically between passages were selected, and the single cell line was isolated and cultured purely, and the results of the photographing are shown in Fig. 1. The above Schizochytrium strain was named Schizochytrium sp. CD03-7004 strain and deposited with the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology on June 20, 2022, and assigned the accession number KCTC15006BP.

[0126]

[0127] Example 2. Analysis of crude fat and fatty acid content of culture medium of mutant strain Schizochytrium sp. CD03-7004

[0128] Example 2-1. Cultivation of CD01-5000 strain and CD03-7004 strain

[0129] To compare the components of the culture broth of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain obtained by gamma irradiation, the dried mycelia from the fermented culture broth of each strain were used as the sample for component analysis. For the preliminary culture prior to the main culture at 30 L scale, each strain was inoculated into GYEP medium containing 50 ml of working volume and 30 g / L of glucose in a 500 ml flask and cultured in a shaking incubator at 30°C and 180 rpm for approximately 20 h. The preliminary culture was inoculated into a 30 L fermenter containing medium under the same conditions and fermented in a total working volume of 20 L. Under the conditions of 30℃, 500 rpm, 0.5-1 vvm, and pH 5-7, glucose corresponding to 20% of the working volume was continuously added for cell culture, and the glucose concentration at this time was maintained at the level of 20 g / L. The culture was terminated when the supplied carbon source, glucose, was completely consumed. The cultured broth was dried using a freeze dryer until the moisture content became approximately 5-8%, and the obtained dried mycelia were used for analysis of crude fat, crude protein, and carotenoid components.

[0130]

[0131] Example 2-2. Analysis of crude fat and fatty acid content of CD01-5000 and CD03-7004 strain cultures

[0132] The following methods were used to analyze the crude fat and fatty acid contents of the culture solution of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain of the present invention.

[0133] Specifically, in order to hydrolyze the cell walls of microalgae, 2 g of the dried microalgae obtained in Example 1-1 was added with an 8.3 M hydrochloric acid solution, heated to 80°C, 30 mL of ethyl ether and 20 mL of petroleum ether were added, mixed for 30 seconds, and centrifuged. This process was repeated three or more times. The separated solvent layer was recovered, transferred to a round flask whose weight had been measured in advance, nitrogen was injected to remove the solvent, and then cooled in a desiccator to constant weight. The weight of the dried oil was measured by subtracting the weight of the empty flask from the weight of the flask after drying, and the total oil content was calculated. The DHA content in the oil was measured by gas chromatography after pretreatment with methanolic 0.5 N NaOH and 14% trifluoroborane methanol (BF3).

[0134] [Calculation Formula 2]

[0135] Total oil content (%) = (*oil g / dry cell mass g) X 100

[0136] *Oil g: Flask weight after acid hydrolysis and solvent removal - Empty flask weight

[0137] “Biomass” in Table 1 below refers to the concentration of cells in the culture medium, and can be used interchangeably with DCW (dry cell weight).

[0138] Schizochytrium sp. CD01-5000 Schizochytrium sp. CD03-7004 Incubation time (hr) 26.6 28.3 O.D (680 nm) 166.9 124.6 DCW (g / L) 107.9 105 Crude fat content in biomass (%) 25.3 14.4 Fatty acids in crude fat (%) - C20:5 n- 30.6 2.1 - C22:6 n- 341.3 49.4

[0139] (In the table above, C20:5 n-3 refers to eicosapentaenoic acid (EPA), and C22:6 n-3 refers to docosahexaenoic acid (DHA).)

[0140]

[0141] As a result, as shown in Table 2, both the wild-type strain CD01-5000 and the mutant CD03-7004 strain digested all of the supplied carbon source, glucose, within about 30 hours, and produced biomass of about 100 g / L, showing similar biomass growth rates. In the case of the CD03-7004 strain, the crude fat content in the biomass was lower at 14.4% than in the CD01-5000 strain, but the eicosapentaenoic acid (EPA, C20:5 n-3) content was 2.1%, and the docosahexaenoic acid (DHA, C22:6 n-3) content was 49.4%, which were significantly higher than in the CD01-5000 strain. That is, it was confirmed that the CD03-7004 strain contained a high content of omega-3 fatty acids of more than 50% in crude fat.

[0142]

[0143] Example 3. Analysis of crude protein and amino acid contents of culture broth of mutant strain Schizochytrium sp. CD03-7004

[0144] The following method was used to analyze the crude protein and amino acid contents of the dried cells of the culture solution of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain of the present invention.

[0145] Specifically, 1 g of the dried microalgae cells obtained in Example 1-1 were placed in a Kjeldahl apparatus (Kjeltec 2100) analysis tube, 12 to 15 mL of 98% sulfuric acid and a catalyst were added, and after digestion in a digester, the digestion tube was mounted on an autosampler. The crude protein content of the microalgae dry biomass was measured by automatically calculating the nitrogen content by cooling and collecting the gaseous ammonia generated by heating and distillation with caustic soda and steam in the Kjeldahl apparatus and titrating it with a 0.1 N hydrochloric acid solution. 0.5 to 1 g of the dried microalgae cells obtained in Example 1-1 were acid hydrolyzed with a 6 N HCl solution, and then total amino acid analysis was performed using liquid chromatography. The analysis results of individual amino acids were standardized by the amount of dried microalgae cells used to calculate the content ratio of individual amino acids in the dried cells, and the content ratio of all amino acids detected in the analysis results was added to calculate the total amino acid content ratio in the cells.

[0146] Schizochytriumsp. CD01-5000Schizochytriumsp. CD03-7004 Crude protein content in biomass (%) 59.77 5.1 Amino acid content in biomass (%) Aspartic acid 3.98 3.86 Threonine 1.82 1.75 Serine 2.23 1.99 Glutamic acid 13.57 21.30 Glycine 1.87 1.86 Alanine 2.50 2.53 Cysteine ​​0.59 0.52 Valine 1.90 2.21 Methionine 0.76 0.70 Isoleucine 1.16 1.34 Leucine 2.80 2.72 Tyrosine 1.24 1.10 Phenylalanine 1.52 1.66 Lysine 2.50 2.61 Histidine 0.72 0.84 Arginine 5.59 8.27 Proline 0.77 0.16

[0147] (In the table above, the amount of amino acids in biomass means the amount (g) of each amino acid in biomass (kg) expressed as a ratio (%).)

[0148] As a result, as shown in Table 3, the crude protein content in the dried cells of the CD03-7004 mutant strain culture was 75.1%, which was significantly higher than the crude protein content of 59.7% in the dried cells of the wild-type CD01-5000 strain culture. In addition, the amino acid content in the dried cells of the CD03-7004 mutant strain culture was highest in glutamic acid, followed by phenylalanine, arginine, aspartic acid, and lysine.

[0149]

[0150] Example 4. Analysis of antioxidant pigment content in culture solution of mutant strain Schizochytrium sp. CD03-7004

[0151] The following method was used to analyze the antioxidant pigment content of the culture solution of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain of the present invention.

[0152] Specifically, the dried microalgae cells obtained in Example 1-1 were weighed in an appropriate amount, extracted and concentrated with an extraction solution composed of hexane, acetone, chloroform, and ethyl acetate, and analyzed using high performance liquid chromatography (HPLC). The results are shown in Table 4 below.

[0153] Antioxidant pigments Schizochytrium sp. CD01-5000 Schizochytrium sp. CD03-7004 Beta-carotene (mg / kg) Not detected 2.77 Canthaxanthin (mg / kg) 6.22 112.09

[0154] As a result, as shown in Table 4, in the dried cell body of the culture solution of the Schizochytrium sp. CD01-5000 strain, beta-carotene was not detected and the canthaxanthin content was 6.22 mg / kg, whereas in the dried cell body of the culture solution of the Schizochytrium sp. CD03-7004 strain, the beta-carotene content was 2.77 mg / kg and the canthaxanthin content was 112.09 mg / kg, confirming that the Schizochytrium sp. CD03-7004 mutant strain of the present invention produces antioxidant pigments of beta-carotene and canthaxanthin in high quantities.

[0155]

[0156] Example 5. Derivation of a marker to distinguish between the CD03-7004 mutant strain and the wild-type CD01-5000 strain.

[0157] The whole genome sequences of the wild type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain were compared to identify the mutated sequence in CD03-7004 and construct a PCR marker.

[0158] Specifically, the mutant CD03-7004 strain was confirmed to have an additional portion of 15 base pairs (bold portion in the sequence of SEQ ID NO. 1 below) when compared to the genome of the wild-type CD01-5000 strain.

[0159]

[0160] [DNA fragment sequence for amplification of mutant CD03-7004 strain (SEQ ID NO: 1)]

[0161] tttcagactgctttttgcttttttgcttgcttgcttttttgcttgcttgcttttggcttgcttttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0162]

[0163] [DNA fragment sequence to be amplified from the wild-type CD01-5000 strain (SEQ ID NO: 2)]

[0164] tttcagactgctttttgcttttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0165]

[0166] Primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) were selected to amplify this part, and PCR amplification was performed using them. The PCR reaction was performed using a reaction solution containing taq polymerase, denaturing at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds, and then polymerization at 72°C for 5 minutes. The reaction solution amplified through the PCR process was electrophoresed on a 1.7% agarose gel to confirm the amplified DNA size, which is shown in Figure 2.

[0167] As a result, as shown in Fig. 2, the DNA fragment amplified in the mutant CD03-7004 strain was found to be about 140 bp in size, confirming that it was different from the wild-type CD01-5000 strain in which a DNA fragment of about 120 bp in size was amplified.

[0168] Therefore, the above results show that primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) can be utilized to select the mutant CD03-7004 strain.

[0169]

[0170] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering the technical concept or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

[0171]

[0172] [Accession number]

[0173] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0174] Accession number: KCTC15006BP

[0175] Date of acceptance: 20220620

[0176]

[0177]

[0178]

Claims

1. A novel strain of Schizochytrium sp. CD03-7004 (accession number KCTC15006BP).

2. A strain according to claim 1, wherein the strain has the ability to produce antioxidant pigments of the carotenoid series.

3. A strain according to claim 2, wherein the antioxidant pigment is beta-carotene or canthaxanthin.

4. A strain according to any one of claims 1 to 3, wherein the strain has the ability to produce omega-3 unsaturated fatty acids.

5. A strain according to claim 4, wherein the omega-3 unsaturated fatty acid is docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA).

6. A strain according to claim 1, characterized in that the genomic DNA of the strain comprises the base sequence of sequence number 1.

7. A strain according to claim 1, characterized in that the strain can be selected with a primer set including a primer consisting of sequence number 3 and a primer consisting of sequence number 4.

8. Biomass comprising the strain of paragraph 1, a culture solution of the strain, a dried product of the culture solution, or a fragment of the dried product.

9. In the 8th paragraph, the biomass contains an antioxidant pigment of the carotenoid series.

10. In the 9th paragraph, the biomass wherein the antioxidant pigment is beta-carotene or canthaxanthin.

11. A biomass according to any one of claims 8 to 10, wherein the biomass contains 42% or more of omega-3 unsaturated fatty acids based on the total weight of fatty acids.

12. In claim 11, the omega-3 unsaturated fatty acid is docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA).

13. A biomass according to any one of claims 8 to 10, wherein the biomass contains protein at 60% or more by dry weight.

14. A feed composition comprising the strain of paragraph 1, a culture solution of the strain, a dried product of the culture solution, or a crushed product of the dried product.

15. A food composition comprising the strain of paragraph 1, a culture solution of the strain, a dried product of the culture solution, or a crushed product of the dried product.

16. An antioxidant composition comprising the strain of paragraph 1, a culture solution of the strain, a dried product of the culture solution, or a crushed product of the dried product as an active ingredient.

17. A step of culturing the strain of paragraph 1; and A method for producing an antioxidant pigment, comprising: a step of extracting an antioxidant pigment of the carotenoid series from a culture of the above strain; 18. A method for producing an antioxidant pigment in claim 17, wherein the antioxidant pigment is beta-carotene or canthaxanthin.

Images