Compositions and methods for improving mitochondrial function and treating neurodegenerative diseases and cognitive disorders

Abstract

Provided are compositions comprising compounds or precursors to compounds which may be used for a variety of therapeutic applications including, for example, treating and / or preventing a disease or disorder related to reduced or inadequate mitochondrial activity, including aging or stress, diabetes, obesity, and neurodegenerative diseases. The compounds relate generally to urolithins and precursors thereof, including but not limited to ellagitannins and urolithin A. In certain embodiments the compositions are presented in or as food products or nutritional supplements. These same compounds and compositions can also be used advantageously in generally healthy individuals to increase or maintain metabolic rate, decrease percent body fat, increase or maintain muscle mass, manage body weight, improve or maintain mental performance (including memory), improve or maintain muscle performance, improve or maintain mood, and manage stress. 20 24 20 49 08 17 J ul 2 02 4 A B S T R A C T 2 0 2 4 2 0 4 9 0 8 1 7 J u l 2 0 2 4

Description

75 mitochondrial proteins are considered, it is difficult to explain the variable patterns of affected organ systems in the mitochondrial disease syndromes seen clinically. Mitochondrial diseases result from failures of the mitochondria, specialized compartments present in every cell of the body except red blood cells. Mitochondria are responsible for creating more than 90% of the energy needed by the body to sustain life and 20 support growth. When they fail, less and less energy is generated within the cell. Cell injury and even cell death follow. If this process is repeated throughout the body, whole systems begin to fail, and the life of the person in whom this is happening is severely compromised. Mitochondrial diseases primarily affect children, but adult onset is becoming more recognized. 25          Diseases of the mitochondria appear to cause the most damage to cells of the brain, heart, liver, skeletal muscles, kidney, and the endocrine and respiratory systems. Many symptoms in mitochondrial disorders are non-specific. The symptoms may also show an episodic course, with periodic exacerbations. The episodic condition of migraine, as well as myalgia, gastrointestinal symptoms, tinnitus, depression, chronic 30 fatigue, and diabetes, have been mentioned among the various manifestations of mitochondrial disorders in review papers on mitochondrial medicine (Chinnery and Turnbull (1997) QJM 90:657-67; Finsterer (2004) Eur J Neurol. 11:163-86). In patients with mitochondrial disorders, clinical symptomatology typically occurs at times of higher 2024204908   17 Jul 2024 energy demand associated with physiological stressors, such as illness, fasting, overexercise, and environmental temperature extremes. Furthermore, psychological stressors also frequently trigger symptomatology, presumably due to higher brain energy demands for which the patient is unable to match with sufficient ATP production. 5          Depending on which cells are affected, symptoms may include loss of motor control, muscle weakness and pain, gastro-intestinal disorders and swallowing difficulties, poor growth, cardiac disease, liver disease, diabetes, respiratory complications, seizures, visual / hearing problems, lactic acidosis, developmental delays and susceptibility to infection. 10           Mitochondrial diseases include, without limitation, Alper’s disease; Barth syndrome; beta-oxidation defects; carnitine deficiency; camitine-acyl-camitine deficiency; chronic progressive external ophthalmoplegia syndrome; co-enzyme Q10 deficiency; Complex I deficiency; Complex II deficiency; Complex III deficiency; Complex IV deficiency; Complex V deficiency; CPT I deficiency; CPT II deficiency; creatine 15 deficiency syndrome; cytochrome c oxidase deficiency; glutaric aciduria type II; Kearns- Sayre syndrome; lactic acidosis; TCHAD (long-chain acyl-CoA dehydrogenase deficiency); Leber’s hereditary optic neuropathy; Leigh disease; lethal infantile cardiomyopathy; Luft disease; MAD (medium-chain acyl-CoA dehydrogenase deficiency); mitochondrial cytopathy; mitochondrial DNA depletion; mitochondrial encephalomyopathy, lactic 20 acidosis, and stroke-like symptoms; mitochondrial encephalopathy; mitochondrial myopathy; mitochondrial recessive ataxia syndrome; muscular dystrophies, myoclonic epilepsy and ragged-red fiber disease; myoneurogenic gastrointestinal encephalopathy; neuropathy, ataxia, retinitis pigmentosa, and ptosis; Pearson syndrome; POLG mutations; pyruvate carboxylase deficiency; pyruvate dehydrogenase deficiency; SCHAD (short-chain 25 acyl-CoA dehydrogenase deficiency); and very long-chain acyl-CoA dehydrogenase deficiency. An aspect of the invention is a food product or nutritional supplement comprising an effective amount of pomegranate extract: for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, 30 diabetes mellitus, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorder, mood disorder, stress, and anxiety disorder; for weight management; or to increase muscle performance or mental performance. 2024204908   17 Jul 2024 As used herein, a “food product” refers to a product prepared from a natural food. Non-limiting examples of food products include juices, wines, concentrates, jams, jellies, preserves, pastes, and extracts. As used herein, a “nutritional supplement” refers to a product suitable for consumption or other administration principally for its health- 5 promoting properties rather than its caloric content. As used herein, the term “metabolic syndrome” refers to a combination of medical disorders that, when occurring together, increase the risk of developing cardiovascular disease and diabetes. It affects one in five people in the United States and prevalence increases with age. Some studies have shown the prevalence in the United States to be an 10 estimated 25% of the population. In accordance with the International Diabetes Foundation consensus worldwide definition (2006), metabolic syndrome is central obesity plus any two of the following: • Raised triglycerides: > 150 mg / dL (1.7 mmol / L), or specific treatment for this lipid abnormality; 15       • Reduced HDL cholesterol: < 40 mg / dL (1.03 mmol / L) in males, < 50 mg / dL (1.29 mmol / L) in females, or specific treatment for this lipid abnormality; • Raised blood pressure: systolic BP > 130 or diastolic BP >85 mm Hg, or treatment of previously diagnosed hypertension; and • Raised fasting plasma glucose: (FPG)>100 mg / dL (5.6 mmol / L), or previously 20 diagnosed type 2 diabetes. An aspect of the invention is a food product or nutritional supplement comprising an effective amount of an ellagitannin: for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes mellitus, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive 25 disorder, mood disorder, stress, and anxiety disorder; for weight management; or to increase muscle performance or mental performance. In certain embodiments in accordance with this and other aspects of the invention, the ellagitannin is selected from the group consisting of 2-O-galloyl-punicalin, casaurictin, castalagin & vecalagin, castalin, casuarictin, casuariin, casuarinin, chebulagic acid, 30 chebulinic acid, corilagin, comusiin E, epipunicacortein A, flosin B, gemin D, granatin A, granatin B, grandinin, lagerstroemin, lambertianin C, pedunculagin, punicacortein A, punicacortein B, punicacortein C, punicacortein C, punicacortein D, punicafolin, punicalagin, punicalin, punigluconin, roburin A, roburin B, roburin C, roburin D, roburin E, 2024204908   17 Jul 2024 rubusuaviin C, sanguiin H-4, sanguiin H-5, sanguiin H-6, sanguiin H-10, stachyurin, strictinin, tellimagrandin I, tellimigrandin II, terchebulin, terflavin A, terflavin B, Tergallagin, and terminalin / gallagyldilacton. Of course, additional ellagitannins are also contemplated by the invention. 5          An aspect of the invention is a food product or nutritional supplement comprising an effective amount of punicalagin: for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes mellitus, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorder, mood disorder, stress, and anxiety disorder; for weight management; or to 10 increase muscle performance or mental performance. An aspect of the invention is a food product or nutritional supplement comprising an effective amount of ellagic acid: for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes mellitus, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive 15 disorder, mood disorder, stress, and anxiety disorder; for weight management; or to increase muscle performance or mental performance. An aspect of the invention is a food product or nutritional supplement comprising an effective amount of a urolithin: for the treatment or prevention of a condition selected from the group consisting of obesity, reduced metabolic rate, metabolic syndrome, diabetes 20 mellitus, cardiovascular disease, hyperlipidemia, neurodegenerative disease, cognitive disorder, mood disorder, stress, and anxiety disorder; for weight management; or to increase muscle performance or mental performance. In certain embodiments in accordance with this and other aspects of the invention, the urolithin is urolithin A. In certain embodiments in accordance with this and other 25 aspects of the invention, the urolithin is urolithin B. In certain embodiments in accordance with this and other aspects of the invention, the urolithin is urolithin C. In certain embodiments in accordance with this and other aspects of the invention, the urolithin is urolithin D. In each of the foregoing, in one embodiment the condition is obesity. 30          In each of the foregoing, in one embodiment the condition is reduced metabolic rate. In each of the foregoing, in one embodiment the condition is metabolic syndrome. In each of the foregoing, in one embodiment the condition is diabetes mellitus. In each of the foregoing, in one embodiment the condition is cardiovascular disease. 2024204908   17 Jul 2024 In each of the foregoing, in one embodiment the condition is hyperlipidemia. In each of the foregoing, in one embodiment the condition is neurodegenerative disease. In each of the foregoing, in one embodiment the condition is cognitive disorder. 5          In each of the foregoing, in one embodiment the condition is mood disorder. In each of the foregoing, in one embodiment the condition is stress. In each of the foregoing, in one embodiment the condition is anxiety disorder. In each of the foregoing, in one embodiment the food product or nutritional supplement is for weight management. 10          In each of the foregoing, in one embodiment the food product or nutritional supplement is for increasing muscle performance. In each of the foregoing, in one embodiment the food product or nutritional supplement is for increasing mental performance. An aspect of the invention is a method of increasing or maintaining mitochondrial 15 function. The method includes the step of contacting cells with an effective amount of a urolithin or a precursor thereof, to increase function of the mitochondria. An aspect of the invention is a method of treating, preventing, or managing a mitochondria-related disease or condition associated with an altered mitochondrial function or a reduced mitochondrial density. The method includes the step of administering to a 20 subject in need thereof a therapeutically effective amount of a urolithin or a precursor thereof, to treat the disease or condition associated with altered mitochondrial function or reduced mitochondrial density. An aspect of the invention is a method of increasing metabolic rate. The method includes the step of administering to a subject in need thereof an effective amount of a 25 urolithin or a precursor thereof, to increase metabolic rate. As described elsewhere herein, precursors of a urolithin can include, without limitation, an ellagitannin, punicalagin, and ellagic acid. An aspect of the invention is a method of preventing or treating metabolic syndrome. The method includes the step of administering to a subject in need thereof an 30 effective amount of a urolithin or a precursor thereof, to prevent or treat metabolic syndrome. 2024204908   17 Jul 2024 An aspect of the invention is a method of preventing or treating obesity. The method includes the step of administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof, to prevent or treat obesity. An aspect of the invention is a method of preventing or treating cardiovascular 5 disease. The method includes the step of administering to a subject in need thereof an effective amount of a urolithin or a precursor thereof, to prevent or treat cardiovascular disease. An aspect of the invention is a method of treating hyperlipidemia. The method includes the step of administering to a subject in need thereof an effective amount of a 10 urolithin or a precursor thereof, to treat hyperlipidemia. In one embodiment, the hyperlipidemia is hypertriglyceridemia. In one embodiment, the hyperlipidemia is elevated free fatty acids. An aspect of the invention is a method of treating a metabolic disorder. The method includes the step of administering to a subject in need thereof a therapeutically effective 75 amount of a urolithin or a precursor thereof, to treat the metabolic disorder. In one embodiment, the metabolic disorder is diabetes mellitus. In one embodiment, the metabolic disorder is obesity. Aging By far the greatest risk factor for neurodegenerative diseases, such as Alzheimer’s 20 disease (AD), Parkinson’s disease (PD), and amyotrophic lateral sclerosis (ALS), is aging. Mitochondria have been thought to contribute to aging through the accumulation of mitochondrial DNA (mtDNA) mutations and net production of reactive oxygen species (ROS). Although most mitochondrial proteins are encoded by the nuclear genome, mitochondria contain many copies of their own DNA. Human mtDNA is a circular 25 molecule of 16,569 base pairs that encodes 13 polypeptide components of the respiratory chain, as well as the rRNAs and tRNAs necessary to support intramitochondrial protein synthesis using its own genetic code. Inherited mutations in mtDNA are known to cause a variety of diseases, most of which affect the brain and muscles — tissues with high energy requirements. It has been hypothesized that somatic mtDNA mutations acquired during 30 aging contribute to the physiological decline that occurs with aging and aging-related neurodegeneration. It is well established that mtDNA accumulates mutations with aging, especially large-scale deletions and point mutations. In the mtDNA control region, point mutations at specific sites can accumulate to high levels in certain tissues: T414G in 2024204908   17 Jul 2024 cultured fibroblasts, A189G and T408A in muscle, and C150T in white blood cells. However, these control-region “hot spots” have not been observed in the brain. Point mutations at individual nucleotides seem to occur at low levels in the brain, although the overall level may be high. Using a polymerase chain reaction (PCR)-cloning-sequencing 5 strategy, it was found that the average level of point mutations in two protein-coding regions of brain mtDNA from elderly subjects was ~2 mutations per 10 kb. Noncoding regions, which may be under less selection pressure, potentially accumulate between twice and four times as many. The accumulation of these deletions and point mutations with aging correlates with decline in mitochondrial function. For example, a negative 10 correlation has been found between brain cytochrome oxidase activity and increased pointmutation levels in a cytochrome oxidase gene (COI). Net production of ROS is another important mechanism by which mitochondria are thought to contribute to aging. Mitochondria contain multiple electron carriers capable of producing ROS, as well as an extensive network of antioxidant defenses. Mitochondrial 15 insults, including oxidative damage itself, can cause an imbalance between ROS production and removal, resulting in net ROS production. The importance to aging of net mitochondrial ROS production is supported by observations that enhancing mitochondrial antioxidant defenses can increase longevity. In Drosophila, overexpression of the mitochondrial antioxidant enzymes manganese superoxide dismutase (MnSOD) and 20 methionine sulfoxide reductase prolongs lifespan. This strategy is most successful in shortlived strains of Drosophila, and has no effect in already long-lived strains. However, it has recently been shown that overexpression of catalase experimentally targeted to mitochondria increased lifespan in an already long-lived mouse strain. Cognitive decline during aging has been observed to occur in aging animals and is 25 thought to occur as a result of changes in the synaptic physiology of aging neurons. These changes are thought to lead to an overall global loss of integrative function of the neuronal signaling in the brain (Bishop, Lu et al. 2010) and increased susceptibility to the long-term effects of oxidative stress and inflammation (Joseph, Shukitt-Hale et al. 2005). Cell loss which takes place during normal aging is thought to occur primarily due to oxidative stress 30 as a result of free radicals produced by an inefficient and partially uncoupled oxidative pathway. Indeed, it has been shown that a common trait in aging among different species, (C. elegans, D. melanogaster, mice, rats, chimpanzees, and humans) has been evidence of reduced mitochondrial function. This interpretation is further validated by the observation 2024204908   17 Jul 2024 that significant impairment of mitochondrial function shortens lifespan in both C. elegans (Rea, Ventura et al. 2007) and mice (Trifunovic, Wredenberg et al. 2004; Kujoth, Hiona et al. 2005). Improvement of mitochondrial function, through the overexpression of catalase in mice, resulted in extended life spans (Schriner, Linford et al. 2005). 5          With aging and the decline of mitochondrial function, neurons in the brain become more vulnerable to age-dependent pathologies, as well as cell death. This results in a loss of connections between neurons, as well as impaired neuronal function (loss of neurotransmitters, absence of firing). There is also increased evidence that neurons respond to unrepaired DNA damage by silencing gene expression through epigenetic mechanisms, 10 thus leading to further suppression of cell functions. Additionally, aging neuronal cells show in all species an increased expression of genes involved in stress response pathways. Many hallmarks of these changes are observed in in vitro culture of aging neuronal cells, which show decreased neurite outgrowth and process formation. A decrease that could be reversed by neuronal growth factors (Rozovsky, Wei et al. 2005). 75 Neurodegenerative Disorders Neurodegenerative diseases are a heterogeneous group of disorders characterized by gradually progressive, selective loss of anatomically or physiologically related neuronal systems. Prototypical examples include Alzheimer’s disease (AD), Parkinson’s disease (PD), amyotrophic lateral sclerosis (ALS), and Huntington’s disease (HD). 20          The early stages of neurodegeneration share many of the same hallmarks as the decline seen in aging. It is interesting to note that diseases such as Alzheimer’s disease show an increased incidence with age, with over 50% of adults over the age of 85 presenting with the disease (Hebert, Scherr et al. 2003). As discussed above, declining mitochondrial function appears to be a hallmark of aging. This decline in neuronal function 25 is likely to have a significant impact on neuronal populations with large bioenergetic demands, one such set of neurons are the large pyramidal neurons which degenerate in Alzheimer’s disease (Bishop, Lu et al. 2010). The decline of these classes of neurons in response to impaired mitochondrial function may be responsible for the onset of neurodegenerative disease. The effects of neurodegenerative disorders on neuronal survival 30 can be modeled in vitro. When N2 neuronal cells are incubated with A-beta (AP) peptide, which is thought to be the causative agent of Alzheimer’s disease, there is a significant impact on neurite outgrowth, which can be reversed by anti-oxidants. Manczak et al. (2010) J Alzheimers Dis. 20 Suppl 2:S609-31. 2024204908   17 Jul 2024 The most common form of cell death in neurodegeneration is via the intrinsic mitochondrial apoptotic pathway. This pathway controls the activation of caspase-9 by regulating the release of cytochrome c from the mitochondrial intermembrane space. The concentration of ROS, normal byproducts of mitochondrial respiratory chain activity, is 5 mediated in part by mitochondrial antioxidants, such as manganese superoxide dismutase (SOD2) and glutathione peroxidase. Overproduction of ROS (oxidative stress) is a central feature of all neurodegenerative disorders. In addition to the generation of ROS, mitochondria are also involved with life-sustaining functions, including calcium homeostasis, mitochondrial fission and fusion, the lipid concentration of the mitochondrial 10 membranes, and the mitochondrial permeability transition (MPT). Mitochondrial disease leading to neurodegeneration is likely, at least on some level, to involve all of these functions (DiMauro and Schon, 2008). There is evidence that mitochondrial dysfunction and oxidative stress play a causal role in neurodegenerative disease pathogenesis, including in four of the more well known 15 diseases: Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, and amyotrophic lateral sclerosis (also known as Lou Gehrig’s disease). Alzheimer’s disease (AD) is characterized clinically by progressive cognitive decline, and pathologically by the presence of senile plaques composed primarily of amyloid-P peptide (AP) and neurofibrillary tangles made up mainly of hyperphosphorylated 20 tau. About 5-10% of cases are familial, occurring in an early-onset, autosomal-dominant manner. Three proteins are known to be associated with such familial cases: amyloid precursor protein (APP) — which is cleaved sequentially by P- and y-secretases to produce AP — and presenilins 1 and 2 (PSI and PS2), one or the other of which is a component of each y-secretase complex. Extensive literature supports a role for mitochondrial 25 dysfunction and oxidative damage in the pathogenesis of AD. Oxidative damage occurs early in the AD brain, before the onset of significant plaque pathology. Oxidative damage also precedes AP deposition in transgenic APP mice, with upregulation of genes relating to mitochondrial metabolism and apoptosis occurring even earlier and co-localizing with the neurons undergoing oxidative damage. 30          Several pathways connecting oxidative stress and AD pathology have recently been uncovered. Oxidative stress may activate signaling pathways that alter APP or tau processing. For example, oxidative stress increases the expression of P-secretase through activation of c-Jun amino-terminal kinase and p38 mitogen-activated protein kinase 2024204908   17 Jul 2024 (MAPK), and increases aberrant tau phosphorylation by activation of glycogen synthase kinase 3. Oxidant-induced inactivation of critical molecules may also be important. In a proteomic study, the prolyl isomerase PIN 1 was found to be particularly sensitive to oxidative damage. PIN1 catalyses protein conformational changes that affect both APP and 5 tau processing. Knockout of Pin / increases amyloidogenic APP processing and intracellular Ap levels in mice. Pin 1 -knockout mice also exhibit tau hyperphosphorylation, motor and behavioral deficits, and neuronal degeneration. Oxidative induced damage of PIN 1 and similarly sensitive proteins could thus be important in promoting neurodegenerative processes. 10          Mitochondria also play an important role in Parkinson’s disease (PD) which is characterized clinically by progressive rigidity, bradykinesia and tremor, and pathologically by loss of pigmented neurons in the substantia nigra and the presence of Lewy bodies — distinctive cytoplasmic inclusions that immunostain for a-synuclcin and ubiquitin. Mitochondria were first implicated in PD because MPTP (1-methyl 4-phenyl- 15 1,2,3,6-tetrahydropyridine), whose metabolite MPP+ inhibits complex I of the mitochondrial electron-transport chain, caused parkinsonism in designer-drug abusers. This model has since been refined in laboratory animals, in which chronic infusion of rotenone — another complex-I inhibitor — or MPTP results clinically in a parkinsonian phenotype and pathologically in nigral degeneration with cytoplasmic inclusions immunoreactive for a- 20 synuclein and ubiquitin. The mechanism of toxicity in these complex-I inhibition models probably involves oxidative stress. Complex-I inhibition and oxidative stress were shown to be relevant to naturally occurring PD when complex-I deficiency and glutathione depletion were found in the substantia nigra of patients with idiopathic PD and in patients with pre-symptomatic PD. 25          Many of the genes associated with PD also implicate mitochondria in disease pathogenesis. So far, mutations or polymorphisms in mtDNA and at least nine named nuclear genes have been identified as causing PD or affecting PD risk: a-synuclcin, parkin, ubiquitin carboxy-terminal hydrolase LI, DJ-1, phosphatase and tensin homologue (PTEN)-induced kinase 1 (PINK1\ leucine-rich-repeat kinase 2 (LRRK2}, the nuclear 30 receptor NURR1, HTRA2, and tau. Of the nuclear genes, a-synuclein, parkin, DJ-1, PINK1, LRRK2, and HTRA2 directly or indirectly involve mitochondria. In a small number of cases, inherited mtDNA mutations result in parkinsonism, typically as one feature of a larger syndrome. In one family, the Leber’s optic atrophy G11778A mutation was 2024204908   17 Jul 2024 associated with 1-DOPA-responsive parkinsonism, variably co-occurring with dementia, dystonia, ophthalmoplegia and ataxia. Notably, this mutation is in a subunit of complex I. Mutations in the nuclear-encoded mtDNA polymerase-y (POLG) gene impair mtDNA replication and result in multiple mtDNA deletions, typically causing chronic progressive 5 external ophthalmoplegia and myopathy. In such families, POLG mutations also cosegregate with parkinsonism. Amyotrophic lateral sclerosis (ALS) is characterized clinically by progressive weakness, atrophy and spasticity of muscle tissue, reflecting the degeneration of upper and lower motor neurons in the cortex, brainstem and spinal cord. Approximately 90% of cases 10 are sporadic (SALS) and 10% are familial (FALS). About 20% of familial cases are caused by mutations in Cu / Zn-superoxide dismutase (SOD1). In both SALS and FALS, postmortem and biopsy samples from the spinal cord, nerves and muscles show abnormalities in mitochondrial structure, number and localization. Defects in activities of respiratory chain complexes have also been detected in muscle and spinal cord. 75           Huntington’s disease (HD) is characterized clinically by chorea, psychiatric disturbances, and dementia, and pathologically by loss of long projection neurons in the cortex and striatum. HD is inherited in an autosomal dominant manner, and is due to expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene, which gives rise to an expanded polyglutamine stretch in the corresponding protein. The normal number of 20 CAG (Q) repeats is less than 36; repeat numbers greater than 40 are associated with human disease. Various lines of evidence demonstrate the involvement of mitochondrial dysfunction in HD. Nuclear magnetic resonance spectroscopy reveals increased lactate in the cortex and basal ganglia. Biochemical studies show decreased activities of complexes II and III of the electron-transport chain in the human HD brain. In striatal cells from 25 mutant Htt-knock-in mouse embryos, mitochondrial respiration and ATP production are significantly impaired. An aspect of the invention is a method of treating a neurodegenerative disease, age-related neuronal death or dysfunction. As used herein, “neurodegenerative disease” or, equivalently, “neurodegenerative disorder”, refers to any condition involving progressive 30 loss of functional neurons in the central nervous system. In one embodiment, the neurodegenerative disease is associated with age-related cell death. Exemplary neurodegenerative diseases include, without limitation, Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, amyotrophic lateral sclerosis (also known as ALS and as Lou 2024204908   17 Jul 2024 Gehrig’s disease), as well as AIDS dementia complex, adrenoleukodystrophy, Alexander disease, Alper’s disease, ataxia telangiectasia, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, corticobasal degeneration, Creutzfeldt-Jakob disease, dementia with Lewy bodies, fatal familial insomnia, frontotemporal lobar 5 degeneration, Kennedy’s disease, Krabbe disease, Lyme disease, Machado-Joseph disease, multiple sclerosis, multiple system atrophy, neuroacanthocytosis, Niemann-Pick disease, Pick’s disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum disease, Sandhoff disease, diffuse myelinoclastic sclerosis, spinocerebellar ataxia, subacute combined degeneration of spinal cord, tabes dorsalis, Tay-Sachs disease, toxic 10 encephalopathy, transmissible spongiform encephalopathy, and wobbly hedgehog syndrome. In one embodiment, the method is used to treat age-related neuronal death or dysfunction. Such method is directed to neurodegeneration that is not attributable to a specific neurodegenerative disease, e.g., Alzheimer’s disease, amyotrophic lateral sclerosis, 75 Huntington’s disease, and Parkinson’s disease. In one embodiment, a neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, amyotrophic lateral sclerosis, Huntington’s disease, and Parkinson’s disease. In one embodiment, a neurodegenerative disease is Alzheimer’s disease. 20          The method includes the step of administering to a subject in need of treatment of a neurodegenerative disease a therapeutically effective amount of a urolithin or a precursor thereof, thereby treating the neurodegenerative disease. In accordance with this and other methods of the invention, a “urolithin,” as used herein, refers to any one or combination of urolithin A, urolithin B, urolithin C, and 25 urolithin D (see, for example, FIG. 1 and FIG. 2). In one embodiment, a urolithin is urolithin A, urolithin B, urolithin C, urolithin D, or any combination of urolithin A, urolithin B, urolithin C, and urolithin D. In one embodiment, a urolithin is urolithin A, urolithin B, or a combination of urolithin A and urolithin B. In one embodiment, a urolithin is urolithin A. In one embodiment, a urolithin is provided as an isolated urolithin, e.g., 30 isolated from a natural source or prepared by total synthesis. Isolated urolithins may be synthesized de novo. See, for example, US Pat. Application Publication No. 2008 / 0031862 to Ghosal, the entire contents of which are incorporated herein by reference. 2024204908   17 Jul 2024 In one embodiment, urolithin A (3,8-Dihydroxydibenzo-oc-pyrone)was synthesized in a two-stage synthesis as follows. Stage 1 is a copper-catalyzed reaction that occurs in the presence of a base (Hurtley reaction) where the starting materials 2-bromo-5 -methoxybenzoic acid and resoricinol are reacted together to generate the dihydro- 5 dibenzopyrone scaffold. In Stage 2 the demethylation of the benzopyrone with BBn yields 3,8-Dihydroxydibenzo-oc-pyrone (urolithin A). A mixture of 2-bromo-5-methoxybenzoic acid 1 (27.6 g), resorcinol 2 (26.3 g) and sodium hydroxide (10.5 g) in water (120 mL) was heated under reflux for 1 hour. A 5 % aqueous solution of copper sulfate (3.88 g of CuSO4, 5H2O in 50 mL water) was then added 10 and the mixture was refluxed for additional 30 minutes. The mixture was allowed to cool down to room temperature and the solid was filtered on a Buchner filter. The residue was washed with cold water (50 mL) to give a pale red solid (38.0 g) which was triturated in hot MeOH (200 mL). The suspension was left overnight at 4 °C. The resultant light red precipitate was filtered and washed with cold MeOH (75 mL) to yield the title compound 3 15 as a pale brown solid. 1H NMR is in accordance with the structure of 3. To a suspension of 3 (10.0 g; 41 mmol; 1.0 eq.) in dry dichloromethane (100 mL) was added at 0 °C a 1 M solution of boron tribromide in dry dichloromethane (11.93 mL of pure BBrs in 110 mL of anhydrous dichloromethane). The mixture was left at 0 °C for 1 hour and was then allowed to warm up to room temperature. The solution was stirred at 20 that temperature for 17 hours. The yellow precipitate was filtered and washed with cold water (50 mL) to give a yellow solid which was heated to reflux in acetic acid (400 mL) for 3 hours. The hot solution was filtered quickly and the precipitate was washed with acetic acid (50 mL) then with diethyl ether (100 mL) to yield the title compound 4 as a yellow solid. Structure and purity were determined by 1H and 13C-NMR. Stage t                               Stage 2 1                2                71%                        3                  73%                   4 In one embodiment, a “urolithin” as used herein is or can include a glucuronated, methylated, or sulfated urolithin. In accordance with this and other methods of the invention, a “urolithin precursor,” as used herein, refers to an ellagitannin or an ellagitannin metabolite, including but not 2024204908   17 Jul 2024 limited to ellagic acid (EA). In one embodiment, a urolithin precursor is punicalagin (PA). In one embodiment, a urolithin precursor is punicalin (PB). See, for example, FIG. 1. In one embodiment, a urolithin precursor is ellagic acid (EA). In one embodiment, a urolithin precursor is provided as an isolated urolithin precursor, e.g., isolated from a natural food 5 source or prepared by total synthesis. Isolated urolithin precursors are usually purified from natural sources or synthesized de novo; some urolithin precursors, including EA, are commercially available from suppliers, such as Sigma Aldrich. Also in accordance with this and other methods of the invention, precursors of urolithins also include natural foods containing ellagitannins and ellagic acid, especially 10 natural foods that are rich in ellagitannins, ellagic acid, or both ellagitannins and ellagic acid. Such foods include certain berries, grapes, pomegranates, rose hips, and nuts. In one embodiment, the natural food is pomegranate. Additionally, precursors of urolithins include processed foods and drinks prepared from such natural foods. The processed food can take any form, including, for example, 75 jams, jellies, preserves, pastes, spreads, juices, wines, extracts, concentrates, and the like. In one embodiment, the processed food is pomegranate juice. In one embodiment, a urolithin precursor is provided as an extract, e.g., a fruit extract. In one embodiment, a urolithin precursor is provided as concentrate, e.g., a fruit 20 concentrate or fruit juice concentrate. The method of the invention can be used alone or in combination with any method or compound known to be useful to treat neurodegenerative disease. For example, In one embodiment, the method of the invention can be combined with use of any one or more of acetylcholinesterase inhibitors, such as donezepil (Aricept®), galantamine (Razadyne®), and 25 rivastigmine (Exelon®), and N-methyl D-aspartate (NMDA) receptor antagonists, such as memantine (Namenda®). An aspect of the invention is a method of improving cognitive function. As used herein, “cognitive function” refers to any mental process that involves symbolic operations, e.g., perception, memory, attention, speech comprehension, speech generation, reading 30 comprehension, creation of imagery, learning, and reasoning. In one embodiment, “cognitive function” refers to any one or more of perception, memory, attention, and reasoning. In one embodiment, “cognitive function” refers to memory. 2024204908   17 Jul 2024 The method includes the step of administering to a subject in need of improved cognition a therapeutically effective amount of a urolithin or a precursor thereof, thereby improving cognitive function. Methods for measuring cognitive function are well known and can include, for 5 example, individual or battery tests for any aspect of cognitive function. One such test is the Prudhoe Cognitive Function Test. Margallo-Lana et al. (2003) J Intellect Disability Res. 47:488-492. Another such test is the Mini Mental State Exam (MMSE), which is designed to assess orientation to time and place, registration, attention and calculation, recall, language use and comprehension, repetition, and complex commands. Folstein et al. 10   (1975) J Psych Res. 12:189-198. Other tests useful for measuring cognitive function include the Alzheimer Disease Assessment Scale-Cognitive (ADAS-Cog) (Rosen et al. (1984) Am J Psychiatry. 141(11): 1356-64) and the Cambridge Neuropsychological Test Automated Battery (CANTAB) (Robbins et al. (1994) Dementia. 5(5):266-81). Such tests can be used to assess cognitive function in an objective manner, so that changes in 15 cognitive function, for example in response to treatment in accordance with methods of the invention, can be measured and compared. The method of the invention can be used alone or in combination with any method or compound known to improve cognitive function. For example, In one embodiment, the method of the invention is combined with use of caffeine or nicotine or both. 20          In one embodiment, the subject does not have a cognitive disorder. For example, the method can be used to enhance cognitive function in a subject having normal cognitive function. An aspect of the invention is a method of treating a cognitive disorder. As used herein, a cognitive disorder refers to any condition that impairs cognitive function. In one 25 embodiment, “cognitive disorder” refers to any one or more of delirium, dementia, learning disorder, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD). In one embodiment, the cognitive disorder is a learning disorder. In one embodiment, the cognitive disorder is attention deficit disorder (ADD). In one embodiment, the cognitive disorder is attention deficit hyperactivity disorder (ADHD). 30          The method includes the step of administering to a subject in need of treatment of a cognitive disorder a therapeutically effective amount of a urolithin or a precursor thereof, to treat the cognitive disorder. 2024204908   17 Jul 2024 The method of the invention can be used alone or in combination with any method or compound known to be useful to treat a cognitive disorder. For example, In one embodiment, the method of the invention is combined with use of a stimulant, such as methylphenidate (e.g., Ritalin®), dextroamphetamine (Dexedrine®), mixed amphetamine 5 salts (Adderall®), dextromethamphetamine (Desoxyn®), and lisdexamphetamine (Vyvanase®). An aspect of the invention is a method of treating or preventing a stress-induced or stress-related cognitive dysfunction. As used herein, a “stress-induced or stress-related cognitive dysfunction” refers to a disturbance in cognitive function that is induced or 10 related to stress. The method includes the step of administering to a subject in need of treatment or prevention of a stress-induced or stress-related cognitive dysfunction a therapeutically effective amount of a urolithin or a precursor thereof, to treat or prevent the stress-induced or stress-related cognitive dysfunction. Mood Disorders 75          Brain tissue requires a high level of energy for its metabolism, including the maintenance of the transmembrane potential, signal transduction and synaptic remodeling. An increase of psychiatric symptoms and disorders, in particular depression, is likely present in patients with mitochondrial disorders. Mitochondrial structure and function, measured by a variety of different techniques, 20 have been shown to be abnormal in patients with mood disorders, including major depression as well as in the other affective spectrum disorders. Two studies revealed that a several-fold increased likelihood of developing depression can be maternally inherited along with the mtDNA, which strongly argues that mtDNA sequence variants may induce mitochondrial dysfunction that can predispose 25 individuals towards the development of depression (Boles et al., 2005; Burnett et al., 2005). The relationship between mitochondrial dysfunction and unipolar depression has been explored in several studies. In studies of postmortem brain from subjects with probable or diagnosed major depression, of whom most subjects were (probably) medicated, no increase of the common 5 kb mtDNA deletion could be detected (Kato et al., 30   1997; Sabunciyan et al., 2007; Shao et al., 2008^ Stine et al., 1993). Alterations of translational products linked to mitochondrial function were found in the frontal, prefrontal and tertiary visual cortices (Karry et al., 2004; Whatley et al., 1996). Alterations of four mitochondrial located proteins in the anterior cingulate cortex have been reported (Beasley 2024204908   17 Jul 2024 et al., 2006). Decreased gene expression for 6 of 13 mtDNA-encoded transcripts in frontal cortex tissue (Brodmann areas (BA) 9 and 46) (Shao et al., 2008), and of nDNA-encoded mitochondrial mRNA and proteins in the cerebellum, have also been reported in major depression (Ben-Shachar and Karry, 2008). Levels of an electron transport chain complex I 5 subunit (NDUFS7), and complex I activity, in postmortem prefrontal cortex were found to be below or at the lowest range of the normal controls in half of the cases of major depressive disorder in a recent study (Andreazza et al., 2010). In the two latter studies, the authors were unable to detect any effect of medication on the results. Decreases of respiratory chain enzyme ratios and ATP production rates, and an 10 increased prevalence of small mtDNA deletions (but not of the common 5 kb mtDNA deletion), were found in muscle from patients with a lifetime diagnosis of major unipolar depression with concomitant physical symptoms. Medication did not seem to influence the results (Gardner et al., 2003b). Clinical relevance was suggested by the finding that essentially every depressed subject with very high degrees of somatic complaints 15 demonstrated low ATP production rates in biopsied muscle (Gardner and Boles, 2008a). An aspect of the invention is a method of treating a mood disorder (also known as an affective disorder). As used herein, a “mood disorder” refers to a disturbance in emotional state, such as is set forth in the Diagnostic and Statistical Manual of Mental Disorders, published by the American Psychiatric Association. Mood disorders include but 20 are not limited to major depression, postpartum depression, dysthymia, and bipolar disorder. In one embodiment, the mood disorder is major depression. The method includes the step of administering to a subject in need of treatment of a mood disorder a therapeutically effective amount of a urolithin or a precursor thereof, to treat the mood disorder. 25         The method of the invention can be used alone or in combination with any method or compound known to be useful to treat a mood disorder. For example, In one embodiment, the method of the invention is combined with use of an antidepressant agent. Antidepressant agents are well known in the art and include selective serotonin reuptake inhibitors (SSRIs), serotonin-norepinephrine reuptake inhibitors (SNRIs), noradrenergic 30 and specific serotonergic antidepressants, norepinephrine reuptake inhibitors, norepinephrine-dopamine reuptake inhibitors, selective serotonin reuptake inhibitors, norepinephrine-dopamine disinhibitors, tricyclic antidepressants, and monamine oxidase inhibitors. 2024204908   17 Jul 2024 An aspect of the invention is a method of treating or preventing a stress-induced or stress-related mood disorder. As used herein, a “stress-induced or stress-related mood disorder” refers to a disturbance in emotional state that is induced or related to stress. Such mood disorders are sometimes referred to as reactive mood disorders and are to be 5 distinguished from other mood disorders, e.g., so-called organic mood disorders. The method includes the step of administering to a subject in need of treatment or prevention of a stress-induced or stress-related mood disorder an effective amount of a urolithin or a precursor thereof, to treat or prevent the stress-induced or stress-related mood disorder. An aspect of the invention is a method of treating an anxiety disorder. As used 10 herein, an “anxiety disorder” refers to a dysfunctional state of fear and anxiety, e.g., fear and anxiety that is out of proportion to a stressful situation or the anticipation of a stressful situation. In one embodiment, an anxiety disorder is any one or combination of generalized anxiety disorder, panic disorder, panic disorder with agoraphobia, agoraphobia, social anxiety disorder, obsessive-compulsive disorder, and post-traumatic stress disorder. In one 75 embodiment, an anxiety disorder is any one or combination of generalized anxiety disorder, obsessive-compulsive disorder, panic disorder, post-traumatic stress disorder, and social anxiety disorder. In one embodiment, an anxiety disorder is generalized stress disorder. In one embodiment, an anxiety disorder is post-traumatic stress disorder. In one embodiment, an anxiety disorder is a stress-induced anxiety disorder. 20          The method includes the step of administering to a subject in need of treatment of an anxiety disorder a therapeutically effective amount of a urolithin or a precursor thereof, to treat the anxiety disorder. The method of the invention can be used alone or in combination with any method or compound known to be useful to treat an anxiety disorder. For example, In one 25 embodiment, the method of the invention is combined with use of any one or combination of psychotherapy, benzodiazepines, buspirone (Buspar®), or beta-blockers. Benzodiazepines are well known in the art and include, without limitation, clonazepam (Klonopin®), lorazepam (Ativan®), and alprazolam (Xanax®). Additional drugs that may be used in combination with the methods of the invention include imipramine (Tofranil®) and 30 venlafaxine (Effexor®). An aspect of the invention is a method of treating or preventing a stress-induced or stress-related anxiety disorder. As used herein, a “stress-induced or stress-related anxiety disorder” refers to a dysfunctional state of fear and anxiety that is induced or related to 2024204908   17 Jul 2024 stress. Such anxiety disorders are sometimes referred to as reactive anxiety disorders and are to be distinguished from other anxiety disorders, e.g., so-called organic anxiety disorders. The method includes the step of administering to a subject in need of treatment or prevention of a stress-induced or stress-related anxiety disorder an effective amount of a 5 urolithin or a precursor thereof, to treat or prevent the stress-induced or stress-related anxiety disorder. An aspect of the invention is a method of promoting neurite outgrowth. In one embodiment, the method is an in vitro method. In one embodiment, the method is an in vivo method. As used herein, a “neurite” refers to any projection from the cell body of a 10 neuron. In one embodiment, such projection is an axon. In one embodiment, such projection is a dendrite. The term is frequently used when speaking of immature or developing neurons, especially of cells in culture, because it can be difficult to tell axons from dendrites before differentiation is complete. Neurites are often packed with microtubule bundles, the growth of which is stimulated by nerve growth factor (NGF), as 15 well as tau proteins, microtubule associated protein 1 (MAPI), and microtubule associated protein 2 (MAP2). The neural cell adhesion molecule N-CAM simultaneously combines with another N-CAM and a fibroblast growth factor receptor to stimulate the tyrosine kinase activity of that receptor to induce the growth of neurites. Neurite outgrowth can be measured morphologically or functionally. 20 Morphological measurement typically entails microscopic examination with measurement of the length and / or number of neurites. As used herein, “promoting” refers to enhancing or inducing. In one embodiment, “promoting” means inducing. For example, neurite outgrowth in a negative control sample may be negligible, while neurite outgrowth in an experimental or treatment sample may be 25 non-negligible. In one embodiment, “promoting” means enhancing. For example, neurite outgrowth in a negative control sample may be non-negligible, while neurite outgrowth in an experimental or treatment sample may be statistically significantly greater than the negative control. Of course “promoting” as used herein can encompass both enhancing and inducing. 30          In one embodiment, the method includes the step of contacting a nerve cell with an effective amount of a urolithin or a precursor thereof, to promote neurite outgrowth. 2024204908   17 Jul 2024 In one embodiment, the method includes the step of administering to a subject in need thereof a therapeutically effective amount of the urolithin or precursor thereof, to promote neurite outgrowth. The methods of the invention can be used alone or in combination with any method 5 or compound known to be useful to promote neurite outgrowth. For example, In one embodiment, a method of the invention can be combined with use of any one or more of NGF, tau protein, MAPI, MAP2, N-CAM, or an agent that induces the expression of any one or more of NGF, tau protein, MAPI, MAP2, N-CAM, or fibroblast growth factor receptor. 10 Using Neuronal Cells in vitro to Screen Compounds for Neuroprotective Activities In the processes of aging and neurodegeneration, the progressive deterioration of cognitive function is essentially due to the loss of entities sustaining neuronal communication. These entities are essentially composed of neuronal cell bodies, neurites and synaptic contacts that connect them to target cells. Neurons display very complex 75 morphologies. The most complex neuronal cell types, such as motor neurons extending axonal processes up to one meter long or nigral dopaminergic neurons making more than 150,000 synaptic contacts, will often be the most vulnerable in normal aging or disease. To maintain such a complex architecture and effectively convey electrical and neurochemical signals, neurons heavily rely on energy supply. Therefore, axonal transport, synaptic 20 activity, and the maintenance of ion gradients highly depend on mitochondrial function. To carry on these demanding cellular functions, neurons experience over time difficulties to sustain the delicate balance of mitochondrial activity and ensuing oxidative stress. Such imbalance is often considered the cause of neuronal dysfunction or premature degeneration. Therefore, any treatment promoting neuronal survival, or the formation of the 25 neuronal processes and synaptic contacts that build up neuronal complex architecture, is expected to positively impact neuronal functions. The measurement of compound effects on neuronal function typically relies on the tedious monitoring of animal behavioral outcomes, which is not amenable to medium- or high-throughput screening of biological activities. In vitro models based on neuroblastoma cell lines or primary neuronal cultures 30 represent an accepted proxy to assess compound effects on crucial morphological parameters, which will reflect the ability of neurons to sustain their normal function in the mammalian brain. Indicators such as the number of processes, their length, or complexity will reveal compound effects on critical steps of intracellular signaling. Although one 2024204908   17 Jul 2024 should keep in mind that such parameters only indirectly reflect the performance of higher brain functions, they provide a valuable appraisal of compound efficacy that may translate into improved cognitive or motor functions in normal or diseased conditions. Metabolic Disorders 5           Mitochondrial function in key metabolic tissues (liver, muscle, adipose tissue, pancreas) is involved in the pathogenesis of metabolic diseases. In each of these tissues, mitochondrial oxidative activity must be appropriate to fully oxidize nutrient loads, particularly fatty acids. Failure of complete oxidation can lead to accumulation of lipid intermediates, incomplete fatty acid oxidation products, and ROS. Altogether, these 10 cellular events contribute to fat accumulation, insulin resistance, altered insulin secretion, low grade inflammation, and oxidative stress, which are all components of type II diabetes mellitus and obesity. The importance of mitochondrial activity in the pathogenesis of metabolic diseases has been established in several studies in humans. For example, insulin resistance in 15 skeletal muscle has been associated with a defect in mitochondrial oxidative phosphorylation, where a 30% reduction in mitochondrial activity is observed in insulinresistant offspring of patients with type 2 diabetes as compared to control subjects. Petersen KF, et al. (2004) New Engl J Med. 350:664-71. It has also been observed that obese patients display a 20% decrease in mitochondrial activity along with a 35% reduction 20 in mitochondrial size compared to healthy lean subjects. Petersen KF, et al. (2003) Science 300:1140-2. Finally, age-associated decline in mitochondrial function contributes to insulin resistance in the elderly. Accordingly, a 40% reduction in mitochondrial oxidative and phosphorylation activity has been reported in the elderly compared to young subjects. These observations link disturbance in mitochondrial function to metabolic disorders, 25 especially “diabesity” (Kelley DE, et al. (2002) Diabetes 51:2944-50). Mitochondrial oxidative activity, also referred to as oxidative phosphorylation, can be considered as a key determinant underlying the risk of metabolic diseases. Reductions in mitochondrial activity can be mediated by genetic factors (e.g., family history, ethnicity), epigenetic mechanisms, developmental exposures, eating behavior and aging. 30          When sustained fuel excess (e.g., from overeating or impaired fat storage) surpasses energetic demands and / or oxidative capacity, and / or appropriate compensatory mechanisms are insufficient (for example, due to inactivity or failure of mitochondria to adapt to higher cellular oxidative demands), there is an increased risk of metabolic disorders. The resulting 2024204908   17 Jul 2024 lipid accumulation and oxidative stress can alter transcriptional responses and damage mitochondria, further reducing oxidative phosphorylation capacity, compounding the deleterious effects of fuel excess elevating the risk of metabolic disorders. The sufficiency fully to oxidize fatty acids resides in the balance between: (i) the 5 net mitochondrial oxidative activity (determined by the need to generate energy to meet cellular demands, e.g., contraction and ion transport), and (ii) fuel availability (determined by food intake, adiposity, and adipose storage capacity). Balance is achieved when oxidative activity equals or exceeds fuel loads. Under normal homeostatic conditions, both oxidative activity and cellular fuel 10 availability can be altered to ensure that mitochondrial function is appropriate for the ambient metabolic environment. For example, cellular demand for energy can be increased through exercise, and fuel availability can be reduced through weight loss and / or reduced food intake. In this context, inter-individual variations in oxidative capacity and / or activity, fuel load, or ability to modulate mitochondrial activity (acute response), increase 75 mitochondrial capacity (chronic response), or resolve oxidative stress could determine the set point of metabolic balance. Such differences could become prominent particularly in an obesogenic environment (one characterized by environments that promote increased overall food intake, intake of nonhealthful foods, and physical inactivity). Therefore, individuals with a high oxidative capacity or adaptive responses would have high tolerance to large fuel 20 loads. Conversely, individuals with reduced oxidative capacity and / or suboptimal adaptive responses would be intolerant to moderate high fuel loads, leading to lipid accumulation, incomplete oxidation, production of ROS, and insulin resistance. With time, insufficient compensation will result in chronic insulin resistance and metabolic disorders. Insufficient oxidative capacity could be resolved by compensatory 25 mechanisms that increase oxidative capacity (e.g., exercise) or decrease fuel load (weight loss). However, these lifestyle changes appear usually insufficient or not achievable for most overweight / obese and type 2 diabetic or pre-diabetic subjects. Mitochondria are particularly important for skeletal muscle function, given the high oxidative demands imposed on this tissue by intermittent contraction. Mitochondria play a 30 critical role in ensuring adequate levels of ATP needed for contraction by the muscle sarcomere. This high-level requirement for ATP by sarcomeres has likely contributed to the distinct subsarcolemmal and sarcomere-associated populations of mitochondria in muscle. Moreover, muscle cells must maintain metabolic flexibility, the ability to rapidly 2024204908   17 Jul 2024 modulate substrate oxidation as a function of ambient hormonal and energetic conditions. For example, healthy muscle tissue predominantly oxidizes lipid in the fasting state, as evidenced by low respiratory quotient (RQ), with subsequent transition to carbohydrate oxidation (increased RQ) during the fed state. Availability of fuels, particularly lipids, and 5 capacity to oxidize them within mitochondria are also critical for sustained exercise. Thus, mitochondrial functional capacity is likely to directly affect muscle metabolic function and, because of its large contribution to total body mass, to have a significant impact on wholebody metabolism. This possibility is supported by the findings of increased mitochondrial content in skeletal muscle in an individual with hypermetabolism and resistance to weight 10 gain (Luft syndrome). Insulin Resistance and Diabetes Mellitus Skeletal muscle is the largest insulin-sensitive organ in humans, accounting for more than 80% of insulin-stimulated glucose disposal. Thus, insulin resistance in this tissue has a major impact on whole-body glucose homeostasis. Indeed, multiple metabolic 15 defects have been observed in muscle from insulin-resistant but normoglycemic subjects at high risk for diabetes development, including: (i) reduced insulin-stimulated glycogen synthesis; (ii) alterations in insulin signal transduction; and (iii) increased muscle lipid accumulation. Although it remains unclear at present whether any of these defects play a causal role in insulin resistance, intramyocellular lipid excess strongly correlates with the 20   severity of insulin resistance, even after correction for the degree of obesity, and has been observed in muscles of multiple fiber types. Moreover, lipid excess has been linked experimentally to induction of insulin resistance and alterations in insulin signal transduction. Thus, one possible mechanism by which impaired mitochondrial function might contribute to insulin resistance is via altered metabolism of fatty acids. Increased 25 tissue lipid load, as with obesity, and / or sustained inactivity, may lead to the accumulation of fatty acyl coenzyme A (CoA), diacylglycerols, ceramides, products of incomplete oxidation, and ROS, all of which have been linked experimentally to reduced insulin signaling and action. Additional mechanisms potentially linking impaired mitochondrial oxidative function to insulin resistance include: (i) reduced ATP synthesis for energy- 50 requiring functions such as insulin-stimulated glucose uptake; (ii) abnormalities in calcium homeostasis (necessary for exercise-induced glucose uptake); and (iii) reduced ATP production during exercise, potentially contributing to reduced aerobic capacity, muscle 2024204908   17 Jul 2024 fatigue, and decreased voluntary exercise over time - further feeding a vicious cycle of inactivity-fueled insulin resistance. Mitochondrial capacity is central to the key function of the pancreatic beta (P)-cell-regulated insulin secretion. Both rapid (first phase) and more prolonged (second phase) 5 insulin secretion are dependent on glucose metabolism and mitochondrial oxidative capacity; glucose oxidation increases the ATP / ADP ratio, inhibiting plasma membrane K-ATP channels and allowing voltage-gated calcium channels to open. Increased cytoplasmic calcium then triggers exocytosis of plasma-membrane docked insulin granules (first phase). Subsequent recruitment of granules to the plasma membrane (second phase) appears to 10 depend on mitochondrial metabolites produced by anaplerosis. Mitochondrial metabolism is also required for the transient, controlled production of ROS, which is required for the mitochondrial signaling pathways that trigger granule exocytosis. Mitochondrial diabetes only develops upon aging, with an average age of onset between 35 and 40 yr for maternally inherited diabetes with deafness (MIDD) and 48 yr for 15   14577 T / C, a mitochondrial DNA missense mutation in maternally inherited type 2 diabetes. This contrasts with the early childhood onset of diabetes in syndromes such as maturity-onset diabetes of the young 2 (M0DY2), in which a mutation in glucokinase, the first step of glycolysis, results in attenuated glucose-stimulated ATP generation and insulin secretion. These data suggest that mitochondrial diabetes is more likely to result from a 20 gradual deterioration of P-cell function, rather than from an acute functional impairment due to insufficient ATP production. Mitochondrial function in tissues involved in the pathogenesis of diabetes mellitus (liver, muscle, adipose tissue, and pancreatic P-cells) is critical for multiple aspects of cellular metabolism. In each of these tissues, mitochondrial oxidative activity must be 25 appropriate to fully oxidize nutrient loads, particularly fatty acids. Failure of complete oxidation can lead to accumulation of lipid intermediates, incomplete fatty acid oxidation products, and ROS, inducing both insulin resistance (muscle, liver, adipose) and altered secretion (P-cells). Mild deficiencies in mitochondrial activity, and / or an inability to increase activity 30 and capacity in response to cellular energy demand, could explain the reduced exercise ability seen in individuals with a family history of diabetes mellitus. Over time, this phenotype could contribute to reduced voluntary exercise and increase the likelihood of an imbalance between mitochondrial activity and fatty acid load. Secondly, chronic imbalance 2024204908   17 Jul 2024 in energy metabolism due to ovemutrition, obesity, and inactivity could directly contribute to increased cellular and mitochondrial ROS production. In turn, excessive ROS can induce both insulin resistance and mitochondrial dysfunction. For example, a high-fat, high-sucrose diet in the diabetes-prone C57BL6 mouse causes mitochondrial alterations in 5 parallel with enhanced ROS production and impaired insulin sensitivity. Similarly, exposure of muscle cells in vitro to saturated fatty acids or high-fat feeding in mice results in alterations in mitochondrial structure and insulin resistance, both of which are reversed by antioxidants. Thus, oxidative stress can induce mitochondrial dysfunction in parallel with insulin resistance - perhaps an adaptive response aimed at limiting further oxidative 10 damage. Importantly, resolution of oxidative stress can reverse insulin resistance. Muscle Performance In other embodiments, the invention provides methods for enhancing muscle performance by administering a therapeutically effective amount of a mitochondria-enhancing or -activating extract, formulation or compound. For example, extracts 75 containing ellagitannins or ellagic acid, or compositions containing ellagitannins, ellagic acid, or urolithins behave to activate mitochondria and may be useful for improving physical endurance (e.g., ability to perform a physical task such as exercise, physical labor, sports activities), inhibiting or retarding physical fatigue, enhancing blood oxygen levels, enhancing energy in healthy individuals, enhancing working capacity and endurance, 20 reducing muscle fatigue, reducing stress, enhancing cardiac and cardiovascular function, improving sexual ability, increasing muscle ATP levels, and / or reducing lactic acid in blood. In certain embodiments, the methods involve administering an amount of an ellagitannin- or ellagic acid-containing natural extract, or compositions containing ellagitannins, ellagic acid or urolithin, that increase mitochondrial activity, increase 25 mitochondrial biogenesis, and / or increase mitochondrial mass. Sports performance refers to the ability of an athlete's muscles to perform when participating in sports activities. Enhanced sports performance, strength, speed, and endurance are measured by an increase in muscular contraction strength, increase in amplitude of muscle contraction, or shortening of muscle reaction time between stimulation 30 and contraction. Athlete refers to an individual who participates in sports at any level and who seeks to achieve an improved level of strength, speed, or endurance in their performance, such as, for example, body builders, bicyclists, long distance runners, and short distance runners. Enhanced sports performance is manifested by the ability to 2024204908   17 Jul 2024 overcome muscle fatigue, ability to maintain activity for longer periods of time, and have a more effective workout. It is contemplated that the compositions and methods of the present invention will also be effective in the treatment of muscle-related pathological conditions, including 5 myopathies, neuromuscular diseases, such as Duchenne muscular dystrophy, acute sarcopenia, for example, muscle atrophy and / or cachexia associated with bums, bed rest, limb immobilization, or major thoracic, abdominal, and / or orthopedic surgery. Chronic Stress Chronic stress has also been reported to have a significant effect on cognitive 10 performance and more precisely on learning and memory processes (Sandi 2004; Sandi and Pinelo-Nava 2007). Several factors are determinant on the impact that chronic stress will have on cognitive function. The levels of stress are important in determining whether the stress will serve to facilitate cognitive function or be deleterious. It is thought that in response to stressful situations the body induces stress hormones, which produce an 75 inverted U effect on learning, memory, and plasticity. Baldi et al. (2005) Nonlinearity Biol Toxicol Med. 3(1) 9-21; Joels (2006) Trends Pharmacol Sci. 27(5):244-50. Thus the level of stress has a great effect on cognitive function, with high levels of stress resulting in high levels of stress hormones and decreased performance. The length of the stress, chronic vs. acute, has been also shown to play an important 20 role, with distinct effects on cognitive function, as well as brain structure and function (Sandi and Loscertales 1999; Pinnock and Herbert 2001). Also, stress acts on the memory forming process resulting in different outcomes, with consolidation (memory storage) being facilitated by acute stress, and retrieval (memory recall) being inhibited (Roozendaal 2003). In addition, the predictability of the stress also plays a role on the severity of the effects 25 observed on cognitive performance (Maier and Watkins 2005). Additionally, the context in which the chronic stress occurs, as well as individual differences in stress response inherent to individuals and gender, play an important role in determining the final cognitive impact of chronic stress (Bowman, Beck et al. 2003; Shors 2004; Joels, Pu et al. 2006). 30           The biological basis for the effects of chronic stress is not yet well defined. However, a common observed feature is the key role of glucocorticoids in mediating both, the facilitating and impairing actions of stress, on different memory processes and phases. While the mechanism of glucocorticoids action has yet to be elucidated, it has been shown 2024204908   17 Jul 2024 in vitro to impair neuronal outgrowth induced by nerve growth factor (NGF). Unsicker et al. (1978) Proc Natl Acad Sci USA. 75:3498-502. Furthermore, neuronal structure and neurite outgrowth induced by factors such as NGF correlate strongly with their neuroprotective activity, suggesting again that neuronal structure is important for cognition. 5 Stress and structural remodeling Initially, the hippocampus was the brain region that received close attention due to the many reports indicating impairing effects of chronic stress in hippocampus-dependent memory tasks. However, intensive work is now providing evidence for a more integral impact of chronic stress throughout the brain, with major changes having also being 10 reported for the prefrontal cortex and the amygdala. Changes in dendritic branching and synaptogenesis occurring in the amygdala are plausible candidates to participate in stress-induced mood alterations. Also, changes occurring at the level of the hippocampus and the prefrontal cortex are believed to play a key role in stress-induced mood alterations. Hippocampus. The hippocampus is well known for its crucial role in memory 15 processes. Hippocampus-dependent tasks are generally affected by both acute and chronic stress manipulations. In humans, neuroimaging studies have reported hippocampal atrophy in association with stress- and glucocorticoid-related cognitive and neuropsychiatric alterations, including depression. In rodents, a prominent and many times replicated effect is a dendritic atrophy in 20 apical dendrites from CA3 pyramidal neurons. This reduced dendritic branching has been associated with (i) a reduction in synaptic density of excitatory glutamatergic synapses; (ii) a shrinkage of the volume of the complex dendritic spines termed dendritic excrescences, that are located on the proximal apical dendrite and soma of CA3 pyramidal cells and which serve as postsynaptic targets for the mossy fiber synaptic inputs; and (iii) a 25 rearrangement of synaptic vesicles and mitochondria in the afferent mossy fiber terminals. On its turn, evidence for synaptic remodeling — in terms of changes in synaptic features — has also been reported for the hippocampal CAI region. Prefrontal cortex. The prefrontal cortex (PFC), and more particularly its medial part (mPFC), plays key roles in higher cognitive processes (including executive function, 30 working memory, attention), as well as in the integration of cognitive and emotionally relevant information. It should be noted that the mPFC contains high levels of glucocorticoid receptors and is involved in the regulation of stress-induced hypothalamic-pituitary-adrenal (HPA) activity. As noted above, clinical evidence highlights the mPFC as 2024204908   17 Jul 2024 an area that experiences marked alterations in a wide variety of neuropsychiatric disorders, including depression. There is substantial evidence from rodent studies for stress-induced dendritic shrinkage in the PFC. In particular, major neuronal remodeling was described to occur in 5 layer II / III of the mPFC as a consequence of repeated exposure to chronic stress or repeated glucocorticoid treatment. The major described changes in this area are (i) a dendritic atrophy, including both decrease of total length and number of apical dendrites from pyramidal neurons; and (ii) a decrease in apical dendritic spine density (approximately one-third of all axospinous synapses on apical dendrites of pyramidal neurons are lost). 10           Antidepressant effects. Treatment with the atypical (modified tricyclic) antidepressant tianeptine was shown to reverse dendritic atrophy induced by chronic stress in CA3 pyramidal neurons in rats. Moreover, antidepressants were also reported to facilitate axonal and dendritic sprouting. These findings suggest that antidepressants can have a major impact on neuronal remodeling, providing the basis for relevant circuits to be 75 reorganized in the course of recovery from depression. Early-Life Stress An aspect of the invention is a method for treating mood effects of early-life stress. The method includes the step of administering to a subject in need thereof a therapeutically effective amount of urolithin or a precursor thereof, to treat the effects of early-life stress on 20 mood, depression, anxiety, and risk-taking behavior. Early-life stress has been reported to have a significant detrimental effect on cognitive performance, including psychological parameters such as increased rates of or susceptibility to depression, anxiety, and abnormal risk-taking behavior. Heim C, Nemeroff CB. (2001) Biol Psychiatry 49:1023-1039. Increased rates of attention- 25 deficit / hyperactivity disorder (ADHD), post-traumatic stress disorder (PTSD), and major depression have been reported in individuals having experienced early-life stress. Famularo R et al. (1992) J Am Acad Child Adolesc Psychiatry 31:863-867; Pelcovitz D et al. (1994) J Am Acad Child Adolesc Psychiatry 33:305-312. Early-life stress is thought to have an impact on the hypothalamic-pituitary-adrenal (HPA) axis. Ladd CO et al. (2000) Prog 30 Brain Res 122:81-103. The key effector thought to control the responsiveness of the HPA axis to stress is the central corticotrophin releasing factors (CRF). CRF is a 41 amino acid peptide which is distributed throughout the CNS. This includes the cell bodies of the medial parvocellular region of the hypothalamic 2024204908   17 Jul 2024 paraventricular nucleus (PVN), a central component of the HPA axis. Upon stress, CRF is released from the median eminence nerve terminals into the hypothalamo-hypophysial portal circulation and transported to the anterior pituitary where it binds to CRF receptors (CRF1 and CRF2). CRF binding to the CRF1 receptor produces effects that are 5 reminiscent of stress, depression, and anxiety. CRF binding to CRF2 receptor stimulates the production and release of adrenocorticotropic hormone (ACTH), which in turn stimulates the production of glucocorticoids involved in the stress response. In models of early-life stress caused by maternal separation, a consistent long-term elevated level of CRF mRNA is observed. Plotsky PM et al. (2005) 10 Neuropsychopharmacology 30:2192-2204. Such increases in CRF have been shown to have effects at the level of amygdala in increasing anxiety response. It is thought that a persistent sensitization of the CRF neurocircuits is responsible for the abnormally elevated anxiety, depression, and risk-taking behavior observed in mice exposed to early-life stress. Current Strategies Employing Antidepressants to Improve Psychological Disorders Due to 15 Early-Life Stress A number of studies have shown that antidepressants decrease CRF activity in the HPA axis in rodents and primates, including humans. Banki CM et al. (1992) J Affect Disord25:39-45; Brady LS et al. (1992) Brain Res 572:117-125; Brady LS et al. (1991) J Clin Invest 87:831-837; De Bellis MD et al. (\993) Am J Psychiatry 150:656-657; Veith 20 RC et al. (1993) Psychiatry Res 46:1-8. Several classes of antidepressant drugs appear to produce a decrease in the activity of one or more CRF neural systems. These include selective 5-HT reuptake inhibitors (SSRI), which have been shown to be effective in the treatment of several psychiatric disorders that have been associated with early-life stress (e.g., depression and PTSD). Hidalgo RB et al. (2000) JPsychopharmacol 14:70-76. 25 Notably, in a randomized placebo-controlled trial, subjects having undergone early-life stress and suffering from PTSD were responsive to fluoxetine, van der Kolk BA et al. (1994) J Clin Psychiatry 55:517-522. Furthermore, SSRIs, including fluoxetine and paroxetine, show significant efficacy versus placebo in the treatment of early-onset depression in children and adolescents. Martin A et al. (2000) Child Adolesc Psychiatr Clin 30   N Am 9:135-157. Tricyclic antidepressants have also been found to reverse increased HPA axis reactivity to stress in adult primates exposed to maternal deprivation. Suomi SJ. (1991) Ciba FoundSymp 156:171-183. It appears that several available drugs, including 2024204908   17 Jul 2024 the SSRIs, may be beneficial in the treatment of children and adults exposed to early-life stress. Fisher PA et al. (2000) J Am Acad Child Adolesc Psychiatry 39:1356-1364. Additional Indications The invention will also find use in the treatment of any of a variety of additional 5 diseases and conditions in which defective or diminished mitochondrial activity participates in the pathophysiology of the disease or condition, or in which increased mitochondrial function will yield a desired beneficial effect. As an example, the invention further includes methods and compounds that may be used to treat male infertility associated with diminished sperm motility. Nakada et al. (2006) Proc Natl Acad Sci USA. 103:15148-53. 10 As another example, the invention further includes methods and compounds that may be used to treat macular degeneration and certain other age-related and inherited eye disorders. Khandhadia et al. (2010) Expert Rev Mol Med. 12:e34; Jarrett et al. (2010) Ophthalmic Res. 44:179-90. Another example is a method of treating hearing loss, including but not limited to age-related hearing loss. In each of these and other indications, the method involves 75 administering to a subject in need of such treatment an effective amount of a urolithin or precursor thereof, as disclosed herein, to treat the indication. Formulations and Clinical Use A “subject” as used herein refers to a living vertebrate. In one embodiment, a subject is a mammal. In one embodiment, a subject is a human. 20          As used herein, the term “treat” as used in connection with a disease, disorder, or condition of a subject, means to reduce by a detectable amount at least one clinical or objective manifestation of the disease, disorder, or condition of a subject. In one embodiment, the term “treat” used in connection with a disease, disorder, or condition of a subject, means to cure the disease, disorder, or condition of a subject. 25          The urolithin or precursor thereof may be administered, alone or together with another agent, to a subject (e.g., mammal) in a variety of ways. For example, the urolithin or precursor thereof can be administered orally or parenterally. Parenterally includes, without limitation, intravenously, intramuscularly, intraperitoneally, subcutaneously, intraarticularly, intrasynovially, intraocularly, intrathecally, topically, or by inhalation. As such, 30 the form of the urolithin or precursor thereof dose can be in a variety of forms, including natural foods, processed foods, natural juices, concentrates and extracts, injectable solutions, microcapsules, nano-capsules, liposomes, plasters, inhalation forms, nose sprays, nosedrops, eyedrops, sublingual tablets, and sustained-release preparations. 2024204908   17 Jul 2024 The compounds of this invention can be provided in isolated form. As used herein, the term “isolated” means substantially removed from other compounds or components with which the compound of interest may otherwise be found, for example, as found in nature. In one embodiment, a compound is isolated when it is essentially completely 5 removed from other compounds or components with which the compound of interest may otherwise be found. In one embodiment, a compound is isolated when it is pure. The compounds of this invention can be incorporated into a variety of formulations for therapeutic administration. More particularly, the compounds of the present invention can be formulated into pharmaceutical compositions by combination with appropriate 10 pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. As such, administration of the compounds can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, and intratracheal 75 administration. The active agent may be systemic after administration or may be localized by the use of regional administration, intramural administration, or use of an implant that acts to retain the active dose at the site of implantation. The compounds of the invention can also be formulated as food additives, food ingredients, functional foods, dietary supplements, medical foods, nutraceuticals, or food 20 supplements. In pharmaceutical dosage forms, the compounds may be administered in the form of their pharmaceutically acceptable salts. They may also be used in appropriate association with other pharmaceutically active compounds. The following methods and excipients are merely exemplary and are in no way limiting. 25          For oral preparations, the compounds can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, com starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, com starch or gelatins; with disintegrators, such as com starch, potato starch or sodium carboxymethylcellulose; with 30 lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents. The compounds can be formulated into preparations for injections by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or 2024204908   17 Jul 2024 other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional, additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. The compounds can be utilized in aerosol formulation to be administered via 5 inhalation. The compounds of the present invention can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like. Furthermore, the compounds can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases. The compounds of the present invention can be administered rectally via a suppository. The suppository can 10 include vehicles such as cocoa butter, carbowaxes and polyethylene glycols, which melt at body temperature, yet are solidified at room temperature. Unit dosage forms for oral or rectal administration such as syrups, elixirs, and suspensions may be provided wherein each dosage unit, for example, teaspoonful, tablespoonful, tablet or suppository, contains a predetermined amount of the composition 75 containing one or more compounds of the present invention. Similarly, unit dosage forms for injection or intravenous administration may comprise the compound of the present invention in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier, wherein each dosage unit, for example, mL or L, contains a predetermined amount of the composition containing one or more compounds of 20 the present invention. Implants for sustained release formulations are well-known in the art. Implants are formulated as microspheres; slabs, etc., with biodegradable or non-biodegradable polymers. For example, polymers of lactic acid and / or glycolic acid form an erodible polymer that is well-tolerated by the host. The implant containing the inhibitory compounds may be placed 25 in proximity to a site of interest, so that the local concentration of active agent is increased relative to the rest of the body. The term “unit dosage form”, as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of compounds of the present invention calculated in an amount 30 sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the novel unit dosage forms of the present invention depend on the particular compound employed and the effect to, be achieved, and the pharmacodynamics associated with each compound in the host 2024204908   17 Jul 2024 The pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public. 5           For clinical use, the urolithin or urolithin precursor is administered in a therapeutically effective amount. As used herein, an “effective amount” refers to an amount that is sufficient to realize a desired biological effect. As used herein, a “therapeutically effective amount” refers to an amount sufficient to realize, in a single dose or multiple doses, a desired therapeutic effect. A skilled artisan can determine 10 therapeutically effective amounts based on in vitro, preclinical, or clinical studies, or any combination thereof. Dosing will generally be daily to weekly. In one embodiment, dosing is at least weekly. For example, a subject may receive one dose once weekly, twice weekly, thrice weekly, or every other day. In one embodiment, dosing is at least daily. For example, a 15 subject may receive one or more doses daily. For clinical use, a urolithin will generally be administered in an amount ranging from about to 0.2 - 150 milligram (mg) of urolithin per kilogram (kg) of body weight of the subject. In one embodiment, the urolithin or precursor thereof is administered in a dose equal or equivalent to 2 - 120 mg of urolithin per kg body weight of the subject. In one 20 embodiment, the urolithin or precursor thereof is administered in a dose equal or equivalent to 4 - 90 mg of urolithin per kg body weight of the subject. In one embodiment, the urolithin or precursor thereof is administered in a dose equal or equivalent to 8-30 mg of urolithin per kg body weight of the subject. Where a precursor of urolithin is to be administered rather than a urolithin, it is administered in an amount that is equivalent to the 25 above-stated amounts of urolithin. Any given dose may be given as a single dose or as divided doses. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a peak serum level of at least 0.001 micromolar (pM). In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to 30 achieve a peak serum level of at least 0.01 pM. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a peak serum level of at least 0.1 pM. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a peak serum level of at least 1 pM. In one embodiment, the 2024204908   17 Jul 2024 urolithin or precursor thereof is administered in a dose sufficient to achieve a peak serum level of at least 5 [1M. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a peak serum level of at least 10 [1M. In one embodiment, the urolithin or precursor thereof is administered in a dose 5 sufficient to achieve a sustained serum level of at least 0.001 micromolar ((1M). In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a sustained serum level of at least 0.01 [1M. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a sustained serum level of at least 0.1 [1M. In one embodiment, the urolithin or precursor thereof is administered in a 10 dose sufficient to achieve a sustained serum level of at least 1 [1M. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a sustained serum level of at least 5 [1M. In one embodiment, the urolithin or precursor thereof is administered in a dose sufficient to achieve a sustained serum level of at least 10 [1M. The sustained serum level can be measured using any suitable method, for example, high 15 pressure liquid chromatography (HPLC) or HPLC-MS. In one embodiment, the urolithin or precursor thereof is administered as pomegranate juice in the amount of 25 mL to 5 L, or an equivalent dose of ellagitannins, ellagic acid, urolithins, or any combination thereof. Table 4 shows the consumption of different pomegranate compounds for different levels of pomegranate juice. The range 20 covers differences in compound concentration among different varieties of pomegranate. For the calculations of ellagic acid equivalents, it was assumed that the metabolism of each mole of punicalagin resulted in the release of 1 mole of ellagic acid, and that this conversion happened with 100% efficiency. Levels of urolithin were determined by assuming that all the ellagic acid present, including that derived from punicalagin, 25 converted to urolithin with 100 % efficiency. Not taken into consideration were other sources of ellagic acid besides punicalagin and ellagic acid. Table 4. Juice Equivalent (mL) Punicalagin (mg / d) Ellagic Acid (mg / d) Ellagic Acid Equivalents (1:1) (mg / d) Total Urolithin (1:1) (mg / d) 25 10-65 3-30 20-35 15-25 50 20-130 6-60 40-70 30-50 2024204908   17 Jul 2024 75 30-195 9-90 60-105 45-75 100 40-260 12-120 80-140 60-100 150 60-390 18-180 120-210 90-150 200 80-510 24-240 160-280 120-200 250 100-650 30-300 200-350 150-250 500 200-1300 60-600 400-700 300-500 750 300-1950 90-900 600-1050 450-750 1000 400-1600 120-1200 800-1400 600-1000 2000 800-3200 240-2400 1600-2800 1200-2000 3000 1200-4800 360-3600 2400-4200 1800-3000 4000 1600-6400 480-4800 3200-5600 2400-4000 5000 2000-13000 600-6000 4000-7000 3000-5000 In one embodiment, the subject is not taking a urolithin or precursor thereof for any purpose other than for the treatment of a condition in accordance with the methods of the invention. In one embodiment, the subject is not taking a urolithin or precursor thereof for 5   the treatment of atherosclerosis, thrombosis, cancer, unwanted angiogenesis, infection, or inflammation. EXAMPLES The invention now being generally described, it will be more readily understood by 10 reference to the following, which is included merely for purposes of illustration of certain aspects and embodiments of the present invention, and is not intended to limit the invention. Example 1 Preparation of Functional Extracts from Pomegranate Compounds 15          The pomegranate extracts described in this application containing specific molecules were prepared using an extraction procedure based on adsorption of polyphenols in a standard polymer adsorption-based column as described. For the preparation of the extracts 31008 and 1108 derived from pomegranate juice, pomegranates were juiced using a standard juicing and manufacturing process and adsorbed onto a polymeric 20 chromatographic resin as pure juice. The resin Amberlite XAD-16 (Rohm & Haas) was packed into semi-preparative columns and loaded with the extracted juice. The column was washed with water to remove the sugars until completion (Brix levels were below 0.1 % ). 2024204908   17 Jul 2024 The polyphenols were eluted with 100% ethanol. The remaining ethanol was evaporated under vacuum to produce a concentrated extract containing 4.5 g of total polyphenol per liter as determined using the Folin assay for total polyphenol content. Extract 1011 was prepared in a similar manner as extract 31008 and 1108, but the liquid extract was then 5 spray dried utilizing a spray dryer to produce a final powder extract. Utilizing HPLC-MS for the identification of compounds, extract 31008, 1108, and 1011 were found to contain the molecules punicalagin, punicalin, tellimagrandin, and pedunculagin. The extract 71109 derived from the pomegranate husk was prepared by manually separating the husk from the pomegranate arils pulp, followed by pressing with a manual 10 fruit press. To extract the maximal amount of polyphenols, the cake / pomace of pressed pomegranate parts were soaked in water consecutively for several periods of time (5 minutes) in order to increase extraction efficiency. The extracted pomegranate solution was clarified by centrifugation before being adsorbed onto the polymeric chromatographic Amberlite XAD-16 resin (Rohm & Haas), packed in semi-preparative columns, and loaded 75 with the water extracted from pomegranate husk. The column was washed with water to remove the sugars until completion (Brix levels were below 0.1 % ). The polyphenols were eluted with 100% ethanol. The remaining ethanol was evaporated under vacuum to produce a concentrated extract containing 17.1 g of total polyphenol per liter as determined using the Folin assay for total polyphenol content. This technique is a modification of 20 methods known in the art as described by several published methods for purification of polyphenols from various plants and berries. Tuck, K. L. and P. J. Hayball (2002) "Major phenolic compounds in olive oil: metabolism and health effects." JNutr Biochem 13(11):636-644; and Schieber, A., P. Hilt, et al. (2003) "A new process for the combined recovery of pectin and phenolic compounds from apple pomace." Innovative Food Sci. 25 Emerging Technol. 4:99-107. For the preparation of Extract 61109, an aqueous extract of the pomegranate was fractionated utilizing centrifugal partition chromatography. The isolation fractions were lyophylized to produce extract 61109, highly enriched in punicalagin (>90%). 30 Purification of Punicalagin Preparation of Extract Extract from pomegranate was dissolved in 16 mL of the organic / aqueous phase mixture (1:1) and filtered on a Teflon filter (0.45 pm). 2024204908   17 Jul 2024 Separation of Punicalagin from Extract Using Centrifugal Partition Chromatography Separation of punicalagin from pomegranate extract was achieved by utilizing Centrifugal Partition Chromatography CPC. The CPC apparatus was a FCPC® 1000 apparatus provided by Kromaton Technologies (Angers, France) that is fitted with a rotor of 5   1000 mb capacity. The solvents were pumped by a 4-way binary high-pressure gradient pump. The samples were introduced into the CPC column via a high pressure injection valve (Rheodyne) equipped with a 20 mL sample loop. The effluent was monitored with a diode array detection (DAD) detector equipped with a preparative flow cell. Fractions were collected by a fraction collector. The separation steps were conducted at room temperature. 10          To accomplish the extraction, the stationary phase was first introduced into the column in the ascending mode without rotating, and mobile phase was then pumped through the stationary phase until an equilibrium stage was reached. Then, the rotation speed was increased from 0 to 1000 rpm and the mobile phase was pumped into the column at a flow-rate of 20 mL / min. After injection of 10 g of pomegranate extract, fractions of 20 75 mL were collected every minute. The content of the outgoing organic phase was monitored by online UV absorbance measurement at z. = 260 nm. An elution-extrusion procedure was used to recover all the compounds from the column: after a classical elution of 100 min, the mobile phase was replaced by the stationary phase used as mobile liquid, until all volume contained (1000 mL) was pushed 20 out the column. A fraction containing punicalagins (mixture of A and B isomers) with 9497% chromatographic purity was obtained between 51 and 63 minutes of elution, and a second fraction with a chromatographic purity of 85-88% was obtained between 64 and 79 min. To determine the level of purification, the purified sample was examined using by 25 HPLC-DAD at a detection wavelength of 260 nm. The sample was run over a Prosontil Cl8, 5 pm, 250 x 4 mm column. The solvents used were FLO mQ +9.1% TFA / Acetonitrile + 0.1% TFA at a flow rate of 1 mL / min. Example 2 In Vitro Screening Assays for Compounds Promoting Enhancement of the Expression of 30 Mitochondrial Genes in a Prototypical Skeletal Muscle Cell Line (C2C12 Myotubes) Skeletal muscles have a pivotal role in the regulation of metabolic homeostasis since they are involved in metabolic functions such as energy expenditure and maintenance of insulin sensitivity. These functions are tightly linked to mitochondrial activity, and 2024204908   17 Jul 2024 impairment of mitochondrial function has a causal role in defective metabolic homeostasis and development of metabolic disorders such as type 2 diabetes, obesity, and dyslipidemia. Gene expression profile of genes involved in mitochondrial activity in differentiated C2C12 cells (myotubes) is an appropriate model to assess the impact of compounds on 5 mitochondrial activity by evaluating numerous pathways which reflect mitochondrial activity, e.g., mitochondrial biogenesis, glycolysis, fatty acid P-oxidation, electron transport chain (ETC), mitochondrial dynamics. To assess the effects of compounds on mitochondrial gene expression, C2C12 myoblasts were differentiated into myotubes by serum deprivation for 4 days (Canto et al. 10   (2009) Nature. 458:1056-60). Myotubes were incubated for 48 hr with ellagic acid or urolithin A at a final concentration of 1, 10 or 50 [1M (all dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (final concentration 0.1%). At the end of the treatment, cells were washed with phosphate buffered saline (PBS) and mRNA were immediately extracted according to manufacturer’s instructions (Trizol Reagent, 75 Invitrogen) by adding 1 mb of Trizol reagent. After extraction, cDNA were produced by reverse transcription according to manufacturer’s instructions. Assessment of the expression levels of genes (PGC-la, Tfam, PFKFB3, CPTlb, MCAD, LCAD, Ndufa2, Cyt c, and Mfn2) which control the mitochondrial function was performed by real time quantitative PCR (Watanabe et al. (2004) J Clin Invest. 113:1408 20   18) by using the following set of primers (Fwd: forward primer; Rev: reverse primer): PGC-la: (Fwd) (Rev) AAGTGTGGAACTCTCTGGAACTG (SEQ ID NO:1) GGGTTATCTTGGTTGGCTTTATG (SEQ ID NO:2) 25 Tfam: (Fwd) (Rev) AAGTGTTTTTCCAGCATGGG (SEQ ID NOG) GGCTGCAATTTTCCTAACCA (SEQ ID NO:4) 30 PFKFB3: (Fwd) (Rev) TCATGGAATAGAGCGCC (SEQ ID NOG) GTGTGCTCACCGATTCTACA (SEQ ID NO :6) CPTlb: (Fwd) (Rev) CCCATGTGCTCCTACCAGAT (SEQIDNO:7) CCTTGAAGAAGCGACCTTTG (SEQIDNO:8) MCAD: (Fwd) GATCGCAATGGGTGCTTTTGATAGAA (SEQ ID NO:9) 35 (Rev) AGCTGATTGGCAATGTCTCCAGCAAA (SEQ ID NOTO) LCAD: (Fwd) (Rev) GTAGCTTATGAATGTGTGCAACTC (SEQ ID NO: 11) GTCTTGCGATCAGCTCTTTCATTA (SEQ ID NO: 12) 2024204908   17 Jul 2024 Ndufa2: (Fwd) (Rev) GCACACATTTCCCCACACTG (SEQ ID NO: 13) CCCAACCTGCCCATTCTGAT (SEQ ID NO: 14) Cyt c: (Fwd) TCCATCAGGGTATCCTCTCC (SEQ ID NO: 15) 5 (Rev) GGAGGCAAGCATAAGACTGG (SEQ ID NO :16) Mfn2: (Fwd) (Rev) ACGTCAAAGGGTACCTGTCCA (SEQ ID NO :17) CAATCCCAGATGGCAGAACTT (SEQ ID NO: 18) 10          PGC-1 a (PPARy-coregulator 1 a) and Tfam (mitochondrial transcription factor A) are master regulators of the mitochondrial function, namely of mitochondrial biogenesis and mitochondrial phosphorylative oxidation (mOXPHOS). An increase in their expression levels reveals an overall enhancement of mitochondrial activity. The assessment of other target genes involved in key functions of the mitochondria allows identifying the enhanced 75 pathways. PFKFB3 (6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 3) is a key enzyme of glycolysis, i.e., the use of glucose to produce energy. In aerobic conditions (i.e., when there are supplies of oxygen), pyruvate produced from glucose via glycolysis is used by the mitochondria to produce energy (ATP) through the Krebs cycle. CPTlb (carnitine O-palmitoyltransferase lb), MCAD (medium chain acyl CoA dehydrogenase), and LCAD 20 (long chain acyl CoA dehydrogenase) play a pivotal role in mitochondrial fatty acid uptake and P-oxidation, two critical steps for energy production from fatty acids. Ndufa2 (NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2) and Cyt c (cytochrome c) are subunits of complex I and IV of the mitochondrial electron transport chain, respectively. These proteins have an essential role in mitochondrial respiratory chain and energy 25 production from reduced equivalent produced by the Krebs cycle. Mfti2 (Mitofusin 2) is involved in mitochondrial dynamics and fusion process. Its expression is increased in the context of increased mitochondrial remodeling and / or mitochondrial biogenesis (increased number of mitochondria per cell). The data depicted in FIG. 3 clearly indicate that ellagic acid and urolithin A 30 increase mitochondrial activity in a dose-dependent manner by modulating the expression of numerous genes involved in several pathways of mitochondrial metabolism. Example 3 In Vitro Screening Assay for Compounds Promoting Enhancement of Mitochondrial Activity in a Prototypical Skeletal Muscle Cell Line (C2C12 Myotubes) 35          Citrate synthase is the initial enzyme of the tricarboxylic acid (TCA) cycle and the rate limiting step to enter the TCA cycle. The TCA cycle will produce NADH2 and 2024204908   17 Jul 2024 FADH2, which are then used to fuel the electron transport chain which will generate a proton (energy) gradient, which will be used in the generation of ATP. As such, citrate synthase is an exclusive marker of the mitochondrial number and of the mitochondrial activity. By measuring the effects of compounds or formulations on citrate synthase 5 enzyme activity, it is possible to assess the ability of the compounds to stimulate mitochondria activity (i.e., OXPHOS and ATP production). The enzyme citrate synthase catalyzes the reaction between acetyl coenzyme A (acetyl CoA) and oxaloacetic acid to form citric acid. The acetyl CoA contributes 2 carbons to the 4 carbons of oxaloacetate, resulting in citrate with 6 carbons. The hydrolysis 10   of the thioester of acetyl CoA results in the formation of CoA with a thiol group (CoA-SH). The activity of citrate synthase is measured via the reaction between the thiol of CoA-SH with the DTNB in the mixture to form 5-thio-2-nitrobenzoic acid (TNB). This yellow product (TNB) is observed spectrophotometrically by measuring absorbance at 412 nm (Citrate Synthase Assay Kit, Cat Number CS0720, Sigma Aldrich). 75          C2C12 myoblasts were differentiated into myotubes by serum deprivation for 4 days (Canto et al. (2009) Nature. 458:1056-60). Myotubes were incubated for 48 hr with punicalagin at a final concentration of 1 or 10 [1M or with ellagic acid or urolithin at a final concentration of 1, 10 or 50 [1M (all dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (final concentration 0.1%). At the end of the treatment, cells 20 were washed 3 times with PBS and assayed for citrate synthase activity according to manufacturer’s instructions (Citrate Synthase Assay Kit, Cat Number CS0720, Sigma Aldrich). As depicted in FIG. 4, punicalagin, ellagic acid, and urolithin increase citrate synthase activity in a dose-dependent manner, illustrating an overall increase in 25 mitochondrial activity and / or mitochondrial density (number of mitochondria per cells). These results confirm the results obtained by gene expression profile of mitochondrial genes (Example 1) showing an enhancement of mitochondrial activity and mitochondrial biogenesis in treated differentiated C2C12. Statistics: 1-way ANOVA * p < 0.05. 30                                   Example 4 In Vitro Screening Assay for Compounds Promoting AMP-Activated Protein Kinase (AMPK) Activity in a Prototypical Skeletal Muscle Cell Line (C2C12 Myotubes) 2024204908   17 Jul 2024 AMPK acts as a metabolic master switch regulating several intracellular systems including the cellular uptake of glucose, the P-oxidation of fatty acids, and the biogenesis of glucose transporter 4 (GLUT4) and mitochondria. The energy-sensing capability of AMPK can be attributed to its ability to detect and react to fluctuations in the AMP ATP ratio that 5 take place during rest and exercise (muscle stimulation). As an example, during a bout of exercise, AMPK activity increases (phosphorylation of AMPK, P-AMPK) while the muscle cell experiences metabolic stress brought about by an extreme cellular demand for ATP. Upon activation (AMPK phosphorylation, P-AMPK), AMPK increases cellular energy levels by inhibiting anabolic energy-consuming pathways (fatty acid synthesis, protein 10 synthesis, etc.) and stimulating energy-producing, catabolic pathways (fatty acid oxidation, glucose transport, etc.). Consequently, AMPK activation leads to an enhancement of mitochondrial function, including increased OXPHOS and mitochondrial biogenesis. C2C12 myoblasts were differentiated to myotubes by serum deprivation for 4 days (Canto et al. (2009) Nature. 458:1056-60). Myotubes were incubated for 1 hr with 15 resveratrol (RSV), which served as a positive control, or ellagic acid (EA) or urolithin A (UL) at a final concentration of 50 [1M (all dissolved in DMSO, final concentration 0.1%). DMSO was used as a control (final concentration of DMSO: 0.1%). At the end of the treatment, cells were washed 3 times with PBS, and AMP-activated protein kinase (AMPK) was assessed by Western blot. Following compound treatment, C2C12 cells were lysed in 20 buffer containing phosphatase inhibitors, and protein concentration was determined using a standard Bradford assay. The equivalent of 25 [1g of protein was used for separation on a 10% SDS-PAGE gel and subsequently transferred by standard Western blotting procedures. Antibodies directed to AMPK (Cell Signaling) and phosphorylated AMPK (P-AMPK, Cell Signaling) were used for detection. 25          As depicted in FIG. 5, Western blot analysis for the phosphorylated, and thus the activated form of AMPK - i.e., P-AMPK, indicated that the levels of phosphorylation of AMPK (P-AMPK) and hence activation of the AMP-activated protein kinase (AMPK) were indeed increased in cells treated with ellagic acid or urolithin relative to control treated cells.. This data indicates that ellagic acid and urolithin A are both AMPK activators. This 30 further supports the observations that ellagic acid and urolithins induce an increase in mitochondria function. Example 5 Screening Assay for Compounds Promoting Neurite Outgrowth in PC-12 Cells 2024204908   17 Jul 2024 Neurite outgrowth and the number of mean processes per cell in neuronal culture have been shown to correspond to neuronal function. Chronic stress has been shown to result in reductions both of dendritic length and branch number, an effect which was reversed upon the removal of stress. Furthermore, it has been shown that this reversibility 5 became inhibited with aging (Bloss, Janssen et al. 2010). There is also further evidence that learning and novel sensory experiences are associated with increases in spine formation and elimination of protracted processes. Hence synaptic structural plasticity plays an important role in learning and memory (Yang, Pan et al. 2009). Indeed, the level of neurite outgrowth and number of processes induced by compounds such as nerve growth factor (NGF) 10 correlates strongly with their neuroprotective abilities. With aging this synaptic plasticity becomes compromised and there is an increased loss of spines and a decreased density of synapses (Dumitriu, Hao et al. 2010). Neurodegenerative diseases also have an effect on neurite outgrowth. A-beta (AP) peptide, which plays an important role in Alzheimer’s disease, inhibited neurite outgrowth in mouse neuroblastoma cells. Therefore, by assaying 75 the effects on neurite outgrowth in vitro, compounds and formulations with neuroprotective effects on neurons under chronic stress, neurons undergoing aging, and neurons present in neurodegenerative diseases can be identified. The in vitro effects on neurite outgrowth of the different ellagitannins and their metabolites punicalagin (PA), punicalin (PB), tellimagrandin (TL), ellagic acid (EA), and 20 urolithin (UA), were tested on cells of a noradrenergic rat pheochromocytoma cell line (PC-12 cells), which have been shown to differentiate in response to nerve growth factor (NGF) (Greene and Tischler 1976). Neuritic outgrowth in these differentiated PC-12 cells has been shown to be strongly promoted by dibutyryl cyclic AMP (dbcAMP) (Gunning, Landreth et al. 1981), and this compound was utilized as a positive control. As a negative 25 control, the specific Janus N-terminal kinase (JNK) inhibitor SP600125, which has been shown to decrease different parameters of neurite outgrowth, was utilized (Xiao, Pradhan et al. 2006). The ellagitannins and their metabolites tested in the assays were synthesized or purchased from suppliers which included Funakoshi, Sigma, and Chemos. Stock solutions were aliquoted and stored at -20 °C. 30         PC-12 cells (ATCC CRL-1721) were cultured at 37 °C, 5% CO2 in poly L-lysine- coated culture flasks in complete culture medium (RPMI 1640 + 10% heat-inactivated horse serum + 5% fetal bovine serum). 2024204908   17 Jul 2024 Cell differentiation was performed in culture flasks 24 h after plating, in complete medium supplemented with 100 ng / mL NGF (2.5 S NGF, Invitrogen). The NGF-supplemented medium was renewed every third day, and differentiation was induced over an 8-day period. 5          All compounds to be tested were prepared just before the experiment as a 50 mM stock solution in dimethylsulfoxide (DMSO). The final DMSO concentration was 0.1% in the medium of all experimental groups. For neurite outgrowth measurements, differentiated cells were washed with phosphate-buffered saline (PBS), collected after detachment and replated at a density of 10   5,000 cells / well (biocoat imaging 96 well plate) in complete medium supplemented with 100 ng / mL NGF, with or without 10 pM SP600125 (negative control), 1 mM dbcAMP (positive control), or tested compound at 5 x 10'7 M. In the undifferentiated control group, no NGF was added after replating. After 72 h in culture, PC-12 cells were washed with PBS and fixed in 1% 75 paraformaldehyde solution for 20 minutes. After 3 washes with PBS, immunofluorescence labeling was performed with Texas Red Maleimide probe, which reacts with thiol groups of cysteine residues of proteins, permitting the visualization of the entire cell morphology, including neurites. Immunofluorescence analysis was performed in automated confocal microscopy. 20 Images were acquired with a BD pathway 855 system, under X20 objective with 8X8 field montage. Neurite outgrowth was then measured from acquired images with the neurite module of Metamorph® software. Total and mean outgrowth, total and mean number of processes per cell, and total and percentage of cells with extensive outgrowth (defined as outgrowth longer than 20 pm) were analyzed. 25          All compounds, except PA and PB, increased the number of PC-12 cells in the wells by >30%, as shown in FIG. 6, indicating a trophic effect for these compound at a concentration of 0.5 pM (p < 0.001 for UA, EA, and TL versus differentiated control (ctrl)). Promotion of Neurite Outgrowth As shown in FIG. 7 and FIG. 8, all compounds tested (PA, PB, TL, EA and UA) 30 were able to induce robust neurite outgrowth from differentiated PC-12 cells. The mean outgrowth (FIG. 7) showed an increase of >30% over differentiated control for all the compounds tested. The percent of cells showing significant outgrowth (FIG. 8) was significantly greater than that observed for differentiated cells for all compounds tested (p < 2024204908   17 Jul 2024 0.05 for UA and PB (26% increase), p < 0.01 for PA (>26% increase), p < 0.001 for EA and TL, (>37% increase)). Promotion of Process Formation and Branching The compounds PA, PB, UA, EA, and TL, all induced an increase in the number of 5 processes when applied to differentiated PC-12 cells. Compounds (UA, p < 0.05 (15.7% increase); PA, p < 0.01 (26.3% increase); EA and TL, p < 0.001 (>31% increase) were either as effective as or more effective than dbcAMP, the positive control, in promoting process formation (FIG. 9). Neurite branching was significantly higher than that observed in differentiated 10 control, with most compounds inducing a two-fold increase in branching. Example 6 Screening Assay for Compounds Promoting Neurite Outgrowth in Primary Dopaminergic TH-Positive Neurons Primary neurons due to their untransformed state, serve as a good in vitro model for 75 the effects of compounds on markers of neuronal plasticity and differentiation, such as neuronal outgrowth, and formation of dendrites and processes. The effects of different ellagitannin metabolites punicalagin (PA), urolithin (UA), ellagic acid (EA), and tellimagrandin (TL) on this process were examined. The compounds tested in the assays were purchased from suppliers which included Funakoshi and Sigma, or were chemically 20 synthesized. Stock solutions were aliquoted and stored at -20 °C. Primary mesencephalic cultures were prepared from rat E14 embryos. Ventral mesencephalon was carefully dissected and dissociated. Cells were then plated in DMEM F12 medium containing 10% heat inactivated horse serum at the density of 100,000 cells / well (96-well plate), with or without the JNK-specific inhibitor SP600125 (10 [1M) 25 (which served as a negative control) or dbcAMP (1 rnM) (which served as a positive control), or the compounds tested each at the doses of 0.1 [1M. 72 h after plating, the effects on the neurite outgrowth of dopaminergic tyrosine hydroxylase (TH)-positive neurons were measured from images acquired by automated confocal microscopy (X4 objective, montage 4X4) and covering the entire well surface, and 30 quantified using the Neurite outgrowth module of Metamorph® software. Several representative parameters of neurite outgrowth were thus generated: total and mean outgrowth, total and mean number of processes per cell, and total and percentage of cells 2024204908   17 Jul 2024 with extensive outgrowth (defined as outgrowth longer than 20 pm) were analyzed. All experiments were performed in quadruplicate. Promotion of Neurite Outgrowth As shown in FIGs. 10-16, compounds selected in the above PC-12 screening assay 5 were also able to induce neurite outgrowth in primary mesencephalic neurons at a concentration of 0.1 pM. Most compounds were as effective as dbcAMP in promoting outgrowth per cell (> 25% increase in outgrowth) as measured by the mean outgrowth per cell shown in FIG. 10 (p < 0.001 for UA, GA, EA, TL vs control). All compounds tested performed as well or better than dbcAMP (FIG. 11). 10 Increase in Neurite Processes and Branching All the compounds tested showed significant increases in the mean processes per cell (> 10%) (FIG. 12), as well as in the maximum process length (> 10%) (FIG. 13). Primary cells showed an increase in branching in the presence of the positive control (dbcAMP). However, the JNK inhibitor SP600125 did not inhibit primary cell 75 branching, as in PC 12 cells, but was capable of promoting branching albeit not to the same level as dbcAMP (60% vs 86% increase seen for dbcAMP). The compounds UA, EA, and TL were able to promote branching to the same levels as dbcAMP (> 111% increase in branching, FIG. 14). Increases in Dendrites per Cell and Dendrite Length 20          Dendrite number was increased significantly for UA, EA, and TL, at levels above that of dbcAMP, with all compounds showing an increase >18% (FIG. 15). Ellagic acid, urolithin A, and tellimagrandin all produced increases in dendritic length > 26%, higher than that observed for dbcAMP (FIG. 16). Example 7 25 Pomegranate Extract, Punicalagin, Ellagic Acid, and Urolithin A Reduce Weight Gain and Fat Mass in Mice Fed a High Fat Diet Male C57BL6 / J mice were purchased from Charles River Laboratory (L’Arbresle, France) at the age of 7 weeks and acclimatized to the animal facility for 2 weeks before initiation of experiments. Mice were housed in groups of 5 in standard housing conditions, 30 with a 12 hr light-dark cycle and free access to food and water. Beginning at 9 weeks of age, mice were fed a high-fat diet (HFD) (60% kcal from fat; DI2492; Research Diets Inc., New Brunswick, NJ, USA) for fourteen weeks. Body weight was monitored weekly. 2024204908   17 Jul 2024 Mice in different treatment groups were administered (i) urolithin A mixed with food (food admix) to reach a dosing of 55 mg / kg body weight / day (mkd); (ii) ellagic acid mixed with food (food admix) to reach a dosing of 75 mkd; (iii) punicalagin (gavage) to reach a dosing of 90 mkd; or (iv) pomegranate extract (PE) (gavage) to reach a dosing of 5   140 mkd of total polyphenols. A typical pomegranate extract used in these experiments had the following composition: polyphenols, 140 mkd; punicalagin, 13.1 mkd; and ellagic acid, 13.2 mkd. For animals treated by gavage, gavage was performed daily (7 days / week) between 8:00 and 10:00 a.m.; compounds were mixed with saline solution (0.9% NaCl) and provided at a final volume of 5 mL / kg of body weight. Mice in high-fat control groups 10 were fed with the same diet as the experimental animals. Mice in corresponding different control groups were administered either high-fat diet alone or high-fat diet plus daily gavage with vehicle (saline). Another control group of mice were fed standard chow diet alone. Body composition was monitored by EchoMRI (Echo Medical Systems, Houston, 15 TX, USA) 5 weeks after the initiation of the treatment for high-fat diet fed mice and 2 weeks after the initiation of the treatment for chow diet fed mice. Animals were placed individually into a plastic cylinder and then introduced into an EchoMRI system for about 2 min for body composition scanning (lean and fat mass). Results are shown in FIGs. 17 and 18. 20          Mice fed with a high-fat diet (HFD) developed a severe obesity compared to control mice fed with a standard chow diet (CD) (FIG. 17A). Body weight gain in untreated high-fat fed mice was associated with an increase in the percentage of fat mass (FIG. 17B) and a decrease in the percentage of muscle mass (lean mass) (FIG. 17C), both as measured by EchoMRI after 5 weeks of treatment. In mice fed a high-fat diet, treatment with urolithin A 25 (administered by food admix) or with punicalagin or pomegranate extract (PE) (both administered by gavage) prevented the onset of obesity with a strong reduction of body weight gain in treated HFD-fed mice compared to control HFD-fed mice (FIG. 17A). Along with this, fat mass was significantly reduced in HFD-fed mice treated with urolithin A, punicalagin, or PE compared to untreated HFD fed mice (FIG. 17B). 30          Mice fed a standard-chow diet and treated with either ellagic acid or urolithin A also saw a reduction in fat mass with a concomitant increase in muscle (lean mass), illustrating that these treatments favor the management of weight and a lean or muscular physique (FIG. 18B). 2024204908   17 Jul 2024 Example 8 Pomegranate Extract, Punicalagin, Ellagic Acid, and Urolithin A Increase Muscle Mass in Normal and Obese Mice Male C57BL6 / J mice were grouped and treated as described in Example 7. 5          In both standard chow diet-fed mice and HFD-fed mice, treatment with PE, punicalagin, ellagic acid or urolithin A resulted in a statistically significant increase in the percentage of lean mass. Mice fed a high-fat diet and treated with urolithin A, punicalagin, or PE saw a reduction in fat mass with a concomitant increase in muscle (lean mass) (FIGs. 17B and 17C). Mice fed a chow diet and treated with either ellagic acid or urolithin A also 10 saw a reduction in fat mass with a concomitant increase in muscle (lean mass), illustrating that these treatments favor the management of weight and a lean or muscular physique (FIGs. 18A and 18B). Since lean mass is predominantly represented by muscle mass, these results illustrate how treatments with either PE, punicalagin, ellagic acid or urolithin A result in an increase in the proportion of muscle mass in both normal and obese mice with 15 respect to total body mass. This effect was observed after as little as two weeks of treatment. Example 9 Pomegranate Extract, Punicalagin, Ellagic Acid, and Urolithin A Increase Energy Expenditure in Normal and Obese Mice 20          Male C57BL6 / J mice were grouped and treated as described in Example 7. In addition, however, basal energy expenditure of mice was measured by indirect calorimetry oxygen consumption, carbon dioxide production, and respiratory exchange ratio), 8 weeks after the initiation of treatment for the HFD-fed mice and 2 weeks after the initiation of treatment for standard show diet-fed mice, using the Comprehensive Laboratory Animal 25 Monitoring System (CLAMS; Columbus Instruments, Columbus, OH, USA). Animals were first acclimatized for 22 h to CLAMS cages (room temperature 22 °C ± 1 °C) starting between 11 to 12 am. Then measurement was performed for at least 20 h in the same condition. Measurement included an entire dark cycle. Parameters measured during CLAMS were the following: (i) Oxygen consumption (VO2 in mL / kg / h): VO2 is directly 30 correlated to energy expenditure; (ii) Carbon dioxide production (VCO2 in mL / kg / h); and (iii) Respiratory Exchange Ratio (RER): VCO2 / VO2: RER is an indicator of the use of energy substrate. In a steady state, RER is equivalent to the Respiratory Quotient (RQ). 2024204908   17 Jul 2024 Pure carbohydrate use gives RER=1, whereas pure fat burning yields an RER=0.7. A mixed diet gives a RER=0.85. Results are shown in FIGs. 19 and 20. Oxygen consumption is a physiological marker of mitochondrial activity and energy 5 expenditure. Treatments with either PE, punicalagin, ellagic acid, or urolithin A significantly increased oxygen consumption in mice. Ellagic acid and urolithin A increased energy expenditure in standard chow-fed mice (FIGs. 19A and 19B). This effect was observed after as little as 2 weeks of treatment. Pomegranate extract (PE), punicalagin, and urolithin A treatment increased energy expenditure in HFD-fed mice (FIGs. 20A and 20B). 10                                  Example 10 Pomegranate Extract, Punicalagin, Ellagic Acid, and Urolithin A Increase Use of Fatty Acids As Energy Substrates in Normal and Obese Mice Male C57BL6 / J mice were grouped and treated as described in Example 9. As stated above, in addition to oxygen consumption, indirect calorimetry also 75 monitors carbon dioxide production. The ratio between carbon dioxide production (VCO2) and oxygen consumption (VO2) is called Respiratory Exchange Ratio (RER). RER is an excellent indicator of the use of energy substrates. In a steady state, RER is equivalent to the Respiratory Quotient (RQ). A preferential use of carbohydrates as energy substrate gives a RER close to 1, whereas a use of fat as energy substrate (fat burning) yields a lower 20 RER which is close to 0.7 when fatty acids are preferentially used. As depicted in FIG. 21 and FIG. 22, PE, punicalagin, ellagic acid, and urolithin A treatment significantly decreased RER in both chow diet and HFD-fed mice. This effect was dramatic in chow diet fed mice treated with ellagic acid and urolithin A (FIG. 21). These results support the shifts in body composition observed following the consumption of 25 PE, punicalagin, ellagic acid or urolithin A which favor a more muscular (lean) physique with reduced fat composition. Example 11 Pomegranate Extract, Punicalagin, and Urolithin A Decrease Plasma Levels of Triglycerides and Free Fatty Acids in Obese Mice 30          Male C57BL6 / J mice were grouped and treated as described in Example 7. In addition, plasma biochemistry was performed 14 weeks after the initiation of the treatment using a standard automated clinical chemistry analyzer (Dimension Xpand, SIEMENS). Animals were fasted for 12 h (from 8pm to 8am) before blood collection. Approximately 2024204908   17 Jul 2024 500 uL of blood was collected from vena cava in anesthetized animals under isofluorane anesthesia. Blood was collected in heparinized tubes and immediately placed on wet ice. Plasma was prepared by centrifugation (1500 x g, 15 min, 4 °C). Plasma samples were then transferred in clean 1.5 mL microtubes and stored at -80 °C until biochemical 5 measurements were performed on a standard automated clinical chemistry analyzer (Dimension Xpand, SIEMENS) using corresponding kits. Circulating levels of triglycerides and free fatty acids was measured by standard biochemistry in the blood of control and treated HFD-fed mice (FIG. 23). PE, punicalagin and urolithin A treatment led to a statistically significant improvement of plasma levels of 10 triglycerides and free fatty acids. These results indicate that PE, punicalagin, and urolithin A are effective in treating dyslipidemia in obese mice and consequently can act to improve cardiovascular function and prevent cardiovascular disease. Example 12 Punicalagin, Ellagic Acid, and Urolithin A Improve Glucose Tolerance in Obese Mice 15         Male C57BL6 / J mice were grouped and treated as described in Example 7. In addition, glucose tolerance test (GTT) was performed for HFD-fed mice which developed glucose intolerance. Glucose tolerance test was monitored 10 weeks after the initiation of the treatment by Oral Glucose Tolerance Test (oGTT). Animals were fasted for 12h (from 8pm to 8am) before oGTT. The day of the oGTT, a small drop of blood (< 2 uL) was 20 collected from the lateral tail vein and glycemia was monitored using a glucometer (AccuCheck Aviva, Roche Diagnosis). Each animal then received, at time 0, an oral dose of D-glucose at a dosing of 2 g / kg body weight. Glycemia was then monitored at times 15, 30, 45, 60, 90, 120, and 150 min after oral glucose load. As in humans, high fat diet feeding in mice resulted in the onset of obesity and type 25   2 diabetes which is characterized by a severe glucose intolerance as assessed by the follow up of glycemia immediately following an exposure to glucose (2 g / kg of body weight) (Glucose tolerance test) (FIG. 24). As depicted FIG. 24, punicalagin, ellagic acid, and urolithin A treatment improved glucose tolerance in HFD-fed mice. Consequently, these treatments may also be effective therapeutic approaches for the treatment of type 2 diabetes. 30                                  Example 13 Urolithin A Increases Mitochondrial Function in Aged C. elegans C. elegans strains were cultured at 20 °C on nematode growth media (NGM) agar plates seeded with E. coli strain OP50. Strain used was wild-type Bristol N2 provided by 2024204908   17 Jul 2024 the Caenorhabditis Genetics Center (University of Minnesota). Urolithin A was dissolved in DMSO. Animals were exposed to compounds from eggs on plates seeded with live OP50 bacteria. Control plates were prepared with the corresponding concentration of DMSO (0.1%). 5         Measurement of oxygen consumption is a direct indicator of mitochondrial activity. The effect of urolithin A on mitochondrial activity in aged C. elegans (10 days old) was assessed by treating C. elegans with urolithin A for 10 days of adulthood, at which time oxygen consumption was measured using the Seahorse XF24 equipment (Seahorse Bioscience Inc., North Billerica, MA). 250 ten-day-old C. elegans were used per condition. 10 C. elegans were recovered from NGM plates with M9 medium, washed three times in 2 mb M9 to eliminate residual bacteria, and resuspended in 500 [1L M9 medium. Worms were transferred into 24-well standard Seahorse plates (#100777-004) (50 worms per well) and oxygen consumption was measured. The basal oxygen consumption of the worms was first measured over 30 minutes at 5 minute intervals (0 min, 5 min, 15 min, 20 min, 25 min and 75   30 min) with 5 replicates per interval. Respiration rates were normalized to the exact number of worms per well determined after the completion of the experiment using a stereomicroscope. After determining the basal oxygen consumption, uncoupled oxygen consumption was measured by adding carbonylcyanidc-p-ftrifluoromcthoxy) phenylhydrazone (FCCP) at the 30 minute time point to the media in order assess the 20 maximal oxygen consumption capacity and maximal mitochondrial capacity. Uncoupled oxygen consumption was measured at 5 minute intervals (35 min, 40 min, 45 min, 50 min, 55 min and 60 min) to permit measuring the mitochondrial function over time. FCCP is a chemical uncoupling agent that abolishes the obligatory linkage between the respiratory chain and the phosphorylation system which is observed with intact mitochondria. This 25 effect is due to the amphipathic properties of the molecule which dissolves in mitochondrial phospholipid bilayers. This dramatically increases ionic permeability of the mitochondrial membrane and generates dramatic proton leak leading to increase in oxygen consumption due to the quenching by oxygen of the electrons pumped into the respiratory chain in parallel to the proton leak. Since this oxygen consumption is dissociated (uncoupled) to 30 ATP production (oxidative phosphorylation), FCCP increases oxygen consumption while decreasing the generation of energy (ATP) by the mitochondria. Fully uncoupled mitochondria, as achieved with FCCP, display the maximal capacity of their mitochondrial respiratory chain (maximal oxygen consumption) without the “brake” that oxidative 2024204908   17 Jul 2024 phosphorylation and energy production represents). The results depicted in FIG. 25 illustrate that urolithin A increases the maximal mitochondrial capacity of aged C. elegans, as depicted by a prolonged effect on increased uncoupled respiration in worms treated with urolithin A versus control (DMSO) treated 5 worms. Control, untreated worms showed a brief increase in uncoupled respiration which quickly returned to basal levels of oxygen consumption. Urolithin A-treated worms showed a more extended elevation in oxygen consumption. The extent of enhanced mitochondrial activity is shown by comparing the area under the curves (AUC) during the decoupling period with the average coupled respiration employed as the baseline. It was 10 observed that urolithin A significantly increased uncoupled respiration in aged worms as compared to control untreated worms over the 30 minute period evaluated. Example 14 Urolithin A Increases Mitochondrial Activity in C. elegans C. elegans strains were cultured at 20 °C on nematode growth media agar plates 15 seeded with HT115 bacteria and containing 50 [1M urolithin A or a corresponding concentration of DMSO as a control. The worms were treated for 24 hours. The strains used were the SJ4103 (zcIsl4[myo-3::GFP(mit)]), which is a stable transgenic line expressing a mitochondrially localized green fluorescent protein (GFP) with a cleavable mitochondrial import signal peptide under the control of the specific body wall muscle 20 promoter myo-3. GFP expression and quantification was carried out according to the protocol previously described (Durieux et al., 2011). Worms were treated with 50 [1M urolithin A from eggs, and GFP was monitored after one day of adulthood. Fluorimetric assays were performed using a Victor X4 multilabel plate reader (Perkin-Elmer Life Science). Eighty worms were picked at random (20 worms per well of a black-walled 9625 well plate) and each well was read four times and averaged. The results in FIG. 26 show that treatment of worms with urolithin A induced the expression of the mitochondrial GFP-reporter driven by the muscle-specific myo-3 promoter in C. elegans. This striking increase in GFP expression provides clear evidence that mitochondrial capacity increased due to the urolithin A. To permit such an increase in 30 observed GFP signal, mitochondria in muscle must either be enlarged or more numerous in these worms. 2024204908   17 Jul 2024 Example 15 Effects of Pomegranate-Derived Compounds on Mood and Cognition in Response to Chronic Stress 7-week-old C57BL / 6J wild-type male mice were exposed to chronic unpredictable 5 stress for a period of four weeks. Several behavioral experiments were carried out before, during, and after the chronic stress period to determine the impact on mood and cognition. As has been previously been reported, chronic stress negatively impacts mood and cognition. Natural compounds derived from pomegranate were administered to these mice to determine what impact these compounds would have on ameliorating this negative 10 impact on mood and cognition. Mice were habituated to our animal facility for 9 days before beginning the experiments. All mice were housed in groups of three in standard plastic cages, and they were kept under a 12 h light / dark cycle (7:00 a.m. - 7:00 p.m.) with ad libitum access to food and water. All the procedures carried out were performed in accordance with the 15 Swiss National Institutional Guidelines on Animal Experimentation and were approved by the Swiss Cantonal Veterinary Office Committee for Animal Experimentation. Characterization of Animals After adaptation to the animal facility, all mice were characterized in terms of body weight, anxiety-like behavior in the elevated zero maze (EZM), and locomotion and 20 exploration in the open field and novel object assays. The objective of these experiments was to match animals according to their anxiety and exploration rates in order to establish experimental and control groups that are equivalent according to these traits. Elevated Zero Maze Anxiety was measured in an elevated zero maze (EZM). Mice were observed for 5 25 min in the EZM (a 5.5-cm-wide annular runway with a diameter of 46 cm and raised 46 cm above the ground) under dim and dispersed light conditions. Two opposing 90° sectors were protected by 13.5 cm high inner and outer walls. Thus, three zones were defined as follows: an intermediate zone comprising four 30° segments at the ends of the protection walls separated by the two 50° wide closed / protected and the two 70° wide 30 open / unprotected exploration zones. With these boundaries, the entries into the open sectors were detected only when the animal entered into them with all four paws. The trajectories of each mouse were automatically recorded by video tracking (Ethovision 3.0, Noldus, Wageningen, Netherlands). The total number of entries into all the sectors served 2024204908   17 Jul 2024 as an indicator of spontaneous locomotor activity, while differences in the number of entries and the time spent in the open sectors was taken as indicators of anxiety. Between sessions the maze was cleaned with 4% ethanol / water. Open Field and Novel Object 5          Locomotion and reactivity to an open field (OF) was assessed in a white quadratic box (50x50x37 cm) under dim and dispersed light conditions. The mouse is placed into the center of the field and allowed to move freely during 10 min. The total distance moved, frequency of entries to the center, time and percent time in the center of the OF were analyzed. Avoidance of the interior or “unprotected” area of the field is interpreted as an 10   anxiety-like behavior. Measures of total distance are used as an index of activity. Exploratory behavior was assessed by using the novel object (NO) test. The NO test was performed immediately after the OF test. A small, metallic object (3 x 1.5 x 5 cm) was placed into the center of the open field while the mouse was inside. Mice were given then 5 min to freely explore the novel object. The time spent in the center and the periphery of the 75 compartment, number and latency of entries to the center, and total distance moved in the center and the whole compartment were analyzed. Percent time and distance the mice spent in the center, exploring the novel object, were considered as indicators of “focused” exploratory activity. Treatment with Pomegranate-Derived Extract 20          Three weeks before the initiation of the chronic stress protocol mice were separated into four different groups. One group received standard mouse chow diet (Control), while the remaining three groups received varying doses of extract 1011, an extract derived from pomegranate juice. Low dose corresponded to an extract dose of 21 mg / kg / d of gallic acid equivalents of polyphenols (GAE PPE), the medium dose corresponded to an extract dose 25 of 43 mg / kg / d of GAE PPE, the high dose corresponded to an extract dose of 86 mg / kg / d of GAE PPE (see Table 5). Table 5. Pomegranate Powder Extract 1011. Extract 1011 Polyphenols Punicalagin Punicalin Ellagic Acid Low Dose 21 mg / kg / d 2.1 mg / kg / d 5.2 mg / kg / d 2.0 mg / kg / d Medium Dose 43 mg / kg / d 4.2 mg / kg / d 10.5 mg / kg / d 3.9 mg / kg / d 2024204908   17 Jul 2024 High Dose 86 mg / kg / d 8.5 mg / kg / d 21 mg / kg / d 7.8 mg / kg / d Treatment with the diet began three weeks before the initiation of the chronic stress protocol and continued until the termination of the experiment. Treatment with Urolithin A, a Pomegranate-Derived Metabolite 5          Three weeks before the initiation of the chronic stress protocol, mice were separated into two groups. One group received standard mouse chow diet (Control), while the other group received a diet containing urolithin A, delivered at a dose of 25 mg / kg / d. Chronic Unpredictable Stress The unpredictable chronic stress protocol involved exposing animals to a daily 10 stressful situation at an unpredictable moment for 4 weeks (between 8 am and 4 pm, and randomly distributed over the 28 days). The stress stimuli used were either: 6 min tail suspension; 3 x 0.4 mA inescapable foot-shock; 4 h exposure to soiled, damp sawdust; 2 h exposure on an elevated platform; 1 h immobilization in a plastic tube; 30 min exposure to 16 °C; 2 days inversed light / dark cycle; 10 min exposure to an older, aggressive 15 conspecific; intense light exposure (600 lux); 2 h overcrowded cage (6 mice) and 8 h with a 40° cage inclination. All animals were weighed and the state of their coat was evaluated on a regular basis (every 3-5 days). During this experiment one group of mice was exposed to the chronic stress and the other group of animals was left undisturbed and served as controls. 20 Behavioral Assays Tail suspension test The tail suspension test (TST) is used as a model for assessing antidepressant-like activity in mice. The test is based on the fact that animals subjected to the short-term (6 min.), inescapable stress of being suspended by their tail, will develop an immobile posture. 25 The mouse was hung on a metal bar by an adhesive tape placed 20 mm from the extremity of its tail. The distance between the floor and the bar was approximately 25 cm. Immobility is defined as the absence of initiated movements and includes passive swaying. Investigation time, which included immobility, struggling and climbing, was scored from videotape. 2024204908   17 Jul 2024 As shown in FIG. 27, chronic stress resulted in an increased immobility in the TST, an indicator of increased depression and sense of helplessness. However, mice treated with increasing doses of pomegranate extract demonstrated a reversal in this pattern and a restoration of mobility and struggling to levels observed in non-stressed mice. Thus the 5 pomegranate extract prevents the depression response observed in chronically stressed nontreated mice. Contextual Recognition Contextual fear conditioning is a measurement of an animal’s ability to remember a particular context. In this assay, mice are placed in a box and then receive two mild shocks, 10 one minute apart. In reaction to the shocks mice freeze. The ability of mice to recognize the context in which they received the shock is tested by placing them back in the box at a later timepoint. If they recognize the context, mice will freeze in anticipation of receiving a shock. In normal mice, the ability to recognize the context in the absence of any shocks is a 75 measurement of contextual memory. Mice with better contextual memory recognize the initial context better and thus have a higher level of freezing. This assay can also be used to measure anxiety in stressed mice. In stressed mice, increased anxiousness could be observed in increased freezing reaction time in response to the initial shocks, as well as a longer extinction period for the memory of the context. 20   Extinction of the contextual memory is measured by placing the mouse in the same context once a day for several days in the absence of the initial adverse stimulus. With time mice unlearn the association of the context with the adverse stimulus, which is evidenced by a gradual decrease in freezing. In stressed mice that are anxious this extinction of the adverse memory takes longer. 25          Contextual fear conditioning was used to test the effect of pomegranate extract on anxiety induction (i.e., learned anxiety) in mice in response to contextual recognition. Training and testing took place in a rodent conditioning chamber (20 x 20x 28 cm), placed into a plexiglass box and illuminated by a 20-W bulb. The side walls of the conditioning chamber were constructed of white methacrylate, and the door and the top cover were 30 constructed of plexiglass. The floor consisted of 20 steel rods through which a scrambled shock from a shock generator could be delivered. Ventilation fans provided a background noise of 68 dB (whole system: Panlab, S.L., Barcelona, Spain). Fear conditioning to the context was performed during the third week of the chronic stress protocol in the stressed 2024204908   17 Jul 2024 group. On the day of fear conditioning, mice were transported from the colony room to the adjacent behavioral laboratory and placed in the conditioning chamber. Training consisted of exposure of the mice to a conditioning context for 3 min followed by three electric footshocks (2 sec, 0.4 mA) delivered after every min. After the last foot-shock the animal 5 stayed for 30 s in the chamber. The fear conditioning chamber was thoroughly cleaned with 0.5% acetic acid before each mouse was placed into the box. To determine the effect of chronic stress and the various doses of pomegranate extract on the level of anxiety induced by this contextual memory, the level of anxiety-induced behavior in response to this context was measured. The following behavioral responses, known to be sensitive to 10 levels of anxiety, were examined: % freezing, % rearing, and % grooming. These behavioral measurements were performed 48 h later after re-exposing the mice to the conditioning context for 8 min. After training and testing sessions, animals were immediately returned to their home cages. Animals’ behavior was recorded and later scored with in-house-made behavior observation software by an observer blind to the 75 treatment of the animals. Freezing, defined as a lack of movement except for heart beat and respiration, was scored and used as an index of anxiety. Freezing time was transformed to percentage freezing levels. Pomegranate extract showed a dose-dependent response, with a significant reduction in the % freezing at the highest dose (FIG. 28), indicating a protection against 20 anxiety. Similar reduction in anxiety behavior is seen in rearing, with a significant and dose dependent protection of the rearing behavior upon administration of pomegranate extract (FIG. 29). Completing these observations is the strong suppression of anxiety-induced inhibition of grooming by the highest dose of pomegranate extract (FIG. 30). These results demonstrate that the pomegranate extract and compounds reduced experience- 25 induced anxiety in mice. This decrease in experience-induced anxiety in chronically stressed mice was also observed for urolithin A, a metabolite of punicalagin. In this study, levels of anxiety were measured by the extinction of memory of the adverse context provided in the contextual fear assay described above. In this study the mice that have undergone training using the 30 contextual fear paradigm are exposed to this context daily for four days but in the absence of any adverse stimulus. The ability to recognize the context is measured by freezing during a period of 3 minutes of observation. Increased levels of anxiety have been shown to lead to a longer period for extinction for the memory of an adverse context. As shown in 2024204908   17 Jul 2024 FIG. 31, mice that have undergone chronic stress showed a slower period of extinction than normal mice. However, upon treatment with urolithin A at a dose of 25 mg / kg / d, mice that had undergone chronic stress showed a significant improvement in adverse memory extinction, demonstrating that urolithin A, like punicalagin, is able to reduce anxiety in 5 mice that have undergone chronic stress. Morris Water Maze Spatial memory and learning is affected by chronic stress. The Morris water maze apparatus consisted of a large white circular pool (140 cm diameter) filled with opaque colored water (25 °C + / - 1 °C) and with a platform (10 x 10 cm2) submerged 1 cm under the 10 water surface. The water maze is surrounded by gray curtains (25 cm from the pool periphery) containing several prominent visual cues. Before testing the mouse is trained to learn the location of the platform. Utilizing the prominent visual cues, the mouse learns to locate the platform. The learning phase begins with a habituation phase in which mice are introduced to the room, apparatus, and the water by giving them a 2-min free swim trial 75 with no platform present. Data is collected using a video camera fixed to the ceiling, connected to a video tracking system (Ethovision 3.0, Noldus, Wageningen, Netherlands). Following a habituation session (day 0), mice were submitted to different protocols to sequentially assess their spatial learning abilities (days 1-3). Spatial learning sessions were conducted on three consecutive days (days 1-3), performing four trials per day with 20 an inter-trial interval (ITI) of 6 min between each trial. Each trial started by introducing the mouse into the maze with the aid of a cup, facing the pool wall, and at one of four possible positions that were randomly balanced between trials and days. The distance between the mouse and the platform was measured at each sampling time, with 25 sampling times collected per second. These distances were 25 then summed for the 60 second period, to give a measurement of the distance to platform (cm) for each trial. If a mouse did not find the platform within 60 sec, it was gently guided toward it. Each mouse had to remain on the platform for 20 sec before it was returned into its waiting cage. The results of this example demonstrated that chronic stress had a significant 30 negative impact on learning and spatial memory. During the training session there was a significant increase in the distance travelled to reach the platform compared with nonstressed control, showing that chronic stress impairs the normal memory forming during learning (FIG. 32). Treatment of mice with pomegranate extract was able to protect against 2024204908   17 Jul 2024 these negative effects of chronic stress on learning and associated memory. A dosedependent effect was observed in mice receiving the pomegranate extract, and treated, chronically stressed mice were able to perform at the same levels of non-stressed controls (FIG. 33). 5          A similar effect was observed for mice treated with urolithin A, as shown in FIG. 34. Mice having undergone the chronic stress protocol showed erratic learning, as evidenced by the high variability between sequential trials. Treatment of chronically stressed mice with urolithin A at a dose of 25 mg / kg / d showed a stabilization of this variability. This highlights the fact that urolithin A, a downstream metabolite of 10 punicalagin, is also able to protect against these negative effects of chronic stress on cognition, including learning and memory. In summary, these results together demonstrate that pomegranate extract and derived compounds such as urolithin A are able to act to reduce the negative impacts of chronic stress on cognition, including memory and learning. Additionally, the pomegranate 75 extract and derived compounds have anti-depressive activity as seen in the tail suspension test, and decrease anxiety caused by chronic stress. The results also demonstrate that pomegranate extract prevents the deterioration of memory and learning performance and spatial recognition normally observed following chronic stress. Example 16 20                  Effect on Memory and Cognition in the Aged Rat Model During aging there are several effects on cognition and memory, which can be recapitulated in the rat model of aging. For a review see Gallagher and Rapp (1977) Annu Rev Psychol. 48:339-70. The aged rat model has been extensively used to characterize the effects of aging on memory and cognition. In the experiments presented here, improved 25 performance was observed in the presence of pomegranate extract. Aged Sprague-Dawley rats (beginning at 19 months old) received pomegranate extract (1108) in their drinking water, at a concentration of 0.34 mg / mL polyphenols (PPE). Polyphenols content were measured using the Folin-Ciocalteu spectrophotometric method, with the phenolic content expressed as gallic acid equivalents. Control treatment consisted 30 of 1.36% sucrose, 0.12% D-glucose, and 0.12% D-fructose dissolved in water. The rats on average consumed 30 mL / day of both the control and 1108 treatments (see Table 6), with an average weight of 660 g / rat. This resulted in a dose of 15 mg PPE / kg / d or 1.1 mg punicalagin / kg / d for animals receiving the 1108 extract. 2024204908   17 Jul 2024 Table 6. Pomegranate liquid extract. Extract 1108 Polyphenols dose delivered 15 mg / kg / d Punicalagin dose delivered 1.11 mg / kg / d After 2.5 months of treatment, short term working memory was evaluated using a 5 social recognition task, a standard test involving social cognition. Thor and Halloway (1981) Animal Learning Behavior. 9:561-5. In this task, each aged rat was placed in its home cage together with a juvenile male Sprague-Dawley rat (<5 weeks old) for 5 minutes. Thirty minutes later, the same exact procedure was repeated with the same juvenile to determine a second time the degree of interaction between the two animals. Less contact is 10 expected in the second interaction, as the two animals have had a previous interaction. This decrease in contact between the animals is a measure of cognitive performance and memory retention. Thirty minutes later, a novel juvenile rat was placed for 5 minutes together with the aged rat, in order to measure whether the animal can discriminate between the two different juvenile individuals. During each period of contact between the two animals, the 75   total time of contact was measured to assess the intensity of social interaction. Results are shown in FIG. 35. Control-treated aged animals showed no preference for the familiar object and spent equal time exploring both objects, an effect that has been previously shown in aged rats and thought to reflect a decline in temporal order memory during aging. Hauser et al. (2009) Behav Neurosci. 123:1339-45. However, rats treated 20 with extract 1108 showed a decrease in the time spent with the same juvenile during the second exposure period, as well as an increase in the time of interaction with a novel juvenile rat. This observed difference illustrates the protective benefit of extract 1108 on memory development and retention. Example 17 25                       Effect on Spatial Memory in Aged Rat Model Spatial memory also has been reported to be affected by aging, with a decline in performance resulting from aging. Bergado et al. (e-pub October 29, 2010) Spatial and emotional memory in aged rats: a behavioral analysis. Neuroscience. To examine the effects of pomegranate extract on spatial memory decline during aging, aged Sprague- 2024204908   17 Jul 2024 Dawley rats (beginning at 19 months old) were treated with pomegranate extract 1108 or control in their drinking water as described for Example 16. Aged rats were treated with the extract 1108 or an isocaloric control for three months, after which their learning and memory performance were evaluated using the 5 Morris water maze task, described in Example 15. The learning abilities of each animal were evaluated through their performance on the reversal task (three trials). In this task the animals were first taught the location of the platform in quadrant (WEST) through three training trials. The location of the platform is then changed and it is placed in the opposite quadrant (EAST). The animals underwent 10 three new training sessions to learn the new location of the platform. The effort to determine the new location of the platform, as measured by the distance traveled before locating the platform, was measured. Results are shown in FIG. 36. Animals treated with the extract were significantly more efficient at localizing the platform in the reversal test (one-way ANOVA, P < 0.02; control N=11; PJ: N=13; extract: N=14), demonstrating a 75 therapeutic benefit of the administered extract for this aspect of spatial memory. Example 18 Effects of Pomegranate-Derived Compounds on Spatial and Working Memory in Alzheimer’s Disease Alzheimer’s Disease (AD) has been shown to have detrimental effects on spatial 20 memory, an effect that is also observed in AD mouse models of the disease. To determine the effects of pomegranate-derived compounds on ameliorating spatial and working memory in AD, various pomegranate extracts and punicalagin were tested in two behavioral assays of spatial memory, the Y maze and the Morris water maze. Y Maze 25         In this study, the 5XFAD mouse model of AD was utilized. The 5XFAD mouse model for Alzheimer’s disease is based on genetic modifications (introduction of the mutated human APP and PSI genes) leading to the production of amyloid 0 peptide (A0) in brain tissue. These mice were found to have a significant decline in cognitive performance in the Y maze as early as 7 months of age. 30          To determine the effect of pomegranate-derived compounds, a pomegranate extract (PE) derived from whole pomegranate was delivered by gavage at a dose of 60 mg / kg / d of polyphenols, which includes approximately 5.6 mg / kg / d of punicalagin. Mice were gavaged 3 times weekly beginning at 3 months of age until the end of treatment. Mice were 2024204908   17 Jul 2024 tested after 7 months of age for the effects of PE on working memory on the Y maze. Mice were placed in the Y maze for 15 minutes and were allowed to explore two arms, the third arm being closed. Four hours later, the animal was placed again in the maze for five minutes, this time with the third arm open, allowing the mouse to have the possibility to 5 explore freely all three arms. Exploration activity in the novel arm assessed the ability of the animal to recognize that this particular zone has not been explored yet, according to spatial clues. Mice were scored as making a correct alteration during exploration if they explored each of the three arms, and not just the first two presented. As shown in FIG. 37, a significant improvement in working memory performance, 10 as measured by the number of correct alterations, was observed in 5XFAD mice treated with PE. Morris Water Maze The pomegranate extracts 31008, 61109 and 71109 were tested in a second transgenic animal model of Alzheimer’s disease expressing both the amyloid mutant 75 London mutations and the prenisilin-1 human mutation. Animals in this model develop plaques by 4 months of age and memory deficits by 6 months. Dense plaque load is visible after 7 months. In one set of experiments, four-month-old APP-PS1 transgenic mice were fed with a fixed dose of approximately 97 mg total polyphenols / kg / day, which includes approximately 20   15 mg / kg / d of punicalagin of the extract 31008, which was derived from whole pomegranate, via their drinking water. In one set of experiments, four-month-old APP-PS1 transgenic mice were fed with a fixed dose of approximately 468 mg total mg / kg / day of the extract 61109, which was highly enriched for punicalagin (>91%), via drinking water. In one set of experiments, four-month-old APP-PS1 transgenic mice were fed with a fixed 25   dose of approximately 180 mg total polyphenols / kg / day of the extract 71109, which was derived from pomegranate husk, via drinking water. After 3 months of feeding, the mice (then 7 months old) were tested in the Morris water maze spatial test. The Morris water maze was performed during days 84-87 of treatment. The pool (a white, circular vessel 1 m in diameter) contained water at 20 °C with titanium-dioxide as an 30 odorless, nontoxic additive to hide the escape platform (1 cm beneath the water level). Swimming of each mouse was videotaped and analyzed (Ethovision, Noldus information Technology, Wageningen, Netherlands). Prior to training, each mouse was placed on top of the platform for 15 seconds. For place navigation tests, mice were trained to locate the 2024204908   17 Jul 2024 hidden platform in five blocks of three trials over three consecutive days. Each trial consists of a forced swim test of maximum 120 seconds, followed by 60 seconds of rest. The time each mouse needed to locate the platform was measured during the five consecutive blocks of training to determine a learning curve for each mouse. 5          Twenty-four hours after the final training, each animal underwent a probe trial with the platform removed. Mice were allowed to search for the missing platform for 60 seconds and the search time spent in each quadrant of the pool, as well as the number of crossings of the original platform position was measured. As shown in FIG. 38, the mice fed with Extract 31008 showed an increase performance in the probe test as demonstrated 10 by the increased frequency of crossings of the area were the platform was formally located. Mice fed with extracts 61109 and 71109 had even better performance. The compositions of the extracts 61109 used in this experiment are shown in Table 7. 75 Table 7. Extract 61109 Punicalagin 91.3 % (w / w) Punicalagin dose delivered 295 mg / kg / d Example 19 Effects of Pomegranate-Derived Compounds on Depression, Anxiety and Cognition in Response to Early-Life Stress 20          Pomegranate-derived compounds were assessed for their ability to improve brain functions, including cognition, depression and anxiety, in an early-life stress model associated with maternal separation. Early life stress has a significant impact on cognitive performance in later adult life, including (i) increasing abnormal decision making and excessive risk-taking; (ii) 25 susceptibility to increased rates of depression and anxiety; and (iii) impaired learning and memory. All procedures carried out were performed in accordance with the Swiss National Institutional Guidelines on Animal Experimentation and were approved by the Swiss Cantonal Veterinary Office Committee for Animal Experimentation. 2024204908   17 Jul 2024 Early life stress produced by maternal separation At postnatal day 1, pups were culled to have 6 pups per mother. From postnatal day 1 to 14, unpredictable maternal separation (MS) of a period of 3 hours daily was carried out. Maternal separation was performed at random times (from 8 am to 2 pm) to avoid the 5 habituation of the mother to the procedure. The protocol consisted of removing pups from their mother to another cage at room temperature for a 3 hour period, after which the pups were returned to their original nest. These groups are denoted as early-life stress in the figures. A control group of dam / pups was left undisturbed and is denoted in the figures as normal. 10 Treatment with punicalagin isolated from the pomegranate One week after maternal separation mice were separated into two groups. One control group received the standard mouse chow diet (Untreated), while the other group received the ellagitannin punicalagin admixed into the food and designed to deliver a dose of 90 mg / kg / day to the mice. Treatment with the diet began 1 week after the termination of 75 the maternal separation treatment. Behavioral Assays The effects of early-life stress on depression, anxiety and cognition were examined utilizing the following behavioral assays which were carried out 166 days after the completion of the maternal separation protocol. Normally raised mice were compared 20 versus maternally separated mice (early-life stress) and maternally separated mice treated with punicalagin. Dark / Light Box Test In this assay mice are placed in a PVC box which is separated into two compartments: a dark compartment (15 x 20 x 25 cm, black PVC, and covered above) and a 25 lit compartment (30 x 20 x 25 cm, white PVC and illuminated at 200 lux), both linked by an interconnecting door (5x5 cm) (Ligna, Paris, France). The experiment is started by placing the animal in the dark compartment, after which a camera records for a 5 minute period the amount of time the mouse spends in the lit area, the number of transitions from the dark to lit area, and the latency to escape from dark to lit area. 30          Normally, mice will avoid the illuminated area in the box. Maternally separated mice spent an abnormally long time in the illuminated compartment as compared to their non-matemally separated littermates as a consequence of their early-life stress (FIG. 39). 2024204908   17 Jul 2024 This increase in time spent exploring the lit area reflects an impaired decision-making behavior characterized by abnormal and excessive risk-taking. Punicalagin treatment of maternally separated mice reversed and normalized the excessive risk-taking behavior observed and restored the decision making process to normal 5 (FIG. 39). Elevated O-Maze (EOM) Another behavioral assay that measures abnormal risk taking is the elevated O maze (EOM). In this assay an apparatus consisting of a ring with a diameter of 41.5 / 46.5 cm (intemal / extemal diameter) is divided into four equal parts. Two parts of the ring, opposite 10 each other, are enclosed by walls that are 5 cm high. The remaining two parts of the ring have no walls. The maze is elevated 1 m above the floor. The natural tendency of mice is to avoid open surfaces and spend more time in the enclosed regions of the ring that have the 5 cm walls, as opposed to the open regions of the ring. To examine the effect of early life stress, mice were placed at the entrance of one of 75   the areas of the maze with the 5 cm walls, with the nose facing the closed arm, and were allowed to explore the EOM for 5 min. During this period animal behavior was videotaped. The time spent in each arm (closed versus open) was calculated, with an entry into the arm only being considered to have occurred when the animal placed all four paws in the arm. Normally, mice placed in the elevated O-maze will avoid the open regions of the 20 ring and spend limited time exploring this area. Mice stressed by maternal separation spent an abnormally long time in the open sections of the O-maze as compared to their nonstressed littermates (FIG. 40). As also observed in the dark / light box test, this reflects an impaired decision-making behavior in early-life stressed mice which is characterized by abnormal and excessive risk-taking. 25          Punicalagin treatment of maternally separated mice reversed and normalized their abnormal excessive risk taking behaviour due to early-life stress (FIG. 40). Forced Swim Test The Porsolt or Forced Swim Test is commonly used to test antidepressant treatments (Porsolt et al., 1977a; Porsolt et al., 1977b). For this behavioral test, a mouse is placed in a 30 5L cylinder (11 cm diameter and 25 cm height) filled two-thirds full with water at 23 °C. Animals were considered to be engaged in swimming and mobile if there was a clear displacement of the body. Animals floating with minimal movement during the analysis period were considered to be immobile. Animal behavior was recorded over a 6-minute 2024204908   17 Jul 2024 test period using a camera and a mirror behind the cylinder. The first 2 minutes and the last 4 minutes of the swimming were analyzed separately for mouse swimming activity. Increasing level of depression is correlated to an increase in mouse immobility, particularly during the last 4 minutes. Animals that have undergone early-life stress showed a 5 significant increase in immobility as compared to their non-stressed littermates, indicating an elevated level of depression (FIG. 41). Punicalagin treatment of early-life stressed mice reversed this abnormal behavior (increased immobility) and increased swimming activity to levels seen in non-stressed mice. This behavioral effect of punicalagin demonstrates its activity as an anti-depressant (FIG. 41). 10 Contextual Fear Conditioning Contextual fear conditioning was used to determine the effects of the ellagitannin punicalagin on the susceptibility of adult animals, subjected to early life stress, to anxiety. Animals were trained in a fear conditioning chamber (Context A, W x L x H: 30 cm x 24 cm x 26 cm) (PanLab) that contained a grid floor with stainless steel rods and was 75 connected to a shock generator developed by Panlab. During training, animals were placed into the chamber one at a time. After four minutes of exploration inside the chamber, one foot shock (2 seconds and 0.4 mA) was administered, followed by a second foot shock (2 seconds and 0.4 mA) one minute later. Thirty seconds after the second foot shock, the mouse was placed back into its home cage. Animal behavior was monitored every 2 20 seconds throughout the duration of the experiment. The period that mice spent immobile in the chamber was considered as “freezing” and was scored throughout these periods. The time the mice spent immobile after the first shock was recorded for a 60 second period and expressed as a percentage. The behavior of mice to rest immobile and “freeze” in response to a foot shock is a 25 measure of their level of anxiety. The longer the duration the “freezing” lasts during this behavioral test, the higher the animals’ level of anxiety. Differences in freezing between the groups tested (normal non-stressed, early-life stress, and early-life stress + punicalagin) were observed after the first shock (FIG. 42). Early-life stress led to increased anxiety in mice as evidenced by the increased time spent 30 freezing following the foot shock, as compared to their non-stressed littermates (FIG. 42). Punicalagin treatment decreased and normalized these elevated anxiety levels resulting from early-life stress, as shown by a reduced freezing time following the foot shock (FIG. 2024204908   17 Jul 2024 42). These observations in the early-stress model illustrate the anxiolytic effects of punicalagin. The increased anxiety experienced by animals exposed to early life stress is also observed in the extinction (i.e., disappearance) of the contextual memory (i.e., the memory 5 associating the context of the environment to the shock) induced by this assay. To examine the strength of the anxiety developed during the contextual fear conditioning (as described above), animals were placed into the same chamber and context for 3 min daily (same time of day, however no shock this time) for the 12 days that followed the initial testing. Freezing behavior induced by the simple recognition by the animals of the chamber, where 10 they received the initial shock, was measured during each of these daily 3-minute periods. Animal groups (normal non-stressed, early-life stress, and early-life stress + punicalagin) showed differences in the decline of their contextual recall of the shock over the subsequent 12 days (FIG. 43). In this graph, the duration of freezing is presented as the percent of time spent immobile on day 1 (for example, if a mouse was immobile for 60 15 seconds on day 1 and 30 seconds on day 8, percent immobility is 100% on day 1 and is 50% on day 8). Normal, non-stressed mice showed a predictable decline in contextual recall during the 12 day period (FIG. 43). Early-life stressed mice had a heightened contextual recall, which is illustrated by a higher level of freezing than their non-stressed littermates (FIG. 20   43). This shows a prolonged elevated level of anxiety in these maternally separated mice. Punicalagin treatment of early-life stressed mice had a clear impact on reducing anxiety as seen by the extinction of the contextual recall. Treated early-life stressed mice showed a faster extinction than untreated early-life stressed mice, characterized by reduced period of time spent freezing between days 8 and 12 (FIG. 43). 25 Rotarod To measure the effects of pomegranate-derived compounds on the negative cognitive impacts of maternal separation, effects on motor learning were assayed using the rotarod behavioral assay. The rotarod apparatus consists of a rod of 2 cm diameter. A mouse is placed on a rotating rod which is started at an initial speed of 5 rpm. The rod 30 speed is gradually accelerated at a rate of 8 rpm / min until reaching a speed of 45 rpm. The latency to fall was measured with a cutoff time of 300 sec. As shown in FIG. 44, mice that have undergone early-life stress suffered from impaired motor learning. Maternally separated mice fell off the rotarod faster than normal non-stressed mice. Treatment with 2024204908   17 Jul 2024 punicalagin restored motor learning skills in early-life stressed animals to performance levels observed in normal non-stressed littermates. Morris Water Maze The Morris water maze behavioral assay was employed to assess the cognitive 5 impact of maternal separation. In this assay, cognitive learning is measured by the ability of a mouse to locate a hidden platform in a pool of opaque water. The apparatus consists of a pool (140 cm diameter) filled with water at 22 °C. Mice escape from the water by swimming to a hidden circular platform (15 cm diameter) placed 1 cm under the surface of the water. By using visual cues located outside of the maze, mice are able to locate the 10 platform and recall its location during subsequent trials. During the training phase, mice were placed at two starting positions (alternating) every hour. The Morris water maze task was performed with 8 trials at Tl, 6 trials at T2, and 4 trials at T3 (on days 1, 2 and 3). Mice had a maximum of 60 sec to reach the platform. Escape latency to reach the platform was measured by a video tracking system. As can be observed in FIG. 45, early-life stress 75 had a significant impact on cognitive learning, with mice taking a longer period of time to learn the location of the hidden platform, as shown by the increased escape latency versus normal non-stressed mice. Treatment of these maternally-separated mice with punicalagin reversed this negative impact of early-life stress, reducing the time to learn the location of the hidden platform to levels observed in normal non-stressed mice. These results 20 demonstrate the ability of punicalagin to reverse the long-term negative cognitive impacts of early-life stress on learning and memory formation. Pomegranate-Derived Compounds Taken together the data above demonstrate that compounds derived from ellagitannins are able to reverse to long-term negative impact of early-life separation on 25 depression, anxiety, and cognition. Example 20 Effects of Pomegranate-Derived Compounds on Memory and Cognition in Normal Mice Treatment with Pomegranate-Derived Compounds Beginning at 3 months of age, mice were either fed (i) a standard control diet such 30 as AIN-93G; (ii) a diet containing punicalagin at a concentration of 0.87 mg / kg, so as to deliver an approximate dose of 90 mg / kg / day (for a period of 3 months); or (iii) a diet containing urolithin A at a concentration of 0.57 mg / kg, so as to deliver an approximate dose of 55 mg / kg / day (for a period of 2.5 months). Actual doses vary slightly depending 2024204908   17 Jul 2024 on the food consumption of each individual mouse, as well as the weight of the mouse. Behavioral assessment of cognition was measured after this period. Behavioral assay to measure effects of pomegranate-derived compounds on cognition To examine the effect of pomegranate-derived compounds on memory and 5 cognition, mice were examined for improvements in contextual memory utilizing the contextual fear conditioning assay. Mice were trained in a fear conditioning chamber as described in Example 19. During training, animals were placed into the chamber one at a time. After four minutes of exploration inside the chamber, one foot shock (2 seconds and 0.4 mA) was 10 administered, followed by a second foot shock (2 seconds and 0.4 mA) one minute later. Thirty seconds after the second foot shock, the mouse was placed back into its home cage. One day later, trained animals were returned to the chamber for a period of three minutes. During this period mice were monitored for their movement. The amount of time spent immobile or “frozen” was scored as a percentage of the total time (3 minutes) under 15 observation. The time spent immobile is a measure of the strength of the memory of the mice to recall the context in which they were trained. Treatment with both the pomegranate-derived ellagitannin punicalagin and the ellagic acid metabolite urolithin A led to significant improvements in contextual memory over untreated control mice as determined by their contextual memory 24 hours following the training period (FIG. 46). 20         To determine the effect of these pomegranate-derived compounds on memory retention, normal mice fed either (i) a control diet; (ii) punicalagin (for a period of 3 months) or (iii) urolithin A (for a period of 2.5 months) were studied for their memory recall on days 1, 2, 3, 4 and 5 after the initial contextual fear training. Animals were placed in the same chamber and context for 3 min daily (same time of 25 day, however no shock this time) for the 5 days that followed the initial testing. Freezing behavior induced by the simple contextual recognition by the animals of the chamber, where they received the initial shock, was measured during each of these daily 3-minute periods. The ability to recognize this environment in the absence of the stimulus is a measurement of contextual memory. 30          With each passing day control untreated mice begin to have an extinction of their memory for this contextual stimulus, as evidenced by a decrease in extent of freezing (FIG. 47). Mice treated with either punicalagin or urolithin A demonstrated an improved memory retention as compared to control, untreated mice. This is illustrated by an ability to 2024204908   17 Jul 2024 remember the initial context for a longer period, evidenced by a significantly longer period for the extinction of the contextual memory (FIG. 47). These results demonstrate that treatment with either punicalagin or urolithin A lead to improved cognition, as evidenced by a significant increase in context recognition and 5 improved memory retention. Example 21 Effects of Pomegranate-Derived Compounds on Improving Muscle Performance in Normal Mice Ellagitannin-derived compounds punicalagin and urolithin A were evaluated for 10 their ability to improve muscle performance. To examine the benefits of punicalagin and urolithin A on improving muscle performance, their effects were examined using two behavioral assays: (i) the rotarod assay, which measures muscle performance and motor skills, including coordination, and (ii) the treadmill endurance test, which measures muscle performance and endurance. 75   Behavioral Assays to Measure the Effects of Pomegranate-Derived Compounds on Muscle Performance Rotarod Assay Beginning at 3 months of age, mice were fed either a standard control diet such as AIN-93G or a diet containing punicalagin to deliver a dose of 90 mg / kg / day for a period of 20   3 months. To examine the effect of pomegranate derived compounds on muscle performance and motor skills, mice were tested on the rotarod behavioral assay. The rotarod apparatus consists of a rod with a diameter of 2 cm with 5 compartments, 5 cm wide. A mouse is placed on a rotating rod which is started at an initial speed of 5 rpm. The rod speed is 25 gradually accelerated at a rate of 8 rpm / min. The latency to fall was measured with a cutoff time of 300 seconds. Mice were tested for four trials. The latency to fall is a measure of the muscle performance and motor skills of the mice, with a better performance reflected by a longer latency to fall. Both control untreated and punicalagin-treated mice were tested. The ellagitannin punicalagin was able to significantly improve muscle performance and 30 motor skills as compared to untreated mice. Punicaligin-treated mice were able to remain on the rotarod for a longer time and at higher speeds compared to untreated mice during sequential trial periods (FIG. 48). Endurance Test 2024204908   17 Jul 2024 Normal 8-week-old mice were acclimated for 2 weeks prior to the start of the study. Mice were fed with a standard rodent diet (chow diet) or a diet containing urolithin A mixed with the food to reach a dosing of 55 mg / kg / day delivered to the mice. Following 6 weeks of treatment, mice were tested for their muscle performance by means of an 5 endurance test. An endurance test was performed using a variable speed belt treadmill enclosed in a plexiglass chamber with a stimulus device consisting of a shock grid attached to the rear of the belt (Panlab, Barcelona, Spain). Mice were run at 10 cm / sec and a 0° of incline for 5 min. Speed was then incremented by 2cm / sec every 5 min, until mice were exhausted. The 10 distance run and the number of shocks obtained over 5 min intervals were recorded. Mice were considered exhausted and removed from the experiment when they received approximately 20 shocks in a period of 1 min. Control untreated and urolithin A-treated mice were tested and compared for their performance. Improved muscle performance and endurance is reflected by an ability to run at 75 higher speeds on the treadmill. Mice will seek to avoid the shock and will run despite the increasing speed. At a certain point the mice are unable to keep up with the treadmill speed and are shocked. After reaching the threshold levels of shocks, mice are removed from the treadmill. Mice having better muscle performance and improved endurance will be able to keep up with the increasing speed of the treadmill and will experience fewer shocks at a 20 particular speed. Urolithin A-treated mice ran at higher speeds than untreated control mice in this behavioral assay, illustrating that urolithin A improved muscle performance and endurance in this context (FIG. 49). These results demonstrate that the ellagitannin punicalagin and its metabolite urolithin A are able to improve muscle performance and motor skills in mammals. 25 EQUIVALENTS The invention has been described broadly and generically herein. Those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages 30 described herein, and each of such variations and / or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or 2024204908   17 Jul 2024 configurations will depend upon the specific application or applications for which the teachings of the present invention is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood 5 that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, 10 and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the scope of the present invention. Further, each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of 15 whether or not the excised material is specifically recited herein. INCORPORATION BY REFERENCE The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby 20 incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right physically to incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents. 25 References Cited Bai, N., K. He, et al. (2008). "Active compounds from Lagerstroemia speciosa, insulin-like glucose uptake-stimulatory / inhibitory and adipocyte differentiation-inhibitory activities in 3T3-L1 cells." J Agric Food Chem 56(24): 11668-74. 30 Bishop, N. A., T. Lu, et al. (2010). "Neural mechanisms of ageing and cognitive decline." Nature 464(7288): 529-35. 2024204908   17 Jul 2024 Bloss, E. B., W. G. Janssen, et al. (2010). "Interactive effects of stress and aging on structural plasticity in the prefrontal cortex." JNeurosci 30(19): 6726-31. Bowman, R. E., K. D. Beck, et al. (2003). "Chronic stress effects on memory: sex differences in performance and monoaminergic activity." Horm Behav 43(1): 48-59. 5 Cerda, B., J. C. Espin, et al. (2004). "The potent in vitro antioxidant ellagitannins from pomegranate juice are metabolised into bioavailable but poor antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by the colonic micro flora of healthy humans." EurJNutr 43(4): 205-20. Cerda, B., P. Periago, et al. (2005). "Identification of urolithin a as a metabolite produced 10          by human colon micro flora from ellagic acid and related compounds." J Agric Food Chem 53(14): 5571-6. De Souza Schmidt Goncalves, A. E., F. M. Lajolo, et al. "Chemical composition and antioxidant / antidiabetic potential of Brazilian native fruits and commercial frozen pulps." J Agric Food Chem 58(8): 4666-74. 75 Del Pozo-Insfran, D., C. H. Brenes, et al. (2004). "Phytochemical composition and pigment stability of Acai (Euterpe oleracea Mart.)." J Agric Food Chem 52(6): 1539-45. Dumitriu, D., J. Hao, et al. (2010). "Selective changes in thin spine density and morphology in monkey prefrontal cortex correlate with aging-related cognitive impairment." J Neurosci 30(22): 7507-15. 20 Gasperotti, M., D. Masuero, et al. "Profiling and accurate quantification of Rubus ellagitannins and ellagic acid conjugates using direct UPLC-Q-TOF HDMS and HPLC-DAD analysis." J Agric Food Chem 58(8): 4602-16. Gil, M. I., F. A. Tomas-Barberan, et al. (2000). "Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing." J Agric Food Chem 25          48(10): 4581-9. Greene, L. A. and A. S. Tischler (1976). "Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor." Proc Natl AcadSci USA 73(7): 2424-8. Gunning, P. W., G. E. Landreth, et al. (1981). "Differential and synergistic actions of nerve 30          growth factor and cyclic AMP in PC 12 cells." J Cell Biol 89(2): 240-5. 2024204908   17 Jul 2024 Harper, M. E., K. Green, et al. (2008). "The efficiency of cellular energy transduction and its implications for obesity." Annu Rev Nutr 28: 13-33. Hebert, L. E., P. A. Scherr, et al. (2003). "Alzheimer disease in the US population: prevalence estimates using the 2000 census." Arch Neurol 60(8): 1119-22. 5 Joels, M., Z. Pu, et al. (2006). "Learning under stress: how does it work?" Trends Cogn Sci 10(4): 152-8. Joseph, J. A., B. Shukitt-Hale, et al. (2005). "Reversing the deleterious effects of aging on neuronal communication and behavior: beneficial properties of fruit polyphenolic compounds." Am J Clin Nutr 81(1 Suppl): 313S-316S. 10 Kujoth, G. C., A. Hiona, et al. (2005). "Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging." Science 309(5733): 481-4. Lee, J. H., J. V. Johnson, et al. (2005). "Identification of ellagic acid conjugates and other polyphenolics in muscadine grapes by HPLC-ESI-MS." J Agric Food Chem 53(15): 6003-10. 75 Maier, S. F. and L. R. Watkins (2005). "Stressor controllability and learned helplessness: the roles of the dorsal raphe nucleus, serotonin, and corticotropin-releasing factor." Neurosci Biobehav Rev 29(4-5): 829-41. Puech, J. L., C. Mertz, et al. (1999). "Evolution of castalagin and vescalagin in ethanol solutions. Identification of new derivatives." J Agric Food Chem 47(5): 2060-6. 20 Pinnock, S. B. and J. Herbert (2001). "Corticosterone differentially modulates expression of corticotropin releasing factor and arginine vasopressin mRNA in the hypothalamic paraventricular nucleus following either acute or repeated restraint stress." Eur J Neurosci 13(3): 576-84. Rea, S. L., N. Ventura, et al. (2007). "Relationship between mitochondrial electron 25          transport chain dysfunction, development, and life extension in Caenorhabditis elegans." PLoSBiol 5(10): e259. Roozendaal, B. (2003). "Systems mediating acute glucocorticoid effects on memory consolidation and retrieval." Prog Neuropsychopharmacol Biol Psychiatry 27(8): 1213-23. 2024204908   17 Jul 2024 Rozovsky, I., M. Wei, et al. (2005). "Reversible age impairments in neurite outgrowth by manipulations of astrocytic GFAP." Neurobiol Aging 26(5): 705-15. Sandi, C. (2004). "Stress, cognitive impairment and cell adhesion molecules." Nat Rev Neurosci 5(12): 917-30. 5 Sandi, C. and M. Loscertales (1999). "Opposite effects on NCAM expression in the rat frontal cortex induced by acute vs. chronic corticosterone treatments." Brain Res 828(1-2): 127-34. Sandi, C. and M. T. Pinelo-Nava (2007). "Stress and memory: behavioral effects and neurobiological mechanisms." Neural Plast 2007: 78970. 10 Satomi, H., K. Umemura, et al. (1993). "Carbonic anhydrase inhibitors from the pericarps of Punica granatum L." Biol Pharm Bull 16(8): 787-90. Schriner, S. E., N. J. Linford, et al. (2005). "Extension of murine life span by overexpression of catalase targeted to mitochondria." Science 308(5730): 1909-11. Shors, T. J. (2004). "Learning during stressful times." Learn Mem 11(2): 137-44. 75 Tanaka, K., G. Nonaka, et al. (1986). "Tannins and Related Compounds. XLI. 1) Isolation and Charactherization of Novel Ellagitannins, Punicacorteins A, B, C, and Punigluconin from the brak of Punica granatum L." Chern. Pharm. Bull 34(2): 656663. Tanaka, K., G. Nonaka, et al. (1986). "Tannins and Related Compounds. XLI. 1) Isolation 20          and Charactherization of Novel Ellagitannins, Punicacorteins A, B, C, and Punigluconin from the brak of Punica granatum L." Chern. Pharm. Bull 34(2): 656663. Tanaka, K., G. Nonaka, et al. (1986). "Tannins and Related Compounds. XLI. 1). Revision of the Structures of Punicalin and Punicalagin, and Isolation and Charactherization 25          of 2-O-Galloylpunicalin from the Bark of Punica granatum L." Chern. Pharm. Bull 34(2): 650-655. Trifunovic, A., A. Wredenberg, et al. (2004). "Premature ageing in mice expressing defective mitochondrial DNA polymerase." Nature 429(6990): 417-23. Vrhovsek, U., A. Palchetti, et al. (2006). "Concentration and mean degree of 30          polymerization of Rubus ellagitannins evaluated by optimized acid methanolysis." J 2024204908   17 Jul 2024 Agric Food Chem 54(12): 4469-75.Wang, C. H., C. C. Wang, et al. (2010). "Mitochondrial dysfunction in insulin insensitivity: implication of mitochondrial role in type 2 diabetes." Ann N Y Acad Sci 1201: 157-65. Xiao, J., A. Pradhan, et al. (2006). "Functional role of JNK in neuritogenesis of PC12-N1 5           cells." Neurosci Lett 392(3): 231-4. Yang, G., F. Pan, et al. (2009). "Stably maintained dendritic spines are associated with lifelong memories." Nature 462(7275): 920-4.

Claims

1. A method of treating, preventing, or managing obesity, comprising administering toa subject in need thereof an effective amount of urolithin A.

2. A method for weight management, comprising administering to a subject in needthereof an effective amount of urolithin A.

3. The method of claim 1 or 2, wherein the effective amount of urolithin A is 300-500mg.

4. The method of claim 1 or 2, wherein the effective amount of urolithin A is 500 mg.

5. The method of claim 1 or 2, wherein the effective amount of urolithin A is 450-750mg.

6. The method of claim 1 or 2, wherein the effective amount of urolithin A is 600-1000mg.

7. The method of claim 1 or 2, wherein the effective amount of urolithin A is 1000 mg.

8. The method of any one of claims 1-7, wherein the urolithin A is administered orally.

9. The method of claim 8, wherein the urolithin A is formulated as an oral dosageform; and the oral dosage form is a capsule or a plurality of capsules.2024204908   03 Sep 202610. The method of any one of claims 1-9, wherein the subject is a human.

11. Use of urolithin A in the manufacture of an oral dosage form for treating, preventing, or managing obesity.

12. Use of urolithin A in the manufacture of an oral dosage form for weight management.

13. The use of claim 11 or 12, wherein the amount of urolithin A is 300-500 mg.

14. The use of claim 11 or 12, wherein the amount of urolithin A is 500 mg.

15. The use of claim 11 or 12, wherein the amount of urolithin A is 450-750 mg.

16. The use of claim 11 or 12, wherein the amount of urolithin A is 600-1000 mg.

17. The use of claim 13 or 14, wherein the amount of urolithin A is 1000 mg.

18. The use of any one of claims 11-17, wherein the oral dosage form is a capsule or a plurality of capsules.

Images