Oligonucleotides for reduction of PD-L1 expression

Abstract

The present invention relates to antisense oligonucleotides that are capable of reducing expression of PD-L1 in a target cell. The oligonucleotides hybridize to PD-L1 mRNA. The present invention further relates to conjugates of the oligonucleotide and pharmaceutical 5 compositions and methods for treatment of viral liver infections such as HBV, HCV and HDV; a parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis or liver cancer or metastases in the liver using the oligonucleotide. 20 24 20 35 81 29 M ay 2 02 4 A B S T R A C T 2 0 2 4 2 0 3 5 8 1 2 9 M a y 2 0 2 4

Description

CROSS-REFERENCE TO RELATED APPLICATIONS The present application is a divisional application of Australian Patent Application No. 2022202479, which is a divisional application of Australian Patent No. 2021236439, which is a 5 divisional application of Australian Patent No. 2017235278, which is the national phase of International Application No. PCT / EP2017 / 055925, which in turn claims the benefit of priority to European Application No. 16160149.7, filed March 14, 2016. The contents of each of the aforementioned applications are incorporated by cross reference in their entireties herein. SEQUENCE LISTING 0 Preceding applications contained a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy is 255 KB in size. The present application contains a Sequence Listing which has been submitted electronically as an XML document in the ST.26 format and is hereby incorporated by reference in its entirety. Said XML copy, created on May 27, 2024, is named P0000288AUD3 Sequence 15   Listing.xml and is 1,059 KB in size. FIELD OF INVENTION The present invention relates to oligonucleotides (oligomers) that are complementary to programmed death ligand-1 (PD-L1), leading to reduction of the expression of PD-L1 the liver. The present invention also relates to a method of alleviating the T cell exhaustion caused by an 20 infection of the liver or cancer in the liver. Relevant infections are chronic HBV, HCV and HDV and parasite infections like malaria and toxoplasmosis (e.g. caused by protozoa of the Plasmodium, in particular of the species P. vivax, P. malariae and P. falciparum). BACKGROUND The costimulatory pathway consisting of the programmed death-1 (PD-1) receptor and its 25 ligand, PD-L1 (or B7-H1 or CD274) is known to contribute directly to T cell exhaustion resulting in lack of viral control during chronic infections of the liver. The PD-1 pathway also plays a role in autoimmunity as mice disrupted in this pathway develop autoimmune diseases. It has been shown that antibodies that block the interaction between PD-1 and PD-L1 enhance T cell responses, in particular the response of CD8+ cytotoxic T cells (see Barber et al 2006 30 Nature Vol 439 p682 and Maier et al 2007 J. Immunol. Vol 178 p 2714). WO 2006 / 042237 describes a method of diagnosing cancer by assessing PD-L1 (B7-H1) expression in tumors and suggests delivering an agent, which interferes with the PD-1 / PD-L1 interaction, to a patient. Interfering agents can be antibodies, antibody fragments, siRNA or 2024203581   29 May 2024 antisense oligonucleotides. There are no specific examples of such interfering agents nor is there any mentioning of chronic liver infections. RNA interference mediated inhibition of PD-L1 using double stranded RNA (dsRNA, RNAi or siRNA) molecules have also been disclosed in for example WO 2005 / 007855, WO 5   2007 / 084865 and US 8,507,663. None of these describes targeted delivery to the liver. Dolina et al. 2013 Molecular Therapy-Nucleic Acids, 2 e72 describes in vivo delivery of PD-L1 targeting siRNA molecules to Kupffer cells thereby enhancing NK and CD8+ T cell clearance in MCMV infected mice. This paper concludes that PD-L1 targeting siRNA molecules delivered to hepatocytes are not effective in relation to enhancing CD8+ T cell effector function. 0 The siRNA approach is significantly different from the single stranded antisense oligonucleotide approach since the biodistribution and the mode of actions is quite different. As described in Xu et al 2003 Biochem. Biophys. Res .Comm. Vol 306 page 712-717, antisense oligonucleotides and siRNAs have different preferences for target sites in the mRNA. 2024203581   29 May 2024 WO2016 / 138278 describes inhibition of immune checkpoints including PD-L1, using two or more single stranded antisense oligonucleotides that are linked at their 5’ ends. The application does not mention HBV or targeted delivery to the liver. OBJECTIVE OF THE INVENTION 5 The present invention identifies novel oligonucleotides and oligonucleotide conjugates which reduce PD-L1 mRNA very efficiently in liver cells, both in parenchymal cells (e.g. hepatocytes) and in non-parenchymal cells such as Kupffer cells and liver sinusoidal endothelial cells (LSECs). By reducing or silencing PD-L1, the oligonucleotides and oligonucleotide conjugates decrease PD-1-mediated inhibition and thereby promote immunostimulation of exhausted T 0 cells. Alleviation of the T cell exhaustion in a chronic pathogenic infection of the liver will result in regained immune control and reduced levels of viral antigens in the blood during a chronic pathogenic infection of the liver. Natural killer (NK) cells and natural killer T (NKT) cells may also be activated by the oligonucleotides and oligonucleotide conjugates of the present invention. The oligonucleotide conjugates secures local reduction of PD-L1 in liver cells and therefore 15 reduces the risk of autoimmune side effects, such as pneumonitis, non-viral hepatitis and colitis associated with systemic depletion of PD-L1. SUMMARY OF INVENTION The present invention relates to oligonucleotides or conjugates thereof targeting a nucleic acid capable of modulating the expression of PD-L1 and to treat or prevent diseases related to the 20 functioning of the PD-L1. The oligonucleotides or oligonucleotide conjugates may in particular be used to treat diseases where the immune response against an infectious agent has been exhausted. Accordingly, in a first aspect the invention provides oligonucleotides which comprise a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% 25 complementarity to a PD-L1 target nucleic acid. The oligonucleotide can be an antisense oligonucleotide, preferably with a gapmer design. Preferably, the oligonucleotide is capable of inhibiting the expression of PD-L1 by cleavage of a target nucleic acid. The cleavage is preferably achieved via nuclease recruitment. In a further aspect, the oligonucleotide is conjugated to at least one asialoglycoprotein receptor 30 targeting conjugate moiety, such as a conjugate moiety comprising at least one N-Acetylgalactosamine (GalNAc) moiety. The conjugation moiety and the oligonucleotide may be linked together by a linker, in particular a biocleavable linker. In a further aspect, the invention provides pharmaceutical compositions comprising the oligonucleotides or oligonucleotide conjugates of the invention and pharmaceutically acceptable 35 diluents, carriers, salts and / or adjuvants. 2024203581   29 May 2024 In a further aspect, the invention provides methods for in vivo or in vitro method for reduction of PD-L1 expression in a target cell which is expressing PD-L1, by administering an oligonucleotide or composition of the invention in an effective amount to said cell. In a further aspect, the invention provides oligonucleotides, oligonucleotide conjugates or 5 pharmaceutical compositions for use in restoration of immunity against a virus or parasite. In a further aspect, the invention provides oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use as a medicament. In a further aspect the invention provides methods for treating or preventing a disease, disorder or dysfunction by administering a therapeutically or prophylactically effective amount of the 0 oligonucleotide of the invention to a subject suffering from or susceptible to the disease, disorder or dysfunction, in particular diseases selected from viral liver infections or parasite infections. In a further aspect the oligonucleotide, oligonucleotide conjugates or pharmaceutical composition of the invention is used in the treatment or prevention of viral liver infections such 15 as HBV, HCV and HDV or a parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis or liver cancer or metastases in the liver. BRIEF DESCRIPTION OF FIGURES Figure 1: Illustrates exemplary antisense oligonucleotide conjugates, where the oligonucleotide either is represented as a wavy line (A-D) or as “oligonucleotide” (E-H) or as T2 (I) and the 20 asialoglycoprotein receptor targeting conjugate moieties are trivalent N-acetylgalactosamine moieties. Compounds A to D comprise a di-lysine brancher molecule a PEG3 spacer and three terminal GalNAc carbohydrate moieties. In compound A and B the oligonucleotide is attached directly to the asialoglycoprotein receptor targeting conjugate moiety without a linker. In compound C and D the oligonucleotide is attached directly to the asialoglycoprotein receptor 25 targeting conjugate moiety via a C6 linker. Compounds E-l comprise a trebler brancher molecule and spacers of varying length and structure and three terminal GalNAc carbohydrate moieties. Figure 2: Graph showing EC50 (A) and PD-L1 knock down as % of saline (B) for the compounds tested in Example 2, in relation to their position on the target nucleic acid. The cell 30 line in which the compound were tested are THP1 (•) and Karpas (*). Figure 3: Structural formula of the trivalent GalNAc cluster (GN2). GN2 is useful as conjugation moiety in the present invention. The wavy line illustrates the site of conjugation of the cluster to e.g. a C6 amino linker or directly to the oligonucleotide. Figure 4: Structural formula of CMP ID NO 766_2. 2024203581   29 May 2024 Figure 5: Structural formula of CMP ID NO 767 2. Figure 6: Structural formula of CMP ID NO 768_2. Figure 7: Structural formula of CMP ID NO 769_2. Figure 8: Structural formula of CMP ID NO 770_2. 5 Figure 9: Western blot detecting PD-L1 protein expression in liver from poly(IC) induced animals following treatment with saline and the indicated CMP ID NO’s. Each blot shows a naked oligonucleotide versus a GalNAc conjugated version of the same oligonucleotide, blot A) CMP ID NO 744 1 and 755_2, B) CMP ID NO 747_1 and 758_2, C) CMP ID NO 748_1 and 759 2, D) CMP ID NO 752_1 and 763_2 and E) CMP ID NO 753_1 and 764_2. The upper band 0 is the vinculin loading control, the lower band is the PD-L1 protein. The first lane in each blot show saline treated mice without Poly(IC) induction. These mice express very little PD-L protein. Figure 10: Population of mononuclear cells in the liver after treatment with • vehicle (group 10 and 1), ♦ DNA vaccine (group 11 and 2), O anti-PD-L1 antibody (group 12), Anaked PD-L1 ASO + DNA vaccine (group 7) or △ GalNAc conjugated PD-L1 ASO + DNA vaccine (group 8), 15 for each group the individual animals are represented and the average is indicated by the vertical line for each group (see table 18). Statistical significance between the DNA vaccine group and the three treatment groups has been assessed and if present it is indicated by 2 between the groups (* = P< 0.05, *** = P< 0.001 and **** = P< 0.0001). A) represents the number of T cells in the liver following treatment. B) represents the fraction of CD4+ T cells and 20 C) represents the fraction of CD8+ T cells. Figure 11: Modulation of PD-L1 positive cells in the liver after treatment with • vehicle (group 10 and 1), ♦ DNA vaccine (group 11 and 2), O anti-PD-L1 antibody (group 12), Anaked PD-L1 ASO + DNA vaccine (group 7) or △ GalNAc conjugated PD-L1 ASO + DNA vaccine (group 8), for each group the individual animals are represented and the average is indicated by the 25 vertical line for each group (see table 19). Statistical significance between the DNA vaccine group and the three treatment groups has been assessed and if present it is indicated by 2 between the groups (* = P< 0.05 and **** = P< 0.0001 ). A) represents the pertentage of CD8+ T cells which express PD-L1 in the liver following treatment. B) represents the pertentage of CD4+ T cells which express PD-L1 in the liver following treatment and C) represents the 30 pertentage of B cells which express PD-L1 in the liver following treatment. Figure 12: HBV antigen specific CD8+ cytokine secreting cells in the liver after treatment with • vehicle (group 10 and 1), ♦ DNA vaccine (group 11 and 2), O anti-PD-L1 antibody (group 12), Anaked PD-L1 ASO + DNA vaccine (group 7) or △ GalNAc conjugated PD-L1 ASO + DNA vaccine (group 8), for each group the individual animals are represented and the average is 35 indicated by the vertical line for each group (see table 20). Statistical significance between the 2024203581   29 May 2024 DNA vaccine group and the three treatment groups has been assessed and if present it is indicated by 2 between the groups (* = P< 0.05). A) represents the pertentage of IFN-y secreting CD8+ T cells in the liver which are specific towards HBV PreS2+S antigen following treatment. B) represents the pertentage of IFN-y secreting CD8+ T cells in the liver which are specific 5 towards HBV core antigen following treatment and C) represents the pertentage of IFN-y and TNF-o secreting CD8+ T cells in the liver which are specific towards HBV PreS2+S antigen following treatment. Figure 13: HBV-DNA, HBsAg and HBeAg in AAV / HBV mice following treatment with GalNAc conjugated PD-L1 antisense CMP NO: 759_2 (▼) compared to vehicle (■). The vertical line 0 indicates the end of treatment. DEFINITIONS Oligonucleotide The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently 15 bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is 20 chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides. Antisense oligonucleotides The term “Antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a 25 contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. Contiguous Nucleotide Sequence The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is 30 complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker 2024203581   29 May 2024 region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. Nucleotides Nucleotides are the building blocks of oligonucleotides and polynucleotides and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”. Modified nucleoside The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In a preferred embodiment the modified nucleoside comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Modified internucleoside linkage The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed “modified nucleotides”. In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides. In an embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is for example more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%, 6 2024203581   29 May 2024 such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. It will be recognized that, in some embodiments the 5 nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages. Modified internucleoside linkages may be selected from the group comprising phosphorothioate, 0 diphosphorothioate and boranophosphate. In some embodiments, the modified internucleoside linkages are compatible with the RNaseH recruitment of the oligonucleotide of the invention, for example phosphorothioate, diphosphorothioate or boranophosphate. In some embodiments the internucleoside linkage comprises sulphur (S), such as a phosphorothioate internucleoside linkage. 15 A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmakokinetics and ease of manufacture. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide 20 sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester, 25 methylphosphonate, MMI, amide-3, formacetal or thioformacetal. Further internucleoside linkages are disclosed in WO2009 / 124238 (incorporated herein by reference). In an embodiment the internucleoside linkage is selected from linkers disclosed in WO2007 / 031091 (incorporated herein by reference). Particularly, the internucleoside linkage may be selected from -O-P(O)2-O-, -O-P(O,S)-O-, -O-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-30   P(S)2-O-, -O-P(O)2-S-, -O-P(O,S)-S-, -S-P(O)2-S-, -O-PO(Rh)-O-, 0-PO(OCH3)-0-, -O-PO(NRh)- O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHRh)-O-, -O-P(O)2-NRh-, -NRh-P(O)2-O-, -NRh-CO-O-, -NRh-CO-NRh-, and / or the internucleoside linker may be selected form the group consisting of: -O-CO-O-, -O-CO-NRH-, -NRh-CO-CH2-, -O-CH2-CO-NRh-, -O-CH2-CH2-NRh-, -CO-NRh-CH2-, -CH2-NRhCO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -ch2-so2-ch2-, 35 -CH2-CO-NRh-, -O-CH2-CH2-NRh-CO -, -CH2-NCH3-O-CH2-, where RH is selected from hydrogen and C1 -4-alkyl. 2024203581   29 May 2024 Nuclease resistant linkages, such as phosphothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region of headmers and tailmers. Phosphorothioate linkages may, however, also be useful in non-nuclease 5 recruiting regions and / or affinity enhancing regions such as regions F and F’ for gapmers, or the modified nucleoside region of headmers and tailmers. Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of 0 phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and / or bio-distribution of an oligonucleotide - see WO2008 / 113832, incorporated herein by reference. In an embodiment all the internucleoside linkages in the oligonucleotide are phosphorothioate 15 and / or boranophosphate linkages. Preferably, all the internucleoside linkages in the oligonucleotide are phosphorothioate linkages. Nucleobase The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen 20 bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are 25 for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1. In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-30 cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2’thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine. The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified 35 nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the 2024203581   29 May 2024 nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used. Modified oligonucleotide The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar- 5 modified nucleosides and / or modified internucleoside linkages. The term chimeric” oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides. Complementarity The term “complementarity” describes the capacity for Watson-Crick base-pairing of 0 nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T) / uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts 15 of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1). The term “% complementary” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to (i.e. form Watson Crick base pairs with) a contiguous 20 nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences (when aligned with the target sequence 5’-3’ and the oligonucleotide sequence from 3’-5’), dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which 25 does not align (form a base pair) is termed a mismatch. The term “fully complementary”, refers to 100% complementarity. The following is an example of an oligonucleotide (SEQ ID NO: 5) that is fully complementary to the target nucleic acid (SEQ ID NO: 772). 5'gcagtagagccaatta3' (SEQ ID NO:772) 30               3'cgtcatctcggttaat5' (SEQ ID NO: 5) Identity The term “Identity” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are identical to (i.e. in their ability to form Watson Crick base pairs with the 35 complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting 2024203581   29 May 2024 the number of aligned bases that are identical between the two sequences, including gaps, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent Identity = (Matches x 100) / Length of aligned region (with gaps). Hybridization 5 The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are 0 duplexed with the target nucleic acid. At physiological conditions Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by △G°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an 15 oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where aqueous concentrations are 1M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of 20 the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965,C / 7em. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters 25 described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated AG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured 30 by the standard state Gibbs free energy AG0. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 35 kcal or-16 to -27 kcal such as -18 to -25 kcal. 2024203581   29 May 2024 Target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian PD-L1 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as a PD-L1 target nucleic 5 acid. The oligonucleotide of the invention may for example target exon regions of a mammalian PD-L1, or may for example target intron region in the PD-L1 pre-mRNA (see Table 1). Table 1: human PD-L1 Exons and Introns Exonic regions in the human PD-L1 premRNA (SEQ ID NO 1) Intronic regions in the human PD-L1 premRNA (SEQ D NO 1) ID start end ID start end el 1 94 il 95 5597 e2 5598 5663 i2 5664 6576 e3 6577 6918 i3 6919 12331 e4 12332 12736 i4 12737 14996 e5 14997 15410 i5 15411 16267 e6 16268 16327 i6 16328 17337 e7 17338 20064 Suitably, the target nucleic acid encodes a PD-L1 protein, in particular mammalian PD-L1, such as human PD-L1 (See for example tables 2 and 3, which provide reference to the mRNA and 10 pre-mRNA sequences for human, monkey, and mouse PD-L1). In the context of the present invention pre-mRNA is also considered as a nucleic acid that encodes a protein. In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1,2 and 3 or naturally occurring variants thereof (e.g. sequences encoding a mammalian PD-L1 protein). 15 If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA. For in vivo or in vitro application, the oligonucleotide of the invention is typically capable of inhibiting the expression of the PD-L1 target nucleic acid in a cell which is expressing the PD-L1 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the 20 invention is typically complementary to the PD-L1 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D’ or D”). The target nucleic acid may, in some embodiments, be a RNA or DNA, 25 such as a messenger RNA, such as a mature mRNA or a pre-mRNA. In some embodiments the target nucleic acid is a RNA or DNA which encodes mammalian PD-L1 protein, such as 2024203581   29 May 2024 human PD-L1, e.g. the human PD-L1 premRNA sequence, such as that disclosed as SEQ ID NO 1 or the human mRNA sequence with NCBI reference number NM014143. Further information on exemplary target nucleic acids is provided in tables 2 and 3. Table 2: Genome and assembly information for PD-L1 across species. Species Chr. Strand Genomic coordinates Start         End Assembly NCBI reference sequence* accession number for mRNA Human 9 fwd 5450503 5470566 GRCh38:CM000671.2 NM014143 Cynomol gus monkey 15 73560846 73581371 GCF 000364345.1 XM 005581779 Mouse 19 fwd 29367455 29388095 GRCm38:CM001012.2 NM 021893 5 Fwd = forward strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). The NCBI reference provides the mRNA sequence (cDNA sequence). *The National Center for Biotechnology Information reference sequence database is a comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein. It is hosted atwww.ncbi.nlm.nih.gov / refseq. 10 Table 3: Sequence details for PD-L1 across species. Species RNA type Length (nt) SEQ ID NO Human premRNA 20064 1 Monkey Cyno premRNA GCF ref 20261 2 Monkey Cyno premRNA Internal 20340 3 Mouse premRNA 20641 4 Target Sequence The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a 15 region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. In some embodiments the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention. 20 The target sequence may be a sub-sequence of the target nucleic acid. In some embodiments the sub-sequence is a sequence selected from the group consisting of a1-a149 (see tables 4). In some embodiments the sub-sequence is a sequence selected from the group consisting of a human PD-L1 mRNA exon, such as a PD-L1 human mRNA exon selected from the group consisting of e1, e2, e3, e4, e5, e6, and e7 (see table 1 above). 2024203581   29 May 2024 In some embodiments the sub-sequence is a sequence selected from the group consisting of a human PD-L1 mRNA intron, such as a PD-L1 human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5 and i6 (see table 1 above). The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is 5 complementary to or hybridizes to the target nucleic acid, such as a sub-sequence of the target nucleic acid, such as a target sequence described herein. The oligonucleotide comprises a contiguous nucleotide sequence of at least 8 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule. The contiguous nucleotide sequence (and therefore the target sequence) comprises 0 of at least 8 contiguous nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as from 12-25, such as from 14-18 contiguous nucleotides. Target Cell The term a “target cell” as used herein refers to a cell which is expressing the target nucleic 15 acid. In some embodiments the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell. In preferred embodiments the target cell expresses PD-L1 mRNA, such as the PD-L1 pre-mRNA or PD-L1 mature mRNA. The poly A tail of PD-L1 mRNA is typically disregarded for 20 antisense oligonucleotide targeting. Naturally occurring variant The term “naturally occurring variant” refers to variants of PD-L1 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same 25 amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof. In some embodiments, the naturally occurring variants have at least 95% such as at least 98% 30 or at least 99% homology to a mammalian PD-L1 target nucleic acid, such as a target nucleic acid selected form the group consisting of SEQ ID NO 1,2 and 3. 2024203581   29 May 2024 Numerous single nucleotide polymorphisms are known in the PD-L1 gene, for example those disclosed in the following table (human premRNA start / reference sequence is SEQ ID NO 2) Variant name Variant alleles minor allele Minor allele frequency Start on SEQ ID NO: 1 rs73397192 G / A A 0,10 2591 rs12342381 A / G G 0,12 308 rs16923173 G / A A 0,13 14760 rs2890658 C / A A 0,16 14628 rs2890657 G / C C 0,21 2058 rs3780395 A / G A 0,21 14050 rs147367592 AG / - - 0,21 13425 rs7023227 T / C T 0,22 6048 rs2297137 G / A A 0,23 15230 rs 1329946 G / A A 0,23 2910 rs5896124 - / G G 0,23 2420 rs61061063 T / C C 0,23 11709 rs1411263 T / C C 0,23 8601 rs59906468 A / G G 0,23 15583 rs6476976 T / C T 0,24 21012 rs35744625 C / A A 0,24 3557 rs17804441 T / C C 0,24 7231 rs148602745 C / T T 0,25 22548 rs4742099 G / A A 0,25 20311 rs10815228 T / C C 0,25 21877 rs58817806 A / G G 0,26 20769 rs822342 T / C T 0,27 3471 rs10481593 G / A A 0,27 7593 rs822339 A / G A 0,28 2670 rs860290 A / C A 0,28 2696 rs822340 A / G A 0,28 2758 rs822341 T / C T 0.28 2894 rs12002985 C / G C 0.28 6085 rs822338 C / T C 0.28 1055 rs866066 C / T T 0.28 451 rs6651524 A / T T 0.28 8073 rs6415794 A / T A 0.28 8200 rs4143815 G / C C 0.28 17755 rs111423622 G / A A 0.28 24096 rs6651525 C / A A 0.29 8345 rs4742098 A / G G 0.29 19995 rs10975123 C / T T 0.30 10877 rs2282055 T / G G 0.30 5230 rs4742100 A / C C 0.30 20452 rs60520638 - / TC TC 0.30 9502 rs 17742278 T / C C 0.30 6021 rs7048841 T / C T 0.30 10299 2024203581   29 May 2024 Variant name Variant alleles minor allele Minor allele frequency Start on SEQ ID NO: 1 rs10815229 T / G G 0.31 22143 rs10122089 C / T C 0.32 13278 rs1970000 C / A C 0.32 14534 rs112071324 AGAGAG / - AGAGAG 0.33 16701 rs2297136 G / A G 0.33 17453 rs10815226 A / T T 0.33 9203 rs10123377 A / G A 0.36 10892 rs10123444 A / G A 0.36 11139 rs7042084 G / T G 0.36 7533 rs10114060 G / A A 0.36 11227 rs7028894 G / A G 0.36 10408 rs4742097 C / T C 0.37 5130 rs1536926 G / T G 0.37 13486 rs1411262 C / T T 0.39 8917 rs7041009 G / A A 0.45 12741 Modulation of expression The term “modulation of expression” as used herein is to be understood as an overall term for an oligonucleotide’s ability to alter the amount of PD-L1 when compared to the amount of PD-L1 before administration of the oligonucleotide. Alternatively modulation of expression may be 5 determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock). It may however also be an individual treated with the standard of care. One type of modulation is an oligonucleotide’s ability to inhibit, down-regulate, reduce, 10 suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of PD-L1, e.g. by degradation of mRNA or blockage of transcription. Another type of modulation is an oligonucleotide’s ability to restore, increase or enhance expression of PD-L1, e.g. by repair of splice sites or prevention of splicing or removal or blockage of inhibitory mechanisms such as microRNA repression. 15 High affinity modified nucleosides A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to 20   +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2’ substituted nucleosides as well as locked nucleic acids (LNA) (see 2024203581   29 May 2024 e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213). Sugar modifications The oligomer of the invention may comprise one or more nucleosides which have a modified 5 sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance. 0 Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic 15 nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids. Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2’-OH group naturally found in DNA and RNA 20 nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions. Nucleosides with modified sugar moieties also include 2’ modified nucleosides, such as 2’ substituted nucleosides. Indeed, much focus has been spent on developing 2’ substituted nucleosides, and numerous 2’ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance 25 and enhanced affinity. 2’ modified nucleosides. A 2’ sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2’ position (2’ substituted nucleoside) or comprises a 2’ linked biradicle, and includes 2’ substituted nucleosides and LNA (2’ - 4’ biradicle bridged) nucleosides. For example, the 2’ 30 modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the oligonucleotide. Examples of 2’ substituted modified nucleosides are 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 29335   213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2’ substituted modified nucleosides. 2024203581   29 May 2024 2'-O-WOE 2fF-ANA 2'-O-Allyl me Locked Nucleic Acid Nucleosides (LNA). LNA nucleosides are modified nucleosides which comprise a linker group (referred to as a 5 biradicle or a bridge) between C2’ and C4’ of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. In some embodiments, the modified nucleoside or the LNA nucleosides of the oligomer of the invention has a general structure of the formula I or II: wherein W is selected from -O-, -S-, -N(Ra)-, -C(RaRb)-, such as, in some embodiments -O-; B designates a nucleobase or modified nucleobase moiety; Z designates an internucleoside linkage to an adjacent nucleoside, or a 5’-terminal group; Z* designates an internucleoside linkage to an adjacent nucleoside, or a 3’-terminal group; 15 X designates a group selected from the list consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z In some embodiments, X is selected from the group consisting of: -0-, -S-, NH-, NRaRb, -CH2-, CRaRb, -C(=CH2)-, and -C(=CRaRb)- In some embodiments, X is -0- 2024203581   29 May 2024 Y designates a group selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z In some embodiments, Y is selected from the group consisting of: -CH2-, -C(RaRb)-, -CH2CH2-, -C(RaRb)-C(RaRb)-, -CH2CH2CH2-, -C(RaRb)C(RaRb)C(RaRb)-, -C(Ra)=C(Rb)-, 5          and -C(Ra)=N- In some embodiments, Y is selected from the group consisting of: -CH2-, -CHRa-, -CHCH3-, CRaRb- or -X-Y- together designate a bivalent linker group (also referred to as a radicle) together designate a bivalent linker group consisting of 1,2, 3 or 4 groups / atoms selected from the group 0 consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z, In some embodiments, -X-Y- designates a biradicle selected from the groups consisting of: -X-CH2-, -X-CRaRb-, -X-CHRa’, -X-C(HCH3)’, -O-Y-, -O-CH2-, -S-CH2-, -NH-CH2-, -O-CHCHs-, -CH2-O-CH2, -O-CH(CH3CH3)-, -O-CH2-CH2-, OCH2-CH2-CH2-,-O-CH2OCH2-, -O-NCH2-, -C(=CH2)-CH2-, -NRa-CH2-, N-O-CH2, -S-CRaRb- and -S-CHRa-. 15          In some embodiments -X-Y- designates -O-CH2- or -O-CH(CH3)-. wherein Z is selected from -0-, -S-, and -N(Ra)-, and Ra and, when present Rb, each is independently selected from hydrogen, optionally substituted Cve-alkyl, optionally substituted C2.6-alkenyl, optionally substituted C2.6-alkynyl, hydroxy, optionally substituted Ci.6-alkoxy, C2.6-alkoxyalkyl, C2.6-alkenyloxy, carboxy, Ci-6 20 alkoxycarbonyl, Ci.6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(Ci-6-alkyl)amino, carbamoyl, mono- and di(Ci.6-alkyl)-amino-carbonyl, amino-Ci.6-alkyl-aminocarbonyl, mono- and di(Ci.6-alkyl)amino-Ci.6-alkyl-aminocarbonyl, Ci.6-alkyl-carbonylamino, carbamido, Ci.6-alkanoyloxy, sulphono, Ci.6-alkylsulphonyloxy, nitro, azido, 25 sulphanyl, Ci.6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents Ra and Rb together may designate optionally substituted methylene (=CH2), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation. wherein R1, R2, R3, R5 and R5* are independently selected from the group consisting of: 30 hydrogen, optionally substituted C^e-alkyl, optionally substituted C2.6-alkenyl, optionally substituted C2.6-alkynyl, hydroxy, C^-alkoxy, C2.6-alkoxyalkyl, C2.6-alkenyloxy, carboxy, alkoxycarbonyl, CV6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1.6-alkyl)amino, carbamoyl, mono- and di(C1.6-alkyl)-amino-carbonyl, amino-CV6-alkyl- 35 aminocarbonyl, mono- and di(C1.6-alkyl)amino-C1.6-alkyl-aminocarbonyl, Cve-alkyl- 2024203581   29 May 2024 carbonylamino, carbamido, Cve-alkanoyloxy, sulphono, Cve-alkylsulphonyloxy, nitro, azido, sulphanyl, Ci.6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene. 5 In some embodiments R1, R2, R3, R5 and R5* are independently selected from Ci-6 alkyl, such as methyl, and hydrogen. In some embodiments R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments R1, R2, R3, are all hydrogen, and either R5 and R5 is also hydrogen and the other of R5 and R5*is other than hydrogen, such as Ci-6 alkyl such as methyl. 0 In some embodiments, Ra is either hydrogen or methyl. In some embodiments, when present, Rb is either hydrogen or methyl. In some embodiments, one or both of Ra and Rb is hydrogen In some embodiments, one of Ra and Rb is hydrogen and the other is other than hydrogen In some embodiments, one of Ra and Rb is methyl and the other is hydrogen 15 In some embodiments, both of Ra and Rb are methyl. In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO99 / 014226, WO00 / 66604, WO98 / 039352 and WO2004 / 046160 which are all hereby incorporated by reference, and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides. 20 In some embodiments, the biradicle -X-Y- is -S-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160 which are hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -NH-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99 / 014226 and 25   WO2004 / 046160 which are hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -O-CH2-CH2- or -O-CH2-CH2- CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO00 / 047599 and Morita et al, Bioorganic & Med.Chern. Lett. 12 73-76, which are hereby incorporated by reference, and include what are commonly known as 2’-O-4’C-ethylene bridged 30 nucleic acids (ENA). In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as Cve alkyl, 2024203581   29 May 2024 such as methyl. Such 5’ substituted LNA nucleosides are disclosed in WO2007 / 134181 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -O-CRaRb-, wherein one or both of Ra and Rb are other than hydrogen, such as methyl, W is O, and all of R1, R2, R3, and one of R5 and R5* are 5 hydrogen, and the other of R5 and R5* is other than hydrogen such as Ci-6 alkyl, such as methyl. Such bis modified LNA nucleosides are disclosed in WO2010 / 077578 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH2OCH3)- (2’ O-methoxyethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chern. Vol 0   75(5) pp. 1569-81). In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH2CH3)- (2’0-ethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chern. Vol 75(5) pp. 1569-81). In some embodiments, the biradicle -X-Y- is -O-CHRa-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6’ substituted LNA nucleosides are disclosed in WO10036698 and WO07090071 which are both hereby incorporated by reference. 15 In some embodiments, the biradicle -X-Y- is -O-CH(CH2OCH3)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are also known as cyclic MOEs in the art (cMOE) and are disclosed in WO07090071. In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH3)-. - in either the R- or S- configuration. In some embodiments, the biradicle -X-Y- together designate 20 the bivalent linker group -O-CH2-O-CH2- (Seth at al., 2010, J. Org. Chern). In some embodiments, the biradicle -X-Y- is -O-CH(CH3)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6’ methyl LNA nucleosides are also known as cET nucleosides in the art, and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010 / 036698 (alpha-L) which are both hereby incorporated by reference). 25 In some embodiments, the biradicle -X-Y- is -O-CRaRb-, wherein in neither Ra or Rb is hydrogen, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments, Ra and Rb are both methyl. Such 6’ di-substituted LNA nucleosides are disclosed in WO 2009006478 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -S-CHRa-, W is 0, and all of R1, R2, R3, R5 and R5* 30 are all hydrogen. Such 6’ substituted thio LNA nucleosides are disclosed in WO11156202 which is hereby incorporated by reference. In some 6’ substituted thio LNA embodiments Ra is methyl. In some embodiments, the biradicle -X-Y- is -C(=CH2)-C(RaRb)-, such as -C(=CH2)-CH2-, or -C(=CH2)-CH(CH3)-W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such vinyl carbo 2024203581   29 May 2024 LNA nucleosides are disclosed in WO08154401 and WO09067647 which are both hereby incorporated by reference. In some embodiments the biradicle -X-Y- is -N(-ORa)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is Ci-6 alkyl such as methyl. Such LNA nucleosides 5 are also known as N substituted LNAs and are disclosed in WO2008 / 150729, which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- together designate the bivalent linkergroup -O-NRa-CH3- (Seth at al., 2010, J. Org. Chern). In some embodiments the biradicle -X-Y- is -N(Ra)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is Ci-6 alkyl such as methyl. 0 In some embodiments, one or both of R5 and R5* is hydrogen and, when substituted the other of R5 and R5* is Ci.6 alkyl such as methyl. In such an embodiment, R1, R2, R3, may all be hydrogen, and the biradicle -X-Y- may be selected from -O-CH2- or -O-C(HCRa)-, such as -O-C(HCH3)-. In some embodiments, the biradicle is -CRaRb-O-CRaRb-, such as CH2-O-CH2-, W is O and all 15 of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C16 alkyl such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 which is hereby incorporated by reference. In some embodiments, the biradicle is -O-CRaRb-O-CRaRb-, such as O-CH2-O-CH2-, W is O and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is Ci-6 alkyl such as 20 methyl. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238, which is hereby incorporated by reference. It will be recognized than, unless specified, the LNA nucleosides may be in the beta-D or alpha-L stereoisoform. 25 Certain examples of LNA nucleosides are presented in Scheme 1. Scheme 1 2024203581   29 May 2024 a-L-oxy LIMA P-D-amino substituted LIMA 6'methyl p-D-oxy LIMA Carbocyclic(vinyl) p-D- LNA Carbocyclic(vinyl) «-L- LIMA Substituted p-D amino LIMA As illustrated in the examples, in some embodiments of the invention the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides. 5 Nuclease mediated degradation Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence. In some embodiments, the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a 10 nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are 2024203581   29 May 2024 flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers. RNase H Activity and Recruitment The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H 5 when in a duplex with a complementary RNA molecule. WO01 / 23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol / l / min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when 0 using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01 / 23613 (hereby incorporated by reference). Gapmer 15 The term gapmer as used herein refers to an antisense oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5’ and 3’ by regions which comprise one or more affinity enhancing modified nucleosides (flanks or wings). Various gapmer designs are described herein and a characterized by their ability to recruit RNaseH. Headmers and tailmers are oligonucleotides capable of recruiting RNase H where one of the 20 flanks is missing, i.e. only one of the ends of the oligonucleotide comprises affinity enhancing modified nucleosides. For headmers the 3’ flank is missing (i.e. the 5’ flank comprises affinity enhancing modified nucleosides) and for tailmers the 5’ flank is missing (i.e. the 3’ flank comprises affinity enhancing modified nucleosides). LNA Gapmer 25 The term LNA gapmer is a gapmer oligonucleotide wherein at least one of the affinity enhancing modified nucleosides is an LNA nucleoside. Mixed Wing Gapmer The term mixed wing gapmer or mixed flank gapmer refers to a LNA gapmer wherein at least one of the flank regions comprise at least one LNA nucleoside and at least one non-LNA 30 modified nucleoside, such as at least one 2’ substituted modified nucleoside, such as, for example, 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA and 2’-F-ANA nucleoside(s). In some embodiments the mixed wing gapmer has one flank which comprises only LNA nucleosides (e.g. 5’ or 3’) and the other flank (3’ or 5’ respectfully) comprises 2’ substituted modified nucleoside(s) and optionally LNA 35 nucleosides. 2024203581   29 May 2024 Gapbreaker The term “gapbreaker oligonucleotide” is used in relation to a gapmer capable of maintaining RNAseH recruitment even though the gap region is disrupted by a non-RNaseH recruiting nucleoside (a gap-breaker nucleoside, E) such that the gap region comprise less than 5 5 consecutive DNA nucleosides. Non-RNaseH recruiting nucleosides are for example nucleosides in the 3’ endo conformation, such as LNA’s where the bridge between C2’ and C4’ of the ribose sugar ring of a nucleoside is in the beta conformation, such as beta-D-oxy LNA or ScET nucleoside. The ability of gapbreaker oligonucleotide to recruit RNaseH is typically sequence or even compound specific - see Rukov et al. 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which 0 discloses “gapbreaker” oligonucleotides which recruit RNaseH which in some instances provide a more specific cleavage of the target RNA. In some embodiments, the oligonucleotide of the invention is a gapbreaker oligonucleotide. In some embodiments the gapbreaker oligonucleotide comprise a 5’-flank (F), a gap (G) and a 3’-flank (F’), wherein the gap is disrupted by a non-RNaseH recruiting nucleoside (a gap-breaker 15 nucleoside, E) such that the gap contain at least 3 or 4 consecutive DNA nucleosides. In some embodiments the gapbreaker nucleoside (E) is an LNA nucleoside where the bridge between C2’ and C4’ of the ribose sugar ring of a nucleoside is in the beta conformation and is placed within the gap region such that the gap-breaker LNA nucleoside is flanked 5’ and 3’ by at least 3 (5’) and 3 (3’) or at least 3 (5’) and 4 (3’) or at least 4(5’) and 3(3’) DNA nucleosides, and 20 wherein the oligonucleotide is capable of recruiting RNaseH. The gapbreaker oligonucleotide can be represented by the following formulae: F-G-E-G-F’; in particular Fvy-Gs^-ErGs^-F’vy D’-F-G-F’, in particular D’^-Fj-y Gs^-ErG^-F’i.y F-G-F’-D”, in particular F^y- G3.4-E1-G3.4-F’1.y-D”1.3 25   D’-F-G-F’-D”, in particular D’vs-Fvy G3.4-E1-G3.4-F’1.yD”1.3 Where region D’ and D” are as described in the section “Gapmer design”. In some embodiments the gapbreaker nucleoside (E) is a beta-D-oxy LNA or ScET or another beta-LNA nucleosides shown in Scheme 1). Conjugate 30 The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region), also termed a oligonucleotide conjugate. Conjugation of the oligonucleotides of the invention to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, e.g. by affecting the activity, cellular 35 distribution, cellular uptake or stability of the oligonucleotide. In some embodiments the 2024203581   29 May 2024 conjugate moiety targets the oligonucleotide to the liver. A the same time the conjugate serve to reduce activity of the oligonucleotide in non-target cell types, tissues or organs, e.g. off target activity or activity in non-target cell types, tissues or organs. In one embodiment of the invention the oligonucleotide conjugate of the invention display improved inhibition of PD-L1 in the target cell when compared to an unconjugated oligonucleotide. In another embodiment the oligonucleotide conjugate of the invention has improved cellular distribution between liver and other organs, such as spleen or kidney (i.e. more conjugated oligonucleotide goes to the liver than the spleen or kidney) when compared to an unconjugated oligonucleotide. In another embodiment the oligonucleotide conjugate of the invention show improved cellular uptake into the liver of the conjugate oligonucleotide when compared to an unconjugated oligonucleotide. WO 93 / 07883 and WO2013 / 033230 provides suitable conjugate moieties, which are hereby incorporated by reference. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr). In particular tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the the ASGPr, see for example WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620 (hereby incorporated by reference). The conjugate moiety is essentially the part of the antisense oligonucleotides conjugates which is not composed of nucleic acids. Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety. In an embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof. Linkers A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (Region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A). In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and / or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence 2024203581   29 May 2024 complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region). Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered 5 within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic 0 enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 10 nucleosides, such as 1,2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 15   4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014 / 076195 (hereby incorporated by reference). Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide or contiguous 20 nucleotide sequence complementary to the target nucleic acid (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 -25   C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group. Treatment The term ’treatment’ as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will 30 therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic. Restoration of immune response against pathogens The immune response is divided into the innate and adaptive immune response. The innate immune system provides an immediate, but non-specific response. The adaptive immune 35 response is activated by innate immune response and is highly specific to a particular pathogen. Upon presentation of a pathogen-derived antigen on the surface of antigen-presenting cells, 2024203581   29 May 2024 immune cells of the adaptive immune response (i.e. T and B lymphocytes) are activated through their antigen-specific receptors leading to a pathogenic-specifc immune response and development of immunological memory. Chronic viral infections, such as HBV and HCV, are associated with T cell exhaustion characterized by unresponsiveness of the viral-specific T 5 cells. T cell exhaustion is well studied, for a review see for example Yi et al 2010 Immunology129, 474-481. Chronic viral infections are also associated with reduced function of NK cells that are innate immune cells. Enhancing viral immune response is important for clearance of chronic infection. Restoration of immune response against pathogens, mediated by T cells and NK cells, can be assessed by measurement of proliferation, cytokine secretion and 0 cytolytic function (Dolina et al. 2013 Molecular Therapy-Nucleic Acids, 2 e72 and Example 6 herein). DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the use of antisense oligonucleotides and conjugates thereof and pharmaceutical compositions comprising these to restore immune response against 15 pathogens that have infected an animal, in particular a human. The antisense oligonucleotide conjugates of the present invention are particular useful against pathogens that have infected the liver, in particular chronic liver infections like HBV. The conjugates allow targeted distribution of the oligonucleotides and prevents systemic knockdown of the target nucleic acid. The Oligonucleotides of the Invention 20 The invention relates to oligonucleotides capable of modulating expression of PD-L1. The modulation is may achieved by hybridizing to a target nucleic acid encoding PD-L1 or which is involved in the regulation of PD-L1. The target nucleic acid may be a mammalian PD-L1 sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3. The target nucleic acid may be a pre-mRNA, an mRNA or any 25 RNA sequence expressed from a mammalian cell that supports the expression or regulation of PD-L1. The oligonucleotide of the invention is an antisense oligonucleotide which targets PD-L1. In one aspect of the invention the oligonucleotides of the invention are conjugated to a conjugate moiety, in particular an asialoglycoprotein receptor targeting conjugate moiety. 30 In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target. Preferably, such modulation produces an 35 inhibition of expression of at least 20% compared to the expression level when the cell or 2024203581   29 May 2024 organism is challenged by an infectious agent, or treated with an agent simulating the challenge by an infectious agent (eg poly l:C or LPS), more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the expression level when the cell or organism is challenged by an infectious agent, or treated with an agent simulating the challenge by an 5 infectious agent (eg poly l:C or LPS). In some embodiments oligonucleotides of the invention may be capable of inhibiting expression levels of PD-L1 mRNA by at least 60% or 70% in vitro using KARPAS-299 orTHPI cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of PD-L1 protein by at least 50% in vitro using KARPAS-299 or THP1 cells. Suitably, the examples provide assays which may be used to measure PD-0 L1 RNA (e.g. example 1). The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches, hybridization to the target nucleic acid may still be sufficient to show a desired modulation of PD-L1 expression. Reduced 15 binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and / or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2’ modified nucleosides, including LNA, present within the oligonucleotide sequence. In some embodiments the antisense oligonucleotide of the invention is capable of restoring 20 pathogen-specific T cells. In some embodiments, oligonucleotides of the invention are capable of increasing the pathogen-specific T cells by at least 40%, 50%, 60% or 70% when compared to untreated controls or controls treated with standard of care. In one embodiment the antisense oligonucleotide or conjugate of the invention is capable increasing HBV-specific T cells when compared to untreated controls or controls treated with standard of care. Suitably, the examples 25 provide assays which may be used to measure the HBV-specific T cells (e.g. T cell proliferation, cytokine secretion and cytolytic activity). In another embodiment the the antisense oligonucleotide or conjugate of the invention is capable increasing HCV-specific T cells when compared to untreated controls or controls treated with standard of care. In another embodiment the the antisense oligonucleotide or conjugate of the invention is capable 30 increasing HDV-specific T cells when compared to untreated controls or controls treated with standard of care. In some embodiments the antisense oligonucleotide of the invention is capable reducing HBsAg levels in an animal or human. In some embodiments, oligonucleotides of the invention are capable of reducing the HBsAg levels by at least 40%, 50%, 60% or 70%, more preferably by at 35 least 80%, 90% or 95% when compared to the level prior to treatment. Most preferably oligonucleotides of the invention are capable of achieving seroconversion of HBsAg in an animal or human infected with HBV. 2024203581   29 May 2024 An aspect of the present invention relates to an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid. In some embodiments, the oligonucleotide comprises a contiguous sequence which is at least 5   90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid. In a preferred embodiment the oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target 0 nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as fully (or 100%) complementary, to a region target nucleic acid region present in SEQ ID NO: 1 or SEQ ID NO: 15   2. In some embodiments the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO: 2. In some embodiments the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO: 3. In some embodiments, the oligonucleotide or oligonucleotide conjugate comprises a contiguous 20 nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region wherein the contiguous nucleotide sequence is complementary to a sub-sequence of the target nucleic acid selected from the group consisting of position 371-3068, 5467-12107 and 15317-19511 on SEQ ID NO: 1. In a further embodiment the sub-sequence of the target nucleic acid is selected from the 25 group consisting of position 371 -510, 822-1090, 1992-3068, 5467-5606, 6470-12107, 15317 15720, 15317-18083, 18881-19494 and 1881-19494 on SEQ ID NO: 1. In a preferred embodiment the sub-sequence of the target nucleic acid is selected from the group consisting of position 7300-7333, 8028-8072, 9812-9859, 11787-11873 and 15690-15735 on SEQ ID NO: 1. In some embodiments, the oligonucleotide or oligonucleotide conjugate comprises a contiguous 30 nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region present in SEQ ID NO: 1, wherein the target nucleic acid region is selected from the group consisting of region a1 to a449 in table 4. 2024203581   29 May 2024 Table 4: Regions of SEQ ID NO 1 which may be targeted using oligonucleotide of the invention Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length from to from to from to a1 51 82 32 a151 6994 7020 27 a301 13092 13115 24 a2 87 116 30 a152 7033 7048 16 a302 13117 13134 18 a3 118 133 16 a153 7050 7066 17 a303 13136 13169 34 a4 173 206 34 a154 7078 7094 17 a304 13229 13249 21 a5 221 287 67 a155 7106 7122 17 a305 13295 13328 34 a6 304 350 47 a156 7123 7144 22 a306 13330 13372 43 a7 354 387 34 a157 7146 7166 21 a307 13388 13406 19 a8 389 423 35 a158 7173 7193 21 a308 13408 13426 19 a9 425 440 16 a159 7233 7291 59 a309 13437 13453 17 a10 452 468 17 a160 7300 7333 34 a310 13455 13471 17 a11 470 484 15 a161 7336 7351 16 a311 13518 13547 30 a12 486 500 15 a162 7353 7373 21 a312 13565 13597 33 a13 503 529 27 a163 7375 7412 38 a313 13603 13620 18 a14 540 574 35 a164 7414 7429 16 a314 13630 13663 34 a15 576 649 74 a165 7431 7451 21 a315 13665 13679 15 a16 652 698 47 a166 7453 7472 20 a316 13706 13725 20 a17 700 750 51 a167 7474 7497 24 a317 13727 13774 48 a18 744 758 15 a168 7517 7532 16 a318 13784 13821 38 a19 774 801 28 a169 7547 7601 55 a319 13831 13878 48 a20 805 820 16 a170 7603 7617 15 a320 13881 13940 60 a21 827 891 65 a171 7632 7647 16 a321 13959 14013 55 a22 915 943 29 a172 7649 7666 18 a322 14015 14031 17 a23 950 982 33 a173 7668 7729 62 a323 14034 14049 16 a24 984 1000 17 a174 7731 7764 34 a324 14064 14114 51 a25 1002 1054 53 a175 7767 7817 51 a325 14116 14226 111 a26 1060 1118 59 a176 7838 7860 23 a326 14229 14276 48 a27 1124 1205 82 a177 7862 7876 15 a327 14292 14306 15 a28 1207 1255 49 a178 7880 7944 65 a328 14313 14384 72 a29 1334 1349 16 a179 7964 8012 49 a329 14386 14408 23 a30 1399 1425 27 a180 8028 8072 45 a330 14462 14481 20 a31 1437 1458 22 a181 8086 8100 15 a331 14494 14519 26 a32 1460 1504 45 a182 8102 8123 22 a332 14557 14577 21 a33 1548 1567 20 a183 8125 8149 25 a333 14608 14628 21 a34 1569 1586 18 a184 8151 8199 49 a334 14646 14668 23 a35 1608 1662 55 a185 8218 8235 18 a335 14680 14767 88 a36 1677 1700 24 a186 8237 8276 40 a336 14765 14779 15 a37 1702 1721 20 a187 8299 8344 46 a337 14815 14844 30 2024203581   29 May 2024 Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length from to from to from to a38 1723 1745 23 a188 8346 8436 91 a338 14848 14925 78 a39 1768 1794 27 a189 8438 8470 33 a339 14934 14976 43 a40 1820 1835 16 a190 8472 8499 28 a340 14978 15009 32 a41 1842 1874 33 a191 8505 8529 25 a341 15013 15057 45 a42 1889 1979 91 a192 8538 8559 22 a342 15064 15091 28 a43 1991 2011 21 a193 8562 8579 18 a343 15094 15140 47 a44 2013 2038 26 a194 8581 8685 105 a344 15149 15165 17 a45 2044 2073 30 a195 8688 8729 42 a345 15162 15182 21 a46 2075 2155 81 a196 8730 8751 22 a346 15184 15198 15 a47 2205 2228 24 a197 8777 8800 24 a347 15200 15221 22 a48 2253 2273 21 a198 8825 8865 41 a348 15232 15247 16 a49 2275 2303 29 a199 8862 8894 33 a349 15250 15271 22 a50 2302 2333 32 a200 8896 8911 16 a350 15290 15334 45 a51 2335 2366 32 a201 8938 8982 45 a351 15336 15369 34 a52 2368 2392 25 a202 8996 9045 50 a352 15394 15416 23 a53 2394 2431 38 a203 9048 9070 23 a353 15433 15451 19 a54 2441 2455 15 a204 9072 9139 68 a354 15453 15491 39 a55 2457 2494 38 a205 9150 9168 19 a355 15496 15511 16 a56 2531 2579 49 a206 9170 9186 17 a356 15520 15553 34 a57 2711 2732 22 a207 9188 9202 15 a357 15555 15626 72 a58 2734 2757 24 a208 9204 9236 33 a358 15634 15652 19 a59 2772 2786 15 a209 9252 9283 32 a359 15655 15688 34 a60 2788 2819 32 a210 9300 9331 32 a360 15690 15735 46 a61 2835 2851 17 a211 9339 9354 16 a361 15734 15764 31 a62 2851 2879 29 a212 9370 9398 29 a362 15766 15787 22 a63 2896 2912 17 a213 9400 9488 89 a363 15803 15819 17 a64 2915 2940 26 a214 9490 9537 48 a364 15846 15899 54 a65 2944 2973 30 a215 9611 9695 85 a365 15901 15934 34 a66 2973 2992 20 a216 9706 9721 16 a366 15936 15962 27 a67 2998 3016 19 a217 9723 9746 24 a367 15964 15985 22 a68 3018 3033 16 a218 9748 9765 18 a368 15987 16023 37 a69 3036 3051 16 a219 9767 9788 22 a369 16025 16061 37 a70 3114 3139 26 a220 9794 9808 15 a370 16102 16122 21 a71 3152 3173 22 a221 9812 9859 48 a371 16134 16183 50 a72 3181 3203 23 a222 9880 9913 34 a372 16185 16281 97 a73 3250 3271 22 a223 9923 9955 33 a373 16283 16298 16 a74 3305 3335 31 a224 9966 10007 42 a374 16305 16323 19 a75 3346 3363 18 a225 10009 10051 43 a375 16325 16356 32 a76 3391 3446 56 a226 10053 10088 36 a376 16362 16404 43 2024203581   29 May 2024 Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length from to from to from to a77 3448 3470 23 a227 10098 10119 22 a377 16406 16456 51 a78 3479 3497 19 a228 10133 10163 31 a378 16494 16523 30 a79 3538 3554 17 a229 10214 10240 27 a379 16536 16562 27 a80 3576 3597 22 a230 10257 10272 16 a380 16564 16580 17 a81 3603 3639 37 a231 10281 10298 18 a381 16582 16637 56 a82 3663 3679 17 a232 10300 10318 19 a382 16631 16649 19 a83 3727 3812 86 a233 10339 10363 25 a383 16655 16701 47 a84 3843 3869 27 a234 10409 10426 18 a384 16737 16781 45 a85 3874 3904 31 a235 10447 10497 51 a385 16783 16804 22 a86 3926 3955 30 a236 10499 10529 31 a386 16832 16907 76 a87 3974 3993 20 a237 10531 10546 16 a387 16934 16965 32 a88 3995 4042 48 a238 10560 10580 21 a388 16972 17035 64 a89 4053 4073 21 a239 10582 10596 15 a389 17039 17069 31 a90 4075 4123 49 a240 10600 10621 22 a390 17072 17109 38 a91 4133 4157 25 a241 10623 10664 42 a391 17135 17150 16 a92 4158 4188 31 a242 10666 10685 20 a392 17167 17209 43 a93 4218 4250 33 a243 10717 10773 57 a393 17211 17242 32 a94 4277 4336 60 a244 10775 10792 18 a394 17244 17299 56 a95 4353 4375 23 a245 10794 10858 65 a395 17304 17344 41 a96 4383 4398 16 a246 10874 10888 15 a396 17346 17400 55 a97 4405 4446 42 a247 10893 10972 80 a397 17447 17466 20 a98 4448 4464 17 a248 10974 10994 21 a398 17474 17539 66 a99 4466 4493 28 a249 10996 11012 17 a399 17561 17604 44 a100 4495 4558 64 a250 11075 11097 23 a400 17610 17663 54 a101 4571 4613 43 a251 11099 11124 26 a401 17681 17763 83 a102 4624 4683 60 a252 11140 11157 18 a402 17793 17810 18 a103 4743 4759 17 a253 11159 11192 34 a403 17812 17852 41 a104 4761 4785 25 a254 11195 11226 32 a404 17854 17928 75 a105 4811 4858 48 a255 11235 11261 27 a405 17941 18005 65 a106 4873 4932 60 a256 11279 11337 59 a406 18007 18035 29 a107 4934 4948 15 a257 11344 11381 38 a407 18041 18077 37 a108 4955 4974 20 a258 11387 11411 25 a408 18085 18146 62 a109 4979 5010 32 a259 11427 11494 68 a409 18163 18177 15 a110 5012 5052 41 a260 11496 11510 15 a410 18179 18207 29 a111 5055 5115 61 a261 11512 11526 15 a411 18209 18228 20 a112 5138 5166 29 a262 11528 11551 24 a412 18230 18266 37 a113 5168 5198 31 a263 11570 11592 23 a413 18268 18285 18 a114 5200 5222 23 a264 11594 11634 41 a414 18287 18351 65 a115 5224 5284 61 a265 11664 11684 21 a415 18365 18395 31 2024203581   29 May 2024 Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length from to from to from to a116 5286 5302 17 a266 11699 11719 21 a416 18402 18432 31 a117 5317 5332 16 a267 11721 11746 26 a417 18434 18456 23 a118 5349 5436 88 a268 11753 11771 19 a418 18502 18530 29 a119 5460 5512 53 a269 11787 11873 87 a419 18545 18590 46 a120 5514 5534 21 a270 11873 11905 33 a420 18603 18621 19 a121 5548 5563 16 a271 11927 11942 16 a421 18623 18645 23 a122 5565 5579 15 a272 11946 11973 28 a422 18651 18708 58 a123 5581 5597 17 a273 11975 11993 19 a423 18710 18729 20 a124 5600 5639 40 a274 12019 12114 96 a424 18731 18758 28 a125 5644 5661 18 a275 12116 12135 20 a425 18760 18788 29 a126 5663 5735 73 a276 12137 12158 22 a426 18799 18859 61 a127 5737 5770 34 a277 12165 12192 28 a427 18861 18926 66 a128 5778 5801 24 a278 12194 12216 23 a428 18928 18980 53 a129 5852 5958 107 a279 12218 12246 29 a429 19001 19018 18 a130 6007 6041 35 a280 12262 12277 16 a430 19034 19054 21 a131 6049 6063 15 a281 12283 12319 37 a431 19070 19092 23 a132 6065 6084 20 a282 12334 12368 35 a432 19111 19154 44 a133 6086 6101 16 a283 12370 12395 26 a433 19191 19213 23 a134 6119 6186 68 a284 12397 12434 38 a434 19215 19240 26 a135 6189 6234 46 a285 12436 12509 74 a435 19255 19356 102 a136 6236 6278 43 a286 12511 12543 33 a436 19358 19446 89 a137 6291 6312 22 a287 12545 12565 21 a437 19450 19468 19 a138 6314 6373 60 a288 12567 12675 109 a438 19470 19512 43 a139 6404 6447 44 a289 12677 12706 30 a439 19514 19541 28 a140 6449 6482 34 a290 12708 12724 17 a440 19543 19568 26 a141 6533 6555 23 a291 12753 12768 16 a441 19570 19586 17 a142 6562 6622 61 a292 12785 12809 25 a442 19588 19619 32 a143 6624 6674 51 a293 12830 12859 30 a443 19683 19739 57 a144 6679 6762 84 a294 12864 12885 22 a444 19741 19777 37 a145 6764 6780 17 a295 12886 12916 31 a445 19779 19820 42 a146 6782 6822 41 a296 12922 12946 25 a446 19822 19836 15 a147 6824 6856 33 a297 12948 12970 23 a447 19838 19911 74 a148 6858 6898 41 a298 12983 13003 21 a448 19913 19966 54 a149 6906 6954 49 a299 13018 13051 34 a449 19968 20026 59 a150 6969 6992 24 a300 13070 13090 21 In some embodiment the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of a7, a26, a43, a119, a142, a159, a160, a163, a169, a178, a179, a180, a189, 33 2024203581   29 May 2024 a201, a202, a204, a214, a221, a224, a226, a243, a254, a258, 269, a274, a350, a360, a364, a365, a370, a372, a381, a383, a386, a389, a400, a427, a435 and a438. In a preferred embodiment the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is 5 selected from the group consisting of a160, a180, a221, a269 and a360. In some embodiments, the oligonucleotide of the invention comprises or consists of 8 to 35 nucleotides in length, such as from 9 to 30, such as 10 to 22, such as from 11 to 20, such as from 12 to 18, such as from 13 to 17 or 14 to 16 contiguous nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 16 to 20 nucleotides in length. It is to 0 be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included. In some embodiments, the contiguous nucleotide sequence comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous 15 nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 16, 17, 18, 19 or 20 nucleotides in length. In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequences listed in table 5. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence 20 comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5 to 743 (see motif sequences listed in table 5). In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 25   100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5 to 743 and 771. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 6, 8, 9, 13, 41, 30    42, 58, 77, 92, 111, 128, 151, 164, 166, 169, 171,222, 233, 245, 246, 250, 251,252, 256, 272, 273, 287, 292, 303, 314, 318, 320, 324, 336, 342, 343, 344, 345, 346, 349, 359, 360, 374, 408, 409, 415, 417, 424, 429, 430, 458, 464, 466, 474, 490, 493, 512, 519, 519, 529, 533, 534, 547, 566, 567, 578, 582, 601,619, 620, 636, 637, 638, 640, 645, 650, 651,652, 653, 658, 659, 660, 665, 678, 679, 680, 682, 683, 684, 687, 694, 706, 716, 728, 733, 734, and 735. 2024203581   29 May 2024 In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 287. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 342. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 640. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 466. In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 566. In embodiments where the oligonucleotide is longer than the contigious nucleotide sequence (which is complementary to the target nucleic acid), the motif sequences in table 5 form the contigious nucleotide sequence part of the antisense oligonucleotides of the invention. In some embodiments the sequence of the oligonucleotide is equivalent to the contigious nucleotide sequence (e.g. if no biocleavable linkers are added). It is understood that the contiguous nucleobase sequences (motif sequence) can be modified to for example increase nuclease resistance and / or binding affinity to the target nucleic acid. Modifications are described in the definitions and in the “Oligonucleotide design” section. Table 5 lists preferred designs of each motif sequence. Oligonucleotide design Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the oligonucleotide sequence. The oligonucleotides of the invention comprise sugar-modified nucleosides and may also comprise DNA or RNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and DNA nucleosides. Incorporation of modified nucleosides into the oligonucleotide of the invention may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the modified nucleosides can be referred to as affinity enhancing modified nucleotides, the modified nucleosides may also be termed units. In an embodiment, the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at 35 2024203581   29 May 2024 least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In an embodiment the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 8 modified nucleosides, such as from 3 to 7 modified nucleosides, such as from 4 to 6 modified nucleosides, such as 3, 4, 5, 6 or 7 modified nucleosides. In an embodiment, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2’ sugar modified nucleosides. Preferably the oligonucleotide of the invention comprise the one or more 2’ sugar modified nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2’-fluoro-ANA and LNA nucleosides. Even more preferably the one or more modified nucleoside is a locked nucleic acid (LNA). In a further embodiment the oligonucleotide comprises at least one modified internucleoside linkage. In a preferred embodiment all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages. In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as 1,2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as from 2 to 6 LNA nucleosides, such as from 3 to 7 LNA nucleosides, 4 to 6 LNA nucleosides or 3, 4, 5, 6 or 7 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides in the oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90% of the modified nucleosides are LNA nucleosides. In a still further embodiment all the modified nucleosides in the oligonucleotide are LNA nucleosides. In a further embodiment, the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, and / or ENA in either the beta-D or alpha-L configurations or combinations thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. In a preferred embodiment the oligonucleotide or contiguous nucleotide sequence has at least 1 LNA nucleoside at the 5’ end and at least 2 LNA nucleosides at the 3’ end of the nucleotide sequence. In some embodiments, the oligonucleotide of the invention comprises at least one modified nucleoside which is a 2’-MOE-RNA nucleoside, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2’-MOE-RNA nucleosides. In some embodiments, at least one of said modified nucleoside is 2’-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2’-fluoro-DNA nucleosides. In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside and at least one 2’ substituted modified nucleoside. In some embodiments of the invention, the oligonucleotide comprise both 2’ sugar modified nucleosides and DNA units. Preferably the oligonucleotide comprises both LNA and DNA 36 2024203581   29 May 2024 nucleosides (units). Preferably, the combined total of LNA and DNA units is 8-30, such as 10 -25, preferably 12-22, such as 12-18, even more preferably 11-16. In some embodiments of the invention, the nucleotide sequence of the oligonucleotide, such as the contiguous nucleotide sequence consists of at least one or two LNA nucleosides and the remaining nucleosides are 5 DNA units. In some embodiments the oligonucleotide comprises only LNA nucleosides and naturally occurring nucleosides (such as RNA or DNA, most preferably DNA nucleosides), optionally with modified internucleoside linkages such as phosphorothioate. In an embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H. 0 The structural design of the oligonucleotide of the invention may be selected from gapmers, gapbreakers, headmers and tailmers. Gapmer design In a preferred embodiment the oligonucleotide of the invention has a gapmer design or structure also referred herein merely as “Gapmer”. In a gapmer structure the oligonucleotide comprises at 15 least three distinct structural regions a 5’-flank, a gap and a 3’-flank, F-G-F’ in ‘5 -> 3’ orientation. In this design, flanking regions F and F’ (also termed wing regions) comprise a contiguous stretch of modified nucleosides, which are complementary to the PD-L1 target nucleic acid, while the gap region, G, comprises a contiguous stretch of nucleotides which are capable of recruiting a nuclease, preferably an endonuclease such as RNase, for example 20 RNase H, when the oligonucleotide is in duplex with the target nucleic acid. Nucleosides which are capable of recruiting a nuclease, in particular RNase H, can be selected from the group consisting of DNA, alpha-L-oxy-LNA, 2’-Flouro-ANA and UNA. Regions F and F’, flanking the 5’ and 3’ ends of region G, preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3’ endo structure), more preferably one or more affinity enhancing modified nucleosides. 25 In some embodiments, the 3’ flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some embodiments, the 5’ flank comprises at least one LNA nucleoside. In some embodiments both the 5’ and 3’ flanking regions comprise a LNA nucleoside. In some embodiments all the nucleosides in the flanking regions are LNA nucleosides. In other embodiments, the flanking regions may comprise both LNA nucleosides and other nucleosides 30 (mixed flanks), such as DNA nucleosides and / or non-LNA modified nucleosides, such as 2’ substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (nucleosides with a 2’ endo structure, preferably DNA) flanked at the 5’ and 3’ end by an affinity enhancing modified nucleoside, preferably LNA, such as beta-D-oxy-LNA. Consequently, the nucleosides of the 5’ flanking region and the 3’ flanking region 35 which are adjacent to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides. 2024203581   29 May 2024 Region F Region F (5’ flank or 5’ wing) attached to the ‘5 end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. In an embodiment region F comprises or consists of from 1 to 7 modified nucleosides, such as from 2 to 6 modified nucleosides, such as from 2 to 5 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified nucleosides, such as 1,2, 3 or 4 modified nucleosides. The F region is defined by having at least on modified nucleoside at the 5’ end and at the 3’ end of the region. In some embodiments, the modified nucleosides in region F have a 3’ endo structure. In an embodiment, one or more of the modified nucleosides in region F are 2’ modified nucleosides. In one embodiment all the nucleosides in Region F are 2’ modified nucleosides. In another embodiment region F comprises DNA and / or RNA in addition to the 2’ modified nucleosides. Flanks comprising DNA and / or RNA are characterized by having a 2’ modified nucleoside in the 5’ end and the 3’ end (adjacent to the G region) of the F region. In one embodiment the region F comprise DNA nucleosides, such as from 1 to 3 contiguous DNA nucleosides, such as 1 to 3 or 1 to 2 contiguous DNA nucleosides. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. In some embodiments the 2’ modified nucleosides and DNA and / or RNA nucleosides in the F region alternate with 1 to 3 2’ modified nucleosides and 1 to 3 DNA and / or RNA nucleosides. Such flanks can also be termed alternating flanks. The length of the 5’ flank (region F) in oligonucleotides with alternating flanks may be 4 to 10 nucleosides, such as 4 to 8, such as 4 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. In some embodiments only the 5’ flank of the oligonucleotide is alternating. Specific examples of region F with alternating nucleosides are 2’i-3-N’i-4-2’i.3 2’i-2-N’i.2-2’i.2- N’i.2-2’i-2 Where 2’ indicates a modified nucleoside and N’ is a RNA or DNA. In some embodiments all the modified nucleosides in the alternating flanks are LNA and the N’ is DNA.In a further embodiment one or more of the 2’ modified nucleosides in region F are selected from 2’-O-alkyl-RNA units, 2’-O-methyl-RNA, 2’-amino-DNA units, 2’-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2’-fluoro-ANA units. In some embodiments the F region comprises both LNA and a 2’ substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides. In one embodiment of the invention all the modified nucleosides in region F are LNA nucleosides. In a further embodiment all the nucleosides in Region F are LNA nucleosides. In a further embodiment the LNA nucleosides in region F are independently selected from the group 2024203581   29 May 2024 consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and / or ENA, in either the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment region F comprise at least 1 beta-D-oxy LNA unit, at the 5’ end of the contiguous sequence. Region G 5 Region G (gap region) preferably comprise, contain or consist of at least 4, such as at least 5, such as at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 consecutive nucleosides capable of recruiting the aforementioned nuclease, in particular RNaseH. In a further embodiment region G comprise, contain or consist of from 5 to 12, or from 6 to 10 or from 7 to 9, such as 8 consecutive 0 nucleotide units capable of recruiting aforementioned nuclease. The nucleoside units in region G, which are capable of recruiting nuclease are in an embodiment selected from the group consisting of DNA, alpha-L-LNA, C4’ alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chern. Lett. 18 (2008) 22962300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F-15 ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluiter etal., Mol. Biosyst., 2009, 10, 1039 incorporated herein by reference). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked “sugar” residue. In a still further embodiment at least one nucleoside unit in region G is a DNA nucleoside unit, 20 such as from 1 to 18 DNA units, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,12, 13, 14, 15, 16 or 17 DNA units, preferably from 2 to 17 DNA units, such as from 3 to 16 DNA units, such as from 4 to 15 DNA units, such as from 5 to 14 DNA units, such as from 6 to 13 DNA units, such as from 7 to 12 DNA units, such as from 8 to 11 DNA units, more preferably from units 8 to 17 DNA units, or from 9 to 16 DNA units, 10 to 15 DNA units or 11 to 13 DNA units, such as 8, 9, 10, 11, 12, 25   13, 14, 154, 16, 17 DNA units. In some embodiments, region G consists of 100% DNA units. In further embodiments the region G may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage. Region G may consist of at least 50% DNA, more preferably 60 %, 70% or 80 % DNA, and even more preferred 90% or 95% DNA. In a still further embodiment at least one nucleoside unit in region G is an alpha-L-LNA 30 nucleoside unit, such as at least one alpha-L-LNA, such as 2, 3, 4, 5, 6, 7, 8 or 9 alpha-L-LNA. In a further embodiment, region G comprises the least one alpha-L-LNA is alpha-L-oxy-LNA. In a further embodiment region G comprises a combination of DNA and alpha-L-LNA nucleoside units. In some embodiments, nucleosides in region G have a 2’ endo structure. 2024203581   29 May 2024 In some embodiments region G may comprise a gapbreaker nucleoside, leading to a gapbreaker oligonucleotide, which is capable of recruiting RNase H. Region F’ Region F’ (3’ flank or 3’ wing) attached to the ‘3 end of region G comprises, contains or consists 5 of at least one modified nucleoside such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. In an embodiment region F’ comprise or consist of from 1 to 7 modified nucleosides, such as from 2 to 6 modified nucleoside, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified nucleosides, such as 1,2, 3 or 4 modified nucleosides. The F’ region is defined by having at least on modified nucleoside at the 5’ end 0 and at the 3’end of the region. In some embodiments, the modified nucleosides in region F’ have a 3’ endo structure. In an embodiment, one or more of the modified nucleosides in region F’ are 2’ modified nucleosides. In one embodiment all the nucleosides in Region F’ are 2’ modified nucleosides. In an embodiment, one or more of the modified nucleosides in region F’ are 2’ modified 15 nucleosides. In one embodiment all the nucleosides in Region F’ are 2’ modified nucleosides. In another embodiment region F’ comprises DNA or RNA in addition to the 2’ modified nucleosides. Flanks comprising DNA or RNA are characterized by having a 2’ modified nucleoside in the 5’ end (adjacent to the G region) and the 3’ end of the F’ region. In one embodiment the region F’ 20 comprises DNA nucleosides, such as from 1 to 4 contiguous DNA nucleosides, such as 1 to 3 or 1 to 2 contiguous DNA nucleosides. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. In some embodiments the 2’ modified nucleosides and DNA and / or RNA nucleosides in the F’ region alternate with 1 to 3 2’ modified nucleosides and 1 to 3 DNA and / or RNA nucleosides, such flanks can also be termed alternating flanks. The length of the 3’ 25 flank (region F’) in oligonucleotides with alternating flanks may be 4 to 10 nucleosides, such as 4 to 8, such as 4 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. In some embodiments only the 3’ flank of the oligonucleotide is alternating. Specific examples of region F’ with alternating nucleosides are 2’i-2-N’i-4-2’i.4 30    2 i-2_N i-2_2 1-2- N i-2_2 1.2 Where 2’ indicates a modified nucleoside and N’ is a RNA or DNA. In some embodiments all the modified nucleosides in the alternating flanks are LNA and the N’ is DNA.In a further embodiment modified nucleosides in region F’ are selected from 2’-O-alkyl-RNA units, 2’-O-methyl-RNA, 2’-amino-DNA units, 2’-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, LNA units, 35 arabino nucleic acid (ANA) units and 2’-fluoro-ANA units. 2024203581   29 May 2024 In some embodiments the F’ region comprises both LNA and a 2’ substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides. In one embodiment of the invention all the modified nucleosides in region F’ are LNA nucleosides. In a further embodiment all the nucleosides in Region F’ are LNA nucleosides. In a 5 further embodiment the LNA nucleosides in region F’ are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET and / or ENA, in either the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment region F’ has at least 2 beta-D-oxy LNA unit, at the 3’ end of the contiguous sequence. Region D’ and D” 0 Region D’ and D” can be attached to the 5’ end of region F or the 3’ end of region F’, respectively. Region D’ or D” are optional. Region D’ or D” may independently comprise 0 to 5, such as 1 to 5, such as 2 to 4, such as 0, 1,2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. In this respect the oligonucleotide of the invention, may in some 15 embodiments comprise a contiguous nucleotide sequence capable of modulating the target which is flanked at the 5’ and / or 3’ end by additional nucleotides. Such additional nucleotides may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5’ and / or 3’ end nucleosides are linked with phosphodiester linkages, and may be DNA or RNA. In another embodiment, the additional 5’ and / or 3’ end 20 nucleosides are modified nucleosides which may for example be included to enhance nuclease stability or for ease of synthesis. In one embodiment, the oligonucleotide of the invention, comprises a region D’ and / or D” at the 5’ or 3’ end of the contiguous nucleotide sequence. In a further embodiment the D’ and / or D” region is composed of 1 to 5 phosphodiester linked DNA or RNA nucleosides which are not complementary to the target nucleic acid. 25 The gapmer oligonucleotide of the present invention can be represented by the following formulae: 5’-F-G-F’-3’; in particular Fj.y-G^-F’j.y 5’-D’-F-G-F’-3’, in particular D’vs-FvrG^-F’i-y 5’-F-G-F’-D”-3’, in particular Fi.y-G4-i2-F’i-y-D”i.3 30    5’-D’-F-G-F’-D’-3”, in particular D’1.3-F1.7-G4-12-F’i.y-D”1.3 The preferred number and types of nucleosides in regions F, G and F’, D’ and D” have been described above. The oligonucleotide conjugates of the present invention have a region C covalently attached to either the 5’ or 3’ end of the oligonucleotide, in particular the gapmer oligonucleotides presented above. 2024203581   29 May 2024 In one embodiment the oligonucleotide conjugate of the invention comprises a oligonucleotide with the formula 5’-D’-F-G-F’-3’ or 5’-F-G-F’-D”-3’, where region F and F’ independently comprise 1 - 7 modified nucleosides, G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH and region D’ or D” comprise 1 - 5 phosphodiester linked nucleosides. Preferably region D’ or D” is present in the end of the oligonucleotide where conjugation to a conjugate moiety is contemplated. Examples of oligonucleotides with alternating flanks can be represented by the following formulae: 2’i-3-N’i-4-2’-|-3-G6-1 2“2’i -2-N’i-4-2’-| -4 2’i.2-N’1.2-2’1.2-N’1.2-2’1.2-G6-12"2’i-2-N’1.2-2^-2- N’1.2-2’1.2 F-G6-12"2’i-2-N’i.4-2’i.4 F-G6-12"2’i-2-N’1.2-2’1.2-N’1.2-2^-2 2’l-3"N’i.4-2’1.3-G6-12"F’ 2’l-2"N’i.2-2’1.2-N1.2-2’1.2-G6-12"F’ Where a flank is indicated by F or F’ it only contains 2’ modified nucleosides, such as LNA nucleosides. The preferred number and types of nucleosides in the alternating regions, and region F, G and F’, D’ and D” have been described above. In some embodiments the oligonucleotide is a gapmer consisting of 16, 17, 18, 19, 20, 21,22 nucleotides in length, wherein each of regions F and F’ independently consists of 1,2, 3 or 4 modified nucleoside units complementary to the PD-L1 target nucleic acid and region G consists of 8, 9, 10, 11,12,13,14,15,16,17 nucleoside units, capable of recruiting nuclease when in duplex with the PD-L1 target nucleic acid and region D’ consists of 2 phosphodiester linked DNAs. In a further embodiments, the oligonucleotide is a gapmer wherein each of regions F and F’ independently consists of 3, 4, 5 or 6 modified nucleoside units, such as nucleoside units containing a 2’-O-methoxyethyl-ribose sugar (2’-MOE) or nucleoside units containing a 2’-fluoro-deoxyribose sugar and / or LNA units, and region G consists of 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 nucleoside units, such as DNA units or other nuclease recruiting nucleosides such as alpha-L-LNA or a mixture of DNA and nuclease recruiting nucleosides. In a further specific embodiment, the oligonucleotide is a gapmer wherein each of regions F and F’ region consists of two LNA units each, and region G consists of 12, 13, 14 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 2-12-2, 2-13-2 and 2-14-2. In a further specific embodiment, the oligonucleotide is a gapmer wherein each of regions F and F’ independently consists of three LNA units, and region G consists of 8, 9, 10, 11, 12, 13 or 14 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 3-8-3, 39-3 3-10-3, 3-11-3, 3-12-3, 3-13-3 and 3-14-3. 2024203581   29 May 2024 In a further specific embodiment, the oligonucleotide is a gapmer wherein each of regions F and F’ consists of four LNA units each, and region G consists of 8 or 9, 10, 11 or 12 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 4-8-4, 4-9-4, 4-10-4, 4-11-4 and 4-12-4. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 6 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-6-1, 1-6-2, 2-6-1, 1-6-3, 3-6-1, 1-6-4, 4-6-1,2-6-2, 2-6-3, 3-6-2 2-6-4, 4-6-2, 3-6-3, 36-4 and 4-6-3 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 7 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-7-1,2-7-1, 1-7-2, 1-7-3, 3-7-1, 1-7-4, 4-7-1,2-7-2, 2-7-3, 3-7-2, 2-7-4, 4-7-2, 3-7-3, 3-7-4, 4-7-3 and 4-7-4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 8 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-8-1, 1-8-2, 1-8-3, 3-8-1, 1-8-4, 4-8-1,2-8-1,2-8-2, 2-8-3, 3-8-2, 2-8-4, , 4-8-2, 3-8-3, 3-8-4, 4-8-3 and 4-8-4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 9 nucleosides and independently 1 to 4 modified nucleosides in the wings including, 1-9-1,2-9-1, 1-9-2, 1-9-3, 3-9-1, 1-9-4, 4-9-1,2-9-2, 2-9-3, 3-9-2, 2-9-4, 4-9-2, 3-9-3, 3-9-4, 4-9-3 and 4-9-4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 10 nucleosides including, 1 -10-1,2-10-1, 1 -10-2, 1 -10-3, 3-10-1, 1 -10-4, 4-10-1,210-2, 2-10-3, 3-10-2, 2-10-4, 4-10-2, 3-10-3, 3-10-4, 4-10-3 and 4-10-4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 11 nucleosides including, 1-11-1,2-11-1, 1-11-2, 1-11 -3, 3-11 -1, 1-11 -4, 4-11-1,211-2,2-11 -3, 3-11 -2, 2-11 -4, 4-11 -2, 3-11 -3, 3-11 -4, 4-11-3 and 4-11 -4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 12 nucleosides including, 1 -12-1,2-12-1, 1 -12-2, 1 -12-3, 3-12-1, 1 -12-4, 4-12-1,212-2, 2-12-3, 3-12-2, 2-12-4, 4-12-2, 3-12-3, 3-12-4, 4-12-3 and 4-12-4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 13 nucleosides including, 1 -13-1,2-13-1, 1 -13-2, 1 -13-3, 3-13-1, 1 -13-4, 4-13-1,213-2, 2-13-3, 3-13-2, 2-13-4, 4-13-2, 3-13-3, 3-13-4, 4-13-3 and 4-13-4 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of agap with 14 nucleosides including, 1-14-1,2-14-1, 1-14-2, 1-14-3, 3-14-1, 1-14-4, 4-14-1,214-2, 2-14-3, 3-14-2, 2-14-4, 4-14-2, 3-14-3, 3-14-4, 4-14-3 and 4-14-4 gapmers. 2024203581   29 May 2024 Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 15 nucleosides including, 1 -15-1,2-15-1, 1 -15-2, 1 -15-3, 3-15-1, 1 -15-4, 4-15-1,215-2, 2-15-3, 3-15-2, 2-15-4, 4-15-2 and 3-15-3 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting 5 of a gap with 16 nucleosides including, 1 -16-1,2-16-1, 1 -16-2, 1 -16-3, 3-16-1, 1 -16-4, 4-16-1,216-2, 2-16-3, 3-16-2, 2-16-4, 4-16-2 and 3-16-3 gapmers. Specific gapmer designs of this nature include F-G-F’ designs selected from a group consisting of a gap with 17 nucleosides including, 1 -17-1,2-17-1, 1 -17-2, 1 -17-3, 3-17-1, 1 -17-4, 4-17-1,217-2, 2-17-3 and 3-17-2 gapmers. 0 In all instances the F-G-F’ design may further include region D’ and / or D”, which may have 1,2 or 3 nucleoside units, such as DNA units, such as 2 phosphodiester linked DNA units. Preferably, the nucleosides in region F and F’ are modified nucleosides, while nucleotides in region G are preferably unmodified nucleosides. In each design, the preferred modified nucleoside is LNA. 15 In another embodiment all the internucleoside linkages in the gap in a gapmer are phosphorothioate and / or boranophosphate linkages. In another embodiment all the internucleoside linkages in the flanks (F and F’ region) in a gapmer are phosphorothioate and / or boranophosphate linkages. In another preferred embodiment all the internucleoside linkages in the D’ and D” region in a gapmer are phosphodiester linkages. 20 For specific gapmers as disclosed herein, when the cytosine (C) residues are annotated as 5-methyl-cytosine, in various embodiments, one or more of the Cs present in the oligonucleotide may be unmodified C residues. In a particular embodiment, the gapmer is a so-called shortmer as described in WO2008 / 113832 incorporated herein by reference. 25 Further gapmer designs are disclosed in WO2004 / 046160, WO2007 / 146511 and incorporated by reference. For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 5_1 to 743_1 and 7711. For certain embodiments of the invention, the oligonucleotide is selected from the group of 30 oligonucleotide compounds with CMP-ID-NO 6_1, 8_1, 9_1, 13_1,41 1,42 1,58_1,771, 921, 111_1, 1281, 151 _1, 164 1, 166_1, 169_1, 171_1,222_1,233_1,245_1,246_1, 250 1,251_1, 252 1,256_1,272_1,273_1,287_1,292_1,303_1,314_1,318_1,320_1, 324 1,336 1,342 1,343_1,344_1,345_1,346_1,349_1,359_1,360_1,374_1,408_1, 409 1,415_1,417_1,424 1,429_1,430_1,458_1,464_1,466_1,474_1,490_1,493_1, 2024203581   29 May 2024 512_1,519_1, 519_1, 529 1,533_1,534_1,547_1,566_1,567_1,578_1,582_1,601 _1, 619_1,620 1,636 1,637_1,638_1,640_1,645_1,650_1,651 _1, 652_1,653_1,658_1, 659 1,660 1,665 1,678_1,679_1,680_1,682_1,683_1,684_1,687_1,694_1,706_1, 716_1,728 1,733 1,734_1, and 735_1. 5 In one preferred embodiment of the invention, the oligonucleotide is CMP-ID-NO: 287 1. In another preferred embodiment of the invention, the oligonucleotide is CMP-ID-NO: 342 1. In another preferred embodiment of the invention, the oligonucleotide is CMP-ID-NO: 640_1. In another preferred embodiment of the invention, the oligonucleotide is CMP-ID-NO: 466_1. In another preferred embodiment of the invention, the oligonucleotide is CMP-ID-NO: 566_1. 0 Ina further embodiment of the invention the contiguous nucleotide sequence of the oligonucleotide motifs and oligonucleotide compounds of the invention comprise two to four additional phosphodiester linked nucleosides at the 5’ end of the contiguous nucleotide sequence (e.g. region D’). In one embodiment the nucleosides serve as a biocleavable linker (see sectionon biocleavable linkers). In a preferred embodiment a ca (cytidine-adenosine) 15 dinucleotide is linked to the 5’ end of contiguous nucleotide sequence (i.e. any one of the motif sequences or oligonucleotide compounds listed in table 5) via a phosphodiester linkage. In a preferred emboduiment the ca di nucleotide is not complementary to the target sequence at the position where the reminder of the contigious nucleotide is complementary. In some embodiments of the invention the oligonucleotide or contiguous nucleotide sequence is 20 selected from the group consisting of the nucleotide motif sequences with SEQ ID NO: 766, 767, 768, 769 and 770. In some embodiments of the invention the oligonucleotide is selected from the group consisting of the oligonucleotide compounds with CMP-ID-NO 766_1,767 1,768_1,769_1 and 770_1. Carbohydrate conjugate moieties 25 Carbohydrate conjugate moieties include but are not limited to galactose, lactose, n-acetylgalactosamine, mannose and mannose-6-phosphate. Carbohydrate conjugates may be used to enhance delivery or activity in a range of tissues, such as liver and / or muscle. See, for example, EP1495769, WO99 / 65925, Yang et al., Bioconjug Chern (2009) 20(2): 213-21. Zatsepin & Oretskaya Chern Biodivers. (2004) 1(10): 1401-17. 30 In some embodiments the carbohydrate conjugate moiety is multivalent, such as, for example 2, 3 or 4 identical or non-identical carbohydrate moieties may be covalently joined to the oligonucleotide, optionally via a linker or linkers. In some embodiments the invention provides a conjugate comprising the oligonucleotide of the invention and a carbohydrate conjugate moiety. 2024203581   29 May 2024 In some embodiments, the conjugate moiety is or may comprise mannose or mannose-6-phosphate. This is particular useful for targeting muscle cells, see for example US 2012 / 122801. Conjugate moieties capable of binding to the asialoglycoprotein receptor (ASGPr) are particular 5 useful for targeting hepatocytes in liver. In some embodiments the invention provides a oligonucleotide conjugate comprising the oligonucleotide of the invention and an asialoglycoprotein receptor targeting conjugate moiety. The asialoglycoprotein receptor targeting conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGr binding carbohydrate moieties) with affinity equal to or 0 greater than that of galactose. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S.T. and Drickamer, K. JB.C. 1996, 271,6686) or are readily determined using methods typical in the art. One aspect of the present invention is an antisense oligonucleotide conjugate comprising a) an oligonucleotide (Region A) comprising a contiguous nucleotide sequence of 10 to 30 15 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid; and b) at least one asialoglycoprotein receptor targeting conjugate moiety (Region C) covalently attached to the oligonucleotide in a). The oligonucleotide or a contiguous nucleotide sequence can be as described in any of the sections “oligonucleotides of the invention”, “oligonucleotide design and “gapmer design”. 20 In some embodiments asialoglycoprotein receptor targeting conjugate moiety comprises at least one ASPGr binding carbohydrate moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. In some embodiments, the asialoglycoprotein receptor targeting conjugate moiety is mono-valent, di-valent, tri-valent or 25 tetra-valent (i.e. containing 1,2, 3 or 4 terminal carbohydrate moieties capable of binding to the asialoglycoprotein receptor). Preferably, the asialoglycoprotein receptor targeting conjugate moiety is di-valent, even more preferred it is trivalent. In a preferred embodiment the asialoglycoprotein receptor targeting conjugate moiety comprises 1 to 3 N-acetylgalactosamine (GalNAc) moieties (also termed a GalNAc conjugate). In some embodiments the oligonucleotide 30 conjugate comprises a asialoglycoprotein receptor targeting conjugate moiety that is a tri-valent N-acetylgalactosamine (GalNAc) moiety. GalNAc conjugates have been used with phosphodiester, methylphosphonate and PNA antisense oligonucleotides (e.g. US 5,994517 and Hangeland etal., Bioconjug Chern. 1995 Nov-Dec;6(6):695-701, Biessen et al 1999 Biochem J. 340, 783-792 and Maier et al 2003 Bioconjug Chern 14, 18-29 ) and siRNAs (e.g. 35 WO 2009 / 126933, WO 2012 / 089352 & WO 2012 / 083046) and with LNA and 2'-MOE modified nucleosides WO 2014 / 076196 WO 2014 / 207232 and WO 2014 / 179620 (hereby incorporated by reference). 2024203581   29 May 2024 To generate the asialoglycoprotein receptor targeting conjugate moiety the ASPGr binding carbohydrate moieties (preferably GalNAc) are attached to a brancher molecule through the C-l carbons of the saccharides. The ASPGr binding carbohydrate moieties are preferably linked to the brancher molecule via spacers. A preferred spacer is a flexible hydrophilic spacer (U.S. 5 Patent 5885968; Biessen et al. J. Med. Chern. 1995 Vol. 39 p. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer (three ethylene units). The brancher molecule can be any small molecule which permits attachment of two or three terminal ASPGr binding carbohydrate moieties and further permits attachment of the branch point to the oligonucleotide. An exemplary brancher molecule is a di-lysine. A di-lysine 0 molecule contains three amine groups through which three ASPGr binding carbohydrate moieties may be attached and a carboxyl reactive group through which the di-lysine may be attached to the oligonucleotide. Alternative brancher molecules may be a doubler or trebler such as those supplied by Glen Research. In some embodiments the brancher may be selected from the from the group consisting of 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2- 15 [(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite (Glen Research Catalogue Number: 10-1920-xx), tris-2,2,2-(3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1922-xx), tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 1-[5-(4,4'-dimethoxy-trityloxy)pentylamido]-3-[5-fluorenomethoxy-carbonyl- 20 oxy-pentylamido]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1925-xx). WO 2014 / 179620 and PCT application No. PCT / EP2015 / 073331 describes the generation of various GalNAc conjugate moieties (hereby incorporated by reference). One or more linkers may be inserted between the brancher molecule and the oligonucleotide. In a preferred embodiment the linker is a biocleavable linker. 25 The linker may be selected from the linkers described in the section “Linkers” and its subsections. The asialoglycoprotein receptor targeting conjugate moiety, in particular the GalNAc conjugate moiety, may be attached to the 3'- or 5'-end of the oligonucleotide using methods known in the art. In preferred embodiments the asialoglycoprotein receptor targeting conjugate moiety is 30 linked to the 5’-end of the oligonucleotide. Pharmacokinetic modulators in relation to siRNAs delivery has been described in WO 2012 / 083046 (hereby incorporated by reference). In some embodiments the carbohydrate conjugate moiety comprises a pharmacokinetic modulator selected from the group consisting of a hydrophobic group having 16 or more carbon atoms, hydrophobic group having 16-20 carbon 35 atoms, palmitoyl, hexadec-8-enoyl, oleyl, (9E,12E)-octadeca-9,12dienoyl, dioctanoyl, and C16- C20 acyl, and cholesterol. In a preferred embodiment the pharmacokinetic modulator containing carbohydrate conjugate moiety is a GalNAc conjugate. 2024203581   29 May 2024 Preferred carbohydrate conjugate moieties comprises one to three terminal ASPGr binding carbohydrate moieties, preferably N-acetylgalactosamine moiety(s). In some embodiments the carbohydrate conjugate moiety comprises three ASPGr binding carbohydrate moieties, preferably N-acetylgalactosamine moieties, linked via a spacer to a brancher molecule. The spacer molecule can be between 8 and 30 atoms long. A preferred carbohydrate conjugate moiety comprises three terminal GalNAc moieties linked via a PEG spacer to a di-lysine brancher molecule. Preferably the PEG spacer is a 3PEG spacer. Suitable asialoglycoprotein receptor targeting conjugate moieties are shown in Figure 1. A preferred asialoglycoprotein receptor targeting conjugate moiety is shown in figure 3. Other GalNAc conjugate moieties can include, for example, small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor). In some embodiments of the invention the antisense oligonucleotide conjugate is selected from the group consisting of the following CPM ID NO: 766_2, 767 2, 768_2, 769_2 and 770_2. In a preferred embodiment the antisense oligonucleotide conjugate corresponds to the compound represented in figure 4. In another preferred embodiment the antisense oligonucleotide conjugate corresponds to the compound represented in figure 5. In another preferred embodiment the antisense oligonucleotide conjugate corresponds to the compound represented in figure 6. In another preferred embodiment the antisense oligonucleotide conjugate corresponds to the compound represented in figure 7. In another preferred embodiment the antisense oligonucleotide conjugate corresponds to the compound represented in figure 8. Linkers Biocleavable linkers (Region B) The use of a conjugate is often associated with enhanced pharmacokinetic or pharmeodynamic dynamic properties. However, the presence of a conjugate moiety may interfere with the activity of the oligonucleotide against its intended target, for example via steric hindrance preventing hybridization or nuclease recruitment (e.g. RNAseH). The use of a physiologically labile bond (biocleavable linker) between the oligonucleotide (region A or first region) and the conjugate moiety (region C or third region), allows for the improved properties due to the presence of the 48 2024203581   29 May 2024 conjugate moiety, whilst ensuring that once at the target tissue, the conjugate group does not prevent effective activity of the oligonucleotide. Cleavage of the physiologically labile bond occurs spontaneously when a molecule containing the labile bond reaches an appropriate intra-and / or extra-cellular environment. For example, a pH labile bond may be cleaved when the molecule enters an acidified endosome. Thus, a pH labile bond may be considered to be an endosomal cleavable bond. Enzyme cleavable bonds may be cleaved when exposed to enzymes such as those present in an endosome or lysosome or in the cytoplasm. A disulfide bond may be cleaved when the molecule enters the more reducing environment of the cell cytoplasm. Thus, a disulfide may be considered to be a cytoplasmic cleavable bond. As used herein, a pH-labile bond is a labile bond that is selectively broken under acidic conditions (pH<7). Such bonds may also be termed endosomally labile bonds, since cell endosomes and lysosomes have a pH less than 7. For biocleavable linkers associated with a conjugate moiety for targeted delivery it is preferred that, the cleavage rate seen in the target tissue (for example muscle, liver, kidney or a tumor) is greater than that found in blood serum. Suitable methods for determining the level (%) of cleavage in target tissue versus serum or cleavage by S1 nuclease are described in the “Materials and methods” section. In some embodiments, the biocleavable linker (also referred to as the physiologically labile linker, or nuclease susceptible linker or region B), in a conjugate of the invention, is at least about 20% cleaved, such as at least about 30% cleaved, such as at least about 40% cleaved, such as at least about 50% cleaved, such as at least about 60% cleaved, such as at least about 70% cleaved, such as at least about 75% cleaved when compared against a standard. In some embodiments, the oligonucleotide conjugate of the invention comprises three regions: i) a first region (region A), which comprises 10-25 contiguous nucleotides complementary to the target nucleic acid; ii) a second region (region B) which comprises a biocleavable linker and iii) a third region (region C) which comprises a conjugate moiety, such as an asialoglycoprotein receptor targeting conjugate moiety, wherein the third region is covalent linked to the second region which is covalently linked to the first region. In one embodiment of the present invention the oligonucleotide conjugate comprises a biocleavable linker (Region B) between the contiguous nucleotide sequence (region A) and the asialoglycoprotein receptor targeting conjugate moiety (region C). In some embodiments, the biocleavable linker may be situated either at the 5’ end and / or the 3’-end of the contiguous nucleotides complementary to the target nucleic acid (region A). In a preferred embodiment the biocleavable linker is at the 5’-end. In some embodiments, the cleavable linker is susceptible to nuclease(s) which may for example, be expressed in the target cell. In some embodiments the biocleavable linker is 49 2024203581   29 May 2024 composed of 2 to 5 consecutive phosphodiester linkages. The linker may be a short region (e.g. 1 - 10 as detailed in the definition of linkers) phosphodiester linked nucleosides. In some embodiments, the nucleosides in the biocleavable linker region B is (optionally independently) selected from the group consisting of DNA and RNA or modifications thereof which do not interfere with nuclease cleavage. Modifications of DNA and RNA nucleosides which do not interfere with nuclease cleavage may be non-naturally occurring nucleobases. Certain sugar-modified nucleosides may also allow nuclease cleavage such as an alpha-L-oxy-LNA. In some embodiments, all the nucleosides of region B comprise (optionally independently) either a 2’-OH ribose sugar (RNA) or a 2’-H sugar - i.e. RNA or DNA. In a preferred embodiment, at least two consecutive nucleosides of region B are DNA or RNA nucleosides (such as at least 3 or 4 or 5 consecutive DNA or RNA nucleosides). In an even more preferred embodiment, the nucleosides of region B are DNA nucleosides Preferably region B consists of between 1 to 5, or 1 to 4, such as 2, 3, 4 consecutive phosphodiester linked DNA nucleosides. In preferred embodiments region B is so short that it does not recruit RNAseH. In some embodiments, region B comprises no more than 3 or no more than 4 consecutive phospodiester linked DNA and / or RNA nucleosides (such as DNA nucleosides). Where region B is composed of phosphodiester linked nucleosides, region A and B may together form the oligonucleotide that is linked to region C. In this context region A can be differentiated from region B in that Region A starts with at least one, preferably at least two, modified nucleosides with increased binding affinity to the target nucleic acid (e.g. LNA or nucleosides with a 2’ substituted sugar moiety) and region A on its own is capable of modulation of the expression the target nucleic acid in a relevant cell line. Furthermore, if region A comprises DNA or RNA nucleosides these are linked with nuclease resistant internucleoside linkage, such phosphorothioate or boranophosphate. Region B on the other hand comprises phophodiester linkages between DNA or RNA nucleosides. In some embodiments region B is not complementary to or comprises at least 50% mismatches to the target nucleic acid. In some embodiments, region B is not complementary to the target nucleic acid sequence or to the contiguous nucleotides complementary to the target nucleic acid in region A. In some embodiments, region B is complementary with the target nucleic acid sequence. In this respect region A and B together may form a single contiguous sequence which is complementary to the target sequence. In some aspects of the invention the internucleoside linkage between the first (region A) and the second region (region B) may be considered part of the second region. In some embodiments, the sequence of bases in region B is selected to provide an optimal endonuclease cleavage site, based upon the predominant endonuclease cleavage enzymes present in the target tissue or cell or sub-cellular compartment. In this respect, by isolating cell 2024203581   29 May 2024 extracts from target tissues and non-target tissues, endonuclease cleavage sequences for use in region B may be selected based upon a preferential cleavage activity in the desired target cell (e.g. liver / hepatocytes) as compared to a non-target cell (e.g. kidney). In this respect, the potency of the compound for target down-regulation may be optimized for the desired tissue / cell. In some embodiments region B comprises a dinucleotide of sequence AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein C may be 5-methylcytosine, and / or T may be replaced with U. Preferably, the internucleoside linkage is a phosphodiester linkage. In some embodiments region B comprises a trinucleotide of sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAG, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, and GGG wherein C may be 5-methylcytosine and / or T may be replaced with U. Preferably, the internucleoside linkages are phosphodiester linkages. In some embodiments region B comprises a trinucleotide of sequence AAAX, AATX, AACX, AAGX, AT AX, ATTX, ATCX, ATGX, ACAX, ACTX, ACCX, ACGX, AGAX, AGTX, AGCX, AGGX, TAAX, TATX, TACX, TAGX, TTAX, TTTX, TTCX, TAGX, TCAX, TCTX, TCCX, TCGX, TGAX, TGTX, TGCX, TGGX, CAAX, CATX, CACX, CAGX, CTAX, CTGX, CTCX, CTTX, CCAX, CCTX, CCCX, CCGX, CGAX, CGTX, CGCX, CGGX, GAAX, GATX, GACX, CAGX, GTAX, GTTX, GTCX, GTGX, GCAX, GCTX, GCCX, GCGX, GGAX, GGTX, GGCX, and GGGX, wherein X may be selected from the group consisting of A, T, U, G, C and analogues thereof, wherein C may be 5-methylcytosine and / or T may be replaced with U. Preferably, the internucleoside linkages are phosphodiester linkages. It will be recognized that when referring to (naturally occurring) nucleobases A, T, U, G, C, these may be substituted with nucleobase analogues which function as the equivalent natural nucleobase (e.g. base pair with the complementary nucleoside). Other linkers (Region Y) The linker can have at least two functionalities, one for attaching to the oligonucleotide and the other for attaching to the conjugate moiety. Example linker functionalities can be electrophilic for reacting with nucleophilic groups on the oligonucleotide or conjugate moiety, or nucleophilic for reacting with electrophilic groups. In some embodiments, linker functionalities include amino, hydroxyl, carboxylic acid, thiol, phosphoramidate, phosphorothioate, phosphate, phosphite, unsaturations (e.g., double or triple bonds), and the like. Some example linkers (region Y) include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate (SMCC), 6- aminohexanoic acid (AHEX or AHA), 6-aminohexyloxy, 4-aminobutyric acid, 4- aminocyclohexylcarboxylic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane- l-carboxy-(6-amido-caproate) (LCSMCC), succinimidyl m- 2024203581   29 May 2024 maleimido-benzoylate (MBS), succinimidyl N-e-maleimido-caproylate (EMCS), succinimidyl 6-(beta - maleimido-propionamido) hexanoate (SMPH), succinimidyl N-(a-maleimido acetate) (AMAS), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB), beta -alanine (beta -ALA), phenylglycine (PHG), 4-aminocyclohexanoic acid (ACHC), beta -(cyclopropyl) alanine (beta -CYPR), amino dodecanoic acid (ADC), alylene diols, polyethylene glycols, amino acids, and the like. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group. The amino alkyl group may be added to the oligonucleotide (region A or region A-B) as part of standard oligonucleotide synthesis, for example using a (e.g. protected) amino alkyl phosphoramidite. The linkage group between the amino alkyl and the oligonucleotide may for example be a phosphorothioate or a phosphodiester, or one of the other nucleoside linkage groups referred to herein. The amino alkyl group is covalently linked to the 5’ or 3’-end of the oligonucleotide. Commercially available amino alkyl linkers are for example 3'-Amino-Modifier reagent for linkage at the 3’-end of the oligonucleotide and for linkage at the 5 '-end of an oligonucleotide 5'- Amino-Modifier C6 is available. These reagents are available from Glen Research Corporation (Sterling, Va.). These compounds or similar ones were utilized by Krieg, et al, Antisense Research and Development 1991, 1, 161 to link fluorescein to the 5'- terminus of an oligonucleotide. A wide variety of further linker groups are known in the art and can be useful in the attachment of conjugate moieties to oligonucleotides. A review of many of the useful linker groups can be found in, for example, Antisense Research and Applications, S. T. Crooke and B. Lebleu, Eds., CRC Press, Boca Raton, Fla., 1993, p. 303-350. Other compounds such as acridine have been attached to the 3 terminal phosphate group of an oligonucleotide via a polymethylene linkage (Asseline, et al., Proc. Natl. Acad. Sci. USA 1984, 81,3297). Any of the above groups can be used as a single linker (region Y) or in combination with one or more further linkers (region Y-Y’or region Y-B or B-Y). Linkers and their use in preparation of conjugates of oligonucleotides are provided throughout the art such as in WO 96 / 11205 and WO 98 / 52614 and U.S. Pat. Nos. 4,948,882; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,580,731; 5,486,603; 5,608,046; 4,587,044; 4,667,025; 5,254,469; 5,245,022; 5,112,963; 5,391,723; 5,510475; 5,512,667; 5,574,142; 5,684,142; 5,770,716; 6,096,875; 6,335,432; and 6,335,437,WO 2012 / 083046 each of which is incorporated by reference in its entirety. Method of manufacture In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 28752 2024203581   29 May 2024 313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand). In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, 5 carrier, salt and / or adjuvant. Pharmaceutical Composition In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent 0 includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 -300pM solution. 15 Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, 20 administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007 / 031091. Oligonucleotides or oligonucleotide conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical 25 compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. 30 The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible 35 quantity, such as in a squeezable tube designed for a topically applicable cream or ointment. 2024203581   29 May 2024 In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular with respect to oligonucleotide conjugates the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell. Applications 5 The oligonucleotides or oligonucleotide conjugates of the present invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis. In research, such oligonucleotides or oligonucleotide conjugates may be used to specifically modulate the synthesis of PD-L1 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a 0 target for therapeutic intervention. Typically the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein. If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA. 15 The present invention provides an in vivo or in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering an oligonucleotide or oligonucleotide conjugate of the invention in an effective amount to said cell. In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In 20 preferred embodiments the target cell is present in the liver. Liver target cell can be selected from parenchymal cells (e.g. hepatocytes) and non-parenchymal cells such as Kupffer cells, LSECs, stellate cells (or Ito cells), cholangiocytes and liver-associated leukocytes (including T cells and NK cells). In some embodiments the target cell is an antigen-presenting cell. Antigenpresenting cells displays foreign antigens complexed with major histocompatibility complex 25 (MHC) class I or class II on their surfaces. In some embodiments the antigen-presenting cell expresses MHC class II (i.e. professional antigen-presenting cells such as dendritic cells, macrophages and B cells). In diagnostics the oligonucleotides may be used to detect and quantitate PD-L1 expression in cell and tissues by northern blotting, in-situ hybridisation or similar techniques. 30 For therapeutics oligonucleotides or oligonucleotide conjugates of the present invention or pharmaceutical compositions thereof may be administered to an animal or a human, suspected of having a disease or disorder, which can be alleviated or treated by reduction of the expression of PD-L1, in particular by reduction of the expression of PD-L1 in liver target cells. The invention provides methods for treating or preventing a disease, comprising administering a 35 therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide 2024203581   29 May 2024 conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease. The invention also relates to an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention for use as a medicament. 5 The oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate or pharmaceutical composition of the invention as described for the manufacture of a medicament for the treatment of a disease or disorder as referred to herein. In one embodiment the disease 0 is selected from a) viral liver infections such as HBV, HCV and HDV; b) parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis and c) liver cancer or metastases in the liver. In one embodiment, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from 15 viral or parasitic infections. In a further embodiment the disease is selected from a) viral liver infections such as HBV, HCV and HDV; b) parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis and c) liver cancer or metastases in the liver. The disease or disorder, as referred to herein, is associated with immune exhaustion. In particular the disease or disorder is associated with exhaustion of virus-specific T-cell 20 responses. In some embodiments disease or disorder may be alleviated or treated by reduction of PD-L1 expression. The methods of the invention are preferably employed for treatment or prophylaxis against diseases associated with immune exhaustion. In one embodiment of the invention the oligonucleotide, oligonucleotide conjugate or 25 pharmaceutical compositions of the invention are used in restoration of immune response against a liver cancer or metastases in the liver. In one embodiment of the invention the oligonucleotide, oligonucleotide conjugate or pharmaceutical compositions of the invention are used in restoration of immune response against a pathogen. In some embodiments the pathogen can be found in the liver. The 30 pathogens can be a virus or a parasite, in particular those described herein. In a preferred embodiment the pathogen is HBV. The invention further relates to use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the restoration of immunity against a viral or parasite infection as mentioned herein. 2024203581   29 May 2024 Oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention can be used in the treatment of viral infections, in particular viral infections in the liver where the PD-1 patheway is affected (see for example Kapoor and Kottilil 2014 Future Virol Vol. 9 pp. 565-585 and Salem and El-Badawy 2015 World J Hepatol Vol. 7 pp. 2449-2458). Viral 5 liver infections can be selected from the group consisting of hepatitis viruses, in particular HBV, HCV and HDV, in particular chronic forms of these infections. In one embodiment the oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention are used to treat HBV, in particular chronic HBV. Indicators of chronic HBV infections are high levels of viral load (HBV DNA) and even higher levels of empty HBsAg particles (>100- 0 fold in excess of virions) in the circulation. Oligonucleotides or oligonucleotide conjugates of the present invention can also be used to treat viral liver infections that occur as co-infections with HIV. Other viral infections which can be treated with the oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention are Icmv (Lymphocytic Choriomeningitis Virus), and HIV as a mono 15 infection, HSV-1 and -2, and other herpesviruses. These viruses are not hepatotrophic, however they may be sensitive to PDL1 down regulation. In some embodiments the restoration of immunity or immune response involves improvement of the T-cell and / or NK cell response and / or alleviation of the T-cell exhaustion, in particular the HBV-specific T-cell response, the HCV-specific T-cell response and or the HDV-specific T-cell 20 response is restored. An improvement of the T cell response can for example be assessed as an increase in T cells in the liver, in particular an increase in CD8+ and / or CD4+ T cells when compared to a control (e.g. the level prior to treatment or the level in a vehicle treated subject) In a further embodiment it is the virus specific CD8+ T cells that are restored or increased when compared to cotrol), in particular HBV specific CD8+ T cells or HCV specific CD8+ T cells or 25 HDV specific CD8+ T cells are restored or increased when compared to control. In a preferred embodiment CD8+ T cells specific for HBV s antigen (HBsAg) and / or CD8+ T cells specific for HBV e antigen (HBeAg) and / or CD8+ T cells specific for HBV core antigen (HBcAg) are increased in subjects treated with an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention compared to control. Preferably the HBV 30 antigen specific CD8+ T cells produce one or more cytokines, such as interferon-gamma (IFN-y) or tumor necrosis factor alpha (TNF-o). The increase in CD8+ T cells described above is in particular observed in the liver. The increase described herein should be statistically significant when compared to a control. Preferably the increase is at least 20%, such as 25%, such as 50% such as 75% when compared to control. In another embodiment natural killer (NK) cells 35 and / or natural killer T (NKT) cells are activated by the oligonucleotides or oligonucleotide conjugates of the present invention. 2024203581   29 May 2024 Oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention can be used in the treatment parasite infections, in particular parasite infections where the PD-1 pathway is affected (see for example Bhadra et al. 2012 J Infect Dis vol 206 pp. 125134; Bhadra et al. 2011 Proc Natl Acad Sci U S A Vol. 108 pp. 9196-9201; Esch et al. J 5 Immunol vol 191 pp 5542-5550; Freeman and Sharpe 2012 Nat Immunol Vol 13 pp. 113-115; Gutierrez et al. 2011 Infect Immun Vol 79 pp. 1873-1881; Joshi et al. 2009 PLoS Pathog Vol 5 e1000431; Liang et al. 2006 Eur J Immunol Vol. 36 pp 58-64; Wykes et al. 2014 Front Microbiol Vol 5 pp 249). Parasite infections can be selected from the group consisting of malaria, toxoplasmosis, leishmaniasis and trypanosomiasis. Malaria infection is caused by protozoa of 0 the genus Plasmodium, in particular of the species P. vivax, P. malariae and P. falciparum. Toxoplasmosis is a parasitic disease caused by Toxoplasma gondii. Leishmaniasis is a disease caused by protozoan parasites of the genus Leishmania. Trypanosomiasis is caused by the protozoan of the genus Trypanosoma. Chaga disease which is the tropical form caused by the species Trypanosoma cruzi, and sleeping disease is caused by the species Trypanosoma 15 brucei. In some embodiments the restoration of immunity involves restoration of a parasite-specific T cell and NK cell response, in particular a Plasmodium-specific T-cell response, a Toxoplasma gondii-specific T-cell and NK cell response, a Leishmania-specific T-cell and NK cell response, a Trypanosoma cruzi-specific T-cell and NK cell response or a Trypanosoma brucei-specific T-20 cell and NK cell response. In a further embodiment it is the parasite-specific CD8+ T cell and NK cell response that is restored. Administration The oligonucleotides or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, 25 orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal). In a preferred embodiment the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, 30 e.g. intracerebral or intraventricular, intravitreal administration. In one embodiment the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously. In some embodiments, the oligonucleotide, oligonucleotide conjugate or pharmaceutical 35 composition of the invention is administered at a dose of 0.1 - 15 mg / kg, such as from 0.1 - 10 mg / kg, such as from 0.2-10 mg / kg, such as from 0.25 - 10 mg / kg, such as from 0.1-5 2024203581   29 May 2024 mg / kg, such as from 0.2 - 5 mg / kg, such as from 0.25 - 5 mg / kg. The administration can be once a week, every 2nd week, every third week or even once a month. Combination therapies In some embodiments the oligonucleotide, oligonucleotide conjugate or pharmaceutical 5 composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above. For the treatment of chronic HBV infections a combination of antiviral drugs and immune system modulators is recommended as standard of care. The antiviral drugs effective against HBV are 0 for example nucleos(t)ide analogs. There are five nucleos(t)ide analogs licensed for therapy of HBV namely lamivudine (Epivir), adefovir (Hepsera), tenofovir (Viread), telbivudine (Tyzeka), entecavir (Baraclude) these are effective in suppressing viral replication (HBV DNA) but have no effect on HBsAg levels. Other antiviral drugs include ribavirin and an HBV antibody therapy (monoclonal or polyclonal). The immune system modulators can for example be interferon 15 alpha-2a and PEGylated interferon alpha-2a (Pegasys) or TLR7 agonists (e.g. GS-9620) or therapeutic vaccines. IFN-o treatment show only very modest effect in reducing viral load, but result in some HBsAg decline, albeit very inefficiently (<10% after 48 week therapy). The oligonucleotide or oligonucleotide conjugates of the present invention may also be combined with other antiviral drugs effective against HBV such as the antisense 20 oligonucleotides described in WO2012 / 145697 and WO 2014 / 179629 or the siRNA molecules described in WO 2005 / 014806, WO 2012 / 024170, WO 2012 / 2055362, WO 2013 / 003520 and WO 2013 / 159109. When the oligonucleotides or oligonucleotide conjugates of this invention are administered in combination therapies with other agents, they may be administered sequentially or concurrently 25 to an individual. Alternatively, pharmaceutical compositions according to the present invention may be comprised of a combination of an oligonucleotide or oligonucleotide conjugate of the present invention in association with a pharmaceutically acceptable excipient, as described herein, and another therapeutic or prophylactic agent known in the art. EMBODIMENTS 30 The following embodiments of the present invention may be used in combination with any other embodiments described herein. 1.An antisense oligonucleotide which comprises or consists of a contiguous nucleotide sequence of 10 to 30 nucleotides in length capable of reducing the expression of PD-L1. 2024203581   29 May 2024 2. The oligonucleotide of embodiment 1, wherein the contiguous nucleotide sequence is at least 90% complementarity to a PD-L1 target nucleic acid. 3. The oligonucleotide of embodiment 1 or 2, wherein the contiguous nucleotide sequence is complementary to a target nucleic acid selected from the group consisting of SEQ ID NO: 1, 5 SEQ ID NO: 2 and / or SEQ ID NO: 3. 4. The oligonucleotide of embodiment 1 to 3, wherein the contiguous nucleotide sequence is complementary to a region within position 1 and 15720 on SEQ ID NO: 1. 5. The oligonucleotide of embodiment 1 to 4, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid of selected from the group consisting of SEQ ID NO: 1, SEQ 0 ID NO: 2 and / or SEQ ID NO: 3 with a AG° below -10 kcal. 6. The oligonucleotide of embodiment 1 to 5, wherein the contiguous nucleotide sequence is complementary to a sub-sequence of the target nucleic acid, wherein the sub-sequence is selected from the group consisting of position 371-3068, 5467-12107, 15317-15720, 1531718083, 15317-19511 and 18881-19494 on SEQ ID NO: 1. 15   7. The oligonucleotide of embodiment 6, wherein the sub-sequence is selected from the group consisting of position 7300-7333, 8028-8072, 9812-9859, 11787-11873 and 15690-15735 on SEQ ID NO: 1. 8. The oligonucleotide of embodiment 2 to 7, wherein the target nucleic acid is RNA. 9. The oligonucleotide of embodiment 8, wherein the RNA is mRNA. 20   10. The oligonucleotide of embodiment 9, wherein the mRNA is pre-mRNA or mature mRNA. 11. The oligonucleotide of embodiment 1-10, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, particularly 15, 16, 17, 18, 19, 20, 21,22, 23 or 24 contiguous nucleotides. 12. The oligonucleotide of embodiment 1-10, wherein the contiguous nucleotide sequence 25 comprises or consists of from 16 to 20 nucleotides. 13. The oligonucleotide of embodiment 1-10, wherein the oligonucleotide comprises or consists of 14 to 35 nucleotides in length. 14. The oligonucleotide of embodiment 13, wherein the oligonucleotide comprises or consists of 18 to 22 nucleotides in length. 30   15. The oligonucleotide of embodiment 1-14, wherein the oligonucleotide or contiguous nucleotide sequence is single stranded. 16. The oligonucleotide of embodiment 1-15, wherein the contiguous nucleotide sequence is complementary to a sub-sequence of the target nucleic acid, wherein the subsequence is 2024203581   29 May 2024 selected from the group consisting of A7, A26, A43, A119, A142, A159, A160, A163, A169, A178, A179, A180, A189, A201, A202, A204, A214, A221, A224, A226, A243, A254, A258, 269, A274, A350, A360, A364, A365, A370, A372, A381, A383, A386, A389, A400, A427, A435 and A438. 5   17. The oligonucleotide of embodiment 16, wherein the subsequence is selected from the group consisting of A221, A360, A180, A160 and A269. 18. The oligonucleotide of embodiment 1-17, wherein the oligonucleotide is not siRNA and is not self-complementary. 19. The oligonucleotide of embodiment 1-18, wherein the contiguous nucleotide sequence 0 comprises or consists of a sequence selected from SEQ ID NO: 5 to 743 or 771. 20. The oligonucleotide of embodiment 1-19, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 6, 8, 9, 13, 41, 42, 58, 77, 92, 111, 128, 151, 164, 166, 169, 171,222, 233, 245, 246, 250, 251, 252, 256, 272, 273, 287, 292, 303, 314, 318, 320, 324, 336, 342, 343, 344, 345, 346, 349, 359, 360, 374, 408, 409, 415, 417, 15   424, 429, 430, 458, 464, 466, 474, 490, 493, 512, 519, 519, 529, 533, 534, 547, 566, 567, 578, 582, 601, 619, 620, 636, 637, 638, 640, 645, 650, 651, 652, 653, 658, 659, 660, 665, 678, 679, 680, 682, 683, 684, 687, 694, 706, 716, 728, 733, 734, and 735. 21. The oligonucleotide of embodiment 1-20, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 466, 640, 342, 287 and 566. 20   22. The oligonucleotide of embodiment 1-21 wherein the contiguous nucleotide sequence has zero to three mismatches compared to the target nucleic acid it is complementary to. 23. The oligonucleotide of embodiment 22, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acid. 24. The oligonucleotide of embodiment 22, wherein the contiguous nucleotide sequence has 25 two mismatches compared to the target nucleic acid. 25. The oligonucleotide of embodiment 22, wherein the contiguous nucleotide sequence is fully complementary to the target nucleic acid sequence. 26. The oligonucleotide of embodiment 1 -25, comprising one or more modified nucleosides. 27. The oligonucleotide of embodiment 26, wherein the one or more modified nucleoside is a 30 high-affinity modified nucleosides. 28. The oligonucleotide of embodiment 26 or 27, wherein the one or more modified nucleoside is a 2’ sugar modified nucleoside. 2024203581   29 May 2024 29. The oligonucleotide of embodiment 28, wherein the one or more 2’ sugar modified nucleoside is independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, 2’-fluoro-ANA and LNA nucleosides. 5   30. The oligonucleotide of embodiment 28, wherein the one or more modified nucleoside is a LNA nucleoside. 31. The oligonucleotide of embodiment 30, wherein the modified LNA nucleoside is oxy-LNA. 32. The oligonucleotide of embodiment 31, wherein the modified nucleoside is beta-D-oxy-LNA. 33. The oligonucleotide of embodiment 30, wherein the modified nucleoside is thio-LNA. 0   34. The oligonucleotide of embodiment 30, wherein the modified nucleoside is amino-LNA. 35. The oligonucleotide of embodiment 30, wherein the modified nucleoside is cET. 36. The oligonucleotide of embodiment 30, wherein the modified nucleoside is ENA. 37. The oligonucleotide of embodiment 30, wherein the modified LNA nucleoside is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-15 LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA. 38. The oligonucleotide of embodiment 30-37, wherein there in addition to the modified LNA nucleoside is at least one 2’ substituted modified nucleoside. 39. The oligonucleotide of embodiment 38, wherein the 2’ substituted modified nucleoside is selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-20 methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-fluoro-DNA, 2’-fluoro-ANA. 40. The oligonucleotide of any one of embodiments 1-39, wherein the oligonucleotide comprises at least one modified internucleoside linkage. 41. The oligonucleotide of embodiment 40, wherein the modified internucleoside linkage is nuclease resistant. 25   42. The oligonucleotide of embodiment 40 or 41, wherein at least 50% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages. 43. The oligonucleotide of embodiment 40 or 41, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. 30   44. The oligonucleotide of embodiment 1 -43, wherein the oligonucleotide is capable of recruiting RNase H. 45. The oligonucleotide of embodiment 44, wherein the oligonucleotide is a gapmer. 2024203581   29 May 2024 46. The oligonucleotide of embodiment 44 or 45, wherein the oligonucleotide is a gapmer of formula 5’-F-G-F’-3’, where region F and F’ independently comprise or consist of 1 - 7 modified nucleosides and G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH. 5   47. The oligonucleotide of embodiment 44 or 45, wherein the gapmer has formula 5’-D’-F-G-F’- 3’ or 5’-F-G-F’-D”-3’, where region F and F’ independently comprise 1 - 7 modified nucleosides, G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH and region D’ or D” comprise 1 - 5 phosphodiester linked nucleosides. 48. The oligonucleotide of embodiment 47, wherein D’ or D” are optional. 0   49. The oligonucleotide of embodiment 47, wherein region D’ consist of two phosphodiester linked nucleosides. 50. The oligonucleotide of embodiment 49, wherein the phosphodiester linked nucleosides are ca (cytidine-adenosine). 51. The oligonucleotide of embodiment 46 or 47, wherein the modified nucleoside is a 2’ sugar 15 modified nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2’-fluoro-ANA and LNA nucleosides. 52. The oligonucleotide of embodiments 46 to 51, wherein one or more of the modified nucleosides in region F and F’ is a LNA nucleoside. 20   53. The oligonucleotide of embodiment 52, wherein all the modified nucleosides in region F and F’ are LNA nucleosides. 54. The oligonucleotide of embodiment 53, wherein region F and F’ consist of LNA nucleosides. 55. The oligonucleotide of embodiment 52-54, wherein all the modified nucleosides in region F and F’ are oxy-LNA nucleosides. 25   56. The oligonucleotide of embodiment 52, wherein at least one of region F or F’ further comprises at least one 2’ substituted modified nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA and 2’-fluoro-DNA. 57. The oligonucleotide of embodiment 46-56, wherein the RNaseH recruiting nucleosides in 30 region G are independently selected from DNA, alpha-L-LNA, C4’ alkylated DNA, ANA and 2'F-ANA and UNA. 58. The oligonucleotide of embodiment 57, wherein the nucleosides in region G is DNA and / or alpha-L-LNA nucleosides. 2024203581   29 May 2024 59. The oligonucleotide of embodiment 57 or 58, wherein region G consists of at least 75% DNA nucleosides. 60. The oligonucleotide of embodiment 1-59, wherein the oligonucleotide is selected from any one of the CMP ID NO: 5_1 to 743_1 and 7711 (table 5). 5   61. The oligonucleotide of embodiment 1-60, wherein the oligonucleotide is selected from the group consisting of CMP ID NO: 6_1, 8_1, 9_1, 13_1, 41_1, 42_1, 58_1, 77_1, 92_1, 111_1, 1281, 151_1, 164 1, 166 1, 169_1, 171_1, 222_1, 233_1, 245_1, 246_1, 250_1, 251_1, 252 1, 256_1, 272 1, 273_1, 287_1, 292_1, 303_1, 314_1, 318_1, 320_1, 324_1, 336_1, 342_1, 343_1, 344_1, 345_1, 346_1, 349_1, 359_1, 360_1, 374_1, 408_1, 409_1, 415_1, 0   417_1, 424_1, 429_1, 430_1, 458_1, 464_1, 466_1, 474_1, 490_1, 493_1, 512_1, 519_1, 519_1, 529_1, 533_1, 534_1, 547_1, 566_1, 567_1, 578_1, 582_1, 601_1, 619_1, 620_1, 636_1, 637_1, 638_1, 640_1, 645_1, 650_1, 651 _1, 652_1, 653_1, 658_1, 659_1, 660_1, 665_1, 678_1, 679_1, 680_1, 682_1, 683_1, 684_1, 687_1, 694_1, 706_1, 716_1, 728_1, 733_1,734_1, and 735_1. 15   62. The oligonucleotide of embodiment 1-61, wherein the oligonucleotide is selected from the group consisting of CMP ID NO: 287_1, 342_1, 466_1, 640_1, 566_1, 766_1, 767_1, 768_1, 769_1 and 770_1. 63. An antisense oligonucleotide conjugate comprising a. an oligonucleotide according to any one of claims 1-62 (Region A); and 20 b. at least one at least one conjugate moiety (Region C) covalently attached to said oligonucleotide. 64. The oligonucleotide conjugate of embodiment 63, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations 25 thereof. 65. The oligonucleotide conjugate of embodiment 63 or 64, wherein the conjugate moiety is a carbohydrate containing moiety. 66. The oligonucleotide conjugate of embodiment 65, wherein the carbohydrate conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety covalently attached 30 to an oligonucleotide according to any one of claims 1-62. 67. The oligonucleotide conjugate of embodiment 66, wherein the asialoglycoprotein receptor targeting conjugate moiety comprises at least one carbohydrate moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. 2024203581   29 May 2024 68. The oligonucleotide conjugate of embodiment 66 or 67, wherein the asialoglycoprotein receptor targeting conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent. 69. The oligomer conjugate of embodiment 68, wherein the asialoglycoprotein receptor targeting conjugate moiety consists of two to four terminal GalNAc moieties, a PEG spacer 5 linking each GalNAc moiety to a brancher molecule. 70. The oligonucleotide conjugate of embodiment 66 to 69, wherein the asialoglycoprotein receptor targeting conjugate moiety is a tri-valent N-acetylgalactosamine (GalNAc) moiety. 71. The oligonucleotide conjugate of embodiment 66 to 70, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in figure 1. 0   72. The oligonucleotide conjugate of embodiment 71, wherein the conjugate moiety is the trivalent GalNAc moiety in figure 3. 73. The oligonucleotide conjugate of embodiment 63-72, where a linker is present between the oligonucleotide or contiguous oligonucleotide sequence and the conjugate moiety. 74. The oligonucleotide conjugate of embodiment 73, wherein the linker is a physiologically 15 labile linker (region B). 75. The oligonucleotide conjugate of embodiment 74, wherein the physiologically labile linker is nuclease susceptible linker. 76. The oligonucleotide conjugate of embodiment 74 or 75, wherein the physiologically labile linker is composed of 2 to 5 consecutive phosphodiester linkages. 20   77. The oligonucleotide conjugate of embodiment 76, wherein the physiologically labile linker is equivalent to region D’ or D” presented in embodiment 47 to 50. 78. The oligonucleotide conjugate of any one of embodiments 63-77, wherein the oligonucleotide conjugate is selected from CMP ID NO: 766_2, 767_2,768_2, 769_2 and 770_2. 79. The oligonucleotide conjugate of embodiment 78, wherein the oligonucleotide conjugate is 25 selected from the oligonucleotide conjugated represented in figure 4, 5, 6, 7 and 8. 80. The oligonucleotide conjugate of embodiment 63-76, which display improved inhibition of PD-L1 in the target cell, or improved cellular distribution between liver and the spleen or improved cellular uptake into the liver of the conjugate oligonucleotide as compared to an unconjugated oligonucleotide. 30   81. A pharmaceutical composition comprising the oligonucleotide of embodiment 1-62 or a conjugate of embodiment 63-80 and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. 2024203581   29 May 2024 82. A method for manufacturing the oligonucleotide of embodiment 1-62, comprising reacting nucleotide units thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. 83. The method of embodiment 82, further comprising reacting the contiguous nucleotide 5 sequence with a non-nucleotide conjugation moiety. 84. A method for manufacturing the composition of embodiment 81, comprising mixing the oligonucleotide with a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. 85. An in vivo or in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering an oligonucleotide of embodiment 10   62 or a conjugate of embodiment 63-80 or the pharmaceutical composition of embodiment 81 in an effective amount to said cell. 86. A method for treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of embodiment 1-62 or a conjugate of embodiment 63-80 or the pharmaceutical composition of embodiment 81 to a subject suffering 15 from or susceptible to the disease. 87. A method for restoration of immunity against a virus or parasite comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide conjugate of embodiment 63-80 or the oligonucleotide of embodiment 1-62 or the pharmaceutical composition of embodiment 81 to a subject infected with a virus or parasite. 20   88. The method of embodiment 87, the restoration of immunity is an increase in the liver of CD8+ T cells specific to one or more HBV antigens when compared to a control. 89. The oligonucleotide of embodiment 1-62 or a conjugate of embodiment 63-80 or the pharmaceutical composition of embodiment 81, for use as a medicament for treatment or prevention of a disease in a subject. 25   90. Use of the oligonucleotide of oligonucleotide of embodiment 1-62 or a conjugate of embodiment 63-80 for the preparation of a medicament for treatment or prevention of a disease in a subject. 91. The oligonucleotide of embodiment 1-62 or a conjugate of embodiment 63-80 or the pharmaceutical composition of embodiment 81, for use in restoration of immunity against a virus 30 or parasite. 92. The use of embodiment 91, wherein the restoration of immunity is an increase in the liver of CD8+ T cells specific to one or more HBV antigens when compared to a control. 93. The use of embodiment 92, wherein the HBV antigen is the HBsAg. 2024203581   29 May 2024 94. The method, the oligonucleotide or the use of embodiments 86 - 93, wherein the disease is associated with in vivo activity of PD-L1. 95. The method, the oligonucleotide or the use of embodiments 86 - 94, wherein the disease is associated with increased expression of PD-L1 in an antigen presenting cell. 5   96. The method, the oligonucleotide or the use of embodiments 95, wherein the PD-L1 is reduced by at least 30%, or at least or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the expression without or before treatment with the oligonucleotide of embodiment 1-62 or a conjugate of embodiment 6380 or the pharmaceutical composition of embodiment 81. 0   97. The method, the oligonucleotide or the use of embodiments 86 - 95, wherein the disease is selected from a viral liver infection or a parasite infections. 98. The method, the oligonucleotide or the use of embodiment 98, wherein the viral infection is HBV, HCV or HDV. 99. The method, the oligonucleotide or the use of embodiment 86 - 95, wherein the disease is 15 chronic HBV. 100. The method, the oligonucleotide or the use of embodiment 98, wherein the parasite infection is malaria, toxoplasmosis, leishmaniasis or trypanosomiasis. 101. The method, the oligonucleotide or the use of embodiments 86 - 100, wherein the subject is a mammal. 20   102. The method, the oligonucleotide or the use of embodiment 101, wherein the mammal is human. EXAMPLES Materials and methods Motif sequences and oligonucleotide compounds 25 Table 5: list of oligonucleotide motif sequences (indicated by SEQ ID NO) targeting the human PD-L1 transcript (SEQ ID NO: 1), designs of these, as well as specific antisense oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence. SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 5 taattggctctactgc 2-11-3 TAattggctctacTGC 5_1 236 -20 6 tcgcataagaatgact 4-10-2 T CGCataagaatgaCT 6_1 371 -19 7 tgaacacacagtcgca 2-12-2 TGaacacacagtcgCA 7_1 382 -19 8 ctgaacacacagtcgc 3-10-3 CTGaacacacagtCGC 8_1 383 -22 9 tctgaacacacagtcg 3-11-2 T CT gaacacacagtCG 9_1 384 -19 10 ttctgaacacacagtc 3-11-2 TT CtgaacacacagT C 10_1 385 -17 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 11 acaagtcatgttacta 2-11-3 ACaagtcatgttaCTA 11_1 463 -16 12 acacaagtcatgttac 2-12-2 ACacaagtcatgttAC 121 465 -14 13 cttacttagatgctgc 2-11-3 CTtacttagatgcTGC 13_1 495 -20 14 acttacttagatgctg 2-11-3 ACttacttagatgCTG 141 496 -18 15 gacttacttagatgct 3-11-2 GACttacttagatgCT 15_1 497 -19 16 agacttacttagatgc 2-11-3 AGacttacttagaTGC 16_1 498 -18 17 gcaggaagagacttac 3-10-3 GCAggaagagactTAC 171 506 -20 18 aataaattccgttcagg 4-9-4 AAT AaattccgttC AG G 18_1 541 -22 19 gcaaataaattccgtt 3-10-3 G C AaataaattccG TT 19_2 545 -18 19 gcaaataaattccgtt 4-8-4 GCAAataaattcCGTT 19_1 545 -20 20 agcaaataaattccgt 4-9-3 AG C AaataaattcCGT 20_1 546 -20 21 cagagcaaataaattcc 4-10-3 CAG AgcaaataaatT CO 211 548 -21 22 tggacagagcaaataaat 4-11-3 TG G Acagagcaaata A AT 221 551 -19 23 atggacagagcaaata 4-8-4 ATG G acagagca A AT A 23_1 554 -20 24 cagaatggacagagca 2-11-3 CAgaatggacagaGCA 241 558 -21 25 ttctcagaatggacag 3-11-2 TT Ctcagaatggac AG 25_1 562 -17 26 ctgaactttgacatag 4-8-4 CT G AactttgacAT AG 26_1 663 -20 27 aagacaaacccagactga 2-13-3 AAgacaaacccagacT GA 271 675 -21 28 tataagacaaacccagac 4-10-4 T AT AagacaaacccAG AC 28_1 678 -22 29 ttataagacaaacccaga 4-10-4 TTATaagacaaaccCAGA 29_1 679 -23 30 tgttataagacaaaccc 4-10-3 TGTT ataagacaaaCCC 30_1 682 -22 31 tagaacaatggtacttt 4-9-4 T AG AacaatggtaCTTT 31_1 708 -20 32 gtagaacaatggtact 4-10-2 GT AGaacaatggtaCT 321 710 -19 33 aggtagaacaatggta 3-10-3 AG GtagaacaatgGTA 33_1 712 -19 34 aagaggtagaacaatgg 4-9-4 AAG AggtagaacaAT G G 341 714 -21 35 gcatccacagtaaatt 2-12-2 GCatccacagtaaaTT 35_1 749 -17 36 gaaggttatttaattc 2-11-3 GAaggttatttaaTTC 36_1 773 -13 37 ctaatcgaatgcagca 4-9-3 CT AAtcgaatgcaG C A 371 805 -22 38 tacccaatctaatcga 3-10-3 T ACccaatctaatCG A 38_1 813 -20 39 tagttacccaatctaa 3-10-3 T AG ttacccaatcT AA 39_1 817 -19 40 catttagttacccaat 3-10-3 CATttagttacccAAT 40_1 821 -18 41 tcatttagttacccaa 3-10-3 TCAtttagttaccCAA 411 822 -19 42 ttcatttagttaccca 2-10-4 TTcatttagttaCCCA 421 823 -22 43 gaattaatttcatttagt 4-10-4 GAATtaatttcattTAGT 43_1 829 -19 44 cagtgaggaattaattt 4-9-4 CAGTgaggaattaATTT 441 837 -20 45 ccaacagtgaggaatt 4-8-4 CCAAcagtgaggAATT 45_1 842 -21 46 cccaacagtgaggaat 3-10-3 CCCaacagtgaggAAT 46_1 843 -22 47 tatacccaacagtgagg 2-12-3 T AtacccaacagtgAGG 47_1 846 -21 48 ttatacccaacagtgag 2-11-4 TT atacccaacagT G AG 48_1 847 -21 49 tttatacccaacagtga 3-11-3 TTT atacccaacagT GA 49_1 848 -21 50 cctttatacccaacag 3-10-3 CCTttatacccaaCAG 50_1 851 -23 51 taacctttatacccaa 4-8-4 T AACctttatacCC AA 51_1 854 -22 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 52 aataacctttataccca 3-10-4 AAT aacctttataCCC A 521 855 -23 53 gtaaataacctttata 3-11-2 GTAaataacctttaTA 53_1 859 -14 54 actgtaaataacctttat 4-10-4 ACTG taaataacctTT AT 541 860 -20 55 atatatatgcaatgag 3-11-2 ATAtatatgcaatgAG 55_1 903 -14 56 agatatatatgcaatg 2-12-2 AGatatatatgcaaTG 56_1 905 -12 57 gagatatatatgcaat 3-10-3 GAGatatatatgcAAT 571 906 -15 58 ccagagatatatatgc 2-11-3 CCagagatatataTGC 58_1 909 -19 59 caatattccagagatat 4-9-4 C AAT attccagag AT AT 59_1 915 -20 60 gcaatattccagagata 4-10-3 GCAAtattccagagATA 60_1 916 -22 61 agcaatattccagagat 3-11-3 AGCaatattccagaGAT 61_1 917 -22 62 cagcaatattccagag 3-9-4 C AG caatattcc AG AG 621 919 -22 63 aatcagcaatattccag 4-9-4 AAT CagcaatattCC AG 63_1 921 -23 64 acaatcagcaatattcc 4-9-4 AC AAtcagcaataTT CC 641 923 -21 65 actaagtagttacacttct 2-14-3 ACtaagtagttacactT CT 65_1 957 -20 66 ctaagtagttacacttc 4-11-2 CT AAgtagttacactT C 66_1 958 -18 67 gactaagtagttacactt 3-12-3 GACtaagtagttacaCTT 671 959 -20 68 tgactaagtagttaca 3-9-4 T G ActaagtagtT AC A 68_1 962 -19 69 ctttgactaagtagtta 4-10-3 CTTT gactaagtagTT A 69_1 964 -19 70 ctctttgactaagtag 3-10-3 CT CtttgactaagT AG 70_1 967 -19 71 gctctttgactaagta 4-10-2 GCT CtttgactaagT A 711 968 -21 72 ccttaaatactgttgac 2-11-4 CCttaaatactgtTGAC 721 1060 -20 73 cttaaatactgttgac 2-12-2 CTtaaatactgttgAC 73_1 1060 -13 74 tccttaaatactgttg 3-10-3 TCCttaaatactgTTG 74_1 1062 -18 75 tctccttaaatactgtt 4-11-2 T CT CcttaaatactgTT 75_1 1063 -19 76 tatcatagttctcctt 2-10-4 TAtcatagttctCCTT 76_1 1073 -21 77 agtatcatagttctcc 3-10-3 AGTatcatagttcTCC 77_1 1075 -22 78 gagtatcatagttctc 2-11-3 GAgtatcatagttCTC 78_1 1076 -18 79 agagtatcatagttct 2-10-4 AG agtatcatagTT CT 79_1 1077 -18 79 agagtatcatagttct 3-10-3 AGAgtatcatagtTCT 79_2 1077 -19 80 cagagtatcatagttc 3-10-3 C AG agtatcatagTT C 80_1 1078 -18 81 ttcagagtatcatagt 4-10-2 TT C AgagtatcataGT 81_1 1080 -18 82 cttcagagtatcatag 3-9-4 CTT cagagtatcAT AG 821 1081 -19 83 ttcttcagagtatcata 4-11-2 TT CTtcagagtatcaT A 83_1 1082 -19 84 tttcttcagagtatcat 3-10-4 TTT cttcagagtaT CAT 841 1083 -20 85 gagaaaggctaagttt 4-9-3 GAGAaaggctaagTTT 85_1 1099 -19 86 gacactcttgtacatt 2-10-4 GAcactcttgtaCATT 86_1 1213 -19 87 tgagacactcttgtaca 2-13-2 TGagacactcttgtaCA 871 1215 -18 88 tgagacactcttgtac 2-11-3 TGagacactcttgT AC 88_1 1216 -18 89 ctttattaaactccat 2-10-4 CTttattaaactCCAT 89_1 1266 -18 90 accaaactttattaaa 4-10-2 ACCAaactttattaAA 90_1 1272 -14 91 aaacctctactaagtg 4-10-2 AAACctctactaagT G 91_1 1288 -16 92 agattaagacagttga 2-11-3 AG attaagacagtT G A 921 1310 -16 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 93 aagtaggagcaagaggc 2-12-3 AAgtaggagcaagaGGC 93_1 1475 -22 94 aaagtaggagcaagagg 4-10-3 AAAGtaggagcaagAGG 941 1476 -20 95 gttaagcagccaggag 2-12-2 GTtaagcagccaggAG 95_1 1806 -20 96 agggtaggatgggtag 2-12-2 AGggtaggatgggtAG 96_1 1842 -20 97 aagggtaggatgggta 3-11-2 AAGggtaggatgggTA 971 1843 -20 98 caagggtaggatgggt 2-12-2 CAagggtaggatggGT 98_2 1844 -20 98 caagggtaggatgggt 3-11-2 CAAgggtaggatggGT 98_1 1844 -21 99 ccaagggtaggatggg 2-12-2 CCaagggtaggatgGG 99_1 1845 -22 100 tccaagggtaggatgg 2-12-2 T CcaagggtaggatG G 100_1 1846 -20 101 cttccaagggtaggat 4-10-2 CTT Ccaagggtagg AT 101_1 1848 -21 102 atcttccaagggtagga 3-12-2 ATCttccaagggtagGA 102_1 1849 -22 103 agaagtgatggctcatt 2-11-4 AG aagtgatggctC ATT 103_1 1936 -21 104 aagaagtgatggctcat 3-10-4 AAGaagtgatggcTCAT 104_1 1937 -21 105 gaagaagtgatggctca 3-11-3 G AAgaagtgatggcT CA 105_1 1938 -21 106 atgaaatgtaaactggg 4-9-4 AT G AaatgtaaacT G G G 106_1 1955 -21 107 caatgaaatgtaaactgg 4-10-4 C AAT gaaatgtaaaCT G G 107_1 1956 -20 108 gcaatgaaatgtaaactg 4-10-4 GCAAtgaaatgtaaACTG 108_1 1957 -20 109 agcaatgaaatgtaaact 4-10-4 AG C Aatgaaatgta AACT 109_1 1958 -20 110 gagcaatgaaatgtaaac 4-10-4 GAGCaatgaaatgtAAAC 110_1 1959 -19 111 tgaattcccatatccga 2-12-3 T G aattcccatatcCG A 111_1 1992 -22 112 agaattatgaccatat 2-11-3 AG aattatgaccaT AT 1121 2010 -15 113 aggtaagaattatgacc 3-10-4 AGGtaagaattatGACC 113_1 2014 -21 114 tcaggtaagaattatgac 4-10-4 T C AGgtaagaattaT G AC 1141 2015 -22 115 cttcaggtaagaattatg 4-10-4 CTT CaggtaagaatT AT G 115_1 2017 -21 116 tcttcaggtaagaatta 4-9-4 T CTT caggtaaga ATT A 116_1 2019 -20 117 cttcttcaggtaagaat 4-9-4 CTT CttcaggtaaG AAT 1171 2021 -21 118 tcttcttcaggtaagaa 4-10-3 T CTT CttcaggtaaG AA 118_1 2022 -20 119 tcttcttcaggtaaga 3-10-3 TCTtcttcaggtaAGA 119_1 2023 -20 120 tggtctaagagaagaag 3-10-4 TGGtctaagagaaGAAG 120_1 2046 -20 121 gttggtctaagagaag 4-9-3 GTTGgtctaagagAAG 1211 2049 -19 123 cagttggtctaagagaa 2-11-4 CAgttggtctaagAGAA 123_1 2050 -20 124 gcagttggtctaagagaa 3-13-2 GCAgttggtctaagagAA 1241 2050 -22 122 agttggtctaagagaa 3-9-4 AGTtggtctaagAGAA 1221 2050 -20 126 gcagttggtctaagaga 2-13-2 GCagttggtctaagaGA 126_1 2051 -21 125 cagttggtctaagaga 4-10-2 CAGTtggtctaagaGA 125_1 2051 -21 127 gcagttggtctaagag 2-11-3 GCagttggtctaaGAG 1271 2052 -21 128 ctcatatcagggcagt 2-10-4 CT catatcagggC AGT 128_1 2063 -24 129 cacacatgttctttaac 4-11-2 CACAcatgttctttaAC 129_1 2087 -18 130 taaatacacacatgttct 3-11-4 T AAatacacacatgTT CT 130_1 2092 -19 131 gtaaatacacacatgttc 4-11-3 GT AAatacacacatgTT C 131_1 2093 -19 132 tgtaaatacacacatgtt 4-10-4 TGT AaatacacacaT GTT 132_1 2094 -22 133 gatcatgtaaatacacac 4-10-4 GAT CatgtaaatacAC AC 133_1 2099 -20 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 134 agatcatgtaaatacaca 4-10-4 AGATcatgtaaataCACA 134_1 2100 -21 135 caaagatcatgtaaatacac 4-12-4 CAAAgatcatgtaaatACAC 135_1 2101 -19 136 acaaag atcatgtaaataca 4-12-4 AC AAagatcatgtaaaT AC A 136_1 2102 -20 137 gaatacaaagatcatgta 4-10-4 G AAT acaaagatcaT GTA 137_1 2108 -20 138 agaatacaaagatcatgt 4-10-4 AG A Atacaaag ate AT GT 138_1 2109 -20 139 cagaatacaaagatcatg 4-10-4 CAG AatacaaagatCAT G 139_1 2110 -21 140 gcagaatacaaagatca 4-9-4 GCAGaatacaaagAT CA 140_1 2112 -22 141 aggcagaatacaaagat 4-11-2 AGGCagaatacaaagAT 1411 2114 -19 142 aaggcagaatacaaaga 4-10-3 AAGGcagaatacaaAGA 1421 2115 -19 143 attagtgagggacgaa 3-10-3 ATT agtgagggacG AA 143_1 2132 -18 144 cattagtgagggacga 2-11-3 CAttagtgagggaCGA 144_1 2133 -20 145 gagggtgatggattag 2-11-3 G AgggtgatggatT AG 145_1 2218 -19 146 ttaggagtaataaagg 2-10-4 TT aggagtaataAAG G 146_1 2241 -14 147 ttaatgaatttggttg 3-11-2 TTAatgaatttggtTG 1471 2263 -13 148 ctttaatgaatttggt 2-12-2 CTttaatgaatttgGT 148_1 2265 -14 149 catggattacaactaa 4-10-2 CATGgattacaactAA 149_1 2322 -16 150 tcatggattacaacta 2-11-3 T CatggattacaaCT A 150_1 2323 -16 151 gtcatggattacaact 3-11-2 GT CatggattacaaCT 151_1 2324 -18 152 cattaaatctagtcat 2-10-4 CAttaaatctagTCAT 1521 2335 -16 153 gacattaaatctagtca 4-10-3 G AC AttaaatctagT C A 153_1 2336 -19 154 agggacattaaatcta 4-10-2 AG G G acattaaatcT A 1541 2340 -18 155 caaagcattataacca 4-9-3 CAAAgcattataaCCA 155_1 2372 -18 156 acttactaggcagaag 2-10-4 ACttactaggcaG A AG 156_1 2415 -19 157 cagagttaactgtaca 4-10-2 CAGAgttaactgtaCA 1571 2545 -20 158 ccagagttaactgtac 4-10-2 CC AG agttaactgtAC 158_1 2546 -20 159 gccagagttaactgta 2-12-2 GCcagagttaactgTA 159_1 2547 -20 160 tgggccagagttaact 2-12-2 T GggccagagttaaCT 160_1 2550 -21 161 cagcatctatcagact 2-12-2 CAgcatctatcagaCT 161_1 2576 -19 162 tgaaataacatgagtcat 3-11-4 T G AaataacatgagT CAT 162_1 2711 -19 163 gtgaaataacatgagtc 3-10-4 GTG aaataacatg AGT C 163_1 2713 -19 164 tctgtttatgtcactg 4-10-2 TCTGtttatgtcacTG 164_1 2781 -20 165 gtctgtttatgtcact 4-10-2 GTCTgtttatgtcaCT 165_1 2782 -22 166 tggtctgtttatgtca 2-10-4 TGgtctgtttatGTCA 166_1 2784 -21 167 ttggtctgtttatgtc 4-10-2 TTGGtctgtttatgTC 167_1 2785 -20 168 tcacccattgtttaaa 2-12-2 TCacccattgtttaAA 168_1 2842 -15 169 ttcagcaaatattcgt 2-10-4 TT cagcaaatatT CGT 169_1 2995 -17 170 gtgtgttcagcaaatat 3-10-4 GTG tgttcagcaaAT AT 170_1 2999 -21 171 tctattgttaggtatc 3-10-3 TCTattgttaggtATC 1711 3053 -18 172 attgcccatcttactg 2-12-2 ATtgcccatcttacTG 1721 3118 -19 173 tattgcccatcttact 3-11-2 TATtgcccatcttaCT 173_1 3119 -21 174 aaatattgcccatctt 2-11-3 AAatattgcccatCTT 1741 3122 -17 175 ataaccttatcataca 3-11-2 ATAaccttatcataCA 175_1 3174 -16 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 176 tataaccttatcatac 2-11-3 TAtaaccttatcaTAC 176_1 3175 -14 177 ttataaccttatcata 3-11-2 TTAtaaccttatcaTA 177_1 3176 -14 178 tttataaccttatcat 3-10-3 TTTataaccttatCAT 178_1 3177 -16 179 actgctattgctatct 2-11-3 ACtgctattgctaTCT 179_1 3375 -19 180 aggactgctattgcta 2-11-3 AGgactgctattgCTA 180_1 3378 -21 181 gaggactgctattgct 3-11-2 GAGgactgctattgCT 181_1 3379 -22 182 acgtagaataataaca 2-12-2 ACgtagaataataaCA 1821 3561 -11 183 ccaagtgatataatgg 2-10-4 CCaagtgatata AT G G 183_1 3613 -19 184 ttagcagaccaagtga 2-10-4 TTagcagaccaaGTGA 1841 3621 -21 185 gtttagcagaccaagt 2-12-2 GTttagcagaccaaGT 185_1 3623 -19 186 tgacagtgattatatt 2-12-2 TGacagtgattataTT 186_1 3856 -13 187 tgtccaagatattgac 4-10-2 TGT Ccaagatattg AC 1871 3868 -18 188 gaatatcctagattgt 3-10-3 G AAtatcctagatT GT 188_1 4066 -18 189 caaactgagaatatcc 2-11-3 CAaactgagaataT CC 189_1 4074 -16 190 gcaaactgagaatatc 3-11-2 G C Aaactg agaataT C 190_1 4075 -16 191 tcctattacaatcgta 3-11-2 TCCtattacaatcgTA 191_1 4214 -19 192 ttcctattacaatcgt 4-10-2 TTCCtattacaatcGT 1921 4215 -19 193 actaatgggaggattt 2-12-2 ACtaatgggaggatTT 193_1 4256 -15 194 tagttcagagaataag 2-12-2 TAgttcagagaataAG 1941 4429 -13 195 taacatatagttcaga 2-11-3 TAacatatagttcAGA 195_1 4436 -15 196 ataacatatagttcag 3-11-2 ATAacatatagttcAG 196_1 4437 -14 197 cataacatatagttca 2-12-2 CAtaacatatagttCA 1971 4438 -13 198 tcataacatatagttc 2-12-2 TCataacatatagtTC 198_1 4439 -12 199 tagctcctaacaatca 4-10-2 T AG CtcctaacaatC A 199_1 4507 -22 200 ctccaatctttgtata 4-10-2 CTCCaatctttgtaTA 200_1 4602 -20 201 tctccaatctttgtat 4-10-2 TCTCcaatctttgtAT 201_1 4603 -19 202 tctatttcagccaatc 2-12-2 TCtatttcagccaaTC 202 1 4708 -17 203 cggaagtcagagtgaa 3-10-3 CG G aagtcag agtG A A 203_1 4782 -19 204 ttaagcatgaggaata 4-10-2 TT AAgcatgaggaaT A 204 1 4798 -16 205 tgattgagcacctctt 3-10-3 T G AttgagcacctCTT 205_1 4831 -22 206 gactaattatttcgtt 3-11-2 GACtaattatttcgTT 206_1 4857 -15 207 tgactaattatttcgt 3-10-3 TGActaattatttCGT 207 1 4858 -17 208 gtgactaattatttcg 3-10-3 GTGactaattattTCG 208_1 4859 -17 209 ctgcttgaaatgtgac 4-10-2 CTGCttgaaatgtgAC 209_1 4870 -20 210 cctgcttgaaatgtga 2-11-3 CCtgcttgaaatgTGA 210_1 4871 -21 211 atcctgcttgaaatgt 2-10-4 AT cctgcttgaaATGT 211_1 4873 -20 212 attataaatctattct 3-10-3 ATTataaatctatTCT 2121 5027 -13 213 gctaaatactttcatc 2-11-3 GCtaaatactttcATC 213_1 5151 -16 214 cattgtaacataccta 2-10-4 C AttgtaacataCCT A 2141 5251 -19 215 gcattgtaacatacct 2-12-2 GCattgtaacatacCT 215_1 5252 -18 216 taatattgcaccaaat 2-12-2 TAatattgcaccaaAT 216_1 5295 -13 217 gataatattgcaccaa 2-11-3 GAtaatattgcacCAA 2171 5297 -16 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 218 agataatattgcacca 2-12-2 AGataatattgcacCA 218_1 5298 -16 219 gccaagaagataatat 2-10-4 GCcaagaagataAT AT 219_1 5305 -17 220 cacagccacataaact 4-10-2 CACAgccacataaaCT 220_1 5406 -21 221 ttgtaattgtggaaac 2-12-2 TTgtaattgtggaaAC 2211 5463 -12 222 tgacttgtaattgtgg 2-11-3 TGacttgtaattgTGG 222 1 5467 -18 223 tctaactgaaatagtc 2-12-2 TCtaactgaaatagTC 223_1 5503 -13 224 gtggttctaactgaaa 3-11-2 GTGgttctaactgaAA 224 1 5508 -16 225 caatatgggacttggt 2-12-2 CAatatgggacttgGT 225_1 5522 -18 226 atgacaatatgggact 3-11-2 AT G acaatatgggaCT 226_1 5526 -17 227 tatgacaatatgggac 4-10-2 T ATGacaatatggg AC 227 1 5527 -17 228 atatgacaatatggga 4-10-2 AT AT gacaatatggG A 228_1 5528 -17 229 cttcacttaataatta 2-11-3 CTtcacttaataaTTA 229_1 5552 -13 230 ctgcttcacttaataa 4-10-2 CTGCttcacttaatAA 230_1 5555 -18 231 aagactgcttcactta 2-11-3 AAgactgcttcacTT A 231_1 5559 -17 232 gaatgccctaattatg 4-10-2 G AAT gccctaattaT G 232 1 5589 -19 233 tggaatgccctaatta 3-11-2 TG G aatgccctaatT A 233_1 5591 -19 234 gcaaatgccagtaggt 3-11-2 GCAaatgccagtagGT 234 1 5642 -23 235 ctaatggaaggatttg 3-11-2 CT AatggaaggattT G 235_1 5673 -15 236 aatatagaacctaatg 2-12-2 AAtatagaacctaaTG 236_1 5683 -10 237 gaaagaatagaatgtt 3-10-3 GAAagaatagaatGTT 237 1 5769 -12 238 atgggtaatagattat 3-11-2 ATGggtaatagattAT 238_1 5893 -15 239 gaaagagcacagggtg 2-12-2 GAaagagcacagggTG 239_1 6103 -18 240 ctacatagagggaatg 4-10-2 CT ACatagagggaaT G 240_1 6202 -18 241 gcttcctacatagagg 2-10-4 G CttcctacataG AG G 2411 6207 -24 242 tgcttcctacatagag 4-10-2 TGCTtcctacatagAG 242 1 6208 -22 243 tgggcttgaaatatgt 2-11-3 T GggcttgaaataT GT 243_1 6417 -19 244 cattatatttaagaac 3-11-2 CATtatatttaagaAC 244 1 6457 -11 245 tcggttatgttatcat 2-10-4 TCggttatgttaTCAT 245_1 6470 -19 246 cactttatctggtcgg 2-10-4 CActttatctggTCGG 246_1 6482 -22 247 aaattggcacagcgtt 3-10-3 AA AttggcacagcG TT 247 1 6505 -18 248 accgtgacagtaaatg 4-9-3 ACCGtgacagtaaATG 248_1 6577 -20 249 tgggaaccgtgacagta 2-13-2 T GggaaccgtgacagT A 249_1 6581 -22 250 ccacatataggtcctt 2-11-3 CCacatataggtcCTT 250_1 6597 -21 251 catattgctaccatac 2-11-3 CAtattgctaccaTAC 251_1 6617 -18 252 tcatattgctaccata 3-10-3 TCAtattgctaccATA 252 1 6618 -19 253 caattgtcatattgct 4-8-4 C AATtgtcatatT G CT 253_1 6624 -21 254 cattcaattgtcatattg 3-12-3 C ATtcaattgtcataTT G 254 1 6626 -18 255 tttctactgggaatttg 4-9-4 TTT CtactgggaaTTT G 255_1 6644 -20 256 caattagtgcagccag 3-10-3 CAAttagtgcagcCAG 256_1 6672 -21 257 gaataatgttcttatcc 4-10-3 G AAT aatgttcttaT CC 257 1 6704 -20 258 cacaaattgaataatgttct 4-13-3 C AC AaattgaataatgtT CT 258_1 6709 -20 259 catgcacaaattgaataat 4-11-4 C ATGcacaaattgaaT AAT 259_1 6714 -20 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 260 atcctgcaatttcacat 3-11-3 AT CctgcaatttcaC AT 260_1 6832 -22 261 ccaccatagctgatca 2-12-2 CCaccatagctgatCA 261_1 6868 -22 262 accaccatagctgatca 2-12-3 ACcaccatagctgaT C A 262 1 6868 -23 263 caccaccatagctgatc 2-13-2 CAccaccatagctgaT C 263_1 6869 -21 264 tagtcggcaccaccat 2-12-2 T AgtcggcaccaccAT 264 1 6877 -22 265 cttgtagtcggcaccac 1-14-2 CttgtagtcggcaccAC 265_1 6880 -21 266 cttgtagtcggcacca 1-13-2 CttgtagtcggcacCA 266_1 6881 -21 267 cgcttgtagtcggcac 2-12-2 CGcttgtagtcggcAC 267 1 6883 -21 268 tcaataaagatcaggc 3-11-2 T CAataaagatcagGC 268_1 6942 -17 269 tggacttacaagaatg 2-12-2 T GgacttacaagaaT G 269_1 6986 -14 270 atggacttacaagaat 3-11-2 ATGgacttacaagaAT 270_1 6987 -15 271 gctcaagaaattggat 4-10-2 GOT CaagaaattggAT 2711 7073 -19 272 tactgtagaacatggc 4-10-2 T ACT gtagaacatgG C 272 1 7133 -21 273 gcaattcatttgatct 4-9-3 GCAAttcatttgaTCT 273_1 7239 -20 274 tgaagggaggagggacac 2-14-2 TGaagggaggagggacAC 274 1 7259 -20 275 agtggtgaagggaggag 2-13-2 AGtggtgaagggaggAG 275_1 7265 -21 276 tagtggtgaagggaggag 2-14-2 TAgtggtgaagggaggAG 276_1 7265 -21 277 atagtggtgaagggaggag 1-16-2 AtagtggtgaagggaggAG 277 1 7265 -20 278 tagtggtgaagggagga 2-13-2 TAgtggtgaagggagGA 278_1 7266 -21 279 atagtggtgaagggagga 2-14-2 ATagtggtgaagggagGA 279_1 7266 -21 280 tagtggtgaagggagg 3-11-2 TAGtggtgaagggaGG 280_1 7267 -21 281 atagtggtgaagggagg 3-12-2 ATAgtggtgaagggaGG 281_1 7267 -22 282 gatagtggtgaagggagg 2-14-2 G AtagtggtgaagggaG G 282 1 7267 -21 283 atagtggtgaagggag 4-10-2 ATAGtggtgaagggAG 283_1 7268 -20 284 gatagtggtgaagggag 2-12-3 GAtagtggtgaaggGAG 284 1 7268 -21 285 gagatagtggtgaagg 2-10-4 GAgatagtggtgAAGG 285_1 7271 -20 286 catgggagatagtggt 4-10-2 CATGggagatagtgGT 286_1 7276 -22 287 acaaataatggttactct 4-10-4 AC AAataatggttaCT CT 287 1 7302 -20 288 acacacaaataatggtta 4-10-4 ACACacaaataatgGTT A 288_1 7306 -20 289 gagggacacacaaataat 3-11-4 G AGggacacacaaaT AAT 289_1 7311 -21 290 atatagagaggctcaa 4-8-4 AT AT agagaggcT C AA 290_1 7390 -21 291 ttgatatagagaggct 2-10-4 TT gatatagagaGG CT 291_1 7393 -20 292 gcatttgatatagaga 4-9-3 GCATttgatatagAGA 292 1 7397 -20 293 tttgcatttgatatag 2-11-3 TTtgcatttgataTAG 293_1 7400 -15 294 ctggaagaataggttc 3-11-2 CT GgaagaataggtT C 294 1 7512 -17 295 actggaagaataggtt 4-10-2 ACTGgaagaataggTT 295_1 7513 -18 296 tactggaagaataggt 4-10-2 T ACT ggaagaatagGT 296_1 7514 -18 297 tggcttatcctgtact 4-10-2 TGGCttatcctgtaCT 297 1 7526 -25 298 atggcttatcctgtac 2-10-4 ATggcttatcctGTAC 298_1 7527 -22 299 tatggcttatcctgta 4-10-2 TATGgcttatcctgTA 299_1 7528 -22 300 gtatggcttatcctgt 3-10-3 GTAtggcttatccTGT 300_1 7529 -23 301 atgaatatatgcccagt 2-11-4 AT gaatatatgccC AGT 301_1 7547 -22 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 302 gatgaatatatgccca 2-10-4 GAtgaatatatgCCCA 302 1 7549 -22 303 caagatgaatatatgcc 3-10-4 CAAgatgaatataTGCC 303_1 7551 -21 304 gacaacatcagtataga 4-9-4 G AC AacatcagtaT AGA 304 1 7572 -22 305 caagacaacatcagta 4-8-4 C AAG acaacatcAGT A 305_1 7576 -20 306 cactcctagttccttt 3-10-3 CACtcctagttccTTT 306_1 7601 -22 307 aacactcctagttcct 3-10-3 AACactcctagttCCT 307 1 7603 -22 308 taacactcctagttcc 2-11-3 T AacactcctagtT CC 308_1 7604 -20 309 ctaacactcctagttc 2-12-2 CTaacactcctagtTC 309_1 7605 -18 310 tgataacataactgtg 2-12-2 TGataacataactgTG 310_1 7637 -13 311 ctgataacataactgt 2-10-4 CT gataacataaCT GT 311_1 7638 -18 312 tttgaactcaagtgac 4-10-2 TTTGaactcaagtgAC 3121 7654 -16 313 tcctttacttagctag 4-9-3 T CCTttacttagcT AG 313_1 7684 -23 314 gagtttggattagctg 2-11-3 GAgtttggattagCTG 314_1 7764 -20 315 tgggatatgacaggga 2-11-3 TGggatatgacagGGA 315_1 7838 -21 316 tgtgggatatgacagg 4-10-2 T GTGggatatgacaG G 316_1 7840 -22 317 atatggaagggatatc 4-10-2 AT AT ggaagggataT C 3171 7875 -17 318 acaggatatggaaggg 3-10-3 ACAggatatggaaGGG 318_1 7880 -21 319 atttcaacaggatatgg 4-9-4 ATTT caacaggatAT G G 319_1 7885 -20 320 gagtaatttcaacagg 2-11-3 GAgtaatttcaacAGG 320_1 7891 -17 321 agggagtaatttcaaca 4-9-4 AG G G agtaatttc A AC A 3211 7893 -22 322 attagggagtaatttca 4-9-4 ATT AgggagtaatTT C A 322 1 7896 -21 323 cttactattagggagt 2-10-4 CTtactattaggGAGT 323_1 7903 -20 324 cagcttactattaggg 2-11-3 CAgcttactattaGGG 324 1 7906 -20 326 atttcagcttactattag 3-11-4 ATTtcagcttactaTT AG 326_1 7908 -20 325 tcagcttactattagg 3-10-3 TCAgcttactattAGG 325_1 7907 -20 327 ttcagcttactattag 2-10-4 TT cagcttactaTT AG 327 1 7908 -17 328 cagatttcagcttact 4-10-2 CAGAtttcagcttaCT 328_1 7913 -21 329 gactacaactagaggg 3-11-2 GACtacaactagagGG 329_1 7930 -19 330 agactacaactagagg 4-10-2 AG ACtacaactagaG G 330_1 7931 -19 331 aagactacaactagag 2-12-2 AAgactacaactagAG 331_1 7932 -13 332 atgatttaattctagtcaaa 4-12-4 ATG AtttaattctagtC AAA 332 1 7982 -20 333 tttaattctagtcaaa 3-10-3 TTTaattctagtcAAA 333_1 7982 -12 334 gatttaattctagtca 4-8-4 GATTtaattctaGTCA 334 1 7984 -20 771 tgatttaattctagtca 3-10-4 T G AtttaattctaGT C A 771_1 7984 -20 335 atgatttaattctagtca 4-11-3 AT G AtttaattctagT C A 335_1 7984 -20 336 gatgatttaattctagtca 4-13-2 GATGatttaattctagtCA 336_1 7984 -20 337 gatttaattctagtca 2-10-4 GAtttaattctaGTCA 337 1 7984 -18 338 gatgatttaattctagtc 4-11-3 G ATG atttaattctaG T C 338_1 7985 -20 339 tgatttaattctagtc 2-12-2 TGatttaattctagTC 339_1 7985 -13 340 gagatgatttaattcta 4-9-4 G AG AtgatttaatT CT A 340_1 7988 -20 341 gagatgatttaattct 3-10-3 GAGatgatttaatTCT 341_1 7989 -16 342 cagattgatggtagtt 4-10-2 CAGAttgatggtagTT 342 1 8030 -19 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 343 ctcagattgatggtag 2-10-4 CT cagattgatgGTAG 343_1 8032 -20 344 gttagccctcagattg 3-10-3 GTT agccctcagaTT G 344 1 8039 -23 345 tgtattgttagccctc 2-10-4 TGtattgttagcCCTC 345_1 8045 -24 346 acttgtattgttagcc 2-10-4 ACttgtattgttAGCC 346_1 8048 -22 347 agccagtatcagggac 3-11-2 AG Ccagtatcaggg AC 347 1 8191 -23 348 ttgacaatagtggcat 2-10-4 TT gacaatagtgG C AT 348_1 8213 -20 349 acaagtggtatcttct 3-10-3 ACAagtggtatctTCT 349_1 8228 -19 350 aatctactttacaagt 4-10-2 AATCtactttacaaGT 350_1 8238 -16 351 cacagtagatgcctgata 2-12-4 C AcagtagatgcctG AT A 351_1 8351 -24 352 gaacacagtagatgcc 2-11-3 GAacacagtagatGCC 352 1 8356 -21 353 cttggaacacagtagat 4-11-2 CTTGgaacacagtagAT 353_1 8359 -20 354 atatcttggaacacag 3-10-3 AT AtcttggaacaC AG 354 1 8364 -18 355 tctttaatatcttggaac 3-11-4 TCTttaatatcttgGAAC 355_1 8368 -19 356 tgatttctttaatatcttg 2-13-4 T G atttctttaatatCTT G 356_1 8372 -19 357 tgatgatttctttaatatc 2-13-4 TGatgatttctttaaT AT C 357 1 8375 -18 358 aggctaagtcatgatg 3-11-2 AG GctaagtcatgaT G 358_1 8389 -19 359 ttgatgaggctaagtc 4-10-2 TTG AtgaggctaagT C 359_1 8395 -19 360 ccaggattatactctt 3-11-2 CCAggattatactcTT 360_1 8439 -20 361 gccaggattatactct 2-10-4 GCcaggattataCT CT 361_1 8440 -23 362 ctgccaggattatact 3-11-2 CT GccaggattataCT 362 1 8442 -21 363 cagaaacttatactttatg 4-13-2 CAG AaacttatactttaT G 363_1 8473 -19 364 aagcagaaacttatact 4-9-4 AAG C agaaacttaT ACT 364 1 8478 -20 365 gaagcagaaacttatact 3-11-4 G AAgcagaaacttaT ACT 365_1 8478 -20 366 tggaagcagaaacttatact 3-15-2 TGGaagcagaaacttataCT 366_1 8478 -21 367 tggaagcagaaacttatac 3-13-3 TGGaagcagaaacttaT AC 367 1 8479 -20 368 aagcagaaacttatac 2-11-3 AAgcagaaacttaT AC 368_1 8479 -13 369 tggaagcagaaacttata 3-11-4 TG G aagcagaaactT AT A 369_1 8480 -21 370 aagggatattatggag 4-10-2 AAG G gatattatgg AG 370_1 8587 -18 371 tgccggaagatttcct 2-12-2 TGccggaagatttcCT 3711 8641 -21 372 atggattgggagtaga 4-10-2 ATG G attgggagtaG A 372 1 8772 -21 373 agatggattgggagta 2-12-2 AG atggattgggagT A 373_1 8774 -18 374 aagatggattgggagt 3-11-2 AAG atgg attgggaG T 374 1 8775 -18 375 acaagatggattggga 2-10-4 ACaagatggattGGGA 375_1 8777 -20 375 acaagatggattggga 2-12-2 ACaagatggattggGA 375_2 8777 -17 376 agaaggttcagacttt 3-9-4 AGAaggttcagaCTTT 376_1 8835 -20 377 gcagaaggttcagact 2-11-3 GCagaaggttcagACT 377 1 8837 -21 377 gcagaaggttcagact 3-11-2 GCAgaaggttcagaCT 377 2 8837 -22 378 tgcagaaggttcagac 4-10-2 TGCAgaaggttcagAC 378_1 8838 -22 379 agtgcagaaggttcag 2-11-3 AG tgcag aaggttC AG 379_1 8840 -20 379 agtgcagaaggttcag 4-10-2 AGTGcagaaggttcAG 379_2 8840 -21 380 aagtgcagaaggttca 4-10-2 AAGT gcagaaggttC A 380_1 8841 -20 381 taagtgcagaaggttc 2-10-4 T AagtgcagaagGTT C 381_1 8842 -19 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 382 tctaagtgcagaaggt 2-10-4 TCtaagtgcagaAGGT 382 1 8844 -21 383 ctcaggagttctacttc 3-12-2 CT CaggagttctactT C 383_1 8948 -20 384 ctcaggagttctactt 3-10-3 CT CaggagttctaCTT 384 1 8949 -21 385 atggaggtgactcaggag 1-15-2 AtggaggtgactcaggAG 385_1 8957 -20 386 atggaggtgactcagga 2-13-2 ATggaggtgactcagGA 386_1 8958 -21 387 atggaggtgactcagg 2-11-3 AT ggaggtgactcAG G 387 1 8959 -21 388 tatggaggtgactcagg 2-12-3 TAtggaggtgactcAGG 388_1 8959 -21 389 atatggaggtgactcagg 2-14-2 AT atggaggtgactcaGG 389_1 8959 -21 390 tatggaggtgactcag 4-10-2 T AT GgaggtgactcAG 390_1 8960 -21 391 atatggaggtgactcag 2-11-4 AT atggaggtgacT C AG 391_1 8960 -22 392 catatggaggtgactcag 2-14-2 CAtatggaggtgactcAG 392 1 8960 -20 393 atatggaggtgactca 3-10-3 AT AtggaggtgacT C A 393_1 8961 -20 394 catatggaggtgactca 2-12-3 C AtatggaggtgacT C A 394 1 8961 -21 395 catatggaggtgactc 2-10-4 C Atatggaggtg ACT C 395_1 8962 -20 396 gcatatggaggtgactc 2-13-2 GCatatggaggtgacTC 396_1 8962 -21 397 tgcatatggaggtgactc 2-14-2 T GcatatggaggtgacT C 397 1 8962 -21 398 ttgcatatggaggtgactc 1-16-2 TtgcatatggaggtgacTC 398_1 8962 -20 399 tttgcatatggaggtgactc 1-17-2 TttgcatatggaggtgacT C 399_1 8962 -21 400 gcatatggaggtgact 2-12-2 GCatatggaggtgaCT 400_1 8963 -20 401 tgcatatggaggtgact 2-13-2 T GcatatggaggtgaCT 401_1 8963 -20 402 ttgcatatggaggtgact 3-13-2 TT GcatatggaggtgaCT 402 1 8963 -22 403 tttgcatatggaggtgact 1-16-2 TttgcatatggaggtgaCT 403_1 8963 -20 404 tgcatatggaggtgac 3-11-2 TGCatatggaggtgAC 404 1 8964 -20 405 ttgcatatggaggtgac 3-11-3 TTGcatatggaggtGAC 405_1 8964 -21 406 tttgcatatggaggtgac 4-12-2 TTT Gcatatggaggtg AC 406_1 8964 -21 407 tttgcatatggaggtga 4-11-2 TTT GcatatggaggtG A 407 1 8965 -21 408 tttgcatatggaggtg 2-10-4 TTtgcatatggaGGTG 408_1 8966 -21 409 aagtgaagttcaacagc 2-11-4 AAgtgaagttcaaCAGC 409_1 8997 -20 410 tgggaagtgaagttca 2-10-4 T GggaagtgaagTT C A 410_1 9002 -20 411 atgggaagtgaagttc 2-11-3 AT gggaagtgaagTT C 411_1 9003 -17 412 gatgggaagtgaagtt 4-9-3 GAT GggaagtgaaGTT 4121 9004 -21 413 ctgtgatgggaagtgaa 3-11-3 CTGtgatgggaagtGAA 413_1 9007 -20 414 attgagtgaatccaaa 3-10-3 ATT gagtgaatccAAA 414_1 9119 -14 415 aattgagtgaatccaa 2-10-4 AAttgagtgaatCCAA 415_1 9120 -16 416 gataattgagtgaatcc 4-10-3 GAT AattgagtgaaT CC 416_1 9122 -20 417 gtgataattgagtgaa 3-10-3 GTG ataattgagtG AA 4171 9125 -16 418 aagaaaggtgcaataa 3-10-3 AAGaaaggtgcaaT AA 418_1 9155 -14 419 caagaaaggtgcaata 2-10-4 CAagaaaggtgcAAT A 419_1 9156 -15 420 acaagaaaggtgcaat 4-10-2 ACAAgaaaggtgcaAT 420_1 9157 -16 421 atttaaactcacaaac 2-12-2 ATttaaactcacaaAC 4211 9171 -10 422 ctgttaggttcagcga 2-10-4 CTgttaggttcaGCGA 422 1 9235 -24 423 tctgaatgaacatttcg 4-9-4 TCTG aatgaacatTT CG 423_1 9260 -20 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 424 ctcattgaaggttctg 2-10-4 CT cattgaaggtT CT G 424 1 9281 -20 425 ctaatctcattgaagg 3-11-2 CTAatctcattgaaGG 425_1 9286 -17 426 cctaatctcattgaag 2-12-2 CCtaatctcattgaAG 426_1 9287 -16 427 actttgatctttcagc 3-10-3 ACTttgatctttcAGC 427 1 9305 -20 428 actatgcaacactttg 2-12-2 ACtatgcaacacttTG 428_1 9315 -15 429 caaatagctttatcgg 3-10-3 CAAatagctttatCGG 429_1 9335 -17 430 ccaaatagctttatcg 2-10-4 CCaaatagctttAT CG 430_1 9336 -19 431 tccaaatagctttatc 4-10-2 TCCAaatagctttaTC 431_1 9337 -18 432 gatccaaatagcttta 4-10-2 GAT CcaaatagcttT A 432 1 9339 -18 433 atgatccaaatagctt 2-10-4 AT gatccaaataG CTT 433_1 9341 -19 434 tatgatccaaatagct 4-10-2 T ATGatccaaatagCT 434 1 9342 -18 435 taaacagggctgggaat 4-9-4 TAAAcagggctggGAAT 435_1 9408 -22 436 acttaaacagggctgg 2-10-4 ACttaaacagggCT G G 436_1 9412 -21 437 acacttaaacagggct 2-10-4 ACacttaaacagGGCT 437 1 9414 -22 438 gaacacttaaacaggg 4-8-4 GA AC acttaaac AG G G 438_1 9416 -20 439 agagaacacttaaacag 4-9-4 AG AG aacacttaa AC AG 439_1 9418 -20 440 ctacagagaacactta 4-8-4 CT ACagagaacaCTT A 440_1 9423 -20 441 atgctacagagaacact 3-10-4 ATGctacagagaaCACT 441_1 9425 -22 442 ataaatgctacagagaaca 4-11-4 AT AAatgctacagag AAC A 442 1 9427 -20 443 agataaatgctacagaga 2-12-4 AG ataaatgctacaG AG A 443_1 9430 -20 444 tagagataaatgctaca 4-9-4 T AG AgataaatgcT ACA 444 1 9434 -21 445 tagatagagataaatgct 4-11-3 TAGAtagagataaatGCT 445_1 9437 -20 446 caatatactagatagaga 4-10-4 CAATatactagataG AG A 446_1 9445 -21 447 tacacaatatactagatag 4-11-4 T AC Acaatatactag AT AG 447 1 9448 -21 448 ctacacaatatactag 3-10-3 CT AcacaatatacT AG 448_1 9452 -16 449 gctacacaatatacta 4-8-4 G CT Acacaatat ACT A 449_1 9453 -21 450 atatgctacacaatatac 4-10-4 AT AT gctacacaatAT AC 450_1 9455 -20 451 tgatatgctacacaat 4-8-4 TG AT atgctacaC AAT 451_1 9459 -20 452 atgatatgatatgctac 4-9-4 ATG AtatgatatgCT AC 452 1 9464 -21 453 gaggagagagacaataaa 4-10-4 GAGGagagagacaaTAAA 453_1 9495 -20 454 ctaggaggagagagaca 3-11-3 CTAggaggagagagACA 454 1 9500 -22 455 tattctaggaggagaga 4-10-3 T ATTctaggaggag AG A 455_1 9504 -21 456 ttatattctaggaggag 4-10-3 TTATattctaggagGAG 456_1 9507 -21 457 gtttatattctaggag 3-9-4 GTTtatattctaGGAG 457 1 9510 -20 458 tggagtttatattctagg 2-12-4 T GgagtttatattcT AGG 458_1 9512 -22 459 cgtaccaccactctgc 2-11-3 CGtaccaccactcTGC 459_1 9590 -25 460 tgaggaaatcattcattc 4-10-4 T G AGgaaatcattcATT C 460_1 9641 -22 461 tttgaggaaatcattcat 4-10-4 TTTGaggaaatcatT CAT 461_1 9643 -20 462 aggctaatcctatttg 4-10-2 AGGCtaatcctattTG 462 1 9657 -22 463 tttaggctaatcctat 4-8-4 TTT AggctaatcCT AT 463_1 9660 -22 464 tgctccagtgtaccct 3-11-2 TGCtccagtgtaccCT 464 1 9755 -27 465 tagtagtactcgatag 2-10-4 T Agtagtactcg AT AG 465_1 9813 -18 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 466 ctaattgtagtagtactc 3-12-3 CT AattgtagtagtaCT C 466_1 9818 -20 467 tgctaattgtagtagt 2-10-4 TGctaattgtagTAGT 467 1 9822 -19 468 agtgctaattgtagta 4-10-2 AGTGctaattgtagT A 468_1 9824 -19 469 gcaagtgctaattgta 4-10-2 GCAAgtgctaattgT A 469_1 9827 -20 470 gaggaaatgaactaattta 4-13-2 G AGG aaatgaactaattT A 470_1 9881 -18 471 caggaggaaatgaacta 4-11-2 C AG G agg aaatgaacT A 4711 9886 -19 472 ccctagagtcatttcc 2-11-3 CCctagagtcattTCC 472 1 9902 -24 473 atcttacatgatgaagc 3-11-3 ATCttacatgatgaAGC 473_1 9925 -20 475 agacacactcagatttcag 2-15-2 AG acacactcagatttcAG 475_1 9967 -20 474 gacacactcagatttcag 3-13-2 GACacactcagatttcAG 474 1 9967 -20 476 aagacacactcagatttcag 3-15-2 AAGacacactcagatttcAG 476_1 9967 -21 477 agacacactcagatttca 2-13-3 AG acacactcagattT C A 477_1 9968 -20 478 aagacacactcagatttca 3-13-3 AAGacacactcagattT CA 478_1 9968 -21 479 aaagacacactcagatttca 2-14-4 AAagacacactcagatTT C A 479_1 9968 -20 480 gaaagacacactcagatttc 3-14-3 G AAagacacactcagatTT C 480_1 9969 -20 481 aagacacactcagatttc 4-11-3 AAGAcacactcagatTTC 481_1 9969 -21 482 aaagacacactcagatttc 4-11-4 AAAGacacactcagaTTT C 482 1 9969 -20 483 tgaaagacacactcagattt 4-14-2 T G AAagacacactcagatTT 483_1 9970 -20 484 tgaaagacacactcagatt 2-13-4 TGaaagacacactcaG ATT 484 1 9971 -21 485 tgaaagacacactcagat 3-12-3 TGAaagacacactcaGAT 485_1 9972 -20 486 attgaaagacacactca 4-10-3 ATTGaaagacacacT CA 486_1 9975 -19 487 tcattgaaagacacact 2-11-4 T CattgaaagacaC ACT 487 1 9977 -18 488 ttccatcattgaaaga 3-9-4 TTCcatcattgaAAGA 488_1 9983 -18 489 ataataccacttatcat 4-9-4 AT AAtaccacttaT CAT 489_1 10010 -20 490 ttacttaatttctttgga 2-12-4 TT acttaatttcttTGG A 490_1 10055 -20 491 ttagaactagctttatca 3-12-3 TT AgaactagctttaT C A 491_1 10101 -20 492 gaggtacaaatatagg 3-10-3 G AGgtacaaatatAG G 492 1 10171 -18 493 cttatgatacaactta 3-10-3 CTT atgatacaacTT A 493_1 10384 -15 494 tcttatgatacaactt 2-11-3 TCttatgatacaaCTT 494 1 10385 -15 495 ttcttatgatacaact 3-11-2 TTCttatgatacaaCT 495_1 10386 -15 496 cagtttcttatgatac 2-11-3 CAgtttcttatgaTAC 496_1 10390 -16 497 gcagtttcttatgata 3-11-2 GCAgtttcttatgaTA 497 1 10391 -19 498 tacaaatgtctattaggtt 4-12-3 TACAaatgtctattagGTT 498_1 10457 -21 499 tgtacaaatgtctattag 4-11-3 TGT AcaaatgtctatT AG 499_1 10460 -20 500 agcatcacaattagta 3-11-2 AG CatcacaattagT A 500_1 10535 -18 501 ctaatgatagtgaagc 3-11-2 CT Aatgatagtg aaG C 501_1 10548 -17 502 agctaatgatagtgaa 3-11-2 AGCtaatgatagtgAA 502 1 10550 -16 503 atgccttgacatatta 4-10-2 ATGCcttgacatatTA 503_1 10565 -20 504 ctcaagattattgacac 4-9-4 CT C Aagattattg AC AC 504 1 10623 -20 505 acctcaagattattga 2-10-4 ACctcaagattaTTG A 505_2 10626 -18 505 acctcaagattattga 3-9-4 ACCtcaagattaTTGA 505_1 10626 -20 506 aacctcaagattattg 4-10-2 AACCtcaagattatT G 506_1 10627 -17 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 507 cacaaacctcaagattatt 4-13-2 CACAaacctcaagattaTT 507 1 10628 -20 508 gtacttaattagacct 3-9-4 GT Acttaattag ACCT 508_1 10667 -21 509 agtacttaattagacc 4-9-3 AG T Acttaattag AC C 509_1 10668 -20 510 gtatgaggtggtaaac 4-10-2 GTAT gaggtggtaaAC 510_1 10688 -18 511 aggaaacagcagaagtg 2-11-4 AGgaaacagcagaAGTG 511_1 10723 -21 512 gcacaacccagaggaa 2-12-2 GCacaacccagaggAA 5121 10735 -20 513 caagcacaacccagag 3-11-2 CAAgcacaacccagAG 513_1 10738 -20 514 ttcaagcacaacccag 3-10-3 TT CaagcacaaccC AG 5141 10740 -21 515 aattcaagcacaaccc 2-10-4 AAttcaagcacaACCC 515_1 10742 -20 516 taataattcaagcacaacc 4-13-2 T AAT aattcaagcacaaCC 516_1 10743 -20 517 actaataattcaagcac 4-9-4 ACT AataattcaaGC AC 5171 10747 -20 518 ataatactaataattcaagc 4-12-4 AT AAtactaataattcAAG C 518_1 10749 -19 519 tagatttgtgaggtaa 2-10-4 T AgatttgtgagGT AA 519_1 11055 -18 520 agccttaattctccat 4-10-2 AGCCttaattctccAT 520_1 11091 -24 521 aatgatctagagcctta 4-9-4 AATGatctagagcCTT A 5211 11100 -22 522 ctaatgatctagagcc 3-10-3 CT AatgatctagaG CC 522 1 11103 -22 523 actaatgatctagagc 3-9-4 ACT aatgatctaG AG C 523_1 11104 -21 524 cattaacatgttcttatt 3-11-4 C ATtaacatgttctT ATT 524 1 11165 -19 525 acaagtacattaacatgttc 4-12-4 ACAAgtacattaacatGTT C 525_1 11170 -22 526 ttacaagtacattaacatg 4-11-4 TT ACaagtacattaaC AT G 526_1 11173 -20 527 gctttattcatgtttat 4-9-4 GCTTtattcatgtTT AT 527 1 11195 -22 528 gctttattcatgttta 3-11-2 GCTttattcatgttTA 528_1 11196 -18 529 agagctttattcatgttt 3-13-2 AG AgctttattcatgtTT 529_1 11197 -20 530 ataagagctttattcatg 4-10-4 AT AAgagctttattC AT G 530_1 11200 -21 531 cataagagctttattca 4-9-4 CAT AagagctttaTT C A 531_1 11202 -21 532 agcataagagctttat 4-8-4 AG C Ataag agctTT AT 532 1 11205 -22 533 tagattgtttagtgca 3-10-3 TAGattgtttagtGCA 533_1 11228 -20 534 gtagattgtttagtgc 2-10-4 GTagattgtttaGTGC 534 1 11229 -21 535 gacaattctagtagatt 4-9-4 GACAattctagtaGATT 535_1 11238 -21 536 ctgacaattctagtag 3-9-4 CTGacaattctaGT AG 536_1 11241 -20 537 gctgacaattctagta 4-10-2 G CTG acaattctagT A 537 1 11242 -21 538 aggattaagatacgta 2-12-2 AG gattaag atacgT A 538_1 11262 -15 539 caggattaagatacgt 2-11-3 C Agg attaag ataCG T 539_1 11263 -17 540 tcaggattaagatacg 3-11-2 T C AggattaagataCG 540_1 11264 -16 541 ttcaggattaagatac 2-10-4 TT caggattaag AT AC 5411 11265 -15 542 aggaagaaagtttgattc 4-10-4 AG G Aagaaagtttg ATT C 542 1 11308 -21 543 tcaaggaagaaagtttga 4-10-4 T C AAggaagaaagtTTG A 543_1 11311 -20 544 ctcaaggaagaaagtttg 4-10-4 CT C AaggaagaaagTTT G 544 1 11312 -20 545 tgctcaaggaagaaagt 3-10-4 TGCtcaaggaagaAAGT 545_1 11315 -21 546 aattatgctcaaggaaga 4-11-3 AATT atgctcaaggaAG A 546_1 11319 -20 547 taggataccacattatga 4-12-2 T AG G ataccacattatG A 547 1 11389 -22 548 cataatttattccattcctc 2-15-3 C AtaatttattccattcCT C 548_1 11449 -22 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 549 tgcataatttattccat 4-10-3 TGCAtaatttattcCAT 549_1 11454 -22 550 actgcataatttattcc 4-10-3 ACTGcataatttatT CO 550_1 11456 -21 551 ctaaactgcataatttatt 4-11-4 CT AAactgcataattT ATT 551_1 11458 -20 552 ataactaaactgcata 2-10-4 AT aactaaactgC AT A 552 1 11465 -16 553 ttattaataactaaactgc 3-12-4 TT AttaataactaaaCT G C 553_1 11468 -19 554 tagtacattattaataact 4-13-2 TAGT acattattaataaCT 554 1 11475 -18 555 cataactaaggacgtt 4-10-2 CAT AactaaggacgTT 555_1 11493 -17 556 tcataactaaggacgt 2-11-3 T CataactaaggaCGT 556_1 11494 -16 557 cgtcataactaaggac 4-10-2 CGT Cataactaagg AC 557 1 11496 -17 558 tcgtcataactaagga 2-12-2 TCgtcataactaagGA 558_1 11497 -16 559 atcgtcataactaagg 2-10-4 AT cgtcataact A AG G 559_1 11498 -17 560 gttagtatcttacatt 2-11-3 GTtagtatcttacATT 560_1 11525 -15 561 ctctattgttagtatc 3-10-3 CTCtattgttagtATC 561_1 11532 -17 562 agtatagagttactgt 3-10-3 AGT atagagttacT GT 562 1 11567 -19 563 ttcctggtgatacttt 4-10-2 TTCCtggtgatactTT 563_1 11644 -21 564 gttcctggtgatactt 4-10-2 GTT CctggtgatacTT 564 1 11645 -21 565 tgttcctggtgatact 2-12-2 TGttcctggtgataCT 565_1 11646 -20 566 ataaacatgaatctctcc 2-12-4 AT aaacatgaatctCT CC 566_1 11801 -20 567 ctttataaacatgaatctc 3-12-4 CTTtataaacatgaaT CT C 567 1 11804 -19 568 ctgtctttataaacatg 3-10-4 CT GtctttataaaC AT G 568_1 11810 -19 569 ttgttataaatctgtctt 2-12-4 TT gttataaatctgT CTT 569_1 11820 -18 570 ttaaatttattcttggata 3-12-4 TT AaatttattcttgG AT A 570_1 11849 -19 571 cttaaatttattcttgga 2-12-4 CTtaaatttattctT G G A 5711 11851 -19 572 cttcttaaatttattcttg 4-13-2 CTT CttaaatttattctT G 572 1 11853 -18 573 tatgtttctcagtaaag 4-9-4 T AT GtttctcagtAAAG 573_1 11877 -19 574 gaattatctttaaacca 3-10-4 GAAttatctttaaACCA 574 1 11947 -18 575 cccttaaatttctaca 3-11-2 CCCttaaatttctaCA 575_1 11980 -20 576 acactgctcttgtacc 4-10-2 ACACtgctcttgtaCC 576_1 11995 -23 577 tgacaacactgctctt 3-10-3 T G AcaacactgctCTT 577_1 12000 -21 578 tacatttattgggctc 4-10-2 TACAtttattgggcTC 578_1 12081 -19 579 gtacatttattgggct 2-10-4 GTacatttattgGGCT 579_1 12082 -23 580 ttggtacatttattgg 3-10-3 TTGgtacatttatTGG 580_1 12085 -18 581 catgttggtacatttat 4-10-3 C ATG ttggtacattT AT 581_1 12088 -21 582 aatcatgttggtacat 4-10-2 AATCatgttggtacAT 582 1 12092 -16 583 aaatcatgttggtaca 2-12-2 AAatcatgttggtaCA 583_1 12093 -14 584 gacaagtttggattaa 3-11-2 GACaagtttggattAA 584 1 12132 -14 585 aatgttcagatgcctc 2-10-4 AAtgttcagatgCCT C 585_1 12197 -21 586 gcttaatgttcagatg 2-12-2 GCttaatgttcagaTG 586_1 12201 -17 587 cgtacatagcttgatg 4-10-2 CGT AcatagcttgaT G 587 1 12267 -20 588 gtgaggaattaggata 3-11-2 GTG aggaattaggaT A 588_1 12753 -17 589 gtaacaatatggtttg 3-11-2 GTAacaatatggttTG 589_1 12780 -15 590 gaaatattgtagacta 2-11-3 GAaatattgtagaCTA 590_1 13151 -14 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 591 ttgaaatattgtagac 3-11-2 TTGaaatattgtagAC 591_1 13153 -12 592 aagtctagtaatttgc 2-10-4 AAgtctagtaatTTGC 592 1 13217 -17 593 gctcagtagattataa 4-10-2 GCTCagtagattatAA 593_1 13259 -17 594 catacactgttgctaa 3-10-3 CAT acactgttgcT AA 594 1 13296 -19 595 atggtctcaaatcatt 3-10-3 AT G gtctcaaatc ATT 595_1 13314 -17 596 caatggtctcaaatca 4-10-2 C AAT ggtctcaaatC A 596_1 13316 -18 597 ttcctattgattgact 4-10-2 TTCCtattgattgaCT 597 1 13568 -20 598 tttctgttcacaacac 4-10-2 TTT CtgttcacaacAC 598_1 13600 -17 599 aggaacccactaatct 2-11-3 AGgaacccactaaT CT 599_1 13702 -20 600 taaatggcaggaaccc 3-11-2 T AAatggcaggaacCC 600_1 13710 -19 601 gtaaatggcaggaacc 4-10-2 GT AAatggcaggaaCC 601_1 13711 -20 602 ttgtaaatggcaggaa 2-11-3 TT gtaaatggcagG AA 602 1 13713 -16 603 ttatgagttaggcatg 2-10-4 TT atgagttaggC AT G 603_1 13835 -19 604 ccaggtgaaactttaa 3-11-2 CCAggtgaaactttAA 604 1 13935 -17 605 cccttagtcagctcct 3-10-3 CCCttagtcagctCCT 605_1 13997 -30 606 acccttagtcagctcc 2-10-4 ACccttagtcagCT CC 606_1 13998 -27 607 cacccttagtcagctc 2-11-3 C AcccttagtcagCT C 607 1 13999 -24 608 tctcttactaggctcc 3-10-3 T CT cttactaggcT CC 608_1 14091 -24 609 cctatctgtcatcatg 2-11-3 CCtatctgtcatcATG 609_1 14178 -20 610 tcctatctgtcatcat 3-11-2 TCCtatctgtcatcAT 610_1 14179 -20 611 gagaagtgtgagaagc 3-11-2 GAGaagtgtgagaaGC 611_1 14808 -19 612 catccttgaagtttag 4-10-2 CATCcttgaagtttAG 6121 14908 -19 613 taataagatggctccc 3-10-3 TAAtaagatggctCCC 613_1 15046 -21 614 caaggcataataagat 3-11-2 CAAggcataataagAT 614_1 15053 -14 615 ccaaggcataataaga 2-10-4 CCaaggcataatAAGA 615_1 15054 -18 616 tgatccaattctcacc 2-12-2 TGatccaattctcaCC 616_1 15151 -19 617 atgatccaattctcac 3-10-3 AT G atccaattctC AC 6171 15152 -19 618 cgcttcatcttcaccc 3-11-2 CGCttcatcttcacCC 618_1 15260 -26 619 tatgacactgcatctt 2-10-4 T AtgacactgcaT CTT 619_1 15317 -19 620 gtatgacactgcatct 3-10-3 GT AtgacactgcaT CT 620_1 15318 -21 621 tgtatgacactgcatc 2-10-4 T GtatgacactgC AT C 6211 15319 -20 622 ttctcttctgtaagtc 4-10-2 TTCTcttctgtaagTC 622 1 15363 -19 623 ttctacagaggaacta 2-10-4 TT ctacagaggaACT A 623_1 15467 -17 624 actacagttctacaga 3-10-3 ACT acagttctacAG A 624 1 15474 -19 625 ttcccacaggtaaatg 4-10-2 TT CCcacaggtaaaT G 625_1 15561 -21 626 attatttgaatatactcatt 4-12-4 ATT AtttgaatatactC ATT 626_1 15594 -20 627 tgggaggaaattatttg 4-10-3 TG G G aggaaattatTT G 627 1 15606 -20 628 tgactcatcttaaatg 4-10-2 T G ACtcatcttaaaT G 628_1 15621 -17 629 ctgactcatcttaaat 3-11-2 CTGactcatcttaaAT 629_1 15622 -16 630 tttactctgactcatc 3-10-3 TTT actctgactcAT C 630_1 15628 -17 631 tattggaggaattatt 3-11-2 TATtggaggaattaTT 631_1 15642 -14 632 gtattggaggaattat 3-11-2 GTAttggaggaattAT 632 1 15643 -16 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 633 tggtatacttctctaagtat 2-15-3 T GgtatacttctctaagT AT 633_1 15655 -22 634 gatctcttggtatact 4-10-2 GATCtcttggtataCT 634 1 15666 -20 635 cagacaactctatacc 2-12-2 CAgacaactctataCC 635_1 15689 -18 636 aacatcagacaactcta 4-9-4 AAC Atcag acaacT CT A 636_1 15693 -21 637 taacatcagacaactc 4-10-2 T AACatcagacaacT C 637 1 15695 -16 638 tttaacatcagacaactc 4-10-4 TTT AacatcagacaACT C 638_1 15695 -20 639 atttaacatcagacaa 2-12-2 ATttaacatcagacAA 639_1 15698 -11 640 cctatttaacatcagac 2-11-4 CCtatttaacatcAGAC 640_1 15700 -20 641 tccctatttaacatca 3-10-3 TCCctatttaacaTCA 641_1 15703 -21 642 tcaacgactattggaat 4-9-4 T CAAcgactattgG AAT 642 1 15737 -20 643 cttatattctggctat 4-9-3 CTT AtattctggcT AT 643_1 15850 -20 644 atccttatattctggc 4-10-2 ATCCttatattctgGC 644 1 15853 -23 645 gatccttatattctgg 2-10-4 GAtccttatattCTGG 645_1 15854 -21 646 tgatccttatattctg 3-10-3 TGAtccttatattCTG 646_1 15855 -19 647 attgaaacttgatcct 4-8-4 ATTGaaacttgaT CCT 647 1 15864 -21 648 actgtcattgaaactt 2-10-4 ACtgtcattgaaACTT 648_1 15870 -16 649 tcttactgtcattgaa 3-11-2 TCTtactgtcattgAA 649_1 15874 -16 650 aggatcttactgtcatt 2-11-4 AGgatcttactgtCATT 650_1 15877 -21 651 gcaaatcaactccatc 3-10-3 GCAaatcaactccATC 651_1 15896 -20 652 gtgcaaatcaactcca 3-10-3 GT GcaaatcaactCC A 652 1 15898 -22 653 caattatttctttgtgc 4-10-3 CAATtatttctttgTGC 653_1 15910 -21 654 tggcaacaattatttctt 3-11-4 TGGcaacaattattT CTT 654 1 15915 -21 655 gctggcaacaattatt 3-9-4 G CTggcaacaatT ATT 655_1 15919 -21 656 atccatttctactgcc 4-10-2 ATCCatttctactgCC 656_1 15973 -24 657 taatatctattgatttcta 4-11-4 T AAT atctattgattT CT A 657 1 15988 -20 658 tcaatagtgtagggca 2-12-2 T CaatagtgtagggC A 658_1 16093 -18 659 ttcaatagtgtagggc 3-11-2 TT CaatagtgtaggG C 659_1 16094 -19 660 aggttaattaattcaatag 4-11-4 AG GTtaattaattcaAT AG 660_1 16102 -21 661 catttgtaatccctag 3-10-3 CATttgtaatcccTAG 661_2 16163 -20 661 catttgtaatccctag 3-9-4 C ATttgtaatccCT AG 661_1 16163 -22 662 acatttgtaatcccta 3-10-3 ACAtttgtaatccCTA 662 1 16164 -20 663 aacatttgtaatccct 2-10-4 AAcatttgtaatCCCT 663_2 16165 -21 663 aacatttgtaatccct 3-9-4 AACatttgtaatCCCT 663_1 16165 -22 664 taaatttcaagttctg 2-11-3 TAaatttcaagttCTG 664 1 16184 -14 665 gtttaaatttcaagttct 3-11-4 GTTtaaatttcaagTT CT 665_1 16185 -19 666 ccaagtttaaatttcaag 4-10-4 CCAAgtttaaatttCAAG 666_1 16189 -21 667 acccaagtttaaatttc 4-9-4 ACCCaagtttaaaTTT C 667 1 16192 -22 668 catacagtg acccaagttt 2-14-3 CAtacagtgacccaagTTT 668_1 16199 -23 669 acatcccatacagtga 2-11-3 ACatcccatacagT GA 669_1 16208 -21 670 agcacagctctacatc 2-10-4 AGcacagctctaCAT C 670_1 16219 -22 671 atatagcacagctcta 3-9-4 AT AtagcacagcT CT A 6711 16223 -21 672 tccatatagcacagct 3-11-2 T CCatatagcacagCT 672 1 16226 -22 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 673 atttccatatagcaca 3-9-4 ATTtccatatagCACA 673_1 16229 -20 674 tttatttccatatagca 4-9-4 TTT Atttccatat AG C A 674 1 16231 -22 675 tttatttccatatagc 3-10-3 TTTatttccatatAGC 675_1 16232 -18 676 aaggagaggagattatg 4-9-4 AAGG agaggagatT AT G 676_1 16409 -21 677 agttcttgtgttagct 3-11-2 AGTtcttgtgttagCT 677 1 16456 -21 678 gagttcttgtgttagc 2-12-2 GAgttcttgtgttaGC 678_1 16457 -20 679 attaattatccatccac 3-10-4 ATT aattatccatCCAC 679_1 16590 -21 680 atcaattaattatccatc 3-11-4 AT CaattaattatcC AT C 680_1 16593 -19 681 agaatcaattaattatcc 3-12-3 AG AatcaattaattaT CO 681_1 16596 -18 682 tgagataccgtgcatg 2-12-2 TGagataccgtgcaT G 682 1 16656 -18 683 aatgagataccgtgca 2-10-4 AAtgagataccgTGCA 683_1 16658 -21 684 ctgtggttaggctaat 3-11-2 CTGtggttaggctaAT 684 1 16834 -19 685 aagagtaagggtctgtggtt 1-17-2 AagagtaagggtctgtggTT 685_1 16842 -21 686 gatgggttaagagtaa 4-9-3 GAT GggttaagagT AA 686_1 16854 -19 687 agcagatgggttaaga 3-11-2 AG CagatgggttaaG A 687 1 16858 -20 688 tgtaaacatttgtagc 2-10-4 T GtaaacatttgT AGO 688_1 16886 -19 689 cctgcttataaatgta 3-11-2 CCTgcttataaatgTA 689_1 16898 -19 690 tgccctgcttataaat 4-10-2 TGCCctgcttataaAT 690_1 16901 -23 691 tcttcttagttcaata 2-12-2 TCttcttagttcaaTA 691_1 16935 -15 692 tggtttctaactacat 2-10-4 TGgtttctaactACAT 692 1 16980 -18 693 agtttggtttctaacta 2-12-3 AGtttggtttctaaCTA 693_1 16983 -19 694 gaatgaaacttgcctg 3-10-3 G AAtgaaacttgcCT G 694 1 17047 -18 695 attatccttacatgat 3-10-3 ATTatccttacatGAT 695_1 17173 -17 696 gtacccaattatcctt 2-11-3 GTacccaattatcCTT 696_1 17180 -21 697 tgtacccaattatcct 3-10-3 TGT acccaattatCCT 697 1 17181 -24 698 ttgtacccaattatcc 2-11-3 TTgtacccaattaTCC 698_1 17182 -20 699 tttgtacccaattatc 3-11-2 TTTgtacccaattaTC 699_1 17183 -17 700 agcagcaggttatatt 4-10-2 AG C AgcaggttataTT 700_1 17197 -22 701 tgggaagtggtctggg 3-10-3 T G G gaagtggtctG G G 701_1 17292 -25 702 ctggagagtgataata 3-11-2 CT GgagagtgataaT A 702 1 17322 -17 703 aatgctggattacgtc 4-10-2 AAT GctggattacgT C 703_1 17354 -19 704 caatgctggattacgt 2-11-3 CAatgctggattaCGT 704 1 17355 -19 705 ttgttcagaagtatcc 2-10-4 TT gttcagaagtAT CC 705_1 17625 -19 706 gatgatttgcttggag 2-10-4 GAtgatttgcttGGAG 706_1 17646 -21 707 gaaatcattcacaacc 3-10-3 GAAatcattcacaACC 707 1 17860 -17 708 ttgtaacatctactac 3-10-3 TT G taacatctacT AC 708_1 17891 -16 709 cattaagcagcaagtt 3-11-2 CATtaagcagcaagTT 709_1 17923 -17 710 ttactagatgtgagca 3-11-2 TTActagatgtgagCA 710_1 17942 -18 711 tttactagatgtgagc 2-11-3 TTtactagatgtgAGC 7111 17943 -18 712 gaccaagcaccttaca 3-11-2 GACcaagcaccttaCA 7121 17971 -22 713 agaccaagcaccttac 3-10-3 AG AccaagcacctT AC 713_1 17972 -22 714 atgggttaaataaagg 2-10-4 AT gggttaaata AAG G 7141 18052 -15 2024203581   29 May 2024 SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG 715 tcaaccagagtattaa 2-12-2 TCaaccagagtattAA 715_1 18067 -13 716 gtcaaccagagtatta 3-11-2 GT CaaccagagtatT A 716_1 18068 -18 717 attgtaaagctgatat 2-11-3 ATtgtaaagctgaT AT 717_1 18135 -14 718 cacataattgtaaagc 2-10-4 C Acataattgta A AG C 718_1 18141 -16 719 gaggtctgctatttac 2-11-3 GAggtctgctattTAC 719_1 18274 -19 720 tgtagattcaatgcct 2-11-3 TGtagattcaatgCCT 720_1 18404 -20 721 cctcattatactatga 2-11-3 CCtcattatactaTGA 7211 18456 -19 722 ccttatgctatgacac 2-12-2 CCttatgctatgacAC 722 1 18509 -18 723 tccttatgctatgaca 4-10-2 TCCTtatgctatgaCA 723_1 18510 -22 724 aagatgtttaagtata 3-10-3 AAGatgtttaagtATA 724 1 18598 -13 725 ctgattattaagatgt 2-10-4 CTgattattaagATGT 725_1 18607 -17 726 tggaaaggtatgaatt 2-12-2 T GgaaaggtatgaaTT 726_1 18808 -13 727 acttgaatggcttgga 2-12-2 ACttgaatggcttgGA 727 1 18880 -18 728 aacttgaatggcttgg 3-10-3 AACttgaatggctTGG 728_1 18881 -19 729 caatgtgttactattt 4-10-2 CAATgtgttactatTT 729_1 19004 -16 730 acaatgtgttactatt 3-10-3 ACAatgtgttactATT 730_1 19005 -15 731 catctgctatataaga 4-10-2 CAT CtgctatataaG A 731_1 19063 -18 732 cctagagcaaatactt 4-10-2 CCT AgagcaaatacTT 732 1 19223 -20 733 cagagttaataataag 3-10-3 C AG agttaataat A AG 733_1 19327 -13 734 gttcaagcacaacgaa 4-10-2 GTT Caagcacaacg AA 734 1 19493 -18 735 agggttcaagcacaac 2-11-3 AG ggttcaagcac A AC 735_1 19496 -18 736 tgttggagacactgtt 2-12-2 TGttggagacactgTT 736_1 19677 -17 737 aaggaggagttaggac 3-11-2 AAGgaggagttaggAC 737 1 19821 -18 738 ctatgccatttacgat 4-10-2 CT AT gccatttacg AT 738_1 19884 -21 739 tcaaatgcagaattag 2-12-2 T CaaatgcagaattAG 739_1 19913 -12 740 agtgacaatcaaatgc 2-10-4 AG tgacaatcaa AT G C 740_1 19921 -18 741 aagtgacaatcaaatg 2-11-3 AAgtgacaatcaaAT G 7411 19922 -12 742 gtgtaccaagtaacaa 3-11-2 GTGtaccaagtaacAA 742 1 19978 -16 743 tgggatgttaaactga 3-10-3 T G G gatgttaaacT G A 743_1 20037 -20 Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide. Designs refer to the gapmer design, F-G-F’, where each number represents the number of consecutive modified nucleosides, e.g. 2’ modified nucleosides (first number=5’ flank), followed by the number of DNA nucleosides (second number= gap region), followed by the number of modified nucleosides, e.g. 2’ 5 modified nucleosides (third number=3’ flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is complementary to the target nucleic acid. Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl 10 cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages. 2024203581   29 May 2024 Table 6: Oligonucleotides targeting mouse PD-L1 transcript (SEQ ID NO: 4) designs of these, as well as specific oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence. SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start on SEQ ID NO: 4 dG 744 agtttacattttctgc 3-10-3 AGTttacattttcTGC 744 1 4189 -20 745 tatgtgaagaggagag 3-10-3 TATgtgaagaggaGAG 745_1 7797 -19 746 cacctttaaaacccca 3-10-3 CACctttaaaaccCCA 746_1 9221 -23 747 tcctttataatcacac 3-10-3 TCCtttataatcaCAC 747_1 10386 -19 748 acggtattttcacagg 3-10-3 ACGgtattttcacAGG 748_1 12389 -21 749 gacactacaatgagga 3-10-3 GACactacaatgaGGA 749_1 15088 -20 750 tggtttttaggactgt 3-10-3 TGGtttttaggacTGT 750_1 16410 -21 751 cgacaaattctatcct 3-10-3 CGAcaaattctatCCT 751_1 18688 -20 752 tgatatacaatgctac 3-10-3 T G AtatacaatgcT AC 752 1 18735 -16 753 tcgttgggtaaattta 3-10-3 TCGttgggtaaatTTA 753_1 19495 -17 754 tgctttataaatggtg 3-10-3 TGCtttataaatgGTG 754 1 19880 -19 Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide. 5 Designs refer to the gapmer design, F-G-F’, where each number represents the number of consecutive modified nucleosides, e.g. 2’ modified nucleosides (first number=5’ flank), followed by the number of DNA nucleosides (second number= gap region), followed by the number of modified nucleosides, e.g. 2’ modified nucleosides (third number=3’ flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is 10 complementary to the target nucleic acid. Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages. Table 7: Oligonucleotide motif sequences and antisense compounds with 5’ ca biocleavable 15 linker. SEQ ID NO motif sequence oligonucleotide compound with ca linker CMP ID NO 755 caagtttacattttctgc coao AG TttacattttcT G C 755_1 756 catatgtgaagaggagag coaoT AT gtgaagaggaG AG 756_1 757 cacctttaaaacccca coaoCACctttaaaaccCCA 757_1 758 catcctttataatcacac coaoT CCtttataatcaC AC 758_1 759 caacggtattttcacagg coao ACG gtattttcac AG G 759_1 760 cagacactacaatgagga coaoGACactacaatgaGGA 760_1 761 catggtttttaggactgt coaoTGGtttttaggacTGT 761_1 762 cacgacaaattctatcct coaoCGAcaaattctatCCT 762 1 763 catgatatacaatgctac coaoT G AtatacaatgcT AC 763_1 764 catcgttgggtaaattta coaoT CGttgggtaaatTT A 764 1 765 catgctttataaatggtg coaoT G CtttataaatgG T G 765_1 2024203581   29 May 2024 SEQ ID NO motif sequence oligonucleotide compound with ca linker CMP ID NO 766 caacaaataatggttactct coaoAC AAataatggttaCT CT 766_1 767 cacagattgatggtagtt coaoCAGAttgatggtagTT 767 1 768 cacctatttaacatcagac coaoCCtatttaacatcAGAC 768_1 769 cactaattgtagtagtactc coaoCT AattgtagtagtaCT C 769_1 770 caataaacatgaatctctcc coaoAT aaacatgaatctCT CC 770_1 Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester internucleoside linkage and unless otherwise indicated other internucleoside linkages are phosphorothioate internucleoside linkages. Table 8: GalNAc conjugated antisense oligonucleotide compounds. antisense oligonucleotide conjugate CMP ID NO G N2-C60c0a0AGTttacattttcT G C 755_2 G N2-C60c0a0T AT gtgaagaggaG AG 756_2 G N2-C60c0a0C ACctttaaaaccCC A 757 2 G N2-C60c0a0T CCtttataatcaC AC 758_2 GN2-C60c0a0ACGgtattttcacAGG 759_2 G N2-C60c0a0G ACactacaatgaGG A 760_2 G N2-C60c0a0TGGtttttaggacT GT 761_2 G N2-C60c0a0CG AcaaattctatCCT 762 2 G N2-C60c0a0T G AtatacaatgcT AC 763_2 G N2-C60c0a0T CGttgggtaaatTT A 764_2 G N2-C60c0a0TGCtttataaatgGTG 765_2 G N2-C60c0a0AC AAataatggttaCT CT 766_2 G N2-C60c0a0CAG AttgatggtagTT 767 2 G N2-C60c0a0CCtatttaacatcAG AC 768_2 G N2-C60c0a0CT AattgtagtagtaCT C 769_2 G N2-C60c0a0AT aaacatgaatctCT CC 770_2 5 GN2 represents the trivalent GalNAc cluster shown in Figure 3, C6 represents an amino alkyl group with 6 carbons, capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester nucleoside linkage and unless otherwise indicated internucleoside linkages are phosphorothioate internucleoside linkages. Chemical drawings representing some of the molecules are shown in figures 4 to 8. 10  A A V / HB V mouse models Pasteur model: HLA-A2.1- / HLA-DR1-transgenic H-2 class l- / class ll-knockout (here referred to as HLA-A2 / DR1) mice were created and bred at the Institut Pasteur. These mice represent an in vivo experimental model for human immune function studies without any interference with mouse 15 MHC response (Pajot et al 2004 Eur J Immunol. 34(11 ):3060-9. 2024203581   29 May 2024 Adeno-associated virus (AAV) vector, AAV serotype 2 / 8 carrying a replication competent HBV DNA genome was used in these studies. The AAV-HBV vector (batch GVPN #6163) was diluted in sterile Phosphate buffered Saline (PBS) to reach a titer of 5 x 1011 vg / mL. Mice were injected intravenously (i.v.) with 1OOpL of this diluted solution (dose / mouse: 5 x 1010 vg) in a tail 5 vein. Complete viral particles containing HBV DNA were detected in the blood of HBV-carrier mice. HBcAg was detected for up to one year in the liver together with HBV circulating proteins HBeAg and HBsAg in the blood. In all AAV2 / 8-HBV-transduced mice, HBsAg, HBeAg, and HBV DNA persisted in serum for at least one year (Dion et al 2013 J Virol 87:5554-5563). Shanghai model: 0 In this model, mice infected with a recombinant adeno-associated virus (AAV) carrying the HBV genome (AAV / HBV) maintains stable viremia and antigenimia for more than 30 weeks (Dan Yang, et al. 2014 Cellular & Molecular Immunology 11,71-78). Male C57BL / 6 mice (4-6 weeks old), specific pathogen free, were purchased from SLAG (Shanghai Laboratory Animal Center of Chinese Academy of Sciences) and housed in an 15 animal care facility in individually ventilated cages. Guidelines were followed for the care and use of animals as indicated by WuXi IACUC (Institutional Animal Care and Use Committee, WUXI IACUC protocol number R20131126-Mouse). Mice were allowed to acclimate to the new environment for 3 days and are grouped according to the experimental design. Recombinant AAV-HBV was diluted in PBS, 200 pL per injection. This recombinant virus carries 20   1.3 copies of the HBV genome (genotype D, serotype ayw). On day 0, all mice were injected through tail vein with 200 pL AAV-HBV. On days 6, 13 and 20 after AAV injection, all mice in were submandibularly bled (0.1 ml blood / mouse) for serum collection. On day 22 post injection, mice with stable viremia were ready for oligonucleotide treatment. The oligonucleotides can be unconjugated or GalNAc conjugated. 25 DNA vaccine Plasmid DNA were endotoxin-free and manufactured by Plasmid-Factory (Germany). pCMV-S2.S ayw encodes the preS2 and S domains of the HBsAg (genotype D), and its expression is controlled by the cytomegalovirus immediate early gene promoter (Michel et al 1995 Proc Natl Acad Sci U S A 92:5307-5311). pCMV-HBc encodes the HBV capsid carrying the hepatitis core 30 (HBc) Ag (Dion et al 2013 J Virol 87:5554-5563). Treatment with DNA vaccine was conducted as described here. Five days prior to vacciantion cardiotoxine (CaTx, Latoxan refL81-02, 50 pl / muscle) was injected into the muscle of the mice. CaTx depolarizees the muscular fibers to induce cell degeneration, 5 days post injection, new muscular fibers will appear and will receive the DNA vaccine for a better efficacy for 35 transfection. The pCMV-S2.S ayw and pCMVCore at 1 mg / ml each were mixed in equal amount 2024203581   29 May 2024 and each mouse received a total of 100 pg by bilateral intramuscular injection into cardiotoxin-treated tibialis anterior muscles as previously described in Michel et al 1995 Proc Natl Acad Sci USA 92:5307-5311, under anesthesia (100 pL of 12.5 mg / mL ketamine, 1.25 mg / mL xylazine). Anti-PD-LI antibody 5 This is a mouse anti mouse PD-L1 IgG 1 antibody clone 6E11 internally produced at Genetech. It is a surrogate antibody that cross blocks Atezolizumab and has similar in vitro blocking activity Atezolizumabproduced internally at Roche. The antibody was adminstredadministered by intraperitoneal (i.p.) injection at a dose of 12.5 pg / g. Oligonucleotide synthesis 0 Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used. Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 pmol scale. At the end of the synthesis, the oligonucleotides 15 are cleaved from the solid support using aqueous ammonia for 5-16hours at 60°C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS. Elongation of the oligonucleotide: The coupling of p-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA-20 T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5’-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane 25 hydride (0.01 M in acetonitrile / pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF / Pyridine / water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis. For post solid phase synthesis conjugation a commercially available C6 amino linker phosphoramidite can be used in the last cycle of the solid phase synthesis and after 30 deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods. Alternatively, the conjugate moiety can be added to the oligonucleotide while still on the solid support by using a GalNAc- or GalNAc-cluster phosphoramidite as described in 35 PCT / EP2015 / 073331 or in EP appl. NO. 15194811.4. 2024203581   29 May 2024 Purification by RP-HPLC: The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10p 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL / min. The collected fractions are lyophilized to give the purified compound typically 5 as a white solid. Abbreviations: DCI: 4,5-Dicyanoimidazole DCM: Dichloromethane DMF: Dimethylformamide 0 DMT: 4,4’-Dimethoxytrityl THF: Tetrahydrofurane Bz: Benzoyl Ibu: Isobutyryl RP-HPLC: Reverse phase high performance liquid chromatography 15 Tm Assay Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x Tm-buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95QC for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (Tm) is measured on a Lambda 20   40 UV / VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20QC to 95QC and then down to 25QC, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex Tm. Tissue specific In vitro linker cleavage assay 25 FAM-labeled oligonucleotides with the biocleavable linker to be tested (e.g. a DNA phosphodiester linker (PO linker)) are subjected to in vitro cleavage using homogenates of the relevant tissues (e.g. liver or kidney) and Serum. The tissue and serum samples are collected from a suitable animal (e.g. mice, monkey, pig or rat) and homogenized in a homogenisation buffer (0,5% Igepal CA-630, 25 mM Tris pH 8.0, 100 30 mM NaCI, pH 8.0 (adjusted with 1 N NaOH).The tissue homogenates and Serum are spiked with oligonucleotide to concentrations of 200 pg / g tissue. The samples are incubated for 24 hours at 37°C and thereafter the samples are extracted with phenol - chloroform. The solutions are subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an Dionex DNApac p100 column and a gradient ranging from 10mM - 1 M sodium perchlorate at pH 7.5. The 35 content of cleaved and non-cleaved oligonucleotide are determined against a standard using both a fluorescence detector at 615 nm and a uv detector at 260 nm. 2024203581   29 May 2024 S1 nuclease cleavage assay FAM-labelled oligonucleotides with S1 nuclease susceptible linkers (e.g. a DNA phosphodiester linker (PO linker)) are subjected to in vitro cleavage in S1 nuclease extract or Serum. 100 pM of the oligonucleotides are subjected to in vitro cleavage by S1 nuclease in nuclease buffer (60 U pr. 100 pL) for 20 and 120 minutes. The enzymatic activity is stopped by adding EDTA to the buffer solution. The solutions are subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an Dionex DNApac p-100 column and a gradient ranging from 10mM - 1 M sodium perchlorate at pH 7.5. The content of cleaved and non-cleaved oligonucleotide is determined against a standard using both a fluorescence detector at 615 nm and a uv detector at 260 nm. Preparation of liver mononuclear cells Liver cells from AAV / HBV mice were prepared as described below and according to a method described by Tupin et al 2006 Methods Enzymol 417:185-201 with minor modifications. After mouse euthanasia, the liver was perfused with 10 ml of sterile PBS via hepatic portal vein using syringe with G25 needle. When organ is pale, the organ was harvested in Hank's Balanced Salt Solution (HBSS) (GIBCO® HBSS, 24020) + 5 % decomplemented fetal calf serum (FCS). The harvested liver was gently pressed through 100 pm cell-strainer (BD Falcon, 352360) and cells were suspended in 30 ml of HBSS + 5 % FCS. Cell suspension was centrifuged at 50 g for 5 min. Supernatants were then centrifuged at 289 g for 10 min at 4 °C. After centrifugation, supernatants were discarded and pellets were re-suspended in 15 mL at room temperature in a 35 % isotonic Percoll solution (GE Healthcare Percoll #17-0891-01 diluted into RPMI 1640 (GIBCO, 31870)) and transferred to a 15 ml tube. Cells were further centrifuged at 1360g for 25 min at room temperature. The supernatant was discarded by aspiration and the pellet containing mononuclear cells was washed twice with HBSS + 5 % FCS. Cells were cultured in complete medium (o-minimal essential medium (Gibco, 22571) supplemented with 10 % FCS (Hyclone, # SH30066, lot APG21570), 100 U / mL penicillin + 100 pg / mL streptomycin + 0.3 mg / mL L-glutamine (Gibco, 10378), 1X non-essential amino acids (Gibco, 11140), 10 mM Hepes (Gibco, 15630), 1 mM sodium pyruvate (Gibco, 11360) and 50 pM p-mercaptoethanol (LKB, 1830)). Surface labeling of cells Cells were seeded in U-bottom 96-well plates and washed with PBS FACS (PBS containing 1 % bovine serum albumin and 0.01% sodium azide). Cells were incubated with 5 pL of PBS FACS containing a rat anti-mouse CD16 / CD32 antibody and a viability marker LD fixable yellow, Thermofisher, L34959 for 10 min in the dark at 4°C. Then, cells were stained for 20 min in the dark at 4°C with 25 pL of PBS FACS containing monoclonal antibodies (Mab) against NK P46 BV421 (Rat Mab anti mouse NK P46, Biolegend, 137612) and F4 / 80 (rat Mab anti-mouse F4 / 80 90 2024203581   29 May 2024 FITC, BD Biolegend, 123108) and two supplemental surface markers: PD1 (rat Mab anti-mouse PD1 PE, BD Biosciences, 551892) and PDL1 (rat Mab anti-mouse PDL1 BV711, Biolegend, 124319) were also added. Intracelluar cytokine staining (ICS) assay 5 ICS assays were performed on both splenocytes and liver mononuclear cells. Cells were seeded in Ubottom 96-well plates. Plates with cells were incubated overnight at 37 °C either in complete medium alone as negative control or with the peptides described in Table 9 at a concentration of 2 pg / ml. Brefeldin A at 2pg / mL (Sigma, B6542) was added after one hour of incubation. 0 After the overnight culture, cells were washed with PBS FACS and incubated with 5 pL of PBS FACS containing rat anti-mouse CD16 / CD32 antibody and a viability marker LD fixable yellow, Thermofisher, L34959 for 10 min in the dark at 4°C. Then, cells were stained for 20 min in the dark at 4°C with 25 pL of PBS FACS containing Mab. The mix was composed of monoclonal antibodies against CD3 (hamster Mab anti-mouse CD3-PerCP, BD Biosciences, 553067), CD8 15 (rat Mab anti-mouse CD8-APC-H7, BD Biosciences, 560182), CD4 (rat Mab anti-mouse CD4-PE-Cy7, BD Biosciences, 552775), and NK cells (Rat Mab anti mouse NK P46 BV421, Biolegend, 137612). Cells were fixed after several washes and permeabilized for 20 min in the dark at room temperature with Cytofix / Cytoperm, washed with Perm / Wash solution (BD Biosciences, 554714) at 4 °C. 20 Intracellular cytokine staining with antibodies against IFNy (rat Mab anti-mouse IFNy-APC, clone XMG1.2, BD Biosciences, 554413) and tumor necrosis factor alpha (TNFo) (rat Mab antimouse TNFo-FITC, clone MP6-XT22; 1 / 250 (BD Biosciences 554418) was performed for 30 min in the dark at 4 °C. Before analysis by flow cytometry using the MACSQuant Analyzer, cells were washed with Perm / Wash and re-suspended in PBS FACS containing 1% Formaldehyde. 25 Live CD3+CD8+CD4- and cells CD3+CD8-CD4+ were gated and presented on dot-plot. Two regions were defined to gate for positive cells for each cytokine. Numbers of events found in these gates were divided by total number of events in parental population to yield percentages of responding T cells. For each mouse, the percentage obtained in medium alone was considered as background and subtracted from the percentage obtained with peptide 30 stimulations. Threshold of positivity was defined according to experiment background i.e. the mean percentage of stained cells obtained for each group in medium alone condition plus two standard deviations. Only percentage of cytokine represented at least 5 events were considered as positive. 2024203581   29 May 2024 Table 9: HLA-A2 / DR1 restricted epitopes contained in the HBV Core protein and the Envelope domains of the HBsAg (S2+S). Protein Start Position End Position Sequence HLA restriction References Core 18 27 FLPSDFFPSV (SEQ ID NO: 773) A2 Bertoletti et al Gastroenterology 1997;112:193-199 111 125 GRETVLEYLVSFGVW (SEQ ID NO: 774) DR1 (Bertoletti et al Gastroenterology 1997;112:193-199 Envelope (S2+S) 114 128 TTFHQTLQDPRVRGL (SEQ ID NO: 775) DR1 Pajot et al Microbes Infect 2006 ;8:2783-2790. 179 194 QAGFFLLTRILTIPQS (SEQ ID NO: 776) A2 + DR1 Pajot et al Microbes Infect 2006 ;8:2783-2790. 183 191 FLLTRILTI (SEQ ID NO: 777) A2 Sette et al J Immunol 1994;153:5586-5592. 200 214 TSLNFLGGTTVCLGQ (SEQ ID NO: 778) A2 + DR1 Pajot et al Microbes Infect 2006 ;8:2783-2790. 204 212 FLGGTTVCL (SEQ ID NO: 779) A2 Rehermann et al J Exp Med 1995;181: 1047-1058. 335 343 WLSLLVPFV (SEQ ID NO: 780) A2 Nayersina et alJ Immunol 1993;150: 4659-4671. 337 357 SLL VP F VQW FVG LS PTVWLS V (SEQ ID NO: 781) A2 + DR1 Loirat et al J Immunol 2000; 165: 4748-4755 348 357 GLSPTVWLSV (SEQ ID NO: 782) A2 Loirat et al J Immunol 2000; 165: 4748-4755 370 379 SILSPFLPLL (SEQ ID NO: 783) A2 Mizukoshi et al J Immunol 2004;173: 5863-5871. Example 1 Testing in vitro efficacy A gene walk was performed across the human PD-L1 transcript primarily using 16 to 20mer 5 gapmers. Efficacy testing was performed in an in vitro experiment in the human leukemia monocytic cell line THP1 and in the human non-Hodgkin's K lymphoma cell line (KARPAS-299). Cell lines THP1 and Karpas-299 cell line were originally purchased from European Collection of Authenticated Cell Cultures (ECACC) and maintained as recommended by the supplier in a 10 humidified incubator at 37°C with 5% CO2. Oligonucleotide efficacy THP-1 cells (3.104 in RPMI-GLutamax, 10% FBS, 1% Pen-Strep (Thermo Fisher Scientific) were added to the oligonucleotides (4-5 ul) into 96-well round bottom plates and cultured for 6 days in a final volume of 100 pl / well. Oligonucleotides were screened at one single 15 concentration (20 pM) and in dose-range concentrations from 25 pM to 0.004 pM (1:3 dilution in water). Total mRNA was extracted using the MagNA Pure 96 Cellular RNA Large Volume Kit on the MagNA Pure 96 System (Roche Diagnostics) according to the manufacturer’s instructions. 2024203581   29 May 2024 For gene expression analysis, RT-qPCR was performed using the TaqMan RNA-to-ct 1-Step kit (Thermo Fisher Scientific) on the QuantStudio machine (Applied Biosystems) with pre-designed Taqman primers targeting human PDL1 and ACTB used as endogenous control (Thermo Fisher Scientific). The relative PD-L1 mRNA expression level was calculated using 2(-Delta Delta C(T)) 5 method and the percentage of inhibition as the % compared to the control sample (non-treated cells). Karpas-299 cells were cultured in RPMI 1640, 2 mM Glutamine and 20% FBS (Sigma). The cells were plated at 10000 cell / well in 96 wells plates incubated for 24 hours before addition of oligonucleotides dissolved in PBS. Final concentration of oligonucleotides was in a single dose 0 of 5 pM, in a final culture volume was 100 pl / well or added in a dose response ranging from 50 pM, 15.8 pM, 5.0 pM, 1.58 pM, 0.5 pM, 0.158 pM, 0.05 pM, to 0.0158 pM in 100 ptL culture volume. The cells were harvested 3 days after addition of oligonucleotide compounds and RNA was extracted using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer’s instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, 15 random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer’s instruction. For gene expressions analysis, qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Applied Biosystems; Hs01125299_m1) and TBP (Applied Biosystems; 4325803). The relative PD-L1 mRNA expression level is shown in table 10 as % of 20 control sample (PBS-treated cells). Table 10: in vitro efficacy of anti-PD-L1 compounds in THP1 and KARPAS-299 cell lines (Average from n=3 experiments). PD-L1 mRNA levels are normalized to TBP in KARPAS-299 cells or ACTB in THP1 cells and shown as % of control (PBS treated cells). CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 4_1 50 1 32 11 TAattggctctacTGC 236 5_1 25 5 9 6 T CGCataagaatgaCT 371 6_1 29 2 15 5 TGaacacacagtcgCA 382 7_1 27 7 3 1 CTGaacacacagtCGC 383 8_1 23 4 11 3 T CT gaacacacagtCG 384 9_1 32 3 19 6 TT CtgaacacacagT C 385 10_1 57 5 39 16 ACaagtcatgttaCTA 463 11_1 75 5 37 12 ACacaagtcatgttAC 465 121 22 2 10 3 CTtacttagatgcTGC 495 13_1 33 4 23 11 ACttacttagatgCTG 496 141 33 7 21 6 GACttacttagatgCT 497 15_1 41 6 18 10 AGacttacttagaTGC 498 16_1 96 14 40 7 GCAggaagagactTAC 506 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 171 22 2 9 3 AAT AaattccgttC AG G 541 18_1 34 6 21 9 GCAAataaattcCGTT 545 18_2 51 4 27 11 G C AaataaattccG TT 545 19_1 38 5 23 7 AG C AaataaattcCGT 546 20_1 73 8 56 15 CAG AgcaaataaatT CO 548 211 83 8 65 10 TG G Acagagcaaata A AT 551 221 86 6 80 8 ATG G acagagca A AT A 554 23_1 44 4 30 2 CAgaatggacagaGCA 558 241 63 10 40 11 TT Ctcagaatggac AG 562 25_1 31 1 39 5 CT G AactttgacAT AG 663 26_1 60 4 56 19 AAgacaaacccagacT GA 675 271 36 4 34 10 T AT AagacaaacccAG AC 678 28_1 40 4 28 13 TTATaagacaaaccCAGA 679 29_1 30 2 18 6 TGTT ataagacaaaCCC 682 30_1 77 3 67 10 T AG AacaatggtaCTTT 708 31_1 81 17 20 14 GT AGaacaatggtaCT 710 321 29 5 14 8 AG GtagaacaatgGTA 712 33_1 32 1 43 20 AAG AggtagaacaAT G G 714 341 70 4 35 13 GCatccacagtaaaTT 749 35_1 83 2 66 21 GAaggttatttaaTTC 773 36_1 18 2 15 5 CT AAtcgaatgcaG C A 805 371 64 7 35 10 T ACccaatctaatCG A 813 38_1 69 1 49 13 T AG ttacccaatcT AA 817 39_1 49 5 26 9 CATttagttacccAAT 821 40_1 23 7 8 2 TCAtttagttaccCAA 822 411 24 6 12 3 TTcatttagttaCCCA 823 421 51 7 40 5 GAATtaatttcattTAGT 829 43_1 71 9 45 3 CAGTgaggaattaATTT 837 441 60 5 45 17 CCAAcagtgaggAATT 842 45_1 63 1 37 15 CCCaacagtgaggAAT 843 46_1 31 3 29 12 T AtacccaacagtgAGG 846 47_1 44 3 27 0 TT atacccaacagT G AG 847 48_1 38 3 26 6 TTT atacccaacagT GA 848 49_1 20 4 7 1 CCTttatacccaaCAG 851 50_1 22 3 6 2 T AACctttatacCC AA 854 51_1 28 1 29 16 AAT aacctttataCCC A 855 521 80 11 48 10 GTAaataacctttaTA 859 53_1 54 4 37 14 ACTG taaataacctTT AT 860 541 81 4 53 15 ATAtatatgcaatgAG 903 55_1 86 12 70 15 AGatatatatgcaaTG 905 56_1 56 8 27 7 GAGatatatatgcAAT 906 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 571 28 7 13 5 CCagagatatataTGC 909 58_1 88 13 69 23 C AAT attccagag AT AT 915 59_1 29 3 14 6 GCAAtattccagagATA 916 60_1 25 3 14 3 AGCaatattccagaGAT 917 61_1 29 4 17 2 C AG caatattcc AG AG 919 621 27 3 14 3 AAT CagcaatattCC AG 921 63_1 23 6 12 6 AC AAtcagcaataTT CC 923 641 53 9 43 15 ACtaagtagttacactT CT 957 65_1 32 5 14 6 CT AAgtagttacactT C 958 66_1 35 4 31 6 GACtaagtagttacaCTT 959 671 64 10 55 14 T G ActaagtagtT AC A 962 68_1 62 11 57 16 CTTT gactaagtagTT A 964 69_1 42 9 59 13 CT CtttgactaagT AG 967 70_1 81 6 56 12 GCT CtttgactaagT A 968 711 27 3 39 9 CCttaaatactgtTGAC 1060 721 75 5 36 7 CTtaaatactgttgAC 1060 73_1 35 6 43 13 TCCttaaatactgTTG 1062 74_1 57 4 79 25 T CT CcttaaatactgTT 1063 75_1 53 6 28 6 TAtcatagttctCCTT 1073 76_1 26 4 9 2 AGTatcatagttcTCC 1075 77_1 74 5 39 12 GAgtatcatagttCTC 1076 78_1 49 5 35 6 AG agtatcatagTT CT 1077 78_2 74 6 36 8 AGAgtatcatagtTCT 1077 79_1 19 2 19 13 C AG agtatcatagTT C 1078 80_1 23 2 26 2 TT C AgagtatcataGT 1080 81_1 35 3 36 11 CTT cagagtatcAT AG 1081 821 24 6 20 7 TT CTtcagagtatcaT A 1082 83_1 20 2 16 2 TTT cttcagagtaT CAT 1083 841 33 4 37 10 GAGAaaggctaagTTT 1099 85_1 42 2 35 18 GAcactcttgtaCATT 1213 86_1 50 4 54 8 TGagacactcttgtaCA 1215 871 50 8 28 8 TGagacactcttgT AC 1216 88_1 61 4 33 6 CTttattaaactCCAT 1266 89_1 71 8 43 12 ACCAaactttattaAA 1272 90_1 62 5 42 9 AAACctctactaagT G 1288 91_1 22 3 12 5 AG attaagacagtT G A 1310 921 46 3 ND ND AAgtaggagcaagaGGC 1475 93_1 42 4 60 24 AAAGtaggagcaagAGG 1476 941 86 15 46 10 GTtaagcagccaggAG 1806 95_1 66 6 82 27 AGggtaggatgggtAG 1842 96_1 83 19 62 36 AAGggtaggatgggTA 1843 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 971 60 9 69 5 CAAgggtaggatggGT 1844 97_2 76 13 34 7 CAagggtaggatggGT 1844 98_1 65 8 76 28 CCaagggtaggatgGG 1845 99_1 61 2 75 17 T CcaagggtaggatG G 1846 100_1 83 4 82 13 CTT Ccaagggtagg AT 1848 101_1 45 3 52 14 ATCttccaagggtagGA 1849 102_1 29 2 17 7 AG aagtgatggctC ATT 1936 103_1 26 3 22 1 AAGaagtgatggcTCAT 1937 1041 34 6 22 2 G AAgaagtgatggcT CA 1938 105_1 41 5 21 5 AT G AaatgtaaacT G G G 1955 106_1 40 8 29 6 C AAT gaaatgtaaaCT G G 1956 107_1 24 3 16 4 GCAAtgaaatgtaaACTG 1957 108_1 30 4 20 6 AG C Aatgaaatgta AACT 1958 109_1 44 4 34 14 GAGCaatgaaatgtAAAC 1959 110_1 18 1 13 3 T G aattcccatatcCG A 1992 111_1 69 8 35 8 AG aattatgaccaT AT 2010 1121 77 7 38 10 AGGtaagaattatGACC 2014 113_1 97 10 56 13 T C AGgtaagaattaT G AC 2015 114_1 69 8 54 21 CTT CaggtaagaatT AT G 2017 115_1 91 7 115 42 T CTT caggtaaga ATT A 2019 116_1 88 6 104 36 CTT CttcaggtaaG AAT 2021 1171 85 6 118 17 T CTT CttcaggtaaG AA 2022 118_1 105 14 102 9 TCTtcttcaggtaAGA 2023 119_1 37 2 76 18 TGGtctaagagaaGAAG 2046 120_1 46 6 81 11 GTTGgtctaagagAAG 2049 1211 74 11 64 4 AGTtggtctaagAGAA 2050 122_1 74 9 55 21 CAgttggtctaagAGAA 2050 123_1 65 9 95 21 GCAgttggtctaagagAA 2050 1241 63 7 ND ND CAGTtggtctaagaGA 2051 125_1 65 6 ND ND GCagttggtctaagaGA 2051 126_1 67 14 104 34 GCagttggtctaaGAG 2052 1271 22 6 10 3 CT catatcagggC AGT 2063 128_1 50 4 46 9 CACAcatgttctttaAC 2087 129_1 22 4 12 12 T AAatacacacatgTT CT 2092 130_1 24 2 43 28 GT AAatacacacatgTT C 2093 131_1 33 3 20 12 TGT AaatacacacaT GTT 2094 132_1 73 17 57 21 GAT CatgtaaatacAC AC 2099 133_1 47 5 28 14 AGATcatgtaaataCACA 2100 1341 35 6 26 11 CAAAgatcatgtaaatACAC 2101 135_1 30 2 14 3 AC AAagatcatgtaaaT AC A 2102 136_1 52 6 24 18 G AAT acaaagatcaT GTA 2108 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 137_1 33 5 20 6 AG A Atacaaag ate AT GT 2109 138_1 37 1 22 15 CAG AatacaaagatCAT G 2110 139_1 85 6 53 8 GCAGaatacaaagAT CA 2112 140_1 79 4 40 6 AGGCagaatacaaagAT 2114 1411 56 2 53 20 AAGGcagaatacaaAGA 2115 1421 28 5 20 5 ATT agtgagggacG AA 2132 143_1 26 2 22 10 CAttagtgagggaCGA 2133 144_1 29 6 16 4 G AgggtgatggatT AG 2218 145_1 45 6 22 5 TT aggagtaataAAG G 2241 146_1 65 7 44 9 TTAatgaatttggtTG 2263 1471 84 8 43 10 CTttaatgaatttgGT 2265 148_1 32 0 15 3 CATGgattacaactAA 2322 149_1 33 2 20 4 T CatggattacaaCT A 2323 150_1 29 1 11 3 GT CatggattacaaCT 2324 151_1 64 2 40 9 CAttaaatctagTCAT 2335 1521 97 8 63 22 G AC AttaaatctagT C A 2336 153_1 92 7 ND ND AG G G acattaaatcT A 2340 154_1 35 4 25 15 CAAAgcattataaCCA 2372 155_1 34 3 24 6 ACttactaggcaG A AG 2415 156_1 102 6 113 18 CAGAgttaactgtaCA 2545 157_1 102 10 103 15 CC AG agttaactgtAC 2546 158_1 88 7 95 18 GCcagagttaactgTA 2547 159_1 78 10 ND ND T GggccagagttaaCT 2550 160_1 59 5 26 5 CAgcatctatcagaCT 2576 161_1 78 8 42 10 T G AaataacatgagT CAT 2711 162_1 31 6 ND ND GTG aaataacatg AGT C 2713 163_1 18 2 11 3 TCTGtttatgtcacTG 2781 164_1 56 5 29 9 GTCTgtttatgtcaCT 2782 165_1 37 8 12 5 TGgtctgtttatGTCA 2784 166_1 39 1 19 3 TTGGtctgtttatgTC 2785 167_1 41 3 35 14 TCacccattgtttaAA 2842 168_1 18 3 14 4 TT cagcaaatatT CGT 2995 169_1 36 8 13 2 GTG tgttcagcaaAT AT 2999 170_1 18 2 11 4 TCTattgttaggtATC 3053 1711 67 4 26 12 ATtgcccatcttacTG 3118 1721 71 2 33 9 TATtgcccatcttaCT 3119 173_1 47 4 20 5 AAatattgcccatCTT 3122 1741 74 4 34 7 ATAaccttatcataCA 3174 175_1 98 19 44 12 TAtaaccttatcaTAC 3175 176_1 100 10 64 11 TTAtaaccttatcaTA 3176 177_1 72 38 28 5 TTTataaccttatCAT 3177 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 178_1 47 6 34 6 ACtgctattgctaTCT 3375 179_1 41 3 23 6 AGgactgctattgCTA 3378 180_1 32 6 27 7 GAGgactgctattgCT 3379 181_1 83 1 46 20 ACgtagaataataaCA 3561 182_1 94 4 52 9 CCaagtgatata AT G G 3613 183_1 49 2 16 3 TTagcagaccaaGTGA 3621 1841 96 3 26 5 GTttagcagaccaaGT 3623 185_1 78 3 46 10 TGacagtgattataTT 3856 186_1 88 5 45 21 TGT Ccaagatattg AC 3868 187_1 46 6 23 6 G AAtatcctagatT GT 4066 188_1 79 3 45 14 CAaactgagaataT CC 4074 189_1 63 5 27 8 G C Aaactg agaataT C 4075 190_1 77 9 37 11 TCCtattacaatcgTA 4214 191_1 74 10 36 9 TTCCtattacaatcGT 4215 192_1 91 8 51 28 ACtaatgggaggatTT 4256 193_1 95 14 67 24 TAgttcagagaataAG 4429 1941 86 5 47 16 TAacatatagttcAGA 4436 195_1 87 4 81 20 ATAacatatagttcAG 4437 196_1 101 6 67 20 CAtaacatatagttCA 4438 197_1 91 6 60 13 TCataacatatagtTC 4439 198_1 61 3 31 10 T AG CtcctaacaatC A 4507 199_1 79 12 49 11 CTCCaatctttgtaTA 4602 200_1 74 2 58 13 TCTCcaatctttgtAT 4603 201_1 53 3 33 10 TCtatttcagccaaTC 4708 202 1 25 4 30 9 CG G aagtcag agtG A A 4782 203_1 32 5 21 7 TT AAgcatgaggaaT A 4798 204 1 34 10 26 11 T G AttgagcacctCTT 4831 205_1 81 12 62 12 GACtaattatttcgTT 4857 206_1 57 7 37 7 TGActaattatttCGT 4858 207 1 26 5 21 6 GTGactaattattTCG 4859 208_1 48 3 33 13 CTGCttgaaatgtgAC 4870 209_1 32 1 34 13 CCtgcttgaaatgTGA 4871 210_1 60 5 50 19 ATcctgcttgaaATGT 4873 211_1 111 8 110 26 ATTataaatctatTCT 5027 2121 107 1 67 12 GCtaaatactttcATC 5151 213_1 26 3 19 6 C AttgtaacataCCT A 5251 2141 33 2 20 4 GCattgtaacatacCT 5252 215_1 89 8 53 16 TAatattgcaccaaAT 5295 216_1 25 2 29 9 GAtaatattgcacCAA 5297 2171 27 1 27 6 AGataatattgcacCA 5298 218_1 79 6 45 11 GCcaagaagataAT AT 5305 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 219_1 159 16 68 14 CACAgccacataaaCT 5406 220_1 90 2 72 12 TTgtaattgtggaaAC 5463 2211 10 2 11 5 TGacttgtaattgTGG 5467 222 1 82 1 67 18 TCtaactgaaatagTC 5503 223_1 30 1 32 9 GTGgttctaactgaAA 5508 224 1 53 7 53 15 CAatatgggacttgGT 5522 225_1 44 1 33 10 AT G acaatatgggaCT 5526 226_1 49 1 41 14 T ATGacaatatggg AC 5527 227 1 77 1 54 15 AT AT gacaatatggG A 5528 228_1 100 3 98 29 CTtcacttaataaTTA 5552 229_1 90 12 80 19 CTGCttcacttaatAA 5555 230_1 91 0 79 23 AAgactgcttcacTT A 5559 231_1 49 8 77 34 G AAT gccctaattaT G 5589 232 1 17 7 88 33 TG G aatgccctaatT A 5591 233_1 40 5 35 10 GCAaatgccagtagGT 5642 234 1 81 6 72 25 CT AatggaaggattT G 5673 235_1 97 17 87 25 AAtatagaacctaaTG 5683 236_1 98 4 83 21 GAAagaatagaatGTT 5769 237 1 93 2 102 26 ATGggtaatagattAT 5893 238_1 110 24 44 14 GAaagagcacagggTG 6103 239_1 66 5 36 10 CT ACatagagggaaT G 6202 240_1 70 4 34 8 G CttcctacataG AG G 6207 2411 64 NA 33 6 TGCTtcctacatagAG 6208 242 1 30 NA 19 7 T GggcttgaaataT GT 6417 243_1 88 6 69 15 CATtatatttaagaAC 6457 244 1 8 2 5 2 TCggttatgttaTCAT 6470 245_1 18 9 12 4 CActttatctggTCGG 6482 246_1 37 2 19 5 AA AttggcacagcG TT 6505 247 1 46 12 29 8 ACCGtgacagtaaATG 6577 248_1 31 2 25 2 T GggaaccgtgacagT A 6581 249_1 17 2 23 9 CCacatataggtcCTT 6597 250_1 15 6 23 7 CAtattgctaccaTAC 6617 251_1 4 2 9 2 TCAtattgctaccATA 6618 252 1 65 12 85 14 C AATtgtcatatT G CT 6624 253_1 20 2 51 7 C ATtcaattgtcataTT G 6626 254 1 48 8 91 41 TTT CtactgggaaTTT G 6644 255_1 11 5 23 8 CAAttagtgcagcCAG 6672 256_1 43 7 62 13 G AAT aatgttcttaT CC 6704 257 1 28 2 36 19 C AC AaattgaataatgtT CT 6709 258_1 64 4 78 22 C ATGcacaaattgaaT AAT 6714 259_1 53 8 104 73 AT CctgcaatttcaC AT 6832 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 260_1 54 5 59 14 CCaccatagctgatCA 6868 261_1 42 8 52 22 ACcaccatagctgaT C A 6868 262 1 68 5 118 66 CAccaccatagctgaT C 6869 263_1 40 2 73 20 T AgtcggcaccaccAT 6877 264 1 64 6 72 35 CttgtagtcggcaccAC 6880 265_1 56 4 82 35 CttgtagtcggcacCA 6881 266_1 41 5 46 21 CGcttgtagtcggcAC 6883 267 1 51 4 33 14 T CAataaagatcagGC 6942 268_1 61 2 49 10 T GgacttacaagaaT G 6986 269_1 45 7 40 9 ATGgacttacaagaAT 6987 270_1 51 12 36 12 GCT CaagaaattggAT 7073 2711 17 0 14 5 T ACT gtagaacatgG C 7133 272 1 15 3 11 3 GCAAttcatttgaTCT 7239 273_1 64 11 ND ND TGaagggaggagggacAC 7259 274 1 52 6 50 28 AGtggtgaagggaggAG 7265 275_1 79 7 ND ND TAgtggtgaagggaggAG 7265 276_1 81 6 ND ND AtagtggtgaagggaggAG 7265 277 1 70 9 ND ND TAgtggtgaagggagGA 7266 278_1 84 9 ND ND ATagtggtgaagggagGA 7266 279_1 40 6 64 53 TAGtggtgaagggaGG 7267 280_1 42 10 ND ND ATAgtggtgaagggaGG 7267 281_1 63 7 ND ND G AtagtggtgaagggaG G 7267 282 1 27 7 38 11 ATAGtggtgaagggAG 7268 283_1 60 22 ND ND GAtagtggtgaaggGAG 7268 284 1 23 3 97 54 GAgatagtggtgAAGG 7271 285_1 51 6 72 19 CATGggagatagtgGT 7276 286_1 7 1 21 9 AC AAataatggttaCT CT 7302 287 1 66 8 48 20 ACACacaaataatgGTT A 7306 288_1 67 6 58 20 G AGggacacacaaaT AAT 7311 289_1 46 2 50 21 AT AT agagaggcT C AA 7390 290_1 22 6 ND ND TT gatatagagaGG CT 7393 291_1 11 2 17 3 GCATttgatatagAGA 7397 292 1 70 18 44 8 TTtgcatttgataTAG 7400 293_1 30 1 30 9 CT GgaagaataggtT C 7512 294 1 53 5 42 10 ACTGgaagaataggTT 7513 295_1 56 2 41 15 T ACT ggaagaatagGT 7514 296_1 80 8 53 13 TGGCttatcctgtaCT 7526 297 1 73 6 52 14 ATggcttatcctGTAC 7527 298_1 75 7 89 25 TATGgcttatcctgTA 7528 299_1 52 5 50 11 GTAtggcttatccTGT 7529 300_1 27 3 31 6 AT gaatatatgccC AGT 7547 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 301_1 41 8 33 9 GAtgaatatatgCCCA 7549 302 1 8 2 ND ND CAAgatgaatataTGCC 7551 303_1 32 5 37 14 G AC AacatcagtaT AGA 7572 304 1 28 5 30 23 C AAG acaacatcAGT A 7576 305_1 47 5 41 9 CACtcctagttccTTT 7601 306_1 39 6 33 7 AACactcctagttCCT 7603 307 1 68 3 42 14 TAacactcctagtTCC 7604 308_1 115 5 69 22 CTaacactcctagtTC 7605 309_1 97 16 57 14 TGataacataactgTG 7637 310_1 36 1 23 10 CT gataacataaCT GT 7638 311_1 38 5 24 5 TTTGaactcaagtgAC 7654 3121 42 3 39 5 T CCTttacttagcT AG 7684 313_1 15 2 14 3 GAgtttggattagCTG 7764 3141 49 28 ND ND TGggatatgacagGGA 7838 315_1 34 6 ND ND T GTGggatatgacaG G 7840 316_1 47 3 37 8 AT AT ggaagggataT C 7875 3171 11 3 ND ND ACAggatatggaaGGG 7880 318_1 48 4 ND ND ATTT caacaggatAT G G 7885 319_1 18 2 16 4 GAgtaatttcaacAGG 7891 320_1 74 6 44 5 AG G G agtaatttc A AC A 7893 321_1 38 5 56 28 ATT AgggagtaatTT C A 7896 322 1 66 9 32 11 CTtactattaggGAGT 7903 323_1 13 1 15 5 CAgcttactattaGGG 7906 324 1 26 4 20 9 TCAgcttactattAGG 7907 325_1 43 4 17 2 ATTtcagcttactaTT AG 7908 326_1 54 5 57 16 TT cagcttactaTT AG 7908 327 1 28 3 8 2 CAGAtttcagcttaCT 7913 328_1 43 4 37 16 GACtacaactagagGG 7930 329_1 45 12 36 10 AG ACtacaactagaG G 7931 330_1 99 8 94 32 AAgactacaactagAG 7932 331_1 59 4 52 19 ATG AtttaattctagtC AAA 7982 332 1 100 2 84 23 TTTaattctagtcAAA 7982 333_1 91 9 60 19 GATTtaattctaGTCA 7984 771_1 74 6 50 5 T G AtttaattctaGT C A 7984 334 1 73 5 54 12 AT G AtttaattctagT C A 7984 335_1 15 1 26 3 GATGatttaattctagtCA 7984 336_1 71 22 49 16 GAtttaattctaGTCA 7984 337 1 43 5 30 11 G ATG atttaattctaG T C 7985 338_1 98 5 90 27 TGatttaattctagTC 7985 339_1 87 21 86 2 G AG AtgatttaatT CT A 7988 340_1 92 5 85 27 GAGatgatttaatTCT 7989 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 3411 7 1 7 1 CAGAttgatggtagTT 8030 342 1 7 2 24 11 CT cagattgatgGTAG 8032 343_1 3 1 14 9 GTT agccctcagaTT G 8039 344 1 14 5 20 7 TGtattgttagcCCTC 8045 345_1 10 2 11 5 ACttgtattgttAGCC 8048 346_1 52 4 52 17 AG Ccagtatcaggg AC 8191 347 1 33 3 18 8 TT gacaatagtgG C AT 8213 348_1 7 2 13 5 ACAagtggtatctTCT 8228 349_1 63 8 44 15 AATCtactttacaaGT 8238 350_1 36 2 ND ND C AcagtagatgcctG AT A 8351 351_1 24 2 30 9 GAacacagtagatGCC 8356 352 1 23 4 103 14 CTTGgaacacagtagAT 8359 353_1 20 2 45 2 AT AtcttggaacaC AG 8364 354 1 25 3 24 6 TCTttaatatcttgGAAC 8368 355_1 39 2 41 10 T G atttctttaatatCTT G 8372 356_1 54 5 88 43 TGatgatttctttaaT AT C 8375 357 1 31 4 45 27 AG GctaagtcatgaT G 8389 358_1 18 3 43 20 TTG AtgaggctaagT C 8395 359_1 6 2 11 2 CCAggattatactcTT 8439 360_1 43 5 40 14 GCcaggattataCT CT 8440 361_1 56 8 73 13 CT GccaggattataCT 8442 362 1 23 1 33 7 CAG AaacttatactttaT G 8473 363_1 49 8 45 14 AAG C agaaacttaT ACT 8478 364 1 39 6 37 4 G AAgcagaaacttaT ACT 8478 365_1 26 4 45 13 TGGaagcagaaacttataCT 8478 366_1 21 4 44 5 TGGaagcagaaacttaT AC 8479 367 1 97 4 70 22 AAgcagaaacttaT AC 8479 368_1 34 3 32 11 TG G aagcagaaactT AT A 8480 369_1 71 7 46 19 AAG G gatattatgg AG 8587 370_1 51 9 79 38 TGccggaagatttcCT 8641 371_1 45 6 52 25 ATG G attgggagtaG A 8772 372 1 27 7 30 8 AG atggattgggagT A 8774 373_1 13 3 28 6 AAGatggattgggaGT 8775 374 1 42 10 44 11 ACaagatggattGGGA 8777 374_2 41 3 45 14 ACaagatggattggGA 8777 375_1 83 9 88 32 AGAaggttcagaCTTT 8835 376_1 40 5 33 3 GCAgaaggttcagaCT 8837 376_2 28 5 20 4 GCagaaggttcagACT 8837 377 1 70 2 43 8 TGCAgaaggttcagAC 8838 378_1 23 3 55 17 AG tgcag aaggttC AG 8840 378_2 51 6 41 8 AGTGcagaaggttcAG 8840 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 379_1 34 6 35 7 AAGT gcagaaggttC A 8841 380_1 44 11 24 6 T AagtgcagaagGTT C 8842 381_1 37 5 45 9 TCtaagtgcagaAGGT 8844 382 1 75 5 147 26 CT CaggagttctactT C 8948 383_1 90 10 141 55 CT CaggagttctaCTT 8949 384 1 73 8 234 116 AtggaggtgactcaggAG 8957 385_1 33 4 42 7 ATggaggtgactcagGA 8958 386_1 24 3 29 14 AT ggaggtgactcAG G 8959 387 1 37 2 65 15 TAtggaggtgactcAGG 8959 388_1 50 10 81 19 AT atggaggtgactcaGG 8959 389_1 42 5 61 10 T AT GgaggtgactcAG 8960 390_1 36 2 76 50 AT atggaggtgacT C AG 8960 391_1 52 6 64 6 CAtatggaggtgactcAG 8960 392 1 63 5 57 6 AT AtggaggtgacT C A 8961 393_1 53 7 64 12 C AtatggaggtgacT C A 8961 394 1 51 5 56 24 C Atatggaggtg ACT C 8962 395_1 23 3 41 34 GCatatggaggtgacTC 8962 396_1 34 3 54 10 T GcatatggaggtgacT C 8962 397 1 54 5 71 24 TtgcatatggaggtgacTC 8962 398_1 61 11 59 13 TttgcatatggaggtgacT C 8962 399_1 25 2 30 6 GCatatggaggtgaCT 8963 400_1 34 4 25 9 T GcatatggaggtgacT 8963 401_1 25 4 31 20 TT GcatatggaggtgacT 8963 402 1 51 6 37 11 TttgcatatggaggtgaCT 8963 403_1 26 1 33 5 TGCatatggaggtgAC 8964 404 1 25 2 69 19 TTGcatatggaggtGAC 8964 405_1 26 4 24 4 TTT Gcatatggaggtg AC 8964 406_1 19 3 20 7 TTT GcatatggaggtG A 8965 407 1 16 5 46 16 TTtgcatatggaGGTG 8966 408_1 9 2 9 6 AAgtgaagttcaaCAGC 8997 409_1 26 8 109 52 T GggaagtgaagTT C A 9002 410_1 31 5 24 5 AT gggaagtgaagTT C 9003 411_1 49 9 19 10 GAT GggaagtgaaGTT 9004 4121 28 10 17 9 CTGtgatgggaagtGAA 9007 413_1 54 4 34 8 ATT gagtgaatccAAA 9119 414_1 11 1 14 2 AAttgagtgaatCCAA 9120 415_1 58 6 14 2 GAT AattgagtgaaT CC 9122 416_1 5 1 16 3 GTG ataattgagtG AA 9125 4171 73 5 61 14 AAGaaaggtgcaaT AA 9155 418_1 86 6 64 13 CAagaaaggtgcAAT A 9156 419_1 75 19 64 14 ACAAgaaaggtgcaAT 9157 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 420_1 75 8 50 13 ATttaaactcacaaAC 9171 421_1 21 8 23 6 CTgttaggttcaGCGA 9235 422 1 54 10 30 5 TCTG aatgaacatTT CG 9260 423_1 11 4 15 5 CT cattgaaggtT CT G 9281 424 1 87 3 52 8 CTAatctcattgaaGG 9286 425_1 95 1 85 13 CCtaatctcattgaAG 9287 426_1 31 7 22 7 ACTttgatctttcAGC 9305 427 1 64 7 49 16 ACtatgcaacacttTG 9315 428_1 18 6 21 3 CAAatagctttatCGG 9335 429_1 19 6 17 4 CCaaatagctttAT CG 9336 430_1 35 4 27 8 TCCAaatagctttaTC 9337 431_1 75 8 43 7 GAT CcaaatagcttT A 9339 432 1 67 11 32 8 AT gatccaaataG CTT 9341 433_1 53 5 43 6 T ATGatccaaatagCT 9342 434 1 97 9 66 29 TAAAcagggctggGAAT 9408 435_1 58 12 44 17 ACttaaacagggCT G G 9412 436_1 58 10 30 12 ACacttaaacagGGCT 9414 437 1 87 38 41 3 GA AC acttaaac AG G G 9416 438_1 70 4 59 33 AG AG aacacttaa AC AG 9418 439_1 83 17 28 9 CT ACagagaacaCTT A 9423 440_1 49 12 27 4 ATGctacagagaaCACT 9425 441 _1 53 10 24 13 AT AAatgctacagag AAC A 9427 442 1 23 6 20 10 AG ataaatgctacaG AG A 9430 443_1 48 6 27 7 T AG AgataaatgcT ACA 9434 444 1 51 3 32 8 TAGAtagagataaatGCT 9437 445_1 38 5 ND ND CAATatactagataG AG A 9445 446_1 52 3 31 1 T AC Acaatatactag AT AG 9448 447 1 65 6 48 11 CT AcacaatatacT AG 9452 448_1 67 9 29 2 G CT Acacaatat ACT A 9453 449_1 103 17 65 15 AT AT gctacacaatAT AC 9455 450_1 71 13 129 22 TG AT atgctacaC AAT 9459 451_1 19 4 9 1 ATG AtatgatatgCT AC 9464 452 1 75 10 45 21 GAGGagagagacaaTAAA 9495 453_1 68 6 43 10 CTAggaggagagagACA 9500 454 1 72 7 79 25 T ATTctaggaggag AG A 9504 455_1 31 3 29 9 TTATattctaggagGAG 9507 456_1 38 5 62 17 GTTtatattctaGGAG 9510 457 1 15 6 15 8 T GgagtttatattcT AGG 9512 458_1 34 3 21 3 CGtaccaccactcTGC 9590 459_1 41 5 55 22 T G AGgaaatcattcATT C 9641 460_1 81 8 47 22 TTTGaggaaatcatT CAT 9643 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 461_1 76 8 39 5 AGGCtaatcctattTG 9657 462 1 93 12 216 12 TTT AggctaatcCT AT 9660 463_1 15 6 30 9 TGCtccagtgtaccCT 9755 464 1 27 3 25 6 T Agtagtactcg AT AG 9813 465_1 9 2 7 3 CT AattgtagtagtaCT C 9818 466_1 52 3 32 6 TGctaattgtagTAGT 9822 467 1 68 11 36 16 AGTGctaattgtagTA 9824 468_1 35 6 32 3 GCAAgtgctaattgT A 9827 469_1 91 9 ND ND G AGG aaatgaactaattT A 9881 470_1 92 5 ND ND C AG G agg aaatgaacT A 9886 4711 67 5 42 6 CCctagagtcattTCC 9902 472 1 35 5 20 8 ATCttacatgatgaAGC 9925 473_1 13 1 20 5 GACacactcagatttcAG 9967 474 1 24 4 20 2 AG acacactcagatttcAG 9967 475_1 25 4 24 7 AAGacacactcagatttcAG 9967 476_1 26 6 19 4 AG acacactcagattT C A 9968 477_1 28 4 32 13 AAGacacactcagattT CA 9968 478_1 31 8 37 6 AAagacacactcagatTT C A 9968 479_1 63 7 51 26 GAAagacacactcagatTTC 9969 480_1 37 10 ND ND AAGAcacactcagatTTC 9969 481_1 41 4 ND ND AAAGacacactcagaTTT C 9969 482 1 19 5 48 14 T G AAagacacactcagatTT 9970 483_1 60 8 68 10 TGaaagacacactcaG ATT 9971 484 1 42 8 63 22 TGAaagacacactcaGAT 9972 485_1 48 9 41 20 ATTGaaagacacacT CA 9975 486_1 27 6 27 12 T CattgaaagacaC ACT 9977 487 1 88 13 121 33 TTCcatcattgaAAGA 9983 488_1 80 12 ND ND AT AAtaccacttaT CAT 10010 489_1 13 4 27 15 TT acttaatttcttTGG A 10055 490_1 32 5 60 24 TT AgaactagctttaT C A 10101 491_1 58 10 55 17 G AGgtacaaatatAG G 10171 492 1 4 1 12 3 CTT atgatacaacTT A 10384 493_1 37 6 35 5 TCttatgatacaaCTT 10385 494 1 30 0 27 6 TTCttatgatacaaCT 10386 495_1 27 8 18 3 CAgtttcttatgaTAC 10390 496_1 25 10 25 6 GCAgtttcttatgaTA 10391 497 1 77 6 72 29 TACAaatgtctattagGTT 10457 498_1 66 5 69 17 TGT AcaaatgtctatT AG 10460 499_1 27 10 20 4 AG CatcacaattagT A 10535 500_1 31 10 25 5 CT Aatgatagtg aaG C 10548 501_1 21 7 30 8 AGCtaatgatagtgAA 10550 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 502 1 35 5 39 8 ATGCcttgacatatTA 10565 503_1 64 11 79 26 CT C Aagattattg AC AC 10623 504 2 25 4 83 32 ACctcaagattaTTG A 10626 504 1 94 7 22 6 ACCtcaagattaTTGA 10626 505_1 31 6 34 10 AACCtcaagattatT G 10627 506_1 55 6 62 17 CACAaacctcaagattaTT 10628 507 1 66 12 40 4 GTActtaattagACCT 10667 508_1 78 5 80 10 AG T Acttaattag AC C 10668 509_1 36 5 42 15 GTAT gaggtggtaaAC 10688 510_1 40 4 48 22 AGgaaacagcagaAGTG 10723 511_1 27 7 13 6 GCacaacccagaggAA 10735 5121 54 5 ND ND CAAgcacaacccagAG 10738 513_1 35 7 ND ND TT CaagcacaaccC AG 10740 5141 49 6 52 15 AAttcaagcacaACCC 10742 515_1 72 4 106 49 T AAT aattcaagcacaaCC 10743 516_1 43 4 57 21 ACT AataattcaaGC AC 10747 5171 37 3 60 12 AT AAtactaataattcAAG C 10749 518_1 9 3 6 1 T AgatttgtgagGT AA 11055 519_1 59 10 31 5 AGCCttaattctccAT 11091 520_1 41 4 34 9 AATGatctagagcCTT A 11100 5211 34 6 34 7 CT AatgatctagaG CC 11103 522 1 52 6 52 17 ACT aatgatctaG AG C 11104 523_1 60 4 54 10 C ATtaacatgttctT ATT 11165 524 1 57 4 55 8 AC AAgtacattaacatGTT C 11170 525_1 53 6 44 5 TT ACaagtacattaaC AT G 11173 526_1 54 11 49 17 GCTTtattcatgtTT AT 11195 527 1 34 7 17 5 GCTttattcatgttTA 11196 528_1 11 2 21 4 AG AgctttattcatgtTT 11197 529_1 22 4 33 7 AT AAgagctttattC AT G 11200 530_1 30 5 32 15 CAT AagagctttaTT C A 11202 531_1 77 8 24 4 AG C Ataag agctTT AT 11205 532 1 8 3 15 6 TAGattgtttagtGCA 11228 533_1 4 2 10 2 GTagattgtttaGTGC 11229 534 1 41 6 33 11 GACAattctagtaGATT 11238 535_1 50 1 37 7 CTGacaattctaGT AG 11241 536_1 49 7 36 6 G CTG acaattctagT A 11242 537 1 59 2 42 11 AG gattaag atacgT A 11262 538_1 28 11 28 4 C Agg attaag ataCG T 11263 539_1 96 5 20 6 T C AggattaagataCG 11264 540_1 70 11 59 11 TT caggattaag AT AC 11265 5411 53 5 28 4 AG G Aagaaagtttg ATT C 11308 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 542 1 92 13 59 12 T C AAggaagaaagtTTG A 11311 543_1 44 3 67 7 CT C AaggaagaaagTTT G 11312 544 1 43 4 32 4 TGCtcaaggaagaAAGT 11315 545_1 41 7 44 20 AATT atgctcaaggaAG A 11319 546_1 11 4 26 8 T AG G ataccacattatG A 11389 547 1 25 4 26 12 C AtaatttattccattcCT C 11449 548_1 64 6 ND ND TGCAtaatttattcCAT 11454 549_1 48 17 49 7 ACTGcataatttatT CC 11456 550_1 91 10 92 15 CT AAactgcataattT ATT 11458 551_1 85 8 38 9 AT aactaaactgC AT A 11465 552 1 86 4 ND ND TT AttaataactaaaCT G C 11468 553_1 91 13 92 21 TAGT acattattaataaCT 11475 554 1 50 4 37 7 CAT AactaaggacgTT 11493 555_1 41 5 30 7 T CataactaaggaCGT 11494 556_1 80 7 55 13 CGT Cataactaagg AC 11496 557 1 86 3 59 11 TCgtcataactaagGA 11497 558_1 51 9 33 12 AT cgtcataact A AG G 11498 559_1 91 6 65 26 GTtagtatcttacATT 11525 560_1 30 3 41 8 CTCtattgttagtATC 11532 561_1 59 8 18 6 AGT atagagttacT GT 11567 562 1 65 11 41 11 TTCCtggtgatactTT 11644 563_1 57 13 45 13 GTT CctggtgatacTT 11645 564 1 57 15 30 7 TGttcctggtgataCT 11646 565_1 17 4 35 4 AT aaacatgaatctCT CC 11801 566_1 16 3 30 4 CTTtataaacatgaaT CT C 11804 567 1 60 5 45 11 CT GtctttataaaC AT G 11810 568_1 20 2 19 5 TT gttataaatctgT CTT 11820 569_1 68 9 44 4 TT AaatttattcttgG AT A 11849 570_1 76 8 48 12 CTtaaatttattctT G G A 11851 5711 62 5 66 5 CTT CttaaatttattctT G 11853 572 1 28 4 44 10 T AT GtttctcagtAAAG 11877 573_1 29 6 36 11 GAAttatctttaaACCA 11947 574 1 74 6 34 7 CCCttaaatttctaCA 11980 575_1 37 8 30 9 ACACtgctcttgtaCC 11995 576_1 45 14 27 6 T G AcaacactgctCTT 12000 577_1 2 1 12 5 TACAtttattgggcTC 12081 578_1 65 14 39 9 GTacatttattgGGCT 12082 579_1 34 4 53 12 TTGgtacatttatTGG 12085 580_1 41 7 35 6 C ATG ttggtacattT AT 12088 581_1 11 4 12 5 AATCatgttggtacAT 12092 582 1 96 16 48 9 AAatcatgttggtaCA 12093 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 583_1 71 15 42 13 GACaagtttggattAA 12132 584 1 46 34 39 6 AAtgttcagatgCCT C 12197 585_1 37 26 28 12 GCttaatgttcagaTG 12201 586_1 75 8 43 12 CGT AcatagcttgaT G 12267 587 1 41 10 28 5 GTG aggaattaggaT A 12753 588_1 41 5 27 9 GTAacaatatggttTG 12780 589_1 67 10 37 7 GAaatattgtagaCTA 13151 590_1 97 10 80 12 TTGaaatattgtagAC 13153 591_1 64 10 47 9 AAgtctagtaatTTGC 13217 592 1 84 7 60 9 GCTCagtagattatAA 13259 593_1 42 8 32 9 CAT acactgttgcT AA 13296 594 1 101 6 79 17 AT G gtctcaaatc ATT 13314 595_1 53 14 46 7 C AAT ggtctcaaatC A 13316 596_1 47 6 36 6 TTCCtattgattgaCT 13568 597 1 97 12 41 6 TTT CtgttcacaacAC 13600 598_1 85 1 49 11 AGgaacccactaaT CT 13702 599_1 56 3 34 7 T AAatggcaggaacCC 13710 600_1 15 4 24 8 GT AAatggcaggaaCC 13711 601_1 40 6 26 8 TT gtaaatggcagG AA 13713 602 1 59 12 26 6 TT atgagttaggC AT G 13835 603_1 62 2 42 10 CCAggtgaaactttAA 13935 604 1 77 9 55 18 CCCttagtcagctCCT 13997 605_1 82 13 42 11 ACccttagtcagCT CC 13998 606_1 74 1 39 10 C AcccttagtcagCT C 13999 607 1 76 9 30 8 T CT cttactaggcT CC 14091 608_1 82 5 50 13 CCtatctgtcatcATG 14178 609_1 82 1 48 12 TCCtatctgtcatcAT 14179 610_1 41 6 50 13 GAGaagtgtgagaaGC 14808 611_1 70 5 84 19 CATCcttgaagtttAG 14908 612_1 64 14 61 16 TAAtaagatggctCCC 15046 613_1 85 2 51 14 CAAggcataataagAT 15053 614_1 47 1 35 10 CCaaggcataatAAGA 15054 615_1 74 8 53 11 TGatccaattctcaCC 15151 616_1 63 4 41 11 AT G atccaattctC AC 15152 617_1 46 7 42 9 CGCttcatcttcacCC 15260 618_1 104 4 15 4 T AtgacactgcaT CTT 15317 619_1 8 3 8 5 GT AtgacactgcaT CT 15318 620_1 21 3 27 10 T GtatgacactgC AT C 15319 621_1 37 7 38 11 TTCTcttctgtaagTC 15363 622 1 49 7 36 11 TT ctacagaggaACT A 15467 623_1 47 1 32 10 ACT acagttctacAG A 15474 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 624 1 78 8 69 6 TT CCcacaggtaaaT G 15561 625_1 70 7 ND ND ATT AtttgaatatactC ATT 15594 626_1 73 7 49 25 TG G G aggaaattatTT G 15606 627 1 80 5 64 11 T G ACtcatcttaaaT G 15621 628_1 71 6 66 19 CTGactcatcttaaAT 15622 629_1 31 6 41 6 TTT actctgactcAT C 15628 630_1 88 2 68 18 TATtggaggaattaTT 15642 631_1 53 2 27 6 GTAttggaggaattAT 15643 632 1 23 3 39 7 T GgtatacttctctaagT AT 15655 633_1 42 9 33 3 GATCtcttggtataCT 15666 634 1 38 1 30 16 CAgacaactctataCC 15689 635_1 10 2 19 3 AAC Atcag acaacT CT A 15693 636_1 13 1 11 3 T AACatcagacaacT C 15695 637 1 14 2 27 2 TTT AacatcagacaACT C 15695 638_1 101 14 81 16 ATttaacatcagacAA 15698 639_1 14 1 17 1 CCtatttaacatcAGAC 15700 640_1 65 2 ND ND TCCctatttaacaTCA 15703 641_1 41 6 42 12 T CAAcgactattgG AAT 15737 642 1 37 2 29 5 CTT AtattctggcT AT 15850 643_1 31 7 35 4 ATCCttatattctgGC 15853 644 1 13 3 8 1 GAtccttatattCTGG 15854 645_1 25 5 20 4 TGAtccttatattCTG 15855 646_1 33 6 54 10 ATTGaaacttgaT CCT 15864 647 1 43 3 27 6 ACtgtcattgaaACTT 15870 648_1 54 7 32 12 TCTtactgtcattgAA 15874 649_1 12 1 25 2 AGgatcttactgtCATT 15877 650_1 13 4 11 3 GCAaatcaactccATC 15896 651_1 10 5 16 3 GT GcaaatcaactCC A 15898 652 1 7 0 36 18 CAATtatttctttgTGC 15910 653_1 21 3 31 7 TGGcaacaattattT CTT 15915 654 1 75 9 73 24 G CTggcaacaatT ATT 15919 655_1 21 6 39 6 ATCCatttctactgCC 15973 656_1 25 3 38 8 T AAT atctattgattT CT A 15988 657 1 14 2 11 5 T CaatagtgtagggC A 16093 658_1 11 4 10 3 TT CaatagtgtaggG C 16094 659_1 18 1 32 12 AG GTtaattaattcaAT AG 16102 660_1 33 7 25 10 C ATttgtaatccCT AG 16163 660_2 64 14 31 8 CATttgtaatcccTAG 16163 661_1 48 6 34 6 ACAtttgtaatccCTA 16164 662 2 29 6 23 5 AAcatttgtaatCCCT 16165 662 1 30 6 18 6 AACatttgtaatCCCT 16165 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 663_1 49 1 26 6 TAaatttcaagttCTG 16184 664 1 17 3 30 10 GTTtaaatttcaagTT CT 16185 665_1 22 7 40 9 CCAAgtttaaatttCAAG 16189 666_1 89 11 ND ND ACCCaagtttaaaTTT C 16192 667 1 60 16 87 8 CAtacagtgacccaagTTT 16199 668_1 65 9 50 12 ACatcccatacagT GA 16208 669_1 83 8 103 4 AGcacagctctaCAT C 16219 670_1 80 9 150 36 AT AtagcacagcT CT A 16223 671_1 57 14 ND ND T CCatatagcacagCT 16226 672 1 53 10 106 8 ATTtccatatagCACA 16229 673_1 78 3 96 14 TTT Atttccatat AG C A 16231 674 1 77 9 31 7 TTTatttccatatAGC 16232 675_1 32 6 ND ND AAGG agaggagatT AT G 16409 676_1 32 5 24 6 AGTtcttgtgttagCT 16456 677 1 19 4 17 4 GAgttcttgtgttaGC 16457 678_1 14 3 25 3 ATT aattatccatCCAC 16590 679_1 11 2 20 6 AT CaattaattatcC AT C 16593 680_1 31 5 40 11 AG AatcaattaattaT CC 16596 681_1 8 3 30 10 TGagataccgtgcaT G 16656 682 1 11 3 ND ND AAtgagataccgTGCA 16658 683_1 15 3 33 10 CTGtggttaggctaAT 16834 684 1 45 7 38 7 AagagtaagggtctgtggTT 16842 685_1 24 5 ND ND GAT GggttaagagT AA 16854 686_1 11 2 ND ND AG CagatgggttaaG A 16858 687 1 ND ND 51 7 T GtaaacatttgT AGC 16886 688_1 83 1 54 11 CCTgcttataaatgTA 16898 689_1 103 4 73 14 TGCCctgcttataaAT 16901 690_1 104 2 64 22 TCttcttagttcaaTA 16935 691_1 ND ND 60 9 TGgtttctaactACAT 16980 692 1 ND ND 94 22 AGtttggtttctaaCTA 16983 693_1 8 2 17 5 G AAtgaaacttgcCT G 17047 694 1 98 6 51 9 ATTatccttacatGAT 17173 695_1 48 4 18 4 GTacccaattatcCTT 17180 696_1 94 2 48 9 TGT acccaattatCCT 17181 697 1 31 5 42 13 TTgtacccaattaTCC 17182 698_1 41 4 39 6 TTTgtacccaattaTC 17183 699_1 63 0 28 12 AG C AgcaggttataTT 17197 700_1 99 6 43 12 T G G gaagtggtctG G G 17292 701_1 103 2 28 5 CT GgagagtgataaT A 17322 702 1 52 6 27 9 AAT GctggattacgT C 17354 703_1 67 3 37 7 CAatgctggattaCGT 17355 2024203581   29 May 2024 CMP ID NO KARPAS-299 cells 5 pM CMP THP1 cells 20 pM CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 704 1 36 10 80 12 TT gttcagaagtAT CC 17625 705_1 19 9 47 9 GAtgatttgcttGGAG 17646 706_1 44 NA 60 9 GAAatcattcacaACC 17860 707 1 46 9 32 9 TT G taacatctacT AC 17891 708_1 56 0 79 17 CATtaagcagcaagTT 17923 709_1 30 9 46 7 TTActagatgtgagCA 17942 710_1 29 4 36 6 TTtactagatgtgAGC 17943 7111 41 13 41 6 GACcaagcaccttaCA 17971 712_1 36 19 49 11 AG AccaagcacctT AC 17972 713_1 30 6 34 7 AT gggttaaata AAG G 18052 714_1 70 2 24 8 TCaaccagagtattAA 18067 715_1 11 4 26 8 GT CaaccagagtatT A 18068 716_1 126 56 26 6 ATtgtaaagctgaT AT 18135 717_1 73 1 42 10 C Acataattgta A AG C 18141 718_1 23 9 55 18 GAggtctgctattTAC 18274 719_1 50 1 42 11 TGtagattcaatgCCT 18404 720_1 79 3 39 10 CCtcattatactaTGA 18456 7211 27 6 30 8 CCttatgctatgacAC 18509 722 1 26 7 50 13 TCCTtatgctatgaCA 18510 723_1 59 1 48 12 AAGatgtttaagtATA 18598 724 1 54 2 50 13 CTgattattaagATGT 18607 725_1 92 10 84 19 T GgaaaggtatgaaTT 18808 726_1 24 8 61 16 ACttgaatggcttgGA 18880 727 1 8 4 51 14 AACttgaatggctTGG 18881 728_1 35 4 35 10 CAATgtgttactatTT 19004 729_1 36 9 53 11 ACAatgtgttactATT 19005 730_1 70 2 41 11 CAT CtgctatataaG A 19063 731_1 38 NA 42 9 CCT AgagcaaatacTT 19223 732 1 102 15 15 4 C AG agttaataat A AG 19327 733_1 37 10 8 5 GTT Caagcacaacg AA 19493 734 1 13 1 38 11 AG ggttcaagcac A AC 19496 735_1 49 NA 36 11 TGttggagacactgTT 19677 736_1 48 NA 32 10 AAGgaggagttaggAC 19821 737 1 36 NA 64 11 CT AT gccatttacg AT 19884 738_1 105 19 66 19 T CaaatgcagaattAG 19913 739_1 44 NA 41 6 AG tgacaatcaa AT G C 19921 740_1 107 NA 68 18 AAgtgacaatcaaAT G 19922 741 _1 102 4 27 6 GTGtaccaagtaacAA 19978 742 1 110 10 30 16 T G G gatgttaaacT G A 20037 2024203581   29 May 2024 Example 2 - Testing in vitro efficacy in a dose response curve A selection of oligonucleotides from Table 10 were tested in KARPAS-299 cells using half-log serial dilutions in in PBS (50 pM, 15.8 pM, 5.0 pM, 1.58 pM, 0.5 pM, 0.158 pM, 0.05 pM, to 0.0158 pM oligonucleotide) in the in vitro efficacy assay described in Example 1. IC 50 and max 5 inhibition (% residual PD-L1 expression) was assessed for the oligonucleotides. EC50 calculations were performed in GraphPad Prism6. The IC50 and maximum PD-L1 knock down level is shown in table 11 as % of control (PBS) treated cells. Table 11: Max inhibition as % of saline and EC50 in KARPAS-299 cell line. CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline-treated) EC50 (pM) Compound CMP Start on SEQ ID NO: 1 Avg SD Avg SD 6_1 11 3.3 0.69 0.11 T CGCataagaatgaCT 371 8_1 29 1.7 0.06 0.01 CTGaacacacagtCGC 383 9_1 19 1.7 0.23 0.02 T CT gaacacacagtCG 384 13_1 14 4.7 0.45 0.12 CTtacttagatgcTGC 495 411 10 1.8 0.19 0.02 TCAtttagttaccCAA 822 421 17 1.3 0.19 0.02 TTcatttagttaCCCA 823 58_1 23 1.5 0.17 0.01 CCagagatatataTGC 909 77_1 24 2.4 0.16 0.02 AGTatcatagttcTCC 1075 921 12 2.4 0.25 0.03 AG attaagacagtT G A 1310 111_1 3 2.0 0.27 0.03 T G aattcccatatcCG A 1992 128_1 11 1.8 0.25 0.03 CT catatcagggC AGT 2063 151_1 16 2.7 0.28 0.05 GT CatggattacaaCT 2324 1641 19 1.6 0.15 0.01 TCTGtttatgtcacTG 2781 166_1 36 1.7 0.11 0.02 TGgtctgtttatGTCA 2784 169_1 10 1.6 0.22 0.02 TT cagcaaatatT CGT 2995 1711 12 2.0 0.21 0.02 TCTattgttaggtATC 3053 222 1 1 2.0 0.21 0.02 TGacttgtaattgTGG 5467 233_1 1 4.3 0.89 0.17 TG G aatgccctaatT A 5591 245_1 4 2.0 0.17 0.02 TCggttatgttaTCAT 6470 246_1 7 2.1 0.25 0.03 CActttatctggTCGG 6482 250_1 0 2.5 0.23 0.03 CCacatataggtcCTT 6597 251_1 0 2.8 0.75 0.10 CAtattgctaccaTAC 6617 252 1 3 2.2 0.19 0.02 TCAtattgctaccATA 6618 256_1 5 2.2 0.32 0.03 CAAttagtgcagcCAG 6672 272 1 1 3.2 0.69 0.10 T ACT gtagaacatgG C 7133 273_1 3 2.8 0.28 0.04 GCAAttcatttgaTCT 7239 287 1 1 1.4 0.13 0.01 AC AAataatggttaCT CT 7302 292 1 2 2.1 0.21 0.02 GCATttgatatagAGA 7397 303_1 0 1.2 0.21 0.01 CAAgatgaatataTGCC 7551 3141 3 2.1 0.39 0.04 GAgtttggattagCTG 7764 2024203581   29 May 2024 CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline-treated) EC50 (pM) Compound CMP Start on SEQ ID NO: 1 Avg SD Avg SD 318_1 3 1.4 0.14 0.01 ACAggatatggaaGGG 7880 320_1 2 2.4 0.22 0.03 GAgtaatttcaacAGG 7891 324 1 0 2.4 0.44 0.05 CAgcttactattaGGG 7906 336_1 0 2.5 0.21 0.03 GATGatttaattctagtCA 7984 342 1 1 2.2 0.12 0.01 CAGAttgatggtagTT 8030 343_1 4 1.8 0.11 0.01 CT cagattgatgGTAG 8032 344 1 0 0.9 0.12 0.01 GTT agccctcagaTT G 8039 345_1 0 2.3 0.36 0.04 TGtattgttagcCCTC 8045 346_1 1 2.1 0.22 0.02 ACttgtattgttAGCC 8048 349_1 4 2.9 0.21 0.03 ACAagtggtatctTCT 8228 359_1 6 2.9 0.39 0.05 TTG AtgaggctaagT C 8395 360_1 0 1.7 0.18 0.02 CCAggattatactcTT 8439 374 1 5 1.7 0.33 0.03 AAG atgg attgggaG T 8775 408_1 3 1.8 0.21 0.02 TTtgcatatggaGGTG 8966 409_1 0 1.8 0.21 0.02 AAgtgaagttcaaCAGC 8997 415_1 0 1.4 0.23 0.02 AAttgagtgaatCCAA 9120 417_1 7 0.9 0.15 0.01 GTG ataattgagtG AA 9125 424 1 6 3.2 0.19 0.03 CT cattgaaggtT CT G 9281 429_1 5 2.5 0.48 0.05 CAAatagctttatCGG 9335 430_1 1 2.7 0.68 0.09 CCaaatagctttAT CG 9336 458_1 0 4.1 0.35 0.07 T GgagtttatattcT AGG 9512 464 1 0 4.1 0.56 0.10 TGCtccagtgtaccCT 9755 466_1 1 2.1 0.21 0.02 CT AattgtagtagtaCT C 9818 474 1 0 2.4 0.27 0.03 GACacactcagatttcAG 9967 490_1 0 1.9 0.29 0.03 TT acttaatttcttTGG A 10055 493_1 3 1.8 0.20 0.02 CTT atgatacaacTT A 10384 512_1 0 3.3 0.63 0.10 GCacaacccagaggAA 10735 519_1 5 1.5 0.15 0.01 T AgatttgtgagGT AA 11055 529_1 0 2.7 0.24 0.03 AG AgctttattcatgtTT 11197 533_1 6 1.5 0.14 0.01 TAGattgtttagtGCA 11228 534 1 5 0.9 0.06 0.00 GTagattgtttaGTGC 11229 547 1 1 1.6 0.26 0.02 T AG G ataccacattatG A 11389 566_1 0 3.0 0.40 0.06 AT aaacatgaatctCT CC 11801 567 1 2 2.5 0.34 0.04 CTTtataaacatgaaT CT C 11804 578_1 2 1.3 0.09 0.01 TACAtttattgggcTC 12081 582 1 1 1.6 0.20 0.02 AATCatgttggtacAT 12092 601_1 1 2.1 0.47 0.05 GT AAatggcaggaaCC 13711 619_1 4 3.4 0.44 0.08 T AtgacactgcaT CTT 15317 620_1 1 1.2 0.12 0.01 GT AtgacactgcaT CT 15318 636_1 0 1.3 0.19 0.01 AAC Atcag acaacT CT A 15693 2024203581   29 May 2024 CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline-treated) EC50 (pM) Compound CMP Start on SEQ ID NO: 1 Avg SD Avg SD 638_1 0 2.2 0.36 0.04 T AACatcagacaacT C 15695 637 1 0 2.1 0.21 0.02 TTT AacatcagacaACT C 15695 640_1 2 3.3 0.42 0.06 CCtatttaacatcAGAC 15700 645_1 1 2.9 0.34 0.04 GAtccttatattCTGG 15854 650_1 0 2.4 0.24 0.03 AGgatcttactgtCATT 15877 651_1 4 3.4 0.33 0.05 GCAaatcaactccATC 15896 652 1 0 1.3 0.16 0.01 GT GcaaatcaactCC A 15898 653_1 4 2.0 0.09 0.01 CAATtatttctttgTGC 15910 658_1 3 1.6 0.32 0.02 T CaatagtgtagggC A 16093 659_1 5 1.4 0.20 0.01 TT CaatagtgtaggG C 16094 660_1 4 2.1 0.22 0.02 AG GTtaattaattcaAT AG 16102 665_1 3 1.8 0.18 0.02 GTTtaaatttcaagTT CT 16185 678_1 3 2.1 0.43 0.04 GAgttcttgtgttaGC 16457 679_1 0 3.5 0.31 0.05 ATT aattatccatCCAC 16590 680_1 4 1.6 0.12 0.01 AT CaattaattatcC AT C 16593 682 1 3 2.4 0.27 0.03 TGagataccgtgcaT G 16656 683_1 0 3.2 0.16 0.03 AAtgagataccgTGCA 16658 684 1 2 2.3 0.25 0.03 CTGtggttaggctaAT 16834 687 1 5 1.3 0.13 0.01 AG CagatgggttaaG A 16858 694 1 0 1.7 0.16 0.02 G AAtgaaacttgcCT G 17047 706_1 15 3.6 0.27 0.06 GAtgatttgcttGGAG 17646 716_1 10 2.1 0.15 0.02 GT CaaccagagtatT A 18068 728_1 5 1.2 0.09 0.01 AACttgaatggctTGG 18881 733_1 0 12.7 8.01 3.62 C AG agttaataat A AG 19327 734 1 0 14.6 3.49 2.39 GTT Caagcacaacg AA 19493 735_1 0 2.5 0.30 0.04 AG ggttcaagcac A AC 19496 A selection of oligonucleotides from Table 6 were tested in THP-1 cells using 1:3 serial in water from 25 pM to 0.004 pM in the in vitro efficacy assay described in Example 1. IC 50 and max inhibition (Percent residual PD-L1 expresson) was assessed for the oligonucleotides. EC50 calculations were performed in GraphPad Prism6. The IC50 and maximum PD-L1 knock 5 down level is shown in table 12 as % of control (PBS) treated cells. Table 12: Max inhibition as % of saline and EC50 in THP1 cell line. CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline) EC50 (pM) Compound CMP Start on SEQ ID NO: 1 Avg SD Avg SD 6_1 12 11.5 0.73 0.38 T CGCataagaatgaCT 371 8_1 6 5.6 0.11 0.04 CTGaacacacagtCGC 383 9_1 1 14.3 0.36 0.27 T CT gaacacacagtCG 384 2024203581   29 May 2024 CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline) EC50 (pM) Compound CMP Start on SEQ ID NO: 1 Avg SD Avg SD 13_1 2 12.4 0.49 0.31 CTtacttagatgcTGC 495 411 14 14.6 0.38 0.27 TCAtttagttaccCAA 822 421 21 10.4 0.22 0.10 TTcatttagttaCCCA 823 58_1 6 19.8 0.97 0.81 CCagagatatataTGC 909 77_1 5 4.8 0.14 0.04 AGTatcatagttcTCC 1075 921 0 12.9 0.57 0.39 AG attaagacagtT G A 1310 128_1 15 10.1 0.23 0.13 CT catatcagggC AGT 2063 151_1 9 14.4 0.18 0.15 GT CatggattacaaCT 2324 1641 16 22.0 0.57 0.60 TCTGtttatgtcacTG 2781 166_1 13 11.9 0.17 0.11 TGgtctgtttatGTCA 2784 169_1 0 9.3 0.22 0.11 TT cagcaaatatT CGT 2995 1711 11 12.9 0.28 0.20 TCTattgttaggtATC 3053 222 1 16 19.7 0.68 0.64 TGacttgtaattgTGG 5467 245_1 14 6.1 0.26 0.08 TCggttatgttaTCAT 6470 246_1 28 7.3 0.10 0.20 CActttatctggTCGG 6482 252 1 19 8.0 0.29 0.12 TCAtattgctaccATA 6618 272 1 3 9.7 0.25 0.14 T ACT gtagaacatgG C 7133 3141 13 9.6 0.31 0.15 GAgtttggattagCTG 7764 344 1 11 8.0 0.14 0.06 GTT agccctcagaTT G 8039 349_1 12 12.5 0.18 0.14 ACAagtggtatctTCT 8228 415_1 11 9.6 0.26 0.12 AAttgagtgaatCCAA 9120 493_1 15 16.5 0.48 0.34 CTT atgatacaacTT A 10384 512_1 43 14.1 0.31 0.68 GCacaacccagaggAA 10735 519_1 9 12.2 0.45 0.26 T AgatttgtgagGT AA 11055 533_1 11 13.6 0.29 0.21 TAGattgtttagtGCA 11228 534 1 9 6.5 0.09 0.03 GTagattgtttaGTGC 11229 582 1 0 12.3 0.33 0.23 AATCatgttggtacAT 12092 619_1 8 10.4 0.32 0.18 T AtgacactgcaT CTT 15317 620_1 12 24.6 1.10 1.08 GT AtgacactgcaT CT 15318 638_1 2 5.4 0.00 0.00 T AACatcagacaacT C 15695 645_1 20 29.6 1.10 1.50 GAtccttatattCTGG 15854 651_1 0 11.2 0.14 0.09 GCAaatcaactccATC 15896 658_1 11 13.8 0.48 0.32 TCaatagtgtagggCA 16093 659_1 0 8.2 0.11 0.06 TT CaatagtgtaggG C 16094 733_1 0 69.6 11.03 26.95 C AG agttaataat A AG 19327 734 1 36 16.8 2.84 2.12 GTT Caagcacaacg AA 19493 The results in table 7 and 8 are also shown in figure 2 in relation to their position where they target the PD-L1 pre mRNA of SEQ ID NO: 1. 2024203581   29 May 2024 From this it can be seen that almost all of the compounds have EC50 values below 1 pM and a target knock down below 25% of the PD-L1 expression level in the control cells (treated with saline). Example 3 - In vitro potency and efficacy and in vivo PD-L1 reduction in poly(l:C) 5 induced mice using naked and GalNAc conjugated PD-L1 antisense oligonucleotides Efficacy and potency testing was performed in an in vitro experiment in in dose-response studies in MCP-11 cells using the oligonucleotides in table 6. The same oligonucleotides as well as GalNAc conjugated versions (Table 8 CMP ID NO 755_2 - 765_2) were tested in vivo in poly(l:C) induced C57BL / 6J female mice for their ability to reduce PD-L1 mRNA and protein 0 expression In vitro assay MCP-11 cells (originally purchased from ATCC) suspended in DMEM (Sigma cat. no. D0819) supplemented with 10% horse serum, 2 mM L-glutamine, 0.025 mg / ml gentamicin and 1 mM sodium pyruvate were added at a density of 8000 cells / well to the oligonucleotides (10 pl) in OGIS well round bottom plates and cultured for 3 days in a final volume of 200 pl / well in a humidified incubator at 37°C with 5% CO2. Oligonucleotides were screened in dose-range concentrations (50 pM, 15.8 pM, 5.0 pM, 1.58 pM, 0.5 pM, 0.158 pM, 0.05 pM and 0.0158 pM). Total mRNA was extracted using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer’s instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, 20 random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer’s instruction. For gene expressions analysis, qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and Gusb (Thermo Fisher Scientific; VIC-MGB-PL Mm01197698-m1). The relative PD-L1 25 mRNA expression level is shown in table 9 as % of residual PD-L1 expression in % of PBS control samples (PBS-treated cells). EC50 calculations were performed in GraphPad Prism6. The EC50 and maximum PD-L1 knockdown level is shown in table 13 as % of control (PBS) cells. In vivo assay 30 C57BL / 6J female mice (20-23 g; 5 mice per group) were injected s.c. with 5 mg / kg unconjugated oligonucleotides to mouse PD-L1 or 2.8 mg / kg GalNAc-conjugated oligonucleotides to mouse PD-L1. Three days later, the mice were injected i.v. with 10 mg / kg poly(l:C) (LWM, Invivogen). The mice were sacrificed 5 h after poly(l:C) injection and liver samples were placed in RNAIater (Thermo Fisher Scientific) for RNA extraction or frozen at dry 35 ice for protein extraction. 2024203581   29 May 2024 Total mRNA was extracted from homogenized liver samples using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer’s instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer’s 5 instruction. For gene expressions analysis, qPCR was performed using TaqMan® Fast Advanced Master Mix TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 mRNA (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and TBP (Thermo Fisher Scientific; VIC-MGB-PL Mm00446971_m1). The relative PD-L1 mRNA expression level is shown in table 13 as % of control samples from mice 0 injected with saline and poly(l:C). Liver homogenates were prepared by homogenizing liver samples in 2 ml per 100 mg tissue T-PER® Tissue Protein Extraction Reagent (Thermo Fisher Scientific) mixed with 1x Halt Protease Inhibitor Cocktail, EDTA-Free (Thermo Fisher Scientific). Protein concentrations in liver homogenates were measured using Coomassie Plus (Bradford) Assay Reagent (Thermo 15 Scientific) according to the manufacturer’s instructions. Liver homogenates (40 pg protein) were separated on 4-12% Bis-Tris Plus polyacrylamide gels (Thermo Fisher Scientific) in IxMOPS running buffer and transferred to nitrocellulose membranes using iBLOT Dry blotting system (Thermo Fisher Scientific) according to the manufacturer’s instructions. Each blot was cut in to two parts horizontally at the 64 kDa band. Following blocking in TBS containing 5% skim milk 20 and 0.05% Tween20, the membranes were incubated overnight at 4°C with rabbit monoclonal anti-vinculin (Abeam cat. no. ab129002) diluted 1:10000 (upper membranes) or goat polyclonal anti-mPD-L1 (R&D Systems cat. no. AF1019) diluted 1:1000 (lower membranes) in TBS containing 5% skim milk and 0.05% Tween20. The membranes were washed in TBS containing 0.05% Tween20 and exposed for 1 h at room temperature to HRP-conjugated swine anti-rabbit 25 IgG (DAKO) diluted 1:3000 (upper membranes) or HRP-conjugated rabbit anti-goat IgG (DAKO) diluted 1:2000 in TBS containing 5% skim milk and 0.05% Tween20. Following washing of the membranes, the reactivity was detected using ECL select (Amersham GE Healthcare). For each group of mice treated with oligonucleotides, the intensity of the PD-L1 bands in relation to vinculin bands were evaluated by comparison with the PD-L1 / vinculin band intensities of mice 30 injected with saline and poly(l:C) (control). Results are shown in table 13, and westernblots with pairs of naked and conjugated oligonucleotides are shown in figure 9 A-E. Table 13: In vitro and in vivo efficacy of oligonucleotides to mouse PD-L1 CMP ID NO Compound CMP Max Inhibition (%of PBS) EC50 (pM) PD-L1 mRNA (% of control) PD-L1 protein (relative to control) 744 1 AGTttacattttcTGC 9.1 0.56 86 ++ 746_1 CACctttaaaaccCCA 5.0 0.46 181 nd 747_1 TCCtttataatcaCAC 4.4 0.52 104 ++ 2024203581   29 May 2024 CMP ID NO Compound CMP Max Inhibition (%of PBS) EC50 (pM) PD-L1 mRNA (% of control) PD-L1 protein (relative to control) 748_1 ACGgtattttcacAGG 1.8 0.26 102 +++ 749_1 GACactacaatgaGGA 7.6 1.21 104 nd 750_1 TGGtttttaggacTGT 12.4 0.74 84 nd 751_1 CGAcaaattctatCCT 9.9 0.69 112 nd 752 1 T G AtatacaatgcT AC 10.5 1.11 142 +++ 753_1 TCGttgggtaaatTTA 5.7 0.53 116 +++ 754 1 TGCtttataaatgGTG 5.2 0.35 98 nd 755^2 5'-G N2-C6-caAGTttacattttcT G C nd nd 58 + 757 2 5'-G N2-C6-caC ACctttaaaaccCC A nd nd 62 nd 758_2 5'-G N2-C6-caT CCtttataatcaC AC nd nd 53 + 759_2 5'-G N2-C6-caACGgtattttcacAG G nd nd 66 + 760_2 5'-G N2-C6-caG ACactacaatgaGG A nd nd 101 nd 761 _2 5'-GN2-C6-caTGGtttttaggacTGT nd nd 99 nd 762 2 5'-G N2-C6-caCG AcaaattctatCCT nd nd 84 nd 763_2 5'-G N2-C6-caT G AtatacaatgcT AC nd nd 93 +++ 764 2 5'-G N2-C6-caT CGttgggtaaatTT A nd nd 53 + 765_2 5'-G N2-C6-caTGCtttataaatgGT G nd nd 106 nd +++: similar to PD-L1 / vinculin band intensity of control; ++: weaker than PD-L1 / vinculin band intensity of control; +: much weaker than PD-L1 / vinculin band intensity of control; nd= not determined. From the data in table 13 it can be seen that GalNAc conjugation of the oligonucleotides clearly improves the in vivo PD-L1 reduction. The reduction of mRNA generally correlates with a 5 reduction in PD-L1 protein. Except for CMP ID NO: 754 1, a low in vitro EC...

Claims

1. An antisense oligonucleotide conjugate comprising:a. an oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid; andb. at least one asialoglycoprotein receptor targeting conjugate moiety covalently attached to the oligonucleotide in a), wherein the contiguous nucleotide sequence is complementary to a sub-sequence of the target nucleic acid, wherein the subsequence is position 5467-12107 on SEQ ID NO: 1.

2. The antisense oligonucleotide conjugate of claim 1, wherein the oligonucleotide comprises the sequence SEQ ID NO: 466.15   3. The antisense oligonucleotide conjugate of claim 1 or claim 2, wherein the contiguousnucleotide sequence comprises one or more modified nucleosides.

4. The antisense oligonucleotide conjugate of claim 3, wherein the one or more modified nucleosides are 2' sugar modified nucleosides.

205. The antisense oligonucleotide conjugate of claim 4, wherein the one or more 2' sugar modified nucleoside is independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

256. The antisense oligonucleotide conjugate of any one of claims 3 to 5, wherein all the modified nucleosides are LNA nucleosides.

7. The antisense oligonucleotide conjugate of any one of claims 1 to 6, wherein the contiguous 30 nucleotide sequence comprises at least one modified internucleoside linkage.

8. The antisense oligonucleotide conjugate of claim 7, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.35   9. The antisense oligonucleotide conjugate of any one of claims 1 to 8, wherein the oligonucleotideis a gapmer.2024203 5g 1   29 May 202410. The antisense oligonucleotide conjugate of any one of claims 1 to 9, wherein the asialoglycoprotein receptor targeting conjugate moiety comprises at least one carbohydrate moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine.

11. The antisense oligonucleotide conjugate of any one of claims 1 to 10, wherein the asialoglycoprotein receptor targeting conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent.

12. The antisense oligonucleotide conjugate of any one of claims 1 to 11, wherein the asialoglycoprotein receptor targeting conjugate moiety is a tri-valent N-acetylgalactosamine (GalNAc) moiety.15   13. An antisense oligonucleotide of formula CTAattgtagtagtaCTC, wherein capital letters representbeta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine and all internucleoside linkages are phosphorothioate internucleoside linkages.

14. An antisense oligonucleotide conjugate comprising the oligonucleotide of claim 13 and a 20 conjugate moiety covalently attached to said oligonucleotide.

15. The antisense oligonucleotide conjugate of claim 14, wherein a linker is present between the oligonucleotide and the conjugate moiety.25   16. The antisense oligonucleotide conjugate of claim 14 or claim 15, wherein the conjugate moietyis an asialoglycoprotein receptor targeting moiety.

17. The antisense oligonucleotide conjugate of claim 16, wherein the asialoglycoprotein receptor targeting moiety is a tri-valent N-acetylgalactosamine (GalNAc) moiety.3018. The antisense oligonucleotide conjugate of any one of claims 15 to 17, wherein the linker is a physiologically labile linker.

19. The antisense oligonucleotide conjugate of claim 18, wherein the physiologically labile linker is 35 a nuclease susceptible linker.

20. The antisense oligonucleotide conjugate of claim 18 or claim 19, wherein the physiologically labile linker comprises a cytidine-adenosine dinucleotide.2024203 5g 1   29 May 202421. The antisense oligonucleotide conjugate of claim 14, wherein a linker is present between the oligonucleotide and the conjugate moiety; further wherein the conjugate moiety is an asialoglycoprotein receptor targeting moiety that is a tri-valent N-acetylgalactosamine (GalNAc) moiety; wherein the linker is a physiologically labile linker; further wherein the physiologically labile linker comprises a cytidine-adenosine dinucleotide.

22. The antisense oligonucleotide conjugate of any one of claims 14 to 21, wherein the antisense oligonucleotide conjugate is of formula GN2-C60c0a0CTAattgtagtagtaCTC, wherein C6 represents an amino alkyl group with 6 carbons, capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester nucleoside linkage and unless otherwise indicated, all internucleoside linkages are phosphorothioate internucleoside linkages, and wherein GN2 represents the trivalent GalNAc cluster shown in Figure 3, further wherein the wavy line in Figure15        3 illustrates the site of conjugation of the cluster to the C6 amino alkyl group.

23. The antisense oligonucleotide conjugate of any one of claims 14 to 22, wherein the oligonucleotide conjugate is CMP ID NO: 769_2.20   24. The antisense oligonucleotide conjugate shown in Figure 7.

25. A pharmaceutical composition comprising the antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 24 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.2526. The pharmaceutical composition according to claim 25, wherein the pharmaceutically acceptable diluent is sterile phosphate buffered saline.

27. The  pharmaceutical  composition  according  to  claim  25  or claim  26,  wherein  the30 pharmaceutically acceptable salt is sodium.

28. The  pharmaceutical  composition  according  to  claim  25  or claim  26,  wherein  thepharmaceutically acceptable salt is potassium.35   29. An in vivo or in vitro method for modulating PD-L1 expression in a target cell which is expressingPD-L1, said method comprising administering an antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition of any one of claims 1 to 28 in an effective amount to said cell.2024203 5g 1   29 May 202430. The antisense oligonucleotide, antisense oligonucleotide conjugate or the pharmaceutical composition of any one of claims 1 to 28 for use in restoration of immune response against a virus.

31. The antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition for use according to claim 30, wherein the virus is HBV.

32. The antisense oligonucleotide, antisense oligonucleotide conjugate or the pharmaceutical composition of any one of claims 1 to 28 for use in restoration of immune response against a parasite.

33. The antisense oligonucleotide, antisense oligonucleotide conjugate or the pharmaceutical composition for use according to any one of claims 30 to 32, wherein the restoration of the15 immune response is an increase in the liver of CD8+ T cells specific to one or more HBV antigens when compared to a control.

34. The antisense oligonucleotide, antisense oligonucleotide conjugate or the pharmaceutical composition of any one of claims 1 to 28 for use as a medicament.2035. The antisense oligonucleotide, antisense oligonucleotide conjugate or the pharmaceutical composition of any one of claims 1 to 28 for use in the treatment or prevention of HBV infection.

36. Use of the antisense oligonucleotide, antisense oligonucleotide conjugate or the pharmaceutical 25 composition of any one of claims 1 to 28, for the preparation of a medicament for treatment or prevention of HBV infection.

37. A method for treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of an antisense oligonucleotide, antisense oligonucleotide 30 conjugate or pharmaceutical composition of any one of claims 1 to 28 to a subject suffering from or susceptible to the disease.

38. A method for treating or preventing HBV infection comprising administering a therapeutically or prophylactically effective amount of an antisense oligonucleotide, antisense oligonucleotide 35 conjugate or pharmaceutical composition of any one of claims 1 to 28 to a subject suffering from or susceptible to HBV infection.2024203581   29 May 202439. A pharmaceutically acceptable salt of the antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 24.

40. A pharmaceutically acceptable sodium salt of the antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 24.

41. A pharmaceutically acceptable potassium salt of the antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 24.

Images