Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
Patent Information
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- F HOFFMANN LA ROCHE & CO AG
- Filing Date
- 2024-03-22
- Publication Date
- 2026-07-30
AI Technical Summary
Current therapies for chronic hepatitis B virus (HBV) infection, such as nucleos(t)ide analogues, are ineffective in significantly reducing HBsAg levels and do not address the immunosuppressive effects of HBV proteins like HBeAg, leading to persistent infection and immune dysfunction.
Development of novel nucleic acid molecules that target and inhibit both PAPD5 and PAPD7, which are associated with HBV antigen expression, allowing for simultaneous reduction of HBsAg and HBeAg secretion, thereby enhancing immune response and inhibiting chronic infection.
The nucleic acid molecules effectively inhibit HBV antigen expression, improving immune function and reducing the risk of chronic infection by targeting multiple pathways, offering a more comprehensive treatment approach than existing therapies.
Smart Images

Figure 00000033_0000 
Figure 00000147_0000 
Figure 00000149_0000
Abstract
Description
CROSS-REFERENCE TO RELATED APPLICATIONS The present application is a divisional application of Australian Patent Application No. 5 2021203300, which is a divisional application of Australian Patent No. 2018350693, which is the national phase of International Application No. PCT / EP2018 / 078136, which in turn claims the benefit of European Application No. EP 17196554.4, filed on 16 October 2017, and European Application No. EP 17208056.6, filed on 18 December 2017. The contents of each of the aforementioned applications are incorporated by cross reference in their entireties herein. 0 REFERENCE TO SEQUENCE LISTINGS Preceding applications contained a Sequence Listing which was originally submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy is 463 KB in size. The present application contains a Sequence Listing which has been submitted electronically as an XML document in the ST.26 format and is hereby incorporated by 15 reference in its entirety. Said XML copy, created on 18 January 2024, is named P0018346AUD2.xml and is 393 KB in size. FIELD OF THE INVENTION The present invention relates to nucleic acid molecules that are complementary to both PAP associated domain containing 5 (PAPD5) and PAP associated domain containing 7 (PAPD7), 20 leading to inhibition of the expression of both PAPD5 and PAPD7 when using a single oligonucleotide. The invention also provides for PAPD5 and PAPD7 specific nucleic acid molecules for use in treating and / or preventing a HBV infection, in particular a chronic HBV infection. Also comprised in the present invention is a pharmaceutical composition for use in the treatment and / or prevention of a HBV infection. 25 BACKGROUND HBV infection remains a major health problem worldwide which concerns an estimated 350 million chronic carriers. Approximately 25% of carriers die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second most significant carcinogen behind tobacco, causing from 60% to 80% of all primary liver cancer. HBV is 100 times more contagious than HIV. 30 The hepatitis B virus (HBV) is an enveloped, partially double-stranded DNA virus. The compact 3.2 kb HBV genome consists of four overlapping open reading frames (ORF), which encode for the core, polymerase (Pol), envelope and X-proteins. The Pol ORF is the longest and the envelope ORF is located within it, while the X and core ORFs overlap with the Pol ORF. The lifecycle of HBV has two main events: 1) generation of closed circular DNA (cccDNA) from 35 relaxed circular (RC DNA), and 2) reverse transcription of pregenomic RNA (pgRNA) to produce 2024201873 22 Mar 2024 __k RC DNA. Prior to the infection of host cells, the HBV genome exists within the virion as RC DNA. It has been determined that HBV virions are able to gain entry into host cells by non-specifically binding to the negatively charged proteoglycans present on the surface of human hepatocytes (Schulze, Hepatology, 46, (2007), 1759-68) and via the specific binding of HBV 5 surface antigens (HBsAg) to the hepatocyte sodium-taurocholate cotransporting polypeptide (NTCP) receptor (Yan, J Virol, 87, (2013), 7977-91). All HBV viral mRNAs are capped and polyadenylated, and then exported to the cytoplasm for translation. In the cytoplasm, the assembly of new virons is initiated and nascent pgRNA is packaged with viral Pol so that reverse transcription of pgRNA, via a single stranded DNA intermediate, into RC DNA can 0 commence. The secretion of antiviral cytokines in response to a HBV infection by the hepatocytes and / or the intra-hepatic immune cells plays a central role in the viral clearance of the infected liver. However, chronically infected patients only display a weak immune response due to various escape strategies adopted by the virus to counteract the host cell recognition systems and the 15 subsequent antiviral responses. 2024201873 22 Mar 2024 Many observations showed that several HBV viral proteins could counteract the initial host cellular response by interfering with the viral recognition signalling system and subsequently the interferon (IFN) antiviral activity. Among these, the excessive secretion of HBV empty sub-viral particles (SVPs, HBsAg) are thought to participate to the maintenance of the immunological 5 tolerant state observed in chronically infected patients (CHB). The persistent exposure to HBsAg and other viral antigens can lead to HBV-specific T-cell deletion or to progressive functional impairment (Kondo, Journal of Immunology (1993), 150, 4659-4671; Kondo, Journal of Medical Virology (2004), 74, 425-433; Fisicaro, Gastroenterology, (2010), 138, 682-93;). Moreover HBsAg has been reported to suppress the function of immune cells such as 0 monocytes, dendritic cells (DCs) and natural killer (NK) cells by direct interaction (Op den Brouw, Immunology, (2009b), 126, 280-9; Woltman, PLoS One, (2011), 6, e15324; Shi, J Viral Hepat. (2012), 19, e26-33; Kondo, ISRN Gasteroenterology, (2013), Article ID 935295). HBsAg quantification is a significant biomarker for prognosis and treatment response in chronic hepatitis B. However the achievement of HBsAg loss and seroconversion is rarely observed in 15 chronically infected patients but remains one of the ultimate goals of therapy. Current therapy such as Nucleos(t)ide analogues are molecules that inhibit HBV DNA synthesis but are not directed at reducing HBsAg level. Nucleos(t)ide analogs, even with prolonged therapy, only show weak HBsAg clearance comparable to those observed naturally (between -1%-2%) (Janssen, Lancet, (2005), 365, 123-9; Marcellin, N. Engl. J. Med., (2004), 351, 1206-17; Buster, 20 Hepatology, (2007), 46, 388-94). It was recently shown that completely or patially integrated hepatitis B virus DNA is a source of HBsAg expression in chronically infected individuals (see Wooddell et all 2017 Sci. Transl. Med. Vol 9, Issue 409, eaan0241). Hepatitis B e-antigen (also called HBV envelope antigen or HBeAg) is a viral protein that is secreted by hepatitis B infected cells. HBeAg is associated with chronic hepatitis B infections 25 and is used as a marker of active viral disease and a patient’s degree of infectiousness. The function of the hepatitis B virus precore or HBeAg is not completely known. However HBeAg is well known to play a key role in viral persistence. HBeAg is thought to promote HBV chronicity by functioning as an immunoregulatory protein. In particular, the HBeAg is a secreted accessory protein, which appears to attenuate the host immune response to the intracellular 30 nucleocapsid protein (Walsh, Virology, 2011, 411(1):132-141). The HBeAg acts as an immune tolerogen contributing to HBV persistence, and possibly functions in utero considering that soluble HBeAg traverses the placenta (Walsh, Virology, 2011,411(1):132-141). Furthermore, HBeAg downregulates: i) cellular genes controlling intracellular signaling; and ii) the Toll-like receptor 2 (TLR-2) to dampen the innate immune response to viral infection (Walsh, Virology, 35 2011, 411(1):132-141). In the absence of HBeAg, HBV replication is associated with upregulation of the TLR2 pathway (Walsh, Virology, 2011,411(1):132-141). Accordingly, HBeAg has a significant role in modulating virus / host interactions to influence the host immune 2024201873 22 Mar 2024 response (Walsh, Virology, 2011,411(1):132-141). Thus, reducing HBeAg in HBeAg positive patient population may lead to reversal of HBV specific immunedysfunction (Milich, 1997, J. Viral. Hep. 4: 48-59; Milich, 1998, J. Immunol. 160: 2013-2021). In addition, the secreted HBeAg is significantly more efficient than the intracellular hepatitis core antigen (HBeAg) at 5 eliciting T-cell tolerance, and the split T-cell tolerance between the HBeAg and the HBeAg and the clonal heterogeneity of HBc / HBeAg-specific T-cell tolerance may have significant implications for natural HBV infection and especially for precore-negative chronic hepatitis (Chen, 2005, Journal of Virology, 79: 3016-3027). Accordingly, reducing secretion of HBeAg in addition to secretion of HBsAg would lead to an 10 improved inhibition of development of a chronic HBV infection as compared to the inhibition of secretion of HBsAg alone. In addition, the highest rates of transmission of an acute infection to chronic (>80%) have been reported in cases of materno-fetal and neonatal HBV transmission from HBeAg-positive mothers (Liaw, Lancet, 2009, 373: 582-592; Liaw, Dig. Dis. Sci., 2010, 55: 2727-2734; and Hadziyannis, 2011, Journal of hepatology, 55: 183-191). Therefore, reducing 15 HBeAg in an expected mother may not only reduce the patient’s degree of infectiousness, but may also inhibit the development of a chronic HBV infection of her child. Therefore, in the therapy of HBV there is an unmet medical need to inhibit viral expression, particularly to inhibit secretion of HBsAg and HBeAg (Wieland, S. F. & F. V. Chisari. J Virol, (2005), 79, 9369-80; Kumar et al. J Virol, (2011), 85, 987-95; Woltman et al. PLoS One, (2011), 20 6, e15324; Op den Brouw et al. Immunology, (2009b), 126, 280-9). In WO 2017 / 066712 down regulation of PAPD5 in relation to the treatment and diagnosis of telomere diseases has been described. Five shRNA structures for this purpose have been described. PCT / EP2017 / 064980 discloses targeting PAPD5 or PAPD7 with a nucleic acid molecule and 25 the combination of such molecules to treatment HBV infections. OBJECTIVE OF THE INVENTION The present invention identifies novel nucleic acid molecules which are capable of inhibiting the expression of both PAPD5 and PAPD7 in vivo and in vitro. The ability to inhibit two target nucleic acids with a single molecule has distinct advantages in terms of production, simplicity of 30 delivery to the target cell, simplicity of pharmacokinetic / pharmacodynamic (PK / PD) and the concentration needed to achieve a therapeutic benefit. Furthermore the present invention shows that there is a correlation between the PAPD5 and PAPD7 knock down and the HBV antigen inhibition, such as HBsAg inhibition. 2024201873 22 Mar 2024 BRIEF DESCRIPTION OF THE FIGURES The Figures show: Figure 1: Illustrates exemplary antisense oligonucleotide conjugates, where the oligonucleotide either is represented as a wavy line (A-D) or as “oligonucleotide” (E-H) or as T2 (I) and the 5 asialoglycoprotein receptor targeting conjugate moieties are trivalent N-acetylgalactosamine moieties. Compounds A to D comprise a di-lysine brancher molecule, a PEG3 spacer and three terminal GalNAc carbohydrate moieties. In compound A and B the oligonucleotide is attached directly to the asialoglycoprotein receptor targeting conjugate moiety without a linker. In compound C and D the oligonucleotide is attached to the asialoglycoprotein receptor targeting 10 conjugate moiety via a C6 linker. Compounds E-l comprise a commercially available trebler brancher molecule and spacers of varying length and structure and three terminal GalNAc carbohydrate moieties. Figure 2: Structural formula of the trivalent GalNAc cluster (GN2). GN2 is useful as conjugation moiety in the present invention. The wavy line illustrates the site of conjugation of the cluster to 15 e.g. a C6 amino linker or directly to the oligonucleotide Figure 3: Shows the correlation between PAPD5 and PAPD7 knock down in Hela cells from example 1 with HBsAg reduction in dHepRG cells from example 2. Figure 4: Structural formula of CMP ID NO: 20_12. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being 20 associated with the compound. Figure 5: Structural formula of CMP ID NO: 20_13. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 6: Structural formula of CMP ID NO: 20_14. Pharmaceutical salts thereof include 25 monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 7: Structural formula of CMP ID NO: 20_15. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. 30 Figure 8: Structural formula of CMP ID NO: 20_18. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 9: Structural formula of CMP ID NO: 20_36. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being 35 associated with the compound. 2024201873 22 Mar 2024 Figure 10: Structural formula of CMP ID NO: 20_30. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 11: Representation of in vitro PAPD5 and PAPD7 reduction achieved with 5 oligonucleotides targeting the human and mouse transcripts (table 5) in the human HeLa cell line (A) and in primary mouse hepatocytes (PMH, B). Figure 12: Structural formula of CMP ID NO: 20_20. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. 10 Figure 13: Structural formula of CMP ID NO: 20_21. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 14: Structural formula of CMP ID NO: 21_2. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being 15 associated with the compound. Figure 15: Structural formula of CMP ID NO: 20_22. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 16: Structural formula of CMP ID NO: 21_33. Pharmaceutical salts thereof include 20 monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. Figure 17: Structural formula of CMP ID NO: 21_34. Pharmaceutical salts thereof include monovalent or divalent cations, such as Na+, K+, and Ca2+ or a mixture of these being associated with the compound. 25 Figure 18: Effect on HBsAg and HBeAg over time in vivo in the AAV / HBV mouse model following a single treatment with 10 mg / kg of two oligonucleotides one targeting PAPD5 and one targeting PAPD7. SUMMARY OF THE INVENTION Definitions 30 Nucleic acid molecule The term “nucleic acid molecule” or “therapeutic nucleic acid molecule” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides (i.e. a nucleotide sequence). The nucleic acid molecule(s) referred to in the method of the invention are generally therapeutic oligonucleotides below 50 2024201873 22 Mar 2024 nucleotides in length. The nucleic acid molecules may be or comprise an antisense oligonucleotide, or may be another oligomeric nucleic acid molecule, such as a CRISPR RNA, a siRNA, shRNA, an aptamer, or a ribozyme. Nucleic acid molecules are compositions that are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. 5 When referring to a sequence of the nucleic acid molecule, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The nucleic acid molecule of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The nucleic acid molecule of the invention may comprise one or more modified nucleosides or nucleotides. 10 In some embodiments, the nucleic acid molecule of the invention comprises or consists of 12 to 50 nucleotides in length, such as from 13 to 40, such as from 14 to 35, such as from 15 to 30, such as from 16 to 22, such as from 16 to 18 or 15 to 17 contiguous nucleotides in length. In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence thereof comprises or consists of 22 or less nucleotides, such as 20 or less nucleotides, such as 18 or 15 less nucleotides, such as 14, 15, 16 or 17 nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if a nucleic acid molecule is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included. In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides in length 20 The nucleic acid molecule(s) are for modulating the expression of a target nucleic acid in a mammal. In some embodiments the nucleic acid molecules, such as for siRNAs, shRNAs and antisense oligonucleotides, are typically for inhibiting the expression of a target nucleic acid(s). In one embodiment of the invention the nucleic acid molecule is selected from a RNAi agent, such as a siRNA or shRNA. In another embodiment the nucleic acid molecule is a single 25 stranded antisense oligonucleotide, such as a high affinity modified antisense oligonucleotide. In some embodiments the nucleic acid molecule is a phosphorothioate nucleic acid molecule. In some embodiments the nucleic acid molecule comprises phosphorothioate internucleoside linkages. In some embodiments the nucleic acid molecule may be conjugated to non-nucleosidic moieties 30 (conjugate moieties). A library of nucleic acid molecules is to be understood as a collection of variant nucleic acid molecules. The purpose of the library of nucleic acid molecules can vary. In some embodiments, the library of nucleic acid molecules is composed of oligonucleotides with overlapping nucleobase sequence targeting a region in common between the PAPD5 and 35 PAPD7 target nucleic acids with the purpose of identifying the most potent sequence within the library of nucleic acid molecules. In some embodiments, the library of nucleic acid molecules is 2024201873 22 Mar 2024 a library of nucleic acid molecule design variants (child nucleic acid molecules) of a parent or ancestral nucleic acid molecule, wherein the nucleic acid molecule design variants retaining the core nucleobase sequence of the parent nucleic acid molecule. Oligonucleotide 5 The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made 10 to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides. Antisense oligonucleotides 15 The term “Antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. The term single stranded is 20 generally understood by the skilled person in the art. Especially it is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self complementarity is less than 50% across of the full length of the oligonucleotide. 25 In one embodiment of the invention the antisense oligonucleotide is an RNaseH recruiting oligonucleotide. Contrary to RNAi molecules antisense oligonucleotides also act in the nucleous of the cell. For targeting pre-mRNA sequences and antisense oligonucleotide is preferable since it acts in the nucleus of the cell. RNAi 30 Herein, the term “RNA interference (RNAi) molecule” refers to short double-stranded RNA molecule capable of inducing RNA-dependent gene silencing via the RNA-induced silencing complex (RISC) in a cell's cytoplasm, where they interact with the catalytic RISC component argonaute. One type of RNAi molecule is a small interfering RNA (siRNA), which is a doublestranded RNA molecule that, by binding complementary mRNA after transcription, leads to their 35 degradation and loss in translation. A small hairpin RNA (shRNA) is an artificial RNA molecule with a hairpin structure which upon expression is able to reduce mRNA via the DICER and RNA 2024201873 22 Mar 2024 reducing silencing complex (RISC). RNAi molecules can be designed on the base of the RNA sequence of the gene of interest. Corresponding RNAi can then be synthesized chemically or by in vitro transcription, or expressed from a vector or PCR product siRNA and shRNA molecules are generally between 20 and 50 nucleotides in length, such as 5 between 25 and 35 nucleotides in length, and interacts with the endonuclease known as Dicer which is believed to processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs which are then incorporated into an RNA-induced silencing complex (RISC). Effective extended forms of Dicer substrates have been described in US 8,349,809 and US 8,513,207, hereby incorporated by reference. Upon binding to the 10 appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing. RNAi agents may be chemically modified using modified internucleotide linkages and high affinity nucleosides, such as 2‘-4‘ bicyclic ribose modified nucleosides, including LNA and cET. Contiguous Nucleotide Sequence 15 The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide 20 sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. Nucleotides Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the 25 purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”. 30 Modified nucleoside The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In a preferred embodiment the modified nucleoside comprise a modified sugar moiety. The term modified 35 nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar 2024201873 22 Mar 2024 moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing. Modified internucleoside linkage 5 The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed “modified nucleotides”. In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the nucleic acid molecules of the invention compared to a 10 phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides as well as siRNA’s for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide or siRNA of the invention, for example within the gap 15 region of a gapmer oligonucleotide, as well as in regions of modified nucleosides. In an embodiment, the nucleic acid molecule, e.g. antisense oligonucleotide, shRNA or siRNA, comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is for example more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance 20 assay (e.g. snake venom phosphodiesterase (SVPD), both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages. In some embodiments at least 50% of the internucleoside linkages in the antisense oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%, such as at least 25 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, 30 such as a conjugate, may be phosphodiester. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages. Modified internucleoside linkages may be selected from the group comprising phosphorothioate, diphosphorothioate and boranophosphate. In some embodiments, the modified internucleoside 35 linkages are compatible with the RNaseH recruitment of the oligonucleotide of the invention, for example phosphorothioate, diphosphorothioate or boranophosphate. 2024201873 22 Mar 2024 In some embodiments the internucleoside linkage comprises sulphur (S), such as a phosphorothioate internucleoside linkage. A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmakokinetics and ease of manufacture. In some embodiments at least 50% of 5 the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are 10 phosphorothioate. In some embodiments at least one of the phosphorothioate internucleoside linkages is stereodefined, such as at least 20%, 30%, 40%, 50%, 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide are stereo defined. The synthesis of stereodefined phosphorothiate linkages are for example described in WO2014 / 012081 and WO2016 / 079181. 15 In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester, methylphosphonate, MMI, amide-3, formacetal or thioformacetal. Further internucleoside linkages are disclosed in WO2009 / 124238 (incorporated herein by reference). In an embodiment the internucleoside linkage is selected from linkers disclosed in 20 WO2007 / 031091 (incorporated herein by reference). Particularly, the internucleoside linkage may be selected from -O-P(O)2-O-, -O-P(O,S)-O-, -O-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -O-P(O)2-S-, -O-P(O,S)-S-, -S-P(O)2-S-, -O-PO(RH)-O-, 0-PO(OCH3)-0-, -O-PO(NRh)-O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHRH)-O-, -O-P(O)2-NRH-, -NRH-P(O)2-O-, -NRH-CO-O-, -NRH-CO-NRH-, and / or the internucleoside linker may be selected form the group 25 consisting of: -O-CO-O-, -O-CO-NRH-, -NRH-CO-CH2-, -O-CH2-CO-NRH-, -O-CH2-CH2-NRH-, -CO-NRH-CH2-, -CH2-NRhCO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NRh-, -O-CH2-CH2-NRh-CO -, -CH2-NCH3-O-CH2-, where RH is selected from hydrogen and C1 -4-alkyL Nuclease resistant linkages, such as phosphothioate linkages, are particularly useful in 30 antisense oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region of headmers and tailmers. Phosphorothioate linkages may, however, also be useful in nonnuclease recruiting regions and / or affinity enhancing regions such as regions F and F’ for gapmers, or the modified nucleoside region of headmers and tailmers. 35 Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of 2024201873 22 Mar 2024 phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and / or bio-distribution of an oligonucleotide - see WO2008 / 113832, incorporated herein by reference. 5 In an embodiment all the internucleoside linkages in the antisense oligonucleotide are phosphorothioate and / or boranophosphate linkages. Preferably, all the internucleoside linkages in the oligonucleotide are phosphorothioate linkages. Stereorandom Phosphorothioate Linkages Phosphorothioate linkages are internucleoside phosphate linkages where one of the non-0 bridging oxygens has been substituted with a sulfur. The substitution of one of the non-bridging oxygens with a sulfur introduces a chiral center, and as such within a single phosphorothioate oligonucleotide, each phosphorothioate internucleoside linkage will be either in the S (Sp) or R (Rp) stereoisoforms. Such internucleoside linkages are referred to as “chiral internucleoside linkages”. By comparison, phosphodiester internucleoside linkages are non-chiral as they have 15 two non-terminal oxygen atoms. The designation of the chirality of a stereocenter is determined by standard Cahn- Ingold-Prelog rules (CIP priority rules) first published in Cahn, R.S.; Ingold, C.K.; Prelog, V. (1966). "Specification of Molecular Chirality". Angewandte Chemie International Edition. 5 (4): 385-415. doi:10.1002 / anie.196603851. 20 During standard oligonucleotide synthesis the stereoselectivity of the coupling and the following sulfurization is not controlled. For this reason the stereochemistry of each phosphorothioate internucleoside linkages is randomly Sp or Rp, and as such a phosphorothioate oligonucleotide produced by traditional oligonucleotide synthesis actually can exist in as many as 2X different phosphorothioate diastereoisomers, where X is the number of phosphorothioate internucleoside 25 linkages. Such oligonucleotides are referred to as stereorandom phosphorothioate oligonucleotides herein, and do not contain any stereodefined internucleoside linkages. Stereorandom phosphorothioate oligonucleotides are therefore mixtures of individual diastereoisomers originating from the non-stereodefined synthesis. In this context the mixture is defined as up to 2X different phosphorothioate diastereoisomers. 30 Stereodefined Internucleoside Linkages A stereodefined internucleoside linkage is an internucleoside linkage which introduces a chiral center into the oligonucleotide, which exists in predominantly one stereoisomeric form, either R or S within a population of individual oligonucleotide molecules. It should be recognized that stereoselective oligonucleotide synthesis methods used in the art 35 typically provide at least about 90% or at least about 95% stereoselectivity at each 2024201873 22 Mar 2024 internucleoside linkage stereocenter, and as such up to about 10%, such as about 5% of oligonucleotide molecules may have the alternative stereo isomeric form. In some embodiments the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 90%. In some embodiments the stereoselectivity of each 5 stereodefined phosphorothioate stereocenter is at least about 95%. Stereodefined phosphorothioate linkages Stereodefined phosphorothioate linkages are phosphorothioate linkages which have been chemically synthesized in either the Rp or Sp configuration within a population of individual oligonucleotide molecules, such as at least about 90% or at least about 95% stereoselectivity at 0 each stereocenter (either Rp or Sp), and as such up to about 10%, such as about 5% of oligonucleotide molecules may have the alternative stereo isomeric form. The stereo configurations of the phosphorothioate internucleoside linkages are presented below R 3' R 3' o o s J s ■ ^p.. He / '"'o HOZ o \ 5' \ 5' SP R RP R Where the 3’ R group represents the 3’ position of the adjacent nucleoside (a 5’ nucleoside), and 15 the 5’ R group represents the 5’ position of the adjacent nucleoside (a 3’ nucleoside). Rp internucleoside linkages may also be represented as srP, and Sp internucleoside linkages may be represented as ssP herein. In some embodiments the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 97%. In some embodiments the stereoselectivity of each 20 stereodefined phosphorothioate stereocenter is at least about 98%. In some embodiments the stereoselectivity of each stereodefined phosphorothioate stereocenter is at least about 99%. In some embodiments a stereoselective internucleoside linkage is in the same stereoisomeric form in at least 97%, such as at least 98%, such as at least 99%, or (essentially) all of the oligonucleotide molecules present in a population of the oligonucleotide molecule. 25 Stereoselectivity can be measured in a model system only having an achiral backbone (i.e. phosphodiesters) it is possible to measure the stereoselectivity of each monomer by e.g. coupling a stereodefined monomer to the following model-system “5’ t-po-t-po-t-po 3”’. The result of this will then give : 5’ DMTr-t-srp-t-po-t-po-t-po 3’ or 5’ DMTr-t-ssp-t-po-t-po-t-po 3’ 2024201873 22 Mar 2024 which can be separated using HPLC. The stereoselectivity is determined by integrating the UV signal from the two possible compounds and giving a ratio of these e.g. 98:2, 99:1 or >99:1. It will be understood that the stereo % purity of a specific single diastereoisomer (a single stereodefined oligonucleotide molecule) will be a function of the coupling selectivity for the 5 defined stereocenter at each internucleoside position, and the number of stereodefined internucleoside linkages to be introduced. By way of example, if the coupling selectivity at each position is 97%, the resulting purity of the stereodefined oligonucleotide with 15 stereodefined internucleoside linkages will be 0.9715, i.e. 63% of the desired diastereoisomer as compared to 37% of the other diastereoisomers. The purity of the defined diastereoisomer may after 10 synthesis be improved by purification, for example by HPLC, such as ion exchange chromatography or reverse phase chromatography. In some embodiments, a stereodefined oligonucleotide refers to a population of an oligonucleotide wherein at least about 40%, such as at least about 50% of the population is of the desired diastereoisomer. 15 Alternatively stated, in some embodiments, a stereodefined oligonucleotide refers to a population of oligonucleotides wherein at least about 40%, such as at least about 50%, of the population consists of the desired (specific) stereodefined internucleoside linkage motif (also termed stereodefined motif). For stereodefined oligonucleotides which comprise both stereorandom and stereodefined 20 internucleoside stereocenters, the purity of the stereodefined oligonucleotide is determined with reference to the % of the population of the oligonucleotide which retains the defined stereodefined internucleoside linkage motif(s), the stereorandom linkages are disregarded in the calculation. Nucleobase 25 The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” 30 refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1. In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine 35 into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo- 2024201873 22 Mar 2024 cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2’thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine. The nucleobase moieties may be indicated by the letter code for each corresponding 5 nucleobase, e.g. A, T, G, C or II, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used. Modified oligonucleotide 10 The term modified oligonucleotide or modified nucleic acid molecule describes an oligonucleotide or nucleic acid molecule comprising one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term “chimeric” is a term that has been used in the literature to describe oligonucleotides or nucleic acid molecules with modified nucleosides, in particular gapmer oligonucleotides. 15 Stereodefined Oligonucleotide A stereodefined oligonucleotide is an oligonucleotide wherein at least one of the internucleoside linkages is a stereodefined internucleoside linkage. A stereodefined phosphorothioate oligonucleotide is an oligonucleotide wherein at least one of the internucleoside linkages is a stereodefined phosphorothioate internucleoside linkage. 20 Stereodefined Internucleoside Motif A stereodefined internucleoside motif, also termed stereodefined motif herein, refers to the pattern of stereodefined R and S internucleoside linkages in a stereodefined oligonucleotide, and is written 5’ - 3’. For example, the stereodefined oligonucleotide 5 -TsrP CssP AssP 8srP CsrP tssP tsrP tsrP CssP 3srP CssP tsrP tssP CssP AssP G-3 (SEQ ID NO 1 8), 25 has a stereodefined internucleoside motif of RSSRRSRRSRSRSSS. With respect to sub-libraries of stereodefined oligonucleotides, these will contain a common stereodefined internucleoside motif in an otherwise stereorandom background (optionally with one or more non chiral internucleoside linkages, e.g. phosphodiester linkages). For example, the oligonucleotide 30 5 -Ts Cs As 8s CsrP tssP tssP tsrP Cs Os Cs ts tsCsAsG-3 (SEQ ID NO 18) has a stereodefined internucleoside motif of XXXXRSSRXXXXXXX, with X representing a stereorandom phosphorothioate internucleoside linkage (shown as subscript s in the compound). It will be noted that in this example the first 5’ stereodefined internucleoside linkage is the 5th internucleoside linkage from the 5’ end (between the nucleosides at position 4 2024201873 22 Mar 2024 and 5), and as such the above motif is also referred to as a “RSSR” motif at (internucleoside linkage) position 5. When the stereodefined internucleoside motif (stereodefined motif) is made up on a series of adjacent stereodefined internucleoside linkages (i.e. positioned between contiguous 5 nucleosides), it is referred to herein as a contiguous stereodefined internucleoside motif (a contiguous stereodefined motif). It will be understood that a contiguous stereodefined motif must comprise two or more adjacent stereodefined internucleoside linkages. In a sub-library mixture, a stereodefined internucleoside motif may also be dis-contiguous, i.e. the stereodefined internucleoside linkages are dispersed with one or more stereorandom 10 internucleoside linkages. For example the compound 5 -Ts CssP As8s CsrP tssP ts ts Cs Os Cs ts tssP CsrP AssP G_3 (SEQ ID NO 18) has a dis-contiguous motif XSXXRSXXXXXXSRS. Parent Oligonucleotide 15 A parent oligonucleotide is an oligonucleotide which has a defined nucleobase sequence (motif sequence). In the methods of the invention, a parent oligonucleotide is typically an oligonucleotide which is to be improved by the use of the method of the invention by creating one or more libraries. Typically a library can vary the nucleoside modifications (design libraries) while maintaining the 20 nucleobase sequence of the parent and the stereochemistry (typically stereorandom). Alternative a library can vary the stereochemistry of the parent oligonucleotide while maintaining the nucleobase sequence (motif sequence) and nucleoside modification pattern (design). In such a library the stereochemistry of one, or more (2+), of the internucleoside linkages is stereodefined and is different to that of the parent oligonucleotide. 25 In some embodiments, the parent oligonucleotide is a stereorandom phosphorothioate oligonucleotide. In some embodiments, the parent oligonucleotide is a stereorandom phosphorothioate oligonucleotide gapmer. In some embodiments, the parent oligonucleotide may be a sub-library which comprises a common stereodefined motif. 30 Stereodefined Variants (Child Oligonucleotides) A stereodefined variant of an oligonucleotide is an oligonucleotide which retain the same sequence and nucleoside modifications as a parent oligonucleotide (i.e. the same sequence and nucleoside modification chemistry and design), but differs with respect to one or more 2024201873 22 Mar 2024 stereodefined internucleoside linkages, such as one or more stereodefined phosphorothioate internucleoside linkages (a stereodefined phosphorothioate variant). A stereodefined variant may be a sub-library, or may be a fully stereodefined oligonucleotide. Sub-Library of stereodefined oligonucleotides 5 An oligonucleotide which comprises both stereorandom and stereodefined oligonucleotides is referred to herein as a sub-library. Sub-libraries are less complex mixtures of the diastereoisomeric mixture of a fully stereorandom oligonucleotide thus representing a sub-set of all possible diastereoisomers. For example, theoretically, a fully phosphorothioate stereorandom 16mer is a mixture of 215 diastereoisomer (32768), whereas a sub-library where 0 one of the phosphorothioate internucleoside linkages is stereodefined will have half the library complexity (16384 diastereoisomer), (2 stereodefined linkages = 8192 diastereoisomer; 3 stereodefined linkages = 4096 diastereoisomer, 4 stereodefined linkages = 2048 diastereoisomer, 5 stereodefined linkages = 1024 diastereoisomer) assuming 100% stereoselective coupling efficacy. 15 Fully Stereodefined Oligonucleotides A fully stereodefined oligonucleotide is an oligonucleotide wherein all the chiral internucleoside linkages present within the oligonucleotide are stereodefined. A fully stereodefined phosphorothioate oligonucleotide is an oligonucleotides wherein all the chiral internucleoside linkages present within the oligonucleotide are stereodefined phosphorothioate internucleoside 20 linkages. It will be understood that, in some embodiments, a fully stereodefined oligonucleotide may comprise one or more, non-chiral internucleosides, such as phosphodiester internucleoside linkages, for example phosphodiester linkages can be used within the flanking regions of gapmers, and / or when linking terminal nucleosides, such as between short regions of DNA 25 nucleosides (biocleavable linker) linking a gapmer sequence and a conjugate group. In some embodiments of fully stereodefined oligonucleotide, all of the internucleoside linkages present in the oligonucleotide, or contiguous nucleotide region thereof, such as an F-G-F’ gapmer, are stereodefined internucleoside linkages, such as stereodefined phosphorothioate internucleoside linkages. 30 Complementarity The term “complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T) / uracil (II). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, 35 and as such the term complementarity encompasses Watson Crick base-paring between nonmodified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical 2024201873 22 Mar 2024 Research vol. 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1). The term “% complementary” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a 5 given position, are complementary to ( / .e. form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences (when aligned with the target sequence 5’-3’ and the oligonucleotide sequence from 3’-5’), dividing by the total number of nucleotides in the 10 oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which does not align (form a base pair) is termed a mismatch. Preferably, insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. The term “fully complementary”, refers to 100% complementarity. The following is an example of an oligonucleotide (SEQ ID NO: 12) that is fully complementary 15 to a region of a target nucleic acid. 759 ctgtggatgcagatctgggaga 781 (Pos. 759-781 of SEQ ID NO: 1) ii ii i! ii Him ii 1 -3'-ACCTACGTCTAGACCC-5'---16 (SEQ ID NO: 12) Identity 20 The term “Identity” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are identical to (i.e. in their ability to form Watson Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting 25 the number of aligned bases that are identical between the two sequences dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent Identity = (Matches x 100) / Length of aligned region. Preferably, insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. Hybridization 30 The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are 35 duplexed with the target nucleic acid. At physiological conditions Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003,Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the 2024201873 22 Mar 2024 dissociation constant (Kd) of the reaction by △G°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where 5 aqueous concentrations are 1M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965,C / ?em. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that 10 commercial equipment is available forAG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto etal., 1995, Biochemistry 34:11211-11216 and McTigue etal., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic 15 acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated AG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of-10 kcal, such as below -15 kcal, 20 such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG° value of-10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or-16 to -27 kcal such as -18 to -25 kcal. Target nucleic acid 25 According to the present invention, there are two target nucleic acids which are to be modulated by the same oligonucleotide. The target nucleic acids are i) a nucleic acid which encodes mammalian PAPD5 (target nucleic acid 1) and ii) a nucleic acid which encodes mammalian PAPD7 (target nucleic acid 2). The target nucleic acids may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. Suitably, the target nucleic acid 30 encodes a PAPD5 or PAPD7 protein, in particular mammalian PAPD5 or PAPD7, such as human PAPD5 or PAPD7 (See for example table 1 and 2) which provides the pre-mRNA sequences for human, monkey, and mouse PAPD5 and PAPD7). In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 3 and / or 5 naturally occurring variants thereof (e.g. sequences encoding a mammalian 35 PAPD5). 2024201873 22 Mar 2024 In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 2, 4, and / or 6 or 11 or naturally occurring variants thereof (e.g. sequences encoding a mammalian PAPD7). Table 1A. Genome and assembly information for PAPD5 across species. Species Chr. Ban d Stra nd Genomic coordinates Start End ensembl_gene_id Assembly Human 16 q12. 1 fwd 50152918 50235310 ENSG00000121274 GRCh38.p7 Cynomol gus monkey 20 fwd 37953893 38040642 RefSeq ID: NC_022291.1 Macaca_fasc icularis_5.0 (GCF_00036 4345.1) mouse 8 C3 fwd 88199213 88259722 ENSMUSG00000036779 GRCm38.p5 Rat 19 p11 rev 19771677 19832812 ENSRNOG00000024212 Rnor_6.0 Table 1B. Genome and assembly information for PAPD7 across species. Species Chr Ban d Stra nd Genomic coordinates Start End ensembl_gene_id Assembly Human 5 p15. 31 fwd 6713007 6757048 ENSG00000112941 GRCh38.p7 Cynomol gus monkey 6 fwd 6740764 6790723 RefSeq NC_022277.1 Macaca_fascic ularis_5.0 (GCF_000364 345.1) mouse 13 B3 rev 69497959 69534617 ENSMUSG00000034575 GRCm38.p5 Rat 1 p11 fwd 36400443 36433238 ENSRNOG00000017613 Rnor_6.0 Fwd = forward strand. Rev= reverse strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). If employing the oligonucleotide of the invention in research or diagnostics the target nucleic 10 acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA. For in vivo or in vitro application, the oligonucleotide of the invention is typically capable of inhibiting the expression of the PAPD5 and PAPD7 target nucleic acid in a cell which is expressing the PAPD5 and PAPD7 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary a conserved 15 region of the PAPD5 and PAPD7 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D’ or D”). Further information on exemplary target nucleic acids is provided in table 2. 20 Table 2. Sequence details for PAPD5 and PAPD7 across species. Species Target RNA type Length (nt) SEQ ID NO Human PAPD5 Pre-mRNA 82393 1 Human PAPD7 Pre-mRNA 44042 2 Species Target RNA type Length (nt) SEQ ID NO Cyno monkey PAPD5 Pre-mRNA 86750 3 Cyno monkey PAPD7 Pre-mRNA 49960 4 Mouse PAPD5 Pre-mRNA 60510 5 Mouse PAPD7 Pre-mRNA 36659 6 2024201873 22 Mar 2024 Target Sequence The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide or nucleic acid molecule of the invention. In some embodiments, the target 5 sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention (i.e. a sub-sequence). In the present invention the target sequence is present both in the human PAPD5 and human PAPD7 target nucleic acid. The target sequence may therefore be referred to as a bispecific target sequence present in both the PAPD5 and PAPD7 target nucleic acid. In advantageous 10 embodiments the target sequence is also present in at least one additional species, such as PAPD5 and PAPD7 from cynomolgus monkey, and / or PAPD5 and PAPD7 from mouse. The oligonucleotide or nucleic acid molecule of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to a region on the target nucleic acid, such as a target sequence described herein. 15 The target nucleic sequence to which the oligonucleotide is complementary to or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous nucleotide sequence is between 10 to 50 nucleotides, such as 12-30, such as 13 to 25, such as 14 to 20, such as 15 to 18 contiguous nucleotides. Naturally occurring variant 20 The term “naturally occurring variant” refers to variants of PAPD5 or PAPD7 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient 25 complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof. In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian PAPD5 target nucleic acid, such as a target nucleic acid selected form the group consisting of SEQ ID NO: 1, 3 or 5. In some embodiments the 30 naturally occurring variants have at least 99% homology to the human PAPD5 target nucleic acid of SEQ ID NO: 1. In some embodiments the naturally occurring variants are the polymorphisms listed in table 3A. In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian PAPD5 target nucleic acid, such as a target nucleic 5 acid selected form the group consisting of SEQ ID NO: 2 or 4 or 6. In some embodiments the naturally occurring variants have at least 99% homology to the human PAPD7 target nucleic acid of SEQ ID NO: 2. In some embodiments the naturally occurring variants are the polymorphisms listed in table 3B. Numerous single nucleotide polymorphisms are known in the PAPD5 or PAPD7 gene, for 10 example those disclosed in Table 3A (human PAPD5 premRNA start / reference sequence is SEQ ID NO: 1) and Table 3B human PAPD7 premRNA start / reference sequence is SEQ ID NO: 2)- 2024201873 22 Mar 2024 Table 3A: PAPD5 polymorphisms (naturally occurring variants) minor allele Minor allele frequency Start on SEQ ID NO: 1 G 0,00399361 29 G 0,000199681 34 T 0,000399361 39 A 0,000599042 62 A 0,000599042 97 G 0,000199681 141 A 0,000199681 142 T 0,000199681 158 A 0,0241613 235 A 0,00239617 279 - 0,214058 370 G 0,000798722 450 CAGCA 0,000798722 603 A 0,0223642 1028 C 0,000199681 1044 A 0,0189696 1068 T 0,000199681 1181 T 0,0249601 1199 T 0,000998403 1258 A 0,000199681 1261 T 0,000599042 1441 T 0,000199681 1443 C 0,000599042 1469 A 0,000399361 1535 15 Table 3B: PAPD7 polymorphisms (naturally occurring variants) minor allele Minor allele frequency Start on SEQ ID NO: 2 A 0,293331 21 T 0,00119808 50 T 0,000199681 64 2024201873 22 Mar 2024 minor allele Minor allele frequency Start on SEQ ID NO: 2 A 0,00279553 127 A 0,0597045 224 G 0,000199681 234 T 0,000599042 270 A 0,128994 284 C 0,000399361 316 T 0,000199681 349 G 0,00778754 362 A 0,000199681 409 G 0,000199681 425 A 0,000199681 448 T 0,000199681 473 C 0,000199681 491 C 0,327676 564 T 0,0203674 606 - 0,389577 837 - 0,00139776 1317 T 0,000599042 1331 T 0,000199681 1475 T 0,000399361 1483 C 0,01877 1673 A 0,000199681 1682 T 0,00339457 1726 GGTCCTGGCCGGCGCCCGC 0,258586 1736 G 0,000599042 1760 C 0,000199681 1777 G 0,000399361 1780 T 0,000199681 1852 T 0,000199681 1861 T 0,000199681 1889 C 0,000399361 1923 G 0,000399361 1962 T 0,0147764 1987 G 0,000998403 1996 T 0,000399361 2036 Modulation of expression The term “modulation of expression” as used herein is to be understood as an overall term for a nucleic acid molecules ability to alter the amount of PAPD5 and PAPD7 when compared to the amount of PAPD5 and PAPD7 before administration of the nucleic acid molecule. Alternatively, 5 modulation of expression may be determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting or nucleic acid molecule (mock). It may however also be an individual treated with the standard of care. One type of modulation is a nucleic acid molecules, such as an antisense oligonucleotides, 10 ability to inhibit, down-regulate, reduce, remove, stop, prevent, lessen, lower, avoid or terminate expression of PAPD5 and PAPD7, e.g. by degradation of mRNA or blockage of transcription. 2024201873 22 Mar 2024 High affinity modified nucleosides A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of 5 the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2’ sugar modified nucleosides, such as 2’ substituted nucleosides like Ome and MOE as well as 2’ to 4’ bridged nucleic acids such as locked nucleic acids (LNA) 10 (see e.g. Freier & Altmann; NucL Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213). Sugar modifications The nucleic acid molecule of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose 15 sugar moiety found in DNA and RNA. Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of nucleic acid molecules, such as affinity and / or nuclease resistance. Such modifications include those where the ribose ring structure is modified, e.g. by 20 replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides where the 25 sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids. Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the -OH groups naturally found in RNA or DNA nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions. 30 2’ sugar modified nucleosides. A 2’ sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2’ position (2’ substituted nucleoside) or comprises a 2’ linked biradicle capable of forming a bridge between the 2’ carbon and a second carbon in the ribose ring, such as LNA (2’ - 4’ biradicle bridged) nucleosides. 35 Indeed, much focus has been spent on developing 2’ substituted nucleosides, and numerous 2’ substituted nucleosides have been found to have beneficial properties when incorporated into 2024201873 22 Mar 2024 oligonucleotides. For example, the 2’ modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the oligonucleotide. Examples of 2’ substituted modified nucleosides are 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside. For further examples, 5 please see e.g. Freier & Altmann; NucL Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2’ substituted modified nucleosides. och3 r-o-Me fF-RNA 10 In relation to the present invention 2’ substituted does not include 2’ bridged molecules like LNA. Locked Nucleic Acid Nucleosides (LNA). An “LNA nucleoside” is 2’-sugar modified nucleoside which comprises a biradical linking the C2’ and C4’ of the ribose sugar ring of a said nucleoside (also referred to as a “2’- 4’ bridge”), which 15 restricts or locks the conformation of the ribose ring. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the 20 oligonucleotide / complement duplex. In some embodiments, the 2’-sugar modified nucleoside(s) or the LNA nucleoside(s) of the oligomer of the invention has a general structure of the formula I or II: 2024201873 22 Mar 2024 Formula I Formula II wherein W is selected from -O-, -S-, -N(Ra)-, -C(RaRb)-, such as, in some embodiments -O-; B designates a nucleobase or modified nucleobase moiety; 5 Z designates an internucleoside linkage to an adjacent nucleoside, or a 5'-terminal group; Z* designates an internucleoside linkage to an adjacent nucleoside, or a 3'-terminal group; X designates a group selected from the list consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z In some embodiments, X is selected from the group consisting of: -0-, -S-, NH-, NRaRb, -CH2-, 10 CRaRb, -C(=CH2)-, and -C(=CRaRb)- In some embodiments, X is -O Y designates a group selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z In some embodiments, Y is selected from the group consisting of: -CH2-, -C(RaRb)-, -CH2CH2-, 15 -C(RaRb)-C(RaRb)-, -CH2CH2CH2-, -C(RaRb)C(RaRb)C(RaRb)-, -C(Ra)=C(Rb)-, and -C(Ra)=N- In some embodiments, Y is selected from the group consisting of: -CH2-, -CHRa-, -CHCH3-, CRaRb- or -X-Y- together designate a bivalent linker group (also referred to as a radicle) together designate a bivalent linker group consisting of 1, 2, 3 or 4 groups / atoms selected from the group 20 consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z, In some embodiments, -X-Y- designates a biradicle selected from the groups consisting of: -X-CH2-, -X-CRaRb-, -X-CHRa', -X-C(HCH3)-, -O-Y-, -O-CH2-, -S-CH2-, -NH-CH2-, -O-CHCH3-, -CH2-O-CH2, -O-CH(CH3CH3)-, -o-ch2-ch2-, och2-ch2-ch2-,-o-ch2och2-, -O-NCH2-, -C(=CH2)-CH2-, -NRa-CH2-, N-O-CH2, -S-CRaRb- and -S-CHRa-. 25 In some embodiments -X-Y- designates -O-CH2- or -O-CH(CH3)-. wherein Z is selected from -0-, -S-, and -N(Ra)-, and Ra and, when present Rb, each is independently selected from hydrogen, optionally substituted Ci-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, optionally substituted Ci-6-alkoxy, C2.6-alkoxyalkyl, C2.6-alkenyloxy, carboxy, C1-6- 2024201873 22 Mar 2024 alkoxycarbonyl, C-i-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(Ci-6-alkyl)amino, carbamoyl, mono- and di(Ci-6-alkyl)-amino-carbonyl, amino-C-i-6-alkyl-aminocarbonyl, mono- and di(Ci-6-alkyl)amino-Ci-6-alkyl-aminocarbonyl, Ci-6-alkyl- 5 carbonylamino, carbamido, Ci-6-alkanoyloxy, sulphono, Ci-6-alkylsulphonyloxy, nitro, azido, sulphanyl, Ci-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents Ra and Rb together may designate optionally substituted methylene (=CH2), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation. 10 wherein R1, R2, R3, R5 and R5* are independently selected from the group consisting of: hydrogen, optionally substituted Ci-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, Ci-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6-alkoxycarbonyl, Ci-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(Ci-6- 15 alkyl)amino, carbamoyl, mono- and di(Ci-6-alkyl)-amino-carbonyl, amino-Ci-6-alkyl-aminocarbonyl, mono- and di(Ci-6-alkyl)amino-Ci-6-alkyl-aminocarbonyl, Ci-6-alkyl-carbonylamino, carbamido, Ci-6-alkanoyloxy, sulphono, Ci-6-alkylsulphonyloxy, nitro, azido, sulphanyl, Ci-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally 20 substituted methylene. In some embodiments R1, R2, R3, R5 and R5* are independently selected from C1-6 alkyl, such as methyl, and hydrogen. In some embodiments R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments R1, R2, R3, are all hydrogen, and either R5 and R5* is also hydrogen and 25 the other of R5 and R5*is other than hydrogen, such as Ci-6 alkyl such as methyl. In some embodiments, Ra is either hydrogen or methyl. In some embodiments, when present, Rb is either hydrogen or methyl. In some embodiments, one or both of Ra and Rb is hydrogen In some embodiments, one of Ra and Rb is hydrogen and the other is other than hydrogen 30 In some embodiments, one of Ra and Rb is methyl and the other is hydrogen In some embodiments, both of Ra and Rb are methyl. In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO99 / 014226, WO00 / 66604, WO98 / 039352 and WO2004 / 046160 which are all hereby incorporated by reference, and 35 include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides. 2024201873 22 Mar 2024 In some embodiments, the biradicle -X-Y- is -S-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160 which are hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -NH-CH2-, W is O, and all of R1, R2, R3, R5 and R5* 5 are all hydrogen. Such amino LNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160 which are hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -O-CH2-CH2- or -O-CH2-CH2- CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO00 / 047599 and Morita et al, Bioorganic & Med.Chern. Lett. 12 73-76, which are hereby 10 incorporated by reference, and include what are commonly known as 2’-O-4’C-ethylene bridged nucleic acids (ENA). In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such 5’ substituted LNA nucleosides are disclosed in WO2007 / 134181 which 15 is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -O-CRaRb-, wherein one or both of Ra and Rb are other than hydrogen, such as methyl, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such bis modified LNA nucleosides are disclosed in WO2010 / 077578 which is hereby 20 incorporated by reference. In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH2OCH3)- (2’ O-methoxyethyl bicyclic nucleic acid - Seth at aL, 2010, J. Org. Chern. Vol 75(5) pp. 1569-81). In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH2CH3)- (2’0-ethyl bicyclic nucleic acid - Seth at aL, 2010, J. Org. Chern. Vol 25 75(5) pp. 1569-81). In some embodiments, the biradicle -X-Y- is -O-CHRa-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6’ substituted LNA nucleosides are disclosed in WO10036698 and WO07090071 which are both hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -O-CH(CH2OCH3)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are also known as cyclic MOEs in the art 30 (cMOE) and are disclosed in WO07090071. In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH3)-. - in either the R- or S- configuration. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -O-CH2-O-CH2- (Seth at aL, 2010, J. Org. Chern). In some embodiments, the biradicle -X-Y- is -O-CH(CH3)-, W is O, and all of R1, R2, R3, R5 and R5* are 35 all hydrogen. Such 6’ methyl LNA nucleosides are also known as cET nucleosides in the art, 2024201873 22 Mar 2024 and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010 / 036698 (alpha-L) which are both hereby incorporated by reference). In some embodiments, the biradicle -X-Y- is -O-CRaRb-, wherein in neither Ra or Rb is hydrogen, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments, Ra 5 and Rb are both methyl. Such 6’ di-substituted LNA nucleosides are disclosed in WO 2009006478 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -S-CHRa-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6’ substituted thio LNA nucleosides are disclosed in WO11156202 which is hereby incorporated by reference. In some 6’ substituted thio LNA embodiments Ra is 10 methyl. In some embodiments, the biradicle -X-Y- is -C(=CH2)-C(RaRb)-, such as -C(=CH2)-CH2-, or-C(=CH2)-CH(CH3)-W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647 which are both hereby incorporated by reference. 15 In some embodiments the biradicle -X-Y- is -N(-ORa)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as N substituted LNAs and are disclosed in WO2008 / 150729 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -O-NRa-CHs- (Seth at aL, 2010, J. Org. Chern). In some embodiments the 20 biradicle -X-Y- is -N(Ra)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. In some embodiments, one or both of R5 and R5* is hydrogen and, when substituted the other of R5 and R5* is C1-6 alkyl such as methyl. In such an embodiment, R1, R2, R3, may all be hydrogen, and the biradicle -X-Y- may be selected from -O-CH2- or-O-C(HCRa)-, such as -O-C(HCH3)-. 25 In some embodiments, the biradicle is -CRaRb-O-CRaRb-, such as CH2-O-CH2-, W is O and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 which is hereby incorporated by reference. In some embodiments, the biradicle is -O-CRaRb-O-CRaRb-, such as O-CH2-O-CH2-, W is O 30 and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et aL, Nucleic Acids Research 2009 37(4), 1225-1238, which is hereby incorporated by reference. It will be recognized than, unless specified, the LNA nucleosides may be in the beta-D or alpha-35 L stereoisoform. 2024201873 22 Mar 2024 Non limiting, exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352 , WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et aL, Bioorganic & Med.Chern. Lett. 12, 73-76, Seth et 5 al. J. Org. Chern. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et aL, Nucleic Acids Research 2009, 37(4), 1225-1238. Certain examples of LNA nucleosides are presented in Scheme 1. Scheme 1 6'methyl p-D-oxy LNA 6'dimethylp-D-oxy LNA Carbocycltc(vmyl) p-D- LNA 6' methyl thio p-D LNA 5' methyl p-D-oxy LNA 5'methyl, 6'dimethyl p-D-oxy LNA 10 As illustrated in the examples, in some embodiments of the invention the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides. Nuclease mediated degradation Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence. 15 In some embodiments, the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a 2024201873 22 Mar 2024 nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 consecutive DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for 5 example gapmers, headmers and tailmers. RNase H Activity and Recruitment The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01 / 23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. 10 Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol / l / min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all 15 monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01 / 23613 (hereby incorporated by reference). For use in determining RHase H activity, recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland Gapmer The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof may 20 be a gapmer. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5’-flank, a gap and a 3’-flank, F-G-F’ in the ‘5 -> 3’ orientation. The “gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5’ flanking region (F) comprising one or more 25 sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3’ flanking region (F’) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F’ enhance the affinity of the oligonucleotide for the target nucleic acid (i.e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified 30 nucleosides in region F and F’ are 2’ sugar modified nucleosides, such as high affinity 2’ sugar modifications, such as independently selected from LNA and 2’-MOE. In a gapmer design, the 5’ and 3’ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5’ (F) or 3’ (F’) region respectively. The flanks may further defined by having at least one sugar modified nucleoside at the end 35 most distant from the gap region, i.e. at the 5’ end of the 5’ flank and at the 3’ end of the 3’ flank. 2024201873 22 Mar 2024 Regions F-G-F’ form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F’. The overall length of the gapmer design F-G-F’ may be, for example 12 to 32 nucleosides, such 5 as 13 to 24, such as 14 to 22 nucleosides, Such as from 14 to 17, such as 16 to 18 nucleosides. By way of example, the gapmer oligonucleotide of the present invention can be represented by the following formulae: Fi-8-G5-16-F’i-8, such 3S F-1-8-G7-16-F’2-8 10 with the proviso that the overall length of the gapmer regions F-G-F’ is at least 12, such as at least 14 nucleotides in length. Regions F, G and F’ are further defined below and can be incorporated into the F-G-F’ formula. Gapmer - gap, Region G Region G (gap region) of the gapmer is a region of nucleosides which enables the 15 oligonucleotide to recruit RNaseH, such as human RNase H1, typically DNA nucleosides. RNaseH is a cellular enzyme which recognizes the duplex between DNA and RNA, and enzymatically cleaves the RNA molecule. Suitably gapmers may have a gap region (G) of at least 5 or 6 contiguous DNA nucleosides, such as 5 - 16 contiguous DNA nucleosides, such as 6-15 contiguous DNA nucleosides, such as 7-14 contiguous DNA nucleosides, such as 8 - 12 20 contiguous DNA nucleotides, such as 8 - 12 contiguous DNA nucleotides in length. The gap region G may, in some embodiments consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 contiguous DNA nucleosides. Cytosine (C) DNA in the gap region may in some instances be methylated, such residues are either annotated as 5-methyl-cytosine (meC or with an e instead of a c). Methylation of Cytosine DNA in the gap is advantageous if eg dinucleotides are present 25 in the gap to reduce potential toxicity, the modification is not expected to have significant impact on efficacy of the oligonucleotides. In some embodiments the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 contiguous phosphorothioate linked DNA nucleosides. In some embodiments, all internucleoside linkages in the gap are phosphorothioate linkages. 30 Whilst traditional gapmers have a DNA gap region, there are numerous examples of modified nucleosides which allow for RNaseH recruitment when they are used within the gap region. Modified nucleosides which have been reported as being capable of recruiting RNaseH when included within a gap region include, for example, alpha-L-LNA, C4’ alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chern. Lett. 18 (2008) 2296 - 35 2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F- ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluiter et a / ., Mol. Biosyst., 2009, 10, 1039 incorporated herein by reference). UNA 2024201873 22 Mar 2024 is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked “sugar” residue. The modified nucleosides used in such gapmers may be nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region, i.e. modifications which allow for RNaseH recruitment). In some embodiments the DNA 5 Gap region (G) described herein may optionally contain 1 to 3 sugar modified nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region. Region G - “Gap-breaker” Alternatively, there are numerous reports of the insertion of a modified nucleoside which confers a 3’ endo conformation into the gap region of gapmers, whilst retaining some RNaseH activity. 10 Such gapmers with a gap region comprising one or more 3’endo modified nucleosides are referred to as “gap-breaker” or “gap-disrupted” gapmers, see for example WO2013 / 022984. Gap-breaker oligonucleotides retain sufficient region of DNA nucleosides within the gap region to allow for RNaseH recruitment. The ability of gapbreaker oligonucleotide design to recruit RNaseH is typically sequence or even compound specific - see Rukov et al. 2015 Nucl. Acids 15 Res. Vol. 43 pp. 8476-8487, which discloses “gapbreaker” oligonucleotides which recruit RNaseH which in some instances provide a more specific cleavage of the target RNA. Modified nucleosides used within the gap region of gap-breaker oligonucleotides may for example be modified nucleosides which confer a 3’endo confirmation, such 2’ -O-methyl (OMe) or2’-O-MOE (MOE) nucleosides, or beta-D LNA nucleosides (the bridge between C2’ and C4’ 20 of the ribose sugar ring of a nucleoside is in the beta conformation), such as beta-D-oxy LNA or ScET nucleosides. As with gapmers containing region G described above, the gap region of gap-breaker or gap-disrupted gapmers, have a DNA nucleosides at the 5’ end of the gap (adjacent to the 3’ nucleoside of region F), and a DNA nucleoside at the 3’ end of the gap (adjacent to the 5’ 25 nucleoside of region F’). Gapmers which comprise a disrupted gap typically retain a region of at least 3 or 4 contiguous DNA nucleosides at either the 5’ end or 3’ end of the gap region. Exemplary designs for gap-breaker oligonucleotides include Fl-8-[D3-4-El- D 3-4]-F’l-8 Fi-8" [D 1-4-E-l- D 3-4]-F’l-8 30 Fi-8- [D 3-4-Ei- D 1-4]-F’ 1-8 wherein region G is within the brackets [Dn-Er- Dm], D is a contiguous sequence of DNA nucleosides, E is a modified nucleoside (the gap-breaker or gap-disrupting nucleoside), and F and F’ are the flanking regions as defined herein, and with the proviso that the overall length of the gapmer regions F-G-F’ is at least 12, such as at least 14 nucleotides in length. 35 In some embodiments, region G of a gap disrupted gapmer comprises at least 6 DNA nucleosides, such as 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 DNA nucleosides. As described 2024201873 22 Mar 2024 above, the DNA nucleosides may be contiguous or may optionally be interspersed with one or more modified nucleosides, with the proviso that the gap region G is capable of mediating RNaseH recruitment. Gapmer - flanking regions, F and F’ 5 Region F is positioned immediately adjacent to the 5’ DNA nucleoside of region G. The 3’ most nucleoside of region F is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside. Region F’ is positioned immediately adjacent to the 3’ DNA nucleoside of region G. The 5’ most 10 nucleoside of region F’ is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside. Region F is 1 - 8 contiguous nucleotides in length, such as 1-6, such as 2-6, such as 3-4 contiguous nucleotides in length. Advantageously the 5’ most nucleoside of region F is a sugar 15 modified nucleoside. In some embodiments the two 5’ most nucleoside of region F are sugar modified nucleoside. In some embodiments the 5’ most nucleoside of region F is an LNA nucleoside. In some embodiments the two 5’ most nucleoside of region F are LNA nucleosides. In some embodiments the two 5’ most nucleoside of region F are 2’ substituted nucleoside nucleosides, such as two 3’ MOE nucleosides. In some embodiments the 5’ most nucleoside of 20 region F is a 2’ substituted nucleoside, such as a MOE nucleoside. Region F’ is 2 - 8 contiguous nucleotides in length, such as 3-6, such as 4-5 contiguous nucleotides in length. Advantageously, embodiments the 3’ most nucleoside of region F’ is a sugar modified nucleoside. In some embodiments the two 3’ most nucleoside of region F’ are sugar modified nucleoside. In some embodiments the two 3’ most nucleoside of region F’ are 25 LNA nucleosides. In some embodiments the 3’ most nucleoside of region F’ is an LNA nucleoside. In some embodiments the two 3’ most nucleoside of region F’ are 2’ substituted nucleoside nucleosides, such as two 3’ MOE nucleosides. In some embodiments the 3’ most nucleoside of region F’ is a 2’ substituted nucleoside, such as a MOE nucleoside. It should be noted that when the length of region F or F’ is one, it is advantageously an LNA 30 nucleoside. In some embodiments, region F and F’ independently consists of or comprises a contiguous sequence of sugar modified nucleosides. In some embodiments, the sugar modified nucleosides of region F may be independently selected from 2’-O-alkyl-RNA units, 2’-O-methyl-RNA, 2’-amino-DNA units, 2’-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, LNA units, arabino 35 nucleic acid (ANA) units and 2’-fluoro-ANA units. 2024201873 22 Mar 2024 In some embodiments, region F and F’ independently comprises both LNA and a 2’ substituted modified nucleosides (mixed wing design). In some embodiments, region F and F’ consists of only one type of sugar modified nucleosides, such as only MOE or only beta-D-oxy LNA or only ScET. Such designs are also termed uniform 5 flanks or uniform gapmer design. In some embodiments, all the nucleosides of region F or F’, or F and F’ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides. In some embodiments region F consists of 1-5, such as 2-4, such as 3-4 such as 1,2, 3, 4 or 5 contiguous LNA nucleosides. In some embodiments, all the nucleosides of region F and F’ are 10 beta-D-oxy LNA nucleosides. In some embodiments, all the nucleosides of region F or F’, or F and F’ are 2’ substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 contiguous OMe or MOE nucleosides. In some embodiments only one of the flanking regions can consist of 2’ substituted nucleosides, such as OMe or MOE nucleosides. In 15 some embodiments it is the 5’ (F) flanking region that consists 2’ substituted nucleosides, such as OMe or MOE nucleosides whereas the 3’ (F’) flanking region comprises at least one LNA nucleoside, such as beta-D-oxy LNA nucleosides or cET nucleosides. In some embodiments it is the 3’ (F’) flanking region that consists 2’ substituted nucleosides, such as OMe or MOE nucleosides whereas the 5’ (F) flanking region comprises at least one LNA nucleoside, such as 20 beta-D-oxy LNA nucleosides or cET nucleosides. In some embodiments, all the modified nucleosides of region F and F’ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides, wherein region F or F’, or F and F’ may optionally comprise DNA nucleosides (an alternating flank, see definition of these for more details). In some embodiments, all the modified nucleosides of 25 region F and F’ are beta-D-oxy LNA nucleosides, wherein region F or F’, or F and F’ may optionally comprise DNA nucleosides (an alternating flank, see definition of these for more details). In some embodiments the 5’ most and the 3’ most nucleosides of region F and F’ are LNA nucleosides, such as beta-D-oxy LNA nucleosides or ScET nucleosides. 30 In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F’ and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkages between the nucleosides of region F or F’, F and F’ are phosphorothioate internucleoside linkages. 35 Further gapmer designs are disclosed in WO2004 / 046160, WO2007 / 146511 and WO2008 / 113832, hereby incorporated by reference. 2024201873 22 Mar 2024 LNA Gapmer An LNA gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of beta-D-oxy LNA nucleosides. 5 In some embodiments the LNA gapmer is of formula: [LNA]i-5-[region G] -[LNA]i-5, wherein region G is as defined in the Gapmer region G definition. In some embodiments the LNA is beta-D-oxy-LNA and the gapmer has the formula; F2-5 LNA, 0-2 DNA-G7-11 DNA-F’3-5 LNA, 0-2 DNA MOE Gapmers 10 A MOE gapmers is a gapmer wherein regions F and F’ consist of MOE nucleosides. In some embodiments the MOE gapmer is of design [MOE]i-8-[Region G]-[MOE] 1-8, such as [MOE]2-7-[Region G]s-i6-[MOE]2-7, such as [MOE]3-6-[Region G]-[MOE]s-6, wherein region G is as defined in the Gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art. 15 Mixed Wing Gapmer A mixed wing gapmer is an LNA gapmer wherein one or both of region F and F’ comprise a 2’ substituted nucleoside, such as a 2’ substituted nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA units, 2’-O-methyl-RNA, 2’-amino-DNA units, 2’-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units and 2’-fluoro-ANA units, such 20 as a MOE nucleosides. In some embodiments wherein at least one of region F and F’, or both region F and F’ comprise at least one LNA nucleoside, the remaining nucleosides of region F and F’ are independently selected from the group consisting of MOE and LNA. In some embodiments wherein at least one of region F and F’, or both region F and F’ comprise at least two LNA nucleosides, the remaining nucleosides of region F and F’ are independently selected 25 from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of region F and F’ may further comprise one or more DNA nucleosides. Mixed wing gapmer designs are disclosed in WO2008 / 049085 and WO2012 / 109395, both of which are hereby incorporated by reference. Alternating Flank Gapmers 30 Oligonucleotides with alternating flanks are LNA gapmer oligonucleotides where at least one of the flanks (F or F’) comprises DNA in addition to the LNA nucleoside(s). In some embodiments at least one of region F or F’, or both region F and F’, comprise both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking region F or F’, or both F and F’ comprise at least three nucleosides, wherein the 5’ and 3’ most nucleosides of the F and / or F’ region are 35 LNA nucleosides. 2024201873 22 Mar 2024 In some embodiments at least one of region F or F’, or both region F and F’, comprise both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking region F or F’, or both F and F’ comprise at least three nucleosides, wherein the 5’ and 3’ most nucleosides of the F or F’ region are LNA nucleosides, and the. Flanking regions which comprise both LNA and DNA 5 nucleoside are referred to as alternating flanks, as they comprise an alternating motif of LNA-DNA-LNA nucleosides. Alternating flank LNA gapmers are disclosed in WO2016 / 127002. An alternating flank region may comprise up to 3 contiguous DNA nucleosides, such as 1 to 2 or 1 or 2 or 3 contiguous DNA nucleosides. The alternating flak can be annotated as a series of integers, representing a number of LNA 10 nucleosides (L) followed by a number of DNA nucleosides (D), for example [L]i.3-[D]i^-[L]i-3 [L]l-2-[D]l-2-[L]l-2-[D]l-2-[L]l-2 In oligonucleotide designs these will often be represented as numbers such that 2-2-1 represents 5’ [L]2-[D]2-[L] 3’, and 1-1-1-1-1 represents 5’ [L]-[D]-[L]-[D]-[L] 3’. The length of the 15 flank (region F and F’) in oligonucleotides with alternating flanks may independently be 3 to 10 nucleosides, such as 4 to 8, such as 5 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. In some embodiments only one of the flanks in the gapmer oligonucleotide is alternating while the other is constituted of LNA nucleotides. It may be advantageous to have at least two LNA nucleosides at the 3’ end of the 3’ flank (F’), to confer additional exonuclease 20 resistance. Some examples of oligonucleotides with alternating flanks are: [L]l_5-[D]l^-[L]l-3-[G]5-16-[L]2-6 [L]l.2-[D]l.2-[L]l.2-[D]l.2-[L]l.2-[G]5-16-[L]l.2-[D]l.3-[L]2-4 [L]1^-[G]5-16-[L]-[D]-[L]-[D]-[L]2 with the proviso that the overall length of the gapmer is at least 12, such as at least 14 25 nucleotides in length. Region D’ or D” in an oligonucleotide The oligonucleotide of the invention may in some embodiments comprise or consist of the contiguous nucleotide sequence of the oligonucleotide which is complementary to the target nucleic acid, such as the gapmer F-G-F’, and further 5’ and / or 3’ nucleosides. The further 5’ 30 and / or 3’ nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5’ and / or 3’ nucleosides may be referred to as region D’ and D” herein. The addition of region D’ or D” may be used for the purpose of joining the contiguous nucleotide sequence, such as the gapmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a 35 biocleavable linker. Alternatively it may be used to provide exonucleoase protection or for ease of synthesis or manufacture. 2024201873 22 Mar 2024 Region D’ and D” can be attached to the 5’ end of region F or the 3’ end of region F’, respectively to generate designs of the following formulas D’-F-G-F’, F-G-F’-D” or D’-F-G-F’-D”. In this instance the F-G-F’ is the gapmer portion of the oligonucleotide and region D’ or D” constitute a separate part of the oligonucleotide. 5 Region D’ or D” may independently comprise or consist of 1,2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F’ region is not a sugar-modified nucleotide, such as a DNA or RNA or base modified versions of these. The D’ or D’ region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5’ and / or 3’ 10 end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. Nucleotide based biocleavable linkers suitable for use as region D’ or D” are disclosed in WO2014 / 076195, which include by way of example a phosphodiester linked DNA dinucleotide. The use of biocleavable linkers in poly-oligonucleotide constructs is disclosed in WO2015 / 113922, where they are used to link multiple antisense constructs (e.g. gapmer regions) within a single 15 oligonucleotide. In one embodiment the oligonucleotide of the invention comprises a region D’ and / or D” in addition to the contiguous nucleotide sequence which constitute the gapmer. In some embodiments, the oligonucleotide of the present invention can be represented by the following formulae: 20 F-G-F’; in particular Fi-8-G5-i6-F’2-8 D’-F-G-F’, in particular D’i-3-Fi^-G5-i6-F’2-8 F-G-F’-D”, in particular Fi-8-G5-i6-F’2-8-D”i-3 D’-F-G-F’-D”, in particular D’1-3- Fi-8-G5-i6-F’2-8-D”i-3 In some embodiments the internucleoside linkage positioned between region D’ and region F is 25 a phosphodiester linkage. In some embodiments the internucleoside linkage positioned between region F’ and region D” is a phosphodiester linkage. Conjugate The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). 30 Conjugation of the oligonucleotide of the invention to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, e.g. by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotide. In some embodiments the conjugate moiety modify or enhance the pharmacokinetic properties of the oligonucleotide by improving cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular 35 uptake of the oligonucleotide. In particular the conjugate may target the oligonucleotide to a specific organ, tissue or cell type and thereby enhance the effectiveness of the oligonucleotide 2024201873 22 Mar 2024 in that organ, tissue or cell type. A the same time the conjugate may serve to reduce activity of the oligonucleotide in non-target cell types, tissues or organs, e.g. off target activity or activity in non-target cell types, tissues or organs. WO 93 / 07883 and WO2013 / 033230 provides suitable conjugate moieties, which are hereby 5 incorporated by reference. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the ASGPR, see for example WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620 (hereby incorporated by reference). Such conjugates serve to enhance uptake of the oligonucleotide to the liver while reducing its presence in the 10 kidney, thereby increasing the liver / kidney ratio of a conjugated oligonucleotide compared to the unconjugated version of the same oligonucleotide. In an embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins 15 (e.g. capsids) or combinations thereof. Conjugate Linkers A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety 20 (e.g. linker or tether). Linkers serve to covalently connect one region, e.g. a conjugate moiety to another region, e.g. an oligonucleotide (e.g. the termini of region A or C). In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region which is positioned between the oligonucleotide and the conjugate moiety. In some embodiments, the linker between the 25 conjugate and oligonucleotide is biocleavable. The linker and the oligonucleotide is often attached via a phosphodiester linkage. Biocleavable linkers (Region B) comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical 30 transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to 35 S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked 2024201873 22 Mar 2024 nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA. In one embodiment the linker between the oligonucleotide and the conjugate moiety is a physiologically labile linker composed of 2 to 5 consecutive phosphodiester linked nucleosides 5 at the 5’ or 3’ terminal of the contiguous nucleotide sequence of the antisense compound. In some embodiments the consecutive phosphodiester linkages are a dinucleotide with a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG. In some embodiments the consecutive phosphodiester linkages are a trinucleotide of sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, 10 AGA, AGT, AGC, AGG, TAA, TAT, TAG, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG. In specific examples phosphodiester linked CA dinucleotide, with three consecutive phosphodiester linkages, has been used as biocleavable linker between 15 the contiguous nucleotide sequence and the conjugate moiety. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014 / 076195 (hereby incorporated by reference). In a conjugate compound with a biocleavable linker at least about 50% of the conjugate moiety is cleaved from the oligonucleotide, such as at least about 60% cleaved, such as at least about 70% cleaved, such as at least about 80% cleaved, such as at least about 85% 20 cleaved, such as at least about 90% cleaved, such as at least about 95% of the conjugate moiety is cleaved from the oligonucleotide cleaved when compared against a standard. Conjugates may also be linked to the oligonucleotide via non-biocleavable linkers, or in some embodiments the conjugate may comprise a non-cleavable linker which is covalently attached to the biocleavable linker. Linkers that are not necessarily biocleavable primarily serve to 25 covalently connect a conjugate moiety to an oligonucleotide or biocleavable linker, and potentially generate some distance between the conjugate moiety and the oligonucleotide. . Some example linkers (region Y) include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate (SMCC), 6- aminohexanoic acid (AHEX or AHA), 6-aminohexyloxy, 4-aminobutyric acid, 4- aminocyclohexylcarboxylic acid, succinimidyl 430 (N-maleimidomethyl)cyclohexane- l-carboxy-(6-amido-caproate) (LCSMCC), succinimidyl m-maleimido-benzoylate (MBS), succinimidyl N-e-maleimido-caproylate (EMCS), succinimidyl 6-(beta - maleimido-propionamido) hexanoate (SMPH), succinimidyl N-(a-maleimido acetate) (AMAS), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB), beta -alanine (beta -ALA), phenylglycine (PHG), 4-aminocyclohexanoic acid (ACHC), beta -(cyclopropyl) alanine (beta -35 CYPR), amino dodecanoic acid (ADC), alylene diols, polyethylene glycols, amino acids, and the like. Non-cleavable linkers may also comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example 2024201873 22 Mar 2024 Ce to C12 amino alkyl groups. In some embodiments the linker (region Y) is a Ce amino alkyl group (also termed a C6 linker). Conjugate linker groups may be routinely attached to an oligonucleotide via use of an amino modified oligonucleotide, and an activated ester group on the conjugate group. The linkage group between the amino alkyl and the oligonucleotide may 5 for example be a phosphorothioate or a phosphodiester, or one of the other nucleoside linkage groups referred to herein. A conjugate compound of the present invention may be composed of the following regions C-B-A (Conjugate moiety-biocleavable linker-oligonucleotide / contiguous nucleotide sequence) or C-Y-B-A (conjugate moiety-non-cleavable linker-biocleavable linker-oligonucleotide / contiguous nucleotide sequence). 10 Treatment The terms “treatment”, “treating”, “treats” or the like are used herein generally mean obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in terms of partially or completely curing a disease and / or adverse effect attributed to the disease. The term “treatment” as used herein covers any treatment of a disease in a subject and includes: (a) 15 inhibiting the disease, i.e. arresting its development like the inhibition of increase of HBsAg and / or HBeAg; or (b) ameliorating (i.e. relieving) the disease, i.e. causing regression of the disease, like the repression of HBsAg and / or HBeAg production . Thus, a compound that ameliorates and / or inhibits a HBV infection is a compound that treats a HBV invention. Preferably, the term “treatment” as used herein relates to medical intervention of an already 20 manifested disorder, like the treatment of an already defined and manifested HBV infection. Prevention Herein the term “preventing”, “prevention” or “prevents” relates to a prophylactic treatment, i.e. to a measure or procedure the purpose of which is to prevent, rather than to cure a disease. Prevention means that a desired pharmacological and / or physiological effect is obtained that is 25 prophylactic in terms of completely or partially preventing a disease or symptom thereof. Accordingly, herein “preventing a HBV infection” includes preventing a HBV infection from occurring in a subject, and preventing the occurrence of symptoms of a HBV infection. In the present invention in particular the prevention of HBV infection in children from HBV infected mothers are contemplated. 30 Patient For the purposes of the present invention the “subject” (or “patient”) may be a vertebrate. In context of the present invention, the term “subject” includes both humans and other animals, particularly mammals, and other organisms. Thus, the herein provided means and methods are applicable to both human therapy and veterinary applications. Accordingly, herein the subject 35 may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably the subject is human. 2024201873 22 Mar 2024 HBV infection The term “hepatitis B virus infection” or “HBV infection” is commonly known in the art and refers to an infectious disease that is caused by the hepatitis B virus (HBV) and affects the liver. A HBV infection can be an acute or a chronic infection. Some infected persons have no symptoms 5 during the initial infection and some develop a rapid onset of sickness with vomiting, yellowish skin, tiredness, dark urine and abdominal pain (“Hepatitis B Fact sheet N°204”. who.int. July 2014. Retrieved 4 November 2014). Often these symptoms last a few weeks and can result in death. It may take 30 to 180 days for symptoms to begin. In those who get infected around the time of birth 90% develop a chronic hepatitis B infection while less than 10% of those infected 0 after the age of five do (“Hepatitis B FAQs for the Public - Transmission”, U.S. Centers for Disease Control and Prevention (CDC), retrieved 2011-11-29). Most of those with chronic disease have no symptoms; however, cirrhosis and liver cancer may eventually develop (Chang, 2007, Semin Fetal Neonatal Med, 12: 160-167). These complications result in the death of 15 to 25% of those with chronic disease (“Hepatitis B Fact sheet N°204”. who.int. July 15 2014, retrieved 4 November 2014). Herein, the term “HBV infection” includes the acute and chronic hepatitis B infection. The term “HBV infection” also includes the asymptotic stage of the initial infection, the symptomatic stages, as well as the asymptotic chronic stage of the HBV infection. Compound 20 Herein, the term “compound” means any nucleic acid molecule, such as RNAi molecules or antisense oligonucleotides according to the invention or any conjugate comprising such a nucleic acid molecule. For example, herein the compound may be a nucleic acid molecule targeting PAPD5 and PAPD7, in particular an antisense oligonucleotide. Composition 25 The term “composition” may also be used to describe a nucleic acid molecule compound. A nucleic acid molecule composition has less than 20% impurities, preferably less than 15% or 10% impurities, more preferably less than 9, 8, 7 or 6 % impurities, most preferably less than 5 % impurities. The impurities are typically nucleic acid molecules which are one or two nucleotides shorter (n-1 or n-2) than the primary nucleic acid molecule component. 30 The present invention is further described by reference to the non-limiting figures and examples. DETAILED DESCRIPTION OF THE INVENTION PAPD5 and PAPD7 are non-canonical poly(A)-polymerases that belong to the superfamily of polymerase P-like nucleotidyl transferases. In PCT / EP2017 / 064981 PAPD5 and PAPD7 were identified as relevant targets for inhibition of an HBV infection by inhibiting the production of 35 HBV surface antigen (HBsAg) and the expression of HBV RNA during HBV infection with two small molecules followed by confirmation with pools of siRNA compounds. In 2024201873 22 Mar 2024 PCT / EP2017 / 064980 antisense oligonucleotides targeting either PAPD5 or PAPD7 were described and combined to achieve in vitro inhibition of an HBV infection. The present invention has identified target sequences of 12 to 22 nucleotides in length which are shared between human PAPD5 and human PAPD7 mRNA in order to be able to inhibit both 5 targets with a single nucleic acid molecule. There are around 4500 shared target sites between human PAPD5 and human PAPD7 pre-mRNA. In terms of generating a pharmaceutical acceptable molecule other parameters needs to be taken into account such as the number of off-targets as well as conservation to other species to allow in vivo proof of concept as well as meaningful pharmacokinetic / pharmacodynamic (PK / PD) modelling. 10 Oligonucleotides of the invention The present invention has identified novel antisense oligonucleotides which are capable of inhibiting the expression of both PAPD5 and PAPD7 in vitro and in vivo. The oligonucleotides are complementary to one of three target sites of between 16 and 22 nucleotides in length which are present in both human PAPD5 and human PAPD7. 15 The inhibition is achieved by hybridizing the antisense oligonucleotide to a target nucleic acid encoding PAPD5 and a target nucleic acid encoding PAPD7. It is understood that the same molecule does not need to hybridize to the two targets simultaneously in order to be effective. Target nucleic acid 1 may be a mammalian PAPD5 sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1, 3 and 5. 20 Target nucleic acid 2 may be a mammalian PAPD7 sequence, such as a sequence selected from the group consisting of SEQ ID NO: 2, 4 and 6. In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of target 1 and target 2 by inhibiting or down-regulating them. Preferably, such modulation produces an inhibition of expression of at least 50% compared to the normal 25 expression level of the targets, more preferably at least 60%, 70%, 80%, 90%, 95% or 98% inhibition compared to the normal expression level of the targets. In some embodiments oligonucleotides of the invention are capable of inhibiting expression levels of PAPD5 and PAPD7 mRNA by at least 65% - 98%, such as 70% to 95%, in vitro using HeLa cells, this range of target reduction is advantageous in terms of selecting oligonucleotides with good correlation 30 to the HBV antigen reduction, such as HBsAg and / or HBeAg reduction, . In some embodiments compounds of the invention may be capable of inhibiting expression levels of PAPD5 and PAPD7 protein by at least 50% in vitro using HeLa cells. The materials and Method section and the Examples herein provide assays which may be used to measure target RNA inhibition in HeLa cells. The target modulation is triggered by the hybridization between a contiguous 35 nucleotide sequence, such as the gapmer region, of the oligonucleotide and the target nucleic acids. In some embodiments the oligonucleotide of the invention comprises mismatches 2024201873 22 Mar 2024 between the oligonucleotide or the contiguous nucleotide sequence and one or both of the target nucleic acids. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of PAPD5 and PAPD7 expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased length of 5 the oligonucleotide and / or an increased number of modified nucleosides capable of increasing the binding affinity to the target within the oligonucleotide sequence. Advantageously, the oligonucleotides of the present invention contain modified nucleosides capable of increasing the binding affinity, such as 2’ sugar modified nucleosides, including LNA. An aspect of the present invention relates to an antisense oligonucleotide of 12 to 32 10 nucleotides in length, which comprises a contiguous nucleotide sequence of 12 to 22 nucleotides in length which is capable of inhibiting the expression of both PAPD5 and PAPD7. In some embodiments, the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 15 98%, or 100% complementary to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 2, or natural variants thereof. In one embodiment the antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acids, or in some embodiments may comprise one or two mismatches between the 20 oligonucleotide and the target nucleic acids. In some embodiments the antisense oligonucleotide comprises a contiguous nucleotide sequence of 12 to 22 nucleotides in length with at least 93% complementary, such as fully (or 100%) complementary, to a target nucleic acid region present in SEQ ID NO: 1 and SEQ ID NO: 2. 25 In some embodiments the antisense oligonucleotide or the contiguous nucleotide sequence of the invention is at least 93% complementarity, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. In some embodiments the antisense oligonucleotide or the contiguous nucleotide sequence of the invention is at least 93% complementarity, such as fully (or 100%) complementary, to the 30 target nucleic acid of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6. In some embodiments the antisense oligonucleotide or the contiguous nucleotide sequence is 100% complementary to position 64669 to 69429 on SEQ ID NO: 1 and position 29514 to 29530 on SEQ ID NO: 2. In some embodiments the antisense oligonucleotide or the contiguous nucleotide sequence is 35 100% complementary to position 64670 to 64685 on SEQ ID NO: 1 and position 29515 to 29530 on SEQ ID NO: 2. 2024201873 22 Mar 2024 In some embodiments the antisense oligonucleotide or the contiguous nucleotide sequence is 100% complementary to position 69414 to 69429 on SEQ ID NO: 1 and position 30731 to 30746 on SEQ ID NO: 2. In some embodiments the antisense oligonucleotide or the contiguous nucleotide sequence is 5 100% complementary to position 759 to 781 on SEQ ID NO: 1 and position 1032 to 1054 on SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide of the invention comprises or consists of 12 to 32 nucleotides in length, such as from 14 to 25, such as 15 to 22, such as from 16 to 20 contiguous nucleotides in length. 0 In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide which is complementary to the target nucleic acids comprises or consists of 12 to 22, such as from 14 to 20, such as from 16 to 20, such as from 15 to 18, such as from 16 to 18, such as from 16 to 17 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide or the contiguous nucleotide sequence 15 thereof comprises or consists of 22 or less nucleotides, such as 20 or less nucleotides, such as 17 or less nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 12 to 32 nucleotides, both 12 and 32 nucleotides are included. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence 20 comprises or consists of 12 to 32 nucleotides in length with at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 7 to 16. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 12 to 32 nucleotides in length with at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 17 to 19. 25 In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 12 to 32 nucleotides in length with at least 93% identity, preferably 100% identity, to a sequence of SEQ ID NO: 17 or 18. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 12 to 32 nucleotides in length with at least 93% identity, preferably 30 100% identity, to a sequence of SEQ ID NO: 19. In a further aspect the invention relates to siRNA molecules where the antisense strand has at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 17 to 19. 2024201873 22 Mar 2024 In a further aspect the invention relates to shRNA molecules where a region of the molecule has at least 93% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 17 to 19. It is understood that the contiguous nucleobase sequences (motif sequence) can be modified to 5 for example increase nuclease resistance and / or binding affinity to the target nucleic acid. The pattern in which the high affinity modified nucleotides are incorporated into the oligonucleotide sequence is generally termed oligonucleotide design. The oligonucleotides of the invention are designed with modified nucleosides and DNA nucleosides. Advantageously, high affinity modified nucleosides are used. 10 In an embodiment, the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In an embodiment the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 9 modified nucleosides, such as from 3 to 8 modified nucleosides, such as from 4 to 7 15 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described in the “Definitions” section under “modified nucleoside”, “high affinity modified nucleosides”, “sugar modifications”, “2’ sugar modifications” and Locked nucleic acids (LNA)”. In an embodiment, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2’ sugar modified nucleosides. Preferably the oligonucleotide of the invention comprise one 20 or more 2’ sugar modified nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2’-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA). Often used LNA LNA nucleosides are oxy-LNA, or cET. 25 In a further embodiment the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the “Definitions” section under “Modified internucleoside linkage”. It is advantageous if at least 75%, such as all, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments all the internucleotide 30 linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages. In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as from 2 to 6 LNA nucleosides, such as from 3 to 7 LNA nucleosides, 4 to 8 LNA nucleosides or 3, 4, 5, 6, 7 or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides in the 35 oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90% of the modified nucleosides are LNA nucleosides. In a still further embodiment all the modified nucleosides in 2024201873 22 Mar 2024 the oligonucleotide are LNA nucleosides. In a further embodiment, the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, ScET and / or ENA in either the beta-D or alpha-L configurations or combinations thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. It 5 is advantageous for the nuclease stability of the oligonucleotide or contiguous nucleotide sequence to have at least 1 LNA nucleoside at the 5’ end and at least 2 LNA nucleosides at the 3’ end of the nucleotide sequence. In an embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H. 10 In the current invention an advantageous structural design is a gapmer design as described in the “Definitions” section under for example “Gapmer”, “LNA Gapmer”, “MOE gapmer” and “Mixed Wing Gapmer” “Alternating Flank Gapmer”. The gapmer design includes gapmers with uniform flanks, mixed wing flanks, alternating flanks, and gapbreaker designs. In the present invention it is advantageous if the oligonucleotide of the invention is a gapmer with an F-G-F’ 15 design. In addition to the F-G-F’ designs described in the definitions sections one design may be where the F and F’ wing regions independently comprise 1-82’ sugar modified nucleosides and G is a gap region between 5 and 16 nucleosides which are capable of recruiting RNaseH. In some embodiments the gapmer is an LNA gapmer with uniform flanks or with alternating flanks. 20 In some embodiments of the invention the LNA gapmer is selected from the following designs uniform flank designs 2-11-3, 2-11-4, 2-12-2, 2-12-3, 2-13-2, 2-9-6, 3-10-3, 3-10-4, 3-11-2, 311-3, 3-12-2, 3-9-4, 4-10-2, 4-10-3, 4-11-2, 4-7-5, 4-8-4, 4-9-3, 5-10-2, 5-6-5, 5-7-4, 5-7-5, 5-83, 5-8-4, 5-9-2 or 6-9-2. In some embodiments of the invention the LNA gapmer is selected from the following 25 alternating flanks designs 4-7-1-1-3, 4-9-1-1-2, 1-1-3-7-1-1-2, 1-1-3-9-2, 2-1-1-9-2, 2-1-1-9-3 Table 5 and 7 (Materials and Method section) lists preferred designs of each motif sequence. In all instances the F-G-F’ design may further include region D’ and / or D” as described in the “Definitions” section under “Region D’ or D” in an oligonucleotide”. In some embodiments the oligonucleotide of the invention has 1, 2 or 3 phosphodiester linked nucleoside units, such as 30 DNA units, at the 5’ or 3’ end of the gapmer region. In some embodiments the oligonucleotide of the invention consists of two 5’ phosphodiester linked DNA nucleosides followed by a F-G-F’ gapmer region as defined in the “Definitions” section. In addition to the D’-F-G-F’-D” designs described in the definitions sections one design may be an antisense oligonucleotide wherein a) the F region is between 1 and 6 nucleotides in length and consists of 2-5 identical LNA 35 nucleosides, such as beta-D-oxy LNA or cET, and 0-3 DNA nucleosides; and b) the F’ region is between 2 and 6 nucleotides in length and consists of 2-5 identical LNA nucleosides, such as 2024201873 22 Mar 2024 beta-D-oxy LNA or cET, and 0-3 DNA nucleosides; and c) the G region consists of between 5 and 11, such as from 7-10 DNA nucleotides and d) optionally region D’ consists of between 1 and 3 phosphodiester linked DNA nucleosides. Oligonucleotides that contain phosphodiester linked DNA units at the 5’ or 3’ end are suitable for conjugation and may further comprise a 5 conjugate moiety as described herein. For delivery to the liver ASGPR targeting moieties are particular advantageous as conjugate moieties, see the Conjugate section below for further details. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP ID NO: 7_1 to 7_83 (see oligonucleotides listed in table 10 5), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 8_1 to 8_81 (see oligonucleotides listed in table 5, or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of 15 oligonucleotide compounds with CMP-ID-NO: 9_1 to 9_12 (see oligonucleotides listed in table 5), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 10_1 to 10_18 (see oligonucleotides listed in table 5), or pharmaceutically acceptable salts thereof. 20 For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 11_1 to 11_26 (see oligonucleotides listed in table 5), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 12_1 to 12_15 (see oligonucleotides listed in 25 table 5), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 13_1 or 13_2 (see oligonucleotides listed in table 5)- For certain embodiments of the invention, the oligonucleotide is selected from the group of 30 oligonucleotide compounds with CMP-ID-NO: 14_1 to 14_13 (see oligonucleotides listed in table 5), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 15_1 to 15_21 (see oligonucleotides listed in table 5), or pharmaceutically acceptable salts thereof. 2024201873 22 Mar 2024 For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 16_1 to 16_5 (see oligonucleotides listed in table 5)- For certain embodiments of the invention, the oligonucleotide is selected from the group of 5 oligonucleotide compounds with CMP-ID-NO: 17_1 to 17_183 (see oligonucleotides listed in table 7), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 18_1 to 18_31 or 18_250 to 18_361 (see oligonucleotides listed in table 7), or pharmaceutically acceptable salts thereof. 10 For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 18_32 to 18_249 or 18_362 to 18_610 (see oligonucleotides listed in table 7), or pharmaceutically acceptable salts thereof. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 19_1 to 19_22 (see oligonucleotides listed in 15 table 7), or pharmaceutically acceptable salts thereof. In an embodiment of the invention the oligonucleotide is selected from the group of oligonucleotide with the compound with CMP-ID-NO: 18_1, 18_5, 18_10, 18_15, 18_18, 18_19, 18_24, 18_27, 18_30, 18_346, 18_347, 18_357, 17_10, 17_137 and 17_139.. In an embodiment of the invention the oligonucleotide is selected from the group of 20 oligonucleotide with the compound with CMP-ID-NO: 18_1, 18_15, 18_30, 17_10, 17_137 and 17_139. In a further embodiment of the invention the oligonucleotide may comprise at least one stereodefined internucleoside linkages, such as a stereodefined phosphorothioate internucleoside linkage. 25 A key advantage of generating stereodefined oligonucleotide variants is the ability to increase the diversity across a sequence motif, and select stereodefined oligonucleotides including sublibraries of stereodefined oligonucleotides, which have improved medicinal chemical properties as compared to a parent oligonucleotide. In some embodiments, the improved medicinal chemical property (or improved properties) is 30 selected from one or more of enhanced potency, enhanced specific activity, enhanced tissue uptake, enhanced cellular uptake, enhanced efficacy, altered biodistribution, reduced off-target effects, enhanced mismatch discrimination, reduced toxicity, reduced immunogenicity, altered serum protein binding, improved duration of action, and stability. Improvement in one or more property is assessed as compared to the parent oligonucleotide, such as a stereorandom parent 35 oligonucleotide. 2024201873 22 Mar 2024 In some embodiments the improved property may be the ability of the oligonucleotide to modulate target expression, such as via an improved interaction with the cellular machinery involved in modulating target expression, by way of example, an enhanced RNase H activity, an improved splice modulating activity, or an improved microRNA inhibition. 5 In some embodiments, the improved property is RNaseH specificity, RNaseH allelic discrimination (i.e. discrimination between single nucleotide polymorphisms (SNPs) and / or RNaseH activity. In some embodiments, the improved property is other than RNaseH specificity, RNaseH allelic discrimination and / or RNaseH activity. In some embodiments the improved property is improved intracellular uptake. In some embodiments the improved property is 10 reduced toxicity, such as cytotoxicity or hepatotoxicity. A stereodefined oligonucleotide which exhibits one or more improved property as compared to a parent oligonucleotide, or other stereodefined oligonucleotides, is referred to as an improved phosphorothioate variant. In an embodiment of the invention the oligonucleotide is selected from the group of 15 oligonucleotide with the compound with CMP-ID-NO: 18_223, 18_36, 18_196, 18_188, 18_243. In a further aspect of the invention the nucleic acid molecules, such as the antisense oligonucleotide, of the invention can be targeted directly to the liver by covalently attaching them to a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPr), such as divalent or trivalent GalNAc cluster. 20 Conjugates Since HBV infection primarily affects the hepatocytes in the liver it is advantageous to conjugate the antisense oligonucleotides of the invention to a conjugate moiety that will increase the delivery of the oligonucleotide to the liver compared to the unconjugated oligonucleotide. In one embodiment liver targeting moieties are selected from moieties comprising cholesterol or other 25 lipids or conjugate moieties capable of binding to the asialoglycoprotein receptor (ASGPR). In some embodiments the invention provides a conjugate comprising an antisense oligonucleotide of the invention covalently attached to a conjugate moiety. The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting 30 moieties) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S.T. and Drickamer, K. JB.C. 1996, 271, 6686) or are readily determined using methods typical in the art. In one embodiment the conjugate moiety comprises at least one asialoglycoprotein receptor 35 targeting moiety selected from group consisting of galactose, galactosamine, N-formyl- 2024201873 22 Mar 2024 galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. Advantageously the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). To generate the ASGPR conjugate moiety the ASPGR targeting moieties (preferably GalNAc) 5 can be attached to a conjugate scaffold. Generally the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment the conjugate moiety consists of two to four terminal GalNAc moieties linked to a spacer which links each GalNAc moiety to a brancher molecule that can be conjugated to the antisense oligonucleotide. In a further embodiment the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent 10 with respect to asialoglycoprotein receptor targeting moieties. . Advantageously the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) moieties. The the ASPGR targeting scaffold which constitute the conjugate moiety can for example be generated by linking the GalNAc moiety to the spacer through its C-l carbon. A preferred spacer 15 is a flexible hydrophilic spacer (U.S. Patent 5885968; Biessen et al. J. Med. Chern. 1995 Vol. 39 p. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of two to three GalNAc moieties or other asialoglycoprotein receptor targeting moieties and further permits attachment of the branch point to the oligonucleotide, such constructs are termed 20 GalNAc clusters or GalNAc conjugate moieties. An exemplary branch point group is a di-lysine. A di-lysine molecule contains three amine groups through which three GalNAc moieties or other asialoglycoprotein receptor targeting moieties may be attached and a carboxyl reactive group through which the di-lysine may be attached to the oligomer. Khorev, et al 2008 Bioorg. Med. Chern. Vol 16, pp. 5216 also describes the synthesis of a suitable trivalent brancher. Other 25 commercially available branchers are 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite (Glen Research Catalogue Number: 10-1920-xx); tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1922-xx); and tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N- 30 diisopropyl)]-phosphoramidite; and 1-[5-(4,4'-dimethoxy-trityloxy)pentylamido]-3-[5-fluorenomethoxy-carbonyl-oxy-pentylamido]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1925-xx). Other GalNAc conjugate moieties can include, for example, those described in WO 2014 / 179620 and WO 2016 / 055601 and PCT / EP2017 / 059080 (hereby incorporated by 35 reference), as well as small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based 2024201873 22 Mar 2024 galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor). The ASGPR conjugate moiety, in particular a trivalent GalNAc conjugate moiety, may be attached to the 3'- or 5'-end of the oligonucleotide using methods known in the art. In one 5 embodiment the ASGPR conjugate moiety is linked to the 5’-end of the oligonucleotide. One or more linkers may be inserted between the conjugate moiety (such as at the brancher molecule) and the oligonucleotide. It is advantageous to have a biocleavable linker between the conjugate moiety and the antisense oligonucleotide, optionally in combination with a non-cleavable linker such as a C6 linker. The linker(s) may be selected from the linkers described in 10 the “Definitions” section under “Conjugate linkers” in particular biocleavable region D’ or D” linkers are advantageous. In one embodiment the conjugate moiety is a tri-valent N-acetylgalactosamine (GalNAc), such as those shown in figure 1, in particular as shown in figure 1D. In an embodiment of the invention the conjugate compound is selected from the group of 15 compounds in table 9 in the Material and Method section. In an embodiment of the invention the conjugate compound is CMP-ID-NO: 20_12. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_13. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_14. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_15. 20 In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_16. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_18. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_20. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_21. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_22. 25 In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_30. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_35. In an embodiment of the invention the conjugate compound is CMP-ID-NO 20_36. In an embodiment of the invention the conjugate compound is CMP-ID-NO 21_2. In an embodiment of the invention the conjugate compound is CMP-ID-NO 21_33. 30 In an embodiment of the invention the conjugate compound is CMP-ID-NO 21_34. Method of manufacture 2024201873 22 Mar 2024 In a further aspect, the invention provides methods for manufacturing the antisense oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the 5 method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or 10 conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. Pharmaceutical Compositions In a further aspect, the invention provides pharmaceutical compositions comprising an antisense oligonucleotides and / or conjugate compounds of the invention or salts thereof and a 15 pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A typical pharmaceutical composition is prepared by mixing antisense oligonucleotide or conjugate compound of the invention and a diluent, carrier, or excipient. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In 20 some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300pM solution. For nucleic acid molecules, antisense oligonucleotides and conjugate compound comprising these suitable formulations are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug 25 delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007 / 031091. 30 The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term “pharmaceutically acceptable salt” refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the compounds of the present invention and are formed from suitable nontoxic organic or inorganic acids or organic or inorganic bases. Acid-addition salts include for 35 example those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid and nitric acid, and those derived 2024201873 22 Mar 2024 from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, and the like. Base-addition salts include those derived from ammonium, potassium, sodium and, quaternary ammonium hydroxides, such as for example, tetramethyl ammonium hydroxide. The chemical modification 5 of a pharmaceutical compound into a salt is a technique well known to pharmaceutical chemists in order to obtain improved physical and chemical stability, hygroscopicity, flowability and solubility of compounds. It is for example described in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, the pharmaceutically 10 acceptable salt of the compounds provided herein may be a sodium salt or potassium salt. Applications The oligonucleotides of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis. In research, such oligonucleotides may be used to specifically modulate the synthesis of 15 PAPD5 and PAPD7 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein. 20 If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA. Also encompassed by the present invention is an in vivo or in vitro method for modulating PAPD5 and PAPD7 expression in a target cell which is expressing PAPD5 and PAPD7, said method comprising administering an antisense oligonucleotide, conjugate compound or 25 pharmaceutical composition of the invention in an effective amount to said cell. In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments the target cell is present in in the liver. The target cell may be a hepatocyte. 30 One aspect of the present invention is related the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention for use as a medicament. In an aspect of the invention the antisense oligonucleotide, conjugate compound or pharmaceutical composition of the invention is capable of inhibiting the propagation of HBV. In particular the antisense oligonucleotide is capable of affecting one or more of the following 35 parameters i) reduce the expression of viral RNA; ii) reduce the production of viral DNA (HBV 2024201873 22 Mar 2024 DNA) derived from viral RNA (HBV RNA), iii) reduce the production of new viral particles (HBV particles); iv) reduce production of HBV antigens, in particular HBsAg and / or HBeAg. For example, an antisense oligonucleotide that inhibits propagation of HBV may reduce i) the expression of viral RNA (HBV RNA) by at least 40% such as 50%, 60%, 70%, 80%, or 90% 5 reduction compared to controls; ii) the production of viral DNA (HBV DNA) by at least 40% such as 50%, 60%, 70%, 80%, or 90% reduction compared to controls; iii) the production of new viral particles (HBV particles) by at least 40% such as 50%, 60%, 70%, 80%, or 90% reduction compared to controls; or iv) the production and / or secretion of HBsAg and / or HBeAg by at least 50%, such as at least 60%, 70%, 80%, 90% or even up to complete depletion of one or both of 10 the antigens compared to controls. The controls may be untreated cells or animals or cell or animal treated with an appropriate control. Inhibition of propagation of HBV may be measured in vitro using HBV infected dHepaRG cells or ASGPR-dHepaRG cells or in vivo for oligonucleotides complementary to mouse PAPD5 and PAPD7 using the AAV / HBV mouse model as described in the Materials and Methods section. 15 Inhibition of secretion of HBsAg and / or HBeAg may be measured by ELISA, e.g. by using the CLIA ELISA Kit (Autobio Diagnostic) according to the manufacturers’ instructions. Inhibition of production of intracellular HBV mRNA may be measured by real-time PCR, e.g. as described in the Materials and Methods section. Further methods for evaluating whether a test compound inhibits propagation of HBV are measuring secretion of HBV DNA by RT-qPCR e.g. as 20 described in WO 2015 / 173208 or as described in Materials and method section; Northern Blot; in-situ hybridization, or immuno-fluorescence. Due to the reduction of HBsAg secretion the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the present invention can be used to inhibit development of or in the treatment of HBV infection. In particular, due to inhibition of HBeAg secretion, the 25 antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the present invention more efficiently inhibits development of or treats a chronic HBV infection as compared to a compound that only reduces secretion of HBsAg. In addition, reducing HBeAg in an expecting mother may also inhibit the development of a chronic HBV infection of her child. Thus, due to the reduction of HBeAg secretion the antisense oligonucleotides, conjugate 30 compounds or pharmaceutical compositions of the present invention inhibits development of a chronic HBV infection (such as development of a chronic HBV infection in the offspring of an HBV infected mother) and reduces the infectiousness of a HBV infected person. Accordingly, one aspect of the present invention is related to use of the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention to 35 reduce secretion of HBsAg and HBeAg in an HBV infected individual. It is advantageous if the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the 2024201873 22 Mar 2024 invention are capable of reducing HBsAg expression from HBV DNA integrated into the host genome. A further aspect of the invention relates to the use of the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention to inhibit development of or treat a 5 chronic HBV infection. A further aspect of the invention relates to the use of the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention to and reduces the infectiousness of a HBV infected person. In a particular aspect of the invention, the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention inhibits development of 10 a chronic HBV infection in the offspring of a HBV infected mother. This mother is preferably HBeAg positive. The subject to be treated with the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention (or which prophylactically receives antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the present 15 invention) is preferably a human, more preferably a human patient who is HBsAg positive and / or HBeAg positive, even more preferably a human patient that is HBsAg positive and HBeAg positive. Said human patient may be an expected mother, e.g. an expected mother who is HBeAg positive and / or HBsAg positive, more preferably an expected mother who is HBeAg positive and HBsAg positive. 20 Accordingly, the present invention relates to a method of treating and / or preventing a HBV infection, wherein the method comprises administering an effective amount of the antisense oligonucleotides, conjugate compounds or pharmaceutical compositions of the invention. The invention also provides for the use of a nucleic acid molecule, an antisense oligonucleotide, a conjugate compound or a pharmaceutical composition of the invention for the manufacture of 25 a medicament, in particular a medicament for use in the treatment or prevention of HBV infection or chronic HBV infection or reduction of the infectiousness of a HBV infected person. In preferred embodiments the medicament is manufactured in a dosage form for subcutaneous administration. The invention also provides for the use of a nucleic acid molecule, an antisense oligonucleotide, 30 a conjugate compound, the pharmaceutical composition of the invention for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration. The nucleic acid molecule, antisense oligonucleotide or the pharmaceutical composition of the invention may be used in a combination therapy. For example, nucleic acid molecule, antisense oligonucleotide, or the pharmaceutical composition of the invention may be combined with other 35 anti-HBV agents such as interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), 2024201873 22 Mar 2024 adefovir, or other emerging anti-HBV agents such as a HBV RNA replication inhibitor, a HBsAg secretion inhibitor, a HBV capsid inhibitor, an antisense oligomer (e.g. as described in WO2012 / 145697 and WO 2014 / 179629), a siRNA (e.g. described in WO 2005 / 014806, WO 2012 / 024170, WO 2012 / 2055362, WO 2013 / 003520, WO 2013 / 159109, WO 2017 / 027350 and 5 WO2017 / 015175), a HBV therapeutic vaccine, a HBV prophylactic vaccine, a HBV antibody therapy (monoclonal or polyclonal), or TLR 2, 3, 7, 8 or 9 agonists for the treatment and / or prophylaxis of HBV. Administration The antisense oligonucleotides, conjugate compounds or pharmaceutical composition of the 10 invention is formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular mammal being treated, the clinical condition of the individual patient, the site of delivery of the agent, the method of administration, the scheduling of administration, the age and sex of the patients and other factors known to medical practitioners. Herein, an “effective amount” (also known as 15 “(therapeutically) effective dose”) means the amount of a compound that will elicit the biological or medical response of a subject that is being sought by a medical doctor or other clinician. The “effective amount” of an antisense oligonucleotide, conjugate compound or pharmaceutical composition of the invention, will be governed by such considerations, and is the minimum amount necessary to inhibit HBsAg and / or HBeAg. For example, such amount may be below 20 the amount that is toxic to the cells of the recipient, or to the mammal as a whole. In some embodiments, the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 - 15 mg / kg, such as from 0.2-10 mg / kg, such as from 0.25 - 5 mg / kg. The administration can be once a week, every 2nd week, every third week or even once a month. 25 The nucleic acid molecules or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal). In a preferred embodiment the nucleic acid molecule, antisense oligonucleotide, conjugate 30 compounds or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion. In one embodiment the active oligonucleotide or oligonucleotide conjugate is administered intravenously. With GalNAc conjugated compounds it may be advantageous to administer subcutaneously in order to delay saturation of the ASGP 35 reseptor. 2024201873 22 Mar 2024 Combination therapies In some embodiments the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or 5 disorders described above. By way of example, the oligomer or the oligomer conjugate of the present invention may be used in combination with other actives, such as oligonucleotide-based antivirals - such as sequence specific oligonucleotide-based antivirals - acting either through antisense (including other LNA oligomers), siRNAs (such as ARC520), aptamers, morpholinos or any other antiviral, 10 nucleotide sequence-dependent mode of action. By way of further example, the oligomer or the oligomer conjugate of the present invention may be used in combination with other actives, such as immune stimulatory antiviral compounds, such as interferon (e.g. pegylated interferon alpha), TLR7 agonists (e.g. GS-9620), or therapeutic vaccines. 15 By way of further example, the oligomer or the oligomer conjugate of the present invention may be used in combination with other actives, such as small molecules, with antiviral activity. These other actives could be, for example, nucleoside / nucleotide inhibitors (eg entecavir or tenofovir disoproxil fumarate), encapsidation inhibitors, entry inhibitors (eg Myrcludex B). In certain embodiments, the additional therapeutic agent may be an HBV agent, an Hepatitis C 20 virus (HCV) agent, a chemotherapeutic agent, an antibiotic, an analgesic, a nonsteroidal antiinflammatory (NSAID) agent, an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant agent. In particular related embodiments, the additional HBV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV 25 RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal). In other particular related embodiments, the additional HCV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; pegasys; 30 an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; or an HCV monoclonal or polyclonal antibody therapy. Embodiments of the invention The following embodiments of the present invention may be used in combination with any other 35 embodiments described herein. 2024201873 22 Mar 2024 1. A nucleic acid molecule of 12 to 32 nucleotides in length, which comprises a contiguous nucleotide sequence of 12 to 22 nucleotides in length which is capable of inhibiting the expression of both PAPD5 and PAPD7. 2. The nucleic acid molecule of embodiment 1, wherein the contiguous nucleotide 5 sequence is at least 93% complementarity to target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. 3. The nucleic acid molecule of embodiment 1 or 2, wherein the contiguous nucleotide sequence is at least 100% complementarity to target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. 10 4. The nucleic acid molecule of embodiment 1 or 3, wherein the contiguous nucleotide sequence is complementary to target nucleic acid of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. 5. The nucleic acid molecule of embodiment 1 or 3, wherein the contiguous nucleotide sequence is complementary to target nucleic acid of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 15 5 and SEQ ID NO: 6. 6. The nucleic acid molecule of embodiment 1 to 3 or 5, wherein the nucleic acid molecule is complementary to position 759 to 781 on SEQ ID NO: 1 and position 1032 to 1054 on SEQ ID NO: 2. 7. The nucleic acid molecule of embodiment 1 to 4, wherein the nucleic acid molecule is 20 complementary to position 64669 to 69429 on SEQ ID NO: 1 and position 29514 to 29530 on SEQ ID NO: 2. 8. The nucleic acid molecule of embodiment 1 to 4, wherein the nucleic acid molecule is complementary to position 69414 to 69429 on SEQ ID NO: 1 and position 30731 to 30746 on SEQ ID NO: 2. 25 9. The nucleic acid molecule of embodiment 1 to 8 is capable of hybridizing to a target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 with a AG0 below -15 kcal. 10. The nucleic acid molecule of embodiment 2 to 9, wherein the target nucleic acid is RNA. 11. The nucleic acid molecule of embodiment 10, wherein the RNA is pre-mRNA. 12. The nucleic acid molecule of embodiment 1-11, wherein the nucleic acid molecule is 30 selected from antisense oligonucleotide, siRNA or shRNA. 13. The nucleic acid molecule of embodiment 1-11, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide. 2024201873 22 Mar 2024 14. The antisense oligonucleotide of embodiment 12 or 13, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, particularly 15, 16, 17, 18, 19 or 20 contiguous nucleotides. 15. The antisense oligonucleotide of embodiment 12 or 13, wherein the contiguous 5 nucleotide sequence comprises or consists of from 14 to 20 nucleotides. 16. The antisense oligonucleotide of embodiment 15, wherein the contiguous nucleotide sequence comprises or consists of from 16 to 18 nucleotides. 17. The antisense oligonucleotide of embodiment 1 to 16, wherein the oligonucleotide comprises or consists of 14 to 25 nucleotides in length. 10 18. The antisense oligonucleotide of embodiment 17, wherein the antisense oligonucleotide comprises or consists of 15 to 22 nucleotides in length. 19. The antisense oligonucleotide of embodiment 17 or 18, wherein the antisense oligonucleotide comprises or consists of 16 to 20 nucleotides in length. 20. The antisense oligonucleotide of embodiment 12-19, wherein the contiguous nucleotide 15 sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19. 21. The antisense oligonucleotide of embodiment 12-20, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 7, 8, 9, 10, 11, 12, 13, 14, 15 and 16. 20 22. The antisense oligonucleotide of embodiment 12-20, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 17 or SEQ ID NO: 18. 23. The antisense oligonucleotide of embodiment 12-20, wherein the contiguous nucleotide sequence comprises or consists of SEQ ID NO: 19. 25 24. The antisense oligonucleotide of embodiment 12-23, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the target nucleic acids it is complementary to. 25. The antisense oligonucleotide of embodiment 24, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acids. 30 26. The antisense oligonucleotide of embodiment 24, wherein the contiguous nucleotide sequence has two mismatches compared to the target nucleic acids. 27. The antisense oligonucleotide of embodiment 24, wherein the contiguous nucleotide sequence is fully complementary to both target nucleic acid sequences. 2024201873 22 Mar 2024 28. The antisense oligonucleotide of embodiment 12-27, comprising one or more modified nucleosides. 29. The antisense oligonucleotide of embodiment 28, wherein the one or more modified nucleoside is a high-affinity modified nucleosides. 5 30. The antisense oligonucleotide of embodiment 28 or 29, wherein the one or more modified nucleoside is a 2’ sugar modified nucleoside. 31. The antisense oligonucleotide of embodiment 30, wherein the one or more 2’ sugar modified nucleoside is independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, 2’-fluoro- 10 ANA and LNA nucleosides. 32. The antisense oligonucleotide of embodiment 28-31, wherein the one or more modified nucleoside is a LNA nucleoside. 33. The antisense oligonucleotide of embodiment 32, wherein the modified LNA nucleoside is selected from oxy-LNA, amino-LNA, thio-LNA, cET, and ENA. 15 34. The antisense oligonucleotide of embodiment 32 or 33, wherein the modified LNA nucleoside is oxy-LNA with the following 2’-4’ bridge -O-CH2-. 35. The antisense oligonucleotide of embodiment 34, wherein the oxy-LNA is beta-D-oxy-LNA. 36. The antisense oligonucleotide of embodiment 32 or 33, wherein the modified LNA 20 nucleoside is cET with the following 2’-4’ bridge -O-CH(CH3)-. 37. The antisense oligonucleotide of embodiment 36, wherein the cET is (S)cET, i.e. 6’(S)methyl-beta-D-oxy-LNA. 38. The antisense oligonucleotide of embodiment 32 or 33, wherein the LNA is ENA, with the following 2’ - 4’ bridge -O-CH2-CH2-. 25 39. The antisense oligonucleotide of any one of embodiments 12-33, wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage. 40. The antisense oligonucleotide of embodiment 39, wherein the modified internucleoside linkage is nuclease resistant. 41. The antisense oligonucleotide of embodiment 39 or 40, wherein at least 75% of the 30 internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages. 42. The antisense oligonucleotide of embodiment 39 or 40, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. 2024201873 22 Mar 2024 43. The antisense oligonucleotide of embodiment 41 or 42, wherein at least one of the phosphorothioate internucleoside linkages are stereodefined 44. The antisense oligonucleotide of embodiment 12-43, wherein the antisense oligonucleotide is capable of recruiting RNase H. 5 45. The antisense oligonucleotide of embodiment 44, wherein the antisense oligonucleotide or the contiguous nucleotide sequence is a gapmer. 46. The antisense oligonucleotide of embodiment 45, wherein the gapmer has the formula 5’-F-G-F’-3’, where the F and F’ wing regions independently comprise or consist of 1 - 7 2’ sugar modified nucleosides in accordance with embodiments 31 to 38 and G is a region 0 between 5 and 16 nucleosides which are capable of recruiting RNaseH. 47. The antisense oligonucleotide of embodiment 46, wherein each wing (F and F’) is characterized by having at least one 2’ sugar modified nucleoside at the 5’ terminal and the 3’ terminal of the wing and the G region has at least one DNA nucleoside adjacent to the wing regions (e.g. 5’ and 3’ terminal of the G region). 15 48. The antisense oligonucleotide of embodiment 46 or 47, wherein all the 2’ sugar modified nucleosides in region F and F’ are identical LNA nucleosides. 49. The oligonucleotide of embodiment 46 - 48, wherein the F region is between 1 and 6 nucleotides in length and consists of 1-5 identical LNA nucleosides and 0-3 DNA nucleosides; and the F’ region is between 2 and 6 nucleotides in length and consists of 2-5 identical LNA nucleosides and 0-3 DNA nucleosides; and the G region is between 5 and 11 nucleotides which are capable of recruiting RNaseH, and optionally a D’ region with 1 to 3 phosphodiester linked DNA nucleosides are positioned at the 5’ end of the F region 50. The antisense oligonucleotide of embodiment 47, wherein region F and F’ consist of identical LNA nucleosides. 51. The antisense oligonucleotide of embodiment 46-48, wherein all the 2’ sugar modified nucleosides in region F and F’ are oxy-LNA nucleosides. 30 52. The antisense oligonucleotide of embodiment 46 or 47, wherein at least one of region F or F’ further comprises at least one 2’ substituted modified nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA and 2’-fluoro-DNA. 2024201873 22 Mar 2024 53. The antisense oligonucleotide of embodiment 46-52, wherein the RNaseH recruiting nucleosides in region G are independently selected from DNA, alpha-L-LNA, C4’ alkylated DNA, ANA and 2' F-ANA and UNA. 54. The antisense oligonucleotide of embodiment 53, wherein the nucleosides in region G is 5 DNA and / or alpha-L-LNA nucleosides. 55. The antisense oligonucleotide of embodiment 46 or 53 or 54, wherein region G consists of at least 75% DNA nucleosides. 56. The antisense oligonucleotide of embodiment 55, where all the nucleosides in region G are DNA nucleosides. 10 57. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 7_1 to 7_83, or pharmaceutically acceptable salts thereof. 58. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 8_1 to 8_81, or pharmaceutically acceptable salts 15 thereof. 59. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 9_1 to 9_12, or pharmaceutically acceptable salts thereof. 60. The antisense oligonucleotide of embodiment 12-55, wherein the antisense 20 oligonucleotide is selected from CMP ID NO: 10_1 to 10_18, or pharmaceutically acceptable salts thereof. 61. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 11_1 to 11_26, or pharmaceutically acceptable salts thereof. 25 62. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 12_1 to 12_15, or pharmaceutically acceptable salts thereof. 63. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 13_1 or 13_2, or pharmaceutically acceptable 30 salts thereof. 64. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 14_1 to 14_13, or pharmaceutically acceptable salts thereof. 2024201873 22 Mar 2024 65. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 15_1 to 15_21, or pharmaceutically acceptable salts thereof. 66. The antisense oligonucleotide of embodiment 12-55, wherein the antisense 5 oligonucleotide is selected from CMP ID NO: 16_1 to 16_5, or pharmaceutically acceptable salts thereof. 67. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 17_1 to 17183, or pharmaceutically acceptable salts thereof. 10 68. The antisense oligonucleotide of embodiment 12-55, wherein the antisense oligonucleotide is selected from CMP ID NO: 18_1 to 18_31 or 18_250 to 18_361, or pharmaceutically acceptable salts thereof. 69. The antisense oligonucleotide of embodiment 68, wherein the antisense oligonucleotide is selected from CMP ID NO: 18_1, 18_5, 18_10, 18_15, 18_18, 18_19, 18_24, 18_27, 18_30, 15 18_346, 18_347, 18_357, 17_10, 17_137 and 17_139, or pharmaceutically acceptable salts thereof. 70. The antisense oligonucleotide of embodiment 69, wherein the antisense oligonucleotide is selected from CMP ID NO: 18_1, 18_15, 18_27, 18_30, 17_10, 17_137 and 17_139. 71. The antisense oligonucleotide of embodiment 12-55, wherein the antisense 20 oligonucleotide is selected from CMP ID NO: 18_32 to 18_249 or 18_362 to 18_610, or pharmaceutically acceptable salts thereof. 72. The antisense oligonucleotide of embodiment 71, wherein the antisense oligonucleotide is selected from CMP ID NO: 18_223, 18_36, 18_196, 18_188 and 18_243. 73. The antisense oligonucleotide of embodiment 12-55, wherein the antisense 25 oligonucleotide is selected from CMP ID NO: 19_1 to 19_22, or pharmaceutically acceptable salts thereof. 74. A conjugate compound comprising a nucleic acid molecule according to any one of claims 1 to 11 or an antisense oligonucleotide according to any one of claims 12-57, and at least one conjugate moiety covalently attached to said antisense oligonucleotide. 30 75. The conjugate compound of embodiment 74, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof. 76. The conjugate compound of embodiment 74 or 75, wherein the conjugate moiety is 35 capable of binding to the asialoglycoprotein receptor. 2024201873 22 Mar 2024 77. The conjugate compound of embodiment 76, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. 5 78. The conjugate compound of embodiment 77, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). 79. The conjugate compound of embodiment 77 or 78, wherein the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. 0 80. The conjugate compound of embodiment 79, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer linking each GalNAc moiety to a brancher molecule that can be conjugated to the antisense compound. 81. The conjugate compound of embodiment 80, wherein the spacer is a PEG spacer. 82. The conjugate compound of embodiment 76 to 81, wherein the conjugate moiety is a tri- 15 valent N-acetylgalactosamine (GalNAc) moiety. 83. The conjugate compound of embodiment 76 to 82, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in figure 1. 84. The conjugate compound of embodiment 83, wherein the conjugate moiety is the trivalent GalNAc moiety in figure 1D. 20 85. The conjugate compound of embodiment 74-84, comprising a linker which is positioned between the nucleic acid molecule or the antisense oligonucleotide and the conjugate moiety. 86. The conjugate compound of embodiment 85, wherein the linker is a physiologically labile linker. 87. The conjugate compound of embodiment 86, wherein the physiologically labile linker is 25 nuclease susceptible linker. 88. The oligonucleotide conjugate of embodiment 86 or 87, wherein the physiologically labile linker is composed of 2 to 5 consecutive phosphodiester linkages. 89. The conjugate compound of embodiment 86 to 88, wherein the antisense oligonucleotide has the formula D’-F-G-F’ or F-G-F’-D”, wherein F, F’ and G are as defined in 30 embodiments 46-56 and D’ or D” comprises 1, 2 or 3 DNA nucleosides with phosphodiester internucleoside linkages. 90. The oligonucleotide conjugate of embodiment 88 or 89, wherein at least two consecutive phosphodiester internucleoside linkages are associated with a CA dinucleotide. 2024201873 22 Mar 2024 91. The conjugate compound of embodiment 76-90, which display improved cellular distribution between liver vs. kidney or improved cellular uptake into the liver of the conjugate compound as compared to an unconjugated nucleic acid molecule or antisense oligonucleotide. 92. The conjugate compound of embodiment 76-91, where in the conjugate compound is 5 selected from the group consisting of CPM ID NO 20_12, 20_13, 20_14, 20_15, 20_16, 20_18, 20_20, 20_21, 20_22, 20_30, 20_35, 20_36, 21_2, 21_33 and 21_34. 93. A pharmaceutical composition comprising a nucleic acid molecule according to any one of embodiments 1 to 11, an antisense oligonucleotide of embodiment 12-73, a conjugate compound of embodiment 74-92 or acceptable salts thereof and a pharmaceutically acceptable 10 diluent, carrier, salt and / or adjuvant. 94. A method for manufacturing the antisense oligonucleotide of embodiment 12-73, comprising reacting nucleotide units thereby forming covalently linked contiguous nucleotide units comprised in the antisense oligonucleotide. 95. The method of embodiment 94, further comprising reacting the contiguous nucleotide 15 sequence with a non-nucleotide conjugation moiety as described in any one of claims 76-84. 96. A method for manufacturing the composition of embodiment 93, comprising mixing the antisense oligonucleotide with a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. 97. An in vivo or in vitro method for modulating PAPD5 and PAPD7 expression in a target 20 cell which is expressing PAPD5 and PAPD7, said method comprising administering the nucleic acid molecule of any one of embodiments 1 to 11, the antisense oligonucleotide of any one of embodiments 12-73 or the conjugate compound of any one of embodiment 74-92 or the pharmaceutical composition of embodiment 93 in an effective amount to said cell. 98. The method of embodiments 97, wherein the PAPD5 and PAPD7 expression is reduced 25 by at least 30%, or at least or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% in the target cell compared to the level without any treatment. 99. A method for treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of the nucleic acid molecule any one of embodiments 1 to 30 11, the antisense oligonucleotide of any one of embodiments 12-73 or the conjugate compound of any one of embodiments 74-92 or the pharmaceutical composition of embodiment 93 to a subject suffering from or susceptible to the disease. 100. The nucleic acid molecule any one of embodiments 1 to 11, the antisense oligonucleotide of any one of embodiments 12-57 or the conjugate compound of any one of 2024201873 22 Mar 2024 embodiments 74-92 or the pharmaceutical composition of embodiment 93, for use as a medicament for treatment or prevention of a disease in a subject. 101. Use of the nucleic acid molecule any one of embodiments 1 to 11, the antisense oligonucleotide of any one of embodiment 12-73 or the conjugate compound of any one of 5 embodiment 74-92 for the preparation of a medicament for treatment or prevention of a disease in a subject. 102. The method, the nucleic acid molecule, or the use of embodiments 99-101, wherein the disease is HBV infection or chronic HBV infection. 103. The method, the nucleic acid molecule or the use of embodiments 102, wherein the 10 secretion of HBsAg and / or HBeAg and / or intracellular HBV mRNA and / or HBV DNA is reduced. 104. The method, the nucleic acid molecule or the use of embodiments 102 or 103, wherein HBsAg is reduced by at least 30%, or at least or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the level without any treatment. 15 105. The method, the antisense oligonucleotide or the use of embodiments 99- 104 wherein the subject is a mammal. 106. The method, the antisense oligonucleotide or the use of embodiment 105, wherein the mammal is human. EXAMPLES 20 The Examples illustrate the invention. Material and Methods Oligonucleotide motif sequences and oligonucleotide compounds Table 4: List of oligonucleotide motif sequences targeting human and mouse transcripts Sequences are indicated by SEQ ID NO, the motif sequence and the position they target on the 25 human PAPD5 transcript (SEQ ID NO: 1) and the human PAPD7 transcript (SEQ ID NO: 2). SEQ ID NO Motif Sequence Start ID NO: 1 End ID NO: 1 Start ID NO: 2 End ID NO: 2 7 AGATCTGCATCCACAG 759 774 1032 1047 8 CAGATCTGCATCCACAG 759 775 1032 1048 9 CCAGATCTGCATCCACAG 759 776 1032 1049 10 CCAGATCTGCATCCACA 760 776 1033 1049 11 CCCAGATCTGCATCCAC 761 777 1034 1050 12 CCCAGATCTGCATCCA 762 777 1035 1050 13 TCCCAGATCTGCATCCA 762 778 1035 1051 14 GTCTCCCAGATCTGCAT 765 781 1038 1054 15 TCTCCCAGATCTGCAT 765 780 1038 1053 16 GTCTCCCAGATCTGCA 766 781 1039 1054 Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide. 2024201873 22 Mar 2024 Table 5: Lists oligonucleotides designs and specific antisense oligonucleotide compounds Compounds are indicated by CMP ID NO, and based on the on the motif sequence in table 4. SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 7 1-1-1-7-3-1-2 AgAtctgcatCCAcAG 7 1 -23 7 1-9-3-1-2 AgatctgcatCCAcAG 7 2 -22 7 1-9-2-1-3 AgatctgcatCCaCAG 7 3 -23 7 1-1-2-6-2-2-2 Ag AT ctgcatCCacAG 7 4 -23 7 1-1-1-7-2-2-2 AgAtctgcatCCacAG 7 5 -21 7 1-3-1-5-2-2-2 AgatCtgcatCCacAG 7 6 -22 7 1-9-2-2-2 AgatctgcatCCacAG 7 7 -21 7 2-8-1-1-4 AGatctgcatCcACAG 7 8 -23 7 1-1-1-7-1-1-4 AgAtctgcatCcACAG 7 9 -22 7 1-3-1-5-1-1-4 AgatCtgcatCcACAG 7 10 -22 7 1-9-1-1-4 Ag atctg catCcAC AG 7 11 -21 7 3-7-1-1-1-1-2 AG Atctg catC cAcAG 7 12 -22 7 2-2-1-5-1-1-1-1-2 AGatCtgcatCcAcAG 7 13 -21 7 2-8-1-1-1-1-2 AGatctgcatCcAcAG 7 14 -20 7 1-1-3-5-1-1-1-1-2 AgATCtgcatCcAcAG 7 15 -22 7 1-1-1-1-1-5-1-1-1-1-2 AgAtCtgcatCcAcAG 7 16 -20 7 1-1-1-7-1-1-1-1-2 AgAtctgcatCcAcAG 7 17 -19 7 1-2-2-5-1-1-1-1-2 AgaTCtgcatCcAcAG 7 18 -21 7 1-3-1-5-1-1-1-1-2 AgatCtgcatCcAcAG 7 19 -20 7 1-9-1-1-1-1-2 Ag atctg catCcAcAG 7 20 -19 7 1-1-2-6-1-2-3 Ag AT ctgcatCcaCAG 7 21 -23 7 1-1-1-7-1-2-3 AgAtctgcatCcaCAG 7 22 -21 7 1-3-1-5-1-2-3 AgatCtgcatCcaCAG 7 23 -22 7 1-9-1-2-3 AgatctgcatCcaCAG 7 24 -21 7 3-7-1-3-2 AGAtctgcatCcacAG 7 25 -22 7 2-2-1-5-1-3-2 AGatCtgcatCcacAG 7 26 -21 7 2-8-1-3-2 AGatctgcatCcacAG 7 27 -20 7 1-1-3-5-1-3-2 AgATCtgcatCcacAG 7 28 -22 7 1-1-1-1-1-5-1-3-2 Ag AtCtg catC cacAG 7 29 -20 7 1-1-1-7-1-3-2 AgAtctgcatCcacAG 7 30 -19 7 1-2-2-5-1-3-2 AgaTCtgcatCcacAG 7 31 -21 7 1-3-1-5-1-3-2 AgatCtgcatCcacAG 7 32 -20 7 1-9-1-3-2 AgatctgcatCcacAG 7 33 -19 7 1-1-1-8-5 Ag Atctg catcCACAG 7 34 -23 7 1-10-5 AgatctgcatcCACAG 7 35 -23 7 2-2-1-6-2-1-2 AGatCtgcatcCAcAG 7 36 -22 7 2-9-2-1-2 AGatctgcatcCAcAG 7 37 -21 7 1-1-2-7-2-1-2 Ag AT ctgcatcCAcAG 7 38 -22 7 1-1-1-1-1-6-2-1-2 Ag AtCtg catcCAcAG 7 39 -22 7 1-1-1-8-2-1-2 AgAtctgcatcCAcAG 7 40 -21 7 1-3-1-6-2-1-2 Ag atCtg catcCAcAG 7 41 -21 7 1-10-2-1-2 AgatctgcatCCAcAG 7 42 -20 7 1-1-1-8-1-1-3 AgAtctgcatcCaCAG 7 43 -21 7 1-3-1-6-1-1-3 AgatCtgcatcCaCAG 7 44 -22 7 1-10-1-1-3 AgatctgcatcCaCAG 7 45 -21 7 3-1-1-6-1-2-2 AGAtCtgcatcCacAG 7 46 -22 7 2-2-1-6-1-2-2 AGatCtgcatcCacAG 7 47 -21 7 1-1-3-6-1-2-2 AgATCtgcatcCacAG 7 48 -22 7 1-1-1-1-1-6-1-2-2 AgAtCtgcatcCacAG 7 49 -20 7 1-1-1-8-1-2-2 AgAtctgcatcCacAG 750 -19 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 7 1-2-2-6-1-2-2 AgaTCtgcatcCacAG 7 51 -21 7 1-3-1-6-1-2-2 AgatCtgcatcCacAG 7 52 -20 7 1-10-1-2-2 AgatctgcatcCacAG 7 53 -19 7 1-1-1-1-1-7-4 AgAtCtgcatccACAG 7 54 -22 7 1-1-1-9-4 Ag Atctg catccAC AG 7 55 -21 7 1-2-2-7-4 AgaTCtgcatccACAG 7 56 -23 7 1-3-1-7-4 AgatCtgcatccACAG 7 57 -22 7 1-11-4 AgatctgcatccACAG 7 58 -21 7 3-1-1-7-1-1-2 AGAtCtgcatccAcAG 7 59 -22 7 3-9-1-1-2 AG Atctg catccAcAG 7 60 -21 7 2-2-1-7-1-1-2 AGatCtgcatccAcAG 7 61 -20 7 1-1-3-7-1-1-2 Ag AT CtgcatccAcAG 7 62 -22 7 1-1-1-1-1-7-1-1-2 Ag AtCtg catccAcAG 7 63 -20 7 1-1-1-9-1-1-2 AgAtctgcatccAcAG 7 64 -19 7 1-2-2-7-1-1-2 AgaTCtgcatccAcAG 7 65 -20 7 1-3-1-7-1-1-2 AgatCtgcatccAcAG 7 66 -19 7 1-11-1-1-2 AgatctgcatccAcAG 7 67 -18 7 3-10-3 AG Atctg catcca C AG 7 68 -23 7 1-1-1-1-1-8-3 AgAtCtgcatccaCAG 7 69 -22 7 1-1-1-10-3 AgAtctgcatccaCAG 7 70 -21 7 1-2-2-8-3 AgaTCtgcatccaCAG 7 71 -22 7 1-3-1-8-3 AgatCtgcatccaCAG 7 72 -21 7 1-12-3 AgatctgcatccaCAG 7 73 -20 7 3-1-1-9-2 AGAtCtgcatccacAG 7 74 -22 7 3-11-2 AG Atctg catcca cAG 7 75 -21 7 2-1-2-9-2 AGaT CtgcatccacAG 7 76 -21 7 2-2-1-9-2 AGatCtgcatccacAG 7 77 -20 7 1-1-3-9-2 Ag AT Ctg catccacAG 7 78 -21 7 1-1-1-1-1-9-2 AgAtCtgcatccacAG 7 79 -19 7 1-1-1-11-2 AgAtctgcatccacAG 7 80 -18 7 1-2-2-9-2 AgaTCtgcatccacAG 7 81 -20 7 1-3-1-9-2 AgatCtgcatccacAG 7 82 -19 7 1-13-2 AgatctgcatccacAG 7 83 -18 8 1-2-1-7-2-2-2 CagAtctgcatCCacAG 8 1 -23 8 1-3-1-6-2-2-2 CagaT ctgcatCCacAG 8 2 -23 8 1-10-2-2-2 CagatctgcatCCacAG 8 3 -22 8 1-2-1-7-1-1-4 CagAtctgcatCcACAG 8 4 -23 8 1-10-1-1-4 CagatctgcatCcACAG 8 5 -23 8 2-1-1-7-1-1-1-1-2 CAg Atctg catC cAcAG 8 6 -23 8 2-3-1-5-1-1-1-1-2 CAgatCtgcatCcAcAG 8 7 -23 8 2-9-1-1-1-1-2 CAgatctgcatCcAcAG 8 8 -22 8 1-1-2-7-1-1-1-1-2 CaG Atctg catCcAcAG 8 9 -23 8 1-1-1-2-1-5-1-1-1-1-2 CaGatCtgcatCcAcAG 8 10 -22 8 1-1-1-8-1-1-1-1-2 CaGatctgcatCcAcAG 8 11 -21 8 1-2-1-1-1-5-1-1-1-1-2 CagAtCtgcatCcAcAG 8 12 -22 8 1-2-1-7-1-1-1-1-2 CagAtctgcatCcAcAG 8 13 -21 8 1-3-2-5-1-1-1-1-2 CagaTCtgcatCcAcAG 8 14 -22 8 1-4-1-5-1-1-1-1-2 CagatCtgcatCcAcAG 8 15 -21 8 1-10-1-1-1-1-2 CagatctgcatCcAcAG 8 16 -20 8 1-2-1-7-1-2-3 CagAtctgcatCcaCAG 8 17 -23 8 1-10-1-2-3 CagatctgcatCcaCAG 8 18 -22 8 2-1-1-7-1-3-2 CAg Atctg catCca cAG 8 19 -23 8 2-3-1-5-1-3-2 CAgatCtgcatCcacAG 8 20 -23 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 8 2-9-1-3-2 CAgatctgcatCcacAG 8 21 -22 8 1-1-2-7-1-3-2 CaGAtctgcatCcacAG 8 22 -23 8 1-1-1-2-1-5-1-3-2 CaGatCtgcatCcacAG 8 23 -22 8 1-1-1-8-1-3-2 CaGatctgcatCcacAG 8 24 -21 8 1-2-1-1-1-5-1-3-2 CagAtCtgcatCcacAG 8 25 -22 8 1-2-1-7-1-3-2 CagAtctgcatCcacAG 8 26 -21 8 1-3-2-5-1-3-2 CagaTCtgcatCcacAG 8 27 -22 8 1-4-1-5-1-3-2 CagatCtgcatCcacAG 8 28 -21 8 1-10-1-3-2 CagatctgcatCcacAG 8 29 -20 8 1-2-1-8-5 Gag Atctg catcC AC AG 8 30 -24 8 1-2-1-1-1-6-2-1-2 Cag AtCtg catcC AcAG 8 31 -23 8 1-2-1-8-2-1-2 Cag Atctg catcC AcAG 8 32 -22 8 1-4-1-6-2-1-2 CagatCtgcatcCAcAG 8 33 -22 8 1-11-2-1-2 CagatctgcatcCAcAG 8 34 -21 8 1-2-1-8-1-1-3 CagAtctgcatcCaCAG 8 35 -22 8 1-4-1-6-1-1-3 CagatCtgcatcCaCAG 8 36 -23 8 1-11-1-1-3 CagatctgcatcCaCAG 8 37 -22 8 2-1-1-8-1-2-2 CAgAtctgcatcCacAG 8 38 -22 8 2-3-1-6-1-2-2 CAgatCtgcatcCacAG 8 39 -23 8 2-10-1-2-2 CAgatctgcatcCacAG 8 40 -22 8 1-1-2-1-1-6-1-2-2 CaG AtCtg catcCa cAG 8 41 -23 8 1-1-1-2-1-6-1-2-2 CaGatCtgcatcCacAG 8 42 -22 8 1-2-3-6-1-2-2 CagATCtgcatcCacAG 8 43 -23 8 1-2-1-1-1-6-1-2-2 CagAtCtgcatcCacAG 8 44 -21 8 1-2-1-8-1-2-2 CagAtctgcatcCacAG 8 45 -20 8 1-3-2-6-1-2-2 CagaT CtgcatcCacAG 8 46 -22 8 1-4-1-6-1-2-2 CagatCtgcatcCacAG 8 47 -21 8 1-11-1-2-2 CagatctgcatcCacAG 8 48 -20 8 2-1-1-9-4 CAg Atctg catccAC AG 8 49 -24 8 1-2-1-1-1-7-4 Cag AtCtg catccAC AG 8 50 -23 8 1-4-1-7-4 CagatCtgcatccACAG 8 51 -23 8 1-12-4 CagatctgcatccACAG 8 52 -22 8 2-1-1-1-1-7-1-1-2 CAg AtCtg catccAcAG 8 53 -23 8 2-1-1-9-1-1-2 CAg Atctg catccAcAG 8 54 -22 8 2-3-1-7-1-1-2 CAgatCtgcatccAcAG 8 55 -22 8 2-11-1-1-2 C Ag atctg catccAcAG 8 56 -21 8 1-1-2-1-1-7-1-1-2 CaGAtCtgcatccAcAG 8 57 -23 8 1-1-1-2-1-7-1-1-2 CaGatCtgcatccAcAG 8 58 -21 8 1-2-3-7-1-1-2 CagAT CtgcatccAcAG 8 59 -23 8 1-2-1-1-1-7-1-1-2 CagAtCtgcatccAcAG 8 60 -21 8 1-2-1-9-1-1-2 CagAtctgcatccAcAG 8 61 -20 8 1-3-2-7-1-1-2 CagaTCtgcatccAcAG 8 62 -22 8 1-4-1-7-1-1-2 CagatCtgcatccAcAG 8 63 -20 8 1-12-1-1-2 CagatctgcatccAcAG 8 64 -19 8 2-1-1-10-3 CAgAtctgcatccaCAG 8 65 -24 8 1-2-1-1-1-8-3 CagAtCtgcatccaCAG 8 66 -23 8 1-2-1-10-3 CagAtctgcatccaCAG 8 67 -22 8 1-4-1-8-3 CagatCtgcatccaCAG 8 68 -22 8 1-13-3 CagatctgcatccaCAG 8 69 -21 8 2-1-1-1-1-9-2 C Ag AtC tg catcca cAG 8 70 -23 8 2-1-1-11-2 CAgAtctgcatccacAG 8 71 -22 8 2-2-2-9-2 CAgaTCtgcatccacAG 8 72 -23 8 2-3-1-9-2 CAgatCtgcatccacAG 8 73 -22 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 8 2-13-2 CAgatctgcatccacAG 8 74 -21 8 1-1-2-1-1-9-2 CaGAtCtgcatccacAG 8 75 -23 8 1-1-1-2-1-9-2 CaGatCtgcatccacAG 8 76 -21 8 1-2-1-1-1-9-2 CagAtCtgcatccacAG 8 77 -21 8 1-2-1-11-2 CagAtctgcatccacAG 8 78 -20 8 1-3-2-9-2 CagaTCtgcatccacAG 8 79 -21 8 1-4-1-9-2 CagatCtgcatccacAG 8 80 -20 8 1-14-2 CagatctgcatccacAG 8 81 -19 9 1-3-1-7-1-1-1-1-2 CcagAtctgcatCcAcAG 9 1 -24 9 1-1-1-1-1-7-1-3-2 CcAg Atctg catC ca cAG 9 2 -24 9 1-1-1-10-1-2-2 CcAgatctgcatcCacAG 9 3 -23 9 1-12-1-2-2 CcagatctgcatcCacAG 9 4 -23 9 1-1-1-1-1-9-1-1-2 CcAgAtctgcatccAcAG 9 5 -23 9 1-1-1-11-1-1-2 CcAgatctgcatccAcAG 9 6 -23 9 1-3-1-9-1-1-2 CcagAtctgcatccAcAG 9 7 -23 9 1-13-1-1-2 CcagatctgcatccAcAG 9 8 -22 9 1-3-1-10-3 Ccag Atctg catcca CAG 9 9 -25 9 2-2-1-11-2 CCagAtctgcatccacAG 9 10 -25 9 1-1-1-13-2 CcAgatctgcatccacAG 9 11 -23 9 1-2-2-11-2 CcaGAtctgcatccacAG 9 12 -25 10 1-3-1-6-1-3-2 CcagAtctgcaT ccaCA 10 1 -23 10 1-3-1-7-1-1-3 CcagAtctgcatCcACA 10 2 -24 10 1-1-1-9-1-2-2 CcAgatctgcatCcaCA 10 3 -23 10 1-3-1-7-1-2-2 CcagAtctgcatCcaCA 10 4 -23 10 1-11-1-2-2 CcagatctgcatCcaCA 10 5 -23 10 1-3-1-8-4 CcagAtctgcatcCACA 10 6 -25 10 1-1-1-10-1-1-2 CcAgatctgcatcCaCA 10 7 -23 10 1-3-1-8-1-1-2 CcagAtctgcatcCaCA 10 8 -23 10 1-12-1-1-2 CcagatctgcatcCaCA 10 9 -22 10 1-1-1-1-1-9-3 C cAg Atctg catccAC A 10 10 -23 10 1-1-1-11-3 CcAgatctgcatccACA 10 11 -23 10 1-3-1-9-3 CcagAtctgcatccACA 10 12 -23 10 1-13-3 CcagatctgcatccACA 10 13 -22 10 1-1-1-1-1-10-2 CcAgAtctgcatccaCA 10 14 -23 10 1-1-1-12-2 CcAgatctgcatccaCA 10 15 -22 10 1-2-2-10-2 CcaGAtctgcatccaCA 10 16 -24 10 1-3-1-10-2 CcagAtctgcatccaCA 10 17 -22 10 1-14-2 CcagatctgcatccaCA 10 18 -22 11 1-1-1-8-1-1-1-1-2 CcCagatctgcAtCcAC 11 1 -23 11 1-2-1-7-1-1-1-1-2 CccAgatctgcAtCcAC 11 2 -23 11 1-10-1-1-1-1-2 CccagatctgcAtCcAC 11 3 -23 11 1-1-1-8-1-2-3 CcCagatctgcAtcCAC 11 4 -25 11 1-2-1-7-1-2-3 CccAg atctg cAtcC AC 11 5 -25 11 1-10-1-2-3 Cccag atctg cAtcC AC 11 6 -24 11 2-1-1-7-1-3-2 CCcAgatctgcAtccAC 11 7 -25 11 2-9-1-3-2 CCcagatctgcAtccAC 11 8 -24 11 1-1-2-7-1-3-2 CcCAgatctgcAtccAC 11 9 -25 11 1-1-1-1-1-6-1-3-2 CcCaGatctgcAtccAC 11 10 -23 11 1-1-1-8-1-3-2 CcCagatctgcAtccAC 11 11 -23 11 1-2-2-6-1-3-2 C ccAGa tctg cAtccAC 11 12 -24 11 1-2-1-1-1-5-1-3-2 CccAgAtctgcAtccAC 11 13 -23 11 1-2-1-7-1-3-2 CccAg atctg cAtccAC 11 14 -23 11 1-10-1-3-2 CccagatctgcAtccAC 11 15 -22 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 11 1-2-1-1-1-7-1-1-2 C ccAg Atctg catCcAC 11 16 -24 11 1-12-1-1-2 CccagatctgcatCcAC 11 17 -23 11 1-2-1-1-1-8-3 CccAgAtctgcatcCAC 11 18 -25 11 1-4-1-8-3 CccagAtctgcatcCAC 11 19 -24 11 2-3-1-9-2 CCcagAtctgcatccAC 11 20 -25 11 1-1-2-1-1-9-2 C cCAg Atctg catccAC 11 21 -25 11 1-1-1-1-2-9-2 CcCaGAtctgcatccAC 11 22 -25 11 1-1-1-12-2 CcCagatctgcatccAC 11 23 -23 11 1-2-1-1-1-9-2 CccAgAtctgcatccAC 11 24 -23 11 1-2-1-11-2 CccAg atctg catccAC 11 25 -23 11 1-14-2 CccagatctgcatccAC 11 26 -22 12 1-9-2-2-2 CccagatctgCAtcCA 12 1 -24 12 1-1-1-7-1-3-2 CcCagatctgCatcCA 12 2 -23 12 1-2-1-6-1-3-2 CccAgatctgCatcCA 12 3 -23 12 1-9-1-3-2 CccagatctgCatcCA 12 4 -23 12 1-2-1-7-1-1-3 CccAgatctgcAtCCA 12 5 -25 12 1-10-1-1-3 CccagatctgcAtCCA 12 6 -24 12 2-9-1-2-2 CCcagatctgcAtcCA 12 7 -24 12 1-1-1-8-1-2-2 CcCagatctgcAtcCA 12 8 -23 12 1-2-1-7-1-2-2 CccAgatctgcAtcCA 12 9 -23 12 1-3-1-6-1-2-2 CccaGatctgcAtcCA 12 10 -23 12 1-10-1-2-2 CccagatctgcAtcCA 12 11 -22 12 2-1-1-10-2 CCcAgatctgcatcCA 12 12 -25 12 1-1-1-11-2 CcCagatctgcatcCA 12 13 -22 12 1-2-1-10-2 CccAg atctg catcC A 12 14 -22 12 1-13-2 CccagatctgcatcCA 12 15 -22 13 2-10-1-2-2 TCccagatctgcAtcCA 13 1 -24 13 2-2-1-10-2 TCccAgatctgcatcCA 13 2 -25 14 1-3-1-6-1-1-1-1-2 GtctCccagatCtGcAT 14 1 -24 14 1-4-1-5-1-3-2 GtctcCcag atCtg cAT 14 2 -23 14 1-10-1-3-2 GtctcccagatCtgcAT 14 3 -23 14 1-1-1-2-1-6-1-2-2 GtCtcCcagatcTgcAT 14 4 -24 14 1-4-1-6-1-2-2 GtctcCcag atcT g cAT 14 5 -23 14 1-1-1-1-1-8-1-1-2 GtCtCccagatctGcAT 14 6 -24 14 1-2-2-8-1-1-2 GtcTCccagatctGcAT 14 7 -24 14 1-4-1-7-1-1-2 GtctcCcag atctG cAT 14 8 -23 14 1-4-1-8-3 GtctcCcag atctg CAT 14 9 -25 14 1-1-1-2-1-9-2 GtCtcCcagatctgcAT 14 10 -23 14 1-1-1-12-2 GtCtcccagatctgcAT 14 11 -23 14 1-3-1-10-2 GtctCccagatctgcAT 14 12 -22 14 1-4-1-9-2 GtctcCcag atctg cAT 14 13 -22 15 2-8-1-1-1-1-2 TCtcccagatCtGcAT 15 1 -22 15 1-3-1-5-1-2-3 TctcCcagatCtgCAT 15 2 -23 15 2-1-1-6-1-3-2 T CtCccagatCtg cAT 15 3 -23 15 2-2-1-5-1-3-2 T CtcCcagatCtg cAT 15 4 -23 15 2-8-1-3-2 TCtcccagatCtgcAT 15 5 -22 15 1-3-1-5-1-3-2 TctcCcagatCtgcAT 15 6 -21 15 2-9-2-1-2 T CtcccagatcT GcAT 15 7 -23 15 2-1-1-7-1-2-2 T CtCccagatcTgcAT 15 8 -23 15 2-2-1-6-1-2-2 T CtcCcagatcTgcAT 15 9 -23 15 2-9-1-2-2 T CtcccagatcT g cAT 15 10 -22 15 4-8-1-1-2 T CT CccagatctGcAT 15 11 -24 15 3-9-1-1-2 TCT cccag atctGcAT 15 12 -23 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 15 2-2-1-7-1-1-2 TCtcCcagatctGcAT 15 13 -22 15 2-10-1-1-2 T CtcccagatctGcAT 15 14 -21 15 2-2-1-8-3 TCtcCcagatctgCAT 15 15 -24 15 1-3-1-8-3 TctcCcagatctgCAT 15 16 -22 15 3-11-2 T CT cccagatctgcAT 15 17 -22 15 2-1-1-10-2 TCtCccagatctgcAT 15 18 -22 15 2-2-1-9-2 TCtcCcagatctgcAT 15 19 -22 15 2-12-2 TCtcccagatctg cAT 15 20 -21 15 1-2-2-9-2 TctCCcagatctgcAT 15 21 -23 16 1-3-1-6-1-2-2 GtctCccag atCtg C A 16 1 -24 16 1-10-1-2-2 GtctcccagatCtg CA 16 2 -23 16 1-1-1-1-1-9-2 GtCtCccagatctgCA 16 3 -24 16 1-1-1-11-2 GtCtcccagatctg CA 16 4 -23 16 1-3-1-9-2 GtctCccag atctg C A 16_5 -23 Designs refer to the gapmer design, F-G-F’. In classic gapmer design e.g. 3-10-3 all the nucleotides in the flanks (F and F’) are constituted of the same 2’-sugar modified nucleoside, e.g. LNA, cET, or MOE, and a stretch of DNA in the middle forming the gap (G). In gapmers with alternating flank designs the flanks of oligonucleotide is annotated as a series of integers, representing a number of 2’ sugar modified 5 nucleosides (M) followed by a number of DNA nucleosides (D). For example a flank with a 2-2-1 motif represents 5’ [M]2-[D]2-[M] 3’ and a 1-1-1-1-1 motif represents 5’ [M]-[D]-[M]-[D]-[M] 3’. Both flanks have a 2’ sugar modified nucleoside at the 5’ and 3’ terminal. The gap region (G), which is constituted of a number of DNA nucleosides (typically between 5 and 16), is located between the flanks. The heading “Oligonucleotide compound” in the table represents specific designs of a motif sequence. 10 Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl cytosine DNA are presented by “e”, all internucleoside linkages are phosphorothioate internucleoside linkages. Table 6: list of oligonucleotide motif sequences targeting human and cyno Sequences are indicated by SEQ ID NO, the motif sequence (nucleobase sequence) and the 15 position they target on the human PAPD5 transcript (SEQ ID NO: 1) and the human PAPD7 transcript (SEQ ID NO: 2). SEQ ID NO Motif Sequence Start ID NO: 1 End ID NO: 1 Start ID NO: 2 End ID NO: 2 17 TCAACTTTCACTTCAGT 64669 64685 29514 29530 18 TCAACTTTCACTTCAG 64670 64685 29515 29530 19 TGTTTCAATACTAAAA 69414 69429 30731 30746 Vlotif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide. Table 7: Lists oligonucleotides designs and specific antisense oligonucleotide compounds Compounds are indicated by CMP ID NO, and based on the on the motif sequence in table 6. SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 17 2-12-3 TCaa ctttcacttcAGT 17 1 -19 17 2-2-1-6-1-2-3 TCaaCtttcacTtcAGT 17 2 -21 17 2-9-1-2-3 TCaactttcacTtcAGT 17 3 -20 17 1-3-1-6-1-2-3 T caaCtttcacTtcAGT 17 4 -20 17 2-9-1-3-2 TCaactttcacTtcaGT 175 -19 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 17 2-2-1-7-2-1-2 TCaa Ctttca ctTCa GT 17 6 -21 17 1-1-1-9-1-1-3 T cAactttcactT cAGT 17 7 -19 17 1-1-2-8-1-2-2 T cAActttcactT caGT 17 8 -18 17 5-8-1-1-2 TCAACtttcacttCaGT 17 9 -23 17 4-9-1-1-2 T C AActttca cttCa GT 17 10 -21 17 2-2-1-8-1-1-2 TCaaCtttcacttCaGT 17 11 -20 17 2-11-1-1-2 T CaactttcacttCaGT 17 12 -19 17 1-1-2-9-1-1-2 T cAActttcacttCaGT 17 13 -18 17 3-11-3 TCAactttcacttcAGT 17 14 -21 17 2-2-1-9-3 TCaa Ctttca cttcAGT 17 15 -20 17 2-13-2 TCaactttcacttcaGT 17 16 -18 17 3-1-1-6-6 TCAaCtttcacTTCAGT 17 17 -26 17 2-1-2-6-6 TCaACtttcacTTCAGT 17 18 -25 17 2-2-1-6-6 TCaa Ctttca cTT CAGT 17 19 -25 17 2-9-6 T CaactttcacTT CAGT 17 20 -24 17 1-1-3-6-6 T cAACtttca cTT CAGT 17 21 -24 17 1-1-2-1-1-5-6 T cAAcTttcacTT CAGT 17 22 -23 17 1-3-1-6-6 T caaCtttcacTT CAGT 17 23 -23 17 5-6-3-1-2 TCAACtttcacTTCaGT 17 24 -25 17 4-7-3-1-2 T CAActttca cTT CaGT 17 25 -23 17 3-1-1-6-3-1-2 TCAaCtttcacTTCaGT 17 26 -24 17 3-2-1-5-3-1-2 TCAacTttcacTTCaGT 17 27 -23 17 3-8-3-1-2 TCAactttcacTTCaGT 17 28 -23 17 2-1-2-6-3-1-2 TCaACtttcacTTCaGT 17 29 -23 17 2-1-1-1-1-5-3-1-2 T CaAcTttcacTTCaGT 17 30 -22 17 2-1-1-7-3-1-2 TCaActttcacTT CaGT 17 31 -21 17 2-2-1-6-3-1-2 TCaaCtttcacTTCaGT 17 32 -22 17 2-3-1-5-3-1-2 T CaacTttcacTT CaGT 17 33 -22 17 2-9-3-1-2 TCaactttcacTTCaGT 17 34 -21 17 1-1-3-6-3-1-2 TcAACtttcacTTCaGT 17 35 -22 17 5-6-2-1-3 TCAACtttcacTT cAGT 17 36 -24 17 4-1-1-5-2-1-3 T CAAcTttcacTT cAGT 17 37 -23 17 2-1-1-1-1-5-2-1-3 T CaAcTttcacTT cAGT 17 38 -22 17 1-1-2-1-1-5-2-1-3 T cAAcTttcacTT cAGT 17 39 -21 17 1-2-1-1-1-5-2-1-3 T caAcTttcacTT cAGT 17 40 -20 17 1-3-1-6-2-1-3 T caaCtttcacTT cAGT 17 41 -21 17 1-4-1-5-2-1-3 T CaacTttcacTT cAGT 17 42 -20 17 1-1-3-6-2-2-2 T cAACtttcacTT caGT 17 43 -21 17 1-1-1-1-1-6-2-2-2 T cAaCtttcacTT caGT 17 44 -20 17 1-3-1-6-2-2-2 T caaCtttcacTT caGT 17 45 -19 17 5-6-1-1-4 TCAACtttcacTtCAGT 17 46 -26 17 3-1-1-6-1-1-4 TCAaCtttcacTtCAGT 17 47 -25 17 2-1-1-7-1-1-4 T Ca ActttcacTtCAGT 17 48 -22 17 2-2-1-6-1-1-4 TCaaCtttcacTtCAGT 17 49 -23 17 2-3-1-5-1-1-4 T CaacTttcacTtCAGT 17 50 -23 17 2-9-1-1-4 T CaactttcacTtCAGT 17 51 -22 17 1-3-1-6-1-1-4 T caaCtttcacTtCAGT 17 52 -22 17 5-6-1-1-1-1-2 TCAACtttcacTtCaGT 17 53 -23 17 4-1-1-5-1-1-1-1-2 T CAAcTttcacTtCaGT 17 54 -22 17 4-7-1-1-1-1-2 T CAActttca cTtCa GT 17 55 -22 17 3-1-1-6-1-1-1-1-2 TCAactttcacTtCaGT 17 56 -22 17 3-8-1-1-1-1-2 TCAactttcacTtCaGT 17 57 -21 17 2-1-2-6-1-1-1-1-2 TCaACtttcacTtCaGT 17 58 -21 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 17 2-1-1-1-1-5-1-1-1-1-2 T CaAcTttcacTtCaGT 17 59 -20 17 2-1-1-7-1-1-1-1-2 T Ca ActttcacTtCaGT 17 60 -20 17 2-2-2-5-1-1-1-1-2 T CaaCTttcacTtCaGT 17 61 -22 17 2-2-1-6-1-1-1-1-2 TCaaCtttcacTtCaGT 17 62 -21 17 2-3-1-5-1-1-1-1-2 T CaacTttcacTtCaGT 17 63 -20 17 2-9-1-1-1-1-2 TCaactttcacTtCaGT 17 64 -20 17 5-6-1-2-3 TCAACtttcacTtcAGT 17 65 -23 17 4-1-1-5-1-2-3 T CAAcTttcacTtcAGT 17 66 -23 17 4-7-1-2-3 T CAActttcacTtcAGT 17 67 -22 17 3-1-1-6-1-2-3 T CAaCtttcacTtcAGT 17 68 -22 17 3-2-1-5-1-2-3 T CAacTttcacTtcAGT 17 69 -22 17 2-1-2-6-1-2-3 TCaACtttcacTtcAGT 17 70 -22 17 2-1-1-1-1-5-1-2-3 T CaAcTttcacTtcAGT 17 71 -21 17 1-1-2-1-1-5-1-2-3 T cAAcTttcacTtcAGT 17 72 -20 17 5-6-1-3-2 T CAACtttcacTtcaGT 17 73 -22 17 4-7-1-3-2 TCAActttcacTtcaGT 17 74 -21 17 3-1-2-5-1-3-2 T CAaCTttcacTtcaGT 17 75 -23 17 3-1-1-6-1-3-2 T CAaCtttcacTtcaGT 17 76 -21 17 3-2-1-5-1-3-2 T CAacTttcacTtcaGT 17 77 -21 17 2-1-2-6-1-3-2 TCaACtttcacTtcaGT 17 78 -21 17 2-1-1-1-1-5-1-3-2 TCaAcTttcacTtcaGT 17 79 -20 17 2-2-1-6-1-3-2 TCaaCtttcacTtcaGT 17 80 -20 17 2-3-1-5-1-3-2 T CaacTttcacTtCaGT 17 81 -19 17 1-1-3-6-1-3-2 TcAACtttcacTtcaGT 17 82 -20 17 1-1-1-1-1-6-1-3-2 TcAaCtttcacTtcaGT 17 83 -19 17 1-3-1-6-1-3-2 T caaCtttcacTtcaGT 17 84 -19 17 5-7-5 TCAACtttcactTCAGT 17 85 -26 17 2-1-1-8-5 TCaActttcactTCAGT 17 86 -23 17 2-2-1-7-5 TCaaCtttcactTCAGT 17 87 -23 17 2-3-1-6-5 T CaacTttcactT CAGT 17 88 -23 17 2-10-5 TCaa ctttcactT CAGT 17 89 -23 17 1-1-2-8-5 T cAActttcactT CAGT 17 90 -22 17 1-1-1-1-1-7-5 T cAaCtttcactT CAGT 17 91 -22 17 1-3-1-7-5 T caaCtttcactT CAGT 17 92 -22 17 1-11-5 T caactttcactT CAGT 17 93 -21 17 5-7-2-1-2 TCAACtttcactTCaGT 17 94 -24 17 4-1-1-6-2-1-2 T C AAcTttcactT Ca GT 17 95 -23 17 4-8-2-1-2 T CAActttcactT CaGT 17 96 -22 17 3-1-1-7-2-1-2 TCAaCtttcactTCaGT 17 97 -22 17 3-2-1-6-2-1-2 T CAacTttcactT CaGT 17 98 -22 17 3-9-2-1-2 TCAaCtttcactTCaGT 17 99 -22 17 2-1-1-8-2-1-2 TCaActttcactTCaGT 17 100 -20 17 2-10-2-1-2 TCaactttcactTCaGT 17 101 -20 17 1-1-3-7-2-1-2 T cAACtttcactT CaGT 17 102 -21 17 1-1-2-8-2-1-2 TcAActttcactTCaGT 17 103 -19 17 1-1-1-1-1-7-2-1-2 T cAaCtttcactT CaGT 17 104 -20 17 1-1-1-2-1-6-2-1-2 TcAacTttcactTCaGT 17 105 -19 17 1-1-1-9-2-1-2 T cAactttcactTCaGT 17 106 -19 17 1-3-1-7-2-1-2 TcaaCtttcactTCaGT 17 107 -20 17 1-11-2-1-2 T caactttcactT CaGT 17 108 -19 17 4-8-1-1-3 T CAActttcactT cAGT 17 109 -22 17 3-1-1-7-1-1-3 T CAaCtttcactT cAGT 17 110 -22 17 2-10-1-1-3 TCaactttcactT cAGT 17 111 -20 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 17 1-1-3-7-1-1-3 T cAACtttcactT cAGT 17 112 -21 17 1-1-2-8-1-1-3 T cAActttcactT cAGT 17 113 -19 17 1-1-1-1-1-7-1-1-3 T cAaCtttcactT cAGT 17 114 -20 17 1-2-1-8-1-1-3 T caActttcactT cAGT 17 115 -19 17 1-3-1-7-1-1-3 T caaCtttcactT cAGT 17 116 -20 17 1-11-1-1-3 T caactttcactT cAGT 17 117 -19 17 5-7-1-2-2 TCAACtttcactT caGT 17 118 -22 17 4-8-1-2-2 TCAActttcactTcaGT 17 119 -21 17 3-1-1-7-1-2-2 T CAaCtttcactT caGT 17 120 -21 17 3-9-1-2-2 TCAactttcactT caGT 17 121 -20 17 2-2-1-7-1-2-2 T CaaCtttcactT caGT 17 122 -20 17 2-10-1-2-2 TCaactttcactTcaGT 17 123 -19 17 1-1-1-1-1-7-1-2-2 T cAaCtttcactT caGT 17 124 -19 17 1-1-1-9-1-2-2 T cAactttcactT caGT 17 125 -18 17 1-2-1-8-1-2-2 T caActttcactT caGT 17 126 -18 17 1-11-1-2-2 TcaactttcactTcaGT 17 127 -17 17 5-8-4 TCAACtttcacttCAGT 17 128 -25 17 3-10-4 T CAactttcacttCAGT 17 129 -23 17 2-1-2-8-4 TCaACtttcacttCAGT 17 130 -23 17 2-1-1-1-1-7-4 T Ca AcTttcacttCAGT 17 131 -22 17 2-1-1-9-4 T Ca ActttcacttCAGT 17 132 -22 17 2-2-1-8-4 TCaaCtttcacttCAGT 17 133 -23 17 2-3-1-7-4 T CaacTttcacttCAGT 17 134 -22 17 2-11-4 TCaaCtttcacttCAGT 17 135 -22 17 1-1-3-8-4 TcAACtttcacttCAGT 17 136 -22 17 1-1-2-9-4 T cAActttcacttCAGT 17 137 -21 17 1-1-1-1-1-8-4 T cAaCtttcacttCAGT 17 138 -21 17 1-1-1-10-4 T cAactttcacttCAGT 17 139 -20 17 4-1-1-7-1-1-2 TCAAcTttcacttCaGT 17 140 -22 17 3-1-2-7-1-1-2 TCAaCTttcacttCaGT 17 141 -23 17 3-1-1-8-1-1-2 TCAaCtttcacttCaGT 17 142 -22 17 3-2-1-7-1-1-2 TCAacTttcacttCaGT 17 143 -21 17 3-10-1-1-2 TCAaCtttcacttCaGT 17 144 -21 17 2-1-3-7-1-1-2 TCaACTttcacttCaGT 17 145 -22 17 2-1-2-8-1-1-2 TCaACtttcacttCaGT 17 146 -21 17 2-1-1-1-1-7-1-1-2 TCaAcTttcacttCaGT 17 147 -20 17 2-2-2-7-1-1-2 TCaaCTttcacttCaGT 17 148 -21 17 2-3-1-7-1-1-2 TCaacTttcacttCaGT 17 149 -20 17 1-1-3-8-1-1-2 TcAACtttcacttCaGT 17 150 -20 17 1-1-1-1-1-8-1-1-2 T cAaCtttcacttCaGT 17 151 -19 17 1-1-1-10-1-1-2 T cAactttca cttCa GT 17 152 -18 17 1-2-1-9-1-1-2 T ca Actttca cttCa GT 17 153 -18 17 1-3-2-7-1-1-2 T caaCTttcacttCaGT 17 154 -20 17 1-12-1-1-2 T caactttcacttCaGT 17 155 -18 17 4-1-1-8-3 T C AAcTttca cttcAGT 17 156 -22 17 4-10-3 TCAActttcacttcAGT 17 157 -22 17 3-1-2-8-3 TCAaCTttcacttcAGT 17 158 -23 17 3-1-1-9-3 TCAaCtttcacttcAGT 17 159 -22 17 2-2-2-8-3 TCaaCTttca cttcAGT 17 160 -22 17 2-3-1-8-3 T CaacTttcacttcAGT 17 161 -20 17 1-1-1-1-1-9-3 T cAaCtttcacttcAGT 17 162 -19 17 1-1-1-11-3 T cAactttcacttCAGT 17 163 -18 17 1-2-1-10-3 T caActttcacttcAGT 17 164 -19 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 17 1-13-3 T caactttcacttcAGT 17 165 -18 17 6-9-2 TCAACTttcacttcaGT 17 166 -23 17 5-10-2 T C AACtttcacttca GT 17 167 -22 17 4-1-1-9-2 T C AAcTttca cttcaGT 17 168 -21 17 4-11-2 T C AActttcacttca GT 17 169 -20 17 3-1-2-9-2 TCAaCTttcacttcaGT 17 170 -22 17 3-1-1-10-2 TCAaCtttcacttcaGT 17 171 -21 17 3-12-2 T CAactttcacttcaGT 17 172 -20 17 2-1-3-9-2 TCaACTttcacttcaGT 17 173 -21 17 2-1-2-10-2 T Ca ACtttcacttcaGT 17 174 -20 17 2-1-1-11-2 T Ca Actttcacttca GT 17 175 -19 17 2-2-1-10-2 TCaa Ctttca cttca GT 17 176 -19 17 2-3-1-9-2 TCaacTttca cttcaGT 17 177 -19 17 1-1-2-11-2 T cAActttcacttcaGT 17 178 -18 17 1-1-1-1-1-10-2 T cAaCtttcacttcaGT 17 179 -18 17 1-1-1-12-2 T cAactttcacttcaGT 17 180 -17 17 1-2-1-11-2 T caActttcacttcaGT 17 181 -17 17 1-3-1-10-2 T caaCtttcacttcaGT 17 182 -18 17 1-14-2 T caactttcacttcaGT 17 183 -17 18 3-10-3 T CAactttcacttCAG 18 1 -19 18 2-2-1-6-5 TCaa Ctttca cTT C AG 18 2 -21 18 1-1-3-6-2-1-2 T cAACtttca cTT cAG 18 3 -18 18 5-6-1-1-3 TCAACtttcacTtCAG 18 4 -22 18 4-7-1-1-3 TCAActttcacTtCAG 18 5 -20 18 2-9-1-1-3 TCaa ctttca cTtC AG 18 6 -18 18 1-3-1-6-1-1-3 T caaCtttcacTtCAG 18 7 -18 18 2-1-1-7-1-2-2 TCaActttcacTtcAG 18 8 -17 18 5-7-4 TCAActttcactTCAG 18 9 -22 18 4-8-4 TCAActttcactTCAG 18 10 -21 18 3-1-1-7-4 TCAaCtttcactTCAG 18 11 -21 18 3-9-4 T CAactttcactT CAG 18 12 -20 18 2-2-1-7-4 TCaa Ctttca ctTC AG 18 13 -20 18 2-10-4 TCaa ctttca ctT CAG 18 14 -19 18 1-1-3-7-1-1-2 T cAACtttcactT cAG 18 15 -17 18 1-1-1-1-1-7-1-1-2 T cAaCtttcactT cAG 18 16 -16 18 1-3-1-7-1-1-2 T caaCtttcactT cAG 18 17 -16 18 5-8-3 TCAACtttcacttCAG 18 18 -21 18 4-9-3 TCAActttcacttCAG 18 19 -20 18 3-1-1-8-3 TCAaCtttcacttcAG 18 20 -20 18 2-2-1-8-3 TCaaCtttcacttCAG 18 21 -19 18 2-11-3 TCaa ctttca cttC AG 18 22 -18 18 5-9-2 TCAACtttcacttcAG 18 23 -19 18 4-10-2 T CAActttcacttcAG 18 24 -18 18 3-1-1-9-2 TCAaCtttcacttcAG 18 25 -18 18 3-11-2 T CAactttcacttcAG 18 26 -17 18 2-1-2-9-2 TCaACtttcacttcAG 18 27 -17 18 2-2-1-9-2 TCaa Ctttca cttcAG 18 28 -17 18 2-12-2 TCaa ctttca cttcAG 18 29 -16 18 1-1-3-9-2 T cAACtttca cttcAG 18 30 -16 18 1-3-1-9-2 T caaCtttcacttcAG 18 31 -15 18 3-10-3 T CAactttcacttCAG 18 249 -19 18 5-5-6 TCAACtttcaCTTCAG 18 250 -25 18 4-6-6 TCAActttcaCTTCAG 18 251 -24 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 18 3-1-1-5-6 TCAaCtttcaCTTCAG 18 252 -24 18 2-1-2-5-6 TCaACtttcaCTTCAG 18 253 -23 18 2-2-1-5-6 TCaaCtttcaCTTCAG 18 254 -22 18 1-3-1-5-6 T caaCtttcaCTT CAG 18 255 -21 18 1-9-6 T caactttcaCTT CAG 18 256 -20 18 1-1-1-1-1-5-3-1-2 T cAaCtttcaCTT cAG 18 257 -19 18 1-3-1-5-3-1-2 T caaCtttcaCTT cAG 18 258 -18 18 1-9-3-1-2 T caactttcaCTT cAG 18 259 -17 18 3-1-1-5-2-1-3 TCAactttcaCTtCAG 18 260 -22 18 3-7-2-1-3 TCAactttcaCTtCAG 18 261 -21 18 2-2-1-5-2-1-3 TCaaCtttcaCTtCAG 18 262 -21 18 2-8-2-1-3 TCaactttcaCTtCAG 18 263 -20 18 1-1-3-5-2-1-3 TcAACtttcaCTtCAG 18 264 -21 18 1-3-1-5-2-1-3 TcaaCtttcaCTtCAG 18 265 -20 18 1-9-2-1-3 T caactttcaCTtCAG 18 266 -19 18 5-5-2-2-2 TCAActttcaCTtcAG 18 267 -21 18 4-6-2-2-2 TCAActttcaCTtcAG 18 268 -20 18 3-1-1-5-2-2-2 TCAaCtttcaCTtcAG 18 269 -20 18 3-7-2-2-2 T CAactttcaCTtcAG 18 270 -19 18 2-1-2-5-2-2-2 TCaActttcaCTtcAG 18 271 -20 18 2-1-1-6-2-2-2 TCaActttcaCTtcAG 18 272 -18 18 1-1-1-1-1-5-2-2-2 T cAaCtttcaCTtcAG 18 273 -18 18 1-3-1-5-2-2-2 T caaCtttcaCTtcAG 18 274 -18 18 5-5-1-1-4 TCAActttcaCtTCAG 18 275 -23 18 4-6-1-1-4 TCAActttcaCtTCAG 18 276 -22 18 3-1-1-5-1-1-4 TCAactttcaCtTCAG 18 277 -22 18 3-7-1-1-4 TCAactttcaCtTCAG 18 278 -21 18 2-1-2-5-1-1-4 TCaActttcaCtTCAG 18 279 -22 18 2-1-1-6-1-1-4 TCaActttcaCtTCAG 18 280 -20 18 2-2-1-5-1-1-4 TCaaCtttcaCtTCAG 18 281 -21 18 2-8-1-1-4 TCaactttcaCtTCAG 18 282 -20 18 2-2-1-5-1-1-1-1-2 TCaaCtttcaCtTcAG 18 283 -18 18 2-8-1-1-1-1-2 T CaactttcaCtT cAG 18 284 -17 18 1-1-3-5-1-1-1-1-2 TcAACtttcaCtTcAG 18 285 -18 18 1-1-2-6-1-1-1-1-2 T cAActttcaCtT cAG 18 286 -16 18 1-1-1-1-1-5-1-1-1-1-2 T cAaCtttcaCtT cAG 18 287 -17 18 1-1-1-7-1-1-1-1-2 T cAactttcaCtT cAG 18 288 -16 18 1-2-1-6-1-1-1-1-2 T ca Actttca CtT cAG 18 289 -16 18 1-3-1-5-1-1-1-1-2 T caaCtttcaCtT cAG 18 290 -17 18 1-9-1-1-1-1-2 T caactttcaCtT cAG 18 291 -16 18 5-5-1-2-3 TCAACtttcaCttCAG 18 292 -22 18 4-6-1-2-3 TCAActttcaCttCAG 18 293 -21 18 3-1-1-5-1-2-3 TCAaCtttcaCttCAG 18 294 -21 18 3-7-1-2-3 TCAactttcaCttCAG 18 295 -20 18 2-1-2-5-1-2-3 TCaACtttcaCttCAG 18 296 -21 18 2-1-1-6-1-2-3 TCaActttcaCttCAG 18 297 -19 18 2-2-1-5-1-2-3 TCaaCtttcaCttCAG 18 298 -20 18 2-8-1-2-3 TCaactttcaCttCAG 18 299 -19 18 1-1-3-5-1-2-3 TcAACtttcaCttCAG 18 300 -20 18 1-2-2-5-1-2-3 TcaACtttcaCttCAG 18 301 -19 18 1-2-1-6-1-2-3 T ca Actttca CttC AG 18 302 -18 18 5-5-1-3-2 TCAACtttcaCttcAG 18 303 -20 18 4-6-1-3-2 TCAActttcaCttCAG 18 304 -19 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 18 3-1-1-5-1-3-2 TCAactttcaCttcAG 18 305 -19 18 3-7-1-3-2 TCAactttcaCttcAG 18 306 -18 18 2-1-2-5-1-3-2 TCaACtttcaCttcAG 18 307 -18 18 2-1-1-6-1-3-2 TCaActttcaCttcAG 18 308 -17 18 2-2-1-5-1-3-2 TCaaCtttcaCttcAG 18 309 -18 18 2-8-1-3-2 TCaactttcaCttcAG 18 310 -17 18 1-1-3-5-1-3-2 TcAACtttcaCttcAG 18 311 -17 18 1-1-2-6-1-3-2 T cAActttcaCttcAG 18 312 -16 18 1-1-1-1-1-5-1-3-2 T cAaCtttcaCttcAG 18 313 -16 18 1-1-1-7-1-3-2 TcAactttcaCttcAG 18 314 -15 18 1-2-2-5-1-3-2 T caACtttcaCttcAG 18 315 -17 18 1-3-1-5-1-3-2 T caaCtttcaCttcAG 18 316 -16 18 1-9-1-3-2 T caactttcaCttcAG 18 317 -15 18 4-7-5 T CAActttcacTT CAG 18 318 -22 18 3-1-1-6-5 TCAaCtttcacTTCAG 18 319 -22 18 2-1-2-6-5 TCaACtttcacTTCAG 18 320 -22 18 1-1-3-6-5 T cAACtttcacTT CAG 18 321 -21 18 1-1-1-1-1-6-5 T cAaCtttcacTTCAG 18 322 -20 18 1-3-1-6-5 T caaCtttcacTT CAG 18 323 -19 18 5-6-2-1-2 T CAACtttcacTT cAG 18 324 -21 18 3-1-1-6-2-1-2 T CAaCtttcacTT cAG 18 325 -20 18 2-2-1-6-2-1-2 TCaa Ctttca cTT cAG 18 326 -18 18 1-1-2-7-2-1-2 T cAActttcacTT cAG 18 327 -16 18 1-1-1-1-1-6-2-1-2 T cAaCtttcacTT cAG 18 328 -17 18 1-1-1-8-2-1-2 T cAactttcacTT cAG 18 329 -16 18 1-3-1-6-2-1-2 T caaCtttcacTT cAG 18 330 -17 18 1-10-2-1-2 T caactttcacTT cAG 18 331 -16 18 3-1-1-6-1-1-3 TCAaCtttcacTtCAG 18 332 -21 18 2-1-1-7-1-1-3 TCaActttcacTtCAG 18 333 -19 18 2-2-1-6-1-1-3 TCaaCtttcacTtCAG 18 334 -19 18 1-1-2-7-1-1-3 T cAActttcacTtCAG 18 335 -18 18 1-10-1-1-3 T caactttcacTtCAG 18 336 -17 18 5-6-1-2-2 TCAACtttcacTtcAG 18 337 -20 18 4-7-1-2-2 T CAActttcacTtcAG 18 338 -18 18 3-1-1-6-1-2-2 T CAaCtttcacTtcAG 18 339 -19 18 2-2-1-6-1-2-2 TCaa Ctttca cTtcAG 18 340 -17 18 2-9-1-2-2 T CaactttcacTtcAG 18 341 -16 18 1-1-3-6-1-2-2 T cAACtttcacTtcAG 18 342 -17 18 1-1-1-1-1-6-1-2-2 T cAaCtttcacTtcAG 18 343 -16 18 1-3-1-6-1-2-2 T caaCtttcacTtcAG 18 344 -16 18 2-1-2-7-4 TCaACtttcactTCAG 18 345 -21 18 2-1-1-8-4 T Ca ActttcactT CAG 18 346 -19 18 1-1-2-8-4 T cAActttcactT CAG 18 347 -18 18 1-2-1-8-4 T caActttcactT CAG 18 348 -18 18 1-11-4 T caactttcactT CAG 18 349 -17 18 4-8-1-1-2 T CAActttcactT cAG 18 350 -18 18 2-2-1-7-1-1-2 TCaa Ctttca ctT cAG 18 351 -17 18 2-10-1-1-2 TCaactttcactT cAG 18 352 -16 18 1-1-2-8-1-1-2 T cAActttcactT cAG 18 353 -15 18 1-2-2-7-1-1-2 T caACtttcactT cAG 18 354 -17 18 1-2-1-8-1-1-2 T ca Actttca ctT cAG 18 355 -15 18 2-1-2-8-3 TCaACtttcacttCAG 18 356 -20 18 2-1-1-9-3 T Ca ActttcacttCAG 18 357 -18 2024201873 22 Mar 2024 SEQ ID NO Design Oligonucleotide Compound CMP ID NO dG 18 1-2-2-8-3 T caACtttcacttCAG 18 358 -18 18 1-2-1-9-3 T caActttcacttCAG 18 359 -17 18 1-12-3 T caactttcacttCAG 18 360 -16 18 1-1-1-1-1-9-2 T cAaCtttcacttcAG 18 361 -15 19 5-6-5 T GTTT caatacTAAAA 19 1 -16 19 4-7-5 TGTTtcaatacTAAAA 19 2 -15 19 5-6-2-1-2 TGTTTcaatacTAaAA 19 3 -16 19 5-5-6 TGTTTcaataCTAAAA 19 4 -18 19 4-6-6 TGTTtcaataCTAAAA 19 5 -17 19 3-1-1-5-6 TGTtTcaataCTAAAA 19 6 -17 19 3-7-6 TGTttcaataCTAAAA 19 7 -16 19 2-1-2-5-6 TGtTTcaataCTAAAA 19 8 -16 19 2-2-1-5-6 TGttTcaataCTAAAA 19 9 -15 19 1-1-3-5-6 TgTTTcaataCTAAAA 19 10 -16 19 5-5-3-1-2 TGTTT caataCT AaAA 19 11 -17 19 4-6-3-1-2 TGTTtcaataCTAaAA 19 12 -16 19 3-1-1-5-3-1-2 TGTtTcaataCTAaAA 19 13 -16 19 3-7-3-1-2 TGTttcaataCTAaAA 19 14 -16 19 2-1-2-5-3-1-2 TGtTTcaataCTAaAA 19 15 -15 19 1-1-3-5-3-1-2 TgTTTcaataCTAaAA 19 16 -15 19 5-5-2-1-3 TGTTT caataCT aAAA 19 17 -17 19 4-6-2-1-3 TGTTtcaataCT aAAA 19 18 -16 19 3-1-1-5-2-1-3 TGTtTcaataCTaAAA 19 19 -15 19 5-5-2-2-2 TGTTT caataCT aaAA 19 20 -16 19 4-6-2-2-2 TGTTtcaataCT aaAA 19 21 -15 19 5-5-1-1-4 TGTTTcaata CtAAAA 19_22 -15 Designs refer to the gapmer design, F-G-F’. In classic gapmer design e.g. 3-10-3 all the nucleotides in the flanks (F and F’) are constituted of the same 2’-sugar modified nucleoside, e.g. LNA, cET, or MOE, and a stretch of DNA in the middle forming the gap (G). In gapmers with alternating flank designs the flanks of oligonucleotide is annotated as a series of integers, representing a number of 2’ sugar modified 5 nucleosides (M) followed by a number of DNA nucleosides (D). For example a flank with a 2-2-1 motif represents 5’ [M]2-[D]2-[M] 3’ and a 1-1-1-1-1 motif represents 5’ [M]-[D]-[M]-[D]-[M] 3’. Both flanks have a 2’ sugar modified nucleoside at the 5’ and 3’ terminal. The gap region (G), which is constituted of a number of DNA nucleosides (typically between 5 and 16), is located between the flanks. The heading “Oligonucleotide compound” in the table represents specific designs of a motif sequence. 10 Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl cytosine DNA are presented by “e”, all internucleoside linkages are phosphorothioate internucleoside linkages. Table 8: List of stereodefined variants. 2024201873 22 Mar 2024 The parent oligonucleotide compound is indicated with its sequence motif and design. The stereodefinition motif of the internucleoside linkages of the parent compound is indicated below the sequence and design, and reflects a fully stereorandom phosphorthioate gapmer. The 5 stereodefined variants of the parent are listed by CMP ID NO and stereodefined motifs below the parent compound. The table contain three parent compounds CMP ID NO: 18_1, 18_347 and 18_12. SEQ ID NO Design CMP ID NO Parent Compound / stereodefinition 18 3-10-3 18_1 TCAactttcacttCAG XXXXXXXXXXXXXXXH CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18_32 RSSRXXXXXXXXXXXH 18_365 SSSSSRSRRXXXXXXH 18_33 XRSSRXXXXXXXXXXH 18_366 SSSSSSRRRXXXXXXH 18_34 XXRSSRXXXXXXXXXH 18_367 SSSRSRRRRXXXXXXH 18_35 XXXRSSRXXXXXXXXH 18_368 SSRSSRRRRXXXXXXH 18_36 XXXXRSSRXXXXXXXH 18_369 SSRRSSRRRXXXXXXH 18_37 XXXXXRSSRXXXXXXH 18_370 SSRRSRSRRXXXXXXH 18_38 XXXXXXRSSRXXXXXH 18_371 SSRRSSSRRXXXXXXH 18_39 XXXXXXXRSSRXXXXH 18_372 SSSRSRSRRXXXXXXH 18_40 XXXXXXXXRSSRXXXH 18_373 SSSSSRRRRXXXXXXH 18_41 XXXXXXXXXRSSRXXH 18_374 SSRSSSRRRXXXXXXH 18_42 XXXXXXXXXXRSSRXH 18_375 SSRSSRSRRXXXXXXH 18_43 XXXXXXXXXXXRSSRH 18_376 SSSRSSRRRXXXXXXH 18_44 XXXXXXXXXSSSSSRH 18_377 SSRRSRRRRXXXXXXH 18_45 XXXXXXXXXRRRRRRH 18_378 RSSRRSSSSRRRRSSH 18_46 XXXXXXXXXSSRRSRH 18_379 SRSRRSSSSRRRRSSH 18_47 XXXXXXXXXSSSRSRH 18_380 SSRRRSSSSRRRRSSH 18_48 XXXXXXXXXSSSRRSH 18_381 SSSSRSSSSRRRRSSH 18_49 XXXXXXXXXSRSSSSH 18_382 SSSRSSSSSRRRRSSH 18_50 XXXXXXXXXRSRSRSH 18_383 SSSRRRSSSRRRRSSH 18_51 XXXXXXXXXSSSSRSH 18_384 SSSRRSRSSRRRRSSH 18_52 XXXXXXXXXSSRRSSH 18_385 SSSRRSSRSRRRRSSH 18_53 XXXXXXXXXRRSSSSH 18_386 SSSRRSSSRRRRRSSH 18_54 XXXXXXXXXRSSRRRH 18_387 SSSRRSSSSSRRRSSH 18_55 XXXXXXXXXSRRRRSH 18_388 SSSRRSSSSSSRRSSH 18_56 XXXXXXXXXSSRSRRH 18_389 SSSRRSSSSRRSRSSH 18_57 XXXXXXXXXRRRSRRH 18_390 SSSRRSSSSRRRSSSH 18_58 XXXXXXXXXRRSRSRH 18_391 SSSRRSSSSRRRRRSH 18_59 XXXXXXXXXSSRRRSH 18_392 SSSRRSSSSRRRRSRH 18_60 XXXXXXXXXSRRSSSH 18_393 SRSSRSSSSRRRRSSH 18_61 XXXXXXXXXRRRRRSH 18_394 SSRSSRSSSRRRRSSH 18_62 XXXXXXXXXRRSSRRH 18_395 SSSRSSRSSRRRRSSH 18_63 XXXXXXXXXRSRRRRH 18_396 SSSRRRSSRRRRRSSH 18_64 XXXXXXXXXSRRRSSH 18_397 SSSRRSSRSSRRRSSH 18_65 XXXXXXXXXSRSRSRH 18_398 SSSRRSSSRSSRRSSH 18_66 XXXXXXXXXRSSSSRH 18_399 SSSRRSSSSRSSRSSH 18_67 XXXXXXXXXSSSSRRH 18_400 SSSRRSSSSRRSSRSH 18_68 XXXXXXXXXRRSSSRH 18_401 SSSRRSSSSRRRSSRH 18_69 XXXXXXXXXRSSRRSH 18_402 RSSRRSSSSRRRSSRH 2024201873 22 Mar 2024 CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18_70 XXXXXXXXXRSSSRRH 18_403 SRSSRSSSSRRSSRSH 18_71 XXXXXXXXXSRRRRRH 18_404 SSRSSRSSSRSSRSSH 18_72 XXXXXXXXXRRSRSSH 18_405 SSSRSSRSRSSRRSSH 18_73 XXXXXXXXXRSRSSRH 18_406 SSSRRSSRRSSRRSSH 18_74 XXXXXXXXXRSRSRRH 18_407 RSSRRRSSRRRRSSRH 18_75 XXXXXXXXXSRRRSRH 18_408 SSSRSSSRRRRRXXXH 18_76 XXXXXXXXXRRSRRSH 18_409 SSSSSSSRRRRRXXXH 18_77 XXXXXXXXXSSSRRRH 18_410 SSSRSSSRRSRRXXXH 18_78 XXXXXXXXXRSRRSRH 18_411 SSSRSSSRRRSRXXXH 18_79 XXXXXXXXXSRRSRSH 18_412 SSSSSSSRRSSRXXXH 18_80 XXXXXXXXXRRSRRRH 18_413 SSSSSSSRRSRRXXXH 18_81 XXXXXXXXXSRRSSRH 18_414 SSSSSSSRRRSRXXXH 18_82 XXXXXXXXXSRSSSRH 18_415 SSSRSSSRRSSRXXXH 18_83 XXXXXXXXXRSRRRSH 18_416 SSRRSRRRRXXRXXXH 18_84 XXXXXXXXXSSSRSSH 18_417 SSSRSRRRRXXRXXXH 18_85 XXXXXXXXXSSRSSRH 18_418 SSRSSRRRRXXRXXXH 18_86 XXXXXXXXXRSSRSSH 18_419 SSRRSSRRRXXRXXXH 18_87 XXXXXXXXXSRSSRSH 18_420 SSRRSRSRRXXRXXXH 18_88 XXXXXXXXXSSSSSSH 18_421 SSSSSSSRRXXRXXXH 18_89 XXXXXXXXXRSRRSSH 18_422 SSRSSSSRRXXRXXXH 18_90 XXXXXXXXXRRRRSRH 18_423 SSSRSSSRRXXRXXXH 18_91 XXXXXXXXXSSRSRSH 18_424 SSSSSSRRRXXRXXXH 18_92 XXXXXXXXXRRRRSSH 18_425 SSSSSRSRRXXRXXXH 18_93 XXXXXXXXXRSRSSSH 18_426 SSRSSRSRRXXRXXXH 18_94 XXXXXXXXXRSSRSRH 18_427 SSSRSRSRRXXRXXXH 18_95 XXXXXXXXXRRRSRSH 18_428 SSSRSSRRRXXRXXXH 18_96 XXXXXXXXXRRSSRSH 18_429 SSRSSSRRRXXRXXXH 18_97 XXXXXXXXXSRSSRRH 18_430 SSRRSSSRRXXRXXXH 18_98 XXXXXXXXXSRRSRRH 18_431 SSSSSRRRRXXRXXXH 18_99 XXXXXXXXXSRSRSSH 18_432 SSSRRSSSSRSRRSSH 18_100 XXXXXXXXXSRSRRRH 18_433 XXXXRSSRXSSSRXXH 18_101 XXXXXXXXXSSRSSSH 18_434 XXXXRSSRXSSRRXXH 18_102 XXXXXXXXXRSSSSSH 18_435 XXXXRSSRXRSSRXXH 18_103 XXXXXXXXXRSSSRSH 18_436 XXXXRSSRXSRSSXXH 18_104 XXXXXXXXXRRRSSRH 18_437 XXXXRSSRXRRRRXXH 18_105 XXXXXXXXXRRRSSSH 18_438 XXXXRSSRXRRSRXXH 18_106 XXXXXXXXXSRSRRSH 18_439 XXXXRSSRXSRRRXXH 18_107 XXXXXXXXXSSRRRRH 18_440 XXXXRSSRXRRSSXXH 18_108 XXXXXXXXXXSSRSSH 18_441 XXXXRSSRXRSRRXXH 18_109 XXXXXXXXXXRRRSSH 18_442 XXXXRSSRXRSSSXXH 18_110 XXXXXXXXXXRRSSRH 18_443 XXXXRSSRXRRRSXXH 18_111 XXXXXXXXXXRSSSRH 18_444 XXXXRSSRXRSRSXXH 18_112 XXXXXXXXXXRRSRRH 18_445 XXXXRSSRXSRRSXXH 18_113 XXXXXXXXXXSSSSRH 18_446 XXXXRSSRXSSSSXXH 18_114 XXXXXXXXXXRRRRRH 18_447 XXXXRSSRXSRSRXXH 18_115 XXXXXXXXXXSRSSSH 18_448 XXXXRSSRXSSRSXXH 18_116 XXXXXXXXXXSSRSRH 18_449 SSSRRSSSRRSSRSSH 18_117 XXXXXXXXXXRSSRSH 18_450 RSSRRSSSRRRRRSSH 18_118 XXXXXXXXXXRSRRRH 18_451 SRSRRSSSRRRRRSSH 18_119 XXXXXXXXXXSRRRRH 18_452 SSRRRSSSRRRRRSSH 18_120 XXXXXXXXXXSRRRSH 18_453 SSSSRSSSRRRRRSSH 18_121 XXXXXXXXXXSSSRSH 18_454 SSSRSSSSRRRRRSSH 18_122 XXXXXXXXXXRSRSSH 18_455 SSSRRSRSRRRRRSSH 2024201873 22 Mar 2024 CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18_123 XXXXXXXXXXSSSSSH 18_456 SSSRRSSRRRRRRSSH 18_124 XXXXXXXXXXSRRSSH 18_457 SSSRRSSSRSRRRSSH 18_125 XXXXXXXXXXRSRRSH 18_458 SSSRRSSSRRSRRSSH 18_126 XXXXXXXXXXSSRRSH 18_459 SSSRRSSSRRRSRSSH 18_127 XXXXXXXXXXRRRSRH 18_460 SSSRRSSSRRRRSSSH 18_128 XXXXXXXXXXSRSRRH 18_461 SSSRRSSSRRRRRRSH 18_129 XXXXXXXXXXRRSRSH 18_462 SSSRRSSSRRRRRSRH 18_130 XXXXXXXXXXRRSSSH 18_463 SSSRRSSSRRRSSSRH 18_131 XXXXXXXXXXRSSSSH 18_464 SSSRRSSSRRRSRRSH 18_132 XXXXXXXXXXRSSRRH 18_465 XXXXRSSRXRRSRRSH 18_133 XXXXXXXXXXSRRSRH 18_466 XXXXRSSRXXRSSSRH 18_134 XXXXXXXXXXSSRRRH 18_467 SSXXSXXRRXXRXXXH 18_135 XXXXXXXXXXSRSSRH 18_468 SSXXSXXRRXXXXXXH 18_136 XXXXXXXXXXRRRRSH 18_469 SSSXSSSRRXXRXXXH 18_137 XXXXXXXXXXRSRSRH 18_470 SXXXSXXXXXXXXXXH 18_138 XXXXXXXXXXSSSRRH 18_497 RRRSSRSSRSSRSRRH 18_139 XXXXXXXXXXSRSRSH 18_498 SSSRRSRRSRRSRSSH 18_140 SSRRRRSSSSSRSSRH 18_499 SRRSRSRSRRRSRRRH 18_141 SSSSSRRRRRRSRRSH 18_500 SRRRSSRRSSRSSSSH 18_142 SRSSRSSSRRRSRSRH 18_501 SRRRSSRSSRSRSSSH 18_143 SRRSSSSRRSRRRRRH 18_502 RRRSSRSRSSSRRRRH 18_144 SSRRSRSRSSSRSRRH 18_503 SRRRSSSRRRRSSSSH 18_145 SSSRRRRSRRRSSRRH 18_504 RRSSRSRSRSSRRSSH 18_146 RRSRSSRRSSSRRSSH 18_505 RRSRSRSRSSSRRSRH 18_147 RSSRRRSSSRSSSRSH 18_506 RSSSRRSSSRSRRSRH 18_148 SSSSRRRSRSSSRRSH 18_507 SRRSRSSSSSSRRRSH 18_149 SSSRSSSSSSSRRRRH 18_508 RRSSRSRRSRSRRRRH 18_150 SSSSRSSSSSSSSSSH 18_509 RRRRSRRRRSSSSRSH 18_151 RRSRRRRRSSSSSSSH 18_510 SSRRSRSRRSSSRRRH 18_152 RRRRSRSSRRRRSSSH 18_511 SSRRRRSRSSSRRRRH 18_153 RRRRRSSRRRSRSSRH 18_512 RRRRRSSSRSRSSSSH 18_154 SSRRRRSRSRSSRRSH 18_513 SRSRSSRRRSSSSSSH 18_155 RSSSSSRSSRRSSSSH 18_514 RSRSRSRSSRSRRRRH 18_156 RRRSSSSSRSRSRRSH 18_515 SSRRSRSSSSSRSSRH 18_157 RSSSRSRSRRRSRRRH 18_516 RSRRSRSSSSRRSSSH 18_158 RRSRRSSSRRRRRRSH 18_517 RRSSRSRRRSRRRSRH 18_159 RRSSSSRSRSSSRSRH 18_518 SRSRSSSSSSSSSSSH 18_160 RSSRSRSRSRSRSRRH 18_519 RSSSSSRSRSSSRSSH 18_161 SRRRSSSSRSRSRSRH 18_520 SRSSSSRSRSSSSRSH 18_162 SRSSSRRSRRRRSSRH 18_521 RRSRRSRRRSRRRSSH 18_163 RSSRRRSRRSRSSRRH 18_522 SRRSRSRSRSRSRRRH 18_164 SSRRRSSRSSRRRRSH 18_523 SRRRRSSSSRRSSRSH 18_165 RSRSSRRSRRRSSSRH 18_524 RSSSRRRRRSSSRRRH 18_166 RRRRSRRRSSRSRRSH 18_525 RRSSRRRRSSSSRRSH 18_167 SRRRSSSRSRSSRRRH 18_526 SSSSRSRRSRSSSRSH 18_168 SRSSRSSSSSRSRSSH 18_527 RRRRSRRSSSSSRSSH 18_169 SSRRSRSSSSSRSSSH 18_528 SRRSRSRRRRSSRRSH 18_170 SSRRRRRSRSRRSSSH 18_529 RSRSSRRRRRSSRSSH 18_171 SSSRRSSRSRRRRRSH 18_530 RRRSRSRSSRSRSSSH 18_172 RSSSSSSSRSRRRRRH 18_531 RRSSRSSSSSRSSSRH 18_173 SSRSRSSRSSRRSRRH 18_532 RRRSSSSSRSSSRSSH 18_174 SRSRSSSRRRSRRRSH 18_533 RRSSSSSRRSSRSRRH 18_175 RRRRRRRSSRRSSSRH 18_534 RSSRSRRSRSSSSRRH 2024201873 22 Mar 2024 CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18_176 SSRSRRRRRSRRSRSH 18_535 SSSSRSSSSRRSRRSH 18_177 RRSRRRRRRSSRRRSH 18_536 RRSSRRSSRSRRSSRH 18_178 SSSSRRRRRRRRRSRH 18_537 RRRSRRRRSSSRSSSH 18_179 SRRRSSRRRSSRRRSH 18_538 SSSRSSRRSRRRSSSH 18_180 SSSRRRRRSRRSSRRH 18_539 RSRRRRRRRSSSRRSH 18_181 RRSRRSSSSRRRSSRH 18_540 SSRSRSSSSRSRSRRH 18_182 SSRRSRSSRRRSSSSH 18_541 SSSRRSSSRSRRRRSH 18_183 SSRSRRRRSSRSSSRH 18_542 SSRRSSSSSRSRRSSH 18_184 RRRSRRSRSSRSRRRH 18_543 SSSRRRSRRRSSRSRH 18_185 RSRSSRSRSRRSRSRH 18_544 SRSSSSSRSSRSRRSH 18_186 SSSRRRRSSRRSRRRH 18_545 SRSSSSSSRRSSRRRH 18_187 RSSRRSRRRRSRRRSH 18_546 SRRSSSSRRRRRRSRH 18_188 SSSRRSSRSRSRSSSH 18_547 RSRSRRRSSSRSRRSH 18_189 RSRSSSSRSSRRRSSH 18_548 RRSRRSSSSSSSRSSH 18_190 SSSRSSSRSRRSRSSH 18_549 RSSRRRSSRRSSSSSH 18_191 RSSRSSSSRSSSSSRH 18_550 RSSRRSRSSRRSSRSH 18_192 RSSRRSSRSSSRRSRH 18_551 RRSSRSRRRRRRRRSH 18_193 RSSRRSRSRRSSSSRH 18_552 SRSSSRSRRRSSRSSH 18_194 RRSSSRRSRRRRSSSH 18_553 RSSRRRRRSRSRRRRH 18_195 RRRRRSSRSRRSSSRH 18_554 RSRSSSSRRSSSSSRH 18_196 SSSSRSRRRSSRRRSH 18_555 RRRRSSRRRSSRSSRH 18_197 RSRRRRRRRRSSRSRH 18_556 SSRSSRRSSSSRSRSH 18_198 RSRRSSSSRSSRSSRH 18_557 SRRRSSSSRRRSSRRH 18_199 SSRRSRSSRRRSSSRH 18_558 SRRSSSSRRSRRSRRH 18_200 RRRRSSSRRSRSRSSH 18_559 SSRRRSSRSSRSRRRH 18_201 RSRRRRRRSRRSSRSH 18_560 RSSRRRRSRSRRSRSH 18_202 SRRSRRRRRSRSSSSH 18_561 RSSRRRRSRRRRRRRH 18_203 SRRSRRSSSRSSSSSH 18_562 RRRRRRSRSRSRSSRH 18_204 SSSRRRRSRSRRRSSH 18_563 SSSRSSSSRRSSSRRH 18_205 SSRSRSRSSSRSRSRH 18_564 SRRSRSSSSSRSRRRH 18_206 SSSRRSRRSRRRSRSH 18_565 SSSSSRRSRSRSSRSH 18_207 SRSSRRRSSSSSRRRH 18_566 SSRSSRRSRRSSSRRH 18_208 RRSSRSSSSSSRSSRH 18_567 SSRSRSRRRSRSRRSH 18_209 SRSSRRSSRSRRSRRH 18_568 SRRSSRSRSRRRRSSH 18_210 RSRRSSRSRSSRRSSH 18_569 SRSRSRSRRSSSSRRH 18_211 RSSSRRSRSSSRSSSH 18_570 SRSSSRRRSRSSSSSH 18_212 SSSSSSSSRSRRRSSH 18_571 SRRSRSSSSSRSRSSH 18_213 RRSSSSSSSRSSSRRH 18_572 RSSRSRSRRSRSRRRH 18_214 SSSRRSSSSRRRRSSH 18_573 SSRSRRRRRRRSSSSH 18_215 SSSRRRRRRSSSSRRH 18_574 RRSSRRSSSSSSSSSH 18_216 RSRSRRRSSSRRRSRH 18_575 SRSSSRRRRRSSRSRH 18_217 SSSSRRSRRRSSRRRH 18_576 SSSSRSRRSSRRSRRH 18_218 RSSRRSSRSRRRSSSH 18_577 RSSSRSSRSRRRSSRH 18_219 RRSSSSSRRRRSRRSH 18_578 RRSRSRSRRRRSRRSH 18_220 RXXXXXXXXXXXXXXH 18_579 SRSRSSRSSSSSRRSH 18_221 SXXXXXXXXXXXXXXH 18_580 RRRSRRSSSSSSSRRH 18_222 XRXXXXXXXXXXXXXH 18_581 RRRSRSRSRSSRRRSH 18_223 XSXXXXXXXXXXXXXH 18_582 SSRRSRSSRRRRSSRH 18_224 XXRXXXXXXXXXXXXH 18_583 RRSSSSSRRRRSSRSH 18_225 XXSXXXXXXXXXXXXH 18_584 SRSSRRSRSSSRRSSH 18_226 XXXRXXXXXXXXXXXH 18_585 RSSSSSSRRSSSSRRH 18_227 XXXSXXXXXXXXXXXH 18_586 SRRRSSSSRRRSSSSH 18_228 XXXXRXXXXXXXXXXH 18_587 RRSRRRSRSSSSRSSH 2024201873 22 Mar 2024 CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18_229 XXXXSXXXXXXXXXXH 18_588 SSSSRSSSRSRSSSSH 18_230 XXXXXRXXXXXXXXXH 18_589 RRSRRRRRSRSSRSRH 18_231 XXXXXSXXXXXXXXXH 18_590 RRSSSRSRRRSRSSSH 18_232 XXXXXXRXXXXXXXXH 18_591 RRSRSRSSSRSSSSSH 18_233 XXXXXXSXXXXXXXXH 18_592 RRSSRSSSSRSRRSRH 18_234 XXXXXXXRXXXXXXXH 18_593 RRRRSSRSRSRSRSRH 18_235 XXXXXXXSXXXXXXXH 18_594 SRRSSRSSRRSRSSSH 18_236 XXXXXXXXRXXXXXXH 18_595 SRRSRRSRRRSSRSRH 18_237 XXXXXXXXSXXXXXXH 18_596 SSSSSRRRSSRRSSSH 18_238 XXXXXXXXXRXXXXXH 18_597 RRSRRRSRSSRSRRRH 18_239 XXXXXXXXXSXXXXXH 18_598 RSRSSRRSSRRSSRSH 18_240 XXXXXXXXXXRXXXXH 18_599 SSSRRRRSSRSRSSSH 18_241 XXXXXXXXXXSXXXXH 18_600 RRRRRSSRSRRRSRSH 18_242 XXXXXXXXXXXRXXXH 18_601 SSSRRSSRSRRSSRRH 18_243 XXXXXXXXXXXSXXXH 18_602 RRRSRSRSSRRSRRSH 18_244 XXXXXXXXXXXXRXXH 18_603 SRSSSSSRRSSRSRSH 18_245 XXXXXXXXXXXXSXXH 18_604 SSSRSSRSSSSSSSRH 18_246 XXXXXXXXXXXXXRXH 18_605 SSRSRSSRSSSSRRRH 18_247 XXXXXXXXXXXXXSXH 18_606 SRSRRSRRSRSRRRRH 18_248 XXXXXXXXXXXXXXRH 18_607 SRSRRRRSRSSRSSSH 18_249 XXXXXXXXXXXXXXSH 18_608 SRSRRRRRSSSRRSRH 18_362 SSSSSSSRRXXXXXXH 18_609 RRRSSSSRSSRRSSRH 18_363 SSRSSSSRRXXXXXXH 18_610 RRRSSSSSRRSRSRRH 18_364 SSSRSSSRRXXXXXXH SEQ ID NO Design CMP ID NO Parent Oligonucleotide Cmp / stereodefinition 18 1-1-2-8-4 18_347 TcAActttcactTCAG XXXXXXXXXXXXXXXH CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18 471 SSSRRSSSRRRRRSSH 18 478 SSSRSSSRSRRSRSSH 18 472 XXXXRSSRXXXXXXXH 18 479 SRRSRSRSRRRSRRRH 18 473 XXXXXXXXXXRSSSRH 18 480 SRRRSSRRSSRSSSSH 18 474 XXXXXXXXXRRSRRSH 18 481 SRRRSSRSSRSRSSSH 18 475 SSSSRSRRRSSRRRSH 18 482 RRRSSRSRSSSRRRRH 18 476 RRSRSSRRSSSRRSSH 18 483 SRRRSSSRRRRSSSSH 18_477 RSRSSSSRSSRRRSSH SEQ ID NO Design CMP ID NO Parent Oligonucleotide Cmp / stereodefinition 18 3-9-4 18_12 TCAactttcactTCAG XXXXXXXXXXXXXXXH CMP ID NO Stereodefined motif CMP ID NO Stereodefined motif 18 484 SSSRRSSSRRRRRSSH 18 491 SSSSRSRRRSSRRRSH 18 485 XXXXRSSRXXXXXXXH 18 492 SRRSRSRSRRRSRRRH 18 486 XXXXXXXXXXRSSSRH 18 493 SRRRSSRRSSRSSSSH 18 487 XXXXXXXXXRRSRRSH 18 494 SRRRSSRSSRSRSSSH 18 488 RRSRSSRRSSSRRSSH 18 495 RRRSSRSRSSSRRRRH 18 489 RSRSSSSRSSRRRSSH 18 496 SRRRSSSRRRRSSSSH 18_490 SSSRSSSRSRRSRSSH 2024201873 22 Mar 2024 In relation to the parent oligonucleotide CMP: Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages. In relation to the stereodefinition / stereodefined motifs: X represent a stereorandom phosphorothioate 5 internucleoside linkage, R represents one stereoisomeric form and S represents the other stereoisomeric form as defined in the a description, H represents the hydrogen atom at the 3’ terminus ot the oligonucleotide. The first letter (X, R or S) in the stereodefined motif correspond to the internucleoside linkage between nucleoside 1 and 2 from the 5’ end of the oligonucleotide. Table 9: Oligonucleotide motif sequences and antisense compounds with 5’ ca biocleavable 10 linker. SEQ ID NO motif sequence oligonucleotide compound with a C6 alkyl ca biocleavable linker CMP ID NO 20 CATCAACTTTCACTTCAG C60c0a0T CAactttcacttCAG 20_1 20 CATCAACTTTCACTTCAG C60c0a0T CAActttcactT CAG 20_2 20 CATCAACTTTCACTTCAG C60c0a0T CAActttcacttCAG 20_3 20 CATCAACTTTCACTTCAG C60c0a0T CAActttcacTtCAG 20_4 20 CATCAACTTTCACTTCAG C60c0a0T CAACtttcacttCAG 20_5 20 CATCAACTTTCACTTCAG C60c0a0T CAACtttcacttcAG 20_6 20 CATCAACTTTCACTTCAG C60c0a0T CAActttcacttcAG 20_7 20 CATCAACTTTCACTTCAG C60c0a0T CAactttcactT CAG 20_8 20 CATCAACTTTCACTTCAG C60c0a0T cAACtttcactT cAG 20_9 20 CATCAACTTTCACTTCAG C60c0a0T cAACtttcacttcAG 20_10 20 CATCAACTTTCACTTCAG C60c0a0T CaACtttcacttcAG 20_11 20 CATCAACTTTCACTTCAG C60c0a0T CaActttcacttCAG 20_23 20 CATCAACTTTCACTTCAG C60c0a0T CaactttcactT CAG 20_24 20 CATCAACTTTCACTTCAG C60c0a0T CAaCtttcacttCAG 20_25 20 CATCAACTTTCACTTCAG C60c0a0TCaaCtttcacttCAG 20_26 20 CATCAACTTTCACTTCAG C60c0a0T CAaCtttcacttcAG 20_27 20 CATCAACTTTCACTTCAG C60c0a0T CaActttcactT CAG 20_28 20 CATCAACTTTCACTTCAG C60c0a0T cAActttcactT CAG 20_29 20 CATCAACTTTCACTTCAG C60c0a0T CAActttcactT cAG 20_37 20 CATCAACTTTCACTTCAG C60c0a0T caACtttcacttCAG 20_38 21 CATCAACTTTCACTTCAGT C60c0a0T CAActttcacttCaGT 21_1 21 CATCAACTTTCACTTCAGT C60c0a0T CAactttcactT cAGT 21_3 21 CATCAACTTTCACTTCAGT C60c0a0T cAActttcacttCaGT 21_4 21 CATCAACTTTCACTTCAGT C60c0a0T CAactttcacttcAGT 21_5 21 CATCAACTTTCACTTCAGT C60c0a0T CaactttcacTtCAGT 21_6 21 CATCAACTTTCACTTCAGT C60c0a0T CAactttcacTtCaGT 21_7 21 CATCAACTTTCACTTCAGT C60c0a0T CaActttcactT CAGT 21_8 21 CATCAACTTTCACTTCAGT C60c0a0T cAActttcactT CAGT 21_9 21 CATCAACTTTCACTTCAGT C60c0a0T CAActttcactT CaGT 21_10 21 CATCAACTTTCACTTCAGT C60c0a0T CAactttcactT CaGT 21_11 21 CATCAACTTTCACTTCAGT C60c0a0T cAActttcactT CaGT 21_12 21 CATCAACTTTCACTTCAGT C60c0a0T CaactttcactT cAGT 21_13 2024201873 22 Mar 2024 SEQ ID NO motif sequence oligonucleotide compound with a C6 alkyl ca biocleavable linker CMP ID NO 21 CATCAACTTTCACTTCAGT C60c0a0T CAactttcacttCAGT 21_14 21 CATCAACTTTCACTTCAGT C60c0a0T CaactttcacttCAGT 21_15 21 CATCAACTTTCACTTCAGT C60c0a0T cAActttcacttCAGT 21_16 21 CATCAACTTTCACTTCAGT C60c0a0T cAactttcacttCAGT 21_17 21 CATCAACTTTCACTTCAGT C60c0a0T CAactttcacttCaGT 21_18 21 CATCAACTTTCACTTCAGT C60c0a0T CAActttcacttcAGT 21_19 21 CATCAACTTTCACTTCAGT C60c0a0T CaactttcactT CAGT 21_37 21 CATCAACTTTCACTTCAGT C60c0a0T CaActttcactT CaGT 21_38 21 CATCAACTTTCACTTCAGT C60c0a0T CAActttcactT caGT 21_39 21 CATCAACTTTCACTTCAGT C60c0a0T CaActttcacttCAGT 21_40 C6 represents an amino alkyl group with 6 carbons, capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester internucleoside linkage and unless otherwise indicated other internucleoside linkages are phosphorothioate internucleoside linkages. 5 Table 10: GalNAc conjugated antisense oligonucleotide compounds. SEQ ID NO CMP ID NO antisense oligonucleotide conjugate Corresponding CMP ID of naked compound 20 20_12 G N2-C6oCoaoT CAactttcacttCAG 18_1 20 20_13 GN2-C6oCoaoT CAActttcactT CAG 10_10 20 20_14 GN2-C6oCoaoTCAActttcacttCAG 18_19 20 20_15 GN2-C6oCoaoTCAActttcacTtCAG 18_5 20 20_16 GN2-C6oCoaoTCAACtttcacttCAG 18_18 20 20_17 GN2-C6oCoaoTCAACtttcacttcAG 18_23 20 20_18 GN2-C6oCoaoTCAActttcacttcAG 18_24 20 20_19 GN2-C6oCoaoT CAactttcactT CAG 18_12 20 20_20 GN2-C6oCoaoTcAACtttcactTcAG 18_15 20 20_21 GN2-C6oCoaoTcAACtttcacttcAG 18_30 20 20_22 GN2-C6oCoaoTCaACtttcacttcAG 18_27 20 20_30 GN2-C6oCoaoTCaActttcacttCAG 18_357 20 20_31 GN2-C6oCoaoT CaactttcactT CAG 18_14 20 20_32 GN2-C6oCoaoTCAaCtttcacttCAG 18_20 20 20_33 GN2-C6oCoaoTCaaCtttcacttCAG 18_21 20 20_34 GN2-C6oCoaoTCAaCtttcacttcAG 18_25 20 20_35 GN2-C6oCoaoT CaActttcactT CAG 18_346 20 20_36 GN2-C6oCoaoT cAActttcactT CAG 18_347 20 20_39 GN2-C6oCoaoTCAActttcactT cAG 18_350 20 20_40 GN2-C6oCoaoT caACtttcacttCAG 18_358 21 21_2 G N2-C6oCoaoT CAActttcacttCaGT 17_10 21 21_20 GN2-C6oCoaoTcAactttcactTcAGT 17_7 21 21_21 GN2-C6oCoaoTcAActttcacttCaGT 17_13 21 21_22 GN2-C6oCoaoTCAactttcacttcAGT 17_14 21 21_23 GN2-C6oCoaoTCaactttcacTtCAGT 17_51 2024201873 22 Mar 2024 SEQ ID NO CMP ID NO antisense oligonucleotide conjugate Corresponding CMP ID of naked compound 21 21_24 GN2-C6oCoaoTCAactttcacTtCaGT 17_57 21 21_25 GN2-C6oCoaoTCaActttcactTCAGT 17_86 21 21_26 GN2-C6oCoaoT cAActttcactT CAGT 17_90 21 21_27 GN2-C6oCoaoT CAActttcactT CaGT 17_96 21 21_28 GN2-C6oCoaoTCAactttcactTCaGT 17_99 21 21_29 GN2-C6oCoaoT cAActttcactT CaGT 17_103 21 21_30 GN2-C6oCoaoTCaactttcactTcAGT 17_111 21 21_31 GN2-C6oCoaoTCAactttcacttCAGT 17_129 21 21_32 GN2-C6oCoaoTCaactttcacttCAGT 17_135 21 21_33 GN2-C6oCoaoTcAActttcacttCAGT 17_137 21 21_34 GN2-C6oCoaoTcAactttcacttCAGT 17_139 21 21_35 GN2-C6oCoaoTCAactttcacttCaGT 17_144 21 21_36 GN2-C6oCoaoTCAActttcacttcAGT 17_157 21 21_41 GN2-C6oCoaoT CaactttcactT CAGT 17_89 21 21_42 GN2-C6oCoaoTCaActttcactTCaGT 17_100 21 21_43 GN2-C6oCoaoTCAActttcactTcaGT 17_119 21 21_44 GN2-C6oCoaoTCaActttcacttCAGT 17_132 GN2 represents the trivalent GalNAc cluster shown in Figure 2, C6 represents an amino alkyl group with 6 carbons, capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester nucleoside linkage and unless otherwise indicated internucleoside linkages are phosphorothioate internucleoside linkages. 5 Chemical drawings representing some of the molecules are shown in figures 4 to 17. AAV / HBVmouse models In the AAV / HBV mouse model mice are infected with a recombinant adeno-associated virus (AAV) carrying the HBV genome (AAV / HBV) maintains stable viremia and antigenimia for more than 30 weeks (Dan Yang, et al. 2014 Cellular & Molecular Immunology 11, 71-78). 10 Male C57BL / 6 mice (4-6 weeks old), specific pathogen free, are purchased from SLAC (Shanghai Laboratory Animal Center of Chinese Academy of Sciences) and housed in an animal care facility in individually ventilated cages. Guidelines are followed for the care and use of animals as indicated by WuXi IACUC (Institutional Animal Care and Use Committee, WUXI IACUC protocol number R20131126-Mouse). Mice are allowed to acclimate to the new 15 environment for 3 days and are grouped according to the experimental design. Recombinant AAV-HBV is diluted in PBS, 200 pL per injection. This recombinant virus carries 1.3 copies of the HBV genome (genotype D, serotype ayw). On day 0, all mice are injected through tail vein with 200 pL AAV-HBV (1x1011 vector genome). On Pre-dose Day 23 (23 days post AAV-HBV injection), animals were distributed to in groups 20 based on serum levels of HBV markers and body weight. Each group was housed (up to 2024201873 22 Mar 2024 5 / cage) in polycarbonate cages with corncob bedding. Low, medium, and high HBV titer values were spread, ensuring group means to be similar across groups.. The animal groups can be treated with oligonucleotides which can be unconjugated or GalNAc conjugated. All serum collections (0.1ml blood / mouse) were performed by retro-orbital bleeding after animals were 5 anesthetized with isoflurane inhalation. HeLa Cell lines HeLa cell line was purchased from European Collection of Authenticated Cell Cultures (ECACC, #93021013) and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO2. For assays, 2,500 cells / well were seeded in a 96 multi well plate in Eagle's 10 Minimum Essential Medium (Sigma, M2279) with 10% fetal bovine serum (FBS), 2mM Glutamin AQ, 1% NEAA, 25pg / ml Gentamicin. Differentiated HepaRG cell culture (no HBV infection) HepaRG cells (Biopredics International, Rennes, France, Cat# HPR101) were cultured at 37°C in a humidified atmosphere with 5% CO2 in complete HepaRG growth medium consisting of 15 William’s E Medium (Sigma W4128), Growth Medium Supplement (Biopredics, Cat# ADD710) and 1% (v / v) GlutaMAX-l (Gibco #32551) for 2 weeks. To initiate differentiation cells were grown in complete HepaRG growth medium for 2 weeks until they were fully confluent. Half of the medium was exchanged by HepaRG differentiation medium consisting of William’s E Medium (Sigma W4128), Growth Medium Supplement 20 (Biopredics, Cat# ADD720) and 1% (v / v) GlutaMAX-l (Gibco #32551), final concentration of DMSO was 0.9% (v / v)). After 3 days, medium was fully replaced by complete differentiation medium (final concentration of DMSO 1.8% (v / v)) in which cells were maintained for approximately 2 weeks with differentiation medium renewal every 7 days. Differentiated HepaRG cells (dHepaRG), displayed hepatocyte-like cell islands surrounded by monolayer of 25 biliary-like cells. Prior to compound treatment, dHepaRG cells were seeded into collagen I coated 96-well plates (Corning BioCoat REF354407) at 80,000 cells per well in 100 pL of complete differentiation medium. Cells were allowed to recover their differentiated phenotype in 96-well plates for approximately 1 week after plating prior to oligonucleotide treatment. RNA was isolated 6 days after treatment. 30 HBV infected dHepaRG cells HepaRG cells (Biopredics International, Rennes, France, Cat# HPR101) were cultured at 37°C in a humidified atmosphere with 5% CO2 in complete HepaRG growth medium consisting of William’s E Medium (GIBCO), Growth Medium Supplement (Biopredics, Cat# ADD711C) and 1% (v / v) GlutaMAX-l (Gibco #32551) and 1x Pen / Strep (Gibco, #15140) for 2 weeks. 35 To initiate differentiation, 0.9% (v / v) DMSO (Sigma-Aldrich, D2650) was added to the growth medium on confluent cells. After one week, medium was replaced by complete differentiation 2024201873 22 Mar 2024 medium (HepaRG growth medium supplemented with 1.8% (v / v) DMSO) in which cells were maintained for approximately 4 weeks with differentiation medium renewal every 7 days. Differentiated HepaRG cells (dHepaRG), displayed hepatocyte-like cell islands surrounded by monolayer of biliary-like cells. 5 Prior to HBV infection and compound treatment, dHepaRG cells were seeded into collagen I coated 96-well plates (Gibco, Cat# A11428-03) at 60,000 cells per well in 100 pL of complete differentiation medium. Cells were allowed to recover their differentiated phenotype in 96-well plates for approximately 1 week after plating prior to HBV infection. The dHepaRG cells were infected with HBV particles at an MOI of 30. The HBV particles were 10 produced from HBV-producing HepG2.2.15 cells (Sells et al 1987 Proc Natl Acad Sci II S A 84, 1005-1009). dHepaRG culture conditions, differentiation and HBV infection have been described previously (Hantz, 2009, J. Gen. Virol., 2009, 90: 127-135). In brief complete differentiation medium (HepaRG growth medium consisting of William’s E Medium (GIBCO), Growth Medium Supplement (Biopredics, Cat# ADD711C) and 1% (v / v) GlutaMAX-l (Gibco 15 #32551) and 1x Pen / Strep (Gibco, #15140), supplemented with 1.8% (v / v) DMSO), containing 4% PEG-8000 and virus stock (20 to 30 GE / cell) was added (120 p,L / well). One day postinfection, the cells were washed four times with phosphate-buffered saline and medium (complete differentiation medium) was replaced on day 4 and day 7 during the experiment. HBV infected A SGPR-dHepaRG 20 From the HepaRG cell line (Biopredics International, Rennes, France, Cat# HPR101) a cell line stably overexpressing human ASGPR1 and ASGPR2 was generated using a lentiviral method. Proliferating HepaRG cells were transduced at MOI 300 with a lentivirus produced on demand by Sirion biotech (CLV-CMV-ASGPR1-T2a_ASGPR2-IRES-Puro) coding for Human ASGPR1 and 2 under the control of a CMV promoter and a puromycin resistance gene. Transduced cells 25 were selected for 11 days with 1 pg / ml puromycin and then maintained in the same concentration of antibiotic to ensure stable expression of the transgenes. ASGPR1 / 2 overexpression was confirmed both at mRNA level by RT-qPCR (ASGPR1: 8560 fold vs nontransduced, ASGPR2: 2389 fold vs non-transduced), and at protein level by flow cytometry analysis. The differentiated cells are termed ASGPR-dHepaRG cells. 30 The ASGPR-HepaRG cells were differentiated using 1.8% DMSO for at least 2 weeks before infection. HBV infection was performed as for the dHepaRG cells described above. Primary mouse hepatocytes (PMH) Primary mouse hepatocytes were isolated from livers of C57BL / 6J mice anesthetized with Pentobarbital after a 2 step perfusion protocol according to the literature (Berry and Friend, 35 1969, J. Cell Biol; Paterna et al., 1998, ToxicoLAppL Pharmacol.). The first step was 5 min with HBSS + 15 mM HEPES + 0.4 mM EGTA followed by 12 min HBSS+20mM NaHCO3 +0.04% 2024201873 22 Mar 2024 BSA (Sigma #A7979) +4mM CaCL2 (Sigma #21115)+0,2 mg / ml Collagenase Type 2 (Worthington #4176). The Hepatocytes were captured in 5 ml cold Williams medium E (WME) (Sigma #W1878, complemented with 1x Pen / Strep / Glutamine, 10% (v / v) FBS (ATCC #302030)) on ice. 5 The crude cell suspension was filtered through a 70 pm followed by a 40 pm cell strainer (Falcon #352350 and #352340), filled up to 25 ml with WME and centrifuged at room temperature for 5 min at 50x g to pellet the hepatocytes. The supernatant was removed and the hepatocytes were resuspended in 25 ml WME. After adding 25 ml 90% Percoll solution (Sigma #P4937; pH=8.5-9.5) and centrifugation for 10 min at 25 °C, 50x g the supernatant and floating 10 cells were removed. To remove the remaining Percoll the pellet was resuspended again in 50 mL WME medium, centrifuged 3 min, 25 °C at 50x g and the supernatant discarded. The cell pellet was resuspended in 20 mL WME and cell number and viability determined (Invitrogen, Cellcount) and diluted to 250,000 cells / ml. 25,000 cells / well were seeded on collagen-coated 96-well plates (PD Biocoat Collagen I #356407) and incubated at 37 °C, 5% CO2. After 3-4 h, 15 the cells were washed with WME to remove unattached cells and the medium was replaced. 24 h after seeding the oligonucleotides were added in the desired concentration and the cells were incubated at 37 °C, 5% CO2 for 72 hours. RNA isolation (Qiagen, RNeasy 96) was followed by one-step RT-QPCR (Quanta Bioscience, qScript XLT 1-Step RT-qPCR ToughMix) using TaqMan assays for the target genes (PAPD5:MmO1244121_m1 FAM-MGB, PAPD7: 20 Mm01349513_m1 FAM-MGB) and a house keeping gene (GusB Mm_01197698_m1, VIC-MGB) according to the manufacturer’s protocols. Primary human hepatocyte (PHH) natural infection assay Primary human hepatocytes (PHH) isolated by collagenase perfusion method from chimeric uPA / SCID mice with humanized livers were obtained from PhoenixBio (Hiroshima, Japan). The 25 cells were plated on type I collagen coated 96-well plates at a concentration of 7 x 104 cells per well in culture media provided by Phoenix Bio (See Ishida et al 2015 Am J Pathol. Vol 185 page1275-1285 for further details). HBV genotype D was derived from HepG2.2.15 cell culture supernatant and concentrated using PEG precipitation. PHHswere infected in PHH medium containing 4% PEG 8000 at MOI 10 for 20h at 37°C before cells were washed 4 times with 30 PBS. One day 1 post-infection, oligonucleotide was delivered to the cells in a final volume of 125pl of PHH medium. The cells were retreated on day 4 and 7 post-infection. At day 11 postinfection, supernatants and cells were harvested. HBsAg and HBeAg levels in the supernatants were assessed using the CLIA ELISA assay (see Materials and Method section; HBV antigen measurements). mRNA was extracted from the cells using a MagNA Pure robot and the MagNA 35 Pure 96 Cellular RNA Large Volume Kit (Roche, #05467535001) according to the manufacturer’s protocol. The relative PAPD5 and PAPD7 mRNA expression levels were analyzed using Real-time PCR as described in Materials and Methods section. 2024201873 22 Mar 2024 HBV antigen measurements To evaluate the impact on HBV antigen expression and secretion, supernatants were collected on Day 11. The HBV propagation parameters, HBsAg and HBeAg levels, were measured using CLIA ELISA Kits (Autobio Diagnostic #CL0310-2, #CL0312-2), according to the manufacturer’s 5 protocol. Briefly, 25pL of supernatant per well were transferred to the respective antibody coated microtiter plate and 25 pL of enzyme conjugate reagent were added. The plate was incubated for 60min on a shaker at room temperature before the wells were washed five times with washing buffer using an automatic washer. 25 pL of substrate A and B were added to each well. The plates were incubated on a shaker for 10min at room temperature before 0 luminescence was measured using an Envision luminescence reader (Perkin Elmer). Real-time PCR for intracellular HBV mRNA from HBV infected cells HBV mRNA was quantified in technical duplicate by qPCR using a QuantStudio 12K Flex (Applied Biosystems), the TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems, #4392938), Human ACTB endogenous control (Applied Biosystems, #4310881E). Taqman reagents were 15 used together with the following commercial ThermoFisher Sceintific primers (HBV Pa03453406_s1, ACTB 4310881E). The mRNA expression was analyzed using the comparative cycle threshold 2-AACt method normalized to the reference gene ACTB and to PBS treated cells. Real-time PCR for PAPD5 and PAPD7 mRNA expression 20 QPCR was conducted on RNA extracted from treated cells or homogenized tissue samples. After RNA / LNA duplex denaturation (90 °C, 40 sec) Real-time PCR was done with a one-step protocol (qScript™ XLT One-Step RT-qPCR ToughMix®, Low ROXTM from Quanta Bioscience, #95134-500) in a duplex set up with the following TaqMan primer assays (ThermoFisher Scientific): 25 PAPD5 (Hs00223727_m1, FAM-MGB) PAPD7 (Hs00173159_m1, FAM-MGB), House keeping gene GUSB (Hu_4326320E, VIC-MGB) following the recommendations of the provider. HBV DNA quantification viral particle titer 30 HBV DNA extraction is performed using the QIAamp UltraSens Virus kit (Qiagen, #53704) according to the manufacturer’s protocol with the following optimizations. 30pL and 3pL of the virus sample are diluted into 1mL of PBS before adding buffer AC. The first centrifugation step is done for 45min at full speed and 4°C. HBV DNA is quantified in duplicate by qPCR using a QuantStudio 12K Flex (Applied Biosystems), the TaqMan Gene Expression Master Mix (Applied 35 Biosystems, #4369016) and a premix 1:1:0.5 of the primers indicated in Table 9 above and probe reconstituted at 100pM. The qPCR is performed using the following settings: UDG incubation (2min, 50°C), enzyme activation (10min, 95°C) and qPCR (40 cycles with 15sec, 2024201873 22 Mar 2024 95°C for denaturation and 1 min, 60°C for annealing and extension). Genomes equivalent calculation is based on a standard curve generated from HBV genotype D plasmid dilutions with known concentrations. The HBV particle titer can be determined using HBV core-specific primer (Integrated DNA 5 Technologies) (Table 11) in a QPCR on isolated intracellular mRNAfrom treated cells. Table 11: HBV core specific TaqMan probes Name Dye Sequence SEQID NO HBV core Primer Forward (F3 HBVcore) CTG TGC CTT GGG TGG CTT T 24 Reverse (R3 HBVcore) AAG GAA AGA AGT CAG AAG GCA AAA 25 Probe (P3 HBVcore) FAM-MGB AGC TCC AAA / ZEN / TTC TTT ATA AGG GTC GAT GTC CAT G 26 ZEN is an internal quencher Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be 10 applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used. Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 pmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60°C. The 15 oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by LIPLC, and the molecular mass is further confirmed by ESI-MS. Elongation of the oligonucleotide: The coupling of P-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), or LNA-T) is performed by using a solution of 20 0.1 M of the 5’-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle, a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile / pyridine 9:1). Phosphordiester linkages can be introduced using 25 0.02 M iodine in THF / Pyridine / water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis. For post solid phase synthesis conjugation a commercially available C6 aminolinker phorphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is 30 isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods. 2024201873 22 Mar 2024 Purification by RP-HPLC: The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10p 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL / min. The collected fractions are lyophilized to give the purified compound typically 5 as a white solid. Abbreviations: DCI: 4,5-Dicyanoimidazole DCM: Dichloromethane DMF: Dimethylformamide 10 DMT: 4,4’-Dimethoxytrityl THF: Tetrahydrofurane Bz: Benzoyl Ibu: Isobutyryl RP-HPLC: Reverse phase high performance liquid chromatography 15 Tm Assay: Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x Tm-buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95°C for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (Tm) is measured on a Lambda 20 40 UV / VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20°C to 95°C and then down to 25°C, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex Tm. Example 1: Screening for in vitro efficacy of antisense oligonucleotides targeting PAPD5 25 and PAPD7 (bispecific) in HeLa cells An oligonucleotide screen was done using 16 to 18mergapmers targeting SEQ ID NO: 17, 18 and 19. Efficacy testing was performed in an in vitro experiment in HeLa cells expressing both PAPD5 and PAPD7. HeLa cells were cultured as described in the Materials and Method section. The cells were 30 incubated for 24 hours before addition of oligonucleotides dissolved in PBS. Final concentration of oligonucleotides was 5 and 25 pM, the final culture volume was 100 pl / well. The cells were harvested 3 days after addition of oligonucleotide compounds and RNA was extracted using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer’s instructions. PAPD5 and PAPD7 mRNA levels were analysed by Real-time PCR as described in the 35 Materials and Method section. 2024201873 22 Mar 2024 The relative PAPD5 mRNA and PAPD7 mRNA expression levels are shown in table 12 as % of average control samples (PBS-treated cells) i.e. the lower the value the larger the inhibition. Table 12: in vitro efficacy of anti-PAPD5 / PAPD7 compounds (single experiment with duplex QPCR). PAPD5 and PAPD7 mRNA levels are normalized to GLISB in HeLa cells and shown as 5 % of control (PBS treated cells). CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 25 pM 5 pM 25 pM 5 pM Avg sd Avg sd Avg sd Avg sd 17_2 35.36 0.58 69.86 3.08 31.55 0.88 89.02 14.48 TCaaCtttcacTtcAGT 17_3 13.76 1.40 35.71 3.94 11.56 1.63 56.65 11.86 TCaactttcacTtcAGT 17_4 39.72 2.23 51.51 4.97 83.29 11.18 117.6 14.81 T caaCtttcacTtcAGT 17_5 24.87 2.09 53.56 8.57 62.21 2.96 27.92 2.32 TCaactttcacTtcaGT 17_6 19.50 1.22 34.68 0.37 14.51 0.16 82.74 26.43 TCaaCtttcactTCaGT 17_7 6.17 1.04 22.09 0.01 13.47 3.64 20.41 3.12 T cAactttcactT cAGT 17_8 9.85 1.44 28.15 4.60 25.29 4.47 26.39 3.48 T cAActttcactT caGT 17_9 18.73 2.57 47.62 3.48 31.00 3.51 58.02 6.32 TCAACtttcacttCaGT 17_10 6.13 1.18 23.39 0.44 5.88 0.34 31.76 3.25 T C AActttca cttCaGT 17_11 14.04 2.09 31.58 4.40 42.82 6.50 86.43 11.95 T CaaCtttcacttCaGT 17_12 15.33 0.62 29.82 1.07 34.94 5.35 51.77 3.89 T CaactttcacttCaGT 17_13 6.63 0.34 23.62 9.01 8.49 0.51 20.44 NA T cAActttcacttCaGT 17_14 4.61 1.98 22.51 5.00 6.19 0.36 44.27 6.69 TCAactttcacttcAGT 17_15 17.99 2.70 32.73 4.67 26.59 2.61 38.30 4.15 TCaaCtttcacttcAGT 17_16 42.29 1.06 75.49 6.32 26.91 1.57 46.19 0.88 TCaactttcacttcaGT 18_2 41.16 0.15 65.30 5.51 48.83 6.29 63.37 10.84 TCaaCtttcacTT CAG 18_3 54.39 3.08 71.95 2.89 69.99 0.89 66.50 3.56 T cAACtttcacTT cAG 18_4 40.86 1.32 64.99 4.39 78.13 1.60 109,0 0.49 TCAActttcacTtCAG 18_5 9.30 0.76 27.26 0.91 7.32 1.32 14.80 1.92 TCAActttcacTtCAG 18_6 7.49 0.75 21.64 2.49 10.32 0.39 14.16 0.82 T CaactttcacTtCAG 18_7 25.02 0.30 47.25 4.07 37.93 10.34 68.66 5.11 T caaCtttcacTtCAG 18_8 22.93 8.09 44.18 1.59 33.95 7.34 39.70 5.06 T Ca ActttcacTtcAG 18_9 15.21 2.21 39.74 0.32 12.21 1.80 23.08 0.01 TCAActttcactTCAG 18_10 3.99 0.67 20.53 4.40 7.81 0.52 23.89 2.49 TCAActttcactTCAG 18_11 13.84 3.93 35.46 1.52 28.39 1.96 56.56 11.43 TCAactttcactTCAG 18_12 5.13 0.14 20.21 0.24 3.40 0.29 41.51 7.20 TCAactttcactTCAG 18_13 11.90 1.05 26.20 0.47 26.51 0.82 20.79 5.61 TCaaCtttcactTCAG 18_14 5.42 0.33 20.05 2.62 8.85 1.46 66.72 8.16 T CaactttcactT CAG 18_15 7.16 0.03 20.84 1.94 6.17 0.05 46.67 1.26 T cAACtttca ctT cAG 18_16 14.28 2.44 33.79 1.00 29.49 1.95 16.87 2.38 T cAaCtttcactT cAG 18_17 27.49 2.66 61.62 9.21 55.71 3.61 36.14 0.32 T caaCtttcactT cAG 18_18 5.43 0.61 26.45 0.75 3.16 0.61 35.64 2.03 TCAACtttcacttCAG 18_19 4.85 1.04 17.24 1.69 12.48 0.60 13.12 0.88 TCAActttcacttCAG 18_20 5.51 0.05 20.28 1.07 12.76 1.24 14.83 0.13 TCAaCtttcacttcAG 18_21 10.64 0.32 23.88 1.67 12.61 0.50 14.50 1.05 TCaaCtttcacttCAG 18_22 10.66 1.95 34.29 7.33 16.22 1.84 25.81 7.43 T CaactttcacttCAG 18_23 5.50 1.99 24.63 0.61 10.97 0.12 27.22 1.51 TCAACtttcacttcAG 18_24 8.37 0.44 NA NA 12.02 1.77 NA NA T CAActttca cttcAG 18_25 7.58 0.80 23.71 3.32 9.03 0.05 19.79 1.14 TCAaCtttcacttcAG 18_26 12.94 0.46 35.03 2.99 25.90 0.06 28.01 0.45 T CAactttcacttcAG 18_27 7.21 1.46 21.24 2.15 19.27 2.92 72.92 25.73 TCaACtttcacttcAG 18_28 15.47 4.10 39.98 4.60 14.80 0.36 43.25 5.37 T CaaCtttcacttcAG 18_29 32.76 9.68 43.53 4.96 21.47 5.16 34.84 0.17 T CaactttcacttcAG 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 25 pM 5 pM 25 pM 5 pM 18_30 4.45 0.12 20.61 5.21 10.94 1.63 24.09 0.58 T cAACtttcacttcAG 18_31 55.81 9.87 71.92 22.31 50.86 4.18 60.22 0.42 T caaCtttcacttcAG 19_1 101.9 10.60 89.66 13.79 59.35 6.51 160.6 2.10 TGTTTcaatacTAAAA 19_2 90.94 1.54 68.65 6.91 59.66 1.75 60.33 1.98 TGTTtcaatacTAAAA 19_3 104.6 13.82 86.79 12.54 80.71 0.60 68.25 5.99 TGTTTcaatacTAa AA Example 2: in vitro EC50 and efficacy in HBV infected HepaRG cells. All the oligonucleotides from Example 1 were tested for their effect on HBV propagation parameters in HBV infected dHepaRG cells. 5 For comparative purposes the antisense oligonucleotides of the invention were compared to antisense oligonucleotides targeting HBV mRNA directly. The HBV targeting oligonucleotides are shown in table 13. Table 13: Comparative HBV targeting oligonucleotides Description Compound SEQ ID NO Reference HBV targeting 1 (HBV1) AGCgaagtgcacaCGG 27 WO2015 / 173208 HBV targeting 2 (HBV2) GCGtaaagagaGG 28 WO2015 / 173208 HBV infected dHepaRG cells (described in the Materials and Methods section, HBV infected 10 dHepaRG cells) were cultured in 96-well plates. One day post HBV infection the oligonucleotides were added to the cells in three-fold serial dilutions (20.00, 6.67, 2.22, 0.74, 0.25, 0.08, 0.03, 0.01 pM oligonucleotide) using unassisted uptake (gymnosis). A total of 49 oligonucleotides were tested. The experiment was conducted in triplicate, with PBS controls. The oligonucleotide treatment was repeated at day 4 and 7. 15 At day 11 post-infection, supernatants and cells were harvested. HBsAg and HBeAg levels in the supernatants were assessed using the CLIA ELISA assay (see Materials and Methods, HBV antigen measurements). EC 50, max KD (efficacy) of the HBV propagation parameters HBsAg and HBeAg was calculated using the R-function drm() from the drc package (v3.0-1) a four-parameter log-logistic 20 function is fitted to the expression of the gene of interest as a function of oligonucleotide concentration to obtain a value for EC50 and maximum knock-down. The results are shown in table 14 and are % of average control samples (PBS control and Non infected (NIF), calculated as follows [(Test Value - meanPBS) / (meanNIF - meanPBS)]*100)). 2024201873 22 Mar 2024 Table 14: EC50 and Max KD of anti-PAPD5 / PAPD7 compounds on HBsAg and HBeAg (average of 3) in HBV infected dHepaRG cells. CMP ID NO HBsAg HBeAg Compound Max KD % of saline EC50 pM Max KD % of saline EC50 pM Avg sd Avg sd Avg sd Avg sd 17_7 57.18 6.67 7.36 20.66 33.61 10.44 7.07 15.94 T cAactttcactT cAGT 17_8 28.29 13.46 4.75 1.59 23.75 11.32 5.14 1.69 T cAActttcactT caGT 17_10 19.10 4.81 6.73 15.00 2.28 11.52 6.63 2.67 T CAActttcacttCaGT 17_13 22.07 8.55 5.74 1.01 4.09 15.51 4.40 1.52 T cAActttcacttCaGT 17_14 0.00 855.97 24.07 61.33 1.04 NA 21.37 NA T CAactttcacttcAGT 18_1 5.42 9.05 4.67 0.71 5.88 14.10 4.12 1.22 TCAactttcacttCAG 18_5 4.70 9.40 6.67 1.20 0.30 7.04 4.86 0.80 TCAActttcacTtCAG 18_6 26.99 12.22 6.66 1.39 22.14 9.60 6.40 3.64 T CaactttcacTtCAG 18_10 0.00 10.01 4.94 0.88 2.68 10.92 4.40 1.09 TCAActttcactTCAG 18_12 14.01 8.21 6.52 0.60 3.86 14.96 6.12 1.14 TCAactttcactTCAG 18_15 15.87 25.90 6.22 3.82 32.23 7.88 2.10 4.75 T cAACtttcactT cAG 18_18 8.11 11.24 7.21 1.14 8.75 6.36 6.58 5.28 TCAACtttcacttCAG 18_19 3.43 3.49 2.32 0.18 3.75 5.69 2.16 3.09 TCAActttcacttCAG 18_20 36.72 4.45 7.05 17.16 0.00 74.91 8.07 9.71 TCAactttcacttCAG 18_21 26.03 51.79 9.16 9.36 0.00 92.94 10.13 14.18 TCaaCtttcacttCAG 18_23 11.13 7.74 5.53 0.76 6.33 9.42 4.82 0.99 TCAACtttcacttcAG 18_24 11.95 8.90 3.64 0.82 13.90 10.15 2.36 0.62 T CAActttcacttcAG 18_25 25.93 17.79 7.90 2.60 19.84 10.18 6.78 4.08 T CAaCtttcacttcAG 18_30 16.85 5.93 2.51 0.38 12.47 8.12 2.22 0.27 T cAACtttcacttcAG 17_3 93.91 127.26 32.39 329.47 89.14 8.47 0.91 10.00 T CaactttcacTtcAGT 17_5 90.80 7.82 1.31 10.00 95.11 10.13 0.10 10.00 TCaactttcacTtcaGT 17_6 92.43 NA 0.57 NA 89.80 NA 0.00 NA T CaaCtttcactT CaGT 17_9 54.71 6.03 7.08 14.69 15.37 35.83 8.44 3.80 TCAACtttcacttCaGT 17_11 83.26 7.52 3.61 10.00 62.66 9.37 0.58 10.00 TCaaCtttcacttCaGT 17_12 97.35 7.36 19.89 10.00 78.78 8.65 0.35 10.00 T CaactttcacttCaGT 17_15 91.43 NA 0.67 NA 78.81 8.76 0.46 10.00 T CaaCtttcacttcAGT 18_7 90.45 NA 11.53 NA 85.05 8.27 0.34 10.00 T caaCtttcacTtCAG 18_8 63.76 12.80 5.22 1.98 52.50 9.20 4.77 1.14 T CaActttcacTtcAG 18_9 23.40 156.35 12.06 23.00 26.07 11.37 7.57 16.01 TCAACtttcactTCAG 18_11 0.00 236.59 23.95 50.46 0.05 NA 18.25 NA TCAaCtttcactTCAG 18_13 53.81 6.31 7.16 11.60 42.15 8.15 7.31 13.89 TCaactttcactTCAG 18_14 32.71 11.10 5.13 1.25 24.27 14.19 4.20 1.31 TCaactttcactTCAG 18_16 81.65 6.89 7.15 17.43 72.67 8.30 7.01 9.77 T cAaCtttcactT cAG 18_22 29.19 5.87 6.40 7.22 16.60 18.52 4.54 1.31 T CaactttcacttC AG 18_26 40.75 8.16 5.35 0.90 36.63 6.43 5.34 1.09 T CAactttcacttcAG 18_27 20.92 10.83 4.61 1.10 13.89 13.63 4.03 1.20 T Ca ACtttca cttcAG 18_28 67.96 9.83 8.11 77.37 47.21 2274.28 18.70 138.89 T CaaCtttcacttcAG 17_2 84.70 14.17 0.28 10.00 61.86 9.52 0.21 10.00 T CaaCtttcacTtcAGT 2024201873 22 Mar 2024 CMP ID NO HBsAg HBeAg Compound Max KD % of saline EC50 pM Max KD % of saline EC50 pM Avg sd Avg sd Avg sd Avg sd 17_4 85.48 10.18 0.31 10.00 55.95 9.53 0.13 10.00 T caaCtttcacTtcAGT 17_16 68.31 10.41 0.10 10.00 39.65 9.69 0.27 10.00 T CaactttcacttcaGT 18_2 94.41 8.20 0.47 10.00 61.03 9.43 0.28 10.00 T CaaCtttcacTT CAG 18_3 68.72 9.16 0.24 10.00 51.03 9.02 0.14 10.00 T cAACtttcacTT cAG 18_4 92.64 8.61 0.12 10.00 85.97 8.77 0.18 10.00 TCAACtttcacTtCAG 18_17 71.76 8.21 0.59 10.00 49.14 8.82 0.83 10.00 T caaCtttcactT cAG 18_29 81.88 9.30 1.00 10.00 72.13 9.16 0.24 10.00 T CaactttcacttcAG 18_31 73.12 9.07 0.43 10.00 73.76 8.47 0.47 10.00 T caaCtttcacttcAG 19_1 82.69 9.37 0.20 10.00 96.30 10.43 0.06 10.00 T GTTT caatacT AAAA 19_2 85.50 16.76 0.27 10.00 83.38 8.96 0.24 10.00 TGTTtcaatacTAAAA 19_3 103.91 NA 0.30 NA 108.39 8.81 0.09 10.00 TGTTTcaatacTAaAA HBV1 0.00 16.32 2.44 1.22 0.00 23.37 1.33 1.09 AGCgaagtgcacaCGG HBV2 0.00 55.69 16.80 19.97 0.00 NA 20.73 NA GCGtaaagagaGG From these data it can be seen that a significant number of the compounds have a good effect on HBsAg and HBeAg. Compounds with the oligonucleotide motif of SEQ ID NO 17 and 18 seem more efficient than the compounds that have been made with the motif of SEQ ID NO: 19 In figure 3, it can also be seen that for oligonucleotides that reduce PAPD5 and PAPD7 in HeLa 5 cells with more than 70% there is a high correlation with respect to these oligonucleotides ability to reduce HBsAg in HBV infected dHepaRG cells. Example 3 Screening for in vitro efficacy of antisense oligonucleotides targeting PAPD5 and PAPD7 in HeLa cells A further library of 298 oligonucleotides expanding the diversity of the oligonucleotide motifs of 10 SEQ ID NO: 17, 18 and 19 using different designs was generated. Efficacy testing was performed in an in vitro experiment as described in Example 1, with the exception that the screening was only conducted at 5 pM. The relative PAPD5 mRNA and PAPD7 mRNA expression levels are shown in table 15 as % of average control samples (PBS-treated cells) i.e. the lower the value the larger the inhibition. 15 Table 15: in vitro efficacy of anti-PAPD5 / PAPD7 compounds (single experiment with duplex QPCR). PAPD5 and PAPD7 mRNA levels are normalized to GLISB in HeLa cells and shown as % of control (PBS treated cells). CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM Avg sd Avg sd 17 17 97.74 7.10 88.55 3.38 TCAaCtttcacTTCAGT 17 18 86.48 5.52 81.81 1.73 TCaACtttcacTTCAGT 17 19 66.13 13.83 78.41 1.05 T CaaCtttcacTT CAGT 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM 17 20 62.79 2.79 61.90 1.55 T CaactttcacTT CAGT 17 21 86.77 5.77 84.45 2.79 TcAACtttcacTTCAGT 17 22 83.56 9.69 76.97 2.27 T cAAcTttcacTT CAGT 17 23 75.81 5.73 73.23 5.44 T caaCtttcacTT CAGT 17 24 97.11 NA 88.80 2.14 TCAACtttcacTTCaGT 17 25 62.02 5.46 64.52 2.73 T CAActttcacTT CaGT 17 26 90.95 11.41 92.31 2.78 T CAaCtttcacTT CaGT 17 27 75.23 6.15 75.70 3.92 T CAacTttcacTT CaGT 17 28 57.34 11.56 51.15 2.33 T CAactttcacTT CaGT 17 29 86.07 8.22 79.21 4.63 T CaACtttcacTT CaGT 17 30 82.66 3.99 82.55 7.92 T CaAcTttcacTT CaGT 17 31 63.66 7.08 58.10 6.16 T CaActttcacTT CaGT 17 32 70.24 8.96 74.38 4.15 T CaaCtttcacTT CaGT 17 33 62.01 4.54 66.85 2.18 T CaacTttcacTT CaGT 17 34 47.04 1.05 53.40 3.12 T CaactttcacTT CaGT 17 35 77.50 7.79 79.78 1.36 T cAACtttcacTT CaGT 17 36 100.06 11.65 81.00 3.56 TCAACtttcacTTcAGT 17 37 85.23 8.93 80.34 2.60 T CAAcTttcacTT cAGT 17 38 68.09 6.84 70.24 2.54 T CaAcTttcacTT cAGT 17 39 75.83 14.88 74.95 1.29 T cAAcTttcacTT cAGT 17 40 60.89 6.53 69.40 1.14 T CaAcTttcacTT cAGT 17 41 67.33 12.02 73.92 1.59 T caaCtttcacTT cAGT 17 42 55.60 7.22 68.28 1.86 T caacTttcacTT cAGT 17 43 NA NA 73.73 6.69 T cAACtttcacTT caGT 17 44 78.69 9.83 69.98 3.35 T cAaCtttcacTT caGT 17 45 76.31 5.75 77.93 6.73 T caaCtttcacTT caGT 17 46 82.77 4.94 88.62 3.06 TCAACtttcacTtCAGT 17 47 75.09 3.28 75.56 NA TCAaCtttcacTtCAGT 17 48 41.87 3.23 46.58 4.31 T CaActttcacTtCAGT 17 49 65.39 3.03 73.12 4.72 TCaaCtttcacTtCAGT 17 50 44.54 7.92 58.99 1.91 T CaacTttcacTtCAGT 17 51 38.28 4.62 49.61 11.12 T CaactttcacTtCAGT 17 52 72.04 11.74 67.18 1.56 T caaCtttcacTtCAGT 17 53 77.11 6.61 80.39 4.87 TCAACtttcacTtCaGT 17 54 68.58 5.17 81.14 9.92 T CAAcTttcacTtCaGT 17 55 54.70 NA 55.71 7.63 T CAActttcacTtCaGT 17 56 73.62 8.99 77.13 4.24 TCAactttcacTtCaGT 17 57 37.11 4.10 45.26 2.67 TCAactttcacTtCaGT 17 58 75.70 7.51 79.77 3.37 TCaActttcacTtCaGT 17 59 62.77 7.89 67.67 2.31 T CaAcTttcacTtCaGT 17 60 59.08 5.30 53.75 3.07 TCaActttcacTtCaGT 17 61 58.34 2.53 66.25 3.04 T CaaCTttcacTtCaGT 17 62 69.33 5.17 72.06 2.78 TCaaCtttcacTtCaGT 17 63 61.54 NA 64.88 2.78 TCaacTttcacTtCaGT 17 64 49.47 3.41 50.89 2.55 TCaactttcacTtCaGT 17 65 80.85 11.35 81.88 4.86 TCAACtttcacTtcAGT 17 66 65.22 NA 68.32 2.12 T CAAcTttcacTtcAGT 17 67 54.53 4.81 53.80 1.98 T CAActttcacTtcAGT 17 68 74.51 6.00 76.56 0.65 T C Aa Ctttca cT tcAGT 17 69 56.83 NA 57.20 4.10 T CAacTttcacTtcAGT 17_70 76.86 NA 76.34 2.03 T CaACtttcacTtcAGT 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM 17 71 63.44 10.55 64.68 5.87 T CaAcTttcacTtcAGT 17 72 62.56 5.79 61.72 1.34 T cAAcTttcacTtcAGT 17 73 60.51 6.25 67.89 3.45 T CAACtttcacTtcaGT 17 74 54.17 NA 56.84 3.66 T CAActttcacTtcaGT 17 75 66.76 4.71 62.81 3.26 T CAaCTttcacTtcaGT 17 76 66.23 5.60 53.07 13.10 T CAaCtttcacTtcaGT 17 77 59.39 8.21 63.25 4.95 TCAacTttcacTtcaGT 17 78 56.02 5.00 64.25 3.27 T CaACtttcacTtcaGT 17 79 45.91 4.00 56.13 3.45 T CaAcTttcacTtcaGT 17 80 69.86 6.08 69.85 3.93 T CaaCtttcacTtcaGT 17 81 65.32 5.73 70.58 4.02 T CaacTttcacTtcaGT 17 82 63.33 8.83 70.99 4.18 T cAACtttcacTtcaGT 17 83 68.96 8.36 74.25 5.87 T cAa Ctttca cTtca GT 17 84 63.62 7.64 81.25 4.70 T caaCtttcacTtcaGT 17 85 83.30 4.59 84.25 2.62 TCAACtttcactTCAGT 17 86 37.09 7.98 43.15 2.13 T CaActttcactT CAGT 17 87 50.48 4.81 60.27 6.81 TCaaCtttcactTCAGT 17 88 53.38 5.35 56.84 5.09 T CaacTttcactT CAGT 17 89 NA NA 43.67 3.84 T CaactttcactT CAGT 17 90 29.17 3.73 37.06 3.81 T cAActttcactT CAGT 17 91 61.71 7.15 71.61 3.90 T cAaCtttcactT CAGT 17 92 56.04 3.53 65.82 5.45 T caaCtttcactT CAGT 17 93 45.09 4.71 56.40 2.59 T CaactttcactT CAGT 17 94 69.38 7.28 70.95 4.84 TCAACtttcactTCaGT 17 95 64.57 3.46 70.96 2.87 T CAAcTttcactT CaGT 17 96 34.51 2.38 39.62 1.63 T CAActttcactT CaGT 17 97 55.05 10.06 57.09 1.62 TCAaCtttcactTCaGT 17 98 64.97 7.46 63.11 2.12 T CAacTttcactT CaGT 17 99 36.70 4.12 39.75 1.43 T CAactttcactT CaGT 17 100 39.06 NA 41.61 1.24 T CaActttcactT CaGT 17 101 41.26 2.45 49.05 3.40 T CaactttcactT CaGT 17 102 78.96 10.63 60.35 2.12 T cAACtttcactT CaGT 17 103 32.50 2.83 36.44 1.34 T cAActttcactT CaGT 17 104 60.36 6.41 58.67 0.78 TcAa Ctttca ctTCa GT 17 105 58.78 3.01 65.37 2.47 T cAacTttcactT CaGT 17 106 41.78 7.71 45.57 2.93 TcAactttcactTCaGT 17 107 68.24 10.65 68.52 2.11 TcaaCtttcactTCaGT 17 108 63.66 6.15 69.87 1.49 T CaactttcactT CaGT 17 109 43.39 6.06 44.03 1.22 T CAActttcactT cAGT 17 110 67.71 3.99 68.24 2.49 T CAaCtttcactT cAGT 17 111 38.72 5.67 45.18 4.37 T CaactttcactT cAGT 17 112 74.81 8.54 82.12 2.07 T cAACtttcactT cAGT 17 113 45.61 3.48 49.46 3.00 T cAActttcactT cAGT 17 114 75.79 7.63 72.29 2.16 T cAaCtttcactT cAGT 17 115 75.42 15.41 74.41 3.07 T caActttcactT cAGT 17 116 65.82 10.42 71.11 2.68 T caaCtttcactT cAGT 17 117 59.41 10.07 62.29 5.94 T CaactttcactT cAGT 17 118 52.64 NA 52.72 2.61 T CAACtttcactT caGT 17 119 39.63 NA 40.24 1.12 T C AActttca ctTca GT 17 120 59.98 2.92 50.20 0.85 T CAaCtttcactT caGT 17_121 43.88 11.36 47.72 4.55 T CAactttcactT caGT 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM 17 122 64.88 13.05 60.50 3.00 T Caa CtttcactT ca GT 17 123 63.11 5.97 66.33 6.52 TCaactttcactTcaGT 17 124 56.82 7.60 52.41 2.44 TcAa Ctttca ctT ca GT 17 125 53.85 8.06 61.73 4.31 T cAactttcactT caGT 17 126 81.50 15.86 84.13 4.80 T caActttcactT caGT 17 127 78.91 10.65 82.69 2.51 T caactttcactT caGT 17 128 81.11 11.24 78.80 1.05 TCAACtttcacttCAGT 17 129 32.28 2.57 39.12 1.07 T CAactttcacttCAGT 17 130 70.27 8.13 72.06 1.44 TCaACtttcacttCAGT 17 131 52.53 5.34 51.48 1.51 T CaAcTttcacttCAGT 17 132 39.54 5.34 40.49 2.90 T CaActttcacttCAGT 17 133 49.75 8.73 51.25 2.19 TCaaCtttcacttCAGT 17 134 40.11 4.72 46.40 3.25 T CaacTttcacttCAGT 17 135 32.68 5.78 44.12 1.28 T CaactttcacttCAGT 17 136 73.83 11.05 64.31 14.71 TcAACtttcacttCAGT 17 137 27.45 3.58 37.37 0.87 T cAActttcacttCAGT 17 138 52.94 2.36 52.33 6.75 T cAaCtttcacttCAGT 17 139 33.04 3.96 41.18 2.84 T cAactttcacttCAGT 17 140 51.65 1.57 52.29 3.62 TCAAcTttcacttCaGT 17 141 61.72 2.80 58.93 0.97 TCAaCTttcacttCaGT 17 142 46.19 NA 52.83 5.45 TCAaCtttcacttCaGT 17 143 43.84 1.08 45.66 0.98 T CAacTttcacttCaGT 17 144 37.39 2.38 43.74 1.32 TCAaCtttcacttCaGT 17 145 67.26 7.35 74.40 4.87 TCaACTttcacttCaGT 17 146 56.45 2.94 56.68 0.48 TCaACtttcacttCaGT 17 147 47.22 1.68 54.43 1.21 T CaAcTttcacttCaGT 17 148 43.18 2.71 56.05 1.42 T CaaCTttcacttCaGT 17 149 45.97 NA 53.84 3.68 TCaacTttcacttCaGT 17 150 59.24 6.22 60.59 3.40 T cAACtttcacttCaGT 17 151 51.93 NA 61.55 5.08 T cAaCtttcacttCaGT 17 152 47.41 5.67 52.89 3.10 T cAaCtttcacttCaGT 17 153 65.27 4.09 69.29 7.55 T caActttcacttCaGT 17 154 53.74 NA 62.46 1.61 T caaCTttcacttCaGT 17 155 66.62 5.23 74.14 3.90 T caactttcacttCaGT 17 156 48.09 0.70 49.14 1.49 T CAAcTttcacttcAGT 17 157 38.49 2.92 43.72 1.30 T CAActttcacttcAGT 17 158 59.33 3.81 63.90 1.94 T C Aa CTttca cttcAGT 17 159 56.79 9.47 55.56 2.69 T CAaCtttcacttcAGT 17 160 50.32 7.20 48.93 2.20 T CaaCTttcacttcAGT 17 161 40.36 4.00 45.81 1.30 T CaacTttcacttcAGT 17 162 64.11 4.76 62.08 1.69 T cAaCtttcacttcAGT 17 163 58.28 NA 59.97 2.18 T cAactttcacttCAGT 17 164 76.29 13.13 77.15 3.83 T caActttcacttcAGT 17 165 78.09 15.89 72.59 8.69 T caactttcacttcAGT 17 166 62.49 3.63 64.37 5.16 T CAACTttcacttcaGT 17 167 50.03 8.03 54.73 1.30 T CAACtttcacttcaGT 17 168 51.60 9.81 52.08 4.48 T CAAcTttcacttcaGT 17 169 46.17 5.15 51.40 2.49 T CAActttcacttca GT 17 170 52.75 11.01 54.83 2.69 TCAaCTttcacttcaGT 17 171 53.33 9.21 54.36 2.78 TC Aa Ctttcacttca GT 17_172 58.21 6.31 58.05 1.23 T C Aactttca cttca GT 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM 17 173 53.76 2.90 58.61 1.13 TCaACTttcacttcaGT 17 174 50.25 5.79 50.99 7.67 T Ca ACtttcacttca GT 17 175 51.82 4.61 54.72 1.85 T Ca Actttca cttca GT 17 176 53.43 NA 58.36 6.34 TCaaCtttcacttcaGT 17 177 57.85 3.78 63.73 2.53 TCaacTttcacttcaGT 17 178 62.40 7.11 60.69 2.19 T cAActttca cttca GT 17 179 58.09 9.19 57.23 4.50 T cAaCtttcacttcaGT 17 180 74.45 11.02 75.46 4.00 T cAactttcacttcaGT 17 181 90.80 14.30 82.83 2.65 T ca Actttca cttca GT 17 182 74.91 NA 75.31 4.39 T ca aCtttca cttca GT 17 183 88.59 4.23 85.23 2.44 TcaactttcacttcaGT 18 1 32.92 3.39 35.69 3.82 T CAactttcacttCAG 18 250 100.08 10.66 88.51 4.20 TCAACtttcaCTTCAG 18 251 84.40 7.39 80.86 4.12 TCAActttcaCTTCAG 18 252 91.54 3.68 89.30 5.79 TCAaCtttcaCTTCAG 18 253 91.81 6.31 89.37 3.90 TCaACtttcaCTTCAG 18 254 85.25 10.05 84.67 2.91 TCaaCtttcaCTTCAG 18 255 86.24 2.27 87.98 0.91 Tea a Ctttca CTTC AG 18 256 78.51 4.22 82.48 9.24 TcaactttcaCTTCAG 18 257 89.59 11.37 90.01 5.75 T cAaCtttcaCTT cAG 18 258 95.95 14.37 92.27 12.06 T caaCtttcaCTT cAG 18 259 81.62 8.01 75.93 5.23 T caactttcaCTT cAG 18 260 89.34 4.48 92.90 6.69 TCAactttcaCTtCAG 18 261 54.74 NA 59.78 4.39 TCAactttcaCTtCAG 18 262 91.32 12.46 85.83 4.88 TCaaCtttcaCTtCAG 18 263 53.49 6.41 55.73 1.72 TCaactttcaCTtCAG 18 264 77.00 7.13 83.85 2.44 TcAACtttcaCTtCAG 18 265 82.71 2.41 80.20 3.21 TcaaCtttcaCTtCAG 18 266 65.50 14.42 63.32 7.76 T caactttcaCTtCAG 18 267 88.30 14.79 88.12 2.67 TCAActttcaCTtcAG 18 268 85.83 5.66 80.25 1.37 TCAActttcaCTtcAG 18 269 84.52 3.17 89.90 6.04 TCAaCtttcaCTtcAG 18 270 57.28 7.24 62.34 NA T CAactttcaCTtcAG 18 271 84.49 8.06 91.51 3.02 TCaACtttcaCTtcAG 18 272 76.13 4.46 79.90 NA T CaActttcaCTtcAG 18 273 85.88 7.38 97.42 4.00 T cAaCtttcaCTtcAG 18 274 95.40 13.18 95.86 1.55 T caaCtttcaCTtcAG 18 275 95.60 10.21 92.33 2.77 TCAActttcaCtTCAG 18 276 83.72 6.59 80.77 2.02 TCAActttcaCtTCAG 18 277 90.13 10.30 96.27 13.83 TCAactttcaCtTCAG 18 278 55.67 8.13 62.46 6.54 TCAactttcaCtTCAG 18 279 87.22 13.33 88.16 8.73 TCaACtttcaCtTCAG 18 280 76.65 3.97 79.84 12.72 TCa Actttca CtTCAG 18 281 81.18 8.97 84.87 7.12 TCaaCtttcaCtTCAG 18 282 61.04 7.74 61.76 1.66 TCaactttcaCtTCAG 18 283 84.65 3.34 80.88 2.96 TCaaCtttcaCtTCAG 18 284 61.02 6.86 62.10 2.82 TCaactttcaCtTcAG 18 285 86.61 3.69 95.03 18.61 TcAACtttcaCtTcAG 18 286 84.98 9.65 85.00 14.32 T cAActttcaCtT cAG 18 287 86.45 4.35 88.69 7.72 T cAaCtttcaCtT cAG 18 288 57.67 1.82 61.38 NA T cAactttcaCtT cAG 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM 18 289 79.05 6.07 83.92 4.10 T caActttcaCtT cAG 18 290 87.52 9.96 91.14 2.20 T caaCtttcaCtT cAG 18 291 73.29 5.03 69.25 5.43 T caactttcaCtT cAG 18 292 72.78 7.03 68.16 1.00 TCAACtttcaCttCAG 18 293 59.43 5.50 58.08 2.89 TCAActttcaCttCAG 18 294 75.84 3.56 63.66 3.73 TCAaCtttcaCttCAG 18 295 46.89 3.57 49.06 2.63 TCAactttcaCttCAG 18 296 65.42 3.75 63.31 3.08 TCaACtttcaCttCAG 18 297 58.20 6.79 55.76 1.22 TCaActttcaCttCAG 18 298 66.88 4.87 66.09 3.03 TCaaCtttcaCttCAG 18 299 57.00 3.54 52.43 0.96 TCaactttcaCttCAG 18 300 67.40 4.43 64.15 3.50 TcAACtttcaCttCAG 18 301 76.29 2.94 66.61 0.93 TcaACtttcaCttCAG 18 302 79.40 6.94 75.09 2.40 T caActttcaCttCAG 18 303 80.86 2.61 67.53 3.70 TCAACtttcaCttcAG 18 304 67.19 3.65 64.77 2.65 TCAActttcaCttCAG 18 305 79.81 7.90 76.61 4.75 TCAaCtttcaCttcAG 18 306 65.48 4.30 60.08 1.89 TCAactttcaCttCAG 18 307 70.08 6.13 70.40 2.08 TCaACtttcaCttcAG 18 308 70.99 2.21 71.46 3.87 TCaActttcaCttCAG 18 309 69.43 6.30 81.14 12.38 TCaaCtttcaCttcAG 18 310 73.04 7.86 73.31 4.69 TCaactttcaCttCAG 18 311 72.32 9.45 78.61 8.91 TcAACtttcaCttcAG 18 312 67.82 11.23 78.05 7.27 T cAActttcaCttcAG 18 313 75.81 10.76 78.01 7.76 T cAaCtttcaCttcAG 18 314 66.04 5.65 75.33 8.56 T cAactttcaCttcAG 18 315 78.82 5.66 75.34 2.78 T caACtttcaCttcAG 18 316 87.37 14.72 95.41 6.94 T caaCtttcaCttcAG 18 317 79.19 4.27 94.13 12.76 T caactttcaCttcAG 18 318 59.57 10.72 63.41 2.62 TCAActttcacTTCAG 18 319 84.55 4.72 81.60 3.53 TCAaCtttcacTTCAG 18 320 72.74 2.03 79.32 10.24 TCaACtttcacTTCAG 18 321 72.73 6.17 74.90 3.78 TcAACtttcacTTCAG 18 322 70.71 12.19 72.65 3.47 T cAaCtttcacTT CAG 18 323 63.05 4.68 64.11 2.23 T caaCtttcacTT CAG 18 324 90.00 7.49 79.94 4.07 TCAACtttcacTTcAG 18 325 79.21 4.73 75.34 2.42 T C Aa Ctttca cTT cAG 18 326 68.92 NA 67.74 4.83 T CaaCtttcacTT cAG 18 327 56.44 4.90 56.48 2.86 T cAActttcacTT cAG 18 328 75.87 4.14 71.99 4.42 T cAaCtttcacTT cAG 18 329 61.35 2.64 57.83 2.46 T cAactttcacTT cAG 18 330 82.34 3.56 78.64 4.39 T caaCtttcacTT cAG 18 331 75.40 6.43 72.02 3.95 T caactttcacTT cAG 18 332 72.69 7.00 73.99 3.23 TCAaCtttcacTtCAG 18 333 47.08 4.26 45.64 2.17 T CaActttcacTtCAG 18 334 63.55 2.17 61.47 5.18 TCaaCtttcacTtCAG 18 335 45.43 2.17 43.67 0.51 T cAActttcacTtCAG 18 336 62.16 1.68 63.10 4.22 T caactttcacTtCAG 18 337 68.12 1.83 69.62 5.48 TCAACtttcacTtcAG 18 338 58.66 3.79 55.57 3.90 T CAActttcacTtcAG 18 339 64.78 3.20 67.31 4.73 T CAaCtttcacTtcAG 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Compound (CMP) 5 pM 5 pM 18 340 73.84 12.62 70.76 2.66 TCaaCtttcacTtcAG 18 341 63.86 1.31 62.80 2.97 T CaactttcacTtcAG 18 342 63.62 7.33 62.67 3.14 T cAACtttcacTtcAG 18 343 77.34 8.12 76.95 8.74 T cAaCtttcacTtcAG 18 344 77.52 4.63 72.61 19.40 T caaCtttcacTtcAG 18 345 44.88 5.16 44.48 2.03 TCaACtttcactTCAG 18 346 33.58 3.96 33.46 0.75 T CaActttcactT CAG 18 347 25.34 3.90 27.48 1.20 T cAActttcactT CAG 18 348 72.22 13.10 69.54 2.55 T caActttcactT CAG 18 349 60.34 3.62 62.20 3.43 T caactttcactT CAG 18 350 42.64 7.75 39.08 1.64 T CAActttcactT cAG 18 351 64.87 4.90 60.46 2.58 T CaaCtttcactT cAG 18 352 60.50 8.75 58.85 NA T CaactttcactT cAG 18 353 46.91 7.66 48.41 2.35 T cAActttcactT cAG 18 354 56.92 5.54 55.90 3.41 T caACtttcactT cAG 18 355 83.71 14.79 81.27 2.26 T caActttcactT cAG 18 356 39.74 8.56 46.46 NA TCaACtttcacttCAG 18 357 38.75 4.00 38.86 1.61 T CaActttcacttCAG 18 358 38.88 4.61 43.88 5.77 T caACtttcacttCAG 18 359 77.53 8.61 72.87 3.73 T caActttcacttCAG 18 360 78.21 NA 75.73 4.38 T caactttcacttCAG 18 361 57.41 NA 51.70 2.51 T cAaCtttcacttcAG 19 4 101.90 8.84 105.29 4.25 TGTTTcaataCTAAAA 19 5 105.24 11.89 100.23 3.22 TGTTtcaataCTAAAA 19 6 99.75 6.33 104.03 3.46 TGTtTcaataCTAAAA 19 7 91.29 NA 91.20 2.56 TGTttca ata CTAAAA 19 8 106.37 NA 100.46 3.70 TGtTTcaataCTAAAA 19 9 108.42 11.96 101.59 4.05 TGttTca ata CTAAAA 19 10 100.39 8.50 102.93 6.06 TgTTTcaata CTAAAA 19 11 90.83 3.68 92.38 3.27 T GTTT caataCT AaAA 19 12 90.86 3.89 91.69 3.53 TGTTtcaataCTAaAA 19 13 89.85 3.87 91.34 2.59 TGTtTcaata CT AaAA 19 14 94.01 8.75 94.66 2.33 TGTttcaataCTAaAA 19 15 92.12 2.54 91.25 2.22 T GtTT caata CT AaAA 19 16 97.86 5.30 93.85 1.92 T gTTT caataCT AaAA 19 17 105.50 15.59 99.75 4.80 T GTTT caata CT a AAA 19 18 102.61 5.30 96.26 2.40 T GTTtcaataCT aAAA 19 19 94.76 5.45 94.05 2.41 TGTtTcaata CTaAAA 19 20 97.80 9.88 102.61 9.09 T GTTT caataCT aaAA 19 21 95.95 9.14 89.84 2.06 TGTTtcaataCTaaAA 1922 101.79 7.29 95.45 3.90 TGTTTcaataCtAAAA From these data it can be seen that the LNA-gapmer designs based on the motif sequence with SEQ ID NO: 19 have very low (between 0 and 10%) PAPD5 and PAPD7 knock down. Example 4: in vitro EC50 and efficacy of selected antisense oligonucleotides in HeLa cells. 5 The EC50 and efficacy (KD) of the best performing oligonucleotides from Example 1 and 3 was determined using the same assay with the following oligonucleotide concentrations 50, 15.81, 5.00, 1.58, 0.50, 0.16, 0.05, and 0.016 pM. 2024201873 22 Mar 2024 EC 50, max KD (efficacy) of the PAPD5 and PAPD7 mRNA expression was calculated using the R-function drm() from the drc package (v3.0-1) a four-parameter log-logistic function is fitted to the expression of the gene of interest as a function of oligonucleotide concentration to obtain a value for EC50 and maximum knock-down. The results are shown in Table 16. 5 Table 16: EC50 and Max KD of anti-PAPD5 / PAPD7 compounds on PAPD5 and PAPD7 mRNA expression in HeLa cells. CMP ID NO PAPD5 PAPD7 Compound Max KD % of saline EC50 pM Max KD % of saline EC50 pM Avg sd Avg sd Avg sd Avg sd 17_7 1.45 7.29 2.40 0.55 8.00 6.58 3.13 0.65 T cAactttcactT cAGT 17_8 7.66 4.14 3.08 0.42 5.37 5.16 4.00 0.62 T cAActttcactT caGT 17_10 0.00 2.40 2.30 0.19 3.31 5.90 3.79 0.68 T CAActttcacttCaGT 17_12 6.52 3.37 2.72 0.31 11.14 4.37 3.32 0.49 TCaactttcacttCaGT 17_13 0.68 5.12 2.43 0.42 2.29 4.83 3.64 0.55 T cAActttcacttCaGT 17_14 0.19 5.00 2.51 0.42 3.13 4.54 3.69 0.52 T CAactttcacttcAGT 17_51 3.29 3.89 1.41 0.21 5.81 1.20 1.78 0.08 T CaactttcacTtCAGT 17_57 2.61 7.96 1.54 0.47 3.07 3.45 1.76 0.21 T CAactttcacTtCaGT 17_86 0.00 3.77 1.19 0.17 0.00 3.32 2.01 0.22 T CaActttcactT CAGT 17_89 6.03 2.64 1.02 0.11 9.23 3.65 1.44 0.21 T CaactttcactT CAGT 17_90 2.43 5.44 1.38 0.29 1.87 5.63 1.95 0.40 T cAActttcactT CAGT 17_96 3.27 2.62 1.85 0.18 0.00 3.44 1.99 0.24 T CAActttcactT CaGT 17_99 0.00 3.61 1.42 0.18 0.55 5.03 1.57 0.28 T CAactttcactT CaGT 17_100 1.01 2.65 1.66 0.16 3.81 3.46 1.89 0.24 T CaActttcactT CaGT 17_103 0.00 2.69 1.09 0.12 0.00 3.70 1.46 0.21 T cAActttcactT CaGT 17_111 3.45 3.62 1.39 0.20 2.65 5.82 2.03 0.41 T CaactttcactT cAGT 17_119 0.00 6.24 1.75 0.39 0.30 3.81 1.86 0.25 T CAActttcactT caGT 17_129 0.00 2.62 1.02 0.11 2.60 2.44 1.41 0.13 T CAactttcacttCAGT 17_132 1.71 2.02 1.27 0.10 0.00 4.17 1.74 0.26 T CaActttcacttCAGT 17_135 0.00 3.23 1.24 0.14 8.56 4.86 2.04 0.38 T CaactttcacttCAGT 17_137 0.00 2.80 1.07 0.12 1.34 3.94 1.64 0.23 T cAActttcacttCAGT 17_139 0.00 3.62 1.43 0.20 2.48 5.82 1.89 0.39 T cAactttcacttCAGT 17_144 0.91 2.35 1.40 0.12 1.53 1.58 1.95 0.11 TCAactttcacttCaGT 17_157 2.94 2.87 1.27 0.14 2.32 3.12 1.62 0.18 T CAActttcacttcAGT 18_1 2.74 1.41 1.82 0.09 5.06 2.24 2.03 0.16 T CAactttcacttCAG 18_5 4.25 6.93 4.08 0.82 6.91 4.42 3.35 0.47 TCAActttcacTtCAG 18_6 5.49 4.00 2.97 0.39 8.16 4.67 2.93 0.45 T CaactttcacTtCAG 18_10 0.00 6.55 1.60 0.38 0.00 3.59 2.17 0.26 TCAActttcactTCAG 18_12 1.34 3.34 1.69 0.20 0.84 4.01 2.37 0.32 T CAactttcactT CAG 18_15 5.89 2.84 2.92 0.28 6.85 3.64 3.10 0.39 T cAACtttcactT cAG 18_18 4.23 4.44 2.71 0.41 2.40 10.93 2.76 0.88 TCAACtttcacttCAG 18_19 2.22 3.25 2.04 0.23 1.66 5.12 2.53 0.44 TCAActttcacttCAG 18_20 0.00 3.21 2.56 0.27 0.00 4.96 2.81 0.47 TCAaCtttcacttCAG 2024201873 22 Mar 2024 CMP ID NO PAPD5 PAPD7 Compound Max KD % of saline EC50 pM Max KD % of saline EC50 pM Avg sd Avg sd Avg sd Avg sd 18_21 2.13 3.08 2.52 0.25 5.72 2.45 2.73 0.23 TCaaCtttcacttCAG 18_23 0.49 4.56 2.65 0.39 0.53 3.28 3.02 0.31 TCAACtttcacttcAG 18_24 0.29 6.14 2.82 0.54 0.00 6.27 2.95 0.61 T CAActttcacttcAG 18_25 2.22 5.75 2.55 0.49 0.00 3.68 3.13 0.36 T CAaCtttcacttcAG 18_27 0.00 4.13 2.30 0.30 1.21 2.04 2.87 0.19 T CaACtttcacttcAG 18_28 10.11 3.82 4.52 0.56 12.26 11.67 5.13 1.78 T CaaCtttcacttcAG 18_30 1.60 3.21 2.56 0.27 0.00 3.47 3.10 0.34 T cAACtttcacttcAG 18_346 0.56 3.27 1.27 0.17 1.43 1.58 1.49 0.09 T CaActttcactT CAG 18_347 0.16 3.81 0.87 0.14 0.00 1.55 1.17 0.07 T cAActttcactT CAG 18_350 0.00 3.12 1.54 0.17 1.43 1.29 2.10 0.09 T CAActttcactT cAG 18_357 0.00 2.87 1.61 0.18 0.00 1.97 2.18 0.15 T CaActttcacttCAG 18_358 0.00 2.30 1.54 0.13 0.15 1.91 2.31 0.14 T caACtttcacttCAG Example 5: in vitro effect on HBV infected ASGPR-dHepaRG cells using selected antisense oligonucleotides targeting PAPD5 and PAPD7. A selection of the oligonucleotides screened in example 3 was screened in ASGPR-dHepaRG 5 essentially using the assay of example 2 with the following changes. The screening was conducted in HBV infected ASGPR-dHepaRG at the following concentrations 20, 6.67 and 2.22 pM of oligonucleotide and with the comparative molecules in table 17. For comparative purposes combinations of a single targeting PAPD5 and a single targeting PAPD7 oligonucleotide in table 17 were tested together with the oligonucleotides of the 10 invention. Table 17: Combination of single targeting PAPD5 and PAPD7 oligonucleotide Description Compound SEQ ID NO Reference PAPD5 and PAPD7 single targeting combination 1 (combol) CAAaggttgttgtacT CT 31 PCT / EP2017 / 064980 CAGTtttatgctaatCA 32 PCT / EP2017 / 064980 PAPD5 and PAPD7 single targeting combination 2 (combo2) GTAttcttattcttgCT 33 PCT / EP2017 / 064980 CATT gcttttataatccT A 34 PCT / EP2017 / 064980 The reduction of HBsAg and HBeAg levels are shown in table 18 and 19, the larger the value the larger the inhibition. Table 18: in vitro efficacy on HBsAg of anti-PAPD5 / PAPD7 compounds in three concentrations 15 (average of 3) in HBV infected ASGPR-dHepaRG cells. CMP ID NO 20 pM 6.67pM 2.22 pM Compound Avg sd Avg sd Avg sd 17_51 -9.61 19.93 -30.60 9.19 -33.16 6.96 T CaactttcacTtCAGT 2024201873 22 Mar 2024 CMP ID NO 20 pM 6.67pM 2.22 pM Compound Avg sd Avg sd Avg sd 17_57 9.44 6.27 -18.18 8.10 -33.24 6.19 T CAactttcacTtCaGT 17_86 20.58 5.80 -5.34 4.43 -8.03 5.54 T CaActttcactT CAGT 17_89 2.66 3.48 -12.71 2.14 -7.18 7.05 T CaactttcactT CAGT 17_90 40.07 6.93 3.05 14.90 -11.67 7.22 T cAActttcactT CAGT 17_96 58.09 7.77 36.82 3.53 4.92 4.06 T CAActttcactT CaGT 17_99 25.54 6.97 5.75 8.72 -7.25 5.93 T CAactttcactT CaGT 17_100 43.85 7.30 15.20 12.19 -10.24 9.46 T CaActttcactT CaGT 17_103 41.44 9.31 25.07 2.93 9.98 3.98 T cAActttcactT CaGT 17_111 -5.59 7.25 -7.04 3.62 -8.11 6.03 T CaactttcactT cAGT 17_119 73.06 2.91 51.21 3.44 13.11 9.33 T CAActttcactT caGT 17_129 37.17 10.95 9.73 10.63 2.19 14.92 T CAactttcacttCAGT 17_132 41.31 5.57 11.54 5.29 -10.07 4.00 T CaActttcacttCAGT 17_135 3.24 6.43 2.61 10.50 -13.05 2.27 T CaactttcacttCAGT 17_137 60.37 4.60 44.00 4.51 13.77 1.76 T cAActttcacttCAGT 17_139 51.89 6.99 25.28 5.62 -9.98 3.81 T cAactttcacttCAGT 17_144 15.51 9.49 2.98 11.13 -14.47 6.57 TCAactttcacttCaGT 17_157 60.44 2.21 43.72 7.14 -0.43 5.64 T CAActttcacttcAGT 18_1 90.68 1.23 75.99 2.96 17.58 8.44 T CAactttcacttCAG 18_346 87.27 1.42 51.65 5.99 -0.36 6.52 T CaActttcactT CAG 18_347 88.09 2.70 66.31 4.12 1.27 11.46 T cAActttcactT CAG 18_350 82.82 2.94 68.17 3.68 25.39 3.40 T CAActttcactT cAG 18_357 91.46 1.63 77.08 2.24 35.54 3.18 T CaActttcacttCAG 18_358 83.98 3.39 63.78 6.55 26.29 5.45 T caACtttcacttCAG Combol 72.08 0.75 58.03 2.25 21.27 8.25 Cambo2 71.77 4.54 67.54 3.72 50.53 5.82 Table 19: in vitro efficacy on HBeAg of anti-PAPD5 / PAPD7 compounds in three concentrations (average of 3) in HBV infected ASGPR-dHepaRG cells. CMP ID NO 20 pM 6.67pM 2.22 pM Compound Avg sd Avg sd Avg sd 17 51 -39.37 39.73 -71.52 24.98 -89.89 24.95 T CaactttcacTtCAGT 17 57 2.88 4.42 -38.92 11.07 -76.67 6.90 T CAactttcacTtCaGT 17 86 22.69 5.54 -20.63 5.70 -42.45 4.40 T CaActttcactT CAGT 17 89 -11.41 3.45 -36.53 9.77 -34.92 9.69 T CaactttcactT CAGT 17 90 50.40 8.09 -4.45 25.09 -36.73 16.16 T cAActttcactT CAGT 17_96 68.32 9.42 47.89 5.53 2.93 16.50 T CAActttcactT CaGT 17 99 34.82 8.81 15.96 21.39 -13.36 13.51 T CAactttcactT CaGT 17 100 55.17 5.99 20.03 20.34 -25.12 18.75 T CaActttcactT CaGT 17 103 48.08 14.67 28.80 9.35 7.18 12.00 T cAActttcactT CaGT 17 111 -5.24 15.62 -10.26 3.22 -18.78 9.24 T CaactttcactT cAGT 17 119 83.29 3.11 69.67 1.75 24.17 9.29 T CAActttcactT caGT 17 129 47.32 8.81 19.21 17.51 -6.65 24.28 T CAactttcacttCAGT 2024201873 22 Mar 2024 CMP ID NO 20 pM 6.67pM 2.22 pM Compound Avg sd Avg sd Avg sd 17 132 59.04 4.63 21.83 1.86 -14.91 0.44 T CaActttcacttCAGT 17135 8.35 11.28 2.09 13.51 -25.60 9.12 T CaactttcacttCAGT 17 137 73.77 2.83 58.40 3.45 18.22 1.27 T cAActttcacttCAGT 17 139 64.19 7.67 39.45 5.57 -17.73 3.08 T cAactttcacttCAGT 17 144 24.74 7.77 12.21 16.40 -31.19 11.36 T CAactttcacttCaGT 17 157 75.79 1.10 61.26 4.35 9.64 7.17 T CAActttcacttcAGT 18 1 97.88 1.00 89.38 2.73 39.44 12.14 TCAactttcacttCAG 18 346 90.95 3.99 61.25 4.11 -4.13 6.95 T CaActttcactT CAG 18 347 91.45 3.48 78.72 2.03 9.18 8.96 T cAActttcactT CAG 18 350 92.56 3.36 80.54 6.12 41.46 7.29 T CAActttcactT cAG 18 357 96.37 1.27 87.86 2.94 51.94 2.98 T CaActttcacttCAG 18 358 89.92 0.54 76.73 7.28 37.70 9.45 T caACtttcacttCAG Combo 1 79.37 2.03 68.47 2.04 25.24 12.68 Combo 2 75.26 2.05 72.07 3.78 59.69 2.36 From these data it can be seen that the best performing bispecific PAPD5 / PAPD7 oligonucleotides have better effect in terms of HBsAg and HBeAg reduction with half the oligonucleotide concentration (20 pM) when compared to the combination treatments (2 x 20 pM). 5 Example 6 Screening for in vitro efficacy of stereodefined antisense oligonucleotides targeting PAPD5 and PAPD7 in HeLa cells To expand the diversity around the motif sequences of SEQ ID NO: 18 even further, a library of stereodefined oligonucleotides was made based on the stereorandom parent compound with CMP ID NO 18_1. 10 Efficacy testing was performed in an in vitro experiment as described in Example 1, with the exception that the screening was conducted with 1 pM and some with 5 pM. The relative PAPD5 mRNA and PAPD7 mRNA expression levels are shown in table 20 as % of the parent oligonucleotide i.e. the larger the value the better the inhibition. Table 20: in vitro efficacy of stereodefined anti-PAPD5 / PAPD7 compounds (single experiment 15 with duplex QPCR). PAPD5 and PAPD7 mRNA levels are normalized to GLISB in HeLa cells and shown as % of control (PBS treated cells). CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Stereodefinition 1 pM 5 pM 1 pM 5 pM Avg sd Avg sd Avg sd Avg sd 18_1 100.0 6.3 100.0 3.4 TCAactttcacttCAG XXXXXXXXXXXXXXXH 18_32 87.0 5.1 94.7 0.9 RS S RXXXXXXXXXXXH 18_33 76.4 NA 89.7 1.7 XRSSRXXXXXXXXXXH 18_34 79.8 6.7 91.5 2.3 XXRSSRXXXXXXXXXH 18_35 70.0 10.8 86.7 3.8 XXXRSSRXXXXXXXXH 18_36 102.5 7.8 107.4 3.1 XXXXRSSRXXXXXXXH 2024201873 22 Mar 2024 CMP ID % PAPD5 mRNA of control % PAPD7 mRNA of control Stereodefinition NO 1 pM 5 pM 1 pM 5 pM 18_37 88.8 7.6 95.1 4.5 XXXXXRSSRXXXXXXH 18_38 68.3 6.5 82.0 3.6 XXXXXXRSSRXXXXXH 18_39 87.2 5.7 93.8 5.0 XXXXXXXRSSRXXXXH 18_40 92.2 3.5 96.3 5.5 XXXXXXXXRSSRXXXH 18_41 81.1 1.3 95.2 7.6 XXXXXXXXXRSSRXXH 18_42 78.0 3.8 92.0 9.4 XXXXXXXXXXRSSRXH 18_43 80.4 3.4 92.7 3.6 XXXXXXXXXXXRSSRH 18_44 79.4 3.5 89.7 3.4 XXXXXXXXXS S S S S RH 18_45 75.2 8.2 88.7 2.4 XXXXXXXXXRRRRRRH 18_46 86.2 6.5 91.0 6.7 XXXXXXXXXSSRRSRH 18_47 79.7 6.2 85.7 1.5 XXXXXXXXXSSSRSRH 18_48 80.6 1.6 87.5 1.5 XXXXXXXXXS S SRRSH 18_49 79.9 3.2 101.8 6.5 XXXXXXXXXSRS S S SH 18_50 82.7 3.1 88.9 2.2 XXXXXXXXXRSRSRSH 18_51 78.0 5.7 90.2 2.9 XXXXXXXXXS S S SRSH 18_52 90.1 6.0 93.7 1.1 XXXXXXXXXS SRRS SH 18_53 82.7 8.7 90.7 3.2 XXXXXXXXXRRS S S SH 18_54 63.3 13.2 77.8 6.4 XXXXXXXXXRS S RRRH 18_55 73.9 6.2 90.9 1.6 XXXXXXXXXSRRRRSH 18_56 83.1 5.6 98.5 6.4 XXXXXXXXXSSRSRRH 18_57 73.4 6.8 89.6 8.2 XXXXXXXXXRRRSRRH 18_58 89.1 2.2 98.7 2.8 XXXXXXXXXRRSRSRH 18_59 73.2 8.5 91.7 2.5 XXXXXXXXXSSRRRSH 18_60 88.8 4.2 93.3 3.4 XXXXXXXXXSRRS S SH 18_61 77.0 13.6 81.6 13.7 XXXXXXXXXRRRRRSH 18_62 75.6 8.7 87.8 8.5 XXXXXXXXXRRS S RRH 18_63 74.8 5.0 85.5 1.4 XXXXXXXXXRSRRRRH 18_64 86.9 7.3 92.2 2.5 XXXXXXXXXSRRRSSH 18_65 77.8 10.3 89.0 7.4 XXXXXXXXXSRSRSRH 18_66 81.7 10.2 88.9 6.1 XXXXXXXXXRS S S SRH 18_67 77.6 7.4 81.1 4.7 XXXXXXXXXS S S SRRH 18_68 88.9 9.2 91.3 2.7 XXXXXXXXXRRS S S RH 18_69 77.8 3.8 89.9 4.0 XXXXXXXXXRSSRRSH 18_70 75.9 11.7 83.9 7.8 XXXXXXXXXRS S SRRH 18_71 84.2 6.7 88.7 1.4 XXXXXXXXXSRRRRRH 18_72 93.6 2.3 95.0 1.7 XXXXXXXXXRRSRSSH 18_73 90.5 4.3 92.4 2.9 XXXXXXXXXRSRSSRH 18_74 88.3 10.5 88.2 3.0 XXXXXXXXXRSRSRRH 18_75 85.2 7.1 89.0 3.1 XXXXXXXXXSRRRSRH 18_76 99.6 2.7 99.5 2.2 XXXXXXXXXRRSRRSH 18_77 87.4 1.5 87.2 1.8 XXXXXXXXXS S S RRRH 18_78 80.6 10.4 83.5 5.2 XXXXXXXXXRSRRSRH 18_79 89.3 6.8 98.7 3.4 XXXXXXXXXSRRSRSH 18_80 85.9 2.0 83.2 2.8 XXXXXXXXXRRSRRRH 18_81 92.4 5.0 84.1 NA XXXXXXXXXSRRSSRH 18_82 86.8 3.4 89.8 3.0 XXXXXXXXXSRSSSRH 18_83 93.1 4.7 92.4 3.3 XXXXXXXXXRSRRRSH 18_84 91.1 4.9 93.4 5.2 XXXXXXXXXS S SRS SH 18_85 84.3 3.9 87.9 1.6 XXXXXXXXXSSRSSRH 18_86 86.2 8.1 84.6 2.2 XXXXXXXXXRS SRS SH 18_87 77.3 9.7 90.6 0.9 XXXXXXXXXSRSSRSH 18_88 85.8 5.4 92.4 3.0 XXXXXXXXXS S S S S SH 2024201873 22 Mar 2024 CMP ID % PAPD5 mRNA of control % PAPD7 mRNA of control Stereodefinition NO 1 pM 5 pM 1 pM 5 pM 18_89 94.9 5.7 95.8 7.3 XXXXXXXXXRSRRSSH 18_90 91.2 6.3 92.9 2.3 XXXXXXXXXRRRRSRH 18_91 85.9 4.1 90.4 5.0 XXXXXXXXXSSRSRSH 18_92 84.7 6.5 90.1 9.3 XXXXXXXXXRRRRS SH 18_93 81.7 6.5 90.6 4.0 XXXXXXXXXRSRS S SH 18_94 82.2 7.7 82.9 8.0 XXXXXXXXXRSSRSRH 18_95 89.4 1.9 84.9 7.5 XXXXXXXXXRRRSRSH 18_96 80.1 3.7 85.0 5.9 XXXXXXXXXRRSSRSH 18_97 68.9 7.5 82.3 4.8 XXXXXXXXXSRSSRRH 18_98 81.7 4.1 93.9 6.9 XXXXXXXXXSRRSRRH 18_99 97.7 5.4 97.7 8.7 XXXXXXXXXSRSRSSH 18_100 77.5 3.7 85.4 4.1 XXXXXXXXXSRSRRRH 18_101 77.9 7.1 88.3 4.3 XXXXXXXXXS SRS S SH 18_102 77.3 6.3 93.0 2.8 XXXXXXXXXRS S S S SH 18_103 74.8 3.7 86.4 1.2 XXXXXXXXXRS S SRSH 18_104 90.3 6.1 91.5 2.3 XXXXXXXXXRRRS S RH 18_105 95.7 7.2 102.9 1.7 XXXXXXXXXRRRS S SH 18_106 79.7 5.4 85.7 1.2 XXXXXXXXXSRSRRSH 18_107 87.6 4.4 89.0 2.2 XXXXXXXXXS S RRRRH 18_108 86.4 10.6 95.3 4.0 XXXXXXXXXXS SRS SH 18_109 99.1 2.5 99.0 6.6 XXXXXXXXXXRRRS SH 18_110 91.1 5.4 93.1 3.5 XXXXXXXXXXRRS S RH 18_111 103.1 2.9 99.1 6.2 XXXXXXXXXXRS S SRH 18_112 96.5 2.7 90.7 2.5 XXXXXXXXXXRRSRRH 18_113 76.0 17.5 90.4 3.7 XXXXXXXXXXS S S S RH 18_114 86.9 3.4 88.8 4.5 XXXXXXXXXXRRRRRH 18_115 94.7 8.1 94.1 3.8 XXXXXXXXXXSRS S SH 18_116 79.8 4.1 83.7 2.6 XXXXXXXXXXSSRSRH 18_117 88.3 6.6 95.6 4.1 XXXXXXXXXXRSSRSH 18_118 83.6 7.9 86.8 2.1 XXXXXXXXXXRSRRRH 18_119 85.2 2.3 88.7 2.5 XXXXXXXXXXSRRRRH 18_120 86.2 6.8 91.9 0.7 XXXXXXXXXXSRRRSH 18_121 90.4 5.9 86.9 0.7 XXXXXXXXXXS S SRSH 18_122 74.2 8.8 79.5 7.8 XXXXXXXXXXRSRSSH 18_123 82.2 1.0 87.6 1.5 XXXXXXXXXXS S S S SH 18_124 91.0 12.7 111.4 11.9 XXXXXXXXXXSRRSSH 18_125 87.6 6.7 85.7 4.4 XXXXXXXXXXRSRRSH 18_126 81.5 7.1 85.5 1.9 XXXXXXXXXXSSRRSH 18_127 82.9 3.7 96.0 2.3 XXXXXXXXXXRRRSRH 18_128 79.0 3.7 83.5 4.3 XXXXXXXXXXSRSRRH 18_129 98.4 NA 91.7 6.2 XXXXXXXXXXRRSRSH 18_130 90.7 5.4 89.8 2.3 XXXXXXXXXXRRS S SH 18_131 82.2 6.1 89.6 1.0 XXXXXXXXXXRS S S SH 18_132 81.6 6.9 84.2 2.3 XXXXXXXXXXRS S RRH 18_133 88.9 4.1 94.5 4.0 XXXXXXXXXXSRRSRH 18_134 73.6 7.5 83.3 4.3 XXXXXXXXXXS S RRRH 18_135 86.6 10.3 91.0 7.1 XXXXXXXXXXSRSSRH 18_136 93.8 4.5 85.0 8.1 XXXXXXXXXXRRRRSH 18_137 100.6 6.4 83.2 7.2 XXXXXXXXXXRSRSRH 18_138 83.1 9.5 86.5 4.0 XXXXXXXXXXS S SRRH 18_139 82.4 10.8 87.3 2.9 XXXXXXXXXXSRSRSH 18_140 83.9 5.6 78.9 5.1 SSRRRRSSSSSRSSRH 2024201873 22 Mar 2024 CMP ID % PAPD5 mRNA of control % PAPD7 mRNA of control Stereodefinition NO 1 pM 5 pM 1 pM 5 pM 18_ .141 96.7 9.9 89.2 13.8 SSSSSRRRRRRSRRSH 18_ .142 81.7 13.0 83.7 7.7 SRSSRSSSRRRSRSRH 18_ .143 86.4 11.5 80.3 11.7 SRRSSSSRRSRRRRRH 18_ .144 88.5 7.1 78.6 8.5 SSRRSRSRSSSRSRRH 18_ .145 75.2 12.2 78.4 3.9 SSSRRRRSRRRSSRRH 18_ .146 109.4 6.8 105.6 8.1 RRSRSSRRSSSRRSSH 18_ .147 82.8 7.1 80.3 2.9 RSSRRRSSSRSSSRSH 18_ .148 78.2 7.1 73.3 9.6 SSSSRRRSRSSSRRSH 18_ .149 78.5 3.9 77.1 14.5 SSSRSSSSSSSRRRRH 18_ .150 80.2 5.3 75.0 8.5 SSSSRSSSSSSSSSSH 18_ .151 65.6 21.5 73.0 9.1 RRSRRRRRSSSSSSSH 18_ .152 98.9 5.4 92.9 3.3 RRRRSRSSRRRRSSSH 18_ .153 92.1 9.5 93.2 3.1 RRRRRSSRRRSRSSRH 18_ .154 98.3 4.0 92.3 2.7 SSRRRRSRSRSSRRSH 18_ .155 77.4 8.1 82.0 3.8 RSSSSSRSSRRSSSSH 18_ .156 79.9 7.8 81.6 5.9 RRRSSSSSRSRSRRSH 18_ .157 76.8 4.3 82.6 3.5 RSSSRSRSRRRSRRRH 18_ .158 81.8 12.8 86.8 4.1 RRSRRSSSRRRRRRSH 18_ .159 76.4 12.4 77.9 2.8 RRSSSSRSRSSSRSRH 18_ .160 82.2 16.3 88.8 4.2 RSSRSRSRSRSRSRRH 18_ .161 76.4 14.9 77.9 4.9 SRRRSSSSRSRSRSRH 18_ .162 66.6 15.9 80.4 4.1 SRSSSRRSRRRRSSRH 18_ .163 76.8 14.0 85.3 2.9 RSSRRRSRRSRSSRRH 18_ .164 88.4 9.4 97.5 5.2 SSRRRSSRSSRRRRSH 18_ .165 75.1 14.9 85.2 3.0 RSRSSRRSRRRSSSRH 18_ .166 81.6 6.7 83.9 5.8 RRRRSRRRSSRSRRSH 18_ .167 74.4 11.7 77.5 4.5 SRRRSSSRSRSSRRRH 18_ .168 73.9 9.7 77.3 1.9 SRSSRSSSSSRSRSSH 18_ .169 73.7 15.1 86.2 1.1 SSRRSRSSSSSRSSSH 18_ .170 75.8 7.0 82.4 2.0 SSRRRRRSRSRRSSSH 18_ .171 97.4 2.3 98.5 3.3 SSSRRSSRSRRRRRSH 18_ .172 85.3 10.9 81.0 2.0 RSSSSSSSRSRRRRRH 18_ .173 88.5 10.0 92.5 1.4 SSRSRSSRSSRRSRRH 18_ .174 84.1 11.1 81.5 17.2 SRSRSSSRRRSRRRSH 18_ .175 72.7 6.6 79.1 1.1 RRRRRRRSSRRSSSRH 18_ .176 77.0 14.4 81.9 4.8 SSRSRRRRRSRRSRSH 18_ .177 81.9 5.6 79.9 10.1 RRSRRRRRRSSRRRSH 18_ .178 88.9 3.9 94.4 3.1 SSSSRRRRRRRRRSRH 18_ .179 87.6 11.8 81.5 8.6 SRRRSSRRRSSRRRSH 18_ .180 75.9 2.9 72.9 11.0 SSSRRRRRSRRSSRRH 18_ .181 85.3 11.1 86.7 1.9 RRSRRSSSSRRRSSRH 18_ .182 93.0 9.2 95.4 7.3 SSRRSRSSRRRSSSSH 18_ .183 83.6 12.3 80.6 5.2 SSRSRRRRSSRSSSRH 18_ .184 87.0 15.0 79.3 4.5 RRRSRRSRSSRSRRRH 18_ .185 98.7 4.6 96.8 1.7 RSRSSRSRSRRSRSRH 18_ .186 87.9 3.7 87.7 5.2 SSSRRRRSSRRSRRRH 18_ .187 99.1 3.5 99.8 2.3 RSSRRSRRRRSRRRSH 18_ .188 101.1 5.9 92.8 6.6 SSSRRSSRSRSRSSSH 18_ .189 106.9 4.2 105.0 3.1 RSRSSSSRSSRRRSSH 18_ .190 104.8 3.5 96.7 2.2 SSSRSSSRSRRSRSSH 18_ .191 87.7 10.4 84.9 7.8 RSSRSSSSRSSSSSRH 18_ .192 86.5 7.9 96.1 1.6 RSSRRSSRSSSRRSRH 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Stereodefinition 1 pM 5 pM 1 pM 5 pM 18_193 76.5 8.0 80.4 3.2 RSSRRSRSRRSSSSRH 18_194 80.0 4.8 86.4 3.3 RRSSSRRSRRRRSSSH 18_195 100.4 8.3 99.3 1.6 RRRRRSSRSRRSSSRH 18_196 109.5 2.6 113.5 4.2 SSSSRSRRRSSRRRSH 18_197 82.6 1.9 81.0 4.8 RSRRRRRRRRSSRSRH 18_198 87.2 4.6 87.4 6.4 RSRRSSSSRSSRSSRH 18_199 80.9 2.8 91.5 1.0 SSRRSRSSRRRSSSRH 18_200 74.7 11.4 84.8 2.1 RRRRSSSRRSRSRSSH 18_201 73.5 13.7 82.0 1.3 RSRRRRRRSRRSSRSH 18_202 70.6 8.6 81.4 1.4 SRRSRRRRRSRSSSSH 18_203 69.8 9.5 73.8 1.4 SRRSRRSSSRSSSSSH 18_204 77.8 6.8 86.3 2.7 SSSRRRRSRSRRRSSH 18_205 73.4 4.2 77.8 2.6 SSRSRSRSSSRSRSRH 18_206 80.6 12.7 90.4 3.6 SSSRRSRRSRRRSRSH 18_207 67.8 7.5 74.3 2.6 SRSSRRRSSSSSRRRH 18_208 71.9 12.0 83.0 4.9 RRSSRSSSSSSRSSRH 18_209 74.0 5.5 83.7 3.4 SRSSRRSSRSRRSRRH 18_210 55.6 14.6 48.5 5.4 84.2 7.2 66.2 4.5 RSRRSSRSRSSRRSSH 18_211 60.5 11.1 52.4 6.7 84.4 6.7 76.4 6.8 RSSSRRSRSSSRSSSH 18_212 53.3 3.3 47.3 3.5 93.4 8.0 60.5 5.6 SSSSSSSSRSRRRSSH 18_213 43.0 8.3 26.1 6.0 72.4 10.7 38.3 8.4 RRSSSSSSSRSSSRRH 18_214 66.6 8.9 97.1 4.2 108.3 7.0 106.6 7.8 SSSRRSSSSRRRRSSH 18_215 61.0 11.2 59.9 8.2 98.3 10.7 76.0 11.9 SSSRRRRRRSSSSRRH 18_216 35.6 9.3 42.2 5.4 56.2 6.8 53.1 12.8 RSRSRRRSSSRRRSRH 18_217 37.6 8.9 73.8 8.8 65.0 6.4 79.6 8.0 SSSSRRSRRRSSRRRH 18_218 101.7 11.6 90.1 1.6 162.0 9.8 100.5 2.4 RSSRRSSRSRRRSSSH 18_219 70.9 10.8 75.5 3.7 97.0 9.1 93.3 4.9 RRSSSSSRRRRSRRSH 18_220 58.0 11.3 62.5 4.0 92.0 8.6 79.5 6.3 RXXXXXXXXXXXXXXH 18_221 66.8 8.8 89.8 4.1 101.2 11.1 109.1 6.9 SXXXXXXXXXXXXXXH 18_222 73.2 6.2 79.4 3.4 108.4 8.8 95.1 4.2 XRXXXXXXXXXXXXXH 18_223 84.1 9.0 98.4 4.9 134.3 6.6 134.7 5.5 XSXXXXXXXXXXXXXH 18_224 73.3 7.0 91.9 4.7 117.0 6.4 131.4 5.2 XXRXXXXXXXXXXXXH 18_225 76.5 9.3 94.3 7.7 110.1 6.0 108.4 7.6 XXSXXXXXXXXXXXXH 18_226 74.4 11.6 92.4 6.7 102.3 7.6 108.8 6.3 XXXRXXXXXXXXXXXH 18_227 83.1 11.6 109.9 8.4 99.1 14.1 111.2 6.9 XXXSXXXXXXXXXXXH 18_228 56.4 7.2 55.0 5.5 87.4 3.7 74.5 7.5 XXXXRXXXXXXXXXXH 18_229 69.4 6.2 81.4 4.4 113.1 4.6 104.9 7.4 XXXXSXXXXXXXXXXH 18_230 66.6 5.8 84.6 3.3 109.3 6.6 106.4 6.7 XXXXXRXXXXXXXXXH 18_231 80.7 2.7 109.0 1.1 114.1 5.6 120.8 4.9 XXXXXSXXXXXXXXXH 18_232 63.4 4.4 66.6 6.3 101.7 5.2 88.0 8.2 XXXXXXRXXXXXXXXH 18_233 68.3 3.1 96.4 8.0 102.4 6.5 120.3 6.6 XXXXXXSXXXXXXXXH 18_234 69.9 10.7 98.7 8.9 113.0 5.2 124.2 7.1 XXXXXXXRXXXXXXXH 18_235 68.6 16.7 82.3 7.5 91.1 12.4 90.3 9.2 XXXXXXXSXXXXXXXH 18_236 114.6 7.6 90.5 2.8 187.8 9.9 113.0 4.6 XXXXXXXXRXXXXXXH 18_237 66.4 13.5 66.6 7.3 117.3 12.3 93.2 7.3 XXXXXXXXSXXXXXXH 18_238 72.5 5.3 90.1 3.9 122.5 6.6 126.8 4.3 XXXXXXXXXRXXXXXH 18_239 39.8 3.0 20.9 5.7 67.2 6.4 29.2 2.1 XXXXXXXXXSXXXXXH 18_240 63.0 12.0 92.7 2.0 116.2 7.9 117.7 1.6 XXXXXXXXXXRXXXXH 18_241 65.1 15.1 75.4 4.4 105.9 19.9 104.8 5.0 XXXXXXXXXXSXXXXH 18_242 65.0 12.7 85.0 3.2 106.0 12.5 114.3 2.4 XXXXXXXXXXXRXXXH 18_243 145.2 7.8 112.0 6.0 180.8 6.4 118.8 6.5 XXXXXXXXXXXSXXXH 18_244 75.3 9.9 87.8 2.8 110.4 8.1 91.2 4.8 XXXXXXXXXXXXRXXH 2024201873 22 Mar 2024 CMP ID NO % PAPD5 mRNA of control % PAPD7 mRNA of control Stereodefinition 1 pM 5 pM 1 pM 5 pM 18_245 81.7 8.6 63.6 5.6 100.3 5.9 79.2 1.9 XXXXXXXXXXXXSXXH 18_246 60.3 7.4 71.7 6.2 90.4 8.0 80.8 8.1 XXXXXXXXXXXXXRXH 18_247 70.3 8.0 90.4 6.4 108.4 7.5 94.4 8.1 XXXXXXXXXXXXXSXH 18_248 74.0 7.7 77.4 5.1 87.4 19.5 86.7 7.3 XXXXXXXXXXXXXXRH 18_249 74.8 4.9 88.2 5.4 114.8 5.6 109.7 6.4 XXXXXXXXXXXXXXSH Example 7: in vitro EC50 and efficacy of selected stereodefined antisense oligonucleotides in HeLa cells. The EC50 and efficacy (KD) of the best performing oligonucleotides from Example 6 was 5 determined using the same assay with the following oligonucleotide concentrations 33, 10.44, 3.33,1.044, 0.33, 0.104, 0.033 and 0.01 pM. EC 50, max KD (efficacy) of the PAPD5 and PAPD7 mRNA expression was calculated using R-function drm() from the drc package (v3.0-1) a four-parameter log-logistic function is fitted to the expression of the gene of interest as a function of oligonucleotide concentration to obtain a 10 value for EC50 and maximum knock-down. The results are shown in Table 21. Table 21: EC50 and Max KD of anti-PAPD5 / PAPD7 compounds on PAPD5 and PAPD7 mRNA expression in HeLa cells. CMP ID NO 18_1 is the stereorandom parent compound. CMP ID NO PAPD5 PAPD7 Stereodefined motif Max KD % of saline EC50 pM Max KD % of saline EC50 pM Avg sd Avg sd Avg sd Avg sd 18_1 2.74 1.41 1.82 0.09 5.06 2.24 2.03 0.16 TCAactttcacttCAG XXXXXXXXXXXXXXXH 18_36 0.49 2.00 1.19 0.08 0.00 2.77 1.57 0.14 XXXXRSSRXXXXXXXH 18_76 1.83 5.88 3.18 0.54 1.12 7.32 3.38 0.69 XXXXXXXXXRRSRRSH 18_99 0.12 7.43 2.87 0.63 4.53 13.63 3.39 1.30 XXXXXXXXXS RS RSS H 18_109 2.46 3.84 1.59 0.20 2.66 4.77 2.04 0.32 XXXXXXXXXXRRRSSH 18_111 0.36 8.02 2.41 0.59 5.64 3.86 2.88 0.34 XXXXXXXXXXRSSSRH 18_124 0.00 8.02 1.76 0.45 0.00 4.30 2.27 0.28 XXXXXXXXXXSRRSSH 18_146 0.00 4.37 1.59 0.22 0.00 5.67 2.27 0.40 RRSRSSRRSSSRRSSH 18_171 0.00 3.47 1.44 0.17 0.00 5.90 2.24 0.41 SSSRRSSRSRRRRRSH 18_185 2.94 4.54 1.57 0.23 2.34 5.97 2.10 0.40 RSRSSRSRSRRSRSRH 18_187 0.00 2.50 1.73 0.14 0.00 6.11 2.27 0.40 RSSRRSRRRRSRRRSH 18_188 0.00 3.88 1.66 0.21 3.63 6.56 1.94 0.38 SSSRRSSRSRSRSSSH 18_190 3.56 5.01 2.59 0.41 7.41 6.38 3.11 0.62 SSSRSSSRSRRSRSSH 18_196 0.00 2.00 1.31 0.09 1.40 5.30 1.71 0.28 SSSSRSRRRSSRRRSH 18_223 0.00 3.36 1.40 0.16 1.15 4.84 1.83 0.28 XSXXXXXXXXXXXXXH 18_227 0.00 6.48 1.75 0.37 0.45 6.48 2.20 0.39 XXXSXXXXXXXXXXXH 18_231 0.00 3.57 1.37 0.17 0.00 4.34 2.13 0.28 XXXXXSXXXXXXXXXH 18_236 2.37 3.44 1.82 0.21 4.69 3.90 2.22 0.27 XXXXXXXXRXXXXXXH 18_243 0.15 5.38 2.38 0.37 5.18 8.67 2.52 0.66 XXXXXXXXXXXSXXXH 2024201873 22 Mar 2024 From these data it can be seen that improvements in EC50 and efficacy in relation to PAPD5 and PAPD7 knock down can be achieved both with stereodefined sub-libraries and with fully stereodefined compounds. Example 8: in vitro effect on HBV infected ASGPR-dHepaRG cells using selected 5 stereodefined antisense oligonucleotides targeting PAPD5 and PAPD7. A selection of the most efficacious oligonucleotides from example 6 was tested for their effect on HBV propagation parameters in HBV infected dHepaRG-ASGPR cells. The experiment was conducted as described in example 5. The reduction of HBsAg and HBeAg levels are shown in table 22 and 23, the larger the value 0 the larger the inhibition. Table 22: in vitro efficacy on HBsAg of anti-PAPD5 / PAPD7 compounds in three concentrations (average of 3) in HBV infected ASGPR-dHepaRG cells. CMP ID NO 18_1 is the stereorandom parent compound CMP ID NO 20 pM 6.67pM 2.22 pM Stereodefined motif Avg sd Avg sd Avg sd 18_1 97.88 1.00 89.38 2.73 39.44 12.14 TCAactttcacttCAG XXXXXXXXXXXXXXXH 18_36 72.64 1.45 37.85 8.05 10.98 8.04 XXXXRSSRXXXXXXXH 18_76 40.85 34.07 2.07 19.39 -15.02 23.15 XXXXXXXXXRRS RRS...
Claims
1. An antisense oligonucleotide selected from the group of:(i) T cAACtttcacttcAG(ii) TCAActttcacttCaGT(i i i) T cAActttcacttCAGT(iv) TcAactttcacttCAGTwherein capital letters represent beta-D-oxy LNA nucleosides; lowercase letters represent DNA nucleosides; all cytosine LNA nucleosides are 5-methyl cytosine; and all internucleoside linkages are phosphorothioate internucleoside linkages.
2. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TcAACtttcacttcAG or a pharmaceutically acceptable salt thereof.
3. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TCAActttcacttCaGT or a pharmaceutically acceptable salt thereof.
4. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TcAActttcacttCAGT or a pharmaceutically acceptable salt thereof.
5. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide is TcAactttcacttCAGT or a pharmaceutically acceptable salt thereof.
6. A conjugate compound comprising the antisense oligonucleotide of any one of claims 1 to 5 and a conjugate moiety attached to said antisense oligonucleotide.
7. The conjugate compound of claim 6, wherein the conjugate moiety is capable of binding to an asialoglycoprotein receptor.
8. The conjugate compound of claim 7, wherein the conjugate moiety is a tri-valent N-acetyl-galactosamine (GalNAc) moiety.
9. The conjugate compound of any one of claims 6 to 8, wherein the conjugate moiety is covalently attached to said antisense oligonucleotide.
10. The conjugate compound of any one of claims 6 to 9, wherein a linker is positioned between the antisense oligonucleotide and the conjugate moiety.
11. The conjugate compound of claim 10, wherein the linker is a physiologically labile linker.
12. The conjugate compound of claim 11, wherein the physiologically labile linker is a S1 nuclease susceptible linker.2024201873 22 Mar 202413. The conjugate compound of claim 11 or claim 12, wherein the physiologically labile linker is a phosphodiester linked cytidine-adenosine dinucleotide with three consecutive phosphodiester linkages.
14. The conjugate compound of any one of claims 11 to 13, wherein a C6 amino alkyl group is positioned between the conjugate moiety and the physiologically labile linker.
15. The conjugate compound of claim 14, wherein the conjugate moiety is capable of binding to an asialoglycoprotein receptor and wherein the conjugate moiety is a tri-valent N-acetyl-galactosamine (GalNAc) moiety; wherein the conjugate moiety is covalently attached to said antisense oligonucleotide; wherein a phosphodiester linked cytidine-adenosine dinucleotide with three consecutive phosphodiester linkages is positioned between the antisense oligonucleotide and the conjugate moiety; and wherein a C6 amino alkyl group is positioned between the conjugate moiety and the phosphodiester linked cytidine-adenosine dinucleotide with three consecutive phosphodiester linkages.
16. The conjugate compound of any one of claims 6 to 15, that has a formula selected from the group of:(i) GN2-C60c0a0TcAACtttcacttcAG;(ii) GN2-C60c0a0TCAActttcacttCaGT;(iii) GN2-C60c0a0TcAActttcacttCAGT; and(iv) GN2-C60c0a0TcAactttcacttCAGTwherein capital letters represent beta-D-oxy LNA nucleosides; all cytosine LNA nucleosides are 5-methyl cytosine; lowercase letters represent DNA nucleosides; subscript o represents a phosphodiester nucleoside linkage; and all other internucleoside linkages are phosphorothioate internucleoside linkages;wherein C6 represents an amino alkyl group with 6 carbons; andwherein GN2 represents a trivalent GalNAc cluster shown in Figure 2;wherein the wavy bond line in Figure 2 indicates the site of conjugation of the trivalent GalNAc cluster to the C6 amino alkyl group.
17. A pharmaceutically acceptable salt of the antisense oligonucleotide of any one of claims 1 to 5 or the conjugate compound of any one of claims 6 to 16.
18. A pharmaceutically acceptable sodium salt of the antisense oligonucleotide of any one of claims 1 to 5 or the conjugate compound of any one of claims 6 to 16.2024201873 22 Mar 202419. A pharmaceutically acceptable potassium salt of the antisense oligonucleotide of any one of claims 1 to 5 or the conjugate compound of any one of claims 6 to 16.
20. A pharmaceutical composition comprising the antisense oligonucleotide of any one of claims 1 to 5 or the conjugate compound of any one of claims 6 to 16 or the pharmaceutically acceptable salt of any one of claims 17 to 19, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.
21. The pharmaceutical composition of claim 20, wherein the pharmaceutically acceptable diluent is sterile phosphate buffered saline.
22. An in vitro method for modulating PAPD5 and PAPD7 expression in a target cell which is expressing PAPD5 and PAPD7, the method comprising administering the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16 or the pharmaceutically acceptable salt of any one of claims 17 to 19 to said target cell in an effective amount.
23. A method for treating HBV infection in a subject suffering from HBV infection, the method comprising administering a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16, the pharmaceutically acceptable salt of any one of claims 17 to 19; or the pharmaceutical composition of claim 20 or 21 to the subject suffering from HBV infection.
24. A method for treating chronic HBV infection in a subject suffering from chronic HBV infection, the method comprising administering a therapeutically effective amount the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16, the pharmaceutically acceptable salt of any one of claims 17 to 19; or the pharmaceutical composition of claim 20 or 21 to the subject suffering from chronic HBV infection.
25. A method for reduction of the infectiousness of a HBV-infected subject, the method comprising administering a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16, the pharmaceutically acceptable salt of any one of claims 17 to 19; or the pharmaceutical composition of claim 20 or 21 to the HBV-infected subject.
26. Use of the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16, or the pharmaceutically acceptable salt of any one of claims 17 to 19 in the manufacture of a medicament for treating HBV infection in a subject.2024201873 22 Mar 202427. Use of the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16, or the pharmaceutically acceptable salt of any one of claims 17 to 19, in the manufacture of a medicament for treating chronic HBV infection in a subject.
28. Use of the antisense oligonucleotide of any one of claims 1 to 5, the conjugate compound of any one of claims 6 to 16, or the pharmaceutically acceptable salt of any one of claims 17 to 19, in the manufacture of a medicament for reducing the infectiousness of a HBV-infected subject.