Complement factor b-modulating compositions and methods of use thereof

AU2024419845A1Pending Publication Date: 2026-08-20ADARX PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
AU2024419845
Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-09
Filing Date
2024-12-16
Publication Date
2026-08-20

AI Technical Summary

Technical Problem

Inappropriate complement activation contributes to various diseases, including atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, and rheumatoid arthritis (RA), necessitating effective treatments to modulate Complement Factor B (CFB) expression or activity.

Method used

Development of compounds and compositions that specifically inhibit CFB mRNA and protein expression or activity, targeting cells or tissues to reduce tissue damage associated with complement pathway dysregulation, using antisense oligonucleotides and other agents to achieve potent and tolerable inhibition of CFB.

Benefits of technology

The compounds effectively inhibit CFB expression, ameliorating or preventing tissue damage in diseases such as aHUS, PNH, C3G, IgAN, SLE, diabetic nephropathy, MPGN, and AMD, by reducing complement pathway activity, thereby slowing disease progression and improving clinical outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Aspects of the disclosure provide compounds, compositions, and methods for modulating the expression or activity of Complement Factor B (CFB). In some aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of CFB mRNA in a cell or animal. In some aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of CFB protein in a cell or animal.
Need to check novelty before this filing date? Find Prior Art

Description

COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 619,249, filed January 9, 2024, which is hereby incorporated by reference in its entirety. BACKGROUND

[0002] Complement Factor B (CFB) is an important component of the alternative pathway of complement activation. CFB is a serine protease secreted from the liver. CFB circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Production of C3 convertase leads to the formation of C5 convertase which cleaves C5 and triggers events that result in the formation of the lytic membrane attack complex (MAC). The membrane attack complex forms transmembrane channels and disrupts the phospholipid bilayer of target cells, leading to cell lysis.

[0003] Inappropriate complement activation contributes to many different diseases, including, for example, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia and reperfusion injury, and rheumatoid arthritis (RA). Accordingly, there is a need to find effective treatments for complement related diseases. SUMMARY

[0004] The present disclosure provides compounds, compositions, and methods for modulating the expression or activity of Complement Factor B (CFB). In certain embodiments, the compounds, compositions, and methods can be used to reduce the expression of CFB mRNA in acell or animal. In certain embodiments, the compounds, compositions, and methods can be used to reduce the amount of CFB protein in a cell or animal.

[0005] In certain embodiments, the animal has or is at risk of having a complement pathway related disease, disorder or condition or a symptom thereof. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). Certain compounds, compositions and methods provided herein are directed to reducing tissue damage, for example ocular damage or kidney damage, related to dysregulation of the complement pathway. Certain compounds, compositions and methods provided herein are directed to reducing atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC- MPGN, polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in an animal. In certain embodiments, the compounds and compositions provided herein are potent and tolerable and inhibit CFB expression, which can be used to treat, prevent, ameliorate, or slow progression of tissue damage, for example ocular damage or kidney damage, related to dysregulation of the complement pathway. In certain embodiments, the compounds and compositions provided herein are potent and tolerable and inhibit CFB expression, which can be used to treat, prevent, ameliorate, or slow progression of atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC- MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographicatrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

[0006] In certain embodiments, the compounds and compositions comprise one or more features that are effective for increasing potency. In certain embodiments, the compounds and compositions comprise one or more features that are effective for increasing tolerability. In certain embodiments, compounds and compositions comprise one or more features that are effective for targeting the compound or composition to a cell or tissue. In certain embodiments, the compounds and compositions are more potent or have greater therapeutic value than compounds publicly disclosed. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] The accompanying Drawings, which constitute a part of this specification, illustrate several embodiments of the disclosure and together with the accompanying description, serve to explain the principles of the disclosure.

[0008] FIG. 1 shows a Schema for RD2830 Phase 1 Clinical Study, as described in Example 4, wherein SAD means single ascending dose; SC means subcutaneous; and SRC means Safety Review Committee.

[0009] FIG. 2 shows a decision tree illustrating the process for transitioning to Part B (PNH Patient Treatment) of the clinical study described in Example 4.

[0010] FIG. 3 is a plot showing average relative plasma complement factor b (CFB) protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 after administration, obtained from participants in Cohort 1 (0.4 mg / kg) and Cohort 4 (1 mg / kg) administered a single subcutaneous dose of RD2830.

[0011] FIG. 4 is a plot showing average relative plasma alternative pathway protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 after administration, obtained from participants in Cohort 1 (0.4 mg / kg) and Cohort 4 (1 mg / kg) administered a single subcutaneous dose of RD2830.

[0012] FIG. 5 is a plot showing average relative plasma classical pathway protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 after administration, obtained from participants in Cohort 1 (0.4 mg / kg) and Cohort 4 (1 mg / kg) administered a single subcutaneous dose of RD2830.

[0013] FIGs. 6A-6C include diagrams showing the decision tree to re-treat with RD2830 (ADX- 038).

[0014] FIG. 7 includes two diagrams showing the pharmacokinetics of ADX-038, by showing the plasma concentration of ADX-038 in cohorts 1-4 over 30 hours (in time and by log).

[0015] FIG. 8 is a graph showing the pharmacodynamics of ADX-038, i.e., the mean (SE) percent change from baseline in alternative pathway (AP) activity levels over time in Study ADX-038-101 (Preliminary Results; PD Population).

[0016] FIG. 9 shows the proportion of subjects able to achieve ≥95% inhibition of alternative pathway (AP) activity by actual dose administered.

[0017] FIG. 10 shows a general schema for ADX-038 Phase 2a Clinical Study, as described in Example 5.

[0018] FIG. 11 shows a general schema for ADX-038 Phase 2 Clinical Study, as described in Example 6. DETAILED DESCRIPTION

[0019] It is to be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0020] All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, NCBI and other sequence reference records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety as of the date of filing this application.

[0021] It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase even if shown in context with a modified compound. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Oligomeric compounds referenced by Compound Number or Ref ID NO indicate a combination of nucleobase sequence, chemical modification, and motif.

[0022] Herein, the use of the singular includes the plural unless specifically stated otherwise. For example, the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting and is used interchangeably with, the phrase "including but not limited to". Definitions

[0023] Unless otherwise indicated, the following terms have the following meanings:

[0024] “Complement Factor B,” used interchangeably with the term “CFB,” refers to any nucleic acid or protein of CFB. Exemplary nucleotide and amino acid sequences of CFB can be found, for example, at GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 1), nucleotides 31946095 to 31952084 of GenBank Accession No. NC_000006.12 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 3), and nucleotides 3423522 to 3429511 of GenBank Accession No. NT_113891.3 (incorporated herein as SEQ ID NO: 4). Additional examples of CFB sequences are readily available through publicly available databases, e.g., GenBank, UniProt, and OMIM. Further information on CFB can be found, for example, at https: / / www.ncbi.nlm.nih.gov / gene / ?term=CFB. CFB, as used herein, also refers to variations of the CFB gene including variants provided in the SNP database. Numerous sequence variations within the CFB gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., https: / / www.ncbi.nlm.nih.gov / snp / ?term=CFB). “CFB mRNA” means an mRNA encoding a CFB protein. CFB may be referred to in either upper or lower case.

[0025] “CFB specific inhibitor” refers to any agent capable of specifically inhibiting CFB RNA and / or CFB protein expression or activity at the molecular level. For example, CFB specific inhibitors include nucleic acids (including oligonucleotide compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CFB RNA and / or CFB protein.

[0026] “2’-O-methoxyethyl” or “2’-MOE” means a 2’-O(CH2)2-OCH3 modification. A 2’-O- methoxyethyl modified sugar is a modified sugar with 2’-O(CH2)2-OCH3in the place of the 2’- OH group of a ribosyl ring.

[0027] “5’ start site” means the nucleotide of the target nucleic acid or region which is aligned to the 3’-most nucleoside of an antisense oligonucleotide.

[0028] “3’ stop site” means the nucleotide of the target nucleic acid or region which is aligned to the 5’-most nucleoside of an antisense oligonucleotide.

[0029] “About” means within ±10% of a value. For example, if it is stated, “a compound achieved about 70% inhibition of CFB”, it is implied that CFB levels are inhibited within a range of 60% and 80%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0030] “Administer” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example, routes of administration that can be used include, but are not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

[0031] “Ameliorate” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

[0032] “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0033] “Antisense oligonucleotide” or “antisense strand” means an oligonucleotide which includes a region that is complementary to a target nucleic acid, e.g., a CFB RNA or a region thereof.

[0034] “Complementarity” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that is complementary to the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (Τ), adenine (A) and uracil (U), and cytosine (C) and guanine (G) unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fullycomplementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

[0035] “Composition” or “pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

[0036] “Co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Co-administration does not require both compounds to be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Co-administration includes parallel or sequential administration of the one or more compounds.

[0037] “Conjugate group” means a group of atoms that is attached to an oligonucleotide. A conjugate group is optionally attached to an oligonucleotide through a conjugate linker. A conjugate group may, for example, alter the distribution, targeting, or half-life of a compound into which it is incorporated. Conjugate groups include targeting moieties.

[0038] “Conjugate linker” means a group of atoms comprising at least one bond that connects a linked moiety to an oligonucleotide.

[0039] “Identity” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. Identity of an oligonucleotide to another oligonucleotide or nucleic acid need not require each nucleobase to match and may include one or more different nucleobases. By contrast, “fully identical” or “100% identity” in reference to oligonucleotides means that such oligonucleotides have the same nucleobase at each relative position over its length as the other oligonucleotide or nucleic acid.

[0040] “Individual” means a human or non-human animal selected for treatment or therapy.

[0041] “Inhibiting the expression or activity” with reference to a target nucleic acid or protein means to reduce or block the expression or activity of such target relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

[0042] As used herein, the term “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0043] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations as further described below. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0044] The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I), or carbon-14 (14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are encompassed within the scope of the present disclosure.

[0045] The term “isotopic variant” refers to a therapeutic agent (e.g., a compound and / or modified oligonucleotide disclosed herein) that contains an unnatural proportion of an isotope at one or more of the atoms that constitute such a therapeutic agent. In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (2H), tritium (3H), carbon-11 (11C), carbon-12 (12C), carbon-13 (13C), carbon-14 (14C), nitrogen-13 (13N), nitrogen-14 (14N), nitrogen-15 (15N), oxygen-14 (14O), oxygen-15 (15O), oxygen-16 (16O), oxygen-17 (17O), oxygen-18 (18O), fluorine-17 (17F), fluorine-18 (18F), phosphorus-31 (31P), phosphorus-32 (32P), phosphorus-33 (33P), sulfur-32 (32S), sulfur-33 (33S), sulfur-34 (34S), sulfur-35 (35S), sulfur-36 (36S), chlorine-35 (35Cl), chlorine-36 (36Cl), chlorine-37 (37Cl), bromine-79 (79Br), bromine-81 (81Br), iodine 123 (123I), iodine-125 (125I), iodine-127 (127I), iodine-129 (129I), and iodine-131(131I). In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (2H), tritium (3H), carbon-11 (11C), carbon-12 (12C), carbon-13 (13C), carbon-14 (14C), nitrogen-13 (13N), nitrogen-14 (14N), nitrogen-15 (15N), oxygen-14 (14O), oxygen-15 (15O), oxygen-16 (16O), oxygen-17 (17O), oxygen-18 (18O), fluorine-17 (17F), fluorine-18 (18F), phosphorus-31 (31P), phosphorus-32 (32P), phosphorus-33 (33P), sulfur-32 (32S), sulfur-33 (33S), sulfur-34 (34S), sulfur- 35 (35S), sulfur-36 (36S), chlorine-35 (35Cl), chlorine-36 (36Cl), chlorine-37 (37Cl), bromine-79 (79Br), bromine-81 (81Br), iodine 123 (123I), iodine-125 (125I), iodine-127 (127I), iodine-129 (129I), and iodine-131 (131I).

[0046] It will be understood that, in a therapeutic agent (e.g., a compound and / or modified oligonucleotide disclosed herein), any hydrogen can be2H, for example, or any carbon can be13C, for example, or any nitrogen can be15N, for example, or any oxygen can be18O, for example, where feasible according to the judgment of one of skill. In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of deuterium (D).

[0047] “Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide or nucleic acid that is not complementary to the corresponding nucleobase of a second oligonucleotide or nucleic acid when the first oligonucleotide / nucleic acid and second oligonucleotide / nucleic acid are aligned in an antiparallel orientation. For example, nucleobases including, but not limited to, a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to the nucleobase to which they are hybridized. As another example, a nucleobase of a first oligonucleotide / nucleic acid that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide / nucleic acid when the first and second oligonucleotides are aligned in an antiparallel orientation is a mismatch or non-complementary nucleobase.

[0048] “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified.

[0049] “Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating CFB RNA can mean to increase or decrease the level of CFB RNA and / or CFB protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a CFB compound can be a modulator that decreases the amount of CFB RNA and / or CFB protein in a cell, tissue, organ or organism.

[0050] “Motif” means the pattern of unmodified and modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide.

[0051] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single- stranded nucleic acids, and double-stranded nucleic acids.

[0052] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (Τ), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase and is capable of pairing with any nucleobase.

[0053] “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.

[0054] “Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

[0055] “Oligomeric Compound” means a compound comprising one or more oligonucleotides and optionally one or more additional features, such as a conjugate group or terminal group. Examples of oligomeric compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, antisense oligonucleotides, interfering RNA compounds (RNAi compounds), microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds). RNAi compounds include double-stranded compounds (e.g., short-interfering RNA (siRNA) and double-stranded RNA (dsRNA)) and single-stranded compounds (e.g., single-stranded siRNA (ssRNA), single- stranded RNAi (ssRNAi), short hairpin RNA (shRNA) and microRNA mimics) which work at least in part through the RNA-induced silencing complex (RISC) pathway resulting in sequence specific degradation and / or sequestration of a target nucleic acid through a process known as RNA interference (RNAi). The term “RNAi compound” is meant to be equivalent to other terms used to describe nucleic acid compounds that are capable of mediating sequence-specific RNA interference, for example, interfering RNA (iRNA), iRNA agent, RNAi agent, short interferingoligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, and others. Additionally, the term “RNAi” is meant to be equivalent to other terms used to describe sequence-specific RNA interference.

[0056] “Oligonucleotide” means a polymer of linked nucleosides, each of which can be modified or unmodified, independent from one another.

[0057] The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.” The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides. In some embodiments, the terms “duplexed oligomeric compound” and “modified oligonucleotide” are used interchangeably. In other embodiments, the terms “oligomeric duplex” and “compound” are used interchangeably.

[0058] “Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.

[0059] “Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. In certain embodiments, a pharmaceutically acceptable carrier or diluent aids the administration of a compound to and absorption by an individual and can be included in the compositions of the present disclosure without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, and the like. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for- injection. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present disclosure.

[0060] “Pharmaceutically acceptable salts” means or refers to physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0061] As used herein, a pharmaceutically acceptable salt is any salt of a compound provided herein which retains its biological properties and which is not toxic or otherwise undesirable forpharmaceutical use. The pharmaceutically acceptable salts of the therapeutic agents disclosed herein include salts that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds or modified oligonucleotides described herein.

[0062] When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent.

[0063] When compounds of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent.

[0064] Thus, the compounds of the present disclosure may exist as salts, such as with pharmaceutically acceptable acids. Such salts may be derived from a variety of organic and inorganic counter-ions well known in the art. Such salts include, but are not limited to: (1) acid addition salts formed with organic or inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, sulfamic, acetic, trifluoroacetic, trichloroacetic, propionic, hexanoic, cyclopentylpropionic, glycolic, glutaric, pyruvic, lactic, malonic, succinic, sorbic, ascorbic, malic, maleic, fumaric, tartaric, citric, benzoic, 3-(4-hydroxybenzoyl)benzoic, picric, cinnamic, mandelic, phthalic, lauric, methanesulfonic, ethanesulfonic, 1,2-ethane-disulfonic, 2- hydroxyethanesulfonic, benzenesulfonic, 4-chlorobenzenesulfonic, 2-naphthalenesulfonic, 4- toluenesulfonic, camphoric, camphorsulfonic, 4-methylbicyclo[2.2.2]-oct-2-ene-1-carboxylic, glucoheptonic, 3-phenylpropionic, trimethylacetic, tert-butylacetic, lauryl sulfuric, gluconic, benzoic, glutamic, hydroxynaphthoic, salicylic, stearic, cyclohexylsulfamic, quinic, muconic acid and the like acids; or (2) salts formed when an acidic proton present in the parent compound either (a) is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion or an aluminum ion, or alkali metal or alkaline earth metal hydroxides, such as sodium, potassium, calcium, magnesium, aluminum, lithium, zinc, and barium hydroxide, ammonia, or (b) coordinates with an organic base, such as aliphatic, alicyclic, or aromatic organic amines, such as ammonia, methylamine, dimethylamine, diethylamine, picoline, ethanolamine, diethanolamine, triethanolamine, ethylenediamine, lysine, arginine, ornithine, choline, N,N′-dibenzylethylene- diamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, N- methylglucamine piperazine, tris(hydroxymethyl)-aminomethane, tetramethylammoniumhydroxide, and the like (see, for example, Berge et al., “Pharmaceutical Salts,” Journal of Pharmaceutical Science, 1977, 66, 1-19).

[0065] Pharmaceutically acceptable salts further include, by way of example only and without limitation, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like, and when the compound contains a basic functionality, salts of non-toxic organic or inorganic acids, such as hydrohalides, e.g. hydrochloride and hydrobromide, sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, pyruvate, lactate, malonate, succinate, sorbate, ascorbate, malate, maleate, fumarate, tartarate, citrate, benzoate, 3-(4-hydroxybenzoyl)benzoate, picrate, cinnamate, mandelate, phthalate, laurate, methanesulfonate (mesylate), ethanesulfonate, 1,2-ethane-disulfonate, 2-hydroxyethanesulfonate, benzenesulfonate (besylate), 4- chlorobenzenesulfonate, 2-naphthalenesulfonate, 4-toluenesulfonate, camphorate, camphorsulfonate, 4-methylbicyclo[2.2.2]-oct-2-ene-1-carboxylate, glucoheptonate, 3- phenylpropionate, trimethylacetate, tert-butylacetate, lauryl sulfate, gluconate, benzoate, glutamate, hydroxynaphthoate, salicylate, stearate, cyclohexylsulfamate, quinate, muconate, and the like. In some embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium or a potassium salt. In some embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium salt.

[0066] The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound may differ from the various salt forms in certain physical properties, such as solubility in polar solvents. In embodiments, compounds of the present disclosure contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. The neutral forms of the compounds may be regenerated by contacting the salt with a base or acid and isolating the parent compound in a conventional manner. The parent form of the compounds differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but, unless specifically indicated, the salts disclosed herein are equivalent to the parent form of the compound for the purposes of the present disclosure.

[0067] “Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

[0068] “Phosphorothioate linkage” means a modified phosphate linkage in which one of the non- bridging oxygen atoms is replaced with a sulfur atom.

[0069] “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligonucleotide.

[0070] “Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time.

[0071] “RNA interference compound” or “RNAi compound” means a compound that acts, at least in part, through an RNA-induced silencing complex (RISC) pathway or Ago2, but not through RNase Η, to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded siRNA, and microRNA, including microRNA mimics.

[0072] “Sense oligonucleotide” or “sense strand” means the strand of a double-stranded compound that includes a region that is substantially complementary to a region of the antisense strand of the compound.

[0073] “Specifically inhibit” with reference to a target nucleic acid or protein means to reduce or block expression or activity of the target nucleic acid or protein while minimizing or eliminating effects on non-target nucleic acids or proteins.

[0074] “Subunit” with reference to an oligonucleotide means a nucleotide, nucleoside, nucleobase or sugar or a modified nucleotide, nucleoside, nucleobase or sugar as provided herein.

[0075] “Target nucleic acid,” “target RNA,” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.

[0076] “Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

[0077] “Targeting moiety” means a conjugate group that provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a compound absent such a moiety.

[0078] “Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0079] “Therapeutically effective amount” or “effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual. A “therapeutically effective amount” or “effective amount” is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g., achieve the effect for which it is administered, treat, prevent or ameliorate a disease or reduce one or more symptoms of a disease or condition). An example of a “therapeutically effective amount” or “effective amount” is an amount sufficient to contribute to the treatment, prevention, amelioration, or reduction of a symptom or symptoms of a disease. A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The term “therapeutically effective amount,” as used herein, refers to that amount of the therapeutic agent sufficient to provide a therapeutic benefit to an individual, such as treating, preventing or ameliorating the disease or disorder or symptom thereof, as described above. For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.

[0080] The terms “treating” or “treatment” refer to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of a physical examination. The term “treating” andconjugations thereof, may include prevention of an injury, pathology, condition, or disease. In embodiments, treating is preventing. In embodiments, treating does not include preventing.

[0081] “Treating” or “treatment” as used herein (and as well-understood in the art) also broadly includes any approach for obtaining beneficial or desired results in a subject's condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease’s transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, “treatment” as used herein includes any cure, amelioration, or prevention of a disease. Treatment may prevent the disease from occurring; inhibit the disease’s spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things.

[0082] “Treating” and “treatment” as used herein include prophylactic treatment. Treatment methods include administering to a subject a therapeutically effective amount of a compound described herein. The administering step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of the compound, the activity of the compositions used in the treatment, or a combination thereof. It will also be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. In some instances, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the patient.

[0083] “Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

[0084] Certain compounds of the present disclosure possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisometric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The compounds of the present disclosure do not include those that are known in art to be too unstable to synthesize and / or isolate. The present disclosure ismeant to include compounds in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.

[0085] As used herein, the term “isomers” refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.

[0086] The term “tautomer,” as used herein, refers to one of two or more structural isomers which exist in equilibrium and which are readily converted from one isomeric form to another.

[0087] It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure.

[0088] Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure (i.e., the R and S configurations for each asymmetric center). Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the disclosure.

[0089] As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0090] Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of a hydrogen by a deuterium or tritium, or the replacement of a carbon by13C- or14C-enriched carbon are within the scope of this disclosure.

[0091] As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage. Certain Embodiments

[0092] In certain aspects, the disclosure relates to methods, compounds and compositions for inhibiting CFB. In certain embodiments, CFB is specifically inhibited. In certain embodiments, CFB is specifically degraded. In certain embodiments, CFB expression is inhibited. In certain embodiments, CFB translation is inhibited. In certain embodiments, CFB activity is inhibited. In certain embodiments, CFB expression, translation, or activity is reduced by at least 10% relative to the expression, translation, or activity in an untreated or control sample. For example, in certain embodiments, CFB expression, translation, or activity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, 10-50%, 25-50%, 25-75%, 50-75%, 50-99%, or 75-99% relative to the expression, translation, or activity in an untreated or control sample. In certain embodiments, CFB expression, translation, or activity is reduced as measured by any suitable assay, including but not limited to, an immunoassay, a hybridization-based assay, or a sequencing-based assay (e.g., RNA-Seq).

[0093] In certain aspects, the disclosure relates to compounds targeted to a CFB nucleic acid. In certain embodiments, the CFB nucleic acid has the sequence set forth in GENBANK Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 1), nucleotides 31946095 to 31952084 of GenBank Accession No. NC_000006.12 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 3), and nucleotides 3423522 to 3429511 of GenBank Accession No. NT_113891.3 (incorporated herein as SEQ ID NO: 4).

[0094] In certain embodiments, the compound is an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

[0095] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100.

[0096] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100.

[0097] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100.

[0098] In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to SEQ ID NO: 1 or 3. In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double-stranded.

[0099] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109.

[0100] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 109.

[0101] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109.

[0102] In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to an equal length portion of SEQ ID NO: 1 or 3. In certain embodiments, the modified oligonucleotide comprises at least onemodification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double-stranded.

[0103] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide.

[0104] In certain embodiments, the compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences provided in Tables 2-3, and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide.

[0105] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide.

[0106] Certain embodiments provide a compound comprising a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

[0107] In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequencecomprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109.

[0108] In certain embodiments, the modified oligonucleotide or first modified oligonucleotide of any preceding compound has at least 80%, at least 85%, at least 90%, or at least 95% complementarity or identity to SEQ ID NO: 1 or 3 over its length. In certain embodiments, the modified oligonucleotide or first modified oligonucleotide has at least 1, at least 2, at least 3 mismatches to a region of SEQ ID NO: 1 or 3. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 14 to 30 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 14 to 23 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 19 to 23 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide.

[0109] In certain embodiments, the modified oligonucleotide or first modified oligonucleotide of any preceding compound comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide of any preceding compound comprises at least one modification selected from the group consisting of a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the phosphorothioate internucleoside linkage ormethylphosphonate internucleoside linkage is at the 3’ terminus of the first or second modified oligonucleotide or at the 5’ terminus of the first modified oligonucleotide. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a 2’-F modification. In certain embodiments, the modified sugar comprises a 2’-OMe modification. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar or a combination thereof. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of 2’-MOE, 2’-F, and 2’-OMe or a combination thereof. In certain embodiments, the first modified oligonucleotide comprises no more than ten 2’-F sugar modifications. In certain embodiments, the second modified oligonucleotide comprises no more than five 2’-F sugar modifications.

[0110] In certain embodiments, the compound of any preceding embodiment comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5’ end of the modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more GalNAc. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the one or more GalNAc is attached to the 2’ or 3’ position of the ribosyl ring. In certain embodiments, the one or more GalNAc is attached to the 5’ nucleoside of the modified oligonucleotide. In certain embodiments, the 5’ nucleoside of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof, wherein R is the portion of the modified oligonucleotide other than the 5’ nucleoside:IJijIJĴIJĵFormula VIII

[0111] In certain embodiments, the conjugate group according to Formula III is represented by the following Formula:

[0112] In certain embodiments, R′ is OH. In certain embodiments, R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula I and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula I and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula II and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula II and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula III and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula III and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula IV and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula IV and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula V and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula V and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VI and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VI and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VII and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VII and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VIII and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VIII and R′ is SH. In certain embodiments, the 5′nucleoside of the modified oligonucleotide is Formula XII and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula XII and R′ is SH.

[0113] In certain embodiments, R′ is OH. In certain embodiments, R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula I and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula I and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula II and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula II and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula III and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula III and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula IV and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula IV and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula V and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula V and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VI and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VI and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VII and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VII and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VIII and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VIII and R′ is SH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula XII and R′ is OH. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula XII and R′ is SH.

[0114] In certain embodiments, R′ is O. In certain embodiments, R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula I and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula I and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula II and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula II and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula III and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula III and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is FormulaIV and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula IV and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula V and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula V and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VI and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VI and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VII and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VII and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VIII and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula VIII and R′ is S. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula XII and R′ is O. In certain embodiments, the 5′ nucleoside of the modified oligonucleotide is Formula XII and R′ is S.

[0115] Certain embodiments provide a compound comprising a modified oligonucleotide having a modified nucleobase sequence as follows: mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fU*mC*mC (Ref ID NO: IA1016), wherein: m is a 2’-O-methyl sugar modification; f is a 2’-F sugar modification; * is a phosphorothioate internucleoside linkage; and . is a phosphate internucleoside linkage.

[0116] Certain embodiments provide a compound comprising a modified oligonucleotide having a modified nucleobase sequence as follows: H4*mG*mG.mA.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ (Ref ID NO: IS1252), wherein: m is a 2’-O-methyl sugar modification; f is a 2’-F sugar modification; * is a phosphorothioate internucleoside linkage; . is a phosphate internucleoside linkage;dQ is an inverted abasic deoxyribose of the following formula:H4 is .

[0117] a first modified oligonucleotide which is IA1016 and a second modified oligonucleotide which is IS1252.

[0118] In certain embodiments, the compound comprising a first modified oligonucleotide which is IA1016 and a second modified oligonucleotide which is IS1252 is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt.

[0119] Certain embodiments provide the compound comprising a first modified oligonucleotide which is IA1016 and a second modified oligonucleotide which is IS1252, as is a stereoisomer.

[0120] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:O NH NH NH N N HO N N N N OID NO: IA1016 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.

[0121] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:NO: IS1252 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.

[0122] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.

[0123] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.

[0124] In an aspect provided herein, is a compound according to the following chemical structure:or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Compound Number RD2830 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.

[0125] In an aspect provided herein, is a sodium salt of a compound according to the following chemical structure:or a stereoisomer thereof. In certain embodiments, Compound Number RD2830 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.

[0126] In certain embodiments, provided herein is a population of modified oligonucleotides, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. In certain embodiments, provided herein is a population of compounds, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

[0127] Certain embodiments provide a composition comprising the compound of any one of the foregoing embodiments and a pharmaceutically acceptable carrier.

[0128] Certain embodiments provide a composition comprising a compound of any preceding embodiment, for use in therapy.

[0129] Certain embodiments provide a method of treating, preventing, or ameliorating a disease, disorder or condition associated with CFB in an individual comprising administering to the individual a compound targeted to CFB, thereby treating, preventing, or ameliorating the disease, disorder or condition. In certain embodiments, the compound or composition of any foregoing embodiment is administered to an individual. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, administering the compound inhibits or reduces or improves atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD,thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom thereof.

[0130] In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual in a therapeutically effective amount. In certain embodiments, a composition comprising a compound of any embodiment described herein is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg / kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the compound or composition is administered to the individual one or more times in a day up to the dosage level or fixed dose.

[0131] In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual at a dosage level sufficient to deliver about 0.1 to 50 mg / kg, about 0.1 to 20 mg / kg, about 0.2 to 15 mg / kg, about 0.4 to 12 mg / kg, about 0.5 to 10 mg / kg, about 1 to 12 mg / kg, about 1 to 8 mg / kg, about 1 to 4 mg / kg, about 2 to 12 mg / kg, about 2 to 8 mg / kg, about 4 to 12 mg / kg, or about 4 to 8 mg / kg of body weight of the individual. In certain embodiments, the dosage level is sufficient to deliver about 0.1 mg / kg, about 0.2 mg / kg, about 0.4 mg / kg, about 0.8 mg / kg, about 1 mg / kg, about 2 mg / kg, about 4 mg / kg, about 6 mg / kg, about 8 mg / kg, about 10 mg / kg, about 12 mg / kg, about 15 mg / kg, or about 20 mg / kg of body weight of the individual. In certain embodiments, the dosage level is sufficient to deliver about 0.4 mg / kg, about 1 mg / kg, about 2 mg / kg, about 4 mg / kg, about 8 mg / kg, or about 12 mg / kg of body weight of the individual. In certain embodiments, the dosage level is sufficient to deliver about 4 mg / kg or about 8 mg / kg of body weight of the individual. In certain embodiments, the compound or composition is administered to the individual one or more times in a day up to the dosage level. In certain embodiments, the compound or composition is administered to the individual in a single dose at the dosage level. In certain embodiments, the compound or composition is administered to the individual in multiple doses up to the dosage level in a single day. In certain embodiments, where multiple doses are used, these can be administered simultaneously, separately or sequentially. In certain embodiments, the compound or composition is administered to the individual by injection or infusion. In certain embodiments, the compound or composition is administered to the individual parenterally. Incertain embodiments, the compound or composition is administered to the individual subcutaneously, intravenously, intramuscularly, intraarterially, intraperitoneally, or intracranially. In certain embodiments, the compound or composition is administered to the individual by subcutaneous administration.

[0132] Dosage levels and fixed dose amounts as described herein provide guidance for the administration of compounds or compositions to an adult. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0133] In certain embodiments, a composition comprising a compound of any embodiment described herein is administered to an individual daily, weekly, monthly, quarterly, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, or yearly. In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual about once per quarter, about once every six months or about once per year.

[0134] Certain embodiments provide a method of inhibiting expression of CFB in a cell comprising contacting the cell with a compound targeted to CFB, thereby inhibiting expression of CFB in the cell. In certain embodiments, the cell is in the liver of an individual. In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

[0135] Certain embodiments provide a method of reducing or inhibiting atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis,diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an individual, comprising administering a compound targeted to CFB to the individual, thereby reducing or inhibiting atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD , thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in the individual. In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, the compound is a compound targeted to CFB. In certain embodiments, the compound is any of the foregoing compounds. In certain embodiments, the compound or composition is administered parenterally.

[0136] Certain embodiments provide use of a compound targeted to CFB for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thromboticmicroangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound is a compound targeted to CFB. In certain embodiments, the compound is any of the foregoing compounds.

[0137] Certain embodiments provide use of a compound targeted to CFB in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound is a compound targeted to CFB. In certain embodiments, the compound is any of the foregoing compounds. Certain Indications

[0138] In certain aspects, the disclosure relates to methods of inhibiting CFB expression, which can be useful for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB in an individual, by administration of a compound that targets CFB. In certain embodiments, the compound can be a CFB specific inhibitor. In certain embodiments, the compound can be an antisense oligonucleotide, an oligomeric compound, or an oligonucleotide targeted to CFB.

[0139] In certain aspects, the disclosure relates to treating, preventing, or ameliorating a disease, disorder or condition associated with CFB. In certain embodiments, diseases, disorders or conditions associated with CFB treatable, preventable, and / or ameliorable with the methods provided herein include atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). Certain compounds providedherein are directed to compounds and compositions that reduce atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal.

[0140] In certain embodiments, a method of treating, preventing, or ameliorating a disease, disorder or condition associated with CFB in an individual comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby treating, preventing, or ameliorating the disease, disorder, or condition. In certain embodiments, the individual is identified as having, or at risk of having, a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is a liver, kidney, or ocular disease. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides) in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of SEQ ID NO: 100.

[0141] In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In certain embodiments, a single-stranded compound can be 14 to 30, 14 to 23, 14 to 20, 16 to 20, or 14 to 16, linked nucleosides in length. In certain embodiments, a single-strandedcompound can be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, linked nucleosides in length. In certain embodiments, a double-stranded compound can comprise two oligonucleotides of the same or different lengths, as described elsewhere herein. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109.

[0142] In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100, and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal.

[0143] In certain embodiments, a method of treating, preventing, or ameliorating atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC- MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby treating, preventing, or ameliorating atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobasesequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobasesequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, administering the compound improves, preserves, or prevents atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal. In certain embodiments, the individual is identified as having, or at risk of having, a disease, disorder or condition associated with CFB.

[0144] In certain embodiments, a method of inhibiting expression of CFB in an individual having, or at risk of having, a disease, disorder or condition associated with CFB comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby inhibiting expression of CFB in the individual. In certain embodiments, administering the compound inhibits expression of CFB in the liver. In certain embodiments, the disease, disorder or condition is a complement pathway related disease, disorder or condition or is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC- MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy,Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. Inany of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof.

[0145] In certain embodiments, a method of inhibiting expression of CFB in a cell comprises contacting the cell with a compound comprising a CFB specific inhibitor, thereby inhibiting expression of CFB in the cell. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is in the liver of an individual who has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy,membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequences of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109.

[0146] In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

[0147] In certain embodiments, a method of reducing or inhibiting a complement pathway related disease, disorder or condition or atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in an individual having, or at risk of having, a disease associated with CFB comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby reducing or inhibiting a complement pathway related disease, disorder or condition or atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferativeglomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC- MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in the individual. In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having, or at risk of having, a disease, disorder or condition associated with CFB.

[0148] Certain embodiments are drawn to a compound comprising a CFB specific inhibitor for use in treating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune ComplexMembranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoingembodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally.

[0149] Certain embodiments are drawn to a compound comprising a CFB specific inhibitor for use in reducing or inhibiting a complement pathway related disease, disorder or condition or atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC- MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certainembodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide selected from the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequencecomprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

[0150] Certain embodiments are drawn to the use of a compound comprising a CFB specific inhibitor for the manufacture or preparation of a medicament for treating a disease, disorder or condition associated with CFB. Certain embodiments are drawn to the use of a compound comprising a CFB specific inhibitor for the preparation of a medicament for treating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is a complement pathway related disease, disorder, or condition. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising SEQ ID NO: 100. In certainembodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

[0151] Certain embodiments are drawn to the use of a compound comprising a CFB specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting a complement pathway related disease, disorder or condition or a symptom thereof in an individual having, or at risk of having, a complement pathway related disease. In certain embodiments, the complement pathway related disease is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). Certain embodiments are drawn to use of a compound comprising a CFB specific inhibitor for the preparation of a medicament for treating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, forexample, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 100 or 109 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ IDNO: 100 or 109 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

[0152] In any of the foregoing methods or uses, the compound can be an oligomeric compound. In any of the foregoing methods or uses, the compound can be single-stranded or double- stranded. In any of the foregoing methods or uses, the compound can be targeted to CFB. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain embodiments, the compound comprises one or more modified oligonucleotides. In certain embodiments, the compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, a modified oligonucleotide is 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 14 to 30 linked nucleosides in length, 14 to 23 linked nucleosides in length, or 19 to 23 linked nucleosides in length. In certain embodiments, a modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NO: 1 or 3 over its length. In certain embodiments, a modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, the modified sugar is a bicyclic sugar, 2’-MOE, 2’-F, or 2’- OMe. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In any of the foregoing embodiments, each modified oligonucleotide is independently 12 to 30, 14 to 30, 14 to 25, 14 to 24, 14 to 23, 16 to 23, 17 to 23, 18 to 23, 19 to 23, 19 to 22, or 19 to 20 linked nucleosides in length. In certain embodiments, a modified oligonucleotide has at least 1, at least 2, at least 3 mismatches to a region of SEQ ID NO: 1 or 3.

[0153] In any of the forgoing methods or uses, the compound comprises a first and second modified oligonucleotide, wherein there is a region of complementarity between a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the region of complementarity between the first oligonucleotide and the second oligonucleotide is 14 to 23, 19 to 23, or 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide comprises at least one modificationselected from the group consisting of a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the modified internucleoside linkage is at the 3’ terminus of the first or second modified oligonucleotide or at the 5’ terminus of the first or second modified oligonucleotide. In certain embodiments, the first or second modified oligonucleotide comprises one or more modified sugars. In certain embodiments, each nucleoside of the first or second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a modification selected from group consisting of 2’-MOE, 2’-F, and 2’-OMe or a combination thereof. In certain embodiments, the first or second modified oligonucleotide comprises no more than ten 2’-F sugar modifications. In certain embodiments, the first or second modified oligonucleotide comprises no more than five 2’-F sugar modifications.

[0154] In any of the forgoing methods or uses, a compound comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5’ end of a modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more GalNAc. In certain embodiments, the one or more GalNAc is attached to the 2’ or 3’ position of the ribosyl ring. In certain embodiments, the one or more GalNAc is attached to the 5’ nucleoside of the modified oligonucleotide. In certain embodiments, the 5’ nucleoside of a modified oligonucleotide is selected from Formulae I-VIII, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide other than the 5’ nucleoside. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula I and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula I and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula II and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula II and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula III and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula III and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula IV and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula IV and R’ is S. In certainembodiments, the 5’ nucleoside of the modified oligonucleotide is Formula V and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula V and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VI and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VI and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VII and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VII and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VIII and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VIII and R’ is S.

[0155] In any of the foregoing methods or uses, in certain embodiments, the compound comprises a modified oligonucleotide having a modified nucleobase sequence as follows: mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fU*mC*mC (Ref ID NO: IA1016), wherein: m is a 2’-O-methyl sugar modification; f is a 2’-F sugar modification; * is a phosphorothioate internucleoside linkage; and . is a phosphate internucleoside linkage.

[0156] In any of the foregoing methods or uses, in certain embodiments, the compound comprises a modified oligonucleotide having a modified nucleobase sequence as follows: H4*mG*mG.mA.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ (Ref ID NO: IS1252), wherein: m is a 2’-O-methyl sugar modification; f is a 2’-F sugar modification; * is a phosphorothioate internucleoside linkage; . is a phosphate internucleoside linkage; dQ is an inverted abasic deoxyribose of the following formula:d H4 is of the following formula: .

[0157] In anythe compound comprises a first modified oligonucleotide of Ref ID NO: IA1016 and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide. Certain embodiments provide a compound comprising a first modified oligonucleotide consisting of Ref ID NO: IA1016 and a second modified oligonucleotide consisting of Ref ID NO: IS1252.

[0158] In certain embodiments, the compound is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt. In certain embodiments, a composition comprises the compound of any one of the foregoing embodiments and a pharmaceutically acceptable carrier.

[0159] In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg / kg of body weight of the individual. In certain embodiments, acompound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the composition is administered to the individual one or more times in a day up to the dosage level or fixed dose.

[0160] In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual at a dosage level sufficient to deliver about 0.1 to 50 mg / kg, about 0.1 to 20 mg / kg, about 0.2 to 15 mg / kg, about 0.4 to 12 mg / kg, about 0.5 to 10 mg / kg, about 1 to 12 mg / kg, about 1 to 8 mg / kg, about 1 to 4 mg / kg, about 2 to 12 mg / kg, about 2 to 8 mg / kg, about 4 to 12 mg / kg, or about 4 to 8 mg / kg of body weight of the individual. In certain embodiments, the dosage level is sufficient to deliver about 0.1 mg / kg, about 0.2 mg / kg, about 0.4 mg / kg, about 0.8 mg / kg, about 1 mg / kg, about 2 mg / kg, about 4 mg / kg, about 6 mg / kg, about 8 mg / kg, about 10 mg / kg, about 12 mg / kg, about 15 mg / kg, or about 20 mg / kg of body weight of the individual. In certain embodiments, the dosage level is sufficient to deliver about 0.4 mg / kg, about 1 mg / kg, about 2 mg / kg, about 4 mg / kg, about 8 mg / kg, or about 12 mg / kg of body weight of the individual. In certain embodiments, the dosage level is sufficient to deliver about 4 mg / kg or about 8 mg / kg of body weight of the individual. In certain embodiments, the compound or composition is administered to the individual one or more times in a day up to the dosage level. In certain embodiments, the compound or composition is administered to the individual in a single dose at the dosage level. In certain embodiments, the compound or composition is administered to the individual in multiple doses up to the dosage level in a single day. In certain embodiments, where multiple doses are used, these can be administered simultaneously, separately or sequentially. In certain embodiments, the compound or composition is administered to the individual by injection or infusion. In certain embodiments, the compound or composition is administered to the individual parenterally. In certain embodiments, the compound or composition is administered to the individual subcutaneously, intravenously, intramuscularly, intraarterially, intraperitoneally, or intracranially. In certain embodiments, the compound or composition is administered to the individual by subcutaneous administration.

[0161] Dosage levels and fixed dose amounts as described herein provide guidance for the administration of compounds or compositions to an adult. The amount to be administered to, forexample, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0162] In certain embodiments, a composition comprising a compound of any embodiment described herein is administered to an individual daily, weekly, monthly, quarterly, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, or yearly. In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any embodiment described herein is administered to an individual about once per quarter, about once every six months or about once per year. Certain Compounds

[0163] In certain aspects, the disclosure relates to a compound that comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a nucleobase sequence complementary to that of a target nucleic acid.

[0164] In certain aspects, the disclosure relates to a compound that comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

[0165] In certain aspects, the disclosure relates to a compound that comprises or consists of an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

[0166] In certain aspects, the disclosure relates to a compound that is a single-stranded compound. In certain embodiments, the single-stranded compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide or modified oligonucleotide of a single-stranded compound comprises a self-complementary nucleobase sequence.

[0167] In certain aspects, the disclosure relates to a compound that is a double-stranded compound. In certain embodiments, the double-stranded compound comprises or consists of anoligomeric compound. In certain embodiments, the double-stranded compound comprises a first oligonucleotide and a second oligonucleotide. In certain embodiments, the first oligonucleotide has a region complementarity to a target nucleic acid and the second oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, the double- stranded compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a region complementarity to a target nucleic acid. In certain embodiments, the double-stranded compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide has a region complementarity to a target nucleic acid and the second modified oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, an oligonucleotide or modified oligonucleotide of a double-stranded compound is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase.

[0168] In certain embodiments, a compound described herein comprises a conjugate group. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double- stranded compound comprises a conjugate group. In certain embodiments, the second oligonucleotide or second modified oligonucleotide of a double-stranded compound comprises a conjugate group. In certain embodiments, a first oligonucleotide or first modified oligonucleotide and a second oligonucleotide or second modified oligonucleotide of a double-stranded compound each comprises a conjugate group.

[0169] In certain embodiments, a compound is 14-30 linked nucleosides in length. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double-stranded compound is 14-30 linked nucleosides in length. In certain embodiments, the second oligonucleotide or second modified oligonucleotide is 14-30 linked nucleosides in length. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound are blunt ended at one or both ends of the compound. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound include non- complementary overhanging nucleosides at one or both ends of the compound.

[0170] In certain embodiments, a compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of SEQ ID NO: 100. In certain embodiments, one of theoligonucleotides or modified oligonucleotides of a double-stranded compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of SEQ ID NO: 100.

[0171] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, antisense oligonucleotides, siRNAs, microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds), and single-stranded RNAi compounds (e.g. small hairpin RNAs (shRNAs), single stranded siRNAs (ssRNAs) and microRNA mimics).

[0172] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target region of a target nucleic acid to which it is targeted.

[0173] In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 23 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 to 23 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 12 to 23 linked subunits, 14 to 30 linked subunits, 14 to 23 linked subunits, 15 to 30 linked subunits, 15 to 23 linked subunits, 16 to 30 linked subunits, 16 to 23 linked subunits, 17 to 30 linked subunits,17 to 23 linked subunits, 18 to 30 linked subunits, 18 to 23 linked subunits, 19 to 30 linked subunits or 19 to 23 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 22 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 23 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 23, 18 to 24, 18 to 25, 18 to 50, 19 to 23, 19 to 30, 19 to 50, 20 to 23 or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits in length, or a range defined by any two of the above values.

[0174] In certain embodiments, the compound may further comprise an additional moiety, such as a conjugate group or delivery moiety. In certain embodiments, such compounds are oligomeric compounds, and the additional moiety is attached to an oligonucleotide. In certain embodiments, a conjugate group is attached to a nucleoside of an oligonucleotide.

[0175] In certain embodiments, compounds may be shortened or truncated. For example, one or more subunits may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation) of an oligonucleotide.

[0176] In certain embodiments, compounds may be lengthened. For example, one or more subunits may be attached to the 3′ end or 5′ end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5′ end of an oligonucleotide. In certain embodiments,at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 3′ end of an oligonucleotide. In certain embodiments, at least one or more subunits may be attached to the 3′ end or 5′ end of an oligonucleotide of a double-stranded compound creating a 3′ and / or 5′ end overhang. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5′ end of both oligonucleotides of a double-stranded compound. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunit) is attached to the 3′ end of both oligonucleotides of a double-stranded compound. In certain embodiments, subunits are attached to both oligonucleotides of a double-stranded compound at the same end (e.g., that subunits are attached to the 3′ end of one of the oligonucleotides and subunits are attached to the 5′ end of the other oligonucleotide). In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide may be the same or may be different. In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide is the same. In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide is different. This scenario, where subunits are attached to both oligonucleotides of a double-stranded compound at the same end, may occur at one or both ends of a double-stranded compound. In certain embodiments, the subunits attached to the 3′ and / or 5′ end are modified.

[0177] In certain embodiments, compounds described herein are oligonucleotides. In certain embodiments, compounds described herein are modified oligonucleotides. In certain embodiments, compounds described herein are antisense oligonucleotides. In certain embodiments, compounds described herein are oligomeric compounds. In certain embodiments, compounds described herein are RNAi compounds. In certain embodiments, compounds described herein are siRNA compounds.

[0178] In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to CFB described herein. In certain embodiments, the compound can be double-stranded.

[0179] In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 100. In certain embodiments, the compound comprises a second oligonucleotide. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 109. In certain embodiments, the compound comprises a first oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 100 and a second oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 109.

[0180] In certain embodiments, the compound comprises ribonucleotides in which the oligonucleotide has uracil (U) in place of thymine (Τ) for any of the sequences provided here. In certain embodiments, the compound comprises deoxyribonucleotides in which the oligonucleotide has thymine (Τ) in place of uracil (U) for any of the sequences provided here. Certain Mechanisms

[0181] In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein comprise or consist of antisense oligonucleotides. In certain embodiments, compounds comprise or consist of oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired activity.

[0182] In certain embodiments, hybridization of a compound described herein to a target nucleic acid results in recruitment of one or more proteins that cause the cleavage of the target nucleic acid. For example, certain compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the targetnucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0183] In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of RNA processing. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0184] Activities resulting from the hybridization of a compound to a target nucleic acid may be observed directly or indirectly. In certain embodiments, observation or detection of an activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal. Certain Modifications

[0185] In certain aspects, the disclosure relates to compounds that comprise or consist of oligonucleotides. Oligonucleotides consist of linked nucleosides. In certain embodiments, oligonucleotides may be unmodified RNA or DNA or may be modified. In certain embodiments, the oligonucleotides are modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise at least one modified sugar, modified nucleobase or modified internucleoside linkage relative to an unmodified RNA or DNA. In certain embodiments, an oligonucleotide has a modified nucleoside. A modified nucleoside may comprise a modified sugar, a modified nucleobase or both a modified sugar and a modified nucleobase. Modified oligonucleotides may also include end modifications, e.g., 5’-end modifications and 3’-end modifications. Sugar Modifications and Motifs

[0186] In certain embodiments, a modified sugar is a substituted furanosyl sugar or non-bicyclic modified sugar. In certain embodiments, a modified sugar is a bicyclic or tricyclic modifiedsugar. In certain embodiments, a modified sugar is a sugar surrogate. A sugar surrogate may comprise one or more substitutions described herein.

[0187] In certain embodiments, a modified sugar is a substituted furanosyl or non-bicyclic modified sugar. In certain embodiments, the furanosyl sugar is a ribosyl sugar. In certain embodiments, the furanosyl sugar comprises one or more substituent groups, including, but not limited to, substituent groups at the 2’, 3’, 4’, and 5’ positions.

[0188] In certain embodiments, substituents at the 2’ position include, but are not limited to, F and OCH3 (“OMe”, “O-methyl” or “methoxy”). In certain embodiments, substituent groups at the 2’ position suitable for non-bicyclic modified sugars include, but are not limited to, halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, F, Cl, Br, SCH3, SOCH3, SO2CH3, ΟΝΟ2, ΝΟ2, Ν3, and ΝΗ2. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, O-(C1-C10) alkoxy, alkoxyalkyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N- alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, O-alkyl-O-alkyl, alkynyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1to C10alkyl or C2to C10alkenyl and alkynyl. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, alkaryl, aralkyl, O-alkaryl, and O-aralkyl. In certain embodiments, these 2’ substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, alkoxy, carboxy, benzyl, phenyl, nitro (ΝΟ2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nCH3, O(CH2)nONH2, O(CH2)nNH2, O(CH2)nSCH3, and O(CH2)nON[(CH2)nCH3)]2, where n and m are independently from 1 to about 10. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, OCH2CH2OCH3 (“MOE”), O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”).

[0189] In certain embodiments, substituent groups at the 4’ position suitable for non-bicyclic modified sugars include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, substituent groups at the 5’ position suitable for non-bicyclic modified sugars include, but are not limited to, methyl (“Me”) (R or S), vinyl, and methoxy. In certain embodiments, substituents described herein for the 2’, 4’ and 5’ position can be added to other specific positions on the sugar. In certain embodiments, such substituents may be added to the 3’ position of the sugar on the 3’ terminal nucleoside orthe 5’ position of the 5’ terminal nucleoside. In certain embodiments, a non-bicyclic modified sugar may comprise more than one non-bridging sugar substituent. In certain such embodiments, non-bicyclic modified sugars substituents include, but are not limited to, 5’-Me- 2’-F, 5’-Me-2’-OMe (including both R and S isomers). In certain embodiments, modified sugar substituents include those described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0190] In certain embodiments, a modified sugar is a bicyclic sugar. A bicyclic sugar is a modified sugar comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, a bicyclic sugar comprises a bridging substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, a bicyclic sugar does not comprise a furanosyl moiety. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a bridge between the 4’ and 2’ furanose ring atoms. In certain embodiments, the bicyclic sugar comprises a bridge between the 5’ and 3’ furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. In certain embodiments, 4’ to 2’ bridging substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2- 2', 4'- (CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (“constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4'- CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (e.g., U.S. Patent No. 7,399,845), 4'-C(CH3)(CH3)-O-2' and analogs thereof (e.g., U.S. Patent No. 8,278,283), 4'- CH2-N(OCH3)-2' and analogs thereof (e.g., U.S. Patent No. 8,278,425), 4'-CH2-O-N(CH3)-2' (e.g., U.S. Patent Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2', wherein R is Η, C1-C12 alkyl, or a protecting group (e.g., U.S. Patent No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (e.g., Chattopadhyaya el al., J. Org. Chem., 2009, 74, 118- 134), and 4'-CH2-C(=CH2)-2' and analogs thereof (e.g., U.S. Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of bicyclic nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, US 2013 / 0190383; and WO 2013 / 036868, the entire contents of each of whichare hereby incorporated herein by reference. Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L- ribofuranose and β-D-ribofuranose (see e.g., WO 99 / 14226). Specified bicyclic nucleosides herein are in the β-D configuration, unless otherwise specified.

[0191] In certain embodiments, a modified sugar is a sugar surrogate. In certain embodiments, a sugar surrogate has the oxygen atom replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, the sugar surrogate may also comprise bridging and / or non-bridging substituents as described herein. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. In certain such embodiments, the sugar surrogate comprises a cyclobutyl moiety in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a six membered ring in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a tetrahydropyran (“THP”) in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a morpholino in place of the pentofuranosyl sugar. Representative US patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,166,315; 5,185,444; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,700,920; 7,875,733; 7,939,677, 8,088,904; 8,440,803; and 9,005,906, the entire contents of each of the foregoing are hereby incorporated herein by reference.

[0192] In some embodiments, sugar surrogates comprise acyclic moieties. In certain embodiments, the sugar surrogate is an unlocked nucleic acid (“UNA”). A UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses a monomer where the bonds between C1’-C4’ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1’ and C4’ carbons). In another example, the C2’-C3’ bond (i.e. the covalent carbon-carbon bond between the C2’ and C3’ carbons) of the sugar has been removed. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent No. 8,314,227; and U.S. Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, sugar surrogates comprise peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides andoligonucleotides described in Manoharan et al., US2013 / 130378, the entire contents of which is hereby incorporated herein by reference. Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0193] In certain aspects, the disclosure relates to compounds comprising at least one oligonucleotide wherein the nucleosides of such oligonucleotide comprise one or more types of modified sugars and / or unmodified sugars arranged along the oligonucleotide or region thereof in a defined pattern or “sugar motif”. In certain instances, such sugar motifs include, but are not limited to, any of the patterns of sugar modifications described herein.

[0194] In certain embodiments, an oligonucleotide comprises a gapmer sugar motif. A gapmer oligonucleotide comprises or consists of a region having two external “wing” regions and a central or internal “gap” region. The gap and wing regions form a contiguous sequence of nucleosides, wherein the majority of nucleoside sugars of each of the wings differ from the majority of nucleoside sugars of the gap. In certain embodiments, the wing regions comprise a majority of modified sugars and the gap comprises a majority of unmodified sugars. In certain embodiments, the nucleosides of the gap are deoxynucleosides. Compounds with a gapmer sugar motif are described in, for example US Patent 8,790,919, the entire contents of which is hereby incorporated herein by reference.

[0195] In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a triplet sugar motif. An oligonucleotide with a triplet sugar motif comprises three identical sugar modifications on three consecutive nucleosides. In certain embodiments, the triplet is at or near the cleavage site of the oligonucleotide. In certain embodiments, an oligonucleotide of a double-stranded compound may contain more than one triplet sugar motif. In certain embodiments, the identical sugar modification of the triplet sugar motif is a 2’-F modification. Compounds with a triplet sugar motif are disclosed, for example, in US Patent 10,668,170, the entire contents of which is incorporated herein by reference.

[0196] In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a quadruplet sugar motif. An oligonucleotide with a quadruplet sugar motif comprises four identical sugar modifications on four consecutive nucleosides. In certain embodiments, the quadruplet is at or near the cleavage site. In certain embodiments, an oligonucleotide of a double-stranded compound may contain more than one quadruplet sugar motif. In certain embodiments, the identical sugar modification of the quadruplet sugar motif is a 2’-Fmodification. For a double-stranded compound having a duplex region of 19-23 nucleotides in length, the cleavage site of the antisense oligonucleotide is typically around the 10, 11, and 12 positions from the 5’-end. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the sense oligonucleotide, counting from the first nucleoside of the 5’-end of the sense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5’-end of the sense oligonucleotide. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the antisense oligonucleotide, counting from the first nucleoside of the 5’-end of the antisense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5’- end of the antisense oligonucleotide. The cleavage site may change according to the length of the duplex region of the double-stranded compound and may change the position of the quadruplet accordingly.

[0197] In certain embodiments, an oligonucleotide comprises an alternating sugar motif. In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise an alternating sugar motif. An oligonucleotide with an alternating sugar motif comprises at least two different sugar modifications wherein one or more consecutive nucleosides comprising a first sugar modification alternates with one or more consecutive nucleosides comprising a second sugar modification and one or more consecutive nucleosides comprising a third sugar modification, etc. For example, if A, Β and C each represent one type of modification to the nucleoside, the alternating motif can be “ABABABABABAB...,” “AABBAABBAABB...,” “AABAABAABAAB...,” “AAABAAABAAAB...,” “AAABBBAAABBB...,” or “ABCABCABCABC...” etc. In certain embodiments, the alternating sugar motif is repeated for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases along an oligonucleotide. In certain embodiments, the alternating sugar motif is comprised of two different sugar modifications. In certain embodiments, the alternating sugar motif comprises 2’-OMe and 2’-F sugar modifications.

[0198] In certain embodiments, each nucleoside of an oligonucleotide is independently modified with one or more sugar modifications provided herein. In certain embodiments, each oligonucleotide of a double-stranded compound independently has one or more sugar motifsprovided herein. In certain embodiments, an oligonucleotide containing a sugar motif, is fully modified in that each nucleoside other than the nucleosides comprising the sugar motif comprises a sugar modification. Nucleobase Modifications and Motifs

[0199] In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside.

[0200] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and Ν-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5- hydroxymethyl cytosine, 5- methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8- substituted purines, 5-halo, particularly, 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5- halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-Ν-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-Ν-benzoylcytosine, 5-methyl 4-N- benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3- diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3- diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone.

[0201] Further nucleobases include those disclosed in U.S. Patent 3,687,808; Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, Ρ. ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, J.L., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie,International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, dsRNA Research and Applications, pages 289-302; Antisense Research and Applications, Crooke, S.T. and Lebleu, Β., Eds., CRC Press, 1993, 273-288; Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443 (Chapters 6 and 15), each of which are hereby incorporated herein by reference.

[0202] Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, US Applications 2003 / 0158403 and 2003 / 0175906; U.S. Patents 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,811,534; 5,750,692; 5,948,903; 5,587,470; 5,457,191; 5,763,588; 5,830,653; 5,808,027; 6,005,096; 6,015,886; 6,147,200; 6,166,197; 6,166,199; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0203] In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

[0204] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5’-end of the oligonucleotide. Internucleoside Linkage Modifications and Motifs

[0205] A 3' to 5' phosphodiester linkage is the naturally occurring internucleoside linkage of RNA and DNA. In certain embodiments, compounds described herein have one or moremodified, i.e., non-naturally occurring, internucleoside linkages. Certain non-naturally occurring internucleoside linkages may impart desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. Representative phosphorus-containing modified internucleoside linkages include, but are not limited to, phosphotriesters, alkylphosphonates (e.g. methylphosphonates), phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2), thiodiester, thionocarbamate (-O- C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-Ν((CΗ3)-Ν((CΗ3)-). Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2- N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed Ν, O, S and CH2 component parts.

[0206] In certain embodiments, compounds provided herein comprise at least one modified internucleoside linkage. A modified internucleoside linkage may be placed at any position of an oligonucleotide. For double-stranded compounds, a modified internucleoside linkage may be placed within the sense oligonucleotide, antisense oligonucleotide, or both oligonucleotides of the double-stranded compound.

[0207] In certain embodiments, the internucleoside linkage modification may occur on every nucleoside of an oligonucleotide. In certain embodiments, internucleoside linkage modifications may occur in an alternating pattern along an oligonucleotide. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (Ρ=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphateinternucleoside linkage. In certain embodiments, the pattern of the internucleoside linkage modification on each oligonucleotide of a double-stranded compound is the same. In certain embodiments, the pattern of the internucleoside linkage modification on each oligonucleotide of a double-stranded compound is different. In certain embodiments, a double-stranded compound comprises 6-8 modified internucleoside linkages. In certain embodiments, the 6-8 modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, the sense oligonucleotide comprises at least two modified internucleoside linkages at either or both the 5’-end and the 3’-end. In certain such embodiments, the modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, the antisense oligonucleotide comprises at least two modified internucleoside linkages at either or both the 5’- end and the 3’-end. In certain such embodiments, the modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages.

[0208] In certain embodiments, a double-stranded compound comprises an overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate internucleoside linkage modification in the overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate internucleotide linkage linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleoside linkages between the terminal three nucleosides, in which two of the three nucleosides are overhang nucleosides, and the third is a paired nucleoside next to the overhang nucleoside. These terminal three nucleosides may be at the 3’-end of the antisense oligonucleotide, the 3’-end of the sense oligonucleotide, the 5’-end of the antisense oligonucleotide, or the 5’end of the antisense oligonucleotide.

[0209] In certain embodiments, modified oligonucleotides comprise one or more internucleoside linkages having chiral centers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having chiral centers can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprisephosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. As is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. Conjugate Groups

[0210] In certain embodiments, the compounds described herein comprise or consist of one or more oligonucleotides and, optionally, one or more conjugate groups. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached at the 3’ end of an oligonucleotide. In certain embodiments, a conjugate group is attached at the 5’ end of an oligonucleotide. In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups.

[0211] In certain embodiments, conjugate groups are terminal groups attached to either or both ends of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 3’ end of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 5’ end of an oligonucleotide. In certain embodiments, terminal groups include, but are not limited to, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified, such as an overhang.

[0212] In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, activity, half-life, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups enhance the affinity of a compound for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a compound absent such a conjugate group. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.

[0213] In certain embodiments, conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0214] In certain embodiments, conjugate groups include an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)- pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial, or an antibiotic.

[0215] In certain embodiments, conjugate groups are targeting moieties. In certain embodiments, a targeting moiety includes, but is not limited to, a lectin, glycoprotein, lipid, protein, peptide, peptide mimetic, receptor ligand, antibody, thyrotropin, melanotropin, surfactant protein A, carbohydrate, carbohydrate derivative, modified carbohydrate, carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative, mucincarbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine (GalNAc), N- acetylglucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin Β12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0216] In certain embodiments, conjugate groups may include, but are not limited to, the conjugate groups described in the following references such as cholesterol (e.g., Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (e.g., Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioether, e.g., hexyl-S-tritylthiol (e.g., Manoharan et al., Αnn. NY. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (e.g., Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains, e.g., do-decan-diol or undecyl residues (e.g., Saison-Behmoaras et al., ΕΜΒΟ J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (e.g, Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamines or a polyethylene glycol chains (e.g., Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), adamantane acetic acid (e.g., Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl (e.g., Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), octadecylamine or hexylamino-carbonyloxychole sterol moiety (e.g., Crooke et al. J. Pharmacol. Exp. Ther., 1996, 277:923-937), tocopherol (e.g., Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16:734-740), GalNAc and other carbohydrates (e.g., Maier et al., Bioconjugate Chemistry, 2003, 14, 18-29; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; WO2009 / 073809 and US Patents 8,106,022; 8,450,467 and 8,828,957; and WO2014 / 179445; WO2014 / 179620 and US Patents 9,127,276; 9,181,549 and 10,844,379) each of which is incorporated herein by reference in its entirety.

[0217] Conjugate groups may be attached to oligonucleotides through conjugate linkers. In certain embodiments, a conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units or combination of such repeating units. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, οxο, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certainembodiments, a conjugate linker comprises at least one phosphorus group. In certain embodiments, a conjugate linker comprises at least one phosphate group. In certain embodiments, a conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (ΑΗΕΧ or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl, or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides may be modified or unmodified nucleosides. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides herein can be linked to one another and to the remainder of the compound through cleavable bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.

[0218] In certain embodiments, conjugate groups and conjugate linkers as well as other modifications include, without limitation, those described in the following references: US 5,994,517; US 6,300,319; US 6,660,720; US 6,906,182; US 7,262,177; US 7,491,805; US 8,106,022; US 7,723,509; US 9,127,276; US 2006 / 0148740; US 2011 / 0123520; WO2013 / 033230; WO2012 / 037254, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011,19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Lee, Carhohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al.,Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759- 770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycohiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216- 5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromh Vase Biol, 2006, 26, 169- 175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., JAm Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998 / 013381; WO2011 / 038356; WO1997 / 046098; WO2008 / 098788; WO2004 / 101619; WO2012 / 037254; WO2011 / 120053; WO2011 / 100131; WO2011 / 163121; WO2012 / 177947; WO2013 / 033230; WO2013 / 075035; WO2012 / 083185; WO2012 / 083046; WO2009 / 082607; WO2009 / 134487; WO2010 / 144740; WO2010 / 148013; WO1997 / 020563; WO2010 / 088537; WO2002 / 043771; WO2010 / 129709; WO2012 / 068187; WO2009 / 126933; WO2004 / 024757; WO2010 / 054406; WO2012 / 089352; WO2012 / 089602; WO2013 / 166121; WO2013 / 165816; U.S. Patents 4,751,219; 7,582,744; 8,552,163; 8,137,695; 6,908,903; 6,383,812; 7,262,177; 6,525,031; 5,994,517; 6,660,720; 6,300,319; 7,723,509; 8,106,022; 7,491,805; 7,491,805; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011 / 0097264; US2011 / 0097265; US2013 / 0004427; US2003 / 0119724; US2011 / 0207799; US2012 / 0035115; US2012 / 0230938; US2005 / 0164235; US2006 / 0183886; US2012 / 0136042; US2012 / 0095075; US2013 / 0109817; US2006 / 0148740; US2008 / 0206869; US2012 / 0165393; US2012 / 0101148; US2013 / 0121954;US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; and US2009 / 0203132; each of which is incorporated herein by reference in its entirety. Certain Targeting Moieties

[0219] In certain embodiments, a compound provided herein comprises a conjugate group. In certain embodiments, an oligonucleotide provided herein comprises a conjugate group. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more GalNAc. In certain embodiments, the one or more GalNAc are attached to one or more positions on a furanose ring. In certain embodiments, the one or more GalNAc are attached to the 2’ or 3’ position on a furanose ring. In certain embodiments, the furanose ring is a subunit of the oligonucleotide. In certain embodiments, the furanose ring is the 5’ nucleoside sugar of an oligonucleotide. In certain embodiments, the furanose ring is the 5’ nucleoside sugar of a sense oligonucleotide. In certain embodiments, a compound or oligonucleotide comprises one or more subunits with the following formula or a salt, solvate, or hydrate thereof:wherein: R1is H, adenine, guanine, thymine, cytosine, uracil, carbocyclyl, heterocyclyl, aryl, heteroaryl, or a nucleobase isostere; R2is the oligonucleotide sequence; L1is alkyl, or alkyl-C(=O)-NH-alkyl; L2is alkyl, or alkyl-C(=O)-NH-alkyl;L3is a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, O, S, S(=O), S(=O)2, NH, substituted N group, alkyl, alkenyl, dienyl, alkynyl, heteroalkyl, phosphate; R3is H, -C=(O)-NH-(CH2CH2O)j-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O- GalNAc; R4is H, -C=(O)-NH-(CH2CH2O)k-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O- GalNAc; R5is -C=(O)-NH-(CH2CH2O)m-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O- GalNAc; R6is -C=(O)-NH-(CH2CH2O)n-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O- GalNAc; W and Q are each independently O, NH, CH2, or CH2O; S1and S2are each independently C(R7) or N, wherein each instance of R7is independently H, alkyl, heteroalkyl, or halogen; j is an integer 1-10, inclusive; k is an integer 1-10, inclusive; m is an integer 1-10, inclusive; and n is an integer 1-10, inclusive.

[0220] In certain embodiments, R3, R4, R5, and R6are the same. In certain embodiments, R3, R5, and R6are the same. In certain embodiments, R3or R4is H.

[0221] In certain embodiments, L1and L2are the same.

[0222] In certain embodiments, L1and L2are each independently alkyl; R3is H, -C=(O)-NH- (CH2CH2O)j-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R4is H, -C=(O)-NH- (CH2CH2O)k-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R5is -C=(O)-NH- (CH2CH2O)m-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; and R6is -C=(O)-NH- (CH2CH2O)n-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc.

[0223] In certain embodiments, L1and L2are each independently alkyl-C(=O)-NH-alkyl; R3is H, -C=(O)-NH-(CH2CH2O)j-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R4is H, -C=(O)-NH-(CH2CH2O)k-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R5is -C=(O)-NH-(CH2CH2O)m-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; and R6is -C=(O)-NH-(CH2CH2O)n-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc.

[0224] In certain embodiments, R4is H.

[0225] In certain embodiments, L1and L2are each independently alkyl; R3is -C=(O)-NH- (CH2CH2O)j-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R4is H; R5is -C=(O)- NH-(CH2CH2O)m-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; and R6is -C=(O)- NH-(CH2CH2O)n-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc.

[0226] In certain embodiments, L1and L2are each independently alkyl-C(=O)-NH-alkyl; R3is -C=(O)-NH-(CH2CH2O)j-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R4is H; R5is -C=(O)-NH-(CH2CH2O)m-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; and R6is -C=(O)-NH-(CH2CH2O)n-GalNAc, or -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc.

[0227] In certain embodiments, R3is -C=(O)-NH-(CH2CH2O)j-GalNAc; R4is H; R5is -C=(O)- NH-(CH2CH2O)m-GalNAc; and R6is -C=(O)-NH-(CH2CH2O)n-GalNAc.

[0228] In certain embodiments, R3is -C(=O)-NH-alkyl-NH-C(=O)-alkyl-O-GalNAc; R4is H; R5is -C(=O)-NH- alkyl-NH-C(=O)-alkyl-O-GalNAc; and R6is -C(=O)-NH-alkyl-NH-C(=O)-alkyl- O-GalNAc.

[0229] In certain embodiments, a compound or oligonucleotide comprises one or more subunits with the following formula or a salt, solvate, or hydrate thereof:wherein:R9is H, adenine, guanine, thymine, cytosine, or uracil, or adenine, guanine, thymine, cytosine, or uracil, each comprising a Protecting Group (PG), a modified nucleobase, optionally substituted alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, or a nucleobase isostere; L is a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, alkyl, or heteroalkyl; R2is the oligonucleotide sequence; Y1 is O, CH2, CH2O, or optionally substituted NH; Y2 is O, CH2, CH2O, or optionally substituted NH; Y3is CO, SO2, P(O)O, CH2-O-C(O), CH2-NH-C(O), CH2-NH-SO2, or CH2; Y4is CO, SO2, P(O)O, CH2-O-C(O), CH2-NH-C(O), CH2-NH-SO2, or CH2; n2 is 0, 1, 2, 3, 4, 5, or 6; and each n1, n3, n4 and n5 is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0230] In certain embodiments, a compound or oligonucleotide comprises one or more subunits with the following formula or a salt, solvate, or hydrate thereof:wherein: each n is independently 1, 2, 3, 4, or 5; each m is independently 0, 1, 2, 3, 4, 5, or 6; each o is independently 0, 1, 2, 3, 4, 5, or 6; each of L1, L2, and L3 is independently absent, C(=O), or C(=O)NH;each Y1is independently O, CH(Ra), S, S(=O), S(=O)2, NH, substituted N group , NHC(=O), C(=O)NH, P(=O)2-O-, P(=O)(=S)-O, P(=S)2-O, -O-P(=O)2-O-, -O-P(=O)(=S)-O-, - O-P(=S)2-O-, -O-P(=O)2-, -O-P(=O)(=S)-, -O-P(=S)2-; each Y2is independently O, CH(Rb), S, S(=O), S(=O)2, NH, substituted N group , NHC(=O), C(=O)NH, P(=O)2-O-, P(=O)(=S)-O, P(=S)2-O, -O-P(=O)2-O-, -O-P(=O)(=S)-O-, - O-P(=S)2-O-, -O-P(=O)2-, -O-P(=O)(=S)-, -O-P(=S)2-; each of Het1, Het2, and Het3is independently optionally substituted heteroaryl or optionally substituted heterocyclyl; R1is the oligonucleotide sequence linked by a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, alkyl, or heteroalkyl; each R5, R6, and R7is ; R9 is optionally substitutedeach Rais independently H, alkyl, halo, ORc, or SRc; each Rbis independently H, alkyl, halo, ORc, or SRc; and each Rcis independently H or alkyl.

[0231] In certain embodiments, the subunit is selected from Formulae I through VIII or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide other than the 5’ nucleoside. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula I and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula I and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula II and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula II and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula III and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula III and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula IV and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula IV and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula V and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula V and R’ isS. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VI and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VI and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VII and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VII and R’ is S. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VIII and R’ is O. In certain embodiments, the 5’ nucleoside of the modified oligonucleotide is Formula VIII and R’ is S. Target Nucleic Acids and Target Regions

[0232] In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is non- coding. In certain such embodiments, the target nucleic acid is selected from an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an exon. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0233] In certain embodiments, compounds disclosed herein hybridize with a CFB nucleic acid. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods of determining whether a sequence hybridizes specifically to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein specifically hybridize with a CFB nucleic acid.

[0234] Nucleotide sequences that encode CFB include, without limitation, the following: GENBANK Accession Nos. NM_001710.6 (incorporated herein as SEQ ID NO: 1), nucleotides 31946095 to 31952084 of GenBank Accession No. NC_000006.12 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 3), andnucleotides 3423522 to 3429511 of GenBank Accession No. NT_113891.3 (incorporated herein as SEQ ID NO: 4). Complementarity

[0235] Oligonucleotides provided herein may have a defined percent complementarity to a particular nucleic acid, target region, oligonucleotide, or portion thereof. Non-complementary nucleobases may be tolerated provided that the oligonucleotide remains able to specifically hybridize to the nucleic acid, oligonucleotide, or portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. Percent complementarity of an oligonucleotide with a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined using routine methods. For example, an oligonucleotide in which 18 of 20 nucleobases of the oligonucleotide are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an oligonucleotide which is 18 nucleobases in length having four non- complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of an oligonucleotide with a region of a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined routinely using BLAST programs (basic local alignment search tools) known in the art. In certain embodiments, oligonucleotides described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. For example, an oligonucleotide may be fully complementary to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. As used herein, “fully complementary” means each nucleobase of an oligonucleotide is complementary to thecorresponding nucleobase of a target nucleic acid, a target region, an oligonucleotide, or a specified portion thereof. For example, a 20 nucleobase oligonucleotide is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. “Fully complementary” can also be used in reference to a specified portion of the first and / or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase oligonucleotide can be “fully complementary” to a 20 nucleobase region of a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

[0236] In certain embodiments, oligonucleotides described herein comprise one or more mismatched nucleobases relative to a target nucleic acid, a target region, an oligonucleotide or a specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5’-end of the oligonucleotide. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3’-end of the oligonucleotide. In certain embodiments, the mismatch forms a wobble base pair with a corresponding nucleobase on the target nucleic acid. For example, in certain embodiments, the mismatch forms a wobble base pair selected from hypoxanthine (nucleobase of inosine) and uracil (I:U base pair); guanine and uracil (G:U base pair); hypoxanthine and adenine (I:A base pair); and hypoxanthine and cytosine (I:Cbase pair). Accordingly, in certain embodiments, a mismatched nucleobase on an oligonucleotide comprises hypoxanthine, guanine, or uracil.

[0237] In certain embodiments, oligonucleotides described herein may be complementary to a portion of a nucleic acid. As used herein, “portion” refers to a defined number of contiguous nucleobases within a region of a nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an oligonucleotide. In certain embodiments, the oligonucleotides are complementary to at least an 8 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 9 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 10 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least an 11 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 12 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 13 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 14 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 15 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 16 nucleobase portion of a nucleic acid. Also contemplated are oligonucleotides that are complementary to at least a 9, 10, 17, 18, 19, 20, 21, 22, 23 or more nucleobase portion of a nucleic acid, or a range defined by any two of these values. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion of a sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide. Identity

[0238] The oligonucleotides provided herein may also have a defined percent identity to a particular nucleic acid, target region, oligonucleotide, or specified portion thereof. As usedherein, an oligonucleotide is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, a DNA which contains thymidine in place of uracil in a disclosed RNA sequence would be considered identical to the RNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an oligonucleotide is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared. In certain embodiments, oligonucleotides described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the nucleic acids, oligonucleotides, or a portion thereof, disclosed herein. In certain embodiments, oligonucleotides described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleic acid or oligonucleotide, or portion thereof.

[0239] In certain embodiments, an oligonucleotide may have one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3’-end of the oligonucleotide. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. Pharmaceutical Compositions and Formulations

[0240] Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependentupon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compounds comprise or consist of one or more modified oligonucleotides. In certain such embodiments, the pharmaceutical composition comprises one or more compound and a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises one or more compound and a sterile saline solution. In certain embodiments, such pharmaceutical composition consists of one compound and a sterile saline solution. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS.

[0241] A compound described herein targeted to CFB can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to CFB and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide provided herein.

[0242] Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compound comprises or consists of one ormore modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound. In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.EXAMPLES

[0244] The following examples describe the process to characterize compound RD2830 targeted to CFB.

[0245] The following examples and related sequence listing accompanying this filing may identify sequence as either “RNA” or “DNA”; however, as disclosed herein, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that the designation of a sequence as “RNA” or “DNA” is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH for the natural 2’-H of DNA) or as an RNA having a modified base (methylated uracil for natural uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleobases.

[0246] Each of the references recited in the present application is incorporated herein by reference in its entirety.

[0247] Abbreviations for chemical modifications are provided in Table 1. IA and IS identify the antisense strand and sense strand, respectively. Table 1 Chemical Nomenclature Abbreviation Structure ‘ ’ 2’ th l ifi ti AExample 1: Compound RD2830

[0248] The unmodified and modified Antisense and Sense sequences of compound RD2830 are shown below. Unmodified Antisense and Sense sequences of compound RD2830SEQ ID NO: 1 SEQ ID NO: 1 Antisense Sequence SEQ ID Sense Sequence SEQ ID Start Site Stop Site (5′-3′) NO: (5′-3′) NO: 1383 1404 UAGACAUCCAGAUAAUCCUUCC 100 UGGAAGGAUUAUCUGGAUGUCUA 109Ref ID SEQ ID Modified Strands (5′-3′) NO: NO: * * * * QExample 2: Effect of RD2830 in cynomolgus monkeys

[0249] Compound RD2830 was evaluated in cynomolgus monkeys. Prior to the study the monkeys were quarantined and observed daily for general health. Two cynomolgus monkey were each injected with a single 4 mg / kg subcutaneous dose on Day 1 of the study. During the study period, the monkeys were observed daily for signs of illness or distress. Animals were bled on day -6 and on days 1 (prior to dosing), 8, and 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85 and 96.

[0250] Immunoblotting was also used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys. Following serum collection, the serum was diluted in 1 X PBS buffer and mixed with SDS-PAGE compatible loading buffer and a reducing reagent. Samples were heated to 70 °C for ten minutes and resolved by SDS-PAGE. Following the migration of the samples by PAGE, the proteins were transferred to nitrocellulose or other compatible membrane. The membranes were stained with Revert 700 and total protein for each sample was quantified using an Odyssey CLx detection system.

[0251] The membranes were blocked with Intercept® blocking buffer (P / N: 927-60001) and then probed with a primary antibody specific to CFB (ProteinTech, catalog no. 10170-1-AP). The antibody was diluted in Intercept® antibody diluent (P / N: 927-75001). After incubating the membrane with the primary antibody, the membrane was washed and then probed with a secondary antibody (IgG P / N: 926-32211). The antibody was diluted in Intercept® antibody diluent (P / N: 927-75001). The membranes were then analyzed on an Odyssey CLx detection system to determine the levels of CFB in each sample. The data for each sample was normalized to the total protein loaded into each lane and the CFB levels were quantified using Image StudioLite. CFB inhibition data is presented in the table below, expressed as percent change from the predose level. Table 2. Compound RD2830 - Average CFB Inhibition Day 8 15 22 29 36 43 50 57 64 71 78 85 96 CFB Inhibition 70 84 90 92 92 89 90 87 83 77 78 75 76

[0252] Inhibition of Alternative Complement Pathway Activity was evaluated using the WIESLAB assay (COMPL AP330) following manufacturer recommended protocol. Data is provided in the table below. Table 3. Compound RD2830 - Average Alternative Pathway Inhibition Day 8 15 22 29 36 43 50 57 64 71 78 85 96 AP Inhibition 60 87 95 95 98 97 94 93 89 83 75 75 74

[0253] Inhibition of Alternative Hemolysis was evaluated using 5.6% serum, 25% Er (Complement Technologies, Inc.) and Buffer GVB◦+MgEDTA as follows. NHP serum (5.6%) was added to GVB° (Complement Technology, Tyler, Texas) and 5 mM EGTA with 25% rabbit erythrocytes (Er, Complement Technology, Tyler, Texas). Samples were incubated at 37°C with intermittent shaking for 1 hour. Hemolysis was stopped by adding GVBE (Complement Technology, Tyler, Texas) at a 1:1 ratio to the samples. Samples were then centrifuged, and supernatants were transferred to a new 96-well plate. Absorbance was measured at 412 nm. Alternative hemolytic activity was measured by subtracting the OD value from the negative control sample (buffer and Er only) and normalizing each sample to the positive control sample (water and Er only). Individual timepoint samples were then normalized to their average pre- dose samples and are presented in the table below. Table 4. Compound RD2830 - Average Alternative Hemolysis Inhibition Day 8 15 22 29 36 43 50 57 64 71 78 85 96 Inhibition 39 55 70 68 78 67 65 70 62 44 47 37 52Example 3: Effect of RD2830 in Sprague Dawley Rats

[0254] Sprague Dawley rats (3 / sex / group main (Groups 1-5), 1 / sex / group toxicokinetic (groups 6-9)), 8-9 weeks of age) were administered the vehicle control (Group 1) or 30, 60, 150, or 300mg / kg / dose RD2830 (Groups 2 and 6, 3 and 7, 4 and 8, or 5 and 9, respectively) on Day 1 and Day 21 via SC injection at a dose volume of 5 mL / kg.

[0255] Observations included cage-side observations (general signs of toxicity including fecal and urine quality), physical examination (predose), body weight (Days 1, 5, 8, 12, 15, 19, 21 (toxicokinetic) and Day 26 (main) and quantitative food consumption (weekly). Blood samples were collected for clinical chemistry, hematology and coagulation on Day 26. Termination was on Day 26. Necropsy included visual examination for external abnormalities, abdominal, thoracic, and cranial cavities abnormalities. Organ weights (heart, kidney, liver, spleen and thymus) were recorded. Histology and microscopic pathology (heart, kidney, lesions, liver, lung, lymph nodes, injection sites, skin, spleen and thymus) were conducted.

[0256] RD2830, administered as single SC doses on Days 1 and 21 at 30, 60, 150 and 300 mg / kg / dose, was considered generally tolerated by male and female rats. Example 4: A Phase 1, Randomized, Placebo-Controlled, Double Blind Single Ascending Dose Study in Healthy Volunteers Followed by Open Label Treatment in Patients with Paroxysmal Nocturnal Hemoglobinuria to Evaluate the Safety, Tolerability, Pharmacokinetics and Pharmacodynamics of RD2830 (ADX-038)

[0257] Rationale

[0258] Paroxysmal nocturnal hemoglobinuria (PNH) is a rare, life-threatening hematologic disease characterized by chronic, intravascular hemolysis due to uncontrolled activation of the terminal complement pathway.

[0259] RD2830 (“ADX-038”) is a N-acetylgalactosamine (GalNAc)-conjugated double stranded (ds) small interfering RNA (siRNA) oligonucleotide intended for the treatment of patients with PNH and other complement-mediated diseases. ADX-038 prevents the expression of complement factor B (CFB) by affecting the (RISC)-mediated cleavage of mRNA transcripts of a gene encoding CFB.

[0260] CFB is responsible for activating the alternative complement pathway. The CFB gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b toform the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. Inappropriate activation of the complement system is responsible for initiating or propagating many different diseases, including C3 glomerulopathy, systemic lupus erythematosus and PNH. Current treatments for PNH are limited and can be complicated to use.

[0261] ADX-038 is highly selective, showing complete inhibition of the alternative complement pathway, whereas the classical complement pathway remains unaffected. While the primary risk to healthy participants is related to infection by encapsulated organisms, this risk is lessened due to the selectivity of ADX-038 for alternative pathway suppression coupled to vaccinations (see Muri, et. al., "Alternative complement pathway inhibition abrogates pneumococcal opsonophagocytosis in vaccine-naïve, but not vaccinated individuals." Front Immunol., 2001, 12, 732146; Ispasanie, et.al., "Alternative complement pathway inhibition does not abrogate meningococcal killing by serum of vaccinated individuals." Front Immunol., 2001, 12, 747594). To be included in the study, prospective participants and PNH patients must provide evidence of prior vaccination or be vaccinated during the screening period against Neisseria meningitidis, Streptococcus pneumoniae, and Hemophilus influenzae at least 3 weeks prior to their dose of ADX-038. If the participant is not vaccinated and they decline vaccination, that prospective participant is no longer considered eligible for participation in this study.

[0262] ADX-038 has shown a long duration of action in primates and is expected to have semi- annual or annual dosing by subcutaneous injection.

[0263] The first-in-human Phase 1 study described herein will evaluate the safety, tolerability, pharmacokinetics (PK) and pharmacodynamics (PD) of ADX-038 in both healthy volunteers (Table 5) and in patients with PNH (Table 6). Data obtained from this study will enable the definition of the ADX-038 safety profile and identification of the dose level and treatment regimen to be used for further evaluation of its therapeutic utility in PNH patients in a subsequent Phase 2 trial. Table 5: Part A (SAD Cohorts) Objectives EndpointsObjectives Endpoints To evaluate the safety and tolerability of Incidence relationship and severity of n dTable 6: Part B (PNH Patient Treatment) Objectives Endpoints nChange from baseline in vital signs Change from baseline in electrocardiogram d -5To evaluate effect of treatment with ADX- Change from baseline in: 038 on patient reported outcome PNH-specific Patient Preference

[0265] The clinical study described herein is a Phase 1, multi-center study evaluating safety, tolerability, PK, and PD of ADX-038. The study consists of 2 parts: • PART A: Randomized, double-blind, placebo-controlled, parallel group, single ascending dose (SAD) in healthy volunteers with up to 5 dose cohorts in a single Phase 1 unit. The planned dosing schedule is as follows: Cohort n (active) n (placebo) Dose (mg / kg) 1 6 2 0.4 2 6 2 1.5 3 (optional) 6 2 4 4 (optional) 6 2 up to 8 5 (optional) 6 2 up to 12 i.e. 2 sentinel participants (1 active, 1 placebo) followed by remaining cohort participants (5 active, 1 placebo). Dosing is performed under fasting conditions (at least 8 h, water permitted). • PART B: Open label, no placebo, single dose cohort(s) in participants with PNH at the selected dose: Cohort n Proposed Dose Levels (mg / kg) 1 2-5 TBD, based on Part A emerging data (blinded) 2 2-5 TBD, based on Part A emerging data (blinded) This part will be initiated at the dose level(s) determined from Part A based on available blinded safety and, PK / PD data collected minimally two months post dose for each participant in the dose Cohorts of healthy participants that are enrolled.

[0266] The study schema is shown in FIG. 1.

[0267] A decision tree to illustrate the process for transitioning into Part B is shown in FIG. 2.

[0268] A Safety Review Committee (SRC) will monitor participant safety during the study and make dose escalation decisions for Part A and dose selection decisions for each Part A and Part B cohort enrolled.

[0269] Both study parts include a screening period, a treatment day, and a follow-up period. All participants are evaluated throughout the study as specified in the Schedule of Activities (SoA) in Table 7 (Part A SAD cohorts) and Table 8 (Part B Expansion cohort). The brief description below applies to both study parts, unless noted otherwise.

[0270] After signing the participant information sheet and informed consent form (PICF), participants will be screened for eligibility. To be eligible in Part A, the participant must be healthy; in Part B, participants must have a documented diagnosis of PNH.

[0271] In both study parts, participants are admitted to a Phase I unit, on Day -1 in Part A and on Day 1 in Part B. Eligible participants in Part A will receive study drug (ADX-038 or placebo) on Day 1 (in Part A according to their assigned cohort and randomization as detailed below, in Part B, dose selected by SRC based on Part A data and alternative pathway level simulation). Participants are discharged from the clinic on Day 2 (after collection of the 30-hour post dose blood samples for PK / PD). Participants will return to the clinic for safety and PK / PD follow up weekly for the first 4 weeks post dose, then every 2 weeks through 14 weeks post dose. If at Day 99 (Week 14), CFB levels have not returned to ≥80% baseline levels, PD monitoring will continue every 4 weeks until CFB levels achieve >80% of baseline levels (based on 2 consecutive measures) or to Day 183 (Week 26), whichever occurs first. If at Day 183 (Week 26) the alternative pathway activity has not returned to ≥50% of its baseline level, monitoring will continue every 4 weeks until alternative pathway activity achieves ≥50% from baseline levels (based on 2 consecutive measures) or to Day 365 (Week 52), whichever occurs first. End of study (EOS) will be defined as the visit upon which CFB levels have returned to ≥80% baseline levels up to Day 183 or alternative pathway activity returned to ≥50% baseline levels or Day 365. Repeated CFB or alternative pathway measures for confirmation must be taken at least one week apart.

[0272] Part A Randomization and Dose Escalation

[0273] For each cohort enrolled in Part A (SAD), 8 participants will be randomized in a 3:1 ratio, 6 participants to active (ADX-038): 2 participants to control (matched placebo). Randomization will be on Day 1.

[0274] Initially, 2 sentinel participants (1 active and 1 placebo) will be randomized and dosed. The sentinel participants will be evaluated for safety for 48 hours in which the investigator will assess to determine that the participants are without treatment emergent and study drug related AEs of grade 3 or higher, or SAEs. Within one business day of the investigator’s assessment, the independent medical monitor will decide upon the randomization and dosing of the 6 remaining participants (5 active and 1 placebo) according to the randomization schedule.

[0275] The decision to continue dosing between cohorts, i.e., to escalate, maintain or reduce dose levels, will be done by a Safety Review Committee (SRC) comprised minimally of Sponsor representative(s), an independent Study Medical Monitor, and the Principal Investigator at the clinical site. The SRC will review all available, blinded safety, PK and PD data of participants in each cohort and all prior cohorts; additional details are provided in the SRC charter. A minimum of 28 days post dose (study visit day 29) safety data along with available PK / PD data through 30 hours following the last participant dosed will be reviewed by an SRC to determine the next dose level. Prior to enrolling for optional Cohorts 4 or 5, all available, blinded safety, PK and PD data of participants in each cohort and all prior cohorts will be reviewed at least 8 weeks (day 57) post- dose from Cohorts 3 or 4 (i.e., the Cohort preceding the respective optional Cohort). All accumulated data in each cohort will be reviewed with data collected up to study visit day 57 for the last participant before continuing to Part B.

[0276] Part B Additional Information

[0277] In Part B, participants with PNH will be monitored as described above for HV in Part A. The investigator should be notified on either the same or day following any breakthrough hemolysis requiring treatment or hospital attendance by a study participant. The occurrence of breakthrough hemolysis by a study participant, particularly if occurring early in the treatment, could be indicative of submaximal drug effect due to the relatively slow onset of action of CFB inhibition by ADX-038. As such, the study investigator would need to determine if the occurrence of the hemolysis event and its severity would result in termination of study participation and resumption of previous treatment or using rescue medication and continuation on study.

[0278] Number of Participants

[0279] Up to 40 healthy volunteers will be enrolled in Part A and 2-10 participants with PNH in Part B.

[0280] Duration

[0281] Each participant in the study Part A is expected to remain in the trial as follows: Study Period Duration Screening Up to 49 days Study drug administration days 1 day Follow-up days Up to 365 days depending on when CFB levels return to ≥80% of baseline level or alternative pathway activity returns to ≥50% of baseline level Total duration Up to 13 months

[0282] Each participant in the study Part B is expected remain in the trail as follows: Study Period Duration Screening Up to 28 days Study drug administration days 1 day Follow-up days Up to 365 days depending on when CFB levels return to ≥80% of baseline level after last dose of study drug or alternative pathway activity returns to ≥50% of baseline level Total Possible Duration Up to 13 months

[0283] All participants enrolled in Part B receive ADX-038. None of the participants enrolled in Part B receive placebo.

[0284] Results

[0285] The Phase 1 study commenced, and data was obtained for participants in Cohort 1 (0.4 mg / kg) and Cohort 2 (1 mg / kg). (Note, the protocol recited maximum doses (i.e. up to 1.5 mg / kg for cohort 2). During the study, Cohort was dosed 1 mg / kg).

[0286] FIG. 3 is a plot showing average relative (i.e. percent reduction from baseline) plasma complement factor b (CFB) protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 after administration, obtained from participants in Cohort 1 (0.4 mg / kg) and Cohort 4 (1 mg / kg) administered a single subcutaneous dose of ADX-038.

[0287] FIG. 4 is a plot showing average relative (i.e. percent reduction from baseline) plasma alternative pathway protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 after administration, obtained from participants in Cohort 1 (0.4 mg / kg) and Cohort 4 (1 mg / kg) administered a single subcutaneous dose of ADX-038.

[0288] FIG. 5 is a plot showing average relative (i.e. percent reduction from baseline) plasma classical pathway protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 after administration, obtained from participants in Cohort 1 (0.4 mg / kg) and Cohort 4 (1 mg / kg) administered a single subcutaneous dose of ADX-038.

[0289] A dose-dependent reduction in serum CFB and AP activity was observed.

[0290] No change in CP activity over the 70-day period was observed.

[0291] Cohort 1 (0.4 mg / kg) reductions in serum CFB and AP activity persisted out to Day 70.Schedule of Activities (SoA) Table 7: Schedule of Activities – Part A (SAD in healthy volunteers, Double-Blind, Placebo-Control) Part Coho dose) Visit Study Study Visit (days Infor conse Domi OutpavisitPart Coho dose) Visit Study Study Visit (days Demo and m histor Vacci Inclus exclu Body Heigh Comp physiexaminationPart Coho dose) Visit Study Study Visit (days Vital Twel safety electr m (E triplicfirst ECG in the triplicate;Part Coho dose) Visit Study Study Visit (days Hema serum SerolC virus (HCV)Part Coho dose) Visit Study Study Visit (days Coag factor Urine tobac alcoh test Urinadose)Part Coho dose) Visit Study Study Visit (days Pregn FSHmenopausePart Coho dose) Visit Study Study Visit (days Rand Study admin Blood for P Blood for C and calternative andPart Coho dose) Visit Study Study Visit (days classi pathw AE refollowed to resolutionPart Coho dose) Visit Study Study Visit (days Prior conco medica ons managemen o s Table 8: Schedule of Activities – Part B (Patients with PNH, Open-Label)Part Patie PNH Visit Study Study Visit (days Infor conse Domi Outpa visit Demo and mhistoryPart Patie PNH Visit Study Study Visit (days Vacci Inclus exclu Body Heigh Comp physi exam Vitalmin, 1, 4, 8 and 12 h post dose;Part Patie PNH Visit Study Study Visit (days Twel safety electr m (E triplicFollow-up (day 15) and EOSPart Patie PNH Visit Study Study Visit (days Hema serum and o Serol Coag factordose)Part Patie PNH Visit Study Study Visit (days Quan (QFT Urina PregneligibilityPart Patie PNH Visit Study Study Visit (days FSH Study admin QLQ- FACID183Part Patie PNH Visit Study Study Visit (days Blood for P Blood for C and c altern classi pathw Blood for an antidrantibodies 183Part Patie PNH Visit Study Study Visit (days AE re Prior concomedications of AEs or as rescue medicationExample 4A. Protocol Revision: A Phase 1, Randomized, Double Blind, Placebo- Controlled, Single Ascending Dose Study in Healthy Participants Followed by a Phase 2a Open Label Study in Participants with Paroxysmal Nocturnal Hemoglobinuria and Residual Anemia to Evaluate the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of RD2830 (ADX-038)

[0292] Subsequent Protocols revised the dose administered to study participants and adjusted the patient population to include patients with PNH and residual anemia.

[0293] ADX-038 is being developed for the treatment of PNH and other complement-mediated disorders. It is a double stranded small interfering ribonucleic acid (siRNA), conjugated on the sense strand with triantennary N-acetylgalactosamine to facilitate uptake by hepatocytes. In hepatocytes, ADX-038 utilizes the RNA interference (RNAi) mechanism and directs catalytic breakdown of messenger RNA (mRNA) for complement factor B (CFB). CFB protein is a regulator of the alternative pathway (AP); therefore, blockade of CFB protein synthesis consequently downregulates activity of the AP. Activation of the classical and lectin pathway (CP, LP) is unaffected by blockade of CFB protein synthesis, as shown in the complement activation cascade. Control of complement-mediated hyperinflammation through CFB inhibition is a clinically validated therapeutic approach for treating a number of complement-mediated disorders (CMD) including paroxysmal nocturnal hemoglobinuria (PNH).

[0294] It is hypothesized that this therapeutic approach has safety advantages over terminal pathway inhibition (e.g., ravulizumab, eculizumab), which completely disengages the complement membrane attack complex - a therapeutic strategy that has been associated with serious infections caused by encapsulated bacteria (SOLIRIS USPI Sep 2024, ULTOMIRIS USPI Sep 2024).

[0295] Pharmacodynamics (PD) data in the non-human primate demonstrated that a single subcutaneous injection of ADX-038 was associated with sustained decreases in CFB protein and AP activity levels, while CP activity level remained essentially unchanged. This favorable PD profile supports the development of ADX-038 as a therapeutic agent for CMD, formulated as a subcutaneous injectable that can be dosed infrequently to reduce the high treatment burden associated with the approved complement inhibitor therapy. The first-in-human, Phase 1 / 2a study will characterize the safety, tolerability, pharmacokinetics (PK), and PD of ADX-038 in healthy participants, and subsequently, in participants with PNH and residual anemia to demonstrate proof-of-concept for ADX-038 as a potential therapeutic agent for PNH.Table 9: Phase 1 Objectives and EndpointsTable 10: Phase 2a Objectives and Endpoints

[0296] Overall Study Design

[0297] The clinical study described in this protocol is a Phase 1 / 2a, multi-center study evaluating safety, tolerability, PK, and PD of ADX-038. The study consists of multiple parts: • Phase 1 study design: Randomized, double blind, placebo-controlled, parallel group, single ascending dose (SAD) in healthy participants with up to 5 dose cohorts. • Phase 2a study design: Open label, no placebo, 2-dose study in participants with PNH and residual anemia. The fixed dose regimen evaluated in this phase is selected based on available safety, PK, and PD data from the Phase 1 study.

[0298] Both phases include a screening period, 1 dose of ADX-038 (Phase 1) or 2 doses of ADX- 038 (Phase 2a), and postdose follow-up period. Participants return for study assessments as specified in the respective schedule of activities (SoA).

[0299] Phase 1

[0300] This is a Phase 1, multi-center study evaluating safety, tolerability, PK, and PD of ADX- 038. After signing the informed consent, participants are screened over a period of up to 49 days. Eligible participants are admitted on Day -1, and receive the study drug on Day 1 (according to their assigned cohort and randomization, as detailed below). Participants are discharged on Day 2 (30 hours post dose after collection of blood samples for PK / PD). Participants return to the study center for safety, PK, and PD assessments. Duration of study participation for each participant is based on the duration of follow up for their assigned cohort.

[0301] Participants who complete the Day 351 Visit and whose AP activity has not returned to within 27 percentage points (absolute) of their baseline value will continue extended follow up. Extended follow up will consist of site visits every 3 months to collect information on SAEs and to collect blood samples to assess CFB protein levels and AP activity. Follow up will continue until the participant’s AP activity returns to within 27 percentage points (absolute) of their baseline value or they withdraw from the study.

[0302] Phase 1 study schema is shown in FIG. 6A.

[0303] Randomization

[0304] For each cohort in Phase 1 (SAD), 8 participants are randomized in a 3:1 ratio; 6 participants to active (ADX-038): 2 participants to control (matched placebo). Randomization is on Day 1. Initially, 2 sentinel participants (1 active and 1 placebo) are randomized and dosed. The sentinel participants are evaluated for safety for 48 hours in which the investigator willassess to determine that the participants are without treatment-emergent and study drug-related AEs of Grade 3 or higher, or SAEs. Within 1 business day of the investigator’s assessment, the independent Medical Monitor decides upon the randomization and dosing of the 6 remaining participants (5 active and 1 placebo).

[0305] Dose Escalation

[0306] The dose escalation plan is described in Table 11. Table 11: Phase 1 – SAD Planned Dosing Schedulea - Safety Review Committee (SRC) will review safety and PK / PD data for each dose level. A lower, intermediate, or higher dose level(s) may be used in lieu of or in addition to doses listed above.

[0307] The recommendation to escalate to the next dose level is made by a Safety Review Committee (SRC), minimally comprised of the Sponsor Medical Representative, an independent Study Medical Monitor, and the Principal Investigator at the clinical site. Phase 1 data is used to select doses for evaluation in the Phase 2a study.

[0308] Each participant in the Phase 1 study is expected to remain in the study as described in Table 12.Table 12: Phase 1 Study Duration

[0309] Participants will be considered to have completed the main study if they meet any of the following criteria: • Cohorts 1-2: CFB protein level returns to within 20% of baseline level, AP activity returns to within 50% of baseline, or they complete the Day 365 Visit, whichever comes first. • Cohorts 3-5: AP activity returns to within 27 percentage points (absolute) of baseline by the Day 351 Visit or they complete the Day 365 Visit, whichever comes first.

[0310] Participants will be considered to have completed the extended follow up period if they continue follow up until their AP activity returns to within 27 percentage points (absolute) of baseline.

[0311] Phase 2a

[0312] This is a Phase 2a, open-label, single-arm (ADX-038), 2-dose study consisting of the following periods: (i) Screening (up to 42 days); (ii), and (iii) Treatment (2 doses). Postdose Follow-up is up to 183 days after each dose.

[0313] Eligible PNH participants with residual anemia on a stable, anti-C5 regimen of ravulizumab or eculizumab for at least 3 months receive ADX-038 treatment (Dose 1), administered as a subcutaneous injection on Day 1. A participant is eligible to receive ADX-038 retreatment at Day 183 (Dose 2), or earlier if there is evidence of diminished therapeutic effect (DTE) before Day 183, i.e., decreases in hemoglobin concentration, after the initial improvement or stabilization of hemoglobin concentration.

[0314] At the Retreatment visit, intra-participant dose reduction for tolerability issues or dose escalation to extend the duration of therapeutic effect to Day 183 will be permitted. If the effect of the first dose persisted through Day 183, the participant will be administered the same dose as the first treatment at Day 183.

[0315] In Phase 2a, ADX-038 is administered in the outpatient setting. However, the option for inpatient dosing is made available to participants who agree to participate in intensive PK sample collections through 30 hours postdose. Domiciled participants are admitted to the inpatient research unit the day before dosing (Day -1). Study assessments for non-domiciled and domiciled participants are as specified in the SoAs.

[0316] Participants receive up to 2 ADX-038 doses. As data supporting the safety of chronic ADX-038 dosing becomes available, the protocol will be amended to offer access to ADX-038 treatment for eligible participants who experienced therapeutic benefits from initial ADX-038 treatment. Phase 2a study schema is shown in FIG. 6B.

[0317] Each participant in the study is expected to remain in the study as described in Table 13. All participants enrolled in the study shall receive ADX-038; none of the participants enrolled in the study shall receive placebo. Table 13: Phase 2a Study Duration

[0318] Phase 2a - ADX-038 Doses

[0319] Emerging safety, PK, and PD data of all fixed doses, derived from the corresponding weight of each healthy participant and the associated weight-based dose they received in the Phase 1, will be reviewed to support the selection of doses for evaluation in the next phase of the study. Selected doses, described below, will not be higher than the highest dose evaluated in the Phase 1 study and will have been determined to be safe by the SRC.

[0320] PNH investigators and the Pharmacy Manual will be updated with the initial planned dosage of L1, L0, and L2 before the first PNH participant is dosed in the Phase 2a study. • L1 (Level 1) is the starting dose (Dose 1) that will be administered to the PNH participant on Day 1. L1 may also be the second dose (Dose 2), if it is given again at the Retreatment visit on Day 183 if the participant tolerates L1 and DTE for this dose is not evident before Day 183. • L0 (Level 0) is a reduced dose, i.e., ≥25% lower than L1, that may be administered at the Retreatment visit (i.e., a timepoint from Day 99 to Day 183 after DTE of L1 is detected) if the participant experiences a drug-related, Grade 3 AE after receiving L1. In this scenario, a participant can only be re-treated with a reduced dose of ADX-038, if and when the drug-related Grade 3 AE (excluding allergic-type reactions such as a systemic rash, anaphylaxis or hypersensitivity reaction, or potential Hy’s law case) has resolved, improved, or stabilized to a level deemed acceptable to the investigator. • L2 (Level 2) is an increased dose, i.e., ≥25% higher than L1, that may be administered at the Retreatment visit (i.e., a timepoint from Day 99 to before Day 183 after DTE of L1 is detected) if the participant tolerates L1 but DTE for this dose is detected prior to Day 183.

[0321] Dose 2 will be administered to the PNH participant at the Retreatment visit (i.e., a timepoint from Day 99 to Day 183), and the choice of dose to administer, L1, L0, or L2, will be based on assessment of safety, tolerability, and time point of DTE of L1. Selection of the Retreatment dose is provided FIG. 6C.

[0322] A PNH participant is considered to have completed the Phase 2a study when s / he completes the Day 183 visit after Dose 2.

[0323] Phase 2a: Inclusion Criteria

[0324] Participants with PNH must meet all the following inclusion criteria:Male or female, at least 18 years of age. History of PNH based on documented clone size of ≥10% of RBCs and / or granulocytes, measured by GPI-deficiency on flow cytometry. On a stable anti-C5 regimen (ravulizumab or eculizumab, irrespective of dose / regimen) for ≥ 12 weeks prior to Day 1. Stable is defined as no changes in dose or regimen for at least 12 weeks. Screening hemoglobin concentration of 10.5 to <12 g / dL (105 to <120 g / L) for a maximum of 4 participants; screening hemoglobin concentration of <10.5 g / dL (105 g / L) for the remaining participants. Any participant with a history of packed red blood cell (PRBC) transfusion within the 12 weeks prior to screening should have screening lab visit scheduled no earlier than 4 weeks after the PRBC transfusion to minimize the effect of transfusion on screening hemoglobin concentrations. All participants (male or female) who are of childbearing potential must agree to use highly effective contraception during the study (from Day 1). Female participants using hormonal contraception must have started highly effective contraception for at least 1 menstrual cycle prior to dosing and for the duration of the study until the final study visit. Female participants should not donate oocytes during this time. Male participants with female partners of childbearing potential must continue to use highly effective contraception from the point of consenting and for the duration of the study until the final study visit. Male participants must agree not to donate sperm during this time. Note: Abstinence is acceptable if this is the usual lifestyle and preferred contraception for the participant. Contraception use by men or women should be consistent with local regulations regarding the methods of contraception for those participating in clinical studies. WOCBP must have a negative serum pregnancy test at screening and a negative urine pregnancy test at Day 1 predose (non-domiciled participant) or on Day -1 (domiciled participant). WOCBP must agree to undergo pregnancy testing during the study per the corresponding SoA. Female participants not of childbearing potential must be either surgically sterile (hysterectomy, bilateral salpingectomy, or bilateral oophorectomy) or postmenopausal, defined as no menses for 12 months without an alternative medical cause, with a FSHlevel in the postmenopausal range (for a woman not using hormonal contraception or hormonal replacement therapy) at screening. 8. Willing and able to provide informed consent and comply with all study visits and procedures as specified in the SoA. 9. Vaccination against Neisseria meningitidis infection is required. If a participant has not been previously vaccinated or if a booster is required, vaccine should be given according to local guideline / regulations within 2 weeks of (before / after) ADX-038 dosing on Day 1. If ADX-038 is administered within 2 weeks after vaccination, prophylactic antibiotics must be initiated. 10. If not received previously, vaccination against Streptococcus pneumoniae and Haemophilus influenzae infections should be given if available and according to local guideline / regulations within 2 weeks of (before / after) ADX-038 dosing on Day 1. If ADX-038 is administered within 2 weeks after vaccination, prophylactic antibiotics must be initiated. Note: The choice of vaccine pertaining to inclusion criteria 9 and 10 should take into account the serotype prevalent in the geographic areas in which the study participant will be enrolled.

[0325] Phase 2a: Exclusion Criteria

[0326] Participants must not meet any of the following exclusion criteria: 1. Known or suspected hereditary or acquired complement deficiency. 2. History of hematopoietic stem cell transplantation. 3. History of recurrent invasive infections caused by encapsulated bacteria, e.g., Meningococcus or Pneumococcus. 4. Major concurrent comorbidities, including but not limited to severe kidney disease (e.g., estimated glomerular filtration rate <30 mL / min / 1.73 m2, dialysis), advanced cardiac disease (e.g., New York Heart Association class IV), or severe pulmonary disease (e.g., severe pulmonary hypertension [World Health Organization class IV]). 5. Active malignancy and / or history of malignancy in the past 5 years, with the exception of completely excised non-melanoma skin cancer or low grade cervical intraepithelialneoplasia and with no evidence of recurrence for at least 3 months prior to ADX-038 administration on Day 1. Active systemic viral (including COVID-19), bacterial, or fungal infection within 14 days prior to ADX-038 administration on Day 1. History of splenectomy. Any other significant medical conditions that, in the onion of the investigator, would make the participant unsuitable for inclusion in the study, or could interfere with study assessments or put the participant at risk for experiencing significant adverse effects during the study. Liver disease, such as a. hepatitis B viral infection, defined as HBsAg positive b. active HCV viral infection, defined as HCV antibody positive with a detectable RNA concentration c. liver injury as indicated by any of the following abnormal liver function tests at screening: i. Total bilirubin >1.5 × ULN (unless consistent with a history of Gilbert’s syndrome or PNH-related hemolysis or treatment, as confirmed by the investigator) ii. ALT >1.5 × ULN (unless consistent with PNH-related hemolysis or treatment, as confirmed by the investigator) iii. AST >1.5 × ULN (unless consistent with PNH-related hemolysis or treatment, as confirmed by the investigator) Has laboratory evidence of bone marrow failure: a. Reticulocyte count <75 × 109 / L (<75 × 106 / mL) b. Platelet count <30 × 109 / L (<30 × 106 / mL) a. Neutrophil count <500 × 106 / L (<500 × 103 / mL) Screening ECG with clinically significant abnormalities, such as QTcF interval >470 ms Has HIV infection, defined as HIV antibody positiveOn immunosuppressive agents such as, but not limited to, cyclosporine, tacrolimus, mycophenolate or mycophenolic acid, cyclophosphamide, methotrexate, cyclophosphamide, methotrexate, or intravenous immunoglobulins, unless on a stable regimen for ≥ 3 months prior to ADX-038 dosing on Day 1. On systemic corticosteroids, unless on a stable regimen of prednisolone ≤20 mg per day or an equivalent for ≥ 4 weeks prior to ADX-038 dosing on Day 1. Known hypersensitivity to any of the study drug ingredients or penicillin. Treatment with another investigational agent within 30 days prior to ADX-038 dosing on Day 1 or within the expected washout period (at least 5 half-lives) of the investigational agent, whichever is longer. Female participant who is breastfeeding or is pregnant or intends to conceive during the course of the study.Schedule of Activities (SoA) Phase 1 Participants who complete the Day 351 Visit of the main study and whose AP activity has not returned to within 27-percentage points (absolute) of their baseline value will continue in extended follow up. Such participants will complete the Day 365 assessments and then follow the schedule of activities outlined in Table 14 until their AP activity is within 27-percentage points (absolute) of their baseline value. Table 14: Schedule of Activities for Main Study – Phase 1 (SAD in HPs, Double-Blind, Placebo-Control)Table 15: Schedule of Activities for Extended Follow Up - Phase 1 (Participants Who Meet Do Not Meet AP Criteria at Day 351 Visit)aAbbreviations: AP, alternative pathway; CFB, complement factor B; SAE, serious adverse events. a Participants who complete the Day 351 Visit and their AP activity has not returned to within 27 percentage points (absolute) of their baseline value will continue the extended follow up. b Participants will continue until their AP activity returns to within 27 percentage points (absolute) of their baseline value or they withdraw from the study. Phase 2a Table 16: Schedule of Activities for Non-Domiciled ParticipantsThe window for assessments performed on the day of dosing are as follows. a. The predose assessment window is within 1 hour before dosing for vital signs, ECG, and PK blood samples, and 4 hours before dosing for all other assessments. b. ±10 minutes for the 30-minute postdose assessments c. ±15 minutes for the 2-hour postdose assessments To determine the dosage for Dose 2 (L1, L0, or L2) see above. Note: Unscheduled study visits may be used to perform laboratory assessments needed to confirm a DTE. Full physical exams are performed predose on the day of dosing and at the end of study; whereas, symptom-directed physical exams may be performed at other scheduled or unscheduled visits, as deemed necessary by the investigator. During screening, only AEs related to study procedures will be recorded in the CRF. Dosing day for Dose 2: The day of study drug administration is considered Day 1. Therefore, on the day Dose 2 is administered, the visit schedule will reset to Day 1 (i.e., Dose 2 Day 1). Dose 2 will be administered at Day 183 (±7 days) or earlier (i.e., at any timepoint from Day 99 to before Day 183), depending on when the investigator assessment confirms a DTE of Dose 1. The Dose 2 visit should be scheduled within 7 days after the date that DTE of Dose 1 is confirmed by the investigator. End of Study (EOS) visit: A PNH participant will complete the EOS visit and will be considered to have completed the study when s / he completes the postdose 2 follow up period (i.e., Dose 2 Day 183 visit [approximately 365 days after Dose 1]). Participants who are withdrawn from the study early will also complete the EOS visit; the visit should be performed within 14 days of the decision to withdraw.Table 17: Schedule of Activities for Domiciled ParticipantsRefer to Table next table for timepoints (window) of specific assessment on the day of dosing. Result of the rapid COVID test for domiciled participants will be retained in the source file. Testing positive for COVID during screening (on Day -1) before Dose 1 is administered will not be considered an AE; therefore, COVID infection should not be recorded in the CRF. Testing positive for COVID infection prior to Day 1 will exclude a participant from study participation. To determine the dosage for Dose 2 (L1, L0, or L2), refer to the section above Note: Unscheduled study visits may be used to perform laboratory assessments needed to confirm a DTE. In addition to ECG in triplicate, local standard monitoring procedures for domiciled participants may include Holter and / or telemetry assessment. Results of Holter and telemetry assessments performed at local sites will be retained in the source files. Only Holter / telemetry findings or abnormalities considered AEs by the investigator will be recorded in the AE CRF. Full physical exams are performed predose on the day of dosing and at the end of study or the early termination visit; whereas, symptom-directed physical exams may be performed at other scheduled or unscheduled visits, as deemed necessary by the investigator. During screening, only AEs related to study procedures will be recorded in the CRF. For sites that document injection site reaction / assessments by photographs, the photographs shall be retained in the source files. Dosing day for Dose 2: The day of study drug administration is considered Day 1. Therefore, on the day Dose 2 is administered, the visit schedule will reset to Day 1 (i.e., Dose 2 Day 1). Dose 2 will be administered at Day 183 (±7 days), or earlier (i.e., at any timepoint from Day 99 to before Day 183), depending on when the investigator assessment confirms a DTE of Dose 1. Dose 2 administration should be scheduled within 7 days after the date that DTE of Dose 1 is confirmed by the investigator; therefore, the domiciled participant should be readmitted to the inpatient research unit 1 day before the planned dosing date for Dose 2. The domiciled participant will be readmitted to the research unit 1 day before Dose 2 is planned to be administered. The inpatient admission date should be scheduled within 8 days after the date that DTE of Dose 1 is confirmed by the investigator.9. End-of-Study (EOS) visit: A PNH participant will complete the EOS visit and will be considered to have completed the study when s / he completes the postdose 2 follow up period (i.e., Dose 2 Day 183 visit [approximately 365 days after Dose 1]). Participants who are withdrawn from the study early will also complete the EOS visit; the visit should be performed within 14 days of the decision to withdraw. Table 18: Domiciled Participant - Timepoints for Vital Signs, ECGs, PK, and Safety Lab AssessmentsExample 4B: Phase 1 Results

[0327] Data are available for 33 healthy volunteers in Phase 1 who were administered a single dose of blinded study drug (ADX-038 n=25 or placebo n=8). ADX-038 doses ranged from 0.4 to 4.0 mg / kg (actual doses of 25 to 340 mg based on body weight). The duration of postdose follow up ranged from 49 to 352 days.

[0328] PK was assessed in the ongoing Phase 1 / 2a study of ADX 038. Blood samples for PK were collected on Day 1 predose; at 0.25, 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 24, 30 hours postdose; and on Day 15. ADX-038 plasma concentrations were measured using a validated liquid chromatography-fluorescence detection (LC FLD) method using a peptide nucleic acid (PNA) probe that detects antisense strand of ADX-038. PK parameters were determined using a noncompartmental method (Model 200-202, Extravascular Input and a linear up / logarithmic down methodology).

[0329] Preliminary PK results are available for 24 healthy volunteers who received a single dose of ADX-038 in Cohorts 1 to 4 (0.4 to 4.0 mg / kg). Table 19 presents a summary of PK parameters. A dose-dependent increase in AUClast and Cmax was demonstrated that was close to dose proportional. For the 10-fold increase in ADX-038 dose from 0.4 to 4.0 mg / kg, the mean AUClast increased from 1910 to 21,100 h*ng / mL (11.0-fold increase), and the mean Cmax increased from 132 to 1390 ng / mL (10.5-fold increase). The median Tmax ranged from 5.00 and 8.00 hours across the 4 cohorts, and mean terminal half-life t½ ranged from 3.46 to 5.64 hours. All Day 15 (nominal 336 hours postdose) concentration data were below limit of quantitation (LLOQ = 2.5 ng / mL).

[0330] PK profiles for the 4 cohorts were characterized by a prolonged initial phase followed by a more rapid terminal phase (FIG. 7, showing Mean and Standard Error of ADX-038 Plasma Concentration-Time Profiles (Linear and Semi-Log Plot) Following Single Dose Administration). The profile change occurred at approximately 16 hours postdose and the terminal t½ values were calculated using this later phase. Table 19: Summary of PK Parameters Following Single-Dose Administration of ADX- 038 to Healthy Volunteers in Study ADX-038-101 (Preliminary Results)Abbreviations: AUClast, area under the concentration-time curve from Time 0 to the last measurable concentration; AUCinf, area under the concentration-time curve from Time 0 extrapolated to infinity; Cmax, maximum observed concentration; h, hour; PK, pharmacokinetic; t1 / 2, terminal half-life; Tmax, time to maximum observed concentration. Notes: AUClast AUCinf, Cmax, and t½ values are displayed as mean ± standard deviation. Tmax values are displayed as median (min, max).’

[0331] Pharmacodynamics

[0332] Changes in CFB, AP activity, and CP activity are being evaluated in the ongoing Phase 1 / 2a clinical study (Study ADX-038-101).

[0333] Preliminary results are available for 24 healthy volunteers who received a single dose of ADX-038 in Cohorts 1 to 4 (0.4 to 4.0 mg / kg). A dose-dependent reduction in CFB and inhibition of AP activity was observed, both in the nadir values and the magnitude of suppression maintained through Day 99, while CP activity remained relatively unchanged. Notably, the 4 mg / kg cohort (mean dose of 280 mg, ranging from 220 to 340 mg) was able to maintain a 99.1% inhibition of AP activity at Day 99 compared with 86.5% for the 2.5 mg / kg cohort.

[0334] When analyzed by actual dose administered, the results were similar. As fixed dosing is commonly used with hepatic-targeted siRNA, with 3 of the 5 approved hepatic-targeted siRNAs using fixed dosing (AMVUTTRA USPI Feb 2023, LEQVIO USPI Jun 2024, ONPATTRO USPI Jan 2023) fixed dosing will be used in future studies. Table 20: Summary of Percent Change From Baseline for CFB, AP Activity, and CP Activity Following a Single Dose of Study Drug in Study ADX-038-101 (Preliminary Results)Abbreviations: AP, alternative pathway; CFB, complement factor B; CP, classical pathway; N / A, not applicable; SE, standard error.aNadir is defined as the lowest mean percent change from baseline through Day 99 Visit for CFB and AP activity. CP activity corresponds to the visit for the nadir AP activity for comparison of the impact on the 2 pathways at the same timepoint.bN reflects total subjects in the cohort. Due to sampling and assay issues, the actual number of subjects and samples included may be smaller.

[0335] Error! Reference source not found. (Mean (SE) Percent Change From Baseline in AP Activity Levels Over Time in Study ADX-038-101 (Preliminary Results; PD Population) shows the mean change from baseline in AP activity over time by actual dose administered. Subjects administered ADX-038 doses >250 mg (n=4; mean of 305 mg, median of 300 mg) had deep and durable inhibition of AP activity (i.e., ≥99% inhibition from baseline), which was observed as early as Day 15 and maintained through Day 99 (last available data timepoint). Table 21: Number of Subjects in FIG. 8 Day 1 8 15 22 29 43 57 71 99 127 155 183 0 mg (n) 8 8 7 8 8 8 8 8 7 4 5 2 >0-50 mg (n) 6 6 6 6 6 6 6 6 6 6 6 6 >50-150 mg (n) 9 9 9 9 8 9 9 9 9 9 9 6 >150-250 mg (n) 5 5 5 5 5 5 5 5 5 3 3 ->250 mg (n) 4 4 4 4 4 4 4 4 4 - - - Abbreviations: AP, alternative pathway; PD, pharmacodynamics; SE, standard error. Note: The number of subjects with samples analyzed by timepoint is presented. Nominal time is used for plotting. Only scheduled visits are included.

[0336] FIG. 9 (Percent of Subjects Who Achieved ≥95% Inhibition of AP Activity Over Time in Study ADX-038-101 (Preliminary Results; PD Population)) shows the proportion of subjects able to achieve ≥95% inhibition of AP activity by actual dose administered. All subjects administered >250 mg ADX-038 achieved ≥95% inhibition by Day 21 and this was maintained through Day 99 (last available timepoint). Example 5: A Phase 2a, Open-Label Study to Assess ADX-038 in Subjects With Complement-Mediated Kidney Disease

[0337] The complement pathway is a critical component of the innate immune system. Three pathways, classical, lectin, and alternative, converge on the common terminal pathway, ultimately leading to formation of the membrane attack complex. Dysregulation of the complement alternative pathway (AP) plays a key role in the pathophysiology of a variety of diseases, including a variety of kidney disorders such as IgAN, C3G, and IC-MPGN. Kidney injury can result from deposition of circulating active complement fragments in glomeruli or from complement components locally produced and activated in the kidney (Maillard, N, RJ Wyatt, BA Julian, et al. (2015). "Current Understanding of the Role of Complement in IgA Nephropathy." J Am Soc Nephrol 26(7): 1503-1512., Rizk, DV, N Maillard, BA Julian, et al. (2019). "The Emerging Role of Complement Proteins as a Target for Therapy of IgA Nephropathy." Front Immunol 10: 504.). CFB is an essential component of the AP; it binds to C3b to form the C3bB complex, which is subsequently cleaved by factor D to generate the active C3 convertase (C3bBb), thereby amplifying the complement cascade and leading to the formation of the terminal membrane attack complex. Selective inhibition of CFB prevents the formation of the AP C3 convertases (C3[H2O]Bb and C3bBb) and the formation of the AP C5 convertase (C3bBb3b) while preserving the formation of the C3 and C5 convertases (C4b2b and C4b2b3b) generated through the lectin and classical pathways. CFB inhibition is a proven therapeutic approach for complement-mediated diseases as it can suppress AP activity while retaining activity of the classical and lectin pathways, and is supported by the approval of iptacopan, an oral CFB inhibitor for paroxysmal nocturnal hemoglobinuria (PNH) and IgAN(FABHALTA USPI (Aug 2024). "FABHALTA (iptacopan capsules) [USPI]. East Hanover, NJ: Novartis Pharmaceuticals."). In addition, positive Phase 3 results with iptacopan have been reported in C3G where a 35% reduction in proteinuria was observed following 6 months of treatment (Nester, CM, RJ Smith, D Kavanagh, et al. (2024b). Efficacy and Safety of Iptacopan in Patients with C3 Glomerulopathy: 12-Month Results from the Phase 3 APPEAR-C3G Study. Abstract presented at American Society of Nephrology Kidney Week, October 24-27, 2024; San Diego, CA. Abstract SA-OR66.). Additionally, the CFB mRNA antisense oligonucleotide, IONIS-FB-LRx, has demonstrated 69% CFB suppression with 39% AP activity inhibition resulting in a 41% reduction in urine proteinuria after 6 months in patients with IgAN (Barbour, S, M Hladunewich, J Irvine, et al. (2022). "An Exploratory Trial of an Investigational RNA Therapeutic, IONIS-FB-LRx, for Treatment of IgA Nephropathy: SA-PO714." Journal of the American Society of Nephrology 33: 800-800.) and is currently in a Phase 3 study in IgAN.

[0338] Immunoglobulin A Nephropathy (IgAN)

[0339] IgAN (also known as Berger’s disease) is a serious, progressive autoimmune disease and is the most common primary glomerulonephritis worldwide. The prevalence of IgAN is not certain due to differences in biopsy practice, diagnostic criteria, and lack of adequate registries, but the overall global incidence is estimated to be approximately 2.5 per 100,000 people per year (Zaidi 2024). The prevalence has great geographic variation, which highlights the likely contributions of both genetics and environment to IgAN susceptibility and risk of disease progression. East Asian countries have the highest prevalence, with lower prevalences in North America and Europe.

[0340] It has been widely accepted that the pathogenesis of IgAN involves a multiple-hit hypothesis, which includes genetic and environmental influences that modulate immune function and lead to IgAN (Cheung 2024). Patients have increased circulating levels of galactose-deficient IgA1 with the presence of galactose-deficient O-glycans in the hinge region of IgA1 (Gd-IgA1). The abnormalities in O-glycan biosynthesis result in exposure of terminal GalNAc residues (Pattrapornpisut 2021). These residues then promote the formation of antiglycan IgG autoantibodies. Circulating immune complexes deposit in the glomerular mesangium, leading to inflammation and injury (Medjeral-Thomas 2021). These immune complexes contain complement C3 and thus activation of the complement cascade is thought to play a key role in the pathogenesis of IgAN. Immunofluorescence from the kidney biopsy must reveal dominant or codominant mesangial IgA deposits with or without capillary loop staining for definitivediagnosis of IgAN; these deposits are accompanied by a variable degree of IgG and IgM staining, and complement C3 is present in up to 90% of cases.

[0341] There are several systemic conditions that are associated with development of histologic and clinical manifestations of IgAN (referred to as “secondary IgAN”) such as malignancies, gastrointestinal diseases (e.g., inflammatory bowel disease), and infections (e.g., hepatitis B and C). Primary and secondary IgAN can be difficult to distinguish. Regardless of the form, IgAN can present with a variety of clinical syndromes, but most commonly adults exhibit asymptomatic hematuria with proteinuria and varying degrees of renal impairment. There is great variability in the clinical course, but proteinuria has been demonstrated to be a dominant risk factor for disease progression, which can lead to kidney failure requiring renal replacement therapy in up to 20% to 40% of patients within 10 to 20 years after diagnosis (Hassler 2020, Jarrick 2019, Kwon 2021, Pattrapornpisut 2021, Pitcher 2023, Schena 2018). In addition, patients with IgAN can have reduced quality of life due to pain, fatigue, and poor mental health (Hassler 2020).

[0342] Supportive care has been the predominant treatment in the management of IgAN and includes smoking cessation, blood pressure control, and use of renoprotective treatments such as RAAS blockade. Traditionally, corticosteroids and other broad immunosuppressives (e.g., cyclophosphamide, azathioprine, and mycophenolate mofetil) have been used with variable success, and require careful management given the potential side effects of these treatments. Since 2021, 3 drugs have been approved for adults with primary IgAN who are at risk for disease progression: iptacopan (FABHALTA), sparsentan (FILSPARI), and budesonide (TARPEYO) (FABHALTA USPI Aug 2024, FILSPARI USPI Sep 2024, TARPEYO USPI Jun 2024). Iptacopan is a CFB inhibitor and sparsentan is an endothelin and angiotensin II receptor antagonist. Both include a boxed / safety warning: iptacopan for increasing the risk of serious and life-threatening infections caused by encapsulated bacteria and sparsentan for hepatotoxicity and embryo-fetal toxicity. Budesonide is a targeted-release corticosteroid, and long-term use is not encouraged given the potential side effect profile of chronic corticosteroid use. Additionally, sparsentan and budesonide are not disease-modifying treatments for IgAN specifically. These are used as supportive therapies in conjunction with other treatments (e.g., ACEi, ARBs, and SGLT2 inhibitors) to regulate blood pressure and reduce proteinuria, (Cheung 2024, Hassler 2020, Pitcher 2023). As these treatments are not disease modifying, patients may still experience progressive decline in renal function that leads to kidney failure. The goal is to develop safe,directed, effective, and convenient therapies such as ADX-038 to address dysregulation of the complement system and to modify IgAN disease progression.

[0343] Complement 3 Glomerulopathy (C3G) and Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN)

[0344] Membranoproliferative glomerulonephritis (MPGN) defines a glomerular histopathologic lesion characterized by hypercellularity, mesangial matrix expansion, and duplication of the glomerular basement membrane. MPGN has been observed in secondary conditions, but also in rare primary forms based on immunofluorescence findings. IC-MPGN is characterized by both C3 and immunoglobulin deposits, and C3G is characterized by predominant or exclusive C3 deposition.

[0345] Both IC-MPGN and C3G are rare kidney diseases characterized by overactivation of the AP, which results in C3 deposition in the glomeruli. It is hypothesized that both inherited and acquired factors contribute to their pathogenesis. In C3G, there are 2 major subgroups of the disease that are distinguished by electron microscopy: dense deposit disease (DDD) and C3 glomerulonephritis (C3GN). Although the subgroups have similar clinical features, DDD is not as common as C3GN and is usually diagnosed in childhood or early adulthood.

[0346] Approximately 25% of patients with C3G may carry rare or unique variants in complement-related genes, such as C3 and CFB. Autoantibodies that target complement proteins and complexes, such as C3 nephritic factors, may contribute to the acquired component of the disorders.

[0347] IC-MPGN is an even rarer condition that shares many clinical and pathological features with C3G but differs by having broad deposition of immunoglobulins in addition to C3. While C3G primarily involves dysregulation of the AP, IC-MPGN may also exhibit abnormalities from the activation of the CP. Despite these differences in underlying mechanisms, the clinical presentation of IC-MPGN is often similar to that of C3G. Secondary forms of glomerulonephritis (GN) such as postinfectious GN, autoimmune diseases, and monoclonal gammopathies must be ruled out prior to the diagnosis. While the incidence of IC-MPGN is unclear, the global prevalence of C3G is 8 to 12 per million (Thomas 2014) and the annual incidence is 1 to 2 per million per year. Patients with C3G and IC-MPGN typically present with proteinuria, hematuria, edema, and hypertension in addition to low levels of C3, which reflect a complement abnormality. The overall prognosis of both is poor. Approximately 50% of patients develop end-stage renal disease (ESRD) within 10 years of diagnosis and require dialysis and renal transplantation; however, the rate of recurrence is up to 86% after kidney transplant.

[0348] There is a high unmet need for therapies to treat C3G and IC-MPGN as there are currently no approved or effective treatments. Management of the disease largely includes supportive therapy. ACE inhibitors, angiotensin II receptor blockers, and other renoprotective agents are the first-line agents prescribed to reduce proteinuria and improve renal hemodynamics. Other drugs currently used are broad immunosuppressant treatments, such as corticosteroids and mycophenolate mofetil, and have limited effectiveness with mixed results in clinical studies. Given the underlying pathogenesis of C3G and IC-MPGN, treatments targeting the complement system are of interest. Eculizumab, a terminal complement C5 inhibitor, has shown some evidence of improvement in C3G in a small Phase 1 study. However, eculizumab blocks terminal complement activation rather than upstream inhibition of the AP, and upstream inhibition may offer greater benefit in controlling glomerular disease as decreased glomerular C3 deposition has been demonstrated in a rat nephritis model following AP inhibition.

[0349] The potential clinical benefit of targeting CFB in C3G is supported by Phase 2 and Phase 3 studies in C3G with iptacopan, an oral CFB inhibitor, where a 45% and 35% reduction in proteinuria, respectively, was observed. Table 22: Study Objectives and Corresponding EndpointsTable 22: Study Objectives and Corresponding EndpointsAbbreviations: AP, alternative pathway; CFB, complement factor B; CP, complement pathway; eGFR, glomerular filtration rate; PK, pharmacokinetics; TEAE, treatment-emergent adverse event; UPCR, urine protein / creatinine ratio.

[0350] Overall Design

[0351] This is a Phase 2a, open-label, parallel-group study of ADX-038 in adults with complement-mediated kidney disease. The study schema is shown in FIG. 10.

[0352] The study will include 2 cohorts of subjects with different complement-mediated kidney diseases who are on maximal ACEi and ARB therapy (as tolerated). The 2 cohorts will enroll concurrently and independently (approximately 15 subjects per cohort): Cohort 1: IgAN; Cohort 2: C3G or IC-MPGN.

[0353] Screening Period

[0354] The study includes a Run-In Screening Period of up to 100 days. During Screening, subjects will be required to complete at least 2 site visits and to collect two 24-hour urine samples for UPCR analysis. Screening Visit 2 should only be performed after the site has received the results from the relevant Screening Visit 1 tests and the subject remains eligible. Subjects are required to have a mean UPCR based on two 24-hour urine samples of ≥0.8 g / g. Investigators must also confirm stability of antihypertensive and other renoprotective treatments and review the subject’s past kidney biopsy report to confirm the diagnosis and ensure that the subject meets the eligibility criteria. Subjects who do not have an eligible kidney biopsy report within the required time period will undergo a biopsy during Screening to confirm eligibility once other key criteria are met (Sponsor acknowledgement is required).

[0355] Subjects who have not received the required vaccinations but have fulfilled all other eligibility criteria should be vaccinated. All required vaccinations should be performed at least 2 weeks prior to the first dose of study treatment. Vaccines should cover as many serotypes aspossible (including meningococcal serotypes A, C, Y, W-135 and B). To minimize participant burden, the use of multivalent vaccines is recommended as locally available and per local guidelines and regulations (e.g. quadravalent vaccines for N. meningitidis which covers serotypes A, C, W and W-135 and Pneumovax-23 which covers 23 S. pneumoniae serotypes).

[0356] Treatment and Follow-Up Period

[0357] Subjects who meet all the study eligibility criteria will be administered ADX-038 via SC injection Q3 months x 4 doses starting on Day 1 and the last dose approximately 90 days later. Subjects will be followed for safety, efficacy, PK, and PD for up to 6 months after Dose 4.

[0358] Subjects who do not receive all of the doses should be encouraged to remain on study and complete their study visits (even those who start additional therapies). Those who receive a second dose should also be encouraged to complete all of their study visits. Those who wish to discontinue study visits and withdraw from the study will need to complete an EOS Visit. A subject will be considered to have completed the study if they receive 4 doses of ADX-038 and complete 6 months of follow up after Dose 4.

[0359] Extended Follow-Up Period

[0360] Subjects who complete the final visit and whose AP activity has not returned to within 30-percentage points (absolute) of their baseline value will continue extended follow up. Extended follow up will consist of site visits every 3 months to collect information on SAEs and to collect blood samples to assess CFB protein levels and AP activity. Follow up will continue until the subject’s AP activity returns to within 30-percentage points (absolute) of their baseline value, they start a complement inhibitor known to impact AP activity (e.g., iptacopan), or they withdraw from the study, whichever occurs first.

[0361] Optional Assessments The study also includes optional pre- and post-treatment kidney biopsies, optional genetic testing on blood samples, and additional optional visits to collect blood samples for PK analysis. Subjects who agree to kidney biopsies and / or genetic testing will be required to provide additional informed consent.

[0362] Sample Size (Planned): Approximately 30 subjects will be enrolled: approximately 15 with IgAN and approximately 15 with C3G or IC-MPGN.

[0363] Key Eligibility Criteria: The study will enroll subjects ≥18 years of age with biopsy- confirmed IgAN, C3G, or IC MPGN with a mean UPCR ≥0.8 g / g despite maximal ACEi andARB therapy (as tolerated); an estimated glomerular filtration rate (eGFR) ≥30 mL / min / 1.73m2; and who meet the vaccination and / or antibiotic requirements.

[0364] Subjects must be on a stable dosage regimen of ACEi or ARBs at either the locally approved maximal daily dose or the maximally tolerated dose (per Investigator’s judgment and local practice) for at least 90 days before Day 1. Subjects with allergies or intolerance to ACEi / ARB are also eligible, but the Investigator must document the reason for not taking these medications.

[0365] If subjects are taking diuretics, other antihypertensive medication, or other antiproteinuric / renoprotective therapy, the doses should be stable for at least 90 days prior to Day 1.

[0366] Study Assessments: Safety, PK, and PD assessments are summarized below.

[0367] Safety Assessments: Adverse events (AE) recording, physical examinations, vital signs, electrocardiograms (ECGs), and clinical safety laboratory tests (including hematology, serum chemistry, coagulation, thyroid-stimulating hormone [TSH], lipids, and urinalysis).

[0368] Efficacy: UPCR and urine albumin-to-creatinine ratio (UACR) by 24-hour urine collection and spot collections, and eGFR.

[0369] PK and Immunogenicity Assessments: Blood samples will be collected for analysis of PK, anti-drug antibodies (ADAs), and anti-polyethylene glycol (PEG) antibodies. The presence of neutralizing antibodies may be analyzed, if necessary.

[0370] PD Assessments: Blood samples will be collected for analysis of CFB protein levels, C3, and complement pathway function (AP and CP). Urine and blood samples will also be collected and stored for exploratory PD and biomarker analysis.

[0371] Optional Kidney Biopsies (select sites): Tissue from subjects who have given written informed consent to have pre- and / or post-treatment kidney biopsies may be assessed to confirm the diagnosis and severity of disease as well as for potential biomarkers. Sponsor acknowledgement is required.

[0372] Optional Genetic Testing: A blood sample from subjects who have given written informed consent for genetic testing may be analyzed to evaluate potential genetic factors that may indicate severity of disease or predictors for disease and treatment response.Table 23: Run-In Screening PeriodAbbreviations: AE, adverse event; ACEi, angiotensin-converting enzyme inhibitor; ARB, angiotensin receptor blocker; ASAP, as soon as possible; ECG, electrocardiogram, FSH, follicle- stimulating hormone; HbsAg, hepatitis B surface antigen; HCV, hepatitis C virus; HIV, human immunodeficiency virus; PD, pharmacodynamics; TB, tuberculosis; TSH, thyroid-stimulating hormone; UACR, urine albumin-to-creatinine ratio; UPCR, urine protein-creatinine ratio; WOCBP, women of childbearing potential. Notes: Unscheduled assessments may be performed at any time during the study at the discretion of the Investigator if clinically indicated or if required by local regulations. 1 Screening Visit 2: This visit should only be performed after the site received the results from the relevant Screening Visit 1 tests. a Written consent must be obtained prior to performing any study-specific procedures. b Review vaccination status for Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. c Subjects must be on a stable dosage regimen of ACEi or ARBs at either the locally approved maximal daily dose or the maximally tolerated dose (per Investigator’s judgment and local practice) for at least 90 days before Day 1. Subjects with allergies or intolerance to ACEi / ARB are eligible, but the Investigator must document the reason for not taking these medications. d TB testing will be performed per local regulations to rule out active and latent TB. Quantiferon testing is the preferred test during Screening when available, but alternate testing (including chest X-ray) may be performed if needed. Those with previously treated latent TB may need a chest X-ray to rule out active TB. e Pregnancy testing (serum) is required for WOCBP. f FSH testing is required for postmenopausal women. FSH levels >40 mIU / mL will confirm menopause. g Subjects should be sitting or lying down for at least 5 minutes prior to and during vital signs and ECG assessments. When vital signs / ECGs and blood sample collection occur at the same timepoint, vital signs / ECGs should be assessed first. h Fasting is recommended if possible. i Proteinuria will not be captured as an AE. j Subjects at select sites may undergo an optional kidney biopsy during Screening: subjects who need a biopsy to confirm eligibility as well as subjects who consent to an optional pretreatment biopsy. All subjects who agree to a biopsy will be required to provide written informed consent.Table 24: Treatment and Follow-Up Period Subjects who complete the Day 267 Visit and whose AP activity has not returned to within 30-percentage points (absolute) of their baseline value will continue in extended follow up. Such participants will complete the Day 351 assessments and then follow with additional activities.Abbreviations: ADA, anti-drug antibody; AE, adverse event; AP, alternative pathway; CFB, complement factor B; CP, classical pathway; D, day; ECG, electrocardiogram; min, minutes; PD, pharmacodynamics;; TSH, thyroid-stimulating hormone; UACR, urine albumin-to-creatinine ratio; UPCR, urine protein-creatinine ratio; WOCBP, women of childbearing potential. Notes: Unscheduled assessments may be performed at any time during the study at the discretion of the Investigator if clinically indicated or if required by local regulations.aInclusion / exclusion criteria should be carefully reviewed to confirm subject eligibility before study drug administration. Sites must confirm the subject has been vaccinated for Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae prior to study drug administration. Clinical safety labs performed during Screening will be used to assess study eligibility.bPregnancy testing (urine) is required for WOCBP. On dosing days, results must be confirmed negative before study drug administration.cPredose assessment.dSubjects should be sitting or lying down for at least 5 minutes prior to and during vital signs and ECG assessments. When vital signs / ECGs occur at the same timepoint as blood sample collection and / or study drug administration, vital signs / ECGs should be assessed first.eOn Day 1, vital signs will be measured predose (within 3 hours before dosing) and postdose at the following timepoints: 0.5 hours (±15 min) and 2 hours (±15 min).fFasting is recommended if possible.gSites will provide subjects with supplies for the 24-hour urine collection at the scheduled visits. Subjects should perform the 24-hour collection within 2 weeks of the visit and then return the sample as soon as possible, but within 1 week after collection.hBlood samples for PK analysis will be collected predose (within 3 hours before dosing) and postdose at the following timepoints: 0.5 hours (±15 min) and 2 hours (±15 min).iSubjects will be asked to return to the site for an optional PK blood sample collection 24 hours (±6 hours) after study drug administration.jBlood samples are not required at the EOS Visit; samples are only required at the Day 351 Visit for subjects whose AP has not returned to within 30 percentage points (absolute) of their baseline value at the Day 267 Visit.kSubjects will be provided with a Safety Card on Day 1 to help them recognize signs / symptoms of meningitis that warrant immediate medical evaluation. The site will review the Safety Card with subjects at each site visit.lProteinuria will not be captured as an AE.mSubjects who agree to genetic testing will be required to provide additional consent.nSubjects who agree to a post-treatment kidney biopsy will be required to provide additional consent. The biopsy should be performed between Day 141 and Day 169, inclusive. A separate visit may be required. 1.1.1. Extended Follow-Up Period (Subjects Who Meet Do Not Meet AP Criteria at Day 267+ Visita) Extended follow up will continue until the subject’s AP activity returns to within 30 percentage points (absolute) of their baseline value, they start a complement inhibitor known to impact AP activity (e.g., iptacopan), or they withdraw from the study, whichever occurs first.Abbreviations: AP, alternative pathway; CFB, complement factor B; SAE, serious adverse events. a Subjects who complete the Day 267+ Visit and their AP activity has not returned to within 30 percentage points (absolute) of their baseline value will continue the extended follow up. b Months refer to time from the first dose of study drug (Day 1).Example 6: A Phase 2, Randomized, Masked, Placebo-Controlled Study to Assess the Efficacy and Safety of ADX-038 in Subjects With Geographic Atrophy (GA) Secondary to Age Related Macular Degeneration (AMD)

[0373] GA is an advanced form of AMD characterized by atrophic lesions that start in the outer retina and progressively expand to cover the macula and the fovea, leading to significant visual function impairment and eventual loss of vision. GA can have a significant impact on a patient’s quality of life by interfering with daily activities and reducing their independence. GA is estimated to affect approximately 5 million people worldwide. The underlying pathophysiology of GA is thought to involve chronic inflammation due to overactivation of the complement system. Patients with AMD have higher serum levels of a number of complement factors such as complement factor B (CFB), an activating factor in the alternative pathway, which also represents a potential therapeutic target.

[0374] This Phase 2 study is designed to assess the efficacy of ADX-038 compared with placebo in subjects with GA secondary to AMD. Safety, pharmacokinetics (PK), and PD will also be assessed.

[0375] Overall Design: This is a Phase 2, randomized, masked, placebo-controlled study in subjects with GA secondary to AMD. The study schema is shown in FIG. 11.

[0376] The study consists of a 28-day Screening Period, a 12-month Treatment period, and approximately 6-month Follow-Up Period. Approximately 240 subjects who meet the eligibility criteria will be randomized to 1 of 2 treatment groups in a 2:1 ratio (Rx:placebo). Randomization will be stratified by Screening photoreceptor / retinal pigment epithelium (PR / RPE) loss ratio of ≥2.8 (yes / no) in the study eye as assessed by spectral-domain optical coherence tomography (SD-OCT) as well as location of the lesion (nonsubfoveal or subfoveal). • Group 1: ADX-038300 mg, SQ, q 3 months (N~160) Group 2: placebo (N~80)

[0377] Study Assessments: Efficacy, safety, PK, and PD assessments are summarized below. See the schedule of activities for the timepoints for each assessment.

[0378] Efficacy Assessments: The following ocular efficacy assessments and imaging will be performed on both eyes:• Normal luminance best corrected visual acuity (NL-BCVA): Assessed on Early Treatment Diabetic Retinopathy Study (ETDRS) chart at a starting distance of 4 m under normal luminance. • Low luminance best corrected visual acuity (LL-BCVA): Assessed on ETDRS chart at a starting distance of 4 m under low luminance conditions. • SD-OCT imaging. • Fundus autofluorescence (FAF) imaging. • Color fundus photography • Fluorescein angiography • Microperimetry (optional substudy)

[0379] SD-OCT and FAF images will be sent to central reading centers for analysis. Site staff performing imaging must...

Claims

Abbreviations: ADA, anti-drug antibody; AE, adverse event; AP, alternative pathway; CFB, complement factor B; CP, classical pathway; ECG, electrocardiogram; EOS, End of Study; FAF, fundus autofluorescence; FSH, follicle-stimulating hormone; HbsAg, hepatitis B surface antigen; HCV, hepatitis C virus; HIV, human immunodeficiency virus; IOP, intraocular pressure; LL- BCVA, low luminance best corrected visual acuity; min, minutes; NL-BCVA, normal luminance best corrected visual acuity; PEG, polyethylene glycol; SD-OCT, spectral-domain optical coherence tomography; WOCBP, women of childbearing potential. Notes: Unscheduled assessments may be performed as clinically indicated.aSubjects who complete the study and subjects who withdraw before Day 183 will return for an EOS Visit.bWritten consent must be obtained prior to performing any study-specific procedures.cInclusion / exclusion criteria should be carefully reviewed to confirm subject eligibility before study drug administration.dPredose.ePregnancy testing is required for WOCBP: serum test during screening and urine test at scheduled timepoints thereafter. Results must be confirmed negative before study drug administration on Day 1 and Day 85.fFSH testing is required for postmenopausal women. FSH levels >40 mIU / mL will confirm menopause.gA complete physical examination will be performed during screening. Symptom-directed physical examinations will be performed at subsequent visits if deemed necessary by the Investigator.hAt the Screening Visit, review vaccination status for Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. On Day 1, confirm subject has been vaccinated prior to study drug administration. If vaccinated within 2 weeks prior to Day 1, subject must receive prophylactic antibiotics.iSubjects should be in a supine or semi-reclined position for at least 5 minutes prior to and during vital signs assessments. When vital signs and blood sample collection occur at the same timepoint, vital signs should be assessed first.jOn dosing days, vital signs will be measured predose (within 3 hours before dosing) and postdose at the following timepoints: 0.5 hours (±15 min) and 2 hours (±15 min).kSubjects should be supine for at least 5 minutes prior to and during ECG assessments. When ECGs and blood sample collection occur at the same timepoint, ECGs should be performed first.lClinical safety labs performed at the Screening Visit will be used to assess study eligibility.mBlood samples for PK analysis will be collected predose (within 3 hours before dosing) and postdose at the following timepoints: 0.5 hours (±15 min) and 2 hours (±15 min).nSubjects will be asked to return to the site for an optional PK blood sample collection 24 hours (±6 hours) after study drug administration.oSubjects will be provided with a Safety Card on Day 1 to help them recognize signs / symptoms of meningitis that warrant immediate medical evaluation.pImages will be sent to central reading centers for analysis.qAEs will be recorded from the time of signing informed consent until the end of the study. Disease progression is not considered an AE unless it becomes more severe (e.g., requires intervention, such as the administration of intravitreal anti VEGF agents for neovascular AMD) or occurs with a greater frequency than expected for the subject’s condition.SEQ ID NO: 1 1 gggaagggaa tgtgaccagg tctaggtctg gagtttcagc ttggacactg agccaagcag 61 acaagcaaag caagccagga cacaccatcc tgccccaggc ccagcttctc tcctgccttc 121 caacgccatg gggagcaatc tcagccccca actctgcctg atgcccttta tcttgggcct 181 cttgtctgga ggtgtgacca ccactccatg gtctttggcc cggccccagg gatcctgctc 241 tctggagggg gtagagatca aaggcggctc cttccgactt ctccaagagg gccaggcact 301 ggagtacgtg tgtccttctg gcttctaccc gtaccctgtg cagacacgta cctgcagatc 361 tacggggtcc tggagcaccc tgaagactca agaccaaaag actgtcagga aggcagagtg 421 cagagcaatc cactgtccaa gaccacacga cttcgagaac ggggaatact ggccccggtc 481 tccctactac aatgtgagtg atgagatctc tttccactgc tatgacggtt acactctccg 541 gggctctgcc aatcgcacct gccaagtgaa tggccgatgg agtgggcaga cagcgatctg 601 tgacaacgga gcggggtact gctccaaccc gggcatcccc attggcacaa ggaaggtggg 661 cagccagtac cgccttgaag acagcgtcac ctaccactgc agccgggggc ttaccctgcg 721 tggctcccag cggcgaacgt gtcaggaagg tggctcttgg agcgggacgg agccttcctg 781 ccaagactcc ttcatgtacg acacccctca agaggtggcc gaagctttcc tgtcttccct 841 gacagagacc atagaaggag tcgatgctga ggatgggcac ggcccagggg aacaacagaa 901 gcggaagatc gtcctggacc cttcaggctc catgaacatc tacctggtgc tagatggatc 961 agacagcatt ggggccagca acttcacagg agccaaaaag tgtctagtca acttaattga 1021 gaaggtggca agttatggtg tgaagccaag atatggtcta gtgacatatg ccacataccc 1081 caaaatttgg gtcaaagtgt ctgaagcaga cagcagtaat gcagactggg tcacgaagca 1141 gctcaatgaa atcaattatg aagaccacaa gttgaagtca gggactaaca ccaagaaggc 1201 cctccaggca gtgtacagca tgatgagctg gccagatgac gtccctcctg aaggctggaa 1261 ccgcacccgc catgtcatca tcctcatgac tgatggattg cacaacatgg gcggggaccc 1321 aattactgtc attgatgaga tccgggactt gctatacatt ggcaaggatc gcaaaaaccc 1381 aagggaggat tatctggatg tctatgtgtt tggggtcggg cctttggtga accaagtgaa 1441 catcaatgct ttggcttcca agaaagacaa tgagcaacat gtgttcaaag tcaaggatat 1501 ggaaaacctg gaagatgttt tctaccaaat gatcgatgaa agccagtctc tgagtctctg 1561 tggcatggtt tgggaacaca ggaagggtac cgattaccac aagcaaccat ggcaggccaa 1621 gatctcagtc attcgccctt caaagggaca cgagagctgt atgggggctg tggtgtctga 1681 gtactttgtg ctgacagcag cacattgttt cactgtggat gacaaggaac actcaatcaa 1741 ggtcagcgta ggaggggaga agcgggacct ggagatagaa gtagtcctat ttcaccccaa 1801 ctacaacatt aatgggaaaa aagaagcagg aattcctgaa ttttatgact atgacgttgc 1861 cctgatcaag ctcaagaata agctgaaata tggccagact atcaggccca tttgtctccc 1921 ctgcaccgag ggaacaactc gagctttgag gcttcctcca actaccactt gccagcaaca 1981 aaaggaagag ctgctccctg cacaggatat caaagctctg tttgtgtctg aggaggagaa 2041 aaagctgact cggaaggagg tctacatcaa gaatggggat aagaaaggca gctgtgagag 2101 agatgctcaa tatgccccag gctatgacaa agtcaaggac atctcagagg tggtcacccc 2161 tcggttcctt tgtactggag gagtgagtcc ctatgctgac cccaatactt gcagaggtga 2221 ttctggcggc cccttgatag ttcacaagag aagtcgtttc attcaagttg gtgtaatcag 2281 ctggggagta gtggatgtct gcaaaaacca gaagcggcaa aagcaggtac ctgctcacgc 2341 ccgagacttt cacatcaacc tctttcaagt gctgccctgg ctgaaggaga aactccaaga 2401 tgaggatttg ggttttctat aaggggtttc ctgctggaca ggggcgtggg attgaattaa 2461 aacagctgcg acaaca[0397] Although the disclosure has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the disclosure and by the following claims.CLAIMS What is claimed is:

1. A compound comprising a modified oligonucleotide having a nucleobase sequence of SEQ ID NO:

100.

2. A compound comprising a modified oligonucleotide having a nucleobase sequence of SEQ ID NO:

109.

3. A compound comprising a modified oligonucleotide having a modified nucleobase sequence as follows: mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fU*mC*mC(Ref ID NO: IA1016), wherein: m is a 2’-O-methyl sugar modification; f is a 2’-F sugar modification; * is a phosphorothioate internucleoside linkage; and . is a phosphate internucleoside linkage.

4. A compound comprising a modified oligonucleotide having a modified nucleobase sequence as follows: H4*mG*mG.mA.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ (Ref ID NO: IS1252), wherein: m is a 2’-O-methyl sugar modification; f is a 2’-F sugar modification; * is a phosphorothioate internucleoside linkage; . is a phosphate internucleoside linkage; dQ is an inverted abasic deoxyribose of the following formula:H4 is of the following formula:.

5. A compound comprising a first modified oligonucleotide of Ref ID NO: IA1016 and a second modified oligonucleotide of Ref ID NO: IS1252.

6. A compound of any one of claims 1-5, wherein the compound is in a pharmaceutically acceptable salt form.

7. The compound of claim 6, wherein the pharmaceutically acceptable salt is a sodium salt.

8. The compound of claim 6, wherein the pharmaceutically acceptable salt is a potassium salt.

9. A modified oligonucleotide according to the following chemical structure:or a pharmaceutically acceptable salt or stereoisomer thereof.

10. The modified oligonucleotide of claim 9, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.

11. The modified oligonucleotide of claim 9, which is a sodium salt according to the following chemical structure:or a stereoisomer thereof.

12. A modified oligonucleotide according to the following chemical structure:or a pharmaceutically acceptable salt or stereoisomer thereof.

13. The modified oligonucleotide of claim 12, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.

14. The modified oligonucleotide of claim 12, which is a sodium salt according to the following chemical structure:or a 15. A compoundor a stereoisomer thereof.

18. A composition comprising the compound or modified oligonucleotide of any one of claims 1-17 and a pharmaceutically acceptable carrier.

19. A composition comprising the compound or modified oligonucleotide of any one of claims 1-17, for use in therapy.

20. A method of treating, preventing or ameliorating a disease, disorder or condition associated with CFB in an individual, comprising administering to the individual a compound or modified oligonucleotide of any one of claims 1-17, thereby treating, preventing, or ameliorating the disease, disorder or condition.

21. A method comprising administering the compound or modified oligonucleotide of any one of claims 1-17 or the composition of claim 18 or 19 to an individual.

22. The method of claim 20 or 21, wherein the disease, disorder or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

23. The method of claim 22, wherein administering the compound inhibits or reduces or improves atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

24. A method of inhibiting expression of CFB in a cell comprising contacting the cell with a compound or modified oligonucleotide of any one of claims 1-17, thereby inhibiting expression of CFB in the cell.

25. The method of claim 24, wherein the cell is in the liver of an individual.

26. The method of claim 25, wherein the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

27. A method of reducing or inhibiting atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in an individual, comprising administering to the individual a compound or modified oligonucleotide of any one of claims 1-17, thereby reducing or inhibiting atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in the individual.

28. The method of claim 27, wherein the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

29. The method of any one of claims 20-28, wherein the compound or modified oligonucleotide is administered parenterally.

30. The method of any one of claims 20-28, wherein the compound or modified oligonucleotide is administered subcutaneously.

31. Use of a compound or modified oligonucleotide of any one of claims 1-17 for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB.

32. The use of claim 31, wherein the disease, disorder or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related macular degeneration (AMD), geographic atrophy secondary to AMD, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).

33. Use of a compound or modified oligonucleotide of any one of claims 1-17 in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB.

34. The use of claim 33, wherein the disease is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, Membranoproliferative glomerulonephritis (MPGN), Immune Complex Membranoproliferative Glomerulonephritis (IC-MPGN), polycystic kidney disease, age-related