Novel yeast belonging to genus leucosporidium and fat production method using same

AU2023411737B2Pending Publication Date: 2026-09-17IDEMITSU KOSAN CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
AU2023411737
Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-23
Filing Date
2023-12-22
Publication Date
2026-09-17

AI Technical Summary

Technical Problem

Traditional methods for producing biofuels using vegetable oils and animal fats face challenges such as competition with food sources and environmental impact, while microalgae and heterotrophic microorganisms face high production costs and efficiency issues, with psychrophilic yeasts like Leucosporidium species having low temperature limitations unsuitable for industrial use.

Method used

A method utilizing mesophilic yeast strains from the genus Leucosporidium golubevii, particularly the IS-300 strain, which exhibits high temperature tolerance and efficient oil production, cultured in a medium containing sugar, such as saccharified lignocellulosic biomass, to produce fats and oils suitable for biofuels, food oils, and surfactants.

Benefits of technology

The method enables efficient production of biofuels and oils with reduced environmental impact, suppressing cooling energy needs and enhancing growth and production rates, allowing for the use of biomass-derived sugars and reducing greenhouse gas emissions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
  • Figure 00000033_0000
    Figure 00000033_0000
Patent Text Reader

Abstract

Provided is a fat production method characterized by culturing, in a medium including a saccharide, yeast that belongs to Leucosporidium golubevii, particularly a Leucosporidium golubevii IS-300 (NITE BP-03675) strain or a related strain thereof, producing fat from the saccharide, and collecting the obtained fat.
Need to check novelty before this filing date? Find Prior Art

Description

Novel yeast belonging to the genus Leucosporidium and method for producing fats and oils using the same

[0001] The present invention relates to a method for producing fats and oils using yeast, and a novel yeast to be used therein.

[0002] Traditionally, vegetable oils and animal fats have been widely used as green fuel feedstocks, but competition with food supplies and the destruction of tropical rainforests due to palm oil plantations have become a concern. Therefore, oil production using microalgae and production from lignocellulosic biomass such as agricultural residues using heterotrophic microorganisms (yeast and mold) have attracted attention. However, both methods have a high cost issue. To overcome this issue, it was necessary to improve the production efficiency (oil-to-sugar yield) of feedstocks in oil production using heterotrophic microorganisms.

[0003] As described in Non-Patent Citation 1, it has been reported that Leucosporidium creatinivorum, which belongs to the genus Leucosporidium, has a high oil-producing ability among many yeasts. However, a problem with yeasts belonging to the genus Leucosporidium is that they grow at a relatively low temperature (approximately 20°C).

[0004] Filippucci et al. Biotechnol Biofuels (2016) 9:259, DOI 10.1186 / s13068-016-0672-1

[0005] As described above, some strains of yeast belonging to the genus Leucosporidium have been reported to have high oil and fat productivity, but they are psychrophilic, posing a problem for their industrial use. Therefore, an object of the present invention is to provide a method for producing oil and fat using mesophilic yeast belonging to the genus Leucosporidium, which is advantageous for industrial production, and to provide a novel yeast strain that can be used in the method.

[0006] As a result of extensive research to solve the above problems, the present inventors have found that yeast strains belonging to the genus Leucosporidium golubevii are excellent for producing fats and oils. They also discovered that some strains belonging to the genus Leucosporidium have relatively high temperature tolerance. In particular, they found that the novel oil-producing yeast strain IS-300 has high temperature tolerance compared to other Leucosporidium yeast species, actively grows even under culture conditions of 28°C, and produces fats and oils. Based on these findings, the present invention has been completed.

[0007] The present invention provides a method for producing fats and oils, comprising culturing a yeast strain belonging to the Leucosporidium golubevii in a medium containing sugar to produce fats and oils from the sugars, and recovering the resulting fats and oils. The sugar-containing medium may also contain a saccharified product of lignocellulosic biomass. The culture temperature may be 10°C to 30°C or 25°C to 30°C. The sugar concentration in the medium may be 50 g / L to 500 g / L or 200 g / L to 500 g / L. The yeast strain belonging to the Leucosporidium golubevii may be Leucosporidium golubevii IS-300 (NITE BP-03675) or a related strain thereof. The related strain may be a strain whose nucleotide sequences in the 5.8S rDNA region, ITS1 region, and ITS2 region are 95% or more identical to those in SEQ ID NO: 1 and whose fat and oil production ability at 28°C is equivalent to that at 24°C. The present invention also provides Leucosporidium golubevii IS-300 (NITE BP-03675) as a novel yeast strain excellent for producing fats and oils. The fats and oils obtained by the production method of the present invention can be used as raw materials for biofuels, bionaphtha, edible oils, lubricating oils, or surfactants. The present invention also relates to fats and oils produced by the production method and biofuels or bionaphtha made from the fats and oils.

[0008] By using Leucosporidium golubevii, particularly the Leucosporidium golubevii IS-300 strain, fats and oils can be efficiently produced using sugars such as biomass saccharified liquid as a raw material. In particular, because the IS-300 strain has high temperature tolerance, culturing the IS-300 strain or its related strains to produce fats and oils through fermentation can reduce the cooling energy required during cultivation. Furthermore, increasing the cultivation temperature is expected to increase the growth rate and fat and oil production rate, allowing for efficient fat and oil production. The fats and oils produced by the method of the present invention can be used not only as biofuel feedstocks and bionaphtha feedstocks that reduce GHG emissions, but also as raw materials for environmentally friendly edible oils, lubricating oil base materials, and surfactants.

[0009] Microscopic image (photo) of strain IS-300. Diagram showing the phylogenetic position of the novel oleaginous yeast, Leucosporidium golubevii IS-300, in the molecular phylogenetic tree of the Leucosporidium genus (5.8S rDNA and ITS sequences, NJ method). The GenBank Accession numbers of the DNA sequences used in the phylogenetic analysis are shown in the figure. The numbers at each node are bootstrap values ​​from 1,000 trials. Diagram showing the dry cell weight and oil production of each Leucosporidium strain every 24 hours at 24°C. Diagram showing the dry cell weight and oil production of each Leucosporidium strain every 24 hours at 28°C. Diagram showing the time course of dry cell weight in flask cultures using CYM medium as a nitrogen source. Diagram showing the time course of oil production in flask cultures using CYM medium as a nitrogen source. Diagram showing the time course of dry cell weight in flask cultures using YSM medium as a nitrogen source. FIG. 1 shows the change over time in the amount of fat produced in flask culture under various conditions with different nitrogen sources based on YSM medium. FIG. 2 shows the change over time in dry cell weight in flask culture, examining ammonium sulfate concentration based on CYM medium. FIG. 3 shows the change over time in the amount of fat produced in flask culture, examining ammonium sulfate concentration based on CYM medium. FIG. 4 shows the change over time in dry cell weight in 250 mL jar fermenter culture, examining various carbon sources based on CYM medium. FIG. 5 shows the change over time in each carbon source in 250 mL jar fermenter culture, examining various carbon sources based on CYM medium. FIG. 6 shows the change over time in the amount of fat produced in 250 mL jar fermenter culture, examining various carbon sources based on CYM medium. FIG. 7 shows the change over time in dry cell weight and amount of fat produced in 2 L jar fermenter culture using blackstrap molasses. FIG. 8 shows the change over time in sucrose concentration, glucose concentration, and fructose concentration in 2 L jar fermenter culture using blackstrap molasses. A graph showing the change in dry cell weight over time in 250 mL jar fermenter culture after examining culture temperature conditions. A graph showing the change in glucose concentration over time in 250 mL jar fermenter culture after examining culture temperature conditions. A graph showing the change in oil and fat production over time in 250 mL jar fermenter culture after examining culture temperature conditions.Examination of culture pH conditions: A graph showing the change in dry cell weight over time in 2 L jar fermenter culture. Examination of culture pH conditions: A graph showing the change in glucose concentration over time in 2 L jar fermenter culture. Examination of culture pH conditions: A graph showing the change in fat and oil production over time in 2 L jar fermenter culture. Examination of initial glucose concentration: A graph showing the change in dry cell weight over time in 250 mL jar fermenter culture. Examination of initial glucose concentration: A graph showing the change in glucose concentration over time in 250 mL jar fermenter culture. Examination of initial glucose concentration: A graph showing the change in fat and oil production over time in 250 mL jar fermenter culture. Examination of initial glucose concentration: A graph comparing the fat and oil yield per sugar at different glucose concentrations at the beginning of culture. Examination of initial glucose concentration (high concentration): A graph showing the change in dry cell weight over time in 250 mL jar fermenter culture. Examination of initial glucose concentration (high concentration): A graph showing the change in glucose concentration over time in 250 mL jar fermenter culture. Figure 1 shows the change in the amount of fat produced over time in 250 mL jar fermenter culture after initial glucose concentration examination (high concentration). Figure 2 shows the comparison of the fat / sugar yield at different glucose concentrations at the initial stage of culture after initial glucose concentration examination (high concentration).

[0010] The method for producing fats and oils of the present invention is characterized by culturing a yeast belonging to the genus Leucosporidium golubevii in a medium containing sugar to produce fats and oils from the sugar, and recovering the fats and oils thus obtained.

[0011] Fats and oils are also called acylglycerols, and the type of fat or oil is not particularly limited as long as it is produced by fermentation from sugars by yeast belonging to Leucosporidium golubevii, and fats and oils include triacylglycerols, diacylglycerols, and monoacylglycerols.

[0012] Leucosporidium golubevii is not particularly limited as long as it is a yeast taxonomically classified as Leucosporidium golubevii, but it is preferable to use IS-300 strain (NITE BP-03675).

[0013] The Leucosporidium golubevii IS-300 strain was isolated from the flowers of Gnaphalium affine in Sodegaura, Chiba Prefecture, Japan, and was internationally deposited under the Budapest Treaty on June 24, 2022, with the NITE Patent Microorganisms Depository (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) under accession number NITE BP-03675. Colonies on YPD agar medium are white, glossy, smooth, and form a viscous substance. Cells are oval and form oil droplets (Figure 1). The nucleotide sequences of the 5.8S rDNA region, ITS1 (internal transcribed spacer 1) region, and ITS2 (internal transcribed spacer 1) region of the DNA encoding the rRNA of the IS-300 strain are shown in SEQ ID NO: 1.

[0014] In the method for producing fats and oils of the present invention, a strain related to the IS-300 strain can also be used. This strain can have an oil-producing ability at moderate temperatures (e.g., 28°C) equivalent to that at low temperatures (e.g., 24°C). Here, "oil-producing ability at 28°C equivalent to that at 24°C" means that when a related strain of the IS-300 strain is cultured in a sugar-containing medium at 28°C, the amount of oil produced is at least 50%, preferably at least 80%, of the amount produced when the same strain is cultured in the same sugar-containing medium at 24°C for the same period. Furthermore, "related strain" refers to a strain whose nucleotide sequences in the 5.8S rDNA region, ITS1 region, and ITS2 region are at least 95%, preferably at least 98%, and more preferably at least 99% identical to those of SEQ ID NO: 1. Related strains may be naturally occurring strains or may be strains bred from the IS-300 strain by mutation or other means. Such related strains include Leucosporidium golubevii CBS 9652.

[0015] The medium is not particularly limited as long as it contains sugar and allows Leucosporidium golubevii to grow. The sugar may be a monosaccharide or a polysaccharide. The medium may also contain a sugar-containing raw material. Specific sugars are not particularly limited as long as they are assimilable by Leucosporidium golubevii, and various sugars can be used, including glucose, sucrose, fructose, xylose, mannose, soluble starch, glycerol, and mannitol. Examples of sugar-containing raw materials include molasses and saccharified products of lignocellulosic biomass. Suitable lignocellulosic biomass includes herbaceous biomass such as bagasse, corn stover, wheat straw, rice straw, switchgrass, napier grass, erianthus, bamboo grass, and Japanese silver grass, as well as woody biomass such as waste wood, sawdust, bark, and recycled paper. Lignocellulosic biomass contains cellulose and hemicellulose (hereinafter sometimes abbreviated as celluloses), and the celluloses can be decomposed into sugars such as glucose and xylose using saccharifying enzymes in accordance with conventional methods and used as sugar-containing raw materials.

[0016] The sugar concentration in the medium is preferably 50 g / L to 500 g / L, more preferably 60 g / L to 420 g / L, and even more preferably 100 g / L to 420 g / L. When the medium contains a sugar-containing raw material, the sugar concentration calculated from the concentration of the sugar-containing raw material is adjusted so that it falls within the above range. Since the IS-300 strain can assimilate high concentrations of sugar, when culturing the IS-300 strain or a related strain, the sugar concentration in the medium may be 200 g / L to 500 g / L or 200 g / L to 400 g / L. This increases the concentration of the oils and fats produced and improves the efficiency of oil and fat production.

[0017] The medium preferably further contains a nitrogen source. The nitrogen source is not particularly limited, and examples thereof include yeast extract, malt extract, meat extract, peptone, casamino acids, and corn steep liquor. The nitrogen source may also be ammonium sulfate, urea, potassium nitrate, and the like. Other components preferably include inorganic salts such as magnesium salts (magnesium sulfate heptahydrate, etc.), calcium salts (calcium chloride, etc.), phosphates (potassium phosphate, etc.), iron salts (iron sulfate, etc.), copper salts (copper sulfate, etc.), and sodium salts (sodium chloride, etc.).

[0018] Generally, for high production of fats and oils, a high C / N ratio (the ratio of nitrogen to carbon source in the medium, amount of carbon source / amount of nitrogen source) is desirable. However, yeast belonging to the genus Leucosporidium are less susceptible to the effect of the C / N ratio in fat and oil production, and the nitrogen concentration may be any concentration that allows the yeast to grow, and is not particularly limited. For example, the C / N ratio (ratio of carbon molar concentration to nitrogen molar concentration) is preferably 10 to 300, more preferably 10 to 150, even more preferably 10 to 100, and particularly preferably 30 to 100.

[0019] The culture temperature is not particularly limited as long as it allows the growth of yeast belonging to Leucosporidium golubevii, but is preferably 10°C to 30°C, more preferably 20°C to 30°C, and even more preferably 20°C to 28°C. Since the IS-300 strain can grow at mesophilic temperatures, the culture temperature may be 25°C to 30°C when culturing the IS-300 strain or its related strains. Cultivation at 20°C to 28°C has the advantage of suppressing the growth of unwanted bacteria and improving the culture efficiency.

[0020] The pH of the medium is not particularly limited as long as it allows the growth of strains belonging to Leucosporidium golubevii, but for example, a pH of 3.5 to 7.0 is preferred, a pH of 3.5 to 6.0 is more preferred, and a pH of 4.0 to 6.0 is even more preferred.

[0021] The method for culturing Leucosporidium golubevii is not particularly limited. The cells may be directly inoculated into a medium for culture, or a pre-culture solution obtained by prior culture may be inoculated into a liquid medium for culture. Alternatively, a strain that has been cultured on a solid medium may be inoculated into a liquid medium for culture. Conventional media used for culturing yeast may also be used, such as PDA medium or YPD medium.

[0022] The culture method is not particularly limited as long as it allows the growth of a strain belonging to Leucosporidium golubevii, and examples of the culture method include agitation culture, shaking culture, static culture, etc. Examples of the culture method include batch culture, fed-batch culture, continuous culture, etc.

[0023] The culture time for the strain belonging to Leucosporidium golubevii may be determined depending on the amount of the desired fat or oil, and may be, for example, one day or more, but is preferably four days or more. When culturing for a long period of time, it is preferable to add sugar during the culture. The upper limit of the culture period is not particularly limited, but can be, for example, within 30 days.

[0024] The method for recovering fats and oils from the cultured bacterial cells can be carried out by a conventionally known method, for example, by first separating and recovering the bacterial cells from the culture solution by centrifugation, filtration, or the like, and then extracting the fats and oils from the bacterial cells with an organic solvent such as normal hexane.

[0025] The obtained fats and oils may be purified. The purification step may be a step of purifying the fats and oils collectively, or a step of purifying a single component of the fats and oils. For example, industrial fat and oil purification methods can be applied, such as adding water or acid to the fraction containing the fats and oils obtained in the recovery step to remove precipitated gums, or adding alkali to remove free fatty acids and decolorizing using activated clay. Furthermore, the components may be further separated and purified by repeating silica gel chromatography.

[0026] The resulting oils and fats can be used as edible oils and fats either directly or after refinement, or as raw materials for biofuels, bionaphtha, lubricating oils, surfactants, etc. The method of the present invention can be carried out using biomass, such as edible sugars, molasses, or saccharified products of lignocellulosic biomass, and the resulting oils and fats can be transesterified with methanol to produce FAME (the product), which can then be hydrodeoxygenated and subsequently isomerized, and cracked as needed to produce HVO and HEFA (the product), which can then be used to produce biodiesel, biojet fuel, and bionaphtha. The resulting oils and fats can be co-processed with petroleum-based feedstocks in a hydrotreating unit at a petroleum refinery to produce mixtures with petroleum-based fuels, such as diesel, jet fuel, kerosene, and gasoline. Lubricating oils can be used, for example, as lubricating oil base stocks or additives. The oils and fats obtained by the method of the present invention can be used directly or by partial hydrogenation of unsaturated bonds, or by producing fatty acids and then alkanoizing them. Examples of surfactants include anionic surfactants such as fatty acid metal salts, which can be obtained by carrying out the method of the present invention, producing fatty acids from the obtained oils and fats, and then neutralizing the fatty acids.

[0027] EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to the following embodiments.

[0028] <1> Acquisition of IS-300 strain The IS-300 strain was obtained from the flowers of Gnaphalium affine in Sodegaura City, Chiba Prefecture, Japan, using its ability to produce oils from sugar as an indicator.

[0029] The nucleotide sequences of the 5.8S rDNA, ITS1 (internal transcribed spacer 1), and ITS2 (internal transcribed spacer 2) regions of the rRNA-encoding DNA of strain IS-300 were analyzed using a DNA sequencer. Phylogenetic analysis was performed by comparing the sequences with those of other Leucosporidium species registered in existing databases. The 5.8S rDNA, ITS1, and ITS2 regions of strain IS-300 were 100% identical to those of the type strain of Leucosporidium golubevii, CBS 9651, and formed a monophyletic group with Leucosporidium golubevii CBS 9652 (Fig. 2). The IS-300 and CBS 9652 strains differed by only one nucleotide. Based on these findings, strain IS-300 was identified as Leucosporidium golubevii. As described below, the CBS 9651 strain differs from the IS-300 strain in growth at 28°C and oil production ability, and therefore, although the sequences of the 5.8S rDNA region, ITS1 region, and ITS2 region are identical, the IS-300 strain is a different strain from the CBS 9651 strain.

[0030] The nucleotide sequences of the 5.8S rDNA region, ITS1 region, and ITS2 region of the novel Leucosporidium golubevii IS-300 strain and Leucosporidium golubevii CBS 9652 are shown below.

[0031] >Leucosporidium golubevii.IS-300 GTGAATATTAGCGCATCTCTTCGGAGAGCGTGACCTCCACTTTCTAACTCTGTGCATTTATTTGGCGGCTCTGAAGATGTAACAGTCTACTTAGCTGCGGCTCATTTTATAACACTAGTTAAAGTATGTAACGAAATATCGAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTTGCTCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCGTGGTATTCCGCGGAGCATGTCTGTTTGAGTGTCATGAACTCTTCAACCCACCAGTTTCTTGTAAATTGGATTGGTGTTTGGATTTTGAGTGTTGCTATTCCTAGTTGAATCAGCTCATTCGTAATATATTAGCATCTCTAATTCGAACTCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACACGCTCTTTGTAGTGTGGCCGAATGAGATCTCAGTAGAAGCTTCCAACTACTTTAGTCAACTTTAGA (SEQ ID NO: 1) >Leucosporidium golubevii.CBS9652 (SEQ ID NO:2).

[0032] <2> Comparison with other Leucosporidium species Each yeast strain grown on PDA (potato dextrose agar) medium was inoculated into YPD medium dispensed into 14 ml PS tubes and cultured for 48 hours at 24°C and 200 rpm with shaking (preculture). The preculture solution was grown to a final concentration of OD 600 The bacteria were inoculated into 100 ml of YPD-modified medium in a 500 ml baffled flask so that the β-actin ratio (β) was 0.1, and cultured with shaking at 160 rpm (main culture). The culture temperature was set to 24°C or 28°C, and an antifoaming agent (Antifoam 204, SIGMA) was added as needed. 1 ml samples were taken every 24 hours from the start of main culture and used to determine the dry cell weight and fat content.

[0033] The composition of each medium is as follows: PDA medium: Potato Dextrose broth (Difco) 24 g, Agar (Wako) 20 g, Distilled water 1 L. YPD medium: Bacto peptone (Difco) 20 g, Yeast extract (Difco) 10 g, Glucose (Wako) 20 g, Distilled water 1 L. Modified YPD medium: Bacto peptone (Difco) 10 g, Yeast extract (Difco) 10 g, Glucose (Wako) 60 g, Distilled water 1 L.

[0034] The sample was centrifuged (700g, 5 minutes), and the resulting precipitate was dried overnight in a freeze dryer. The dry cell weight was measured and then used to measure oil production. Oil production was measured as follows: To inactivate lipase in the dried cells, 260 μl of distilled water and 40 μl of 10x D-PBS (Wako) were added to resuspend the cells and boiled for 10 minutes. 100 μl of 25 mg / ml Zymolyase solution (Nacalai Tesque, Zymolyase-20T) was added and incubated with shaking at 35°C for 1 hour. 200 μl of glass beads (Merck, G8772-500G) and 500 μl of hexane were then added and stirred for 1 hour (TAITEC, E-36, maximum speed). The mixture was centrifuged (10,000g, 10 minutes), and the hexane layer was transferred to a new microtube. 500 μl of hexane was added again and stirred for 1 hour. The hexane layer was centrifuged (10,000 g, 10 minutes) and added to a microtube. The amount of fat in the resulting hexane extract was measured using an enzymatic reaction method (Labo Assay Triglyceride, Wako, 290-63701).

[0035] Figures 3 and 4 show the dry cell weight and oil production of each strain over 24 hours. At 24°C, all strains except L. drummii CBS 11562 grew vigorously and were confirmed to be highly productive of oils (Figure 3). At 28°C, growth was significantly suppressed in all strains except Leucosporidium golubevii CBS9652 and IS-300, but growth in IS-300 and CBS962 was only slightly suppressed, confirming their high oil production (Figure 4).

[0036] Examination of Supplemental Nitrogen Sources for IS-300 Strain in CYM Medium [Test Tube Culture (Preculture)] 3 mL of modified YPD113 medium (10 g / L Bacto Yeast Extract, 10 g / L Bacto Tryptone, 30 g / L Glucose) was inoculated into 15 mL AS ONE polystyrene (PS) tubes (φ17 mm x 100 mm) using a small amount of oleaginous yeast IS-300 cells grown on a YPD agar plate, scraped off with the tip of a disposable loop. Rotational culture was performed at 28°C using a TAITEC ROTARY SHAKER NR-2 set to approximately 200 rpm in a SANYO MIR-253 incubator. Preculture was performed for two days.

[0037] [Investigation of Nitrogen Sources Using CYM Medium in 500 mL Baffled Erlenmeyer Flasks (Main Culture)] CYM medium and media in which the ammonium sulfate in the CYM medium was replaced with urea or potassium nitrate were prepared (Table 1). The amounts of ammonium sulfate, urea, or potassium nitrate added were adjusted to achieve the same nitrogen concentration. To prepare the medium, each medium was adjusted to pH 5.5 with 6N KOH, then diluted to the specified volume and sterilized by filtration through a 0.22 μm MF filter. Then, 100 mL of each medium was aseptically dispensed into sterilized 500 mL baffled Erlenmeyer flasks. The turbidity (OD600 nm) of the preculture in a test tube was measured using a spectrophotometer. An amount of bacteria was inoculated to achieve an OD600 nm value of 0.05 at the start of the main culture, and the medium was then cultured at 28°C with a rotational speed of 180 rpm.

[0038]

[0039] Figure 5 shows the dry cell weight of the IS-300 strain, and Figure 6 shows the change in the amount of oil produced over time. Under each condition, in which ammonium sulfate, urea, and potassium nitrate were added as nitrogen sources, bacterial growth and oil production were confirmed.

[0040] Examination of added nitrogen sources based on YSM medium for the IS-300 strain Preculture was carried out under the same conditions as in Example 3. For the main culture, YSM medium and a medium in which the ammonium sulfate in the YSM medium composition was replaced with other nitrogen sources, urea and potassium nitrate, were prepared to equalize the nitrogen (N) content (Table 2). Each medium was prepared in the same manner as in Example 3, and rotational culture was carried out in a baffled Erlenmeyer flask under the same culture conditions.

[0041]

[0042] Figure 7 shows the dry cell weight of the IS-300 strain, and Figure 8 shows the change in the amount of oil produced over time. Under each condition, in which ammonium sulfate, urea, and potassium nitrate were added as nitrogen sources, bacterial growth and oil production were confirmed.

[0043] Study of Ammonium Sulfate Concentration in Culture Medium for Strain IS-300 [Study of Ammonium Sulfate Concentration Based on CYM Medium in 500 mL Baffled Erlenmeyer Flasks (Main Culture)] Preculture was performed under the same conditions as in Example 3. For the main culture, CYM medium (ammonium sulfate concentration 0.1 g / L, nitrogen concentration 0.103 g / L, C / N ratio = 273), 10x the ammonium sulfate concentration of the CYM medium composition (ammonium sulfate concentration 1.0 g / L, nitrogen concentration 0.294 g / L, C / N ratio = 96), and 100x the ammonium sulfate concentration (ammonium sulfate concentration 10 g / L, nitrogen concentration 2.202 g / L, C / N ratio = 13) were prepared (Table 3). Note that the C / N ratio here refers to the ratio of carbon molar concentration to nitrogen molar concentration. Except for the medium composition, each medium was prepared identically to Example 3, and rotational culture was performed in baffled Erlenmeyer flasks under the same culture conditions.

[0044]

[0045] Figure 9 shows the dry cell weight of the IS-300 strain under medium conditions with various ammonium sulfate concentrations, and Figure 10 shows the change in oil production over time. Under conditions with a 10-fold higher ammonium sulfate concentration (ammonium sulfate concentration 1.0 g / L, nitrogen concentration 0.294 g / L, C / N ratio = 96), oil production increased by more than two-fold compared to the basic conditions (ammonium sulfate concentration 0.1 g / L, nitrogen concentration 0.103 g / L, C / N ratio = 273).

[0046] Confirmation of oil production from various carbon sources in jar fermenter cultures of IS-300 strain [Test tube culture (preculture)]: Each oleaginous yeast cell grown on a YPD agar plate was inoculated into 3.5 mL of YEL medium (5 g / L Bacto Yeast Extract, 30 g / L Glucose) in 15 mL AS ONE polystyrene (PS) tubes (φ17 mm x 100 mm) by slightly scraping it with the tip of a disposable loop. Rotational culture was performed at 28°C for 2 days in an Iwashiya Biosciences MLU-4-GR-16 multi-tank shaking incubator set at 140 rpm.

[0047] Comparison of fat and oil productivity from various carbon sources in 250 mL jar fermenter culture (main culture). The jar fermenter was a 250 mL 8-series AB-Biott Bio Jr. 8 fermentor, and compressed air was used for aeration. Each main fermentor contained 95 mL of various CYM modified media (Table 4, autoclave sterilized) containing glucose, xylose, arabinose, and glycerol as carbon sources. The carbon source concentration was approximately 60 g / L (after inoculation). The test tube cultures were mixed, and 5 mL of the preculture was inoculated into each main fermentor. Batch culture was initiated at 22 °C. The agitation speed was set to a minimum of 300 rpm, and automatic agitation speed control (DO cascade control) was used to maintain a DO lower limit of 2 ppm. Aeration was performed at 100 mL / min (1 vvm). After the start of cultivation, the pH was automatically controlled to a minimum of 5.0 using 0.5 N KOH, and if the pH rose, it was manually lowered to the set pH using an external peristaltic pump with 0.1 N H2SO4. The main cultivation continued for 168 to 216 hours.

[0048]

[0049] Figures 11, 12, and 13 show the time course of dry cell weight, carbon source concentration, and oil production for the IS-300 strain under each carbon source condition (arabinose concentration was not measured). Cell growth and oil production were confirmed in all cultures using the C6 sugar glucose, the C5 sugars xylose and arabinose, and glycerol as carbon sources. The C6 sugar glucose showed the fastest cell growth, oil production, and oil production.

[0050] Confirmation of oil production from blackstrap molasses using IS-300 strain in a jar fermenter [Test tube culture (seed culture)]. 3.5 mL of YEL medium (5 g / L Bacto Yeast Extract, 30 g / L Glucose) was inoculated into 15 mL AS ONE polystyrene (PS) tubes (φ17 mm x 100 mm) by slightly scraping IS-300 cells grown on a YPD agar plate with the tip of a disposable loop. Rotational culture was performed at 28°C using a TAITEC rotary shaker NR-2 installed in a SANYO incubator MIR-253, set at approximately 200 rpm. Preculture was performed for two days.

[0051] [Flask culture (preculture)] The test tube cultures were mixed, and 5 mL of each seed culture was inoculated into 100 mL of YEL medium (5 g / L Bacto Yeast Extract, 30 g / L Glucose) in a 500 mL baffled Erlenmeyer flask. The culture was then cultured at 28°C for 2 days in a multi-tank shaking incubator MLU-4-GR-16 (Iwashiya Biosciences) set at 180 rpm.

[0052] [Confirmation of Oil and Fat Production from Molasses in a 2 L Jar Fermenter (Main Culture)] A 2 L Bioneer-Neo 2 L jar fermenter manufactured by Marubishi Bioengine was used. 950 mL of modified CYM medium containing molasses as the sugar source was prepared in the main culture tank. The modified CYM medium had the same composition as in Example 6. The sugar source concentration was approximately 60 g / L (total of glucose, fructose, and sucrose). After inoculating 50 mL of preculture into the main culture tank, batch culture was initiated at 22 °C. The agitation speed was set to a minimum of 300 rpm, and automatic control (DO cascade control) was performed to maintain a DO lower limit of 24% (approximately 2 ppm). Aeration was performed at 1 L / min (1 vvm). After the start of culture, the pH was automatically controlled to 5.0 using 1.0 N KOH and 0.1 N H2SO4.

[0053] Figures 14 and 15 show the time course of the dry cell weight, sugars (sucrose, glucose, fructose), and fat production of IS-300 strain when molasses was used as the sugar source. Growth of the cells and fat production were also observed when molasses was used as the carbon source. The graph shows the time course of sugar concentrations, with a decrease in sucrose concentration after the start of cultivation, followed by a decrease in glucose concentration and finally a decrease in fructose concentration.

[0054] Examination of Culture Temperature in Jar Fermentor Culture [Test Tube Culture (Preculture)] Preculture was carried out in a test tube under the same conditions as in Example 6 as a seed culture.

[0055] [Investigation of Culture Temperature in 250 mL Jar Fermenter Culture (Main Culture)] The same jar fermenter and aeration system as in Example 6 were used. 95 mL of CYM modified medium containing reagent glucose as the sugar source was prepared in each main culture tank. The CYM modified medium had the same composition as in Example 6. The sugar concentration was approximately 60 g / L (after inoculation). The culture temperature conditions were 10, 12, 16, 20, 24, 28, 30, and 32°C. The test tube cultures were mixed, and 5 mL of the preculture solution was inoculated into each main culture tank. Then, batch culture was initiated at each temperature. The DO and agitation speed conditions were the same as in Example 6. The main culture was continued for 144 hours.

[0056] Figures 16, 17, and 18 show the time course of dry cell weight, glucose, and oil production for the IS-300 strain under each temperature condition. Cell growth and oil production were confirmed in the culture temperature range of 10°C to 30°C, and good results were observed for the oil production rate and amount in the culture temperature range of 20°C to 28°C. No oil production was observed at a culture temperature of 32°C.

[0057] Examination of Culture pH in Jar Fermentor Culture [Test Tube Culture (Seed Culture), Flask Culture (Preculture)] Seed culture and preculture were carried out in test tubes and flasks under the same conditions as in Example 7.

[0058] [Cultivation in a 2L Jar Fermenter (Main Culture)] The jar fermenter and aeration system were the same as those used in Example 7. 950 mL of CYM modified medium containing reagent glucose as the sugar source was added to the main culture tank. The CYM modified medium had the same composition as in Example 6. The sugar concentration was approximately 60 g / L (after inoculation). The culture pH conditions were pH 3.5, 4.0, 4.5, 5.0, 5.5, and pH 6.0. After inoculating 50 mL of the preculture solution into the main culture tank, batch culture was initiated at 22°C. The agitation speed was set to a minimum of 300 rpm, and automatic control of the agitation speed (DO cascade control) was performed to maintain a DO lower limit of 24% (approximately 2 ppm). Aeration was performed at 1 L / min (1 vvm). After the initiation of culture, automatic control of the pH was performed using 1.0 N KOH and 0.2 N H2SO4 to maintain the pH values ​​tested.

[0059] Figures 19, 20, and 21 show the time course of dry cell weight, glucose concentration, and oil production for the IS-300 strain under each culture pH condition. Cell growth and oil production were observed under all culture pH conditions. At a culture pH of 3.5, glucose consumption tended to be slightly slower.

[0060] Examination of initial sugar concentration in medium in jar fermenter culture (reagent glucose concentration range of 240 g / L or less) [Test tube culture (preculture)] Test tube culture was carried out under the same conditions as in Example 6 as preculture.

[0061] [Cultivation in a 250 mL jar fermenter (main culture)] The jar fermenter and aeration system were the same as those used in Example 6. The initial glucose concentrations of the medium were 60 g / L (baseline), 100 g / L, 140 g / L, 180 g / L, 210 g / L, and 240 g / L. The CYM modified medium of Example 6, with a reagent glucose concentration of 60 g / L (post-inoculation), was used as the reference medium composition. For media with other glucose concentrations, the concentrations of other medium components were increased in proportion to the increase in glucose concentration from the base medium composition (glucose concentration 60 g / L). 95 mL of each medium was added to a 250 mL fermentor. The test tube cultures were mixed, and 5 mL of the preculture was inoculated into each main fermentor. Batch culture at each sugar concentration was initiated. The pH, DO, and agitation speed were the same as those in Example 6. The main culture was continued for 144-240 hours.

[0062] Figures 22, 23, and 24 show the time course of dry cell weight, glucose concentration, and oil production for the IS-300 strain under each glucose concentration condition. Cell growth and oil production were observed over a glucose concentration range from 60 g / L to 240 g / L. Figure 25 also shows the oil yield per sugar (relative to that obtained when cultured at 60 g / L glucose) under each initial glucose concentration condition.

[0063] Examination of Initial Sugar Concentration in Medium in Jar Fermentor Culture (High Concentration) [Test Tube Culture (Preculture)] Test tube culture was carried out under the same conditions as in Example 6 as preculture.

[0064] [Cultivation in 250 mL Jar Fermentors (Main Culture)] The jar fermentor and aeration system were the same as in Example 6. The initial glucose concentrations of the medium were 60 g / L (baseline), 240 g / L, 300 g / L, 360 g / L, 420 g / L, and 480 g / L. The CYM modified medium in Example 6 with a reagent glucose concentration of 60 g / L (post-inoculation) was used as the reference medium composition. For media with other glucose concentrations, the concentrations of other medium components were increased in proportion to the increase in glucose concentration from the base medium composition (glucose concentration 60 g / L). 95 mL of each medium was prepared in each 250 mL fermentor. The test tube cultures were mixed, and 5 mL of the preculture was inoculated into each main fermentor. Batch culture at each sugar concentration was initiated. The pH, DO, and agitation speed were the same as in Example 6. The main culture continued for 192-360 hours.

[0065] Figures 26, 27, and 28 show the time course of dry cell weight, glucose concentration, and fat production for the IS-300 strain under each initial glucose concentration condition. Cell growth and fat production were observed over a glucose concentration range from 60 g / L to 420 g / L. No fat production was observed under a glucose concentration of 480 g / L. Figure 29 also shows the fat yield per sugar under each glucose concentration condition (relative to the value obtained when cultured at 60 g / L glucose).

Claims

1. A method of producing fats and oils, comprising culturing a yeast belonging to Leucosporidium golubevii in a medium containing sugar to produce fats and oils from the sugar, and collecting the fats and oilswherein the yeast belonging to Leucosporidium golubevii is Leucosporidium golubevii IS-300 (NITE BP-03675) strain.

2. The method for producing fats and oils according to claim 1, wherein the medium containing sugar is a medium containing saccharified product of lignocellulosic biomass.

3. The method of producing fats and oils according to claim 1, wherein the culture temperature is between 10C and 30C.

4. The method of producing fats and oils according to claim 1, wherein the culture temperature is 25C to 30C.

5. The method for producing fats and oils according to claim 1, wherein the sugar concentration is 50 g / L to 500 g / L.

6. The method for producing fats and oils according to claim 1, wherein the sugar concentration is 200 g / L to 500 g / L.

7. The method for producing fats and oils according to any one of claims 1-6, wherein the fats and oils are raw materials for biofuels, bionaphtha, food oil, lubricating oil, or surfactants.

8. Leucosporidium golubevii IS-300 (NITE BP-03675) strain.

Citation Information

Patent Citations

  • OKX067815

  • OMW710907

  • OAY212987