Genetic engineering delivery and use of tumor antigen peptide fusion protein and composition thereof

Abstract

The present invention relates to genetic engineering delivery and use of a tumor antigen peptide fusion protein and a composition thereof. A tumor antigen peptide fusion protein and a composition thereof have immunogenicity, therapeutic efficacy, and specificity.

Description

Genetically engineered delivery and application of tumor antigen peptide fusion proteins and their compositions Technical Field

[0001] The present invention belongs to the fields of biomedicine and tumor immunity, and provides genetically engineered delivery and application of tumor antigen peptide fusion proteins and compositions thereof. Background Art

[0002] Cancer vaccines can be either preventive or therapeutic. For those without cancer, vaccination can prevent tumor development by activating the immune system to kill cancer cells. For those already diagnosed with cancer, vaccination can treat cancer by activating the immune system to kill cancer cells. Vaccination is an effective measure for both cancer prevention and treatment, but therapeutic cancer vaccines face numerous obstacles in achieving their full potential, including a lack of specific tumor antigens, low antigen immunogenicity, and poor delivery efficiency.

[0003] Therapeutic cancer vaccines are based on tumor antigens, stimulating the body's immune response against cancer cells. Tumor-specific antigens are antigens unique to tumor cells, associated with the major histocompatibility complex (MHC), and can activate immune responses. Tumor-specific antigens are typically caused by acquired genetic mutations and are thought to be most prevalent in highly mutated cancers, such as melanoma and lung cancer. Through immune responses, they can precisely target cancer cells within the tumor microenvironment without causing side effects that harm normal cells. Cancer-testis antigens (CTAs), also known as cancer germline antigens, are tumor-specific antigens and include over 200 proteins expressed in germline tissues (such as the testis, ovary, and placenta). Their expression has the following characteristics: ① They are expressed at varying frequencies in various tumor tissues; ② Most CTAs are located on the X chromosome; ③ They are often present as multiple family members; and ④ CTA expression is often heterogeneous across tumor tissues of varying origin. Tumor cells establish a suppressive immune microenvironment, enabling them to evade the immune system. Therefore, these tumor antigens can be used to develop more precise and effective immunotherapies and are ideal targets for tumor immunotherapy. The prostate cancer vaccine Sipuleucel-T (trade name: Provenge, Chinese name: Puliewei) is an autologous cellular immunotherapy based on antigen-presenting cells and the first prostate cancer immunotherapy drug approved by the U.S. Food and Drug Administration (FDA). The median survival of patients treated with Sipuleucel-T was extended by 4.1 months. Although this improvement in survival is significant, a cure for cancer is still a long way off.

[0004] NAD +The protein-dependent 15-hydroxyprostaglandin dehydrogenase (HPGD) is a key enzyme in the inactivation of prostaglandins. It is widely involved in regulating multiple cellular pathways, including inflammation, differentiation, and signal transduction, and is an important target for drug intervention. Furthermore, HPGD is ubiquitously expressed in mammalian tissues and localized in the cytoplasm. It can inhibit cancer cell proliferation and induce differentiation by degrading prostaglandins (tumor-promoting molecules) in cancer cells. Furthermore, HPGD knockout or low expression can increase colon tumor susceptibility and pancreatic tumor cell expansion. This suggests that HPGD is a tumor suppressor gene and a potential target molecule for cancer control.

[0005] Poxviruses are large, complex DNA viruses, and there are numerous species. The primary human pathogens are orthopoxviruses, such as smallpox, vaccinia, cowpox, and monkeypox. Poxvirus vectors can express foreign proteins, which are closer to native structures and more stable than those expressed in bacteria or yeast. Vaccinia virus, used as a vaccine to prevent smallpox, possesses the following characteristics: ① It has a broad host range, infecting mammalian and avian cells; ② It has a large genome, allowing for the insertion of foreign protein gene fragments; ③ The virus replicates in the host cytoplasm and does not integrate with host cell genes; and ④ Some vaccinia viruses can be used to develop oncolytic viruses. Therefore, vaccinia virus is an ideal vector for expressing eukaryotic genes or foreign viral genes. Currently, the more common vaccinia viruses include Western Reserve (WR) strain, Copenhagen strain, Lister strain, Ankara strain, Modified Vaccinia Ankara strain, New York Vaccinia strain, Temple of Heaven strain, Dryvax strain, Bern strain, Paris strain, Tash Kent strain, IHD-J strain, IHD-W strain, Brighton strain, CVA382 strain, Dairen strain, LC16m8 strain, LC16M0 strain, LIVP strain, ACAM2000 strain, WR65-16 strain, Connaught strain, and EM-63 strain.

[0006] Based on the above background, the present invention aims to provide a genetically engineered delivery method and application of tumor antigen peptide fusion proteins and compositions thereof. Summary of the Invention

[0007] One aspect of the present invention provides a tumor antigen peptide fusion protein comprising a signal peptide, human 15-hydroxyprostaglandin dehydrogenase (HPGD) and optionally at least one tumor antigen peptide.

[0008] A second aspect of the present invention provides a composition comprising the tumor antigen peptide fusion protein of the present invention and a therapeutic factor. The therapeutic factor comprises a therapeutic factor fusion protein comprising the therapeutic factor and at least one selected from a signal peptide, a cell-penetrating peptide, and a signal anchor peptide, wherein the signal peptide, the cell-penetrating peptide, and / or the signal anchor peptide are located at the N-terminus or C-terminus of the therapeutic factor fusion protein.

[0009] In some embodiments, the composition comprises the tumor antigen peptide fusion protein of the present invention and an IL12p70 fusion protein, wherein the IL12p70 fusion protein comprises, from N-terminus to C-terminus: a signal peptide or signal anchor peptide, an IL12p70 protein, and an optional transmembrane peptide.

[0010] The third aspect of the present invention provides a nucleic acid construct encoding the tumor antigen peptide fusion protein of the present invention, or the composition of the present invention.

[0011] The fourth aspect of the present invention provides a genetically engineered recombinant virus comprising the nucleic acid construct of the present invention.

[0012] The fifth aspect of the present invention provides an expression system comprising a host cell and the genetically engineered recombinant virus of the present invention.

[0013] The sixth aspect of the present invention provides a pharmaceutical composition comprising the tumor antigen peptide fusion protein, composition, nucleic acid construct, or genetically engineered recombinant virus of the present invention; and a pharmaceutically acceptable carrier.

[0014] The seventh aspect of the present invention provides a method for treating or preventing tumors, which comprises administering the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus, or pharmaceutical composition of the present invention.

[0015] The eighth aspect of the present invention provides the use of a tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus, or pharmaceutical composition in the preparation of a drug for treating or preventing tumors.

[0016] A ninth aspect of the present invention provides a method for activating or enhancing immune cell function, comprising administering the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus or pharmaceutical composition of the present invention.

[0017] The tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus or pharmaceutical composition of the present invention has the following characteristics:

[0018] (1) Therapeutic: Vaccinia virus has a direct lytic effect on tumor cells and indirectly enhances anti-tumor immunity by activating inflammatory responses. It has an immunopotentiating effect on cancer patients and can activate / enhance the immune system to enter an immune response state. The expression and release of tumor antigen peptide fusion proteins induces the proliferation of tumor-related specific immune cells, while degrading prostaglandin E2, reducing inhibitory factors that inhibit tumor immunity, and enhancing the clearance of tumor cells by immune cells.

[0019] (2) Vaccine properties: It can induce the host to produce tumor immune response. First, the vaccinia virus itself can cause a strong viral immune response in the host. Secondly, while the host produces a strong immune response to the vaccinia virus, the release of tumor antigen peptide fusion protein induces a strong tumor immune response and induces the proliferation of a large number of tumor-related specific immune cells, achieving the effect of treating and preventing cancer.

[0020] (3) High specificity and low side effects: It selectively infects target cells and induces tumor-specific immune responses. The proliferated specific immune cells have no ability to recognize and attack normal cells. It has strong immunogenicity and tumor antigen specificity, few side effects, and strong safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The present invention can be more fully understood with reference to the following drawings.

[0022] Figure 1 shows a schematic diagram of a tumor antigen peptide fusion protein (A) and an IL12p70 fusion protein (B). SP represents a signal peptide, and TA peptide represents a tumor antigen peptide (TA1peptide, TA2peptide, ...TA n The peptides can be the same or different), Linker represents a linker peptide, TP represents a transmembrane peptide, and SAP represents a signal anchor peptide.

[0023] Figure 2 shows a schematic diagram of the shuttle plasmid. Figure 2A is a schematic diagram of the shuttle plasmid for secretory fusion proteins of tumor antigen peptides, wherein Figure 2Ai is a promoter-driven secretory human HPGD (sHPGD) and green fluorescent protein (GFP); Figure 2Aii is a promoter-driven secretory fusion protein of tumor antigen peptide and human HPGD (hHPGD) (secreted TA peptide + hHPGD, sTAH) and GFP; Figure 2Aiii is a promoter-driven secretory fusion protein of multiple tumor antigen peptides and human HPGD (smTAH) and GFP. Figure 2B is a shuttle plasmid of IL12p70 fusion protein, wherein Figure 2Bi is promoter-driven secreted IL12p70 (sIL12) and GFP; Figure 2Bii is promoter-driven type I membrane protein IL12p70 (mIL12I) and GFP; Figure 2Biii is promoter-driven type II membrane protein IL12p70 (mIL12II) and GFP.

[0024] Figure 3 illustrates the genetic engineering of vaccinia virus. Figure 3A is a schematic diagram of the construction of the WC strain of vaccinia virus, which uses the Western Reserve (WR) strain as a backbone and replaces the A34R gene sequence (WR A34R) of the WR strain with the A34R gene sequence (CoA34R) of the Copenhagen strain. Figure 3B compares the plaque shape of extracellular enveloped virus (EEV) and intracellular mature virus (IMV) of the WR and WC strains in CV-1 cells. Figure 3C compares the viral titer of EEV of the WR and WC strains. The data shown are the mean of three experimental results. Figure 3D shows genetic engineering modification using vaccinia virus WC strain as a vector, including modification of 6 gene sequences: sequence 1 (J2R), sequence 2 (A34R), sequences 3-5 (A44L-A45R-A46R) and sequence 6 (A52R), and also includes the knock-in of heterologous nucleic acids encoding tumor antigen peptide fusion proteins and / or therapeutic factors.

[0025] Figure 4 shows the shuttle plasmids used to construct genetically engineered recombinant viruses using the novel vaccinia virus WC strain as a vector, wherein Figure 4A is used for knocking in a heterologous nucleic acid of the Copenhagen strain A34R (CoA34R); Figure 4B is used for knocking out J2R (Figure 4Bi), A44L-A45R-A46R (Figure 4Bii), and A52R (Figure 4Biii); Figure 4C is used for knocking out J2R and knocking in heterologous nucleic acids mouse HPGD (mHPGD) (Figure 4Ci), secreted human HPGD (sHPGD; Figure 4Cii), sIL12 (Figure 4Ciii), mIL12I (Figure 4Civ), and mIL12II (Figure 4Cv); Figure 4D is used for knocking out A44L-A45R-A46R and knocking in heterologous nucleic acids sHPGD (Figure 4Di), secreted fusion MHC 4Div-v); fusion protein of secreted fused MICB peptide, multiple cancer-testis antigen (CTA) peptides and hHPGD (secreted MICB peptide+multiple CTA peptides+hHPGD, sMICBH; Figure 4Dii); fusion protein of secreted fused MICB peptide, multiple prostate cancer tumor antigen (PCTA) peptides and hHPGD (secreted MICB peptide+multiple PCTA peptides+hHPGD, sMICAH; Figure 4Diii); fusion protein of secreted fused MICB peptide, multiple cancer-testis antigen (CTA) peptides and hHPGD (secreted MICB peptide+multiple CTA peptides+hHPGD, smCTAH; Figure 4Div-v); fusion protein of secreted fused MICB peptide, multiple prostate cancer tumor antigen (PCTA) peptides and hHPGD (secreted MICB peptide+multiple PCTA peptides+hHPGD, sMICAH; Figure 4Diii); peptides+hHPGD, smPCTAH; knock-in of Figure 4Dvi-vii); Figure 4E is used for simultaneous gene knockout of A52R and knock-in of heterologous nucleic acids sHPGD (Figure 4Ei), sMICBH (Figure 4Eii), smCTAH (Figure 4Eiii-iv), and smPCTAH (Figure 4Ev-vi).

[0026] FIG5 shows the genetically engineered recombinant virus fused with tumor antigen peptides.

[0027] 5A shows the genetically engineered recombinant viruses IVIR001 to IVIR013 using the novel vaccinia virus WC strain as a vector, wherein IVIR001, IVIR002, and IVIR010 express type I membrane protein IL12p70 (mIL12I) and secretory human HPGD (sHPGD); IVIR003, IVIR004, and IVIR011 express mIL12I and a fusion protein (sMICBH) of the secretory fusion tumor antigen MICB peptide and hHPGD; IVIR005, IVIR006, and IVIR007 express mIL12p70 and secretory human HPGD (sHPGD); IVIR006, IVIR007, and IVIR008 express mIL12p70 and secretory human HPGD (sHPGD); IVIR007, IVIR008, and IVIR009 express mIL12p70 and secretory human HPGD (sHPGD); IVIR008, IVIR009, and IVIR010 express mIL12p70 and secretory human HPGD (sHPGD); IVIR009, IVIR0010 express mIL12p70 and secretory human HPGD (sHPGD); IVIR001 ... IVIR06 and IVIR012 express mIL12I and a fusion protein of the secreted fusion tumor antigen MICB peptide, multiple cancer-testis antigen peptides and hHPGD (smCTAH); IVIR007, IVIR008 and IVIR013 express mIL12I and a fusion protein of the secreted fusion tumor antigen MICB peptide, multiple prostate cancer tumor antigen peptides and hHPGD (smPCTAH); IVIR009 expresses mIL12I and a fusion protein of the secreted fusion tumor antigen MICA peptide and hHPGD (sMICAH).

[0028] Figure 5B shows the fusion proteins delivered by recombinant viruses IVIR001 to IVIR013, respectively, wherein Figure 5Bi is mIL12I (type I membrane protein IL12p70), comprising a signal peptide, IL12p40, a (G4S)2 linker peptide, IL12p35, and a transmembrane peptide (TP); Figure 5Bii is sHPGD, comprising a signal peptide and human HPGD (hHPGD); Figure 5Biii is sMICBH, comprising a signal peptide, a G2S linker peptide, a MICB peptide, an AEAAAAKEAAAKA linker peptide, and hHPGD; Figure 5Biv is smCTAHa, comprising a signal peptide, a G2S linker peptide, a MICB peptide, an AEAAAAKEAAAKA linker peptide, CTA1peptide (cancer-testis antigen peptide 1), CTA2peptide...CTA 33 peptide, AEAAAAKEAAAKA linker peptide and hHPGD, the linker peptide between each CTA peptide is GG; Figure 5Bv is smCTAHb, which contains signal peptide, G2S linker peptide, MICB peptide, AEAAAAKEAAAKA linker peptide, CTA1peptide (cancer-testis antigen peptide 1), CTA2peptide...CTA 33peptide, AEAAAKEAAAKA linker peptide and hHPGD, the linker peptide between each CTA peptide is PP; Figure 5Bvi is smPCTAHa, which contains signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, PCTA1peptide (prostate cancer tumor antigen peptide 1), PCTA2peptide...PCTA 10 peptide, AEAAAKEAAAKA linker peptide and hHPGD, and the linker peptide between each PCTA peptide is GG; Figure 5Bvii is smPCTAHb, which includes a signal peptide, a G2S linker peptide, a MICB peptide, an AEAAAKEAAAKA linker peptide, PCTA1peptide (prostate cancer tumor antigen peptide 1), PCTA2peptide...PCTA 10 peptide, AEAAAKEAAAKA linker peptide and hHPGD, the linker peptide between each PCTA peptide is PP; Figure 5Bviii is sMICAH, which includes a signal peptide, a G2S linker peptide, a MICA peptide, an AEAAAKEAAAKA linker peptide and hHPGD.

[0029] Figure 6 shows the PCR validation results of vaccinia virus gene knockout, where Δ refers to gene knockout.

[0030] Figure 7 shows the verification of IL12p70 expression in CV-1 cells 16 hours after recombinant virus infection. Figure 7A is a schematic diagram of the fusion proteins of IL12p70 expressed by the recombinant viruses WRΔJ2R-sIL12, WRΔJ2R-mIL12I, and WRΔJ2R-mIL12II, wherein sIL12 is secreted IL12p70, mIL12I is the type I membrane protein IL12p70, mIL12II is the type II membrane protein IL12p70, SP is the secretion signal peptide of sIL12, TP is the transmembrane peptide of mIL12I, and SAP is the signal anchor peptide of mIL12II. Figure 7B is a graph showing the Western blot results of non-cellular extracellular (intracellular and on the cell membrane) IL12p70 and the internal reference protein β-actin in the recombinant virus WRΔJ2R-sIL12, WRΔJ2R-mIL12I, and WRΔJ2R-mIL12II infection groups and the control virus WRΔJ2R (J2R knockout WR strain) infection group. Figure 7C is a graph showing the flow cytometry results of IL12p70 on the cell membrane in the recombinant virus WRΔJ2R-sIL12, WRΔJ2R-mIL12I, WRΔJ2R-mIL12II, and virus-uninfected group (Cell Only group).

[0031] FIG8 shows the in vitro functional verification of recombinant viruses expressing intracellular mouse-derived HPGD and secreted human-derived HPGD. ELISA kits were used to detect the concentration of prostaglandin E2 (PGE2) in the culture medium of LLC cells 24 hours after infection with the recombinant viruses IVIR006a and IVIR008a and the control viruses WRΔJ2R (J2R knockout WR strain) and WRΔJ2R-HPGD (J2R knockout and mHPGD knocked-in WR strain recombinant virus). Among them, IVIR006a expresses the secreted fusion MICB peptide, the fusion protein of multiple cancer-testis antigen peptides and human HPGD (secreted MICB peptide+multiple CTA peptides+hHPGD, smCTAH) and type I membrane protein IL12p70 (mIL12I), and IVIR008a expresses the secreted fusion MICB peptide, the fusion protein of multiple prostate cancer tumor antigen peptides and human HPGD (secreted MICB peptide+multiple PCTA peptides+hHPGD, smPCTAH) and mIL12I. The data shown in the figures are mean ± standard deviation (SD), with error bars ± SD; ****WRΔJ2R vs. WRΔJ2R-HPGD, p-value < 0.0001; ****WRΔJ2R vs. IVIR006a, p-value < 0.0001; ****WRΔJ2R vs. IVIR008a, p-value < 0.0001.

[0032] Figure 9 shows the verification of the expression of fusion protein after 16 hours of infection of CV-1 cells by the WC strain recombinant virus IVIR004 that delivers the tumor antigen MICB peptide fusion protein. Figure 9A is a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR004, which expresses a fusion protein of secreted fusion tumor antigen MICB peptide and human HPGD (secreted MICB peptide+hHPGD, sMICBH) and type I membrane protein IL12p70 (mIL12I). The control virus is the J2R knockout WR strain (WRΔJ2R). Figure 9B is a WB result diagram of non-cellular (intracellular and on the cell membrane) HPGD in the IVIR004 infection group and the control virus WRΔJ2R infection group. Figure 9C is a flow cytometry result diagram of IL12p70 expression on the cell membrane of the IVIR004, WRΔJ2R infection group and the virus-uninfected group (Cell only group). FIG9D is a graph showing the WB results of non-extracellular (intracellular and on cell membrane) IL12p70 in the IVIR004 and WRΔJ2R infection groups.

[0033] Figure 10 shows the IFNγ ELISpot results of spleen cells from 6-8 week old female Balb / c mice injected intraperitoneally with the WC strain recombinant virus 14 days after injection. Figure 10A shows a plot of IFNγ spots in spleen cells from mice infected with IVIR002 (without MICB peptide expression, w / o MICB peptide), IVIR004 (with MICB peptide expression, w / MICB peptide), WRΔJ2R (J2R knockout WR strain), and the virus-uninfected (cell-only) group. Figure 10B shows the number of IFNγ spots associated with the MICB peptide (each spot represents an immune cell capable of secreting IFNγ). The data shown in the bar graph for MICB peptide is the number of spots in the IVIR004-infected group minus the number of spots in the IVIR002-infected group in Figure 10A. The data shown for the control group is the number of spots in the WRΔJ2R-infected group minus the number of spots in the cell-only group. The data shown in Figure 10B are mean ± SD, with error bars indicating ± SD; **MICB peptide vs. Control, P < 0.01.

[0034] Figure 11 shows the verification of the fusion protein expressed 16 hours after CV-1 cells were infected with a WC strain recombinant virus that delivers a fusion protein fused with multiple cancer-testis antigen peptides. Figure 11A is a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR006, which contains two subtypes, a and b. The similarity between the two is that they both express a fusion protein of a secreted MICB peptide, multiple cancer-testis antigen peptides, and human HPGD (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH) and the type I membrane protein IL12p70 (mIL12I). The difference is that the linker peptides between the CTA peptides are different, with IVIR006a using a GG linker peptide and IVIR006b using a PP linker peptide. Figure 11B is a WB result diagram of non-cellular extracellular (intracellular and on the cell membrane) HPGD and the internal reference protein β-actin in the IVIR006a infection group and its control virus J2R knockout WR strain (WRΔJ2R) infection group. Figure 11C is a flow cytometry result of IL12p70 expression on the cell membrane of IVIR006a, WRΔJ2R infection group and virus-uninfected group (Cell only group), and Figure 11D is a WB result of IL12p70 expression in non-cellular (intracellular and cell membrane) of each group.

[0035] Figure 12 shows the IFNγ ELISpot results of spleen cells of 6-8 week old C57BL / 6N female mice 14 days after intraperitoneal injection of WC strain recombinant viruses, including WC strain recombinant viruses IVIR006a (expressing MICB peptide and CTA peptide, w / MICB peptide+CTA peptides), IVIR002 (not expressing MICB peptide and CTA peptide, w / o MICB peptide+CTA peptides) and control virus WRΔJ2R (J2R knockout WR strain). Figure 12A is a graph of IFNγ spots in spleen cells of each group of mice. Figure 12B shows the number of IFNγ spots associated with MICB peptide and CTA peptide (each spot represents an immune cell that can secrete IFNγ), and the data shown in the bar graph for MICB peptide+CTA peptides is the number of spots in the IVIR006a injection group minus the number of spots in the IVIR002 injection group in Figure 12A, and the data shown for Control is the number of spots in the WRΔJ2R injection group minus the number of spots in the Cell only group. The data shown in the figure are mean ± SD, and the error bar is ± SD; ****MICB peptide + CTA peptides vs. Control, p-value < 0.0001.

[0036] Figure 13 shows the tumor growth curves of lung cancer and colon cancer in mice after treatment with a WC strain recombinant virus that delivers multiple cancer-testis antigen peptide fusion proteins. Figure 13A is a graph of the tumor growth of LLC lung cancer cells in the control group (Control group), IVIR001 treatment group, and IVIR006a treatment group; Figure 13B is a graph of the tumor growth of MC38 colon cancer cells in the control group, the control virus WRΔJ2R (J2R knockout WR strain) treatment group, and the IVIR006a treatment group. IVIR001 is a WC strain recombinant virus that expresses secreted human HPGD (sHPGD) and type I membrane protein IL12p70 (mIL12I), and IVIR006a is a WC strain recombinant virus that expresses a secreted fusion MICB peptide, a fusion protein of multiple cancer-testis antigen peptides and human HPGD (secreted MICB peptide + multiple CTA peptides + hHPGD, smCTAH), and mIL12I. Each experimental group contained 9-10 mice, and the data shown in the figure are the mean tumor volumes of each group.

[0037] Figure 14 shows the verification of the fusion protein expressed 16 hours after CV-1 cells were infected with the WC strain recombinant virus that delivers multiple prostate cancer tumor antigen peptide fusion proteins. Figure 14A is a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR008, which contains two subtypes, a and b. The similarities between the two are that they both express a fusion protein of secreted MICB peptide, multiple prostate cancer tumor antigen peptides and human HPGD (secreted MICB peptide + multiple PCTA peptides + hHPGD, smPCTAH) and type I membrane protein IL12p70 (mIL12I). The difference is that the linker peptide between the PCTA peptide and another PCTA peptide is different, where IVIR008a uses a GG linker peptide and IVIR008b uses a PP linker peptide. Figure 14B is a WB result diagram of non-cellular extracellular (intracellular and on the cell membrane) HPGD and internal reference protein β-actin in the IVIR008a infection group and the control virus WRΔJ2R (J2R knockout WR strain) infection group. Figure 14C is a flow cytometry result of IL12p70 expression on the cell membrane of IVIR008a, WRΔJ2R infected groups and virus uninfected group (Cell only group). Figure 14D is a WB result of IL12p70 expression in non-cellular (intracellular and cell membrane) in IVIR008a infected group and WRΔJ2R infected group.

[0038] Figure 15 shows the IFNγ ELISpot results of spleen cells from 6-8 week old female Balb / c mice 14 days after intraperitoneal injection of WC strain recombinant viruses, including IVIR008a (expressing MICB peptide and PCTA peptide, w / MICB peptide + PCTA peptides), IVIR002 (not expressing MICB peptide and PCTA peptide, w / o MICB peptide + PCTA peptides), and the control virus WRΔJ2R (J2R knockout WR strain). Figure 15A is a graph of IFNγ spots in spleen cells from each group of mice. Figure 15B shows the number of IFNγ spots associated with MICB peptide and PCTA peptide (each spot represents an immune cell capable of secreting IFNγ). The data shown in the bar graph for MICB peptide + PCTA peptides is the number of spots in the IVIR008a injection group minus the number of spots in the IVIR002 injection group in Figure 15A, and the data shown for Control is the number of spots in the WRΔJ2R injection group minus the number of spots in the Cell only group. The data shown in the figure are mean ± SD, and the error bar is ± SD; **MICB peptide + PCTA peptides vs. Control, p-value < 0.01.

[0039] Figure 16 shows the WB verification of the expression of fusion protein after 16 hours of infection of CV-1 cells by the WC strain recombinant virus IVIR009 that delivers the tumor antigen MICA peptide fusion protein. Figure 16A is a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR009, which expresses a fusion protein of secreted fusion tumor antigen MICA peptide and human HPGD (secreted MICA peptide+hHPGD, sMICAH) and type I membrane protein IL12p70 (mIL12I). The control virus is the J2R knockout WR strain (WRΔJ2R). Figures 16B-C are WB results of non-cellular (intracellular and on the cell membrane) HPGD and IL12p70 in the IVIR009 and WRΔJ2R infection groups.

[0040] Figure 17 shows the IFNγ ELISpot results of spleen cells from 6-8 week old female Balb / c mice 14 days after intraperitoneal injection of WC strain recombinant viruses, including IVIR009 (expressing MICA peptide, w / MICA peptide), IVIR002 (not expressing MICA peptide, w / o MICA peptide), and the control virus WRΔJ2R (J2R knockout WR strain). Figure 17A is a plot of IFNγ spots in spleen cells from each group of mice. Figure 17B shows the number of IFNγ spots associated with MICA peptide (each spot represents an immune cell capable of secreting IFNγ). The data shown in the bar graph for MICA peptide is the number of spots in the IVIR009-injected group minus the number of spots in the IVIR002-injected group in Figure 17A, and the data shown for the control is the number of spots in the WRΔJ2R-injected group minus the number of spots in the cell-only group. Data shown in the figure are mean ± SD, with error bars ± SD; **MICA peptide vs. Control, p-value < 0.01.

[0041] Figure 18 shows the verification of the expression of fusion proteins after 16 hours of infection of CV-1 cells by the WC strain recombinant virus IVIR006b that delivers multiple cancer-testis antigen peptide fusion proteins. Figure 18A is a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR006b, which expresses a fusion protein of secreted fusion tumor antigen MICB peptide, multiple cancer-testis antigen peptides and human HPGD (secreted MICB peptide+multiple CTA peptides+hHPGD, smCTAH) and type I membrane protein IL12p70 (mIL12I). The difference from IVIR006a is that the linker peptide between the CTA peptide and another CTA peptide is a PP linker peptide. Figure 18B is a WB result diagram of non-cellular extracellular (intracellular and on the cell membrane) HPGD in the IVIR006b infection group and the control virus WRΔJ2R (J2R knockout WR strain) infection group. Figure 18C is a flow cytometry result of IL12p70 expression on the cell membrane of IVIR006b, WRΔJ2R infected groups and virus uninfected group (Cell only group). Figure 18D is a WB result of IL12p70 expression in non-cellular (intracellular and cell membrane) of IVIR006b, WRΔJ2R infected groups.

[0042] Figure 19 shows the verification of the fusion protein expressed 16 hours after the WC strain recombinant virus that delivers multiple prostate cancer tumor antigen peptide fusion proteins infected CV-1 cells. Figure 19A is a schematic diagram of the fusion protein expressed by the WC strain recombinant virus IVIR008b, which expresses a fusion protein of secreted fusion MICB peptide, multiple prostate cancer tumor antigen peptides and human HPGD (secreted MICB peptide+multiple PCTApeptides+hHPGD, smPCTAH) and type I membrane protein IL12p70 (mIL12I). The difference from IVIR008a is that the linker peptide between the PCTA peptide and another PCTA peptide is a PP linker peptide. Figure 19B is a WB result diagram of non-cellular extracellular (intracellular and on the cell membrane) HPGD and internal reference protein β-actin in the IVIR008b infection group and the control virus WRΔJ2R (J2R knockout WR strain) infection group. Figure 19C is a flow cytometry result of IL12p70 expression on the cell membrane of IVIR008b, WRΔJ2R infected groups and virus uninfected group (Cell only group). Figure 19D is a WB result of IL12p70 expression in non-cellular (intracellular and cell membrane) of IVIR008b, WRΔJ2R infected groups.

[0043] Figure 20 shows the verification of the fusion protein expressed 16 hours after the WC strain recombinant virus delivering the tumor antigen peptide fusion protein was infected with CV-1 cells. Figure 20A is a schematic diagram of the fusion protein expressed by the WC strain recombinant viruses IVIR010, IVIR011, IVIR012a / b and IVIR013a / b. Figure 20B is a WB result diagram of the non-cellular (intracellular and on the cell membrane) HPGD and the internal reference protein β-actin in the recombinant virus infection group and the control virus WRΔJ2R (J2R knockout WR strain) infection group. Figure 20C is a WB result diagram of the non-cellular (intracellular and on the cell membrane) IL12p70 and the internal reference protein β-actin expression in the recombinant virus infection group and the WRΔJ2R infection group. Figure 20D is a flow cytometry result diagram of the expression of IL12p70 on the cell membrane of the WRΔJ2R, IVIR011, IVIR012b and IVIR013b infection group and the virus-uninfected group (Cell only group).

[0044] Figure 21 shows the IFNγ ELISpot results of spleen cells from 6-8 week old Balb / c female mice 7 days after intraperitoneal injection of WC strain recombinant viruses, including IVIR011 (expressing MICB peptide, w / MICB peptide), IVIR012b (expressing MICB peptide + CTA peptide, w / MICB peptide + CTA peptides), IVIR013b (expressing MICB peptide + PCTA peptide, w / MICB peptide + PCTA peptides), IVIR010 (expressing no MICB peptide, MICB peptide + CTA peptide, and MICB peptide + PCTA peptide, w / o MICB peptide, MICB peptide + CTA peptides, or MICB peptide + PCTA peptides), and the control virus WRΔJ2R (J2R knockout WR strain). Figure 21A is a dot plot of IFNγ in spleen cells from each group of mice. Figure 21B shows the number of IFNγ spots associated with MICB peptide, MICB peptide + CTA peptide, and MICB peptide + PCTA peptide (each spot represents an immune cell capable of secreting IFNγ). The data shown in the bar graph for MICB peptide, MICB peptide + CTA peptides, and MICB peptide + PCTA peptides are the number of spots in the IVIR011-injected group, IVIR012b-injected group, and IVIR013b-injected group minus the number of spots in the IVIR010-injected group in Figure 21A, respectively. The data shown for the control group are the number of spots in the WRΔJ2R-injected group minus the number of spots in the cell-only group. Data shown in the figure are mean ± SD, with error bars representing ± SD; *MICB peptide vs. Control, p-value < 0.05; **MICB peptide + CTA peptides vs. Control, p-value < 0.01; ****MICB peptide + PCTA peptides vs. Control, p-value < 0.0001.

[0045] Detailed description of the invention

[0046] The following description of the present invention is intended only to illustrate various embodiments of the present invention. Therefore, the specific modifications discussed should not be construed as limiting the scope of the present invention. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of the present invention, and it should be understood that these equivalent embodiments are intended to be included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.

[0047] In a first aspect, the present invention provides a tumor antigen peptide fusion protein comprising a signal peptide, human 15-hydroxyprostaglandin dehydrogenase (HPGD) and optionally at least one tumor antigen peptide.

[0048] In some embodiments, the signal peptide, HPGD and / or tumor antigen peptide is a human peptide or a non-human mammalian peptide.

[0049] In some embodiments, the tumor antigen peptide can be selected from, for example, MHC class I polypeptide-related sequence peptides, cancer-testis antigen (CTA) peptides, and prostate carcinoma tumor antigen (PCTA) peptides. The MHC class I polypeptide-related sequence is preferably MHC class I polypeptide-related sequence A (MICA), MHC class I polypeptide-related sequence B (MICA), B, MICB); CTA is preferably CAMEL (melanoma surface antigen recognized by CTL; cancer-testis antigen 2; CT6.2), BAGE (melanoma antigen; CT2.1), DAM-6 / 10 (MAGE-B1 / B2; Alzheimer's disease-associated microglia; melanoma antigen family member B2; CT3.2), GAGE-2 (G antigen 2; CT4.2), GAGE-5 (G antigen 5; CT4.5), GAGE-6 (G antigen 6; CT4.6), GAGE-7 (G antigen 7; CT4.7), GAGE-8 (G antigen 8; CT4.8), GAGE-7B (G antigen 7B; CT4.7), MAGE-A1 (melanoma-associated antigen A1; CT1.1), MAGE-A2 (melanoma The tumor antigen peptides are preferably melanoma-associated antigen A2 (CT1.2), MAGE-A3 (melanoma-associated antigen A3; CT1.3), MAGE-A4 (melanoma-associated antigen A4; CT1.4), MAGE-A6 (melanoma-associated antigen A6; CT1.6), MAGE-A10 (melanoma-associated antigen A10; CT1.10), MAGE-A12 (melanoma-associated antigen A12; CT1.12), NY-ESO-1 (human esophageal squamous cell carcinoma antigen 1; cancer-testis antigen 1B; CT6.1), CTAG1A (cancer-testis antigen 1A; CT6.1), and TRAG-3 (paclitaxel resistance-associated gene 3; chondrosarcoma-associated gene family member 2; CT24.2). PCTA is preferably prostatic acid phosphatase (PAP). In some embodiments, the sequence of the tumor antigen peptide is shown in Table 5.

[0050] In some embodiments, the tumor antigen peptide may be, for example, one or more of MICB peptide, MICA peptide, CTA peptide, and PAP peptide.

[0051] In some embodiments, as shown in FIG1A , the fusion protein may comprise any combination of polypeptides linked in the following order: (i) a signal peptide, HPGD, and one or more tumor antigen peptides; (ii) a signal peptide, one or more tumor antigen peptides, and HPGD; and (iii) a signal peptide, one or more tumor antigen peptides, HPGD, and one or more tumor antigen peptides. The one or more tumor antigen peptides may be the same or different.

[0052] In some embodiments, HPGD and the tumor antigen peptide, as well as multiple tumor antigen peptides, can be connected by a linker peptide as needed. The linker peptide can be any linker peptide, for example, selected from GG, G2S, G3S, (G4S) n (n is an integer ≥ 1, preferably 1, 2, 3 or 4), [A(EAAAK) n A] m (n=2, 3 or 4, m=1 or 2), (XP) n (n is an integer ≥ 1, X can be any amino acid), (CW n )(n is an integer ≥1), one or more of GFLG, PLGLWA, and RVLAEA.

[0053] In some embodiments, the HPGD may be human HPGD (Gene ID: 3248), whose nucleic acid sequence is derived from NM_000860.6, NM_001145816.3, NM_001256301.1, NM_001256305.2, NM_001256306.2, NM_001256307.2, NM_001363574.2, and whose amino acid sequence is derived from NP_000851.2, NP_001139288.1, NP_001243230.1, NP_001243234.1, NP_001243235.1, NP_001243236.1, NP_001350503.1; the HPGD may be mouse HPGD (Gene ID: 3248), whose nucleic acid sequence is derived from NM_000860.6, NM_001145816.3, NM_001256301.1, NM_001256305.2, NM_001256306.2, NM_001256307.2, NM_001363574.2, and whose amino acid sequence is derived from NP_000851.2, NP_001139288.1, NP_001243230.1, NP_001243234.1, NP_001243235.1, NP_001243236.1, NP_001350503.1. ID: 15446), whose nucleic acid sequence is derived from NM_008278.2 and amino acid sequence is derived from NP_032304.2. Preferably, the amino acid sequence of human HPGD is SEQ ID NO: 2; the amino acid sequence of mouse HPGD is SEQ ID NO: 1.

[0054] In some embodiments, the MICB can be human MICB (Gene ID: 4277), whose nucleic acid sequence is derived from NM_001289160.2, NM_001289161.2, NM_005931.5, XM_054328503.1, XM_054330825.1, and XM_054355464.1, and whose amino acid sequence is derived from NP_001276089.1, NP_001276090.1, NP_005922.2, XP_054184478.1, XP_054186800.1, and XP_054211439.1. Preferably, the amino acid sequence of the MICB peptide is SEQ ID NO: 28, as shown in Table 5.

[0055] In some embodiments, the MICA can be human MICA (Gene ID: 100507436), whose nucleic acid sequence is derived from NM_000247.3, NM_001177519.3, NM_001289152.2, NM_001289153.2, and NM_001289154.2, and whose amino acid sequence is derived from NP_000238.1, NP_001170990.1, NP_001276081.1, NP_001276082.1, and NP_001276083.1. Preferably, the amino acid sequence of the MICA peptide is SEQ ID NO: 27, as shown in Table 5.

[0056] In some embodiments, the CTA can be CAMEL (Gene ID: 30848), BAGE (Gene ID: 574), DAM-6 (Gene ID: 4113), DAM-10 (Gene ID: 4112), GAGE-2 (Gene ID: 729447), GAGE-5 (Gene ID: 2577), GAGE-6 (Gene ID: 2578), GAGE-7 (Gene ID: 2579), GAGE-8 (Gene ID: 100101629), GAGE-7B (Gene ID: 26748), MAGE-A1 (Gene ID: 4100), MAGE-A2 (Gene ID: 4101), MAGE-A3 (Gene ID: 4102), MAGE-A4 (Gene ID: 4103), MAGE-A6 (Gene ID: 4105), MAGE-A10 (Gene ID: 4109), MAGE-A12 (Gene Preferably, the amino acid sequence of the CTA peptides is SEQ ID NOs: 29-61, as shown in Table 5. Preferably, the amino acid sequence of the multiple CTA peptides is SEQ ID NO: 8 or 9, as shown in Table 1.

[0057] In some embodiments, the PCTA may be PAP; the PAP may be human PAP (Gene ID: 55), whose nucleic acid sequence is derived from NM_001134194.2 and whose amino acid sequence is derived from NP_001127666.1. Preferably, the PCTA peptide is a PAP peptide, whose amino acid sequence may be SEQ ID NO: 62, as shown in Table 5. Preferably, the amino acid sequence of the multiple PCTA peptides is SEQ ID NO: 10 or 11, as shown in Table 1.

[0058] In some embodiments, the amino acid sequence of the signal peptide, HPGD, MICB peptide, MICA peptide, CTA peptide, or PCTA peptide is an amino acid sequence as shown in Table 1 or Table 5 or a variant thereof.

[0059] In some embodiments, as shown in FIG5B , the fusion protein comprises:

[0060] (1) sHPGD: signal peptide + HPGD;

[0061] (2) sMICBH: signal peptide + MICB peptide + HPGD;

[0062] (3) sMICAH: signal peptide + MICA peptide + HPGD;

[0063] (4) smCTAH: signal peptide + MICB peptide + CTA1 peptide + CTA2 peptide + ... + CTA n peptide+HPGD, wherein n is an integer from 1 to 50, preferably 33; wherein CTA1 peptide, CTA2 peptide, ... CTA n The peptides may be the same or different; or

[0064] (5) smPCTAH: signal peptide + MICB peptide + PCTA1 peptide + PCTA2 peptide + ... + PCTA n Peptide + HPGD, wherein n is an integer from 1 to 20, for example, 10. wherein PCTA1 peptide, PCTA2 peptide, ... PCTA n The peptides can be the same or different.

[0065] In (4) above, smCTAH comprises n CTA peptides; preferably 33 different CTAs, with CTA1 to CTA 33 to represent (i.e., SEQ ID No: 29-61).

[0066] In the above (5), smPCTAH comprises n PCTA peptides; preferably comprises 10 identical prostatic acid phosphatase peptides (PAP peptide) sequences (SEQ ID No: 62).

[0067] In some embodiments, the linker peptide between the MICB peptide or MICA peptide and the signal peptide is GGGGSGGGGS, GGGS, GGS, GG, etc. In some embodiments, the linker peptide between the CTA peptide or PCTA peptide and the MICB peptide is AEAAAKEAAAKA, etc. In some embodiments, the linker peptide between CTA peptides or PCTA peptides is GG, PP, etc.

[0068] In some preferred embodiments, the signal peptide comprises SEQ ID NO: 7 or a variant thereof. In some preferred embodiments, the HPGD comprises the amino acid sequence of SEQ ID NO: 1 or 2 or a variant thereof. In some preferred embodiments, the MICB peptide comprises SEQ ID NO: 28 or a variant thereof.

[0069] In some preferred embodiments, the tumor antigen peptide fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 12-18 or variants thereof, see Table 2.

[0070] The variants of proteins, such as signal peptides, HPGDs, and / or tumor antigen peptides, described herein, have at least 75% (e.g., 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more) sequence identity with the corresponding amino acid sequence, or comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid deletions, insertions, and / or substitutions, or functional domains, of the corresponding amino acid sequence, and the altered sequence substantially retains at least one biological activity of the amino acid sequence from which it is derived. Preferably, the substitutions are conservative substitutions.

[0071] The second aspect of the present invention provides a composition (also referred to as a fusion protein composition) comprising the tumor antigen peptide fusion protein of the first aspect and a therapeutic factor. The therapeutic factor comprises a therapeutic factor fusion protein comprising a therapeutic factor and at least one selected from a signal peptide, a transmembrane peptide, and a signal anchor peptide, wherein the signal peptide, the transmembrane peptide, and / or the signal anchor peptide are located at the N-terminus or C-terminus of the therapeutic factor fusion protein. Thus, the therapeutic factor fusion protein can be secretory (comprising only a signal peptide) or transmembrane (comprising a signal peptide and a transmembrane peptide, or comprising a signal anchor peptide).

[0072] In some embodiments, the therapeutic factor fusion protein is an IL12p70 fusion protein. The IL12p70 fusion protein comprises IL12p35 and IL12p40, preferably IL12p40 and IL12p35 connected by a linker peptide.

[0073] In some embodiments, the IL12p70 can be human IL12p70, which is composed of two genes, IL12p35 (Gene ID: 3592) and IL12p40 (Gene ID: 3593), wherein the nucleic acid sequence of IL12p35 is derived from NM_000882.4, NM_001354582.2, NM_001354583.2, NM_001397992.1, and the amino acid sequence is derived from NP_000873.2, NP_001341511.1, NP_001341512.1, and NP_001384921.1; the nucleic acid sequence of IL12p40 is derived from NM_002187.3, and the amino acid sequence is derived from NP_002178.2. Preferably, the amino acid sequence of human IL12p35 is SEQ ID NO: 6, see Table 1, wherein the underlined amino acid sequence is used to construct the IL12p70 fusion protein; preferably, the amino acid sequence of human IL12p40 is SEQ ID NO: 5, see Table 1, wherein the underlined amino acid sequence is used to construct the IL12p70 fusion protein.

[0074] In some embodiments, the IL12p70 may be a mouse IL12p70, which is composed of IL12p35 (Gene ID: 16159) and IL12p40 (Gene ID: 16160), wherein the nucleic acid sequence of IL12p35 is derived from NM_001159424.3, NM_001410417.1, NM_001410418.1, NM_001410419.1, NM_001410420.1, NM_008351.4, and the amino acid sequence is derived from NP_001152896.2, NP_001397346.1, NP_001397347.1, NP_001397348.1, NP_001397349.1, NP_032377.1; the nucleic acid sequence of IL12p40 is derived from NM_001303244.1, and the amino acid sequence is derived from NP_001290173.1. Preferably, the amino acid sequence of murine IL12p35 is SEQ ID NO: 4, see Table 1, wherein the underlined amino acid sequence is used to construct the IL12p70 fusion protein; preferably, the amino acid sequence of murine IL12p40 is SEQ ID NO: 3, see Table 1, wherein the underlined amino acid sequence is used to construct the IL12p70 fusion protein.

[0075] In some embodiments, as shown in FIG. 1B , the IL12p70 fusion protein may comprise:

[0076] (i) Secreted IL12p70 (sIL12): signal peptide, IL12p35, linker peptide, and IL12p40 linked in sequence, or signal peptide, IL12p40, linker peptide, and IL12p35 linked in sequence;

[0077] (ii) type I membrane protein IL12p70 (mIL12I): a signal peptide, IL12p35, a linker peptide, IL12p40, and a transmembrane peptide linked in sequence, or a signal peptide, IL12p40, a linker peptide, IL12p35, and a transmembrane peptide linked in sequence; and / or

[0078] (iii) Type II membrane protein IL12p70 (mIL12II): a signal anchor peptide, IL12p35, a linker peptide, and IL12p40 linked in sequence, or a signal anchor peptide, IL12p40, a linker peptide, and IL12p35 linked in sequence.

[0079] In some embodiments, IL12p35 comprises an amino acid sequence selected from the underlined portion of SEQ ID NOs: 4 and 6, or a variant thereof. In some embodiments, IL12p40 comprises an amino acid sequence selected from the underlined portion of SEQ ID NOs: 3 and 5, or a variant thereof. In some embodiments, the signal peptide comprises SEQ ID NO: 7, or a variant thereof. In some embodiments, the signal anchor peptide comprises SEQ ID NO: 63, or a variant thereof. In some embodiments, the cell-penetrating peptide comprises SEQ ID NO: 64, or a variant thereof.

[0080] Furthermore, if necessary, the same linker peptide as that used in the tumor antigen peptide fusion protein can be used in the IL12p70 fusion protein.

[0081] In some embodiments, the IL12p70 fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 21-26 or variants thereof, as shown in Table 4.

[0082] The third aspect of the present invention provides a nucleic acid construct encoding the tumor antigen peptide fusion protein of the first aspect, or the composition of the second aspect.

[0083] The present invention does not particularly limit the nucleic acid construct, as long as it can encode the relevant fusion protein, and can be, for example, a DNA fragment, mRNA, or plasmid. The expression of the fusion protein can be via a shuttle plasmid, as shown in Figure 2. The shuttle plasmid can be a shuttle plasmid as shown in Figure 4.

[0084] The fourth aspect of the present invention provides a genetically engineered recombinant virus comprising the nucleic acid construct of the third aspect.

[0085] In some embodiments, the recombinant virus can be a DNA virus, an RNA virus, and mutants thereof. The DNA virus can be a single-stranded (ss) DNA virus, a double-stranded (ds) DNA virus, or a DNA virus containing ss and dsDNA regions, including adenoviridae, herpesviridae, and poxviridae, such as adenovirus, adeno-associated virus, replication-defective transcriptovirus, herpes simplex virus 1 (HSV1), and vaccinia virus (VV).

[0086] In some embodiments, the vaccinia virus can be a Western Reserve (WR) strain, a Copenhagen strain, a Lister strain, an Ankara strain, a Modified Vaccinia Ankara strain, a New York Vaccinia strain, a Tiantan strain, a Dryvax strain, a Bern strain, a Paris strain, a Tash Kent strain, an IHD-J strain, an IHD-W strain, a Brighton strain, a CVA382 strain, a Dairen strain, a LC16m8 strain, a LC16M0 strain, a LIVP strain, an ACAM2000 strain, a WR65-16 strain, a Connaught strain, an EM-63 strain, and derivatives thereof and genetically engineered strains thereof. The genetically engineered strains can include knockout of vaccinia virus genes and knock-in of heterologous nucleic acids (e.g., genes encoding fusion proteins, tumor targeting genes, tumor suppressor genes, etc.) and, optionally, other vaccinia virus strain genes. The viral genes that can be knocked out include any one or more regions of A34R, J2R, A44L, A45R, A46R, and / or A52R. In some embodiments, the genetically engineered vaccinia virus comprises the knockout of one or two or more genes (J2R, A34R, A44L-A45R-A46R, and A52R) in the vaccinia virus genome, and the knock-in of exogenous genes and nucleic acid sequences encoding fusion proteins. The A44L-A45R-A46R gene comprises any one of the A44L, A45R, and A46R genes, or a combination of any two or three thereof, preferably a combination of the three genes A44L, A45R, and A46R.

[0087] In some embodiments, the genetically engineered vaccinia virus is preferably an extracellular enveloped virus (EEV)-enhanced vaccinia virus, which comprises a modification of the EEV outer membrane glycoprotein encoding gene A34R of the vaccinia virus (including replacement and / or mutation of the A34R gene). Preferably, the EEV-enhanced vaccinia virus is a vaccinia virus WR strain comprising the A34R gene modification.

[0088] In some embodiments, the modification includes replacement of the WR A34R gene and / or mutation of the WR A34R gene. In some embodiments, the replacement includes replacing the A34R gene of the vaccinia virus WR strain with the A34R gene of the Copenhagen strain, the IHD-J strain, or the IHD-W strain. In some embodiments, the EEV enhanced vaccinia virus containing the mutation can be, for example, a WI strain, a WC strain, or a strain obtained by performing a point mutation on the A34R gene of the WR strain. The WI strain is a strain that uses the genome of the vaccinia virus WR strain as a backbone, and replaces the A34R gene sequence of the WR strain with the A34R gene sequence of the IHD-J strain. The WC strain is a strain that uses the genome of the WR strain as a backbone, and replaces the A34R gene sequence of the WR strain with the A34R gene (coA34R) sequence of the Copenhagen strain.

[0089] In some embodiments, the EEV-enhanced vaccinia virus comprises a coA34R gene encoding an amino acid sequence comprising SEQ ID NO: 19 or a variant thereof.

[0090] The fifth aspect of the present invention provides an expression system comprising a host cell and the genetically engineered recombinant virus of the fourth aspect.

[0091] In the present invention, the host cell can be a prokaryotic cell or a eukaryotic cell, preferably a eukaryotic cell, more preferably a mammalian cell, such as HeLa cells (Hela), human embryonic kidney cells 293 (HEK 293), Chinese hamster ovary cells (CHO), mouse myeloma cells, African green monkey kidney cells (CV-1 or Vero), etc.

[0092] Genetically engineered recombinant viruses expressed by host cells can selectively infect target cells, achieve efficient delivery and release of tumor antigens in the body, enhance / activate the tumor immunity function of the immune system, promote the proliferation of specific effector cells and kill tumor cells, thereby achieving the effect of treating tumors.

[0093] The tumor antigen peptide fusion protein, fusion protein composition and genetically engineered recombinant virus of the present invention, wherein the effector cell is any mammalian cell type that can promote the death of target cells. In some embodiments, the effector cell is an immune cell, such as a T cell, a B cell, an innate lymphocyte, a natural killer (NK) cell, a natural killer T cell (NKT), a granulocyte (e.g., a neutrophil, a basophil, a mast cell or an eosinophil), a macrophage, a monocyte or a dendritic cell (DC). Both viral vectors and therapeutic polypeptides can activate or restore effector cells (e.g., T cells) so that they have one or more of the following characteristics: (i) increased proliferation of effector cells; (ii) changes in the expression or activity of one or more cell surface proteins of effector cells; (iii) changes in the expression or activity of one or more intracellular proteins expressed by effector cells; (iv) changes in the amount or nature of factors (e.g., cytokines, chemokines, or reactive oxygen species) produced and / or secreted by effector cells; (v) changes in the morphology of effector cells; (vi) changes in the chemotactic potential of effector cells, such as through increased or decreased expression of one or more chemokine receptors; and (vii) changes in the functional activity of effector cells, such as increased cytolytic activity and / or increased phagocytic activity. Activation of effector cells or effector cell populations can be determined by any method known in the art, for example, changes in cell proliferation and protein expression, production or secretion can be determined by flow cytometry, Western blotting (WB), enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISpot), immunohistochemistry, immunoprecipitation or immunofluorescence.

[0094] In a sixth aspect, the present invention provides a pharmaceutical composition comprising the tumor antigen peptide fusion protein, composition, nucleic acid construct, or genetically engineered recombinant virus of the present invention; and a pharmaceutically acceptable carrier.

[0095] In a seventh aspect, the present invention provides a method for treating or preventing tumors, comprising administering the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus or pharmaceutical composition of the present invention.

[0096] In an eighth aspect, the present invention provides use of the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus or pharmaceutical composition of the present invention in the preparation of a drug for treating or preventing tumors.

[0097] A ninth aspect of the present invention provides a method for activating or enhancing immune cell function, comprising administering the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus or pharmaceutical composition of the present invention.

[0098] In some embodiments, the dosage form, administration route, etc. of the tumor antigen peptide fusion protein, composition, nucleic acid construct, genetically engineered recombinant virus or pharmaceutical composition described above can be specifically selected as needed. The dosage form can be a cream or a lipid composition. The administration route can be local or systemic, and can be formulated for local intratumoral injection, local intra-arterial (vascular supplying tumor) injection, subcutaneous injection, intracavitary injection, intraperitoneal injection, intrathoracic injection, systemic intravenous injection, intramuscular injection, intradermal injection, intrathecal injection, direct intraventricular injection, intracardiac injection, intranasal injection and other administration routes. The pharmaceutical composition can be used alone as a monotherapy; or used in combination with an anticancer agent.

[0099] In some embodiments, as shown in FIG5 , the present invention provides the following recombinant viruses:

[0100] (1) IVIR001, IVIR002, and IVIR010 are recombinant viruses that express secreted human HPGD (sHPGD) and type I membrane protein IL12p70 (mIL12I).

[0101] (2) IVIR003, IVIR004, and IVIR011 are recombinant viruses that express mIL12I and a fusion protein (sMICBH) of the secretory fusion tumor antigen MICB peptide and human HPGD.

[0102] (3) IVIR005, IVIR006 and IVIR012 are recombinant viruses that express a fusion protein (smCTAH) of mIL12I and secretory fusion MICB peptide, multiple cancer-testis antigen peptides and human HPGD, respectively. They contain two subtypes, a and b. The difference between the two is that the linker peptides between the CTA peptides are different. The a subtype uses a GG linker peptide, and the b subtype uses a PP linker peptide.

[0103] (4) IVIR007, IVIR008, and IVIR013 are recombinant viruses that express a fusion protein (smPCTAH) of mIL12I and a secretory fusion MICB peptide, multiple prostate cancer tumor antigen peptides, and human HPGD. They contain two subtypes, a and b, respectively. The difference between the two is that the linker peptides between the PCTA peptides are different. Subtype a uses a GG linker peptide, while subtype b uses a PP linker peptide.

[0104] (5) IVIR009 is a recombinant virus that expresses mIL12I and a secretory fusion protein of MICA peptide and human HPGD (sMICAH).

[0105] Among the above (1) to (5), the amino acid sequences of the preferred fusion proteins are shown in Tables 2 and 4.

[0106] the term

[0107] "Tumor antigen (TA)" refers to a class of major histocompatibility complex (MHC)-related molecules expressed on the surface of tumor cells. It is the key to the preparation of therapeutic cancer vaccines. Based on the patient's individual tumor condition, vaccine targets are rationally selected and personalized treatment plans are customized to achieve the purpose of cancer treatment. The first human clinical trial of personalized cancer vaccines has demonstrated the feasibility, safety and immunotherapeutic activity of targeting tumor mutation characteristics.

[0108] Tumor antigen peptides (TA peptides) are a type of tumor marker that serve as antigens that stimulate tumor immune responses and serve as targets for immune cells to attack tumor cells. The core of tumor immunotherapy is the reaction between tumor antigens presented by MHC and T cells. When tumor antigens are broken down within the cell, the resulting small peptides bind to MHC I on the surface of antigen-presenting cells, are expressed on the cancer cell surface, and are presented to T cells.

[0109] Cancer-testis antigens, or CTAs, also known as cancer germline antigens, are derived from genes expressed during fetal development. Their expression pattern in normal tissues is limited, generally confined to germline tissues such as the testis, ovary, and placenta. The human genome contains over 200 CTA genes, organized into 44 gene families, some of which have multiple members. CTA gene homologs and analogs have been found in a variety of organisms, including primates, rodents, zebrafish, fruit flies, nematodes, and even yeast. Relevant data can be found at the Ludwig Institute for Cancer Research (http: / / www.cta.lncc.br / index.php). Their expression has the following characteristics: ① They are expressed at varying frequencies in various tumor tissues; ② Most CTAs are located on the X chromosome; ③ They are often present as multiple family members; and ④ CTA expression is often heterogeneous in tumor tissues of varying origin.

[0110] "Protein", "protein" or "polypeptide" refers to at least two linked amino acids, including post-expression modifications of proteins, such as glycosylation, acetylation, phosphorylation, etc., and also includes variants obtained by genetic engineering of the amino acid sequence of natural proteins or polypeptides, such as deletion, substitution, and knock-in.

[0111] "Modification" refers to the modification of the amino acid sequence of a protein or polypeptide, including the connection of acetyl groups, carboxyl groups, glycosyl groups, immunoglobulin (Ig) Fc, polyethylene glycol (PEG), streptavidin and various other molecules (such as biotin, radioisotopes, fluorescent agents, enzymes, cytotoxic substances, anti-tumor agents, etc.), and also includes the connection with functional groups (such as phosphate residues, amino acid residues). After modification, the biochemical characteristics of the protein are changed, such as improved anti-proteolysis performance, improved solubility, etc., or it is given new biochemical characteristics, such as targeting, new antigen recognition epitopes, etc. In the present invention, the signal peptide can be coupled to the N-terminus of the tumor antigen peptide to obtain the properties of a secreted protein; or the tumor antigen peptide can be connected in series with the tumor suppressor factor HPGD so that the protein it encodes has a tumor suppressor effect; or tumor antigen peptides of different human origins can be connected to develop personalized therapeutic cancer vaccines.

[0112] A signal peptide (SP) refers to a specific sequence at the N-terminus of a secretory protein (sometimes not necessarily at the N-terminus). It directs the polypeptide and ribosome to the endoplasmic reticulum membrane, where it guides the nascent peptide across the membrane. Once inside the endoplasmic reticulum, the SP is typically cleaved by a signal peptidase. If the synthesized protein is secretory, the entire protein enters the endoplasmic reticulum lumen except for the SP cleavage. If the protein is a membrane protein, one or more intrinsic stop-translocation signals anchor the protein to the endoplasmic reticulum membrane.

[0113] "Transmembrane peptide (TP)" refers to a class of short peptides that can anchor proteins or polypeptides to the cell membrane. They perform many biological functions in cells and are essential substances for molecular transport, signal transduction and membrane fusion.

[0114] "Signal-anchor peptide (SAP)" refers to a polypeptide that has a similar effect to the signal peptide SP, that is, it can allow the peptide chain to pass through the membrane without being cleaved. It is a signal peptide of type II membrane protein and can be anchored on the membrane.

[0115] A "linker peptide" refers to an amino acid chain that connects two fusion proteins. It possesses a degree of flexibility to allow the proteins on either side to perform their respective functions. It is generally classified into three types: flexible linkers, rigid linkers, and cleavable linkers. As an indispensable component of fusion protein recombinant engineering, linker peptides play a crucial role in constructing stable, biologically active fusion proteins.

[0116] A "fusion protein" is a protein product produced by purposefully linking two or more genes encoding functional protein molecules using genetic engineering and other techniques. Such fusion proteins are novel proteins with two or more biological activities and functions. Fusion protein technology is used to improve the properties of proteins, including stability, activity, expression, secretion, and solubility, or to impart new functions to them. Therefore, fusion protein technology is widely used clinically to prepare vaccines, drugs with specific biological activities, thrombolytics, antimicrobial peptides, bifunctional enzymes, and more.

[0117] "MICA" and "MICB" are two highly similar MHC class I polypeptide-related sequences that are widely expressed in mammals and upregulated in virus-infected and tumor-transformed cells, encoding cell surface glycoproteins. As a type of cell stress antigen molecule, MICA / MICB activates cytotoxic NK cells and T cells by binding to its receptor G2D natural killer group 2 member D (NKG2D), playing an important role in the body's immune surveillance. The release of soluble MICA / MICB is considered a tumor immune escape mechanism that can reduce the density of NKG2D ligands on the surface of tumor cells, help inhibit immune effector cells, and has been shown to be elevated in the serum of patients with different malignant diseases. It has been reported that stable expression of MICA / MICB may be one of the ways to activate tumor immune responses.

[0118] 15-hydroxyprostaglandin dehydrogenase (HPGD) is an NAD + HPGD is a prostaglandin-degrading enzyme that is ubiquitously expressed in mammalian tissues and localized in the cytoplasm. It exists as a homodimer and widely regulates multiple cellular pathways such as inflammation, differentiation, and signal transduction, making it an important target for drug intervention. Existing studies have shown that the gene encoding HPGD has multiple transcript variants that are responsible for encoding different isomers; by degrading prostaglandins (tumor-promoting molecules) in cancer cells, HPGD can inhibit cancer cell proliferation and induce cancer cell differentiation, and HPGD knockout or low expression can increase colon tumor susceptibility and pancreatic tumor cell expansion. However, HPGD has been less studied in tumorigenesis and immune response, and its role is still unclear and needs further exploration.

[0119] The term "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 out of 6 total positions match). Typically, two sequences are compared when aligned for maximum identity. Such alignment can be achieved, for example, by using the method of Needleman et al. (1970) J. Mol. Biol. 48:443-453, which can be conveniently performed using a computer program such as the Align program (DNAstar, Inc.). The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4: 11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J MoI Biol. 48: 444-453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0120] The term "conservative substitution" refers to an amino acid substitution that does not adversely affect or change the expected properties of the protein / polypeptide comprising the amino acid sequence. For example, conservative substitutions can be introduced by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include substitutions in which amino acid residues are substituted with amino acid residues having similar side chains, such as substitutions with residues that are physically or functionally similar to the corresponding amino acid residues (e.g., having similar size, shape, charge, chemical properties, including the ability to form covalent bonds or hydrogen bonds, etc.). Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, it is preferred to replace the corresponding amino acid residue with another amino acid residue from the same side chain family. Methods for identifying conservative amino acid substitutions are well known in the art.

[0121] "Prostaglandin E2 (PGE2)" is a member of the eicosanoic acid family, produced by almost all cells in the human body. It is the most abundant prostaglandin in the human body, has many important physiological functions, and is widely produced under pathophysiological conditions. Cancer cells that secrete PGE2 have been shown to induce the formation of human regulatory T cells (Treg). In addition, PGE2 selectively inhibits the effector functions of macrophages and neutrophils and type I immunity mediated by Th1-, CTL-, and NK cells, but it promotes Th2, Th17 and Treg cell responses and local accumulation of myeloid-derived suppressor cells. Targeting the production, degradation, and reactivity of PGE2 provides a tool for regulating the immune pattern of a variety of diseases from autoimmunity to cancer.

[0122] "Therapeutic factors" refer to factors that enhance immune responses, including cytokines, immune co-stimulatory molecules, immune checkpoint inhibitors, anti-angiogenic factors, nucleic acid polymers, etc. The cytokines are involved in cellular activities such as cell signaling, apoptosis, development and differentiation, and include chemokines, interferon (INF), interleukin (IL), tumor necrosis factor (TNF), etc. and their respective receptors.

[0123] "Interleukins (IL)" refer to a class of molecules with essentially clear structures and biological functions that play an important regulatory role. They are originally produced by white blood cells and are named after their effects among white blood cells. They are cytokines that play an important role in transmitting information, activating and regulating immune cells, inflammatory responses, and the activation, proliferation, and differentiation of immune T and B cells. They include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35, and IL-36.

[0124] "J2R" is a gene on the vaccinia virus (VV) genome that is closely related to DNA replication and encodes a thymidine kinase (TK).

[0125] "A52R" is an immunoregulatory gene on the VV genome that encodes the Toll / interleukin-1 receptor (TIR) ​​protein molecule, inhibiting TIR-dependent Toll-like receptor (TLR) / nuclear transcription factor kappa-B (NF-κB) signal transduction in cells, inhibiting the innate immune response, and achieving viral immune escape. Deleting the viral gene for TLR signal transduction has been proven to be an effective method to improve VV as an ideal vaccine candidate.

[0126] "A46R" is an immunomodulatory gene on the VV genome that targets multiple TIR adaptor proteins in host cells, such as Myd88, TRIF, TRAM, etc. Its gene knockout leads to significant improvement in immune regulation.

[0127] "A44L" is one of the immunoregulatory genes on the VV genome. The hydroxysteroid dehydrogenase it encodes plays a key role in the synthesis of cellular steroid hormones.

[0128] "A45R" is a gene expressed in the late stage of VV infection, encoding a viral core protein whose amino acid sequence is partially identical to the amino acid sequence of copper-zinc superoxide dismutase (Cu-Zn SOD). This protein is highly conserved in different strains of VV and can interact with the late proteins J1R and A44L proteins to play a role in further viral morphogenesis.

[0129] "A34R" refers to the gene encoding a C-type lectin-like glycoprotein gp22-24 in VV.

[0130] "Target cell" refers to a mammalian cell that should be killed, attacked, destroyed and / or controlled. In particular, a target cell is a cell that has been altered in some way compared to a normal cell of the same cell type, including cancer cells and virus-infected cells.

[0131] "Gene knockout" (abbreviated as KO) is a widely used genetic engineering technique that involves the targeted removal or inactivation of specific genes in the genome of an organism. This can be accomplished through a variety of methods, including homologous recombination, CRISPR-Cas9, and TALEN. Gene knockout includes complete gene knockout and conditional gene knockout (also known as incomplete gene knockout). Complete gene knockout refers to the complete elimination of target gene activity through homologous recombination, while conditional gene knockout refers to the spatially specific gene knockout achieved through a targeted recombination system.

[0132] Gene knock-in (KI) is a genetic engineering method used in molecular cloning and biology to replace or insert foreign gene sequence information into the DNA sequence of a gene. The difference between KI and traditional transgenic technology is that KI involves inserting a gene into a specific site, thus achieving a "targeted" insertion. It is the opposite of gene knockout.

[0133] "Genetically engineered recombinant virus" or "recombinant virus" refers to a virus that has been genetically engineered to infect one or more cells or tissues and express proteins encoded by heterologous nucleic acid. Viruses typically have natural host cell populations that they most effectively infect. Therefore, modifying a virus to incorporate proteins from a different virus can enhance viral entry into specific cell or tissue types, and viruses are genetically engineered for disease treatment purposes. In some embodiments, genetically engineered viruses are able to selectively infect target cells or tissue types, such as tumor cells in cancer patients, compared to non-engineered viruses.

[0134] "Viral genome" refers to the nucleic acid component of a virus that encodes the genome, including any proteins required for replication and / or integration of the genome. In some embodiments, the viral genome serves as a viral vector and may contain heterologous genes. The viral genomes described herein may be based on any viral vector.

[0135] A "vector" is a vehicle used in genetic engineering to introduce a target gene into a recipient cell. One type of vector is a non-viral vector, which can be mRNA, DNA, plasmids, bacteria, etc. Another type of vector is a viral vector, in which other exogenous gene segments can be ligated into the viral genome to achieve exogenous gene expression. Examples of viral vectors include poxviruses, such as Western Reserve (WR), Copenhagen, Lister, Ankara, Modified Vaccinia Ankara, New York Vaccinia, Temple of Heaven, Dryvax, Bern, Paris, Tash Kent, IHD-J, IHD-W, Brighton, CVA382, Dairen, LC16m8, LC16M0, LIVP, ACAM2000, WR65-16, Connaught, and EM-63 vaccinia viruses, as well as adenoviruses and herpes simplex viruses. In an embodiment, the vector is a vaccinia virus vector, and the knocked-in nucleic acid sequence is a recombinant nucleic acid sequence encoding a tumor antigen peptide fusion protein and / or a therapeutic factor fusion protein.

[0136] "Expression system" refers to the host cells in which the expression vector is replicated and amplified. The expression vectors in the present invention include host cells of genetically engineered viruses, including HeLa cells (Hela), Chinese hamster ovary cells (CHO), human embryonic kidney cells 293 (HEK 293), African green monkey kidney cells (CV-1 or Vero), etc.

[0137] The term "pharmaceutically acceptable" means approved by a federal regulatory agency or a state government or listed in the US Pharmacopeia or other generally recognized pharmacopeia for use in animals and humans and does not produce adverse, allergic or other untoward reactions.

[0138] The term "carrier" refers to a diluent, adjuvant, protective agent (e.g., biological glue, fat, artificial lipid membrane, liposome), excipient, or vehicle administered together with the therapeutic agent. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including oils of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Physiological saline solutions and aqueous dextrose solutions and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, anhydrous skim milk, glycerol, propylene glycol, glycol, water, ethanol, etc. If necessary, the composition can also contain a small amount of wetting agent or emulsifier or pH buffer. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, etc.

[0139] The term "treating" refers to administering to a subject an effective amount of a fusion protein, composition, nucleic acid construct, or recombinant virus, etc., as described herein, such that the subject experiences a reduction in at least one symptom of the disease or an improvement in the disease, e.g., a beneficial or desired clinical outcome. For the purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to, alleviation of one or more symptoms, a decrease in the severity of the disease, stabilization of the disease state (i.e., no worsening), a delay or slowing of disease progression, improvement or alleviation of the disease state, and remission (whether partial or complete), whether detectable or undetectable. Treatment may refer to prolonging survival compared to the expected survival in the absence of treatment. Thus, those skilled in the art recognize that treatment may improve the disease state but may not be a complete cure for the disease. As used herein, the term "treating" includes prevention. Alternatively, treatment is "effective" if the progression of the disease is reduced or halted. "Treatment" may also mean prolonging survival compared to the expected survival in the absence of treatment. Patients in need of treatment include those already diagnosed with the relevant condition, as well as those at risk of developing the condition due to genetic predisposition or other factors.

[0140] The terms "patient" and "subject" are interchangeable and mean any living organism that can be treated with the fusion protein of the present disclosure. In the present disclosure, the subject or individual undergoing therapeutic or prophylactic treatment is preferably a mammal, such as, but not limited to, a human, non-human primate, livestock (such as sheep, cattle, horses, donkeys, pigs), pets (such as dogs, cats), laboratory test animals (such as mice, rabbits, rats, guinea pigs, hamsters), or captured wild animals (such as foxes, deer). The subject is preferably a primate. In certain embodiments, the subject is a mammal, preferably a human. In certain embodiments, the subject is an adult, a child, or an infant. DETAILED DESCRIPTION

[0141] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0142] The abbreviations have the following meanings: “h” refers to hour, “min” refers to minute, “s” refers to second, “μL” refers to microliter, “mL” refers to milliliter, “L” refers to liter, and “mM” refers to millimole.

[0143] Experimental methods

[0144] (1) Cell Culture: Vero and CV-1 cells (both from the Cell Bank of the Chinese Academy of Sciences) were cultured in Dulbecco's Modified Eagle's Medium (DMEM) or RPMI medium (Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin. Vero cells were used for virus titer determination, while CV-1 cells were used for large-scale virus production and cell function testing. Cell growth and virus replication were performed in a 37°C, CO2 incubator.

[0145] (2) PCR technology: Viral genome DNA was extracted using a viral genome extraction kit (purchased from Biomiga). Tissue DNA was extracted using a Blood & Tissue kit (Qiagen). Specific procedures are detailed in the manufacturer's instructions. Using DNA as a template, PCR amplification was performed using DNA polymerase (TAKARA) with the following primers: J2R primers: TGTTAGATACATAGATCCTCGTCG and CACTTTCTGGTTCGTAATCTAACTC; A44L-A45R-A46R primers: GTACTCTTACTGTGTAGTGG and CCTCTATACATCTATGAGACTCC; A52R primers: TACGTTTACGGTATAGCCTC and TGCCGTAGCCAATGTAGTAATG. The PCR reaction protocol was as follows: initial denaturation at 94°C for 5 minutes; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute; followed by a further extension at 72°C for 10 minutes, and termination at 25°C. PCR reactions were performed in a Bio-Rad PCR instrument, and PCR products were analyzed by agarose gel electrophoresis.

[0146] (3) Virus plaque assay (Vero cells): The positive control virus and the test virus were removed from the -80°C freezer and thawed within 5-7 minutes, vortexed for 3-5 seconds, and sonicated for 1 minute using a cup ultrasonic disruptor (4-20°C, 20 seconds on / 20 seconds off). The virus was diluted 10-fold in a series of gradients. In a biosafety cabinet, 800 μL / well of the diluted virus sample was pipetted with a 1 mL pipette and added to a six-well plate containing Vero cells. The six-well plate was then placed in an incubator containing 5% CO2 and incubated at 37°C for 1 hour. The inoculum was discarded, and 1.5 mL of culture medium (DMEM + 10% FBS) and 1.5 mL of 3% carboxymethyl cellulose (CMC) solution were added to each well. The cells were incubated at 37°C in an incubator containing 5% CO2 for 40 hours. The cells were stained with 0.1% crystal violet. The 6-well plate was scanned using a scanner and the number of plaques in each well was recorded (a range of 30-300 plaques per well was considered acceptable). Virus titer (Titer) = (number of plaques / 0.8) × dilution factor, expressed as PFU / mL.

[0147] Example 1: Construction and engineering of vaccinia virus WC strain

[0148] Using the genome of vaccinia virus strain WR (ATCC VR-1354) as a backbone, the A34R gene sequence of the WR strain (WR A34R) was knocked out and the A34R gene sequence of the Copenhagen strain (CoA34R; GenBank: AAA48161.1) was knocked in, generating a novel vaccinia virus strain WC (Figure 3A). The amino acid sequences encoded by WR A34R and CoA34R are shown in Table 3. An exemplary procedure was as follows: the shuttle plasmid pShuttleΔA34R-CoA34R was transfected into CV-1 cells using the transfection reagent Lipofectamine 3000. Four hours later, the transfected CV-1 cells were infected with 0.01 PFU / cell of vaccinia virus strain WR. After 48 hours, vaccinia viruses carrying CoA34R and expressing green fluorescent protein (WR-CoA34R GFP) were harvested and selected. The recombinant virus (with a GFP tag) was used to infect CV-1 cells transfected with a Cre expression plasmid (ordered from Shanghai Sangon). The GFP gene was then removed using the Cre / loxP system, resulting in the generation of a recombinant vaccinia virus (WC) strain lacking the fluorescent tag. Comet formation assays revealed that WR strain extracellular enveloped virus (EEV) and intracellular mature virus (IMV) formed circular plaques upon infection of CV-1 cells, whereas WC strain EEV and IMV formed comet-shaped plaques upon infection of CV-1 cells (Figure 3B). Titer assays revealed that at an MOI of 1, the viral titer of WC strain EEV after 12 hours of infection of CV-1 cells (1.50 × 10 5 PFU / mL is the virus titer of WR strain (1.01×10 3 PFU / mL); when MOI=2, the virus titer of WC strain EEV infected CV-1 cells for 12 hours was (1.91×10 5 PFU / mL) is the virus titer of WR strain (1.79×10 3 The 106 times higher PFU / mL) was observed in the 10

[0149] Figure 3D shows a schematic diagram of genetic engineering modification of vaccinia virus WC strain using it as a vector, including modification of six gene sequences: sequence 1 (J2R), sequence 2 (A34R), sequences 3-5 (A44L-A45R-A46R), and sequence 6 (A52R); and also includes the knock-in of a heterologous nucleic acid sequence encoding a fusion protein.

[0150] Example 2: Vector construction

[0151] As shown in Figure 4, the shuttle plasmids include a shuttle plasmid for CoA34R gene knock-in (Figure 4A); a shuttle plasmid for J2R (Figure 4Bi), A44L-A45R-A46R (Figure 4Bii), and A52R (Figure 4Biii) gene knock-out; a shuttle plasmid for simultaneous J2R gene knock-out and heterologous nucleic acid mouse HPGD (mouse HPGD, mHPGD) (Figure 4Ci), sHPGD (secreted human HPGD; Figure 4Cii), sIL12 (Figure 4Ciii), mIL12I (Figure 4Civ), and mIL12II (Figure 4Cv); a shuttle plasmid for simultaneous A44L-A45R-A46R gene knock-in and heterologous nucleic acid sHPGD (Figure 4Di), sMICBH (secreted MICB peptide+hHPGD; Figure 4Dii), and sMICAH (secreted MICA peptide+hHPGD; Figure 4Diii). 4Div-v), smCTAH (secreted MICB peptide + multiple CTA peptides + hHPGD; Figure 4Diii), smCTAH (secreted MICB peptide + multiple CTA peptides + hHPGD; Figure 4Div-v), smPCTAH (secreted MICB peptide + multiple PCTA peptides + hHPGD; Figure 4Dvi-vii) knock-in shuttle plasmids; shuttle plasmids for simultaneous A52R gene knockout and heterologous nucleic acid knock-in sHPGD (Figure 4Ei), sMICBH (Figure 4Eii), smCTAH (Figure 4Eiii-iv), smPCTAH (Figure 4Ev-vi). The amino acid sequences of the fusion proteins encoded by the above heterologous nucleic acids are shown in Tables 2 and 4; the corresponding nucleotide sequences are shown in Table 6.

[0152] (1) Shuttle plasmid expressing tumor antigen peptide fusion protein

[0153] The following target genes were designed for expressing tumor antigen peptide fusion proteins: A44L left arm-pE / L-SP-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Di), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Dii), A44L left arm-pE / L-SP-GGS-MICA peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Diii), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-GG-CTA2peptide-GG…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Div), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-PP-CTA2peptide-PP…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Dv), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-GG-PCTA2peptide-GG…PCTA 10 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Dvi), A44L left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-PP-PCTA2peptide-PP…PCTA 10peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A46R right arm (Figure 4Dvii), A52R left arm-pE / L-SP-hHPGD-loxP-H5-GFP-loxP-A52R ​​right arm (Figure 4Ei), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R ​​right arm (Figure 4Eii), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-GG-CTA2peptide-GG…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R ​​right arm (Figure 4Eiii), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-CTA1peptide-PP-CTA2peptide-PP…CTA 33 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R ​​right arm (Figure 4Eiv), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-GG-PCTA2peptide-GG…PCTA 10 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R ​​right arm (Figure 4Ev), A52R left arm-pE / L-SP-GGS-MICB peptide-AEAAAKEAAAKA-PCTA1peptide-PP-PCTA2peptide-PP…PCTA 10 peptide-AEAAAKEAAAKA-hHPGD-loxP-H5-GFP-loxP-A52R ​​right arm (Figure 4Evi). After the target genes were synthesized, they were cloned into pShuttle DNA (Shanghai Sangon Company) to obtain shuttle plasmids expressing tumor antigen peptide fusion proteins.

[0154] (2) Shuttle plasmid expressing IL12p70 fusion protein

[0155] The following target genes were designed for expressing IL12p70 fusion protein: J2R left arm-pE / L-SP-IL12p40-GGGGSGGGGS-IL12p35-loxP-H5-GFP-loxP-J2R right arm (Figure 4Ciii), J2R left arm-pE / L-SP-IL12p40-GGGGSGGGGS-IL12p35-transmembrane peptide (TP)-loxP-H5-GFP-loxP-J2R right arm (Figure 4Civ), J2R left arm-pE / L-signal-anchor peptide (SAP)-IL12p40-GGGGSGGGGS-IL12p35-loxP-H5-GFP-loxP-J2R right arm (Figure 4Cv). After the target gene was synthesized, it was cloned into two appropriate multiple cloning sites of pShuttle DNA (Shanghai Sangon Company) to obtain the shuttle plasmid expressing IL12p70 fusion protein.

[0156] Example 3: Using shuttle plasmids to achieve gene knockout of vaccinia virus and knock-in of heterologous nucleic acid sequences

[0157] (1) J2R gene knockout and heterologous nucleic acid knock-in: The shuttle plasmid obtained in Example 2 was transfected into CV-1 cells using Lipofectamine 3000, such as pShuttleΔJ2R ( FIG. 4Bi ), pShuttleΔJ2R-HPGD ( FIG. 4Ci ), pShuttleΔJ2R-sHPGD ( FIG. 4Cii ), pShuttleΔJ2R-sIL12 ( FIG. 4Ciii ), pShuttleΔJ2R-mIL12I ( FIG. 4Civ ), or pShuttleΔJ2R-mIL12II ( FIG. 4Cv ). After 4 h, 0.01 PFU / cell of vaccinia virus WR was added. The cells were incubated with the novel vaccinia virus WC strain constructed in Example 1 or the novel vaccinia virus WC strain constructed in Example 1. After 48 hours, the cells were harvested and the cells infected with the virus expressing green fluorescent protein were selected under a fluorescence microscope. The recombinant viruses were selected and amplified on a small scale to obtain a series of WR strain or WC strain recombinant viruses (with GFP tags) with J2R gene knockout and heterologous nucleic acid knock-in, such as WRΔJ2R-GFP, WRΔJ2R-HPGD-GFP, WRΔJ2R-sHPGD-GFP, WRΔJ2R-sIL12-GFP, WRΔJ2R-mIL12I-GFP, WRΔJ2R-mIL12II-GFP, and WCΔJ2R-mIL12I-GFP. The viral genomic DNA was extracted, and the deletion of the J2R gene was identified by PCR. The above-mentioned recombinant virus (with GFP tag) was then used to infect CV-1 cells transfected with the Cre expression plasmid. The GFP gene was removed with the help of the Cre / loxP system, thereby obtaining the J2R gene knockout recombinant viruses with the fluorescent tag deleted: WRΔJ2R, WRΔJ2R-HPGD, WRΔJ2R-sHPGD, WRΔJ2R-sIL12, WRΔJ2R-mIL12I, WRΔJ2R-mIL12II, and WCΔJ2R-mIL12I.

[0158] (2) A44L-A45R-A46R gene knockout and heterologous nucleic acid knock-in: The shuttle plasmids obtained in Example 2 were transfected into CV-1 cells using Lipofectamine 3000, such as pShuttleΔ(A44L-A45R-A46R)-sHPGD ( Figure 4 Di ), pShuttleΔ(A44L-A45R-A46R)-sMICBH ( Figure 4 Dii ), pShuttleΔ(A44L-A45R-A46R)-sMICAH ( Figure 4 Diiii ), and pShuttleΔ(A44L-A45R-A46R)-s mCTAH (Figure 4Div-v) or pShuttleΔ(A44L-A45R-A46R)-smPCTAH (Figure 4Dvi-vii), 4 hours later, 0.01 PFU / cell of the J2R gene knockout recombinant virus WCΔJ2R-mIL12I with the fluorescent tag deleted obtained in the above step (1) was added. After 48 hours, the cells were harvested and cells infected with the virus expressing green fluorescent protein were selected under a fluorescence microscope. The recombinant viruses were selected and amplified on a small scale to obtain recombinant viruses with J2R, A44L-A45R-A46R gene knockout and heterologous nucleic acid knock-in (with GFP tag). The viral genomic DNA was extracted and the deletion of the A44L-A45R-A46R gene was identified by PCR. The above recombinant virus (with GFP tag) was then used to infect CV-1 cells transfected with Cre expression plasmid. The GFP gene was removed by the Cre / loxP system, thereby obtaining a series of recombinant viruses with fluorescent tag-deleted J2R, A44L-A45R-A46R gene knockout, and heterologous nucleic acid knock-in: WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / sHPGD(IVIR001 ), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / sMICBH(IVIR003), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / smCTAH(IVIR005), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / smPCTAH(IVIR007), and WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / sMICAH, as shown in Figure 5A.

[0159] (3) A52R gene knockout and heterologous nucleic acid knock-in: The shuttle plasmids pShuttleΔA52R (Figure 4Biii), pShuttleΔA52R-sHPGD (Figure 4Ei), pShuttleΔA452R-sMICBH (Figure 4Eii), pShuttleΔA52R-smCTAH (Figure 4Eiii-iv) or pShuttleΔA52R-smPCTAH (Figure 4Ev-vi) obtained in Example 2 were transfected into CV-1 cells using Lipofectamine 3000. After 4 hours, 0.01 PFU / cell of the above-mentioned recombinant viruses with deleted fluorescent tags, such as WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / sHPGD (IVIR001), WCΔJ The cells were incubated with WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / sMICBH(IVIR003), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / smCTAH(IVIR005), WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / smPCTAH(IVIR007), and WCΔJ2RΔ(A44L-A45R-A46R)-mIL12I / sMICAH. The cells were harvested after 48 hours, and cells infected with the virus expressing green fluorescent protein were selected under a fluorescence microscope. The recombinant viruses were selected and amplified on a small scale to obtain recombinant viruses with J2R, A44L-A45R-A46R, and A52R gene knockout and heterologous nucleic acid knock-in (with GFP tags).Viral genomic DNA was extracted and the deletion of the A52R gene was identified by PCR. Then, the recombinant viruses (with GFP tag) with J2R, A44L-A45R-A46R, A52R gene knockout and heterologous nucleic acid knock-in were used to infect CV-1 cells transfected with Cre expression plasmid. The GFP gene was removed by Cre / loxP system, thus obtaining a series of recombinant viruses with fluorescent tag deleted J2R, A44L-A45R-A46R, A52R gene knockout and heterologous nucleic acid knock-in: WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12I / sHPGD(IVIR002), WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12I / sMICBH(IVIR004), WCΔJ2RΔ(A44L- A45R-A46R)ΔA52R-mIL12I / smCTAH(IVIR006), WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL1 2I / smPCTAH(IVIR008), WCΔJ2RΔ(A44L-A45R-A46R)ΔA52R-mIL12I / sMICAH(IVIR009), W CΔJ2RΔA52R-mIL12I / sHPGD (IVIR010), WCΔJ2RΔA52R-mIL12I / sMICBH (IVIR011), WCΔJ2RΔA52R-mIL12I / smCTAH (IVIR012), and WCΔJ2RΔA52R-mIL12I / smPCTAH (IVIR013), as shown in Figure 5A .

[0160] Example 4: Selection, Verification and Amplification of Recombinant Viruses

[0161] (1) Selection of recombinant viruses: cells infected with the virus expressing green fluorescent protein were selected and transferred to a cryopreservation tube containing 200 μL of cell culture medium. After freezing and thawing, 20 μL was diluted with cell culture medium and added to a six-well plate inoculated with CV-1 cells 24 hours in advance. After further culture for 48 hours, the cells were observed under a microscope and cells infected with the virus expressing green fluorescent protein were selected for the next round of selection until all infected cells were shown to emit fluorescence under the microscope. In this case, the recombinant virus expressing green fluorescent protein was obtained (the recombinant virus with the GFP gene removed was selected using the same method to select the colorless virus, which is the desired recombinant virus). The cells were then scraped and frozen at -80°C for virus amplification.

[0162] (2) Verification of recombinant virus: 20 μL of virus was added to a 5×10 5CV-1 cells were plated in six-well plates and cultured for 16 hours. Whole-cell lysates of CV-1 cells were used as protein samples. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting (WB) were used to detect the expression of non-extracellular (intracellular and cell membrane) IL12p70 and HPGD proteins using commercial anti-IL12p35 antibodies (αIL12p35, ab131039, Abcam) and anti-HPGD antibodies (αHPGD, ab187161, Abcam). Flow cytometry was used to detect the expression of IL12p70 protein on the cell membrane using anti-IL12 antibody (anti-mouse IL12, 560564, BD Biosciences).

[0163] (3) Amplification of recombinant virus: Take 100 μL of cells infected with the recombinant virus (any one of IVIR001 to IVIR013 obtained in steps (2) and (3) of Example 3) with the fluorescent tag deleted, freeze and thaw, add them to a 6-well plate containing CV-1 cells, grow to 80-90% confluency in about 1.5 mL of cell culture medium, scrape the cells and culture medium after 48 hours and store them to obtain "seed virus". The "seed virus" was quickly frozen and thawed three times and diluted to an appropriate multiple. 100 μL / bottle of the above virus suspension was taken and added to a T225 culture flask containing CV-1 cells. After 48 hours, the cells were blown off and centrifuged several times at 1500 rpm (4°C). The precipitate was washed in PBS and resuspended in 10 mL of 10 mM Tris-HCl buffer (pH 9) and stored at -80°C for virus concentration.

[0164] (4) Concentration of recombinant virus: After thawing the recombinant virus amplified in step (3), vortex for a few seconds and centrifuge at 1500 rpm (4°C) for 5 min. Collect the supernatant (containing the released virus particles) and dilute to a total volume of 30 mL with 10 mM Tris-HCl buffer. Place an average of 30 mL in four Beckman ultracentrifuge tubes, then gently add 17 mL of 36% sucrose solution to the virus solution and centrifuge at 13500 rpm (4°C) for 80 min. Resuspend the final pellet in 1-4 mL of virus suspension buffer (PBS; 10% glycerol; 138 mM NaCl; pH 7.4) and store at -80°C.

[0165] (5) Western blot experiment: Cells infected with viruses (any one of IVIR001 to IVIR013 obtained in steps (2) and (3) of Example 3 and WRΔJ2R, WRΔJ2R-sIL12, WRΔJ2R-mIL12I, and WRΔJ2R-mIL12II obtained in step (1) of Example 3) were collected using a cell scraper, and total cell protein was extracted using RIPA lysis buffer (Shanghai Biyuntian Biotechnology Co., Ltd.) supplemented with PMSF and a protease inhibitor (purchased from Prilep) and low-temperature high-speed centrifugation (4°C, 14,000×g for 15 min). The protein sample concentration was determined using the BCA assay, and 20 μg of protein / well was subjected to SDS-PAGE. The separated target proteins were transferred from the electrophoresis gel to a PVDF membrane and incubated with primary antibodies against αIL12p35 (ab131039, Abcam), αHPGD (ab187161, Abcam), or anti-β-actin antibody (C1313, Applygen) (4°C, 35 rpm, overnight) and secondary antibodies: HRP-conjugated anti-mouse antibody (BA1050, BOSTER) or HRP-conjugated anti-rabbit antibody (ab6721, Abcam) (room temperature, 35 rpm, 2 h). ECL luminescent solution (purchased from Kangwei Century) was then added to the membrane, and the membrane was exposed and imaged using an electronic plate imager (purchased from e-blot).

[0166] (6) Flow cytometry: CV-1 cells were infected with recombinant virus at a multiplicity of infection (MOI) of 0.5. 16 h later, virus-infected cells were harvested by trypLE digestion and incubated with 5 μL of anti-IL12 antibody (anti-mouse IL12, 560564, BD Biosciences) at 4°C for 30 min in the dark. IL12p70-positive cells were detected and analyzed by flow cytometry.

[0167] Through virus recombination, selection and verification, 13 vaccinia virus WC strain recombinant viruses were confirmed as shown in Figure 5A: IVIR001, IVIR002 and IVIR010 (all expressing mIL12I and sHPGD); IVIR003, IVIR004 and IVIR011 (all expressing mIL12I and sMICBH); IVIR005, IVIR006 and IVIR012 (all expressing mIL12I and smCTAH); IVIR007, IVIR008 and IVIR013 (all expressing mIL12I and smPCTAH); IVIR009 (expressing mIL12I and sMICAH).

[0168] Figure 5B shows the fusion proteins expressed by recombinant viruses IVIR001 to IVIR013, wherein Figure 5Bi is mIL12I (type I membrane protein IL12p70), comprising a signal peptide, IL12p40, a (G4S)2 linker peptide, IL12p35, and a transmembrane peptide (TP); Figure 5Bii is sHPGD, comprising a signal peptide and human HPGD (hHPGD); Figure 5Biii is sMICBH, comprising a signal peptide, a G2S linker peptide, a MICB peptide, an AEAAKEAAAKA linker peptide, and hHPGD; Figure 5Biv is smCTAHa, comprising a signal peptide, a G2S linker peptide, a MICB peptide, an AEAAKEAAAKA linker peptide, CTA1peptide (cancer-testis antigen peptide 1), CTA2peptide...CTA 33 peptide, AEAAAAKEAAAKA linker peptide and hHPGD, the linker peptide between each CTA peptide is GG; Figure 5Bv is smCTAHb, which contains signal peptide, G2S linker peptide, MICB peptide, AEAAAAKEAAAKA linker peptide, CTA1peptide (cancer-testis antigen peptide 1), CTA2peptide...CTA 33 peptide, AEAAAKEAAAKA linker peptide and hHPGD, the linker peptide between each CTA peptide is PP; Figure 5Bvi is smPCTAHa, which contains signal peptide, G2S linker peptide, MICB peptide, AEAAAKEAAAKA linker peptide, PCTA1peptide (prostate cancer tumor antigen peptide 1), PCTA2peptide...PCTA 10 peptide, AEAAAKEAAAKA linker peptide and hHPGD, and the linker peptide between each PCTA peptide is GG; Figure 5Bvii is smPCTAHb, which includes a signal peptide, a G2S linker peptide, a MICB peptide, an AEAAAKEAAAKA linker peptide, PCTA1peptide (prostate cancer tumor antigen peptide 1), PCTA2peptide...PCTA 10 peptide, AEAAAKEAAAKA linker peptide and hHPGD, the linker peptide between each PCTA peptide is PP; Figure 5Bviii is sMICAH, which includes a signal peptide, a G2S linker peptide, a MICA peptide, an AEAAAKEAAAKA linker peptide and hHPGD.

[0169] Example 5: Verification of Vaccinia Virus Gene Knockout

[0170] At the molecular level, PCR technology was used to verify the gene knockout of vaccinia virus. As shown in Figure 6, compared with the wild-type WR strain genome as a template, when the J2R knockout WR strain (with GFP tag) (WRΔJ2R-GFP) genome was used as a template, the electrophoresis position of the J2R PCR product was higher (the GFP gene fragment was larger than the J2R gene); compared with the J2R knockout WR strain (WRΔJ2R) genome as a template, when the J2R, A52R knockout WR strain (with GFP tag) (WRΔJ2RΔA52R-GFP) genome was used as a template, the P of A52R was higher. The electrophoretic position of the CR product was lower (the GFP gene fragment was smaller than the A52R gene); compared with the WRΔJ2R genome as a template, when the J2R, A52R, A44L-A45R-A46R knockout WR strain (with GFP tag) (WRΔJ2RΔ(A44L-A45R-A46R)-GFP) genome was used as a template, the electrophoretic position of the PCR product of A44L-A45R-A46R was lower (the GFP gene fragment was smaller than the A44L-A45R-A46R gene).

[0171] Example 6: Verification of recombinant virus expressing IL12p70 fusion protein

[0172] At the molecular level, we verified the expression of the IL12p70 fusion proteins (sIL12), type I membrane protein IL12p70 (mIL12I), and type II membrane protein IL12p70 (mIL12II), as shown in Figure 7A. Western blot analysis revealed that CV-1 cells expressed IL12p70 protein 16 hours after infection with the recombinant viruses WRΔJ2R-sIL12, WRΔJ2R-mIL12I, and WRΔJ2R-mIL12II, respectively. However, cells infected with the control virus WRΔJ2R did not express IL12p70 protein (Figure 7B). Flow cytometry revealed that the proportions of IL12p70-positive cells were 4.15%, 96.7%, and 38.9%, respectively, 16 hours after infection with the recombinant viruses WRΔJ2R-sIL12, WRΔJ2R-mIL12I, and WRΔJ2R-mIL12II (Figure 7C).

[0173] Example 7: Functional verification of secretory human HPGD expressed by recombinant virus

[0174] The enzyme-linked immunosorbent assay (ELISA) experiment was used to detect the prostaglandin E2 (PGE2) secretion levels of mouse lung cancer cells LLC infected with recombinant viruses IVIR006a, IVIR008a, the WR strain recombinant virus of intracellular mouse-derived HPGD (WRΔJ2R-HPGD) prepared in step (1) of Example 3, and the control virus WRΔJ2R.

[0175] (1) Collection of cell culture medium samples: LLC cells were infected with recombinant virus at a multiplicity of infection (MOI) of 1. Cell culture medium was collected 24 h after infection and treated with 20 mM arachidonic acid (Sigma-Aldrich) for 4 h before collection. Any cell debris in the cell culture medium was removed by centrifugation (1500 rpm, 5 min) and set aside.

[0176] (2) ELISA: PGE2 concentration in cell culture medium was determined using a 96-well PGE2 ELISA kit (purchased from Caymen). For detailed procedures, refer to the manufacturer's instructions. Samples and standards were performed in quadruplicate. The absorbance of each well was read at 412 nm, and the PGE2 concentration was determined using a standard curve.

[0177] As shown in Figure 8, after 24 hours, the PGE2 concentrations in the cell culture medium were 257 pg / mL in the WRΔJ2R-HPGD-infected group, 142 pg / mL in the IVIR006a-infected group, and 123 pg / mL in the IVIR008a-infected group. These PGE2 concentrations were all lower than those in the WRΔJ2R-infected group (1561 pg / mL), and the differences were statistically significant (one-way ANOVA, p-value < 0.0001). Meanwhile, the PGE2 concentrations between the WRΔJ2R-infected group (1561 pg / mL) and the virus-uninfected group (Cell Only group; 1611 pg / mL) were not statistically significant (P = 0.9886). These results indicate that, compared with intracellular HPGD expressed by WRΔJ2R-HPGD, secreted HPGD expressed by IVIR006a and IVIR008a has a more pronounced effect on PGE2 degradation.

[0178] Example 8: Verification of recombinant virus expressing fusion protein

[0179] Western blotting and flow cytometry were used to detect the fusion protein expressed in CV-1 cells 16 hours after infection with the recombinant virus IVIR004 (expressing sMICBH and mIL12I, Figure 9A). Western blotting results (Figure 9B) showed that cells in the IVIR004-infected group expressed the HPGD protein, while cells in the control virus WRΔJ2R-infected group did not express the HPGD protein. Flow cytometry results (Figure 9C) showed that the proportion of IL12p70-positive cells in the IVIR004-infected group was 94.8%. Western blotting results (Figure 9D) showed that cells in the IVIR004-infected group expressed the IL12p70 protein, while cells in the control virus WRΔJ2R-infected group did not express the IL12p70 protein.

[0180] Example 9: Effect of recombinant virus as a therapeutic cancer vaccine on the immune function of mouse spleen cells

[0181] Based on animal levels, ELISpot assay was used to detect IFNγ-secreting spleen cells from mice injected with recombinant virus.

[0182] (1) Obtaining spleen cells: 6-8 week-old immune-normal female Balb / c or C57BL / 6N mice (purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) were selected and injected intraperitoneally with 100 μL of recombinant virus (IVIR002, IVIR004 and control virus WRΔJ2R) at a position approximately 0.3-0.5 cm to the side of the intersection of the line connecting the two thigh roots and the midline of the abdomen. The injection dose was 5×10 6 PFU / mouse, 6 mice per group. Spleens were harvested from 3 mice on days 7 and 14 post-injection. Spleens were removed, photographed, and spleen cells prepared: spleens were minced, ground, and lysed with RBC lysis buffer, then resuspended in RPMI + 5% FBS complete medium. 10 μL of the sample was collected for cell counting.

[0183] (2) Preparation of immunostimulants: Recombinant viruses were used to infect CV-1 cells at an MOI of 1. After 24 h, the cells were scraped and frozen and thawed three times, centrifuged at 4000 rpm for 6 min, and the supernatant was collected and inactivated (UV 2.5 min / ultrasound 1 time / 30 s-UV 2.5 min) to obtain inactivated viruses for use as stimulants.

[0184] (3) ELISpot experiment: Mouse spleen cells (the number of spleen cells was 5×10 5 or 3×10 5 / well) were inoculated in a 96-well plate pre-coated with IFNγ, and 3 replicates were set up for each group. 10 μL / well of stimulator was added to a 96-well plate containing spleen cells from mice in different injection groups. After culturing in a 37°C incubator for 60 hours, the cells were removed and the antibody incubation, color development and IFNγ spot counting were performed according to the operating steps of the Mouse IFNγ ELISpot Kit (Beijing Dakoway Biotechnology Co., Ltd.) instructions. IFNγ, as a cytokine secreted by immune active cells, plays an important immunomodulatory role in inducing antiviral immunity, including activating T cells, NK cells and phagocytes. Each spot represents a cell that secretes IFNγ. The number of spots reflects the level of immune cell immune response in the sample. The more spots, the higher the level of cellular immune response.

[0185] The IFNγ ELISpot assay was used to detect IFNγ-positive cells in spleen cells of Balb / c female mice 14 days after intraperitoneal injection of recombinant virus IVIR004 (expressing MICB peptide, w / MICB peptide), IVIR002 (not expressing MICB peptide, w / o MICB peptide) or control virus WRΔJ2R.

[0186] The results of IFNγ ELISpot assay (Figure 10A) showed that the spleen cells of mice in the IVIR004 and IVIR002 injection groups contained IFNγ spots. Quantitative analysis (Figure 10B) showed that every 5×10 5 The number of IFNγ spots formed by MICB peptide-associated mouse spleen cells was statistically significant compared to the control group (unpaired T-test, P<0.01). The results indicate that IVIR004, which expresses MICB peptides, can induce significant proliferation of IFNγ-secreting MICB peptide-associated antigen-specific immune cells. These immune cells are able to specifically kill tumor cells expressing the relevant tumor antigens without affecting normal tissue cells.

[0187] Example 10: Verification of fusion protein of recombinant virus

[0188] WB and flow cytometry experiments were used to detect the fusion protein expressed 16 hours after CV-1 cells were infected with the recombinant virus IVIR006a (expressing smCTAH and mIL12I, Figure 11A). WB results (Figure 11B) showed that cells in the IVIR006a-infected group expressed HPGD protein, while cells in the control virus WRΔJ2R-infected group did not express HPGD protein. Flow cytometry results (Figure 11C) showed that the proportion of IL12p70-positive cells in the IVIR006a-infected group was 90.8%. WB results (Figure 11D) also showed that cells in the IVIR006a-infected group expressed IL12p70 protein, while cells in the control virus WRΔJ2R-infected group did not express IL12p70 protein.

[0189] Example 11: Effect of recombinant virus as a therapeutic cancer vaccine on the immune function of mouse spleen cells

[0190] Based on animal studies, ELISpot assay was used to detect IFNγ secretion in spleen cells derived from mice injected with the recombinant virus. The experimental method was similar to that in Example 9.

[0191] The IFNγ ELISpot assay was used to detect IFNγ-positive cells in the spleen cells of C57BL / 6N female mice 14 days after intraperitoneal injection of recombinant virus IVIR006a (expressing MICB peptide and CTA peptide, w / MICB peptide+CTA peptides), IVIR002 (not expressing MICB peptide and CTA peptide, w / o MICB peptide+CTA peptides) or control virus WRΔJ2R.

[0192] The results of IFNγ ELISpot assay (Figure 12A) showed that the spleen cells of mice in the IVIR006a and IVIR002 injection groups contained IFNγ spots. Quantitative analysis (Figure 12B) showed that every 5×10 5 The number of IFNγ spots formed by mouse spleen cells associated with the MICB peptide and CTA peptide was statistically significant compared to the control (unpaired T-test, p-value < 0.0001). These results indicate that IVIR006a expressing MICB and CTA peptides can induce significant proliferation of antigen-specific immune cells that secrete IFNγ and are associated with the MICB peptide + CTA peptide. These immune cells are able to specifically kill tumor cells expressing the relevant tumor antigens without affecting normal tissue cells.

[0193] Example 12: Effects of Recombinant Viruses as Therapeutic Cancer Vaccines on Lung and Colon Cancer Tumor Growth in Mice

[0194] Xenograft tumor experiments were used to monitor the growth of mouse tumor cell transplants and the effects of recombinant viruses as therapeutic cancer vaccines on tumor growth.

[0195] 6-8 week old C57BL / 6N female mice (purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) were selected and raised for one week. The left hind limb groin was shaved. Two days later, 100 μL of LLC lung cancer cell suspension (containing 5×10 5 LLC cells) or 50 μL colon cancer cell MC38 suspension (containing 5×10 5 MC38 cells) were used to form spherical protrusions. LLC cells were purchased from Wuhan Procell, and MC38 cells were purchased from Shanghai Yaji Biotechnology. Tumor cells were suspended in PBS. Cell count and mycoplasma testing were performed before subcutaneous implantation. Suitable cells for implantation were those in the logarithmic growth phase (70-80% density), free of mycoplasma, and free of bacterial contamination. Ten or thirteen days after implantation, tumor size was measured, and mice with tumors of appropriate size were randomly divided into groups of 9-10 mice per group.

[0196] On days 13 and 16 after LLC cell implantation, recombinant viruses IVIR001 (expressing sHPGD and mIL12I) or IVIR006a (expressing smCTAH and mIL12I) were used for lung cancer tumor treatment ( Figure 13A ), respectively. 100 μL of virus suspension (containing 1×10 7 PFU of virus) or an equivalent volume of PBS. Starting from day 13 after LLC cell implantation, tumor volume was monitored by caliper measurement twice a week. Tumor volume calculated as an ellipsoid = π / 6 × L (long diameter) × W (short diameter) 2 When the tumor volume is greater than 1400 mm 3 The animals were euthanized at 4 ℃ and 8 ℃. The statistically significant reduction in tumor growth rate during treatment of the LLC xenograft tumor model illustrates the therapeutic tumor advantage of the therapeutic cancer vaccine. Survival data were compared using GraphPad software, and the log-rank (Mantel Cox) test was used to determine the significance of the survival difference. The significance was determined using an unpaired Student's T test (*p-value < 0.05). Tumor growth curves were plotted based on tumor volume, and the results (Figure 13A) showed that the tumor growth curves of the IVIR006a-treated group and the IVIR001-treated group were lower than those of the control group (equal volume of PBS); on day 24 after cell implantation, the tumor volume of the IVIR006a-treated group and the IVIR001-treated group was significantly smaller than that of the control group (p-value < 0.05).

[0197] On the 10th and 13th days after MC38 cells were implanted, colon cancer tumors were treated with recombinant virus IVIR006a or control virus WRΔJ2R ( Figure 13B ), and 50 μL of virus suspension (containing 5×10 6 PFU of virus) or an equal volume of PBS. Starting from the 10th day after MC38 cell implantation, the tumor volume was monitored by caliper measurement twice a week. When treating the MC38 xenograft tumor model, the calculation of tumor volume, the drawing of tumor growth curve, the determination of significance (*p-value < 0.05), etc. were all referred to the above-mentioned LLC xenograft tumor model treatment. The results (Figure 13B) showed that the tumor growth curve of the IVIR006a-treated group was lower than that of the control virus WRΔJ2R-treated group and the control group (equal volume of PBS); on the 23rd and 27th days after cell implantation, the tumor volume of the IVIR006a-treated group was significantly smaller than that of the control virus WRΔJ2R-treated group (p-value < 0.05).

[0198] Example 13: Verification of fusion protein of recombinant virus

[0199] WB and flow cytometry experiments were used to detect the fusion protein expressed 16 hours after CV-1 cells were infected with the recombinant virus IVIR008a (expressing smPCTAH and mIL12I, Figure 14A). The WB results (Figure 14B) showed that cells in the IVIR008a-infected group expressed HPGD protein, while cells in the control virus WRΔJ2R-infected group did not express HPGD protein. The flow cytometry results (Figure 14C) showed that the proportion of IL12p70-positive cells in the IVIR008a-infected group was 91.4%. The WB results (Figure 14D) also showed that cells in the IVIR008a-infected group expressed IL12p70 protein, while cells in the control virus WRΔJ2R-infected group did not express IL12p70 protein.

[0200] Example 14: Effect of recombinant virus as a therapeutic cancer vaccine on the immune function of mouse spleen cells

[0201] Based on animal studies, ELISpot assay was used to detect IFNγ secretion in spleen cells derived from mice injected with the recombinant virus. The experimental method was similar to that in Example 9.

[0202] The IFNγ ELISpot assay was used to detect IFNγ-positive cells in the spleen cells of Balb / c female mice 14 days after intraperitoneal injection of recombinant virus IVIR008a (expressing MICB peptide and PCTA peptide, w / MICB peptide+PCTA peptides), IVIR002 (not expressing MICB peptide and PCTA peptide, w / o MICB peptide+PCTA peptides) or control virus WRΔJ2R.

[0203] The results of IFNγ ELISpot assay (Figure 15A) showed that the spleen cells of mice in the IVIR008a and IVIR002 injection groups contained IFNγ spots. Quantitative analysis (Figure 15B) showed that every 3×10 5 The number of IFNγ spots formed by mouse spleen cells associated with the MICB and PCTA peptides was statistically significant compared to the control (unpaired T-test, p-value < 0.01). These results indicate that IVIR008a expressing the MICB and PCTA peptides can induce significant proliferation of antigen-specific immune cells that secrete IFNγ and are associated with the MICB and PCTA peptides. These immune cells are able to specifically kill tumor cells expressing the relevant tumor antigens without affecting normal tissue cells.

[0204] Example 15: Verification of fusion protein of recombinant virus

[0205] Western blotting was used to detect the fusion protein expression in CV-1 cells 16 hours after infection with the recombinant virus IVIR009 (expressing sMICAH and mIL12I, Figure 16A). Western blotting results (Figure 16B) showed that cells in the IVIR009-infected group expressed the HPGD protein, while cells in the control virus WRΔJ2R-infected group and the virus-uninfected group (Cell only group) did not express the HPGD protein. Western blotting results (Figure 16C) also showed that cells in the IVIR009-infected group expressed the IL12p70 protein, while cells in the control virus WRΔJ2R-infected group and the virus-uninfected group (Cell only group) did not express the IL12p70 protein.

[0206] Example 16: Effect of recombinant virus as a therapeutic cancer vaccine on the immune function of mouse spleen cells

[0207] Based on animal studies, ELISpot assay was used to detect IFNγ secretion in spleen cells derived from mice injected with the recombinant virus. The experimental method was similar to that in Example 9.

[0208] The IFNγ ELISpot assay was used to detect IFNγ-positive cells in the spleen cells of Balb / c female mice 14 days after intraperitoneal injection of IVIR009 (expressing MICA peptide, w / MICA peptide), IVIR002 (not expressing MICA peptide, w / o MICA peptide) or the control virus WRΔJ2R.

[0209] The results of IFNγ ELISpot assay (Figure 17A) showed that the spleen cells of mice in the IVIR009 and IVIR002 injection groups contained IFNγ spots. Quantitative analysis (Figure 17B) showed that every 5×10 5 The number of IFNγ spots formed by MICA peptide-associated mouse spleen cells was statistically significant compared to the control (unpaired T-test, p-value < 0.01). These results indicate that IVIR009, which expresses the MICA peptide, can induce significant proliferation of IFNγ-secreting MICA peptide-associated antigen-specific immune cells. These immune cells are able to specifically kill tumor cells expressing the relevant tumor antigen without affecting normal tissue cells.

[0210] Example 17: Verification of fusion protein of recombinant virus

[0211] IVIR006 includes two subtypes, a and b. The similarities between the two subtypes are that they both express a secreted fusion MICB peptide, a fusion protein of multiple cancer-testis antigen peptides and human HPGD (secreted MICB peptide+multiple CTA peptides+hHPGD, smCTAH), and type I membrane protein IL12p70 (mIL12I). The difference lies in the linker peptides between the CTA peptides. IVIR006a uses a GG linker peptide (Figure 11A), and IVIR006b uses a PP linker peptide (Figure 18A). WB and flow cytometry experiments were used to detect the fusion protein expressed 16 hours after CV-1 cells were infected with the recombinant virus IVIR006b. The WB results (Figures 18B and D) showed that cells in the IVIR006b-infected group expressed HPGD protein and IL12p70 protein, while cells in the control virus WRΔJ2R-infected group did not express HPGD protein and IL12p70 protein; the flow cytometry results (Figure 18C) showed that the proportion of IL12p70-positive cells in the IVIR006b-infected group was 90.6%.

[0212] IVIR008 includes two subtypes, a and b. The similarities between the two are that they both express a fusion protein of secreted fusion MICB peptide, multiple prostate cancer tumor antigen peptides and human HPGD (secreted MICB peptide+multiple PCTA peptides+hHPGD, smPCTAH) and type I membrane protein IL12p70 (mIL12I). The difference lies in the different linker peptides between the PCTA peptides. IVIR008a uses a GG linker peptide (Figure 14A) and IVIR008b uses a PP linker peptide (Figure 19A). WB and flow cytometry experiments were used to detect the fusion protein expressed 16 hours after CV-1 cells were infected with the recombinant virus IVIR008b. The WB results (Figures 19B and D) showed that cells in the IVIR008b-infected group expressed HPGD protein and IL12p70 protein, while cells in the control virus WRΔJ2R-infected group did not express HPGD protein and IL12p70 protein; the flow cytometry results (Figure 19C) showed that the proportion of IL12p70-positive cells in the IVIR008b-infected group was 86.9%.

[0213] Example 18: Verification of fusion protein of recombinant virus

[0214] Western blotting and flow cytometry were used to detect the fusion proteins expressed 16 h after CV-1 cells were infected with recombinant viruses IVIR010, IVIR011, IVIR012, and IVIR013 (all expressing mIL12I and expressing sHPGD, sMICBH, smCTAH, and smPCTAH, respectively, Figure 20A). IVIR012 contains two subtypes, a and b. The similarity between the two is that they both express smCTAH and mIL12I, but the difference is that the linker peptides between the CTA peptides are different, among which IVIR012a uses a GG linker peptide and IVIR012b uses a PP linker peptide; IVIR013 contains two subtypes, a and b. The similarity between the two is that they both express smPCTAH and mIL12I, but the difference is that the linker peptides between the PCTA peptides are different, among which IVIR013a uses a GG linker peptide and IVIR013b uses a PP linker peptide. Western blot results (Figures 20B and C) showed that cells infected with IVIR010, IVIR011, IVIR012a, IVIR012b, IVIR013a, and IVIR013b expressed HPGD and IL12p70 proteins, while cells infected with the control virus WRΔJ2R did not express HPGD and IL12p70 proteins. Flow cytometry results (Figure 20D) showed that the proportion of IL12p70-positive cells in the IVIR011, IVIR012b, and IVIR013b infection groups was 82.4%, 78.0%, and 84.9%, respectively.

[0215] Example 19: Effect of recombinant virus as a therapeutic cancer vaccine on the immune function of mouse spleen cells

[0216] Based on animal studies, ELISpot assay was used to detect IFNγ secretion in spleen cells derived from mice injected with the recombinant virus. The experimental method was similar to that in Example 9.

[0217] The IFNγ ELISpot assay was used to detect IFNγ-positive cells in the spleen cells of Balb / c female mice 7 days after intraperitoneal injection of IVIR011 (expressing MICB peptide, w / MICB peptide), IVIR012b (expressing MICB peptide + CTA peptide, w / MICB peptide + CTA peptides), IVIR013b (expressing MICB peptide + PCTA peptide, w / MICB peptide + PCTA peptides), IVIR010 (not expressing MICB peptide, MICB peptide + CTA peptide and MICB peptide + PCTA peptide, w / o MICB peptide, MICB peptide + CTA peptides or MICB peptide + PCTA peptides) or control virus WRΔJ2R.

[0218] The results of IFNγ ELISpot experiment (Figure 21A) showed that the spleen cells of mice injected with IVIR010, IVIR011, IVIR012b and IVIR013b all contained IFNγ spots. 5 The number of IFNγ spots formed by mouse spleen cells in response to MICB peptide alone, MICB peptide + CTA peptide, and MICB peptide + PCTA peptide was statistically significant compared to the control (unpaired T test, p-value < 0.05, p-value < 0.01, and p-value < 0.0001, respectively). These results indicate that IVIR011, IVIR012b, and IVIR013b can induce significant proliferation of IFNγ-secreting immune cells specific for the corresponding antigens. These immune cells are capable of specifically killing tumor cells expressing the relevant tumor antigens without affecting normal tissue cells.

[0219] The above results indicate that linker peptides (GG or PP) between multiple tumor antigen peptides can be used to design tumor antigen peptide fusion proteins.

[0220] Incorporated by Reference

[0221] Each patent and scientific document mentioned herein is incorporated by reference in its entirety for all purposes.

[0222] Equivalence

[0223] The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered in all cases as illustrative rather than limiting of the invention described herein. The scope of the present invention is therefore indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalence of the claims are intended to be embraced therein.

[0224] Sequence Listing

[0225] Table 1 Amino acid sequence Note: The underlined part is the peptide segment used to prepare the fusion protein, and the italicized GG and PP are linker peptides.

[0226] Table 2 Amino acid sequences of tumor antigen peptide fusion proteins Note: The underlined part is the linker peptide, and the italic part is the signal peptide.

[0227] Table 3 Amino acid sequence encoded by A34R

[0228] Table 4 Amino acid sequence of IL12 p70 fusion protein Note: The underlined part is the linker peptide, and the italicized part is the signal peptide, signal anchor peptide or transmembrane peptide.

[0229] Table 5 Amino acid sequences of tumor antigen peptides

[0230] Table 6 Nucleotide sequence of expressed fusion protein

Claims

1. A tumor antigen peptide fusion protein, which comprises a signal peptide, human 15-hydroxyprostaglandin dehydrogenase (HPGD), and optionally at least one tumor antigen peptide.

2. The tumor antigen peptide fusion protein according to claim 1, wherein, The tumor antigen peptide fusion protein comprises, from the N-terminus to the C-terminus, a polypeptide combination selected from any one of the following groups (i)-(iii) connected in the following order: (i) a signal peptide, HPGD, and one or more tumor antigen peptides; (ii) a signal peptide, one or more tumor antigen peptides, and HPGD; and (iii) a signal peptide, one or more tumor antigen peptides, HPGD, and one or more tumor antigen peptides.

3. The tumor antigen peptide fusion protein according to claim 1 or 2, wherein, Between the HPGD and the tumor antigen peptide, and between multiple tumor antigen peptides, they are connected by a linker peptide; preferably, the linker peptide is selected from GG, G2S, G3S, (G4S) n (n≥1, preferably 1, 2, 3 or 4), [A(EAAAK) n A] m (n = 2, 3 or 4, m = 1 or 2), (XP) n (n≥1, X is any amino acid), (CW) n (n≥1), one or more of GFLG, PLGLWA, RVLAEA.

4. The tumor antigen peptide fusion protein according to any one of claims 1-3, wherein, The tumor antigen peptide is selected from MHC class I polypeptide-related sequence B (MICB) peptides and MHC class I polypeptide-related sequence A (MICA) peptides.

5. The tumor antigen peptide fusion protein according to claim 4, wherein, The tumor antigen peptide further includes tumor antigen peptides selected from prostate cancer tumor antigen (PCTA) peptides and cancer-testis antigen (CTA) peptides.

6. The tumor antigen peptide fusion protein according to any one of claims 1-5, wherein, The signal peptide comprises SEQ ID NO: 7, or an amino acid sequence having a sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more than 99.8% with SEQ ID NO: 7; and / or The HPGD comprises SEQ ID NO: 1 or 2, or an amino acid sequence having a sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more than 99.8% with SEQ ID NO: 1 or 2; and / or The MICB peptide comprises SEQ ID NO: 28, or an amino acid sequence having a sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more than 99.8% with SEQ ID NO:

28.

7. The tumor antigen peptide fusion protein according to any one of claims 2-6, wherein, The fusion protein comprises a polypeptide combination selected from any one of the following groups (1)-(5): (1) sHPGD: signal peptide + HPGD; (2) sMICBH: signal peptide + MICB peptide + HPGD; (3) sMICAH: signal peptide + MICA peptide + HPGD; (4)smCTAH: Signal peptide + MICB peptide + CTA1 peptide + CTA2 peptide + … + CTA 33 peptide + HPGD, where CTA1 peptide, CTA2 peptide, … CTA 33 peptide are different; (5)smPCTAH: Signal peptide + MICB peptide + PCTA1 peptide + PCTA2 peptide +... + PCTA 10 peptide + HPGD, where PCTA1 peptide, PCTA2 peptide,... PCTA 10 peptides are the same.

8. The tumor antigen peptide fusion protein according to any one of claims 1-7, wherein After the signal peptide at the N-terminus of the tumor antigen peptide fusion protein, an IL12 p70 protein is further comprised.

9. The tumor antigen peptide fusion protein according to any one of claims 1-8, wherein, The tumor antigen peptide fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 12-18, or an amino acid sequence having a sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more than 99.8% with the amino acid sequences selected from SEQ ID NOs: 12-18.

10. A composition comprising the tumor antigen peptide fusion protein according to any one of claims 1-9 and an IL12 p70 fusion protein, wherein the IL12 p70 fusion protein comprises, from the N-terminus to the C-terminus: a signal peptide or signal anchor peptide, an IL12 p70 protein, and optionally a transmembrane peptide.

11. The composition according to claim 10, wherein, The IL12 p70 protein is IL12 p40 and IL12 p35 linked by a linker peptide.

12. The composition according to claim 10 or 11, wherein The IL12 p70 fusion protein comprises any one of the polypeptide combinations selected from (i)-(iii): (i) A signal peptide, IL12, a linker peptide, and IL12 linked in sequence; (ii) A signal peptide, IL12, a linker peptide, IL12, and a transmembrane peptide linked in sequence; (iii) A signal anchor peptide, IL12, a linker peptide, and IL12 linked in sequence; Wherein, the two IL-12s in the above (i)-(iii) are respectively IL-12 p35 or IL-12 p40; preferably, the linker peptide is selected from GG, G2S, G3S, (G4S) n (n≥1, preferably 1, 2, 3 or 4), [A(EAAAK) n A] m (n = 2, 3 or 4, m = 1 or 2), (XP) n (n≥1, X is any amino acid), (CW) n (n≥1), one or more of GFLG, PLGLWA, RVLAEA.

13. The composition according to claim 12, wherein, The IL12 p40 is a murine or human IL12 p40 fragment, and the IL12 p35 is a murine or human IL12 p35 fragment.

14. The composition according to any one of claims 10 - 12, wherein, The IL12 p70 fusion protein comprises an amino acid sequence selected from SEQ ID NOs: 21-26, or an amino acid sequence having a sequence identity of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 99.8% or more with the amino acid sequences selected from SEQ ID NOs: 21-26.

15. A nucleic acid construct encoding the tumor antigen peptide fusion protein according to any one of claims 1-9, or the composition according to any one of claims 10-14; preferably, the nucleic acid construct is a DNA fragment, mRNA, or plasmid.

16. A genetically engineered recombinant virus comprising the nucleic acid construct according to claim 15, which construct is a DNA fragment.

17. The recombinant virus according to claim 16, wherein the vector of the recombinant virus is selected from poxvirus, adenovirus, and herpes simplex virus; wherein, The poxvirus is selected from the strains of Vaccinia virus Western Reserve (WR), Copenhagen, Lister, Ankara, Modified Vaccinia Ankara, New York Vaccinia, Tian Tan, Dryvax, Bern, Paris, Tash Kent, IHD-J, IHD-W, Brighton, CVA382, Dairen, LC16m8, LC16M0, LIVP, ACAM2000, WR65-16, Connaught, EM-63 and their derivative strains and genetically engineered strains.

18. The recombinant virus according to claim 17, wherein the genetically engineered strain is a knockout of one or more of the following gene sequences: J2R, A34R, A44L, A45R, A46R, A52R.

19. The recombinant virus according to claim 18, wherein the genetically engineered strain is a knockout and exogenous gene knock-in of one or more of the J2R, A34R, A44L-A45R-A46R, and A52R gene sequences; preferably, the A44L-A45R-A46R gene comprises any one, or any combination of two or three of the A44L, A45R, and A46R genes, preferably a combination of the three genes A44L, A45R, and A46R.

20. The recombinant virus according to claim 19, wherein the exogenous gene knock-in is a tumor-targeting gene knock-in, a coding gene knock-in of a therapeutic factor, and / or a tumor suppressor gene knock-in.

21. The recombinant virus according to claim 20, wherein the therapeutic factor comprises one or more of cytokines, co-stimulatory molecules, immune checkpoint inhibitors, anti-angiogenic factors, and nucleic acid polymers; wherein the cytokine is preferably one or more of chemokines, interferon (INF), interleukin (IL), and tumor necrosis factor (TNF).

22. The recombinant virus according to claim 20, wherein the tumor suppressor gene is the coding gene of HPGD and its homologs or fusion proteins.

23. The recombinant virus according to claim 17, wherein the vector of the recombinant virus is an extracellular vesicle-coated virus enhanced vaccinia virus, which is a vaccinia virus WR strain containing a modified A34R gene; preferably, the modification includes replacement and / or mutation of the A34R gene, preferably, the modification includes replacing the A34R gene of the vaccinia virus WR strain with the A34R gene of the vaccinia virus Copenhagen strain, IHD-J strain, or IHD-W strain; preferably, the extracellular vesicle-coated virus enhanced vaccinia virus contains the A34R gene of the Copenhagen strain, which encodes an amino acid sequence comprising SEQ ID NO: 19 or a variant thereof.

24. An expression system, which comprises a host cell and the genetically engineered recombinant virus according to any one of claims 16-23.

25. A pharmaceutical composition, which comprises the tumor antigen peptide fusion protein according to any one of claims 1-9, the composition according to any one of claims 10-14, the nucleic acid construct according to claim 15, or the genetically engineered recombinant virus according to any one of claims 16-23; and a pharmaceutically acceptable carrier.

26. The pharmaceutical composition according to claim 25, wherein the pharmaceutical composition further comprises a combined use with an anti-cancer agent.

27. A method for treating or preventing a tumor, which comprises administering the tumor antigen peptide fusion protein according to any one of claims 1-9, the composition according to any one of claims 10-14, the nucleic acid construct according to claim 15, the genetically engineered recombinant virus according to any one of claims 16-23, or the pharmaceutical composition according to claim 25 or 26. Use of the tumor antigen peptide fusion protein according to any one of claims 1-9, the composition according to any one of claims 10-14, the nucleic acid construct according to claim 15, the genetically engineered recombinant virus according to any one of claims 16-23, or the pharmaceutical composition according to claim 25 or 26 in the preparation of a medicament for treating or preventing tumors.

29. The method according to claim 27 or the use according to claim 28, wherein, The tumor is a solid tumor or a non-solid tumor; preferably, the solid tumor is selected from: breast cancer, lung cancer, colon cancer, ovarian cancer, melanoma, kidney cancer, liver cancer, gastric cancer, glioma, pancreatic cancer, osteosarcoma, prostate cancer, bladder cancer, rectal cancer, mesothelioma, cervical cancer, endometrial cancer, lymphoma, and nasopharyngeal carcinoma.

30. A method for activating or enhancing the function of immune cells, which comprises administering the tumor antigen peptide fusion protein according to any one of claims 1-9, the composition according to any one of claims 10-14, the nucleic acid construct according to claim 15, the genetically engineered recombinant virus according to any one of claims 16-23, or the pharmaceutical composition according to claim 25 or 26.

Images