Modified nucleic acid and use thereof
Patent Information
- Application Number
- AU2025220259
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-05
- Filing Date
- 2025-02-05
- Publication Date
- 2026-08-27
Smart Images

Figure 00000062_0000 
Figure 00000062_0001 
Figure 00000062_0002
Abstract
Description
Technical Field The present invention belongs to the field of biotechnology, and relates to a modified nucleic acid and use thereof. Background The clinical use of therapeutic protein drug for treating a disease often induces immune responses in the body of patients, for example, the release of cytokines or the production of antidrug antibodies (ADAs), and the production of cytokines and ADAs can change the pharmacokinetics, pharmacodynamics, efficacy and safety of the therapeutic protein drug. With the continuous development of gene therapy, the treatment of diseases by gene therapy has gradually become a reality, for example, by transferring synthetic nucleic acids (such as DNA or mRNA) into patients and generating therapeutic proteins in patients to treat diseases. Gene therapy (e.g., DNA therapy or mRNA therapy) has also been found to induce an immune response in the body of a patient, such as the production of cytokines or ADAs, especially treatments requiring repeated administration. However, the induction of an immune response (production of cytokines or ADA, etc.) in the body of a patient is undesirable for gene therapy. Accelerated blood clearance (ABC) was observed in many lipid-containing delivery carriers, including liposomes and lipid nanoparticles (LNPs), wherein the lipid nanoparticles comprise protonatable lipids, cholesterol, phospholipids, and PEG-lipids. Lipid containing delivery carriers, such as lipid nanoparticles (LNPs), encapsulating mRNA therapeutic agent would activate B cells (e.g., B1a cells) when injected into a subject, the activated B1a cells produce IgM, inducing accelerated blood clearance. After repeated administration, B2 cells will also be activated to initiate an adaptive anti-PEG IgM immune response against PEGylated lipids. LNP-based mRNA therapy has a very large application prospect, but needs to be repeatedly administered through a delivery carrier, thus, it is necessary to solve the problem of accelerated blood clearance caused by lipid-containing delivery carriers. At present, one of the approaches to solve the undesirable immune response of gene therapy (such as anti-drug antibody response, accelerated blood clearance caused by lipid-containing delivery carriers) is to introduce a microRNA binding site into DNA or mRNA, and the DNA or mRNA containing the microRNA binding site can bind to microRNA expressed in immune cells, reduce or inhibit the expression of the DNA or mRNA containing the microRNA binding site in immune cells, reduce or inhibit the undesirable immune response, thereby reducing or inhibiting the anti-drug antibody response and accelerated blood clearance. Summary In order to reduce undesired immune response, based on the mechanism of microRNA, current microRNA binding sites are placed in UTRs (untranslated regions) of mRNA, such as 3‘-UTR and / or 5‘-UTR. Surprisingly, we have found that placing a microRNA binding site after the 3‘-UTR (e.g., after the 3‘-UTR and before the poly(A) tail, or in the poly(A) tail) of a synthetic nucleic acid (e.g., mRNA or DNA) can also play a corresponding role. The present disclosure provides a non-native nucleic acid comprising a 3‘-UTR and one or more microRNA binding sites located downstream of the 3‘-UTR. In some embodiments, the non-native nucleic acid further comprises a ploy(A) tail located downstream of the 3‘-UTR, and the one or more microRNA binding sites are located at one of the following positions: (1) after the 3‘-UTR and before the poly(A) tail; (2) in the poly(A) tail; and (3) after the 3‘-UTR and before the poly(A) tail, and in the poly(A) tail. In some embodiments, the microRNA binding site located in the poly(A) tail is at the 5’ end, between the 5’ end and the 3’ end, and / or at the 3’ end of the poly(A) tail. In some embodiments, the microRNA binding sites are the same. In some embodiments, the microRNA binding sites are different, and the microRNA binding sites bind to the same microRNA or different microRNAs. In some embodiments, the different microRNAs are from the same cell, tissue and / or organ, or the different microRNAs are from different cells, tissues and / or organs. In some embodiments, the one or more microRNA binding sites are capable of binding to a microRNA expressed in a target cell, target tissue, and / or target organ to reduce or inhibit the expression of the non-native nucleic acid in the target cell, target tissue, and / or target organ. In some embodiments, the target cell, target tissue, and / or target organ comprises one or more of an immune cell, liver, lung, heart, nervous system, pancreas, kidney, muscle, an endothelial cell, an epithelial cell, a embryonic stem cell, and an abnormal cell; In some embodiments, the target cell is an immune cell. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of miR-122, miR-126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p, miR-126, miR-146-3p, miR-146-5p and miR-155. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p and miR-126. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p, miR-142-5p, miR-126 or miR-122. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind miR-142-3p. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p and one or more of miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-5p and one or more of miR-142-3p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-126 and one or more of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-122 and one or more of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the non-native nucleic acid comprises 1, 2, 3, or 4 of the microRNA binding sites. In some embodiments, there is a spacer sequence between the microRNA binding sites. In some embodiments, the non-native nucleic acid further comprises one or more of: 5‘-UTR and a coding region encoding a polypeptide or protein of interest. In some embodiments, the non-native nucleic acid further comprises a coding region encoding a polypeptide or protein of interest. In some embodiments, the non-native nucleic acid further comprises a 5‘-UTR and a coding region encoding a polypeptide or protein of interest. In some embodiments, the 3‘-UTR is heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the 5‘-UTR is heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the 5‘-UTR and the 3‘-UTR are heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the nucleotides constituting the poly(A) tail comprise at least 20, at least 40, at least 80, at least 100, or at least 120 A nucleotides. In some embodiments, the nucleotides constituting the poly(A) tail comprise at least 20, at least 40, at least 80, at least 100, or at least 120 continuous A nucleotides. In some embodiments, the nucleotides constituting the poly(A) tail comprise one or more nucleotides other than the A nucleotide. In some embodiments, the non-native nucleic acid further comprises at least one microRNA binding site in the 3‘-UTR and / or in the 5‘-UTR. In some embodiments, the non-native nucleic acid is mRNA. In some embodiments, the nucleotide sequence of the DNA corresponding to the 3‘-UTR is set forth in SEQ ID NO: 2 or 3. In some embodiments, the DNA sequence corresponding to the 5‘-UTR is set forth in SEQ ID NO: 4. In some embodiments, the nucleotide sequence of the DNA corresponding to the microRNA binding site is as set forth in ACACTAC, SEQ ID NO: 1 or 13. In some embodiments, the non-native nucleic acid is mRNA comprising a cap structure. In some embodiments, the cap structure is selected from at least one of m7GpppG, m27,3’ OGpppG, m7Gppp(5')N1 and m7Gppp(m2‘-O)N1. In some embodiments, the non-native nucleic acid contains a modified nucleotide. In some embodiments, the non-native nucleic acid contains a modified nucleoside. In some embodiments, the modified nucleoside comprises at least one of a modified uridine, a modified cytidine, a modified adenosine, and a modified guanosine. In some embodiments, 100% of the uridines in the non-native nucleic acid are modified. In some embodiments, the non-native nucleic acid is DNA. The present disclosure provides a genetic engineering vector comprising the non-native nucleic acid of any of the above embodiments, or the genetic engineering vector comprises a polynucleotide capable of being transcribed into the non-native nucleic acid of any of the above embodiments. The present disclosure provides a host cell comprising the genetic engineering vector of any of the above embodiments. The present disclosure provides a delivery carrier comprising the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the host cell of any of the above embodiments. In some embodiments, the delivery carrier is a lipid nanoparticle, a cationic liposome, a cationic protein, or a lipopolyplex. The present disclosure provides a pharmaceutical composition comprising the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, or the delivery carrier of any of the above embodiments, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises a plurality of the delivery carriers; or the pharmaceutical composition comprises a plurality of the mRNAs. The present disclosure also provides use of the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, the delivery carrier of any of the above embodiments, or the pharmaceutical composition of any of the above embodiments in the preparation of a medicament. In some embodiments, the medicament is used for gene therapy, gene vaccination, protein replacement therapy, antisense therapy or treatment by interfering RNA. In some embodiments, the medicament is used for the treatment and / or prevention of a disease. In some embodiments, the medicament is used for the treatment and / or prevention of one or more of the following diseases: rare diseases, cancers, infectious diseases, autoimmune diseases, metabolic diseases, neurological diseases, cardiovascular diseases, transplant rejection, inflammation, genetic diseases and musculoskeletal diseases. In some embodiments, the medicament is a nucleic acid medicament, wherein the nucleic acid includes one or more of RNA and DNA. In some embodiments, the DNA comprises one or more of: a plasmid and an antisense oligonucleotide. In some embodiments, the RNA comprises one or more of: antisense oligonucleotide, messenger RNA, ribosomal RNA, microRNA, transfer RNA, small interfering RNA, small nuclear RNA, small hairpin RNA, single guide RNA and Cas9 mRNA. The present disclosure also provides a method for preventing or treating a disease, comprising administering to a subject the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, the delivery carrier of any of the above embodiments, or the pharmaceutical composition of any of the above embodiments. The present disclosure also provides a method of reducing or inhibiting the expression of a non-native nucleic acid in an undesired cell, tissue and / or organ, comprising administering to a subject the non-native nucleic acid of any of the above embodiments, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in the undesired cell, tissue and / or organ. In some embodiments, the undesired cell is an immune cell. The present disclosure provides a method of reducing or inhibiting the activation of undesired immune cell, comprising administering to a subject the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the delivery carrier of any of the above embodiments, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell. In some embodiments, the method can reduce or inhibit the activation of undesired immune cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. In some embodiments, the activated undesired immune cell is selected from one or more of T cells, B cells, plasma cells, and NK cells. The present disclosure also provides a method of reducing or inhibiting the production of undesired cytokine, comprising administering to a subject the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the delivery carrier of any of the above embodiments, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell. In some embodiments, the method can reduce or inhibit the production of undesirable cytokine by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. The present disclosure also provides a method of reducing or inhibiting an anti-drug antibody response in a subject that is repeatedly administered, comprising administering to the subject the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the delivery carrier of any of the above embodiments, wherein the nonnative nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell, such that the anti-drug antibody response in the subject is reduced or inhibited upon repeated administration. The present disclosure also provides a method of reducing or inhibiting accelerated blood clearance in a subject that is repeatedly administered, comprising administering to the non-native nucleic acid of any of the above embodiments, wherein the non-native nucleic acid is encapsulated in a lipid nanoparticle, the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell, such that accelerated blood clearance in the subject is reduced or inhibited upon repeated administration. The present disclosure also provides a method of reducing or inhibiting the production of polyethylene glycol-binding IgM molecule in a subject that is repeatedly administered, comprising administering to the subject the non-native nucleic acid of any of the above embodiments, wherein the non-native nucleic acid is encapsulated in a lipid nanoparticle, and the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell, such that the production of polyethylene glycol-binding IgM molecule in the subject is reduced or inhibited upon repeated administration. In some embodiments, the lipid nanoparticle encapsulating the non-native nucleic acid comprises a PEG-lipid. In some embodiments, the non-native nucleic acid is mRNA. In some embodiments, the non-native nucleic acid is DNA. In some embodiments, the genetic engineering vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-122, miR-126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p, miR-126, miR-146-3p, miR-146-5p and miR-155. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p, miR-142-5p, miR-126 or miR-122. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p and one or more of miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-5p and one or more of miR-142-3p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-126 and one or more of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises miR-122 and one or more of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of the following: miR-142-3p, miR-142-5p and miR-126. In some embodiments, the microRNA to which the one or more microRNA binding sites can bind is miR-142-3p. In some embodiments, the non-native nucleic acid comprises 2-6 microRNA binding sites capable of binding to miR-142-3p. In some embodiments, the non-native nucleic acid comprises three microRNA binding sites capable of binding to miR-142-3p. In some embodiments, the subject is a mammal; preferably, the mammal is a human. In some embodiments, the frequency of administrations is one, two, three, four, or more. In some embodiments, the time interval of administration is no more than 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week. In some embodiments, the administration is intravenous injection or intramuscular injection. Brief Description of Drawings FIGS. 1A to 1C show the luciferase expression levels in vivo in mice after a single administration. “C-Fluc” represents a control group injected with lipid nanoparticles encapsulating mRNA encoding Fluc without microRNA binding sites (referred to as C-hFluc), and other groups are experimental groups injected with lipid nanoparticles encapsulating mRNA encoding Fluc containing microRNA binding sites, for example, “437-Fluc” represents an experimental group injected with lipid nanoparticles encapsulating mRNA encoding Fluc mRNA containing microRNA binding sites (referred to as 437-Fluc), and the same applies to others; FIG. 2 shows the expression level of hEPO in rat serum after multiple administrations. “PBS” represents a control group injected with PBS, “C-hEPO” represents a control group injected with lipid nanoparticles that encapsulate mRNA encoding hEPO that does not contain microRNA binding sites (referred to as C-hEPO), and other groups are experimental groups injected with lipid nanoparticles that encapsulate mRNA encoding hEPO that contains microRNA binding sites, for example, “437-hEPO” represents an experimental group injected with lipid nanoparticles that encapsulate mRNA encoding hEPO that contains microRNA binding sites (referred to as 437-hEPO). FIG. 3 shows the levels of anti-PEG IgG antibody in rat serum after multiple administrations. Detailed description of the invention I. Definition All patents, patent applications, scientific publications, manufacturers' instructions and guidelines, etc., cited herein, whether supra or infra, are incorporated herein by reference in their entirety. Any content herein should not be understood as an admission that the present disclosure is not entitled to antedate such disclosure. Unless otherwise indicated, scientific and technical terms used herein have meanings commonly understood by those skilled in the art. Moreover, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture and microbiology used herein are all terms widely used in the corresponding fields (see, for example, Molecular Cloning: A Laboratory Manual, 2nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). In addition, to understand the present application better, the following definitions and explanations of related terms are provided. As used herein, the expressions “comprising,” “including,” “containing,” and “having” are open-ended, meaning including the recited elements, steps, or components but not excluding other element, step, or component that is not recited. The expression “consisting of” excludes any element, step, or component that is not specified. The expression “consisting essentially of” means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not materially affect the basic and novel nature of the claimed subject matter. It should be understood that the expressions “consisting essentially of” and “consisting of” are encompassed within the meaning of the expression “comprising.” As used herein, the singular expressions “a” and “an” and “the” and similar referents used in the context describing the application (especially in the context of the claims) should be understood to cover both the singular and the plural, unless specified in the context otherwise. The term “one or more” or “at least one” encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 or more. The term “at least one” encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 or more. The term “at least two” encompasses 2, 3, 4, 5, 6, 7, 8, 9 or more. The term “at least two” encompasses 2, 3, 4, 5, 6, 7, 8, 9 or more. Numerical ranges recited herein should be understood to encompass any and all sub-ranges comprised therein. For example, a range of “1 to 10” should be understood to include not only the explicitly recited values of 1 and 10, but also any single value (e.g., 2, 3, 4, 5, 6, 7, 8 and 9) and sub-range within the range of 1 to 10 (e.g., 1 to 2, 1.5 to 2.5, 1 to 3, 1.5 to 3.5, 2.5 to 4, 3 to 4.5, etc.). This principle also applies to ranges using only one numerical value as the minimum or maximum value. As used herein, the terms “and / or”, “any combination thereof,” and grammatical equivalents thereof are used interchangeably. These terms may express, specifically refer to any combination. For example, the following phrases “A, B, and / or C” or “A, B, C, or any combination thereof” means any of “A alone; B alone; C alone; A and B; B and C; A and C; and A, B, and C.” As used herein, the term “naturally occurring” or “naturally occurred” refers to the fact that a substance can be found in nature. For example, peptides, amino acids, proteins, or nucleic acids, which are present in organisms, including viruses, and can be isolated from natural sources and are not artificially modified in experiments, are naturally occurring. As used herein, the term “non-natrually occurring” or "non-native", when describing a nucleic acid herein, is intended to mean that the nucleic acid is not found in nature. For example, a non-naturally occurring nucleic acid encoding a viral peptide or protein has at least one genetic change or chemical modification which is generally not found in the wild-type strain of the mentioned virus. Such genetic alterations include, for example, the introduction of expressible nucleic acid sequences encoding peptide fragments or polypeptides heterologous to the mentioned virus, other nucleic acid additions, nucleic acid deletions, nucleic acid substitutions, and / or other functional disruptions to the genetic material of the virus. Chemical modifications include, for example, one or more functional nucleotide analogs as described herein. All methods described herein can be performed in any suitable order unless otherwise indicated. As used herein, the term “heterologous” refers to two elements comprised in a non-native nucleic acid, e.g., a polynucleotide encoding a polypeptide and / or protein of interest and 5‘-UTR do not naturally (in natural state) exist in this combination, or a polynucleotide encoding a polypeptide and / or protein of interest and 3‘-UTR do not naturally (in natural state) exist in this combination. They are typically recombinant. Preferably, the 3‘-UTR and / or the 5‘-UTR are derived from a gene different from the polynucleotide encoding the polypeptide and / or protein of interest, that is, the gene from which the 3‘-UTR and / or the 5‘-UTR is derived is different from the gene from which the polynucleotide encoding the polypeptide and / or protein of interest is derived. For example, the gene from which the polynucleotide encoding the polypeptide and / or protein of interest is derived and the gene from which the 3‘-UTR and / or the 5'-UTR is derived are genes encoding different proteins. For another example, the gene from which the polynucleotide encoding the polypeptide and / or protein of interest is derived and the gene from which the 3'-UTR and / or the 5'-UTR is derived are genes encoding the same protein but belonging to different species. As used herein, the term “wild-type” means that the sequence is naturally occurring and not artificially modified, including naturally occurring mutants. The term “fragment” or “fragment of a nucleic acid” refers to a portion of a nucleic acid. For example, nucleic acids shortened at the 5' and / or 3' ends. A fragment of a nucleic acid comprises at least 50%, 60%, 70%, or 80% from the nucleic acid. In some embodiments, a fragment of a nucleic acid comprises at least 70% or 80% from the nucleic acid. Nucleotide residues of at least 90%, 95%, 96%, 97%, 98% or 99% are preferred. It can generally be a shorter portion of the full length of the nucleic acid. The term “variant” in reference to a nucleic acid refers to a nucleic acid variant having at least one nucleotide different from a reference nucleic acid (or “parent”). As compared to the reference nucleic acid, variant nucleic acids include the deletion, addition, mutation, and / or insertion of single or multiple nucleotides, where: deletion includes removing one or more nucleotides from the reference nucleic acid; addition includes fusing one or more nucleotides (e.g., 1, 2, 3, 5, 10, 20, 30, 50 or more nucleotides) to the 5' and / or 3' end of the reference nucleic acid; mutation can include, but is not limited to, substitution (e.g., at least one nucleotide is removed and another nucleotide is inserted at its position (e.g., transversion and conversion)); insertion includes adding at least one nucleotide. In some embodiments, the nucleic acid variant is a variant of 5'-UTR, a variant of 3'-UTR, or a variant of ployA. As used herein, the term “nucleic acid variant” includes naturally occurring variants and engineered variants. Thus, a “nucleic acid variant” as defined herein can be derived from, isolated from, related to, based on, or homogeneous to a reference nucleic acid sequence. A “nucleic acid variant” may optionally have at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the corresponding naturally occurring (wild-type) nucleic acid or homolog, fragment or derivative thereof. In some embodiments, the sequence identity is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 97%. It may be understood that with respect to nucleic acid molecules, the term “variant” includes degenerate nucleic acid sequences, wherein a degenerate nucleic acid sequence according to the invention is a nucleic acid that differs from a reference nucleic acid in a codon sequence due to the degeneracy of the genetic code. As used herein with respect to the term “% identical” or “% identity” refers to the percentage of nucleotides or amino acids that are identical in the optimal alignment between the sequences to be compared, the difference between the two sequences may be distributed over a local region (segment) or the entire length of the sequences to be compared. The identity between two sequences is typically determined after the optimal alignment to a segment or “comparison window.” Optimal alignment may be performed manually or by means of algorithms known in the art. Algorithms known in the art include, but are not limited to, the local homology algorithms described by Smith and Waterman, 1981, Ads App. Math. 2, 482 and Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, the similarity search methods described by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or using computer programs such as Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, GAP in the Wis., BESTFIT, FASTA, BLAST P, BLAST N and TFASTA. For example, the percentage identity of the two sequences may be determined using publicly available algorithms BLASTN or BLASTP on the website of National Center for Biotechnology Information (NCBI). “% identical” or“% identity” can be obtained by determining the number of identical positions corresponding to the sequences to be compared, dividing this number by the number of compared positions (e.g., the number of positions in the reference sequence), and multiplying this result by 100 to obtain % identity. In some embodiments, a degree of identity is given to a region of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. In some embodiments, the degree of identity is given for the entire length of the reference sequence. Alignment for determining sequence identity can be performed with tools known in the art, preferably using optimal sequence alignment, for example, using Align with standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5. In some embodiments, a fragment or variant of a particular nucleic acid, or a nucleic acid having a particular degree of identity to a particular nucleic acid has at least one functional property of the particular nucleic acid, and preferably is functionally equivalent to the particular nucleic acid, e.g., a nucleic acid exhibiting properties that are the same or similar to those of the particular nucleic acid. As used herein, “nucleotide” includes deoxyribonucleotides, ribonucleotides, deoxyribonucleotide derivatives, and ribonucleotide derivatives. As used herein, “ribonucleotide” is a substance constituting ribonucleic acid (RNA), which consists of a molecule of base, a molecule of pentose and a molecule of phosphate, which refers to a nucleotide having a hydroxyl group at the 2’ position of the P-D-ribofuranosyl group, and “deoxyribonucleotide” is a substance constituting deoxyribonucleic acid (DNA), which also consists of a molecule of base, a molecule of pentose and a molecule of phosphate, which refers to a nucleotide having the hydroxyl group at the 2’ position of the P-D-ribofuranosyl group substituted by hydrogen, and is the main chemical component of a chromosome. “Nucleotide” is generally referred to as a single letter representing the base therein, “A” or “A nucleotide” refers to an adenine deoxyribonucleotide or an adenine ribonucleotide containing adenine, “C” or “C nucleotide” refers to a cytosine deoxyribonucleotide or a cytosine ribonucleotide containing cytosine, “G” or “G nucleotide” refers to a guanine deoxyribonucleotide or a guanine ribonucleotide containing guanine, “U” or “U nucleotide” refers to a uracil ribonucleotide containing uracil, and “T” or “T nucleotide” refers to a thymine deoxyribonucleotide containing thymine. “A nucleoside” refers to an adenine deoxyribonucleoside or an adenine ribonucleoside containing adenine. As used herein, the term “nucleic acid” generally refers to any compound comprising a polymer of deoxyribonucleotides (deoxyribonucleic acid, abbreviated as DNA) or a polymer of ribonucleotides (ribonucleic acid, abbreviated as RNA), or a combination thereof. In addition, nucleic acids herein also include derivatives of nucleic acids. The term “derivative of a nucleic acid” includes chemical derivatization of a nucleic acid on the base, the sacchride, or the phosphate of a nucleotide, as well as nucleic acids containing non-native nucleotides and nucleotide analogs. In addition, nucleic acids herein can be single or double stranded in the form of linear or covalent closed circular molecules. “Polynucleotide sequence”, “nucleic acid sequence” and “nucleotide sequence” can be used interchangeably to indicate the ordering of nucleotides in a polynucleotide. It should be understood by those skilled in the art that the coding strand (sense strand) of DNA and the RNA encoded thereby can be regarded as having the same nucleotide sequence, and the deoxythymidylate in the sequence of the coding strand of DNA corresponds to the uridylate in RNA sequence encoded thereby. RNA corresponding to DNA refers to a polynucleotide with T in DNA is completely replaced with U. For example, the RNA corresponding to the DNA having the nucleotide sequence as set forth in ACACTAC refers to an RNA formed by replacing all T in the DNA having the nucleotide sequence as set forth in ACACTAC with U. DNA corresponding to RNA refers to a polynucleotide after all U in RNA is replaced with T. A polynucleotide can comprise one or more segments (nucleic acid fragments) (e.g., 1, 2, 3, 4, 5, 6, 7, 8 segments). For example, a polynucleotide may comprise a segment encoding a polypeptide of interest, such as the polypeptides and polypeptide antigens described herein. In particular embodiments, a polynucleotide may comprise a segment encoding a polypeptide of interest as well as regulatory segments including, but not limited to, segments for the regulation of transcription and the regulation of translation. In one embodiment, the regulatory segment comprises a polynucleotide corresponding to one or more of the following regulatory elements: a promoter, a 5’ untranslated region (5‘-UTR), a 3’ untranslated region (3‘-UTR), and a poly(A) tail. As used herein, the term “promoter” refers to a polynucleotide located upstream of the 5’ end of the coding region of a gene, which contains conserved sequences specific binded by RNA polymerase and required for the initiation of transcription, and can activate RNA polymerase, so that RNA polymerase can accurately bind to template DNA and has the specificity for the initiation of transcription. The promoter may be derived from viruses, bacteria, fungi, plants, insects, and animals. Representative examples of promoters include the phage T7 promoter, the phage T3promoter, the SP6 promoter, the lac operon-promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the SV40 early promoter, or the SV40 late promoter and the CMV IE promoter. As used herein, the term “5‘ untranslated region” or “5‘-UTR” may be an RNA sequence in mRNA that is upstream of the coding sequence and is not translated into a protein. The 5‘-UTR in a gene typically starts at the transcription initiation site and ends at the nucleotide upstream of the translation initiation codon of the coding sequence. The 5‘-UTR may comprise elements that control gene expression, such as a ribosome binding site, a 5‘-terminal oligo pyrimidine bundle, and a translation initiation signal such as a Kozak sequence. mRNA can be post-transcriptional modified by adding a 5’ cap. Thus, 5‘-UTR in mature mRNA can also refer to the RNA sequence between the 5’ cap and the start codon. As used herein, the term “3‘ untranslated region” or “3‘-UTR” may be an RNA sequence in mRNA that is downstream of the coding sequence and is not translated into a protein. The 3‘-UTR in the mRNA is located between the stop codon of the coding sequence and the poly(A) sequence, e.g., starting at the nucleotide downstream of the stop codon and ending at the nucleotide upstream of the poly(A) sequence. As used herein, “5' or 3‘-UTR derived from gene A” refers to 5’ or 3'-UTR from mRNA of gene A. The 5' or 3'-UTR derived from gene A may be all of the 5' or 3'-UTR of the mRNA of the gene A, or a part of the 5' or 3'-UTR of the mRNA of the gene A, and the part of the 5' or 3'-UTR of the mRNA of the gene A includes a part of the 5'-UTR formed by splicing multiple fragments of the 5'-UTR of the mRNA of the gene A or a part of the 3'-UTR formed by splicing multiple fragments of the 3'-UTR of the mRNA of the gene A. As used herein, the terms “polyadenylic acid,” “poly(A) sequence,” and “poly(A) tail” are used interchangeably, and the naturally occurring poly(A) sequences typically consist of adenine ribonucleotides. According to the present invention, the term “modified poly(A) sequence” refers to a poly(A) sequence comprising a nucleotide or a segment of nucleotides other than adenine ribonucleotide. The poly(A) sequence is typically located at the 3' end of mRNA, e.g., the 3' end (downstream) of 3'-UTR. As used herein, the term “5'-cap structure”: 5'-cap structure is typically located at the 5' end of a mature mRNA. In some embodiments, the 5'-cap structure is linked to the 5'-end of the mRNA by a 5'-5'-triphosphate linkage. The 5'-cap structure is typically formed from modified (e.g., methylated) ribonucleotides, especially from guanine nucleotide derivatives. For example, m7GpppN (cap 0 or “cap0”, which is a cap structure formed by the reaction of the 5' phosphate group of hnRNA with the 5'-phosphate group of m7GTP under the action of guanylyltransferase to form a 5',5'-phosphodiester bond), wherein N is the 5'-end nucleotide of the nucleic acid carrying the 5'-cap structure. In some embodiments, the 5'-cap structure includes, but is not limited to, cap 0, cap 1 (a cap structure formed by further methylation at 2'-OH of glycosyl in the nucleotide at position 1 of hnRNA on the basis of cap 0, or referred to as “cap1”), cap 2 (a cap structure formed by further methylation at 2' -OH of glycosyl in the nucleotide at position 2 of hnRNA on the basis of cap 1, or referred to as “cap2”), cap 4, cap 0 analog, cap 1 analog, cap 2 analog, or cap 4 analog. As used herein, the term “expression” includes transcription and / or translation of a nucleotide sequence. Thus, expression may involve the production of transcripts and / or polypeptides. The term “transcription” refers to the process of transcribing the genetic codons in a DNA sequence into an RNA (transcript). The term “in vitro transcription” refers to the in vitro synthesis of RNA, particularly mRNA, in a cell-free system (e.g., in an appropriate cell extract) (see, e.g., Pardi N., Muramatsu H., Weissman D., Kariko K. (2013). In: Rabinovich P. (eds) Synthetic Messenger RNA and Cell Metabolism Modulation. Methods in Molecular Biology (Methods and Protocols), vol 969. Humana Press, Totowa, NJ.). A vector that can be used to produce a transcript are also referred to as “transcription vector” which contains regulatory sequences required for transcription. The term “transcription” encompasses “in vitro transcription.” As used herein, the term “polypeptide” refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A “protein” may comprise one or more polypeptides, wherein the polypeptides interact covalently or non-covalently. As used herein, the term “host cell” refers to a cell for receiving, holding, replicating, expressing a polynucleotide or vector. The term “host cell” includes prokaryotic cells (e.g., E. coli) or eukaryotic cells (e.g., yeast cells and insect cells). For example, cells from human, mouse, hamster, pig, goat, primates. Cells can be derived from a variety types of tissues and include primary cells and cell lines. Some specific examples include keratinocytes, peripheral blood leukocytes, bone marrow stem cells, and embryonic stem cells. In other embodiments, the host cell is an antigen presenting cell, particularly a dendritic cell, a monocyte, or a macrophage. Nucleic acids can be present in a host cell as a single copy or as several copies. In some embodiments, the host cell may be a cell in which the polypeptide of the present invention is expressed. As used herein, the term “recombination” or “recombinant” means “produced by genetic engineering”. In some embodiments, in the context of the present invention, a “recombinant substance” such as a recombinant RNA molecule is non-naturally occurring. As used herein, the term “naturally occurring” or “naturally occurred” refers to the fact that a substance can be found in nature. For example, peptides or nucleic acids that are present in organisms (including viruses) and can be isolated from natural sources and are not artificially intentionally modified in experiments are naturally occurring. In the context of the present invention, the term “plasmid” generally refers to a circular DNA molecule, but the term may also encompass linearized DNA molecules. Specifically, the term “plasmid” also encompasses molecules obtained by linearizing a circular plasmid by, for example, digesting the circular plasmid with a restriction enzyme, thereby converting the circular plasmid molecule into a linear molecule. Plasmids can be replicated, i.e., amplified in cells independently from the genetic information stored as chromosomal DNA, and can be used for cloning, i.e., for amplifying genetic information in bacterial cells. In some embodiments, the DNA plasmid is a medium copy or high copy plasmid. In some embodiments, the DNA plasmid is a high copy plasmid. Examples of such high-copy plasmids include, for example, pUC and pTZ plasmids or any other plasmid (e.g., pMB1, p CoIE1) that includes an origin of replication that supports the high copy of the plasmid. As used herein, the term “antigen” generally refers to a substance that can be recognized by the immune system, preferably by the adaptive immune system, and is capable of triggering an antigen-specific immune response (e.g., formation of antibodies and / or antigen-specific T cells). Typically, the antigen can be or can comprise a peptide or protein that can be presented to the T cell by the MHC. In the sense of the present disclosure, an antigen can be a translation product of a provided nucleic acid (e.g., RNA, RNA molecule, DNA herein). Further, a fragment, a variant, and a derivative of a peptide or protein derived from a peptide or protein comprising at least one epitope or antigen (e.g., tumor antigen, viral antigen, bacterial antigen, protozoan antigen) can be understood as an antigen. The term “vaccine” is typically understood to be a prophylactic or therapeutic material that provides at least one antigen or has an antigenic function, which can stimulate the adaptive immune system in the body to provide an adaptive immune response. As used herein, the term “treating” or the like generally refers to obtaining a desired pharmacological and / or physiological effect. Thus, the treatment in the present application may involve the treatment of the condition of a certain disease, but may also involve prophylactic treatment in terms of the complete or partial prevention of the disease or the symptoms thereof. In some embodiments, the term “treating” should be understood to be therapeutic in partially or completely curing a disease and / or adverse effects and / or symptoms attributed to the disease. The treatment may also be a prophylactic or preventive treatment, i.e., a measure conducted to prevent a disease, e.g., to prevent an infection and / or the onset of a disease. As used herein, the terms “subject” and “patient” may be used interchangeably. In certain embodiments, the subject is a mammal, such as human, non-human primates (e.g., simian, chimpanzee, monkey, and chimpanzee), domestic animals (including dog and cat and livestocks (e.g., horse, cow, pig, sheep, and goat)), or other mammals. Other mammals include, but are not limited to, mouse, rat, guinea pig, rabbit, hamster, etc. In particular embodiments, the subject is human. In one embodiment, the subject is a mammal (e.g., a human) having a genetic disease, a rare disease, or an infectious disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing a genetic disease, a rare disease, or an infectious disease. As used herein, the term “administering” refers to providing or administering an agent to a subject by any effective route. Exemplary routes of administration include, but are not limited to, one or more of the follows: injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, intrathecal, intracerebroventricular, or intravenous), oral, intraductal, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation. When used to treat a disease, disorder, condition, or symptom thereof, the administration of the substance is typically performed after the onset of the disease, disorder, condition, or symptom thereof. When used to prevent a disease, disorder, condition or symptom, the administration of the substance is typically performed prior to the onset of the disease, disorder, condition or symptom. As used herein, “accelerated blood clearance” or “ABC (accelerated blood clearance)” refers to the phenomenon that certain exogenous drugs are rapidly cleared from the blood upon a second or subsequent administration. As used herein, the term “anti-drug antibody” or “ADA (anti-drug antibody)” refers to an antibody produced in a subject against a therapeutic protein present in the subject. Classical antidrug antibody (ADA) response is understood in the art to be produced by the administration of recombinant therapeutic protein to a subject. In addition, in the case of nucleic acid therapeutics (e.g., mRNA therapeutics), ADA response includes antibody responses observed in animal studies described herein, such as the phenomenon of in vivo production of antibodies that bind to therapeutic proteins encoded by mRNA therapeutics. Such an antibody response to a therapeutic protein encoded by an mRNA therapeutic agent is also referred to as an anti-protein antibody (APA) response, and this term is used interchangeably herein with ADA response. As used herein, the term “microRNA” or “miRNA” refers to a non-coding small RNA. Generally, microRNAs are numbered according to the order in which they are discovered, and microRNAs numbered with the same number are derived from the same pre-miRNA, for example, miRNA-142-3p refers to a miRNA- 142 mature derived from the 3‘-end arm of pre-miRNA- 142, and miRNA-142-5p refers to a miRNA-142 mature derived from the 5‘-end arm of pre-miRNA-142. As used herein, if a microRNA is not specified as “5p” or “3p”, it means “5p” and / or “3p”, unless otherwise specified. For example, unless otherwise specified, miR-142 refers to miRNA-142-5p and / or miRNA-142-3p. As used herein, the term “microRNA binding site” refers to a polynucleotide, such as DNA or RNA, that has sufficient complementarity to all or a portion of a region of a miRNA such that it can interact, associate, or bind with microRNA. The binding of microRNA to microRNA binding sites on mRNA triggers microRNA-mediated mRNA regulation, such as microRNA-mediated mRNA degradation or inhibition of mRNA translation, thereby reducing the expression of mRNA coding proteins. Herein, some elements of the present invention will be described. These elements are listed together with specific embodiments, however it should be understood that they can be combined in any manner and in any number to generate additional embodiments. The different described examples and preferred embodiments should not be construed as limiting the invention to the explicitly described embodiments only. This specification should be understood to support and include embodiments that combine the explicitly described embodiments with any number of the disclosed and / or preferred elements. In addition, any arrangement and combination of all described elements in the present invention should be construed as disclosed in the description of the present application unless indicated otherwise in the context. For example, in one embodiment, the non native nucleic acid comprises a plurality of microRNA binding sites located in the poly(A) tail; in another embodiment, the microRNA binding sites located downstream of the 3‘-UTR are capable of binding to one or more microRNAs of: miR-122, miR-126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27, and the following solution is also an embodiment claimed in the present invention: the non-native nucleic acid comprises a plurality of microRNA binding sites located in the poly(A) tail that are capable of binding to one or more microRNAs of: miR-122, miR-126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. II. Non-Native Nucleic Acid The present disclosure provides a non-native nucleic acid comprising a 3‘-UTR and one or more microRNA binding sites located downstream of the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises one microRNA binding site located downstream of the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises 2 to 6 microRNA binding sites located downstream of the 3'-UTR, e.g., 2, 3, 4, 5, or 6. In some embodiments, the above nonnative nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR, and the plurality of microRNA binding sites located downstream of the 3'-UTR are the same. For example, the above non-native nucleic acid comprises three identical microRNA binding sites located downstream of the 3'-UTR and capable of binding to miR-142-3p. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR, and the nucleotide sequences of the plurality of microRNA binding sites located downstream of the 3'-UTR or their corresponding DNA are all as set forth in ACACTAC or SEQ ID NO: 1. In an optional specific example, the above non-native nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR, and the nucleotide sequences of the three microRNA binding sites located downstream of the 3'-UTR or their corresponding DNA are all as set forth in ACACTAC or SEQ ID NO: 1. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR, the plurality of microRNA binding sites located downstream of the 3'-UTR are different, and the plurality of microRNA binding sites downstream of the 3'-UTR bind to the same microRNA or different microRNAs. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR, the plurality of microRNA binding sites located downstream of the 3'-UTR are different, and the plurality of microRNA binding sites located downstream of the 3'-UTR can bind to the same microRNA. At this point, a plurality of microRNA binding sites located downstream of the 3'-UTR can reduce or inhibit the expression of the nonnative nucleic acid in one or more particular cells, tissues and / or organs. For example, the above non-native nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR and capable of binding to miR-142-3p, wherein the first microRNA binding site can bind to the 5' end of miR-142-3p, and the second and third microRNA binding sites are capable of binding to the 3' end of miR-142-3p. For another example, the above non-native nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR and capable of binding to miR-142-3p, wherein the nucleotide sequence of the first microRNA binding site or its corresponding DNA is set forth in SEQ ID NO: 1, and the nucleotide sequence of the second and third microRNA binding sites or their corresponding DNA is set forth in ACACTAC. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3‘-UTR, the plurality of microRNA binding sites located downstream of the 3'-UTR are different, the plurality of microRNA binding sites located downstream of the 3'-UTR bind to different microRNAs, the different microRNAs are from the same cell, tissue and / or organ, or the different microRNAs are from different cells, tissues and / or organs. At this point, a plurality of microRNA binding sites located downstream of the 3'-UTR can reduce or inhibit the expression of the non-native nucleic acid in one or more particular cells, tissues and / or organs. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR, the plurality of microRNA binding sites located downstream of the 3'-UTR are different, the plurality of microRNA binding sites downstream of the 3'-UTR are capable of binding to different microRNAs, and the different microRNAs are derived from the same cell, tissue and / or organ. For example, the above non-native nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR, wherein the first microRNA binding site can bind to miR-142 expressed in immune cells, the second microRNA binding site can bind to miR-155 expressed in immune cells, and the third microRNA binding site can bind to miR-223 expressed in immune cells. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites located downstream of the 3'-UTR, the plurality of microRNA binding sites located downstream of the 3'-UTR are different, the plurality of microRNA binding sites located downstream of the 3'-UTR are capable of binding to different microRNAs, and the different microRNAs are derived from different cells, tissues and / or organs. For example, the above nonnative nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR, wherein the first microRNA binding site can bind to miR-122 expressed in the liver, and the second and third microRNA binding sites can bind to miR-142 expressed in immune cells. In some embodiments, a microRNA binding site located downstream of the 3'-UTR can bind to an microRNA expressed in a target cell, target tissue, and / or target organ to reduce or inhibit the expression of the non-native nucleic acid in the target cell, target tissue, and / or target organ. In some embodiments, the target cell, target tissue, and / or target organ includes one or more of immune cells, liver, lung, heart, nervous system, pancreas, kidney, muscle, endothelial cells, epithelial cells, embryonic stem cells, and abnormal cells. In some embodiments, the target cell is an immune cell. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind includes a microRNA expressed in an immune cell to reduce or inhibit the expression of the non-native nucleic acid in the immune cell. In some embodiments, the immune cell is myeloid cell and / or lymphocyte. In some embodiments, the myeloid cell is selected from one or more of dendritic cell, macrophage, monocyte, neutrophil, basophil, eosinophil, megakaryocyte, and platelet. In some embodiments, the lymphocyte is selected from one or more of the following: T cell, B cell, plasma cell, and NK cell. In some embodiments, the above non-native nucleic acid comprises one or more microRNA binding sites located downstream of the 3'-UTR, and the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind includes a microRNA expressed in an immune cell. The microRNA expressed in an immune cell includes one or more of hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-l-3p, hsa-let-7f-2~5p, hsa-let-7f-5p, miR-125b-l-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-l-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-l-5p, miR-24-2-5p, miR-24-3p, miR-26a-l-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-l-5p, miR-29b-2-5p, miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p and miR-99b-5p. In some embodiments, the microRNA expressed in an immune cell is selected from the microRNAs of Jima DD et al, Blood, 2010,116: el18-el27, microRNAs of Vaz C et al, BMC Genomics, 2010, 11,288 or a combination thereof with the aforementioned microRNAs expressed in an immune cell. In some embodiments, the microRNA expressed in an immune cell is a microRNA expressed in high abundance or specifically expressed in an immune cell. In some embodiments, the microRNA expressed in high abundance or specifically expressed in an immune cell is miR-142. In some embodiments, the microRNA expressed in high abundance or specifically expressed in an immune cell is miR-142-3p. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in liver. The microRNAs expressed in liver include, but are not limited to, one or more of: miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-1249, miR-129-5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p and miR-939-5p. In some embodiments, the microRNA expressed in liver is a microRNA expressed in high abundance or specifically expressed in normal hepatocytes and expressed in low abundance or not expressed in abnormal hepatocytes (e.g., liver cancer cells). In some embodiments, the microRNA expressed in high abundance or specifically expressed in normal hepatocytes and expressed in low abundance or not expressed in abnormal hepatocytes (e.g., liver cancer cells) is miR-122. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in lung. The microRNAs expressed in the lung include, but are not limited to, one or more of: let-7a-2-3p, let-7a-3p, let-7a-5p, miR-126-3p, miR-126-5p, miR-127-3p, miR-127-5p, miR-130a-3p, miR-130a-5p, miR-130b-3p, miR-130b-5p, miR-133a, miR-133b, miR-134, miR-18a-3p, miR-18a-5p, miR-18b-3p, miR-18b-5p, miR-24-l-5p, miR-24-2-5p, miR-24-3p, miR-296-3p, miR-296-5p, miR-32-3p, miR-337-3p, miR-337-5p, miR-381-3p and miR-381-5p. In some embodiments, the microRNA capable of binding to the microRNA binding sites located downstream of the 3‘-UTR includes a microRNA expressed in heart. The microRNAs expressed in heart include, but are not limited to, one or more of: miR-1, miR-133a, miR-133b, miR-149-3p, miR-149-5p, miR-186-3p, miR-186-5p, miR-208a, miR-208b, miR-210, miR-296-3p, miR-320, miR-451a, miR-451b, miR-499a-3p, miR-499a-5p, miR-499b-3p, miR-499b-5p, miR-744-3p, miR-744-5p, miR-92b-3p and miR-92b-5p. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in nervous system. The microRNAs expressed in nervous system include, but are not limited to, one or more of: miR-124-5p, miR-125a-3p, miR-125a-5p, miR-125b-l-3p, miR-125b-2-3p, miR-125b-5p, miR-1271-3p, miR-1271-5p, miR-128, miR-132-5p, miR-135a-3p, miR-135a-5p, miR-135b-3p, miR-135b-5p, miR-137, miR-139-5p, miR-139-3p, miR-149-3p, miR-149-5p, miR-153, miR-181c-3p, miR-181c-5p, miR-183-3p, miR-183-5p, miR-190a, miR-190b, miR-212-3p, miR-212-5p, miR-219-l-3p, miR-219-2-3p, miR-23a-3p, miR-23a-5p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-l-3p, miR-30c-2-3p, miR-30c-5p, miR-30d-3p, miR-30d-5p, miR-329, miR-342-3p, miR-3665, miR-3666, miR-380-3p, miR-380-5p, miR-383, miR-410, miR-425-3p, miR-425-5p, miR-454-3p, miR-454-5p, miR-483, miR-510, miR-516a-3p, miR-548b-5p, miR-548c-5p, miR-571, miR-7-l-3p, miR-7-2-3p, miR-7-5p, miR-802, miR-922, miR-9-3p and miR-9-5p. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in neuron and / or a microRNA expressed in glial cell. The microRNAs expressed in neuron include, but are not limited to, one or more of: miR-132-3p, miR-132-3p, miR-148b-3p, miR-148b-5p, miR-151a-3p, miR-151a-5p, miR-212-3p, miR-212-5p, miR-320b, miR-320e, miR-323a-3p, miR-323a-5p, miR-324-5p, miR-325, miR-326, miR-328 and miR-922. The microRNAs expressed in glial cell include, but are not limited to, one or more of: miR-1250, miR-219-l-3p, miR-219-2-3p, miR-219-5p, miR-23a-3p, miR-23a-5p, miR-3065-3p, miR-3065-5p, miR-30e-3p, miR-30e-5p, miR-32-5p, miR-338-5p and miR-657. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind includes a microRNA expressed in pancreas. The microRNAs expressed in pancreas include, but are not limited to, one or more of: miR-105-3p, miR-105-5p, miR-184, miR-195-3p, miR-195-5p, miR-196a-3p, miR-196a-5p, miR-214-3p, miR-214-5p, miR-216a-3p, miR-216a-5p, miR-30a-3p, miR-33a-3p, miR-33a-5p, miR-375, miR-7-l-3p, miR-7-2-3p, miR-493-3p, miR-493-5p and miR-944. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in kidney. The microRNAs expressed in kidney include, but are not limited to, one or more of: miR-122-3p, miR-145-5p, miR-17-5p, miR-192-3p, miR-192-5p, miR-194-3p, miR-194-5p, miR-20a-3p, miR-20a-5p, miR-204-3p, miR-204-5p, miR-210, miR-216a-3p, miR-216a-5p, miR-296-3p, miR-30a-3p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-l-3p, miR-30c-2-3p, miR30c-5p, miR-324-3p, miR-335-3p, miR-335-5p, miR-363-3p, miR-363-5p and miR-562. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in muscle. The microRNAs expressed in muscle include, but are not limited to, one or more of: let-7g-3p, let-7g-5p, miR-1, miR-1286, miR-133a, miR-133b, miR-140-3p, miR-143-3p, miR-143-5p, miR-145-3p, miR-145-5p, miR-188-3p, miR-188-5p, miR-206, miR-208a, miR-208b, miR-25-3p and miR-25-5p. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind includes a microRNA expressed in endothelial cell. The microRNAs expressed in endothelial cell include, but are not limited to, one or more of: let-7b-3p, let-7b-5p, miR-100-3p, miR-100-5p, miR-101-3p, miR-101-5p, miR-126-3p, miR-126-5p, miR- 1236-3p, miR-1236-5p, miR-130a-3p, miR-130a-5p, miR-17-5p, miR-17-3p, miR-18a-3p, miR-18a-5p, miR-19a-3p, miR-19a-5p, miR-19b-l-5p, miR-19b-2-5p, miR-19b-3p, miR-20a-3p, miR-20a-5p, miR-217, miR-210, miR-21-3p, miR-21-5p, miR-221-3p, miR-221-5p, miR-222-3p, miR-222-5p, miR-23a-3p, miR-23a-5p, miR-296-5p, miR-361-3p, miR-361-5p, miR-421, miR-424-3p, miR-424-5p, miR-513a-5p, miR-92a-l-5p, miR-92a-2-5p, miR-92a-3p, miR-92b-3p and miR-92b-5p. Moreover, in some embodiments, microRNAs expressed in endothelial cell include one or more microRNAs in Voellenkle C et al, RNA, 2012, 18, 472-484. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in epithelial cell. The microRNAs expressed in epithelial cell include, but are not limited to, one or more of: let-7b-3p, let-7b-5p, miR-1246, miR-200a-3p, miR-200a-5p, miR-200b-3p, miR-200b-5p, miR-200c-3p, miR-200c-5p, miR-338-3p, miR-429, miR-451a, miR-451b, miR-494 and miR-802. Further, the microRNAs expressed in respiratory ciliary epithelial cell include, but are not limited to, one or more of: miR-34a, miR-34b-5p, miR-34c-5p, miR-449a, miR-449b-3p and miR-449b-5p. The microRNAs expressed in lung epithelial cell include, but are not limited to, one or more of: let-7 family, miR-133a, miR-133b and miR-126. The microRNAs expressed in renal tubular epithelial cell include, but are not limited to, one or more of miR-382-3p and miR-382-5p. The microRNA expressed in corneal epithelial cell includes, but is not limited to, miR-762. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes a microRNA expressed in embryonic stem cell. The microRNAs expressed in embryonic stem cell include, but are not limited to, one or more of: let-7a-2-3p, let-a-3p, let-7a-5p, let7d-3p, let-7d-5p, miR-103a-2-3p, miR-103a-5p, miR-106b-3p, miR-106b-5p, miR-1246, miR-1275, miR-138-l-3p, miR-138-2-3p, miR-138-5p, miR-154-3p, miR-154-5p, miR-200c-3p, miR-200c-5p, miR-290, miR-301a-3p, miR-301a-5p, miR-302a-3p, miR-302a-5p, miR-302b-3p, miR-302b-5p, miR-302c-3p, miR-302c-5p, miR-302d-3p, miR-302d-5p, miR-302e, miR-367-3p, miR-367-5p, miR-369-3p, miR-369-5p, miR-370, miR-371, miR-373, miR-380-5p, miR-423-3p, miR-423-5p, miR-486-5p, miR-520c-3p, miR-548e, miR-548f, miR-548g-3p, miR-548g-5p, miR-548i, miR-548k, miR-5481, miR-548m, miR-548n, miR-548o-3p, miR-548o-5p, miR-548p, miR-664a-3p, miR-664a-5p, miR-664b-3p, miR-664b-5p, miR-766-3p, miR-766-5p, miR-885-3p, miR-885-5p, miR-93-3p, miR-93-5p, miR-941, miR-96-3p, miR-96-5p, miR-99b-3p and miR-99b-5p. In some embodiments, the microRNAs expressed in embryonic stem cell include, but are not limited to, one or more mentioned in Morin RD et al, Genome Res,2008,18, 610-621, Goff LA et al, PLoS One, 2009, 4:e7192, and Bar M et al, Stem cells, 2008, 26, 24962505. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind includes a microRNA expressed in abnormal cell. Some microRNAs are abnormally overexpressed in certain abnormal cells (e.g., cancer cells), while others are underexpressed in certain abnormal cells. For example, cells, tissues or diseases with the differential expression of a microRNA include cancer cells (WO 2008 / 154098, US2013 / 0059015, US2013 / 0042333, WO2011 / 157294), cancer stem cells (US 2012 / 0053224), pancreatic cancer and diseases (US2009 / 0131348, US2011 / 0171646, US2010 / 0286232, US8389210), asthma and inflammation (US8415096), prostate cancer (US2013 / 0053264), hepatocellular carcinoma (WO2012 / 151212, US2012 / 0329672, WO2008 / 054828, US8252538), lung cancer cells (WO2011 / 076143, WO2013 / 033640, WO2009 / 070653, US2010 / 0323357), skin T cell lymphoma (WO2013 / 011378), colorectal cancer cells (WO2011 / 0281756, WO2011 / 076142), cancer positive lymph nodes (WO2009 / 100430 , US2009 / 0263803), nasopharyngeal carcinoma (EP2112235), chronic obstructive pulmonary disease (US2012 / 0264626 , US2013 / 0053263), thyroid cancer (WO2013 / 066678), ovarian cancer cells (US2012 / 0309645, WO2011 / 095623), breast cancer cells (WO2008 / 154098, WO2007 / 081740, US2012 / 0214699), leukemia and lymphoma (WO2008 / 073915, US2009 / 0092974, US2012 / 0316081, US2012 / 0283310, WO2010 / 018563). In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind includes one or more of: miR-122, miR-126, hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsalet-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-l-3p, hsa-let-7f-2~5p, hsa-let-7f-5p, miR-125b-l-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-144, miR-146-3p, miR-146-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16, miR-16-l-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24, miR-24-l-5p, miR-24-2-5p, miR-24-3p, miR-26a-l-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27, miR-27a-3p, miR-27a-5p, miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-l-5p, miR-29b-2-5p, miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p and miR-99b-5p. In some embodiments, the above non-native nucleic acid comprises two or more (e.g., two, three, four, or more) microRNA binding sites located downstream of the 3'-UTR, wherein: (1) at least one microRNA binding site can bind to a microRNA in hematopoietic cell (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223), and at least one microRNA binding site can bind to a microRNA in plasma cell-like dendritic cell, platelet, or endothelial cell (e.g., miR-126); (2) at least one microRNA binding site can bind to a microRNA in B cell (e.g., miR-142, miR-150, miR-16 or miR-223), and at least one microRNA binding site can bind to a microRNA in plasma cell-like dendritic cell, platelet, or endothelial cell (e.g., miR-126); (3) at least one microRNA binding site can bind to a microRNA in progenitor hematopoietic cell (miR-223, miR-451, miR- 26a or miR-16), and at least one microRNA binding site can bind to a microRNA in plasma dendritic cell, platelet, or endothelial cell (e.g., miR-126); (4) at least one microRNA binding site can bind to a microRNA of a hematopoietic cell (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223), at least one microRNA binding site can bind to a microRNA of a B cell (e.g., miR-142, miR-150, miR-16 or miR-223), and at least one microRNA binding site can bind to a plasma cell-like dendritic cell, platelet, or endothelial cell (e.g., miR-126); or any other possible combination of the above four types of microRNA binding sites (i.e., binding to hematopoietic cell, binding to B cell, binding to progenitor hematopoietic cell, and / or binding to plasma cell-like dendritic cell / platelet / endothelial cell). In some embodiments, the above non-native nucleic acid comprises one or more microRNA binding sites located downstream of the 3'-UTR, and the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind includes one or more of: miR-122, miR- 126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the microRNA binding sites can bind is miR-142-3p. In some embodiments, the microRNA to which the microRNA binding sites can bind is miR-122. In some embodiments, the microRNA to which the microRNA binding sites can bind is miR-126. In some embodiments, the microRNA to which the microRNA binding sites can bind comprises miR-142-3p and one or more of miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind comprises miR-142-5p and one or more of miR-142-3p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind comprises miR-126 and one or more of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3‘-UTR can bind comprises miR-122 and one or more of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27. miR-142, miR-126, miR-146 and miR-155 are expressed in large amounts in immune cells. These microRNA sequences are known in the art, therefore, one of ordinary skill in the art can readily design binding sequences or target sequences to which these microRNAs will bind based on Watson-Crick complementarity. In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein at least one microRNA binding site can bind to miR-142-3p. In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to microRNAs expressed in immune cell, wherein: (1) at least one microRNA binding site can bind to miR-142-3p, and at least one microRNA binding site can bind to miR-155 (e.g., miR-155-3p or miR-155-5p); (2) at least one microRNA binding site can bind to miR-142-3p, and at least one microRNA binding site can bind to miR-146 (e.g., miR-146-3 or miR-146-5p); or (3) At least one microRNA binding site can bind to miR-142-3p, and at least one microRNA binding site can bind to miR-126 (e.g., miR-126-3p or miR-126-5p). In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein at least one microRNA binding site can bind to miR-126-3p. In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein: (1) at least one microRNA binding site can bind to miR-126-3p, and at least one microRNA binding site can bind to miR-155 (e.g., miR-155-3p or miR-155-5p); (2) at least one microRNA binding site can bind to miR-126-3p, and at least one microRNA binding site can bind to miR-146 (e.g., miR-146-3p or miR-146-5p); or (3) at least one microRNA binding site can bind to miR-126-3p, and at least one microRNA binding site can bind to miR-142 (e.g., miR-142-3p or miR-142-5p). In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein at least one microRNA binding site can bind to miR-142-5p. In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein: (1) at least one microRNA binding site can bind to miR-142-5p, and at least one microRNA binding site can bind to miR-155 (e.g., miR-155-3p or miR-155-5p); (2) at least one microRNA binding site can bind to miR-142-5p, and at least one microRNA binding site can bind to miR-146 (e.g., miR-146-3 or miR-146-5p); or (3) at least one microRNA binding site can bind to miR-142-5p, and at least one microRNA binding site can bind to miR-126 (e.g., miR-126-3p or miR-126-5p). In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein at least one microRNA binding site can bind to miR-155-5p. In some embodiments, the above non-native nucleic acid comprises at least two microRNA binding sites located downstream of the 3‘-UTR and capable of binding to a microRNA expressed in immune cell, wherein: (1) at least one microRNA binding site can bind to miR-155-5p, and at least one microRNA binding site can bind to miR-142 (e.g., miR-142-3p or miR-142-5p); (2) at least one microRNA binding site can bind to miR-155-5p, and at least one microRNA binding site can bind to miR-146 (e.g., miR-146-3 or miR-146-5p); or (3) at least one microRNA binding site can bind to miR-155-5p, and at least one microRNA binding site can bind to miR-126 (e.g., miR-126-3p or miR-126-5p). In some embodiments, the above non-native nucleic acid comprises one or more microRNA binding sites located downstream of the 3‘-UTR and capable of binding to miR-142 (e.g., miR-142-3p or miR-142-5p). In some embodiments, the above non-native nucleic acid comprises one or more microRNA binding sites located downstream of the 3‘-UTR and capable of binding to miR-122 (e.g., miR-122-3p or miR-122-5p). In some embodiments, the above non-native nucleic acid comprises one or more microRNA binding sites located downstream of the 3‘-UTR and capable of binding to miR-126 (e.g., miR-126-3p or miR-126-5p). In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind is a microRNA having a higher expression in one cell, tissue or organ than another cell, tissue or organ. In some embodiments, the microRNA to which the microRNA binding sites located downstream of the 3'-UTR can bind is a microRNA that is expressed less in a cancer cell than a non-cancer cell derived from the same tissue. When the above non-native nucleic acid is present in a cancer cell expressing such a low-level microRNA, the polypeptide or protein encoded by the above non-native nucleic acids generally exhibits increased expression. If a polypeptide or protein is capable of inducing apoptosis, this may render the killing of cancer cells easier than normal cells. For example, liver cancer cells typically express a low level of miR-122 compared to normal liver cells. Thus, the non-native nucleic acid (e.g., mRNA) encoding a polypeptide or protein comprising at least one miR-122 binding site (e.g., in the ploy(A) tail of the mRNA) will typically express the polypeptide or protein at a relatively low level in normal liver cells and express the polypeptide at a relatively high level in liver cancer cells. If a polypeptide or protein is capable of inducing apoptosis, liver cancer cells are preferentially killed as compared to normal cells. The microRNA binding site is a polynucleotide or a variant thereof complementary to the fulllength microRNA or a part of the microRNA, and the variant retains the ability of the microRNA binding site to bind to the microRNA, and can achieve the binding of the microRNA to the mRNA where the microRNA binding site is located. A microRNA binding site may be completely complementary to a full-length microRNA or a part of microRNA, or may not be completely complementary to a full-length microRNA or a part of microRNA. Thus, in some embodiments, the microRNA binding site located downstream of the 3‘-UTR is capable of binding to a miroRNA in a completely complementary pairing. In some embodiments, the microRNA binding site located downstream of the 3'-UTR is capable of binding to a part of a miroRNA in a completely complementary pairing. In some embodiments, the microRNA binding site located downstream of the 3'-UTR is capable of binding to a miroRNA in an incompletely complementary pairing. In some embodiments, a microRNA binding site located downstream of the 3'-UTR is capable of binding to a part of a miroRNA in an incompletely complementary pairing. In some embodiments, the length of the microRNA binding site located downstream of the 3'-UTR is 19 nt-25 nt. In some embodiments, the length of the microRNA binding site located downstream of the 3'-UTR is 20 nt-24 nt. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites downstream of the 3'-UTR, and the plurality of microRNA binding sites downstream of the 3'-UTR are each independently 19 nt-25 nt in length. In some embodiments, the above nonnative nucleic acid comprises a plurality of microRNA binding sites downstream of the 3'-UTR, and the plurality of microRNA binding sites downstream of the 3'-UTR are each independently 20 nt-24 nt in length. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites downstream of the 3'-UTR, and there is a spacer sequence between the plurality of microRNA binding sites downstream of the 3'-UTR. In some embodiments, there is a spacer sequence between the plurality of microRNA binding sites downstream of the 3'-UTR. In other embodiments, there is a spacer sequence betweenseveral of the plurality of microRNA binding sites located downstream of the 3'-UTR have a spacer sequence therebetween, and there is not a spacer sequence between the remaining microRNA binding sites. For example, the above non-native nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR, wherein there is a spacer sequence between two microRNA binding sites, and the remaining one microRNA binding site is directly linked to one of the aforementioned microRNA binding sites without a spacer sequence. In some embodiments, the above non-native nucleic acid comprises a plurality of microRNA binding sites downstream of the 3'-UTR, and the plurality of microRNA binding sites downstream of the 3'-UTR are directly linked without a spacer sequence. For example, the above non-native nucleic acid comprises three microRNA binding sites located downstream of the 3'-UTR, and the three microRNA binding sites are directly linked to form a DNA sequence as set forth in SEQ ID NO: 5. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and one or more microRNA binding sites located at one of the following positions: (1) after 3‘-UTR and before the poly(A) tail; (2) in the poly(A) tail; and (3) after 3'-UTR and before the ploy(A) tail, and in the ploy(A) tail. In some embodiments, one or more microRNA binding sites are located in the ploy(A) tail. In some embodiments, the microRNA binding site located in the poly(A) tail is at the 5’ end, between the 5’ end and the 3’ end, and / or at the 3’ end of the poly(A) tail. In some embodiments, the microRNA binding site located in the ploy(A) tail is located at the 5’ end of the ploy(A) tail. In some embodiments, the above non-native nucleic acid comprises a 3‘-UTR, a ploy(A) tail located downstream of the 3‘-UTR, and a plurality of microRNA binding sites located after the 3'-UTR and before the ploy(A) tail. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites located after the 3'-UTR and before the ploy(A) tail, and there is a spacer sequence between at least two of the plurality of microRNA binding sites. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and one or more microRNA binding sites located in the ploy(A) tail. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites in the ploy(A) tail. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites in the ploy(A) tail, and there is a spacer sequence between at least two of the plurality of microRNA binding sites. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites located in the ploy(A) tail, and there are 2 to 20 nucleotides (e.g., A nucleotides) between the first, in the direction from 5' to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites located in the ploy(A) tail, and there are 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides between the first, in the direction from 5' to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites located in the ploy(A) tail, and there are 2 to 20 A nucleotides between the first, in the direction from 5' to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail downstream of the 3'-UTR, and a plurality of microRNA binding sites in the ploy(A) tail, and there are 3 to 17 nucleotides (e.g., A nucleotides) between the first, in the direction from 5' to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites located in the ploy(A) tail, and there are 9 to 17 nucleotides (e.g., A nucleotides) between the first, in the direction from 5' to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail located downstream of the 3'-UTR, and a plurality of microRNA binding sites located in the ploy(A) tail, wherein at least two microRNA binding sites in the plurality of microRNA binding sites have a spacer sequence therebetween, and there are 3 to 17 nucleotides (e.g., A nucleotides) between the first, in the direction from 5’ to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail downstream of the 3'-UTR, and a plurality of microRNA binding sites in the ploy(A) tail, wherein there is a spacer sequence between at least two microRNA binding sites of the plurality of microRNA binding sites, and there are 9 to 17 nucleotides (e.g., A nucleotides) between the first, in the direction from 5' to 3', microRNA binding site located in the ploy(A) tail and the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail downstream of the 3'-UTR, and a plurality of microRNA binding sites downstream of the 3'-UTR, wherein at least one microRNA binding site is located in the ploy(A) tail, and at least one microRNA binding site is located after the 3'-UTR and before the ploy(A) tail. In some embodiments, the above non-native nucleic acid comprises a 3'-UTR, a ploy(A) tail downstream of the 3'-UTR, and a plurality of microRNA binding sites downstream of the 3'-UTR, wherein at least two microRNA binding sites are located in the ploy(A) tail, and at least two microRNA binding sites are located after the 3'-UTR and before the ploy(A) tail. In some embodiments, there is a spacer sequence between multiple microRNA binding sites located in the ploy(A) tail and / or a spacer sequence between multiple microRNA binding sites located after the 3'-UTR and before the ploy(A) tail. In some embodiments, the microRNA binding site located downstream of the 3'-UTR is codon-optimized. In some embodiments, the microRNA binding site downstream of the 3'-UTR or its corresponding DNA comprises a nucleotide sequence as set forth in ACACTAC, SEQ ID NO: 1 or 13. In some embodiments, the microRNA binding site downstream of the 3'-UTR or its corresponding DNA sequence is set forth in ACACTAC, SEQ ID NO: 1 or 13. In some embodiments, the 3'-UTR contained in the above non-native nucleic acid comprises a 3'-UTR derived from one or more of: P-globin gene (e.g., Kariksia, Katalin, et al., "Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability." Molecular therapy 16.11 (2008): 1833-1840, US8278063, US9012219, WO2007036366, US 20110065103, WO2011015347, WO2012072096, WO2013143555, WO2014071963), an a-globin gene (e.g., US 9012219, WO2015101414, WO2015101415, WO2015024667), a human cytochrome b-245 a polypeptide gene (CYBA) (e.g., Ferizi, Mehrije, et al. "Human cellular CYBA UTR sequences increase mRNA translation without affecting the half-life of recombinant RNA transcripts." Scientific reports 6.1 (2016): 39149.), an albumin gene (e.g., Thess, Andreas, et al. "Sequence-engineered mRNA without chemical nucleoside modifications enables an effective protein therapy in large animals." Molecular Therapy 23.9 (2015): 1456-1464), human growth hormone (hGH) gene (e.g., US20140206753, WO2013185069, WO2014089486, WO2014144196, WO2014152659, WO2014152940, WO2014152774, WO2014153052), ribosomal protein S9 gene (such as WO2015101414), FIG4 gene (such as WO2015101415), human albumin 7 gene (such as WO2015101415, WO2015101414, WO201506273, WO2015024667, WO2105062737), and virus. In some embodiments, the virus-derived 3'-UTR includes: 3'-UTR of Venezuelan equine encephalitis virus (VEEV) (e.g., Andries, Oliwia, et al. "N1-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice." Journal of Controlled Release 217 (2015): 337-344). In some embodiments, the DNA sequence of or corresponding to the 3'-UTR is set forth in SEQ ID NO: 2 or 3. It should be noted that “DNA sequence corresponding to 3'-UTR” refers to 3'-UTR in the form of DNA, and the same applies to “DNA sequence of 5'-UTR” and “DNA corresponding to ploy(A) tail” below. It may be understood that, in other embodiments, the 3‘-UTR is not limited to the above, and may also be other 3‘-UTR, e.g. the 3‘-UTR described in patents WO2017059902, WO2013143700, and WO2017001554. In some embodiments, the nucleotides constituting the poly(A) tail comprise at least 20, at least 40, at least 80, at least 100, or at least 120 A nucleotides. In some embodiments, the nucleotides constituting the poly(A) tail comprise at least 20, at least 40, at least 80, at least 100, or at least 120 A continuous nucleotides. In some embodiments, the nucleotides constituting the poly(A) tail comprise one or more nucleotides other than the A nucleotide. In some embodiments, the DNA sequence corresponding to the poly(A) tail is set forth in SEQ ID NO: 6. It can be understood that the ploy(A) tail contained in the non-native nucleic acid (e.g. RNA) of the present disclosure is not limited to the above, and may also be other ploy(A) tails, such as the ploy(A) tail described in patents such as US20170166905 and WO2020074642. In some embodiments, the above non-native nucleic acid further comprises one or more of a coding region encoding a polypeptide or protein of interest, a 5‘-UTR, an internal ribosome entry site (IRES), and a coding region encoding 2A self-cleaving peptides. In some embodiments, the above non-native nucleic acid further comprises a coding region encoding the polypeptide or protein of interest located upstream of the 3'-UTR. In some embodiments, the 3'-UTR and the coding region encoding the polypeptide or protein of interest comprised in the above non-native nucleic acid are heterogenous. For example, the polypeptide or protein of interest encoded by the coding region is a-galactosidase, and the 3'-UTR is a 3'-UTR from the P-globin gene. In some embodiments, the coding region encoding the polypeptide or protein of interest comprised in the above non-native nucleic acid is codon optimized. In some embodiments, a polypeptide or protein of interest refers to a therapeutically or pharmaceutically active polypeptide or protein having a therapeutic or prophylactic effect, of which the function in or near a cell is desired or beneficial. For example, a protein, of which the absence or the defective form leads to the occurrence of a disease, the provision of such proteins can modulate or prevent the disease, or a protein, which is beneficial to the body in or near the cells. The polypeptide or protein of interest may comprise an intact protein or a functional variant thereof. In some embodiments, the polypeptide and / or protein expressed by the above non-native nucleic acid comprising a coding region encoding the polypeptide and / or protein of interest comprises or is one or more of: (a) an antigen; (b) a therapeutic polypeptide or protein, fragment, fragment or variant thereof; and (c) other polypeptides or proteins. In some embodiments, the peptide and / or protein expressed by the above non-native nucleic acid comprising the coding region encoding the polypeptide or protein of interest comprises or is an antigen. In some embodiments, the antigen expressed by the above non-native nucleic acid comprising a coding region encoding a polypeptide or protein of interest is derived from one or more of: (1) a pathogenic antigen, fragment, variant or variant of a fragment thereof, (2) a tumor antigen, fragment, variant or variant of a fragment thereof, (3) an allergic antigen, fragment, variant or variant of a fragment thereof, (4) an autoimmune autoantigen, fragment, variant or variant of a fragment thereof. In some embodiments, the pathogenic antigen is derived from a pathogenic organism that is capable of eliciting an immune response in a subject (e.g., a mammalian subject, further e.g., a human). In some embodiments, the pathogenic organism includes or is one or more of a bacterium, a virus, a fungus, and a protozoan (e.g., a unicellular organism, a multicellular organism). In some embodiments, the pathogenic antigen comprises or is a surface antigen, a fragment, a variant, or a variant of a fragment thereof, such as a protein located on the surface of a virus, bacterium, or protozoa, a fragment thereof (e.g., an outer portion of a surface antigen), a variant, or a variant of a fragment. In some embodiments, the pathogenic antigen comprises or is derived from a polypeptide or protein of a pathogen associated with an infectious disease. In some embodiments, the pathogenic antigen is selected from, but not limited to, the group consisting of the pathogen-derived antigen described in WO2018 / 078053A1 (pages 21 to 35), the pathogen-derived antigen described in WO2019 / 077001A1 (page 57, paragraph 3 to page 63, paragraph 2), the pathogen-derived antigen described inWO2013 / 120628 A1 (page 32, line 26 to page 34, line 27), and the pathogen-derived antigen described in WO2013 / 120628 A1 (page 34, line 29 to page 59, line 5). In some embodiments, the tumor antigen is selected from, but not limited to, the group consisting of the tumor antigens described in WO2018 / 078053A1, pp. 47-51. In some embodiments, the antigen expressed by the above non-native nucleic acid comprising a coding region encoding a polypeptide or protein of interest comprises or is an allergic antigen and an autoimmune autoantigen. In some embodiments, the allergic antigen and the autoimmune autoantigen are derived from or selected from, but not limited to, the group of antigens described in WO2018 / 078053A1 (pages 59-73). In some embodiments, the antigen expressed by the above non-native nucleic acid comprising a coding region encoding a polypeptide or protein of interest is those listed in WO2018 / 078053A1 (pages 48 to 51). In some embodiments, the polypeptide and / or protein expressed by the above non-native nucleic acid comprising a coding region encoding the polypeptide or protein of interest comprises or is a therapeutic polypeptide or protein. In some embodiments, the therapeutic polypeptide or protein comprises or is one or more of: (1) an enzyme replacement therapy for treating metabolic, endocrine, or amino acid disorders or a therapeutic polypeptide or protein for replacing a deleted, defective, or mutated protein; (2) a therapeutic polypeptide or protein for treating blood diseases, circulatory diseases, respiratory diseases, infectious diseases, or immune defects; (3) a therapeutic polypeptide or protein for treating cancer or tumor diseases; (4) a therapeutic polypeptide or protein for hormone replacement treatment; (5) a therapeutic polypeptide or protein for reprogramming somatic cells into pluripotent stem cells or totipotential stem cells; (6) a therapeutic polypeptide or protein for use as an adjuvant or immunostimulatory; (7) a therapeutic polypeptide or protein used as a therapeutic antibody; (8) a therapeutic polypeptide or protein as a gene editing agent; (9) a therapeutic polypeptide or protein for treating or preventing liver diseases selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer; and (10) a therapeutic polypeptide or protein for treating or preventing rare diseases. In some embodiments, the polypeptide or protein of interest is one or more of: a therapeutic protein, a cytokine, a growth factor, an antibody, a fusion protein. In some embodiments, the coding region encoding the polypeptide or protein of interest comprises a non-coding sequence (e.g., an intron). It is understood that non-coding sequences can be removed by post-transcriptional modification. In other embodiments, the coding region encoding the polypeptide or protein of interest does not contain a non-coding sequence. In some embodiments, the above non-native nucleic acid further comprises one or more coding regions encoding a polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a plurality of coding regions encoding a polypeptide or protein of interest, and the plurality of coding regions encoding the polypeptide or protein of interest encode the same polypeptide or protein. In some embodiments, the above non-native nucleic acid comprises a plurality of coding regions encoding a polypeptide or protein of interest, and the plurality of coding regions encoding a polypeptide or protein of interest encode different polypeptides or proteins. In some embodiments, the above non-native nucleic acid comprises a plurality of coding regions encoding the polypeptide or protein of interest, the plurality of coding regions encoding the polypeptide or protein of interest encode different polypeptides or proteins, and there is a coding region encoding a 2A peptide between the coding regions encoding different polypeptides or proteins. In some embodiments, the above non-native nucleic acid further comprises a 5‘-UTR located upstream of the 3‘-UTR. In some embodiments, the 5‘-UTR comprised in the above non-native nucleic acid comprises a 5‘-UTR derived from one or more of: 0-globin gene derived from one or more of the following (e.g., Kariko et al. (2008) Mol. Therap. 16: 1833-1840, US 8,278,063, US9012219, etc.), an a-globin gene (e.g., US 9012219), a human cytochrome b-245 a polypeptide gene (CYBA) (e.g., Ferizi, Mehrije, et al. "Human cellular CYBA UTR sequences increase mRNA translation without affecting the half-life of recombinant RNA transcripts." Scientific reports 6.1 (2016): 39149.), a hydroxysteroid (17-0) dehydrogenase gene (HSD 17B4) (e.g., Thess, Andreas, et al. "Sequence-engineered mRNA without chemical nucleoside modifications enables an effective protein therapy in large animals." Molecular Therapy 23.9 (2015): 1456-1464, WO2015024667), a TOP gene (e.g., WO2015101414, WO2015101415, WO2015062738, WO2015024667, etc.), a ribosomal protein large 32 (L32) gene (e.g., WO2015101414, WO2015101415, WO2015 / 062738, etc.) and ATP5A1 gene (e.g., WO2015024667), and virus. In some embodiments, a 5‘-UTR derived from a virus includes one or more of the following 5‘-UTRs: a 5'-UTR from a tobacco eroding virus (TEV) (e.g., Kariko, Katalin, et al. "Increased erythropoiesis in mice injected with submicrogram quantities of pseudouridine-containing mRNA encoding erythropoietin." Molecular Therapy 20.5 (2012): 948953, US8278063, US9012219, etc.), Venezuelan equala encephalitis virus (VEEV) (e.g., Andries, Oliwia, et al. "N1-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice." Journal of Controlled Release 217 (2015): 337-344), and the cytomegalovirus immediate early 1 (IE1) gene (e.g., US20140206753, WO2014089486, WO2013185069, WO2014144196, WO2014152659, WO2014152940, WO2014152774, WO2014153052, etc.). In some embodiments, the DNA sequence of or corresponding to the 5'-UTR is set forth in SEQ ID NO: 4. It may be understood that, in other embodiments, the 5'-UTR is not limited to the above, and may also be others, e.g., the 5'-UTR described in patents WO2017059902, WO2013143700, WO2017001554, etc. In some embodiments, the above non-native nucleic acid further comprises a coding region encoding the polypeptide or protein of interest and a 5'-UTR, the coding region encoding the polypeptide or protein of interest is located upstream of the 3'-UTR, and the 5'-UTR is located upstream of the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites located in the ploy(A) tail. In some embodiments, the 5‘-UTR and the coding region encoding a polypeptide or protein of interest comprised in the above non-native nucleic acid are heterogenous. For example, the polypeptide or protein of interest encoded by the coding region is a-galactosidase, and the 5‘-UTR is 5‘-UTR from the P-globin gene. In some embodiments, both the 5‘-UTR and the 3‘-UTR comprised in the above non-native nucleic acid are heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5‘-UTR, a coding region encoding a polypeptide or protein of interest, a 3‘-UTR, a ploy(A) tail, and one or more microRNA binding sites located downstream of the 3‘-UTR, and at least one of the 5'-UTR and the 3‘-UTR is heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites located in the ploy(A) tail, and at least one of the 5'-UTR and the 3'-UTR is heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites downstream of the 3'-UTR, and both the 5'-UTR and the 3'-UTR are heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites, wherein the one or more microRNA binding sites are located after the 3'-UTR and before the ploy(A), and / or in the ploy(A) tail, and the 5'-UTR and the 3'-UTR are heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites located in the ploy(A) tail, and the 5'-UTR and the 3'-UTR are heterologous to the coding region encoding the polypeptide or protein of interest. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites located after the 3'-UTR and before the ploy(A), and / or in the ploy(A) tail, wherein: the nucleotide sequence of the microRNA binding site or its corresponding DNA is set forth in ACACTAC, SEQ ID NO: 1 or 13; the nucleotide sequence of 3'-UTR or its corresponding DNA is set forth in SEQ ID NO: 2 or 3; the nucleotide sequence of 5'-UTR or its corresponding DNA is set forth in SEQ ID NO: 4. In some embodiments, the above non-native nucleic microRNA binding site in the 3'-UTR and / or in the 5'-UTR. In some embodiments, the above non-native nucleic microRNA binding sites located in the 5'-UTR. In some embodiments, the above non-native nucleic microRNA binding sites located in the 3'-UTR. In some embodiments, the above non-native nucleic acid further comprises at least one acid further comprises one or more acid further comprises one or more acid further comprises one or more microRNA binding sites located in the 5'-UTR, and one or more microRNA binding sites located in the 3'-UTR. In some embodiments, the specific position in the UTR, length, number, and origin of the bound microRNA, and degree of complementarity to the bound microRNA of the microRNA binding site located in the 3‘-UTR and / or in the 5‘-UTR are not particularly limited. For example, the position in the UTR of the microRNA binding site located in the 3‘-UTR and / or in the 5‘-UTR was described in WO2017062513A1. For example, the length of the microRNA binding site located in the 3‘-UTR and / or in the 5‘-UTR is 2 nt-25 nt. For example, the number of microRNA binding sites located in the 3‘-UTR and / or in the 5‘-UTR is one or more (e.g., 2, 3, 4, 5, or 6). The number of microRNA binding sites located in the 3‘-UTR and / or in the 5‘-UTR is 2-4. For example, the origin of the microRNA to which the microRNA binding site located in the 3'-UTR and / or in the 5‘-UTR can bind may be, but is not limited to, those described above. For example, the microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR are partially or completely complementary to the microRNAs that can be bound. In some embodiments, the above non-native nucleic acid further comprises a microRNA binding site downstream of the 3'-UTR, and a microRNA binding site located in the 3'-UTR and / or in the 5'-UTR, and the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR is the same as the microRNA binding site located downstream of the 3'-UTR. For example, the microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding sites located downstream of the 3'-UTR are both RNAs corresponding to the DNA as set forth in ACACTAC or SEQ ID NO: 1. In some embodiments, the microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR are different from the microRNA binding sites located downstream of the 3'-UTR. In some embodiments, the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR is different from the microRNA binding site located downstream of the 3'-UTR, but the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding site located downstream of the 3'-UTR bind to the same microRNA. For example, the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR is different from the microRNA binding sites located downstream of the 3'-UTR, while the microRNAs that can be bound are all miR-142-3p, wherein the microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR are the RNA corresponding to the DNA as set forth in ACACACTAC, and the microRNA binding sites located downstream of the 3'-UTR are the RNA corresponding to the DNA as set forth in SEQ ID NO: 1. In some embodiments, the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR is different from the microRNA binding site located downstream of the 3'-UTR, and the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding sites located downstream of the 3'-UTR bind to different microRNAs. In some embodiments, the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding site located downstream of the 3'-UTR can bind to different microRNAs, and the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding site located downstream of the 3'-UTR can bind to different microRNAs expressed in the same tissue or cell. In some embodiments, the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding site located downstream of the 3'-UTR can bind to different microRNAs, and the microRNA binding site located in the 3'-UTR and / or in the 5'-UTR and the microRNA binding site located downstream of the 3'-UTR can bind to different microRNAs expressed in different tissues or cells. In some embodiments, the above non-native nucleic acid further comprises a microRNA binding site located downstream of the 3'-UTR, and a microRNA binding site located in the 3'-UTR and / or in the 5'-UTR, and the number of microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR is the same as the number of microRNA binding sites located downstream of the 3 '- UTR. For example, the above non-native nucleic acid contains 3 microRNA binding sites located in the 3‘-UTR and / or in the 5‘-UTR and 3 microRNA binding sites located downstream of the 3'-UTR. In other embodiments, the number of microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR is different from the number of microRNA binding sites located downstream of the 3'-UTR. For example, the above non-native nucleic acid contains one or two microRNA binding sites located in the 3'-UTR and / or in the 5'-UTR and three microRNA binding sites located downstream of the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located in the ploy(A) tail, and one or more microRNA binding sites located after the 3'-UTR and before the ploy(A). In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located in the ploy(A) tail, and one or more microRNA binding sites located in the 5 '-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located in the ploy(A) tail, and one or more microRNA binding sites located in the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located after 3'-UTR and before ploy(A), and one or more microRNA binding sites located in the 5'-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located after 3'-UTR and before ploy(A), and one or more microRNA binding sites located in the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located in the ploy(A) tail, one or more microRNA binding sites located after the 3 '-UTR and before the ploy(A), and one or more microRNA binding sites located in the 5'-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located in the ploy(A) tail, one or more microRNA binding sites located after 3'-UTR and before ploy(A), and one or more microRNA binding sites located in the 3'-UTR. In some embodiments, the above non-native nucleic acid comprises a 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, one or more microRNA binding sites located in the ploy(A) tail, one or more microRNA binding sites located after 3'-UTR and before ploy(A), one or more microRNA binding sites located in the 5'-UTR, and one or more microRNA binding sites located in the 3'-UTR. In some embodiments, the above non-native nucleic acid does not comprise a microRNA binding site located in the 3'-UTR and / or in the 5'-UTR. In some embodiments, the above non-native nucleic acid is a synthesized nucleic acid. In some embodiments, the above non-native nucleic acid is an artificially synthesized isolated nucleic acid. In some embodiments, the above non-native nucleic acid is RNA. In some embodiments, the above non-native nucleic acid is mRNA. The microRNA binding site contained in mRNA binds to a microRNA, triggering microRNA-mediated mRNA regulation, such as mRNA degradation or inhibition of mRNA translation, thereby reducing the expression of mRNA coding proteins. In some embodiments, the microRNA is expressed in high abundance or are specific in a cell, tissue, and / or organ in which the expression of the mRNA is undesired, thereby reducing the expression of the protein encoded by the mRNA in the cell, tissue, and / or organ in which the expression is undesired. In some embodiments, the above non-native nucleic acid is mRNA containing a 3‘-UTR, and the nucleotide sequence of the DNA corresponding to the 3‘-UTR is set forth in SEQ ID NO: 2 or 3. In some embodiments, the above non-native nucleic acid is mRNA, which further comprises a 5‘-UTR, and the nucleotide sequence of the DNA corresponding to the 5‘-UTR is set forth in SEQ ID NO: 4. In some embodiments, the mRNA comprises a cap structure. The cap structure is located at the 5’ end of the 5‘-UTR, also referred to as “5‘-cap structure”. In some embodiments, the 5‘-cap structure is selected from at least one of m7GpppG, m27,3'-OGpppG, m7Gppp(5')N1 and m7Gppp(m2'- O)N1; wherein “m7G” represents a 7-methyl guanosine cap nucleoside, “ppp” represents a triphosphate bond between the 5’ carbon of the cap nucleoside and the first nucleotide of the primary RNA transcript, N1 is the 5‘-most nucleotide, “G” represents a guanosine, “7” represents a methyl group at the 7-position of guanosine, and “m2'"O” represents a methyl group at the 2'-O position of nucleotide. In some embodiments, the cap structure is m7Gppp(5')N1 or m7Gppp(m2'-O)N1. It can be understood that in other embodiments, the cap structure is not limited to the above. In some embodiments, the above non-native nucleic acid does not contain a modified nucleotide. In some embodiments, the above non-native nucleic acid contains a modified nucleotide. In some embodiments, the above non-native nucleic acid contains a modified nucleoside. In some embodiments, when applicable, one or more of the following regions in the above non-native nucleic acids contain a modified nucleoside: 5'-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and a microRNA site. In some embodiments, the modified nucleoside comprised in the above non-native nucleic acid comprises at least one of a modified uridine, a modified cytidine, a modified adenosine, and a modified guanosine. In some embodiments, the modified nucleoside of the above non-native nucleic acid comprises or is a modified uridine. In some embodiments, 0.1%-100% of the uridines in the above non-native nucleic acid are modified. For example, at least 0.1%, at least 0.5%, at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, or 100% of the uridines in the above non-native nucleic acid are modified. In some embodiments, 80%~100% of the uridines are modified. In some embodiments, 100% of the uridines are modified. Exemplary modified uridine comprises pseudouridine (¢), N1- methylpseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-uridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo- uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine-5-oxyacetic acid (cmo5U), uridine-5-oxyacetate methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-tauromethyl-uridine (Tm5U), 1-Taurine methyl-pseudouridine, 5-Taurine methyl-2-thio-uridine (Tm5s2U), 1-Taurine methyl-4-thio-uridine, 5-methyl-uridine (m5U, i.e., deoxythymine with nucleobase), 1-methyl-pseudouridine (m1^), 5-methyl-2-thio-uridine (m5s2U), 1-Methyl-4-thio-pseudouridine (m1s4^), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3 ¢), 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitride-pseudouridine, 2-thio-1-methyl-1-denitride-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydrouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-uridine, 4-methoxy-2-thio-uridine, N1-methyl-uridine, 3-(3-amino-3-carboxypropyl) uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl) pseudouridine (acp3^), 5- (isopentenylaminomethyl) uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2‘-O-methyl-uridine (Um), 5,2‘-O- dimethyl-uridine (m5U m), 2‘-O-methyl-pseudouridine (^m), 2-thio-2‘-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2‘-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2‘-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)-2'-O- methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2- carbomethoxyvinyl) uridine, and 5-[3-(1-E-propenylamino) uridine. In some embodiments, the modified uridines in the above non-native nucleic acid are identical. For example, the above non-native nucleic acid comprises a plurality of modified uridines, each of which are N1-methylpseudouridine. In other embodiments, the modified uridines in the above nonnative nucleic acid are various. For example, the above non-native nucleic acid comprises a plurality of modified uridines selected from at least two of the above exemplary modified uridines (e.g., pseudouridine and N1-methylpseudouridine). In some embodiments, the modified nucleoside in the above non-native nucleic acid comprises or is a modified cytidine. In some embodiments, 0.1%-100% of the cytidines in the above nonnative nucleic acid are modified. For example, at least 0.1%, at least 0.5%, at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, or 100% of the cytidines in the above non-native nucleic acid are modified. In some embodiments, 80%~100% of the cytidines are modified. In some embodiments, 100% of the cytidines are modified. Exemplary modified cytidine comprises 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2- thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-ethoxy-1-methyl-pseudoisocytidine, Lysidine (K2C), a-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m5Cm), N4-Acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytidine, 2'-F-arabino-cytidine, 2'-F-cytidine, and 2'-OH-arabino-cytidine. In some embodiments, the modified cytidines in the above non-native nucleic acid are identical. For example, the above non-native nucleic acid comprises a plurality of modified cytidines, each of which is 5-aza-cytidine. In other embodiments, the modified cytidines in the above non-native nucleic acid are various. For example, the above non-native nucleic acid comprises a plurality of modified cytidines selected from at least two of the above exemplary modified cytidines described above (e.g., 5-aza-cytidine and 6-aza-cytidine). In some embodiments, the modified nucleoside in the above non-native nucleic acid comprises or is a modified adenosine. In some embodiments, 0.1%-100% of the adenosines in the above nonnative nucleic acid are modified. For example, at least 0.1%, at least 0.5%, at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, or 100% of the adenosines in the above non-native nucleic acid are modified. In some embodiments, 80%~100% of the adenosines are modified. In some embodiments, 100% of the adenosines are modified. Exemplary modified adenosine comprises 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6- (cis-hydroxyisopentenyl) adenosine (io6A), 2-methylthio -N6- (cis-hydroxyisopentenyl) adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threcarbamoyl-adenosine (t6A), N6-methyl -N6- threcarbamoyl-adenosine (m6t6A), 2-methylthio -N6-threyl carbamoyl-adenosine (ms2g6A), N6,N6-dimethyl-adenosine (m62A), N6-hydroxyvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6- hydroxyvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2‘-O-methyl-adenosine (Am), N6,2‘-O-dimethyl-adenosine (m6Am), N6,N6,2‘-O- trimethyl-adenosine (m62Am), 1,2‘-O-dimethyl-adenosine (m1Am), 2‘-O-ribosyl-adenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2‘-F-arabine-adenosine, 2‘-F-adenosine, 2‘-OH-arabine-adenosine, and N6-(19-amino-pentaoxa-nonadecyl)-adenosine. In some embodiments, the modified adenosines in the above non-native nucleic acid are identical. For example, the above non-native nucleic acid comprises a plurality of modified adenosines, each of which is 2-amino-purine. In other embodiments, the modified adenosines in the above non-native nucleic acid are various . For example, the above non-native nucleic acid comprises a plurality of modified adenosines selected from at least two of the above exemplary modified adenosine (e.g., 2-amino-purine and 2,6-diaminopurine). In some embodiments, the modified nucleoside in the above non-native nucleic acid is a modified guanosine. In some embodiments, 0.1%-100% of the guanosines in the above non-native nucleic acid are modified. For example, at least 0.1%, at least 0.5%, at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, or 100% of the guanosines in the above non-native nucleic acid are modified. In some embodiments, 80%~100% of the guanosines are modified. In some embodiments, 100% of the guanosines are modified. Exemplary modified guanosine comprises inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methyl wyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW *), 7-deaza-guanosine, queuosine (Q), epoxy-queuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza--8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2,7G), N2,N2,7-trimethyl-guanosine (m2,2,7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thioguanosine, a-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methylguanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (M2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 2'-O-ribosyl-guanosine (phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-arabino-guanosine, and 2'-F-guanosine. In some embodiments, the modified guanosines in the above non-native nucleic acid are identical. For example, the above non-native nucleic acid comprises a plurality of modified guanosines, each of which is inosine. In other embodiments, the modified guanosines in the above non-native nucleic acid are various. For example, the above non-native nucleic acid comprises a plurality of modified guanosines selected from at least two of the above exemplary modified guanosines (e.g., inosine and 1-methyl-inosine). In some embodiments, the modified nucleotide in the above non-native nucleic acid comprises a nucleotide containing an isotope. In some embodiments, the above non-native nucleic acid comprises a nucleotide containing an isotope of hydrogen. The isotope of hydrogen is not limited to deuterium, tritium. In addition, in some embodiments, the above non-native nucleic acid further comprises or is a nucleotide containing an isotope of other elements than hydrogen, wherein the other elements include, but are not limited to, carbon, oxygen, nitrogen and phosphorus. In some embodiments, the above non-native nucleic acid comprises a 5‘-UTR, a coding region encoding a polypeptide or protein of interest, a 3‘-UTR, a ploy(A) tail, and one or more microRNA binding sites located downstream of the 3‘-UTR, and the above non-native nucleic acid is mRNA and contains a modified nucleotide. In some embodiments, the above non-native nucleic acid comprises a 5‘-UTR, a coding region encoding a polypeptide or protein of interest, a 3‘-UTR, a ploy(A) tail, and one or more microRNA binding sites, wherein the one or more microRNA binding sites are located after the 3‘-UTR and before the ploy(A), and / or in the ploy(A) tail, and the above non-native nucleic acid is mRNA and contains a modified nucleotide. In some embodiments, the above non-native nucleic acid comprises a 5‘-UTR, a coding region encoding a polypeptide or protein of interest, a 3‘-UTR, a ploy(A) tail, and one or more microRNA binding sites located downstream of the 3‘-UTR, at least one of the 5‘-UTR and the 3‘-UTR is heterologous to the coding region encoding the polypeptide or protein of interest, and the above non-native nucleic acid is mRNA and contains a modified nucleotide. In some embodiments, the above non-native nucleic acid comprises a 5‘-UTR, a coding region encoding a polypeptide or protein of interest, a 3'-UTR, a ploy(A) tail, and one or more microRNA binding sites located downstream of the 3'-UTR, at least one of the 5'-UTR and the 3'-UTR is heterologous to the coding region encoding the polypeptide or protein of interest, and the above non-native nucleic acid is mRNA and contains a modified uridine. In some embodiments, at least 0.1%, at least 0.5%, at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, or 100% of the uridines in the above non-native nucleic acid are modified. In some embodiments, the modified uridine in the above non-native nucleic acid is N1-methylpseudouridine. In some embodiments, 100% of the uridines in the above non-native nucleic acid are modified, and the modified uridines are N1-methylpseudouridine. In some embodiments, the above non-native nucleic acid comprises a stop codon. It will be understood that, in other embodiments, the above non-native nucleic acid does not comprise a stop codon. When using the above non-native nucleic acid that does not comprise a stop codon, one of ordinary skill in the art knows that a stop codon (e.g., UGA or TGA) should be added at an appropriate position. It is understood that the above non-native nucleic acid may comprise one or more stop codons. In some embodiments, the above non-native nucleic acid is DNA. In some embodiments, the above non-native nucleic acid is DNA, which can be transcribed into RNA in vitro. In some embodiments, the above non-native nucleic acid is DNA, which further comprises a 3'-UTR, and the nucleotide sequence of 3'-UTR is set forth in SEQ ID NO: 2 or 3. In some embodiments, the above non-native nucleic acid is DNA, which further comprises a 5'-UTR, and the nucleotide sequence of 5'-UTR is set forth in SEQ ID NO: 4. In some embodiments, the non-native nucleic acid (e.g., mRNA) comprising one or more microRNA binding sites located downstream of the 3'-UTR of the present disclosure can reduce the activation of undesired immune cells and corresponding immune response in a subject, thereby reducing or inhibiting the anti-drug antibody response, for example, the mRNA comprising one or more microRNA binding sites located downstream of the 3'-UTR capable of binding to a microRNA expressed in immune cell (e.g., miR142, miR126 or miR-155) can reduce or inhibit the anti-drug antibody response. In some embodiments, the non-native nucleic acid (e.g., mRNA) comprising one or more microRNA binding sites located downstream of the 3'-UTR of the present disclosure can reduce the activation of undesired immune cells and corresponding immune response in a subject, thereby reducing or inhibiting the production of anti-PEG IgM, and reducing or inhibiting accelerated blood clearance, for example, the mRNA comprising one or more microRNA binding sites located downstream of the 3'-UTR capable of binding to a microRNA expressed in immune cell (e.g., miR142, miR126, or miR-155), can reduce or inhibit the production of anti-PEG IgM, and reduce or inhibit accelerated blood clearance. In some embodiments, the non-native nucleic acid (e.g., mRNA) comprising one or more microRNA binding sites located downstream of the 3'-UTR of the present disclosure can reduce the activation of undesired immune cells and corresponding immune response in a subject, thereby reducing or inhibiting the production of cytokines (e.g., IL- 6, TNF-a, and INF-y). For example, the mRNA containing one or more microRNA binding sites located downstream of the 3‘-UTR that bind to a microRNA expressed in immune cell (e.g., miR142, miR126 or miR-155) can reduce or inhibit the production of cytokines. In some embodiments, the production of undesirable cytokine can be reduced or inhibited by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. III. Genetic Engineering Vector, Host Cell and Method for Preparing RNA The present disclosure also provides a genetic engineering vector comprising the DNA of any of the above embodiments. In some embodiments, the genetic engineering vector comprising the DNA of any of the above embodiments is a plasmid, cosmid, virus, phage, or other vector conventionally used in genetic engineering. In an optional specific example, the genetic engineering vector comprising the DNA of any one of the above embodiments is a plasmid. In some embodiments, the genetic engineering vector comprising the DNA of any of the above embodiments is an adenovirus, an adeno-associated virus, a lentivirus, or a retrovirus. In some embodiments, the above genetic engineering vector comprises one or more of the follows: origin of replication (ORI), a marker gene or fragment thereof, a reporter gene or fragment thereof, and a restriction site allowing the insertion of a DNA element. In some embodiments, the restriction site is a multiple cloning site (MCS). In some embodiments, the above genetic engineering vector is an expression vector. In some embodiments, the genetic engineering vector comprises a promoter, a 5‘-UTR, a coding region encoding a polypeptide or protein of interest, a 3‘-UTR, a ploy(A) tail, and one or more microRNA binding sites located after the 3‘-UTR and before or in the ploy(A) tail. In other embodiments, the above genetic engineering vector is a cloning vector. In addition, the present disclosure also provides a host cell comprising the RNA of any of the above embodiments, the DNA of any of the above embodiments, or the genetic engineering vector of any of the above embodiments. In some embodiments, the above host cell is an isolated cell. In some embodiments, the above host cell is used to store and / or amplify the above DNA. In some embodiments, the above host cell is a bacterial cell. Bacterial host cells include E. coli cells which is well known to those skilled in the art. The host cell of the present disclosure can be prepared by transforming the genetic engineering vector of any of the above embodiments into a competent host cell. Competent host cells are cells that have the ability to uptake free extracellular genetic material (e.g., DNA plasmid) independent of sequence. A variety of bacterial cells known to those skilled in the art are naturally capable of uptaking exogenous DNA from the environment and thus can serve as bacterial host cells according to the present disclosure. In addition, it is known to those skilled in the art that competent bacterial host cells can be obtained from natural non-competent bacterial cells using, for example, electroporation or chemicals (e.g., treatment with calcium ions with high temperature exposure). Upon uptake, the exogenous DNA is preferably neither degraded nor integrated in the genome of the bacterial host cell. The present disclosure also provides a method of preparing RNA, comprising a step of transcription using the genetic engineering vector of any of the above embodiments of the present disclosure. In some embodiments, the method of preparing RNA is an in vitro method. In some embodiments, the method of preparing RNA comprises contacting the genetic engineering vector (e.g., plasmid) of any of the above embodiments with an RNA polymerase. In some embodiments, the method of preparing RNA further comprises the step of linearizing the genetic engineering vector (e.g., plasmid). In some embodiments, prior to the linearization, the superhelical rate of the genetic engineering vector (e.g., plasmid) is at least about 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, etc.). In some embodiments, the method of preparing RNA further comprises a step of purifying the linearized genetic engineering vector. In some embodiments, the method of preparing RNA further comprises a step of purifying RNA. The present disclosure further provides another method of preparing RNA, comprising a step of preparing the RNA according to the nucleotide sequence of the RNA or DNA corresponding to any of the above embodiments by chemical synthesis. It can be understood that the chemical synthesis method may be a method known in the art, such as a solid phase phosphoramidite method. In some embodiments, the above non-native nucleic acid is mRNA. In some embodiments, any of the above methods of preparing RNA further comprises a step of capping and optionally purifying the capping product. In some embodiments, the cap is a Cap1 cap. The Cap1 cap structure is as follows: cap G1G2 = m7G+-5'-ppp-5'-Gm2'-3'-p-[m7=7-CH3; m2 =2'-O-CH3; -ppp- = -PO2H-O-PO2H-O-PO2H)-; -p-=-PO2H-]. The capping reaction is as follows: pppN1(p)Nx-OH(3') ^ ppN1(pN)x-OH(3') + Pi ppN1(pN)x-OH(3') + GTP ^ G(5')ppp(5')N1(pN)x-OH(3') + PPi G(5')ppp(5')N1(pN)x-OH(3') + AdoMet -> m7G(5')ppp(5')N1(pN)x-OH(3') + AdoHyc m7GpppN1(pN)x-OH(3') + AdoMet -> m7Gppp[m2’-O]N1(pN)x-OH(3') + AdoHyc. In other embodiments, the method of preparing RNA is partially an in vitro method. The method of preparing RNA, at this moment, comprises the following steps: preparing the genetic engineering vector of any of the above embodiments in vitro; and introducing the genetic engineering vector into an organism (e.g., in the form of a plasmid). In some embodiments, the above genetic engineering vector is encapsulated in a delivery carrier. At this moment, the genetic engineering vector is delivered into an organism via the delivery carrier. In some embodiments, the RNA prepared in the method of preparing RNA according to any one of the above embodiments comprises a modified nucleoside or a modified nucleotide. Correspondingly, the raw material for preparing the RNA comprises one or more modified nucleosides or nucleotides. It can be understood that the amount and type of modified nucleosides or nucleotides correspond to the RNA to be prepared. In addition, the present disclosure further provides an RNA prepared by the method of preparing an RNA according to any one of the above embodiments. In some embodiments, the RNA is mRNA. IV. Delivery carrier, pharmaceutical composition and use thereof The present disclosure also provides a delivery carrier comprising the RNA of any of the above embodiments, the DNA of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the host cell of any of the above embodiments. In some embodiments, the above delivery carrier comprises an RNA, DNA, genetic engineering vector or host cell. In other embodiments, the above delivery carrier comprises a plurality of RNAs, a plurality of DNAs, a plurality of genetic engineering vectors, or a plurality of host cells. For example, in some embodiments, the above delivery carrier comprises a plurality of RNAs encoding different polypeptides or proteins. In some embodiments, the above delivery carrier comprises two RNAs encoding different polypeptides or proteins. In some embodiments, the nucleic acid in the above delivery carrier is mRNA. In some embodiments, the above delivery carrier comprises a plurality of mRNAs encoding different polypeptides or proteins. In some embodiments, the above delivery carrier is selected from one or a complex of several of the follows: lipid nanoparticles (LNPs), liposomes, cationic proteins, vesicles, microparticles, polymers, and micelles. In some embodiments, the delivery carrier is selected from one of lipid nanoparticles, liposomes, cationic proteins, vesicles, microparticles, polymers, and micelles. In some embodiments, the above delivery carrier is lipid nanoparticles (LNPs) comprising the RNA of any of the above embodiments, the DNA of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the host cell of any of the above embodiments. In some embodiments, lipid nanoparticles refer to particles at the order of nanometers (e.g., 1nm-1000nm) that include one or more lipids. In some embodiments, the lipid nanoparticles have an average diameter of 20nm~800nm, 20nm~500nm, 20nm~400nm, 20nm~300nm, 20nm~200nm, 20nm~100nm, 30nm~700nm, 30nm~500nm, 30nm~300nm, 30nm~200nm, 30nm~100nm, 40nm~800nm, 40nm~600nm, 40nm~500nm, 40nm~300nm, 40nm~200nm, 40nm~100nm, 50nm~800nm, 50nm~600nm, 50nm~500nm, 50nm~500nm, 50nm~400nm, 50nm~500nm, 50nm~400nm, 50nm~300nm, 50nm~200nm, 50nm~100nm, 60nm~800nm, 60nm~600nm, 60nm~500nm, 60nm~400nm, 60nm~300nm, 60nm~200nm or 60nm~100nm. In some alternative specific examples, the lipid nanoparticles have an average diameter of 26nm, 31nm, 36nm, 41nm, 46nm, 51nm, 56nm, 61nm, 66nm, 71nm, 76nm, 81nm, 86nm, 91nm, 96nm, 101nm, 106nm, 111nm, 116nm, 121nm, 126nm, 131nm, 136nm, 141nm, 146nm, 151nm, 156nm, 161nm, 166nm, 171nm, 176nm, 181nm, 186nm, 191nm, 196nm, 201nm, 206nm, 211nm, 216nm, 221nm, 226nm, 231nm, 236nm, 241nm, 246nm or 249nm. Herein, the average diameter of the lipid nanoparticles may be expressed as a z-average determined by dynamic light scattering. In some embodiments, the lipid nanoparticles comprise one of the follows: cationic lipid nanoparticles, solid lipid nanoparticles (SLN), nanostructured lipid carriers (NLC), and non-lamellar lipid nanoparticles. In an optional specific example, the lipid nanoparticles are cationic lipid nanoparticles. In some embodiments, the lipid nanoparticles contain one or more of the following substances: cationic lipids, helper lipids, structural lipids, and polymer-lipids. The term “cationic lipid” refers to a lipid that becomes positively charged by lowering the pH below the pKa of the ionizable group of the lipid, but becomes gradually neutral at higher pH values, where the positively charged lipid is able to bind to negatively charged nucleic acids. In certain embodiments, the cationic lipid comprises an amphoteric lipid. In some embodiments, the cationic lipid comprises the following compound (I), N-oxide thereof, salt thereof or isomer thereof: (I) where: Ri is selected from the group consisting of C5-C30 alkyl, C5-C20 alkenyl, -R*YR", -YR", and -R"'M‘R‘; R2 and R3 are independently selected from the group consisting of H, C1-C14 alkyl, C2-C14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocyclic or carbocyclic ring; R4 is selected from the group consisting of hydrogen, C3-C6 carbocycle, -(CH2)nQ, -(CH2)nCHQR, -(CH2)oC(R10)2(CH2)n-oQ, -CHQR, -CQ(R)2, and unsubstituted C1-C6 alkyl, wherein Q is selected from carbocycle, heterocycle, -OR, -O(CH2)nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, - N(R)C(S)N(R)2, N(R)R8, -N(R)S(O)2R8, -O(CH2)nOR, -N(R)C( = NR9)N(R)2, -N(R)C( = CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C( =NR9)N(R)2, -N(OR)C(= CHR9)N(R)2, -C(= NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR and -C(R)N(R)2C(O)OR, each o is independently selected from 1, 2, 3 and 4, and each n is independently selected from 1, 2, 3, 4 and 5; each R5 is independently selected from the group consisting of OH, C1-C3 alkyl, C2-C3 alkenyl, and H; each R6 is independently selected from the group consisting of OH, C1-C3 alkyl, C2-C3 alkenyl, and H; M and M‘ are independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)-M”-C(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, -S-S-, aryl groups, and heteroaryl groups, wherein M" is a bond, C1-C13 alkyl, or C2--C13 alkenyl; R7 is selected from the group consisting of C1-3 alkyl, C2-C3 alkenyl, and H; R8 is selected from the group consisting of C3-6 carbocyclic and heterocyclic; R9 is selected from the group consisting of H, CN, NO2, C1-C6 alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C2-C6 alkenyl, C3-C6 carbocyclic, and heterocyclic; R10 is selected from the group consisting of H, C1-C3 alkyl, and C2-C3 alkenyl; each R is independently selected from the group consisting of C1-C3 alkyl, C2-C3 alkenyl, (CH2)qOR*, and H, and each q is independently selected from 1, 2 and 3; each R‘ is independently selected from the group consisting of C1-C18 alkyl, C2-C18 alkenyl, - o-Ru -Rn—{ R*YR”, -YR”, H and , and R11 is selected from the group consisting of C1-C12 alkylene and C2-C12 alkenylene, R12 and R13 are each independently selected from the group consisting of C1-C12 alkyl and C2-C12 alkenyl; each R" is independently selected from the group consisting of C3-C15 alkyl and C3-C15 alkenyl; each R"' is independently selected from the group consisting of C3-C15 alkylene and C3-C15 alkenylene; each R* is independently selected from the group consisting of absent, C1-C12 alkylene, and C2-C12 alkenylene; each R** is independently selected from the group consisting of absent, C1-C12 alkyl, and C2-C12 alkenyl; each Y is independently a C3-C6 carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13; and wherein when R4 is -(CH2)nQ, -(CH2)nCHQR, -CHQR, or -CQ(R)2, then (i) when n is 1, 2, 3, 4 or 5, Q is not -N(R)2; or (ii) when n is 1 or 2, Q is not 5, 6 or 7-membered heterocycloalkyl. In an optional specific example, the cationic lipid is the following compound (I), N-oxide thereof, salt thereof or isomer thereof: (I) R1-R7, M and m are as defined above. In some embodiments, the cationic lipid comprises the following compound (II), N-oxide thereof, salt thereof or isomer thereof: (II) where: R1, R2, R3, R5, R6, M and R7 are as described above, RN is H or C1-C3 alkyl; Xa and Xb are each independently O or S; R14 is selected from the group consisting of H, halogen, -OH, Rb, -N(Rb)2, -CN, -N3, -C(O)OH, -C(O)ORb, -OC(O)Rb, -ORb, -SRb, -S(O)Rb, -S(O)ORb, -S(O)2ORb, -NO2, -S(O)2N(Rb)2, -N(Rb)S(O)2Rb, -NH(CH2)t1N(Rb)2, -NH(CH2)p1O(CH2)q1N(Rb)2, -NH(CH2)s1ORb, -N((CH2)SORb)2, -N(Rb)-carbocycle, -N(Rb)-heterocycle, N(Rb)-aryl, -N(Rb)-heteroaryl, -N(Rb)(CH2)t-carbocycle, -N(Rb)(CH2)t1-heterocycle, -N(Rb)(CH2)t1-aryl, -N(Rb)(CH2)t1-heteroaryl, carbocycle, heterocycle, aryl and heteroaryl; each Rb is independently selected from the group consisting of C1-C3 alkyl, C2-C3 alkenyl, and H; u is 5, 6, 7, 8, 9, 10, 11, 12 or 13; w is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; r is 0 or 1; t1 is 1, 2, 3, 4 or 5; p1 is 1, 2, 5, 4 or 5; q1 is 1, 2, 5, 4 or 5; and s1 is 1, 2, 3, 4 or 5. In an optional specific example, the cationic lipid is the following compound (II), its N-oxide, its salt or its isomer: (II) where R1-R3, R5-R7, R14, Xa, Xb, RN, M, u, w and r are as defined above. In some embodiments, the cationic lipid comprises the following compound (III), N-oxide thereof, salt thereof or isomer thereof: Rl7^ G3 l2 Ri5 G1 G2 ^R16 (III) where: one of L1 or L2 is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)x-, -S-S-, -C(=O)S-, -SC(= O)-, -NRaC( = O)-, -C( = O)NRa-, NRaC( = O)NRa-, -OC( = O)NRa- or -NRaC( = O)O-, and the other of L1 or L2 is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)x-, -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O-or a bond; G1 and G2 are each independently unsubstituted C1-C12 alkylene or C2-C12 alkenylene; G3 is C1-C24 alkylene, C2-C24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; Ra is H or C1-C12 hydrocarbyl; R15 and R16 are each independently C6-C24 alkyl or C6-C24 alkenyl; R17 is H, OR18, CN, -C(=O)OR19, -OC(=O)R19 or -NR18C(=O)R19; R19 is a C1-C12 hydrocarbyl group; R18 is H or C1-C6 hydrocarbyl; and x is 0, 1 or 2. In an optional specific example, the cationic lipid is the following compound (III), its N-oxide, its salt or its isomer: G3 . i2 r15 G1 G2 ^ri6 (III) R15-R17, G1-G3, L1-L2 are as defined above. In some embodiments, the cationic lipid is Compound 2-5, a salt thereof, or an isomer thereof: (Compound 2-5). In some embodiments, the helper lipid of the lipid nanoparticle comprises a phospholipid. Phospholipids are generally semi-synthetic and may be naturally derived or chemically modified. In an optional specific example, the helper lipid of the lipid nanoparticle is a phospholipid. In some embodiments, the phospholipids of the lipid nanoparticles include one or more of the following: DSPC (distearoyl phosphatidylcholine), DOPE (dioleoyl phosphatidylethanolamine), DOPC (dioleoyl phosphatidylcholine), DOPS (dioleoyl phosphatidylserine), DSPG (1,2-dioctadecanoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), DPPG (dipalmitoyl phosphatidylglycerol), DPPC (dipalmitoyl phosphatidylcholine), DGTS (1,2-dipalmitoyl-sn-glycero-3-O-4'-(N,N,N-trimethyl) homoserine), and lysophospholipids. In some embodiments, the helper lipid of the lipid nanoparticle is one or more selected from the group consisting of DSPC, DOPE, DOPC, and DOPS. In some embodiments, the helper lipid of the lipid nanoparticle is DSPC and / or DOPE. In some embodiments, the structural lipid of the lipid nanoparticle includes sterols. In an optional specific example, the structural lipids of the lipid nanoparticle are sterols. In some embodiments, the sterols in the lipid nanoparticle include one or more of the follows: 20a-hydroxycholesterol, cholesterol, cholesterol esters, sterol hormones, sterol vitamins, bile acids, cholesterol, ergosterol, p-sitosterol, and oxidized cholesterol derivatives. In some embodiments, the structural lipid of the lipid nanoparticle comprises at least one of cholesterol, cholesterol ester, sterol hormone, sterol vitamin, and bile acid. In some embodiments, the structural lipid of the lipid nanoparticles is cholesterol. In an alternative specific example, the structural lipid of the lipid nanoparticles is high purity cholesterol, in particular injection-grade high purity cholesterol, such as CHO-HP (produced by AVT). In other embodiments, the structural lipid is 20a-hydroxycholesterol. A polymer-lipid refers to a conjugate comprising a polymer and a lipid coupled to the polymer. The polymer-lipid (e.g., polyethylene glycol-lipid) in the lipid nanoparticles can improve the stability of the lipid nanoparticles in vivo. In some embodiments, the lipids of the polymer-lipid used to form the lipid nanoparticles include one or more of 1,2-dimyristoyl-sn-glycerol (DMG), distearoyl-phosphatidyl-ethanolamine (DSPE), diacylglycerol (DAG), dialkyloxypropyl (DAA), phospholipids, ceramide (Cer), 1,2-distearoyl-rac-glycerol (DSG), and 1,2-dipalmitoyl-rac-glycero (DPG). In some embodiments, the polymer-lipid polymer used to form the lipid nanoparticles includes one or both of a hydrophilic polymer and an amphipathic polymer. In some embodiments, the polymer-lipid polymer used to form the lipid nanoparticles is a hydrophilic polymer. In other embodiments, the polymer-lipid polymer used to form the lipid nanoparticles is an amphoteric polymer. In some embodiments, the hydrophilic polymer includes one or more of the follows: polyethylene glycol (PEG), poly (oxazolines)(POX), poly (glycerols) (PGs), poly (hydroxypropyl methacrylate) (PHPMA), poly (2-hydroxy ethyl methacrylate) (PHEMA), poly (N- (2-hydroxy propyl) methacrylamide) (HPMA), poly (vinylpyrrolidone) (PVP), poly(N,N-dimethyl acrylamide) (PDMA), poly(N-acryloyl morpholine) (PAcM), polyaminoacids, glycosaminoglycans (GAGs), heparin, hyaluronic acid (HA), polysialic acid (PSA), elastin-like polypeptides (ELPs), serum albumin and CD47. Correspondingly, polymer-lipids include one or more of the follows: polyethylene glycollipids (PEG-lipids), polyoxazoline-lipids, polyglycerol-lipids, polyhydroxypropyl methacrylatelipids, poly(2-hydroxyethyl methacrylate)-lipids, poly(N-(2-hydroxypropyl) methacrylamide)-lipids, polyvinylpyrrolidone-lipids, poly(N,N-dimethylacrylamide)-lipids, poly(N- acryloylmorpholine)-lipids, glycosaminoglycan-lipids, heparin-lipids, hyaluronic acid-lipids, polysialyl-lipids, elastidin-like lipids, serum albumin-lipids, and CD47-lipids. It should be noted that “PEG-lipid” is a conjugate of polyethylene glycol and lipid, “polyoxazoline-lipid” refers to a conjugate formed by coupling polyoxazoline with lipid, “polyglycerol-lipid” refers to a conjugate formed by coupling polyglycerol with lipid, and the same applies to other polymer-lipids. In an optional specific example, the hydrophilic polymer comprises polyethylene glycol. In some embodiments, the polymer-lipid comprises a PEG-lipid. In an alternative specific example, the polymer-lipid is a PEG-lipid. In some embodiments, PEG-lipids include one or more of dimyristoylglycerol-PEG (DDG-PEG), distearoyl phosphatidylethanolamine-PEG (DSPE-PEG), diacylglycerol-PEG (DAG-PEG), dialkyloxypropyl-PEG (DAA-PEG), phospholipid-PEG, ceramide-PEG (C-PEG), 1,2-distearoyl-rac-glycerol-PEG (DSG-PEG), and 1,2-dipalmitoyl-rac-glycerol-PEG (PEG-DPG). PEG-Lipids are preferably DMG-PEG, DSG-PEG, DPG-PEG. DMG-PEG is a polyethylene glycol derivative of glycerol 1,2-dimyristate. In some embodiments, the average molecular weight of the PEG in the PEG-lipid is about 2000-5000. In an alternative specific example, the average molecular weight of PEG in PEG-lipid is about 2000. In some embodiments, the amphoteric polymer includes one or more of poly(carboxybetaine) (pCB), poly(sulfobetaine) (pSB), phosphobetaine-base polymers, and phosphorylcholine polymers. In some embodiments, the amphoteric polymer includes one or more of the following: polycarboxybetaine acrylamide, (pCBAA), poly(carboxybetaine methacrylate), poly(sulfobetaine methacrylate), poly(methacryloyloxyethyl phosphorylcholine), poly(vinyl-pyridinio propanesulfonate), poly(carboxybetaine) based on vinylimidazole, poly(sulfobetaine) based on vinylimidazole, poly(sulfobetaine) based on vinylpyridine. Correspondingly, the polymer-lipid comprises one or more of the following: polyhydroxybetaine-lipid, polysulfobetaine-lipid, phosphobetaine-based polymer-lipid, and phosphocholine polymer-lipid. In some embodiments, the polymer-lipid comprises one or more of poly (carboxybetaine acrylamide)-lipid, poly (carboxybetaine methacrylate)-lipid, poly (sulfobetaine methacrylate)-lipid, poly (methacryloxyethyl phosphorylcholine)-lipid, poly (vinyl pyridyl propanesulfonate)-lipid, polyvinylimidazolyl betaine-lipid, polyvinylimidazolyl sulfobetaine-lipid, polyvinypyridyl sulfobetaine-lipid. In addition, in some embodiments, the polymers applied to nanoparticles in Hoang Thi, Thai Thanh et al. “The Importance of Poly(ethylene glycol) Alternatives for Overcoming PEG Immunogenicity in Drug Delivery and Bioconjugation.” Polymers vol. 12,2 298, are also incorporated herein. In some embodiments, the lipid nanoparticles described above contain cationic lipids, helper lipids, structural lipids, and polymer-lipids (e.g., PEG-lipids). In some embodiments, the lipid nanoparticles comprise the following amount (mole percent) of cationic lipids, based on the total amount of the cationic lipids, helper lipids, structural lipids, and polymer-lipids: 25%~75%. For example, 25%~28%, 28%~32%, 32%~35%, 35%~40%, 40%~42%, 42%~45%, 45%~46.3%, 46.3%~48%, 48%~49.5%, 49.5%~50%, 50%~55%, 55%~60%, 60%~65%, or 65%~75%. In some embodiments, the above lipid nanoparticles comprise the following amount (mole percent) of helper lipids, based on the total amount of the cationic lipids, helper lipids, structural lipids, and polymer-lipids (e.g., PEG-lipids): 5%~45%. For example, 5%~9%, 9%~9.4%, 9.4%~10%, 10%~10.5%, 10.5%~11%, 11%~15%, 15%~16%, 16%~18%, 18%~20%, 20%~25%, 25%~33.5%, 33.5%~37%, 37%~40%, 40%~42%, or 42%~45%. In some embodiments, the above lipid nanoparticles comprise the following amount (mole percent) of the structural lipids, based on the total amount of the cationic lipids, helper lipids, structural lipids, and polymer-lipids (e.g., PEG-lipid): 0%~50%. For example, 0%~10%, 10%~15.5%, 15.5%~18.5%, 18.5%~22.5%, 22.5%~23.5%, 23.5%~28.5%, 28.5%~33.5%, 33.5%~35%, 35%~36.5%, 36.5%~38%, 38%~38.5%, 38.5%~39%, 39%~39.5%, 39.5%~40.5%, 40.5%~41.5%, 41.5%~42.5%, 42.5%~42.7%, 42.7%~43%, 43%~43.5%, 43.5%~45%, 45%~46.5%, 46.5%~48.5%, or 46.5%~50%. In some embodiments, the lipid nanoparticles comprise the following amount (mole percent) of polymer-lipids, based on the total amount of the cationic lipids, helper lipids, structural lipids, and polymer-lipids (e.g., PEG-lipid): 0.5%~5%. For example, 0.5%~1%, 1%~1.5%, 1.5%~1.6%, 1.6%~2%, 2%~2.5%, 2.5%~3%, 3%~3.5%, 3.5%~4%, 4%~4.5%, or 4.5%~5%. In some embodiments as described above, the molar ratio of cationic lipids: helper lipids: structural lipids: PEG lipids in the lipid nanoparticles is 45:10:42.5:2.5, 45:11:41.5:2.5, 42:10.5:45:2.5, 42:16:39.5:2.5, 40:16:41.5:2.5, 40:18:39.5:2.5, 35:16:46.5:2.5, 35:25:36.5:3.5, 28:33.5:35:3.5, 32:37:40.5:0.5, 35:40:22.5:2.5, 40:42:15.5:2.5, 40:20:38.5:1.5, 45:15:38.5:1.5, 55:5:38.5:1.5, 60:5:33.5:1.5, 45:20:33.5:1.5, 50:20:28.5:1.5, 55:20:23.5:1.5, 60:20:18.5:1.5, 40:15:43.5:1.5, 50:15:33.5:1.5, 55:15:28.5:1.5, 60:15:23.5:1.5, 40:10:48.5:1.5, 45:10:43.5:1.5, 55:10:33.5:1.5, 40:5:53.5:1.5, 45:5:48.5:1.5, or 50:5:43.5:1.5. In some such embodiments, the helper lipid is DOPE and the structural lipid is CHO-HP. In other embodiments as described above, in the lipid nanoparticles, the molar ratio of cationic lipids: helper lipid: structural lipid: PEG lipids is about 50:10:38.5:1.5, 50:9:38:3, 49.5:10:39:1.5, 48:10:40.5:1.5, 46.3:9.4:42.7:1.6, 45:9:43:3, 45:11:41.5:2.5, 42:10.5:45:2.5, 42:16:39.5:2.5, 40:16:41.5:2.5, 40:18:39.5:2.5, 35:40:22.5:2.5, 40:20:38.5:1.5, 45:15:38.5:1.5, 55:5:38.5:1.5, 60:5:33.5:1.5, 45:20:33.5:1.5, 50:20:28.5:1.5, 55:20:23.5:1.5, 60:20:18.5:1.5, 40:15:43.5:1.5, 50:15:33.5:1.5, 55:15:28.5:1.5, 60:15:23.5:1.5, 40:10:48.5:1.5, 45:10:43.5:1.5, 55:10:33.5:1.5, 40:5:53.5:1.5, 45:5:48.5:1.5, or 50:5:43.5:1.5. In some embodiments, the non-lamellar lipid nanoparticles are selected from one of: alcoholic liposomes and echogenic liposomes. In some embodiments, the above delivery carrier is a liposome comprising the non-native nucleic acid (e.g., DNA or mRNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the host cell of any of the above embodiments. The liposome encapsulates the non-native nucleic acid (e.g., DNA or mRNA), genetic engineering vector or host cell of any of the above embodiments with a vesicle formed by a phospholipid bilayer membrane. In some embodiments, the composition of the liposome comprises a phospholipid and cholesterol. In some embodiments, the above delivery carrier is a cationic protein loaded with the nonnative nucleic acid (e.g., DNA or mRNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the host cell of any of the above embodiments. In some embodiments, the cationic protein includes, but is not limited to, protamine. In some embodiments, the above delivery carrier is a polymer comprising the non-native nucleic acid (e.g., DNA or mRNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments, or the host cell of any of the above embodiments. In some embodiments, the polymer is a lipopolyplex (LPP) and / or a hyaluronic acid polymer (e.g., a hyaluronic acid gel) comprising non-native nucleic acid (e.g., DNA or mRNA), genetic engineering vector or host cell of any of the above embodiments. In an optional specific example, the polymer is a lipopolyplex or a hyaluronic acid gel. A lipopolyplex is a bilayer structure with a polymer-encapsulated nucleic acid (e.g., mRNA) as the core and a lipid (e.g., phospholipid) encapsulated as the shell. It can be understood that the delivery carrier suitable for the present disclosure is not limited to the above, and may also be other substances capable of transporting non-native nucleic acid (e.g., DNA or mRNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments or the host cell of any of the above embodiments into an organism. For example, vesicles (e.g., exosomes) and the like. Moreover, the present disclosure provides a pharmaceutical composition comprising the nonnative nucleic acid (e.g., DNA or mRNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, or the delivery carrier of any of the above embodiments, and a pharmaceutically acceptable carrier. In some embodiments, the above pharmaceutical composition comprises a plurality of nonnative nucleic acids (e.g., DNA or mRNA) of any of the above embodiments, a plurality of genetic engineering vectors of any of the above embodiments, a plurality of host cells of any of the above embodiments, or a plurality of delivery carriers of any of the above embodiments. In some embodiments, the above pharmaceutical composition comprises a plurality of nonnative nucleic acids (e.g., DNA or mRNA) of any of the above embodiments, and the polypeptides or proteins encoded by the plurality of non-native nucleic acids are each different or partially identical. In some embodiments, the pharmaceutical composition comprises a plurality of delivery carriers, and polypeptides or proteins encoded by the non-native nucleic acids contained in the plurality of delivery carriers are each different or partially identical. The present disclosure also provides use of the non-native nucleic acid (e.g., DNA or mRNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, the delivery carrier of any of the above embodiments, or the pharmaceutical composition of any of the above embodiments in the preparation of a medicament. In some embodiments, the above medicament is used for the treatment and / or prevention of a disease. In some embodiments, the above medicament is used for gene therapy, gene vaccination, protein replacement therapy, antisense therapy or treatment by interfering RNA. In some embodiments, the above medicament is used to treat a disease corresponding to the above polypeptide or protein of interest. In some embodiments, the above medicament is used for the treatment and / or prevention of one or more of the following diseases: rare diseases, cancers, infectious diseases, autoimmune diseases, metabolic diseases, neurological diseases, cardiovascular diseases, transplant rejection, inflammation, genetic diseases and musculoskeletal diseases. In some embodiments, the rare diseases include one or more of Brittle Bone Disease, Wilson Disease, Spinal Muscular Atrophy (SMA), Huntingdon’s Disease, Rett Syndrome, Amyotrophic Lateral Sclerosis (ALS), Duchenne Type Muscular dystrophy, Friedrichs Ataxia, methylmalonic acidemia (MMA), Cystic Fibrosis (CF), glycogen storage disease 1a (GSD1a), glycogen storage disease 0 (GSD 0), Crigler-Najjar syndrome, ornithine transcarbamylase deficiency (OTCD), propionic acidemia (PA), phenylketonuria, (PKU), hemophilia A, hemophilia B, P-thalassemia, Lafora disease, Dravet syndrome (DS), Alexander disease, Leber's congenital amaurosis (LCA), Myelodysplastic Syndrome (MDS), and Homocystinuria due to CBS deficiency. In addition, the rare diseases in www.orpha.net / cursor / cgi-bin / Disease _ Search _ List.php and raredises.info.nih.gov / diseases are also incorporated herein. In some embodiments, the cancer comprises one or more of hematological malignancy, lung cancer, liver cancer, kidney cancer, head and neck cancer, esophageal cancer, gastric cancer, colorectal cancer, pancreatic cancer, brain cancer, prostate cancer, gallbladder cancer, ovarian cancer, breast cancer, cervical cancer, endometrial cancer, bladder cancer, and melanoma. In some embodiments, the infectious disease comprises a disease caused by the infection by one or more of viruses, fungi, and bacteria. In some embodiments, the autoimmune disease comprises one or more of acute idiopathic thrombocytopenic purpura, chronic idiopathic thrombocytopenic purpura, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, inflammatory bowel disease, multiple sclerosis, celiac disease, type 1 diabetes, and diffuse toxic thyroid adenoma. In some embodiments, the genetic disease comprises one or more of: hemophilia, thalassemia, and Gaucher Disease. In some embodiments, the neurological disease comprises one or more of amyotrophic lateral sclerosis, Alzheimer's disease, and glioma. In some embodiments, the above medicament is a vaccine. In some embodiments, the vaccine is a multivalent vaccine or a combination vaccine. In some embodiments, the above vaccine does not comprise an adjuvant. In other embodiments, the above vaccine further comprises an adjuvant. It can be understood that the dosage form of the vaccine is not particularly limited. In some embodiments, the above medicament is a nucleic acid medicament, wherein the nucleic acid includes one or more of RNA and DNA. In some embodiments, the DNA comprises one or more of: a plasmid and an antisense oligonucleotide. In some embodiments, the RNA comprises one or more of: antisense oligonucleotide, messenger RNA (mRNA), ribosomal RNA (rRNA), microRNA (miRNA), transfer RNA (tRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small hairpin RNA (shRNA), single guide RNA (sgRNA) and Cas9 mRNA. In some embodiments, the above vaccine is an mRNA vaccine. The present disclosure also provides a medicament comprising the non-native nucleic acid (e.g., DNA or RNA) of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, the delivery carrier of any of the above embodiments, or the pharmaceutical composition of any of the above embodiments. In some embodiments, the disease or condition prevented or treated by the medicament is described above. In addition, the present disclosure also provides a medicament prepared from the pharmaceutical composition of any of the above embodiments. In some embodiments, the disease or condition prevented or treated by the medicament is described above. V. Methods for Prevention or Treatment The present disclosure also provides a method for preventing or treating a disease, comprising the step of administering to a subject the non-native nucleic acid of any of the above embodiments, the genetic engineering vector of any of the above embodiments, the host cell of any of the above embodiments, the delivery carrier (e.g., lipid nanoparticles) of any of the above embodiments, the pharmaceutical composition of any of the above embodiments, or the medicament of any of the above embodiments. In some embodiments, the disease or condition to be prevented or treated is described above in the present disclosure. The present disclosure also provides a method of reducing or inhibiting the expression of a non-native nucleic acid in an undesired cell, tissue, and / or organ, comprising administering to a subject the non-native nucleic acid of the present disclosure encoding a polypeptide or protein of interest, wherein the non-native nucleic acid comprises one or more microRNA binding sites that bind to a microRNA expressed in the undesired cell, tissue, and / or organ. In some embodiments, the microRNA expressed in the undesired cell, tissue, and / or organ a microRNA that is expressed in high abundance or specifically expressed in the undesired cell, tissue, and / or organ. In some embodiments, the undesired cell is a normal hepatocyte, and the microRNA that is expressed in high abundance in the undesired cell is miR-122. In some embodiments, the above method can reduce or inhibit the expression of an undesired cytokine by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. The present disclosure also provides a method for treating or preventing liver disease, comprising administering to a subject the non-native nucleic acid of any one of the above embodiments, the non-native nucleic acid comprises one or more microRNA binding sites that bind to a microRNA expressed in high abundance or specifically expressed in normal hepatocytes and expressed in low abundance or not expressed in abnormal hepatocytes (e.g., liver cancer cells). In some embodiments, the microRNA expressed in high abundance or specifically expressed in normal hepatocytes and expressed or not expressed in low abundance in abnormal hepatocytes (e.g., liver cancer cells) is miR-122. In some embodiments, the liver disease is liver cancer. In some embodiments, the non-native nucleic acid further comprises a coding region for a polypeptide or protein for treating or preventing liver disease. In some embodiments, one or more miR-122 binding sites are located in the ploy(A) tail. In some embodiments, the above method can reduce or inhibit the expression of the non-native nucleic acid in liver by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. The present disclosure also provides a method of reducing or inhibiting the activation of undesired immune cell, comprising administering to a subject a non-native nucleic (e.g., mRNA or DNA) acid of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising the nonnative nucleic acid of the present disclosure, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell. In some embodiments, the method can reduce or inhibit the activation of undesired immune cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. In some embodiments, the activated undesired immune cell is a myeloid cell and / or lymphocyte. In some embodiments, the activated undesired myeloid cell is selected from one or more of dendritic cells, macrophages, monocytes, central granulocytes, basophils, eosinophils, megakaryocytes, and platelets. In some embodiments, the activated undesired immune cell is selected from one or more of T cells, B cells, plasma cells, and NK cells. In some embodiments, the activated undesired immune cell is a B cell. In some embodiments, the activated undesired immune cell is a B1a cell. The present disclosure also provides a method of reducing or inhibiting undesired cytokine production, comprising administering to a subject the non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising the non-native nucleic acid of the present disclosure, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell. In some embodiments, the undesired cytokine is a pro-inflammatory cytokine and / or a chemokine. In some embodiments, the undesired cytokine is one or more of: IL- 6, TNF-a, and INF-y. In some embodiments, the method can reduce or inhibit the production of undesirable cytokine by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites. The present disclosure also provides a method of reducing or inhibiting an anti-drug antibody (ADA) response in a subject that is repeatedly administered, comprising administering to the subject a non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier comprising the non-native nucleic acid (e.g., lipid nanoparticles) of the present disclosure, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell, such that the anti-drug antibody response in the subject is reduced or inhibited upon repeated administration. In some embodiments, the method of reducing or inhibiting an anti-drug antibody response in a subject that is repeatedly administered comprises: (1) administering to a subject a first dose of the non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising the non-native nucleic acid of the present disclosure, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell; and (2) administering a second dose of the non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising the non-native nucleic acid of the present disclosure, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell, thereby reducing or inhibiting an anti-drug antibody response in the subject caused by repeated administration of the non-native nucleic acid. In some embodiments, the present disclosure also provides a method of reducing or inhibiting the anti-drug antibody response in a subject that is repeatedly administered, comprising: (1) administering to a subject a first dose of the non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising the non-native nucleic acid of the present disclosure, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell; (2) detecting a level of an anti-drug antibody in the subject to which the non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising a non-native nucleic acid of the present disclosure has been administered; and (3) administering a second dose of the non-native nucleic acid (e.g., mRNA or DNA) of the present disclosure, a genetic engineering vector comprising the non-native nucleic acid of the present disclosure, or a delivery carrier (e.g., lipid nanoparticles) comprising the non-native nucleic acid of the present disclosure after the level of the anti-drug antibody is reduced, wherein the nonnative nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell to reduce or inhibit the anti-drug antibody response in the subject caused by repeated administration of the nonnative nucleic acid. In some embodiments, the above method can reduce or inhibit anti-drug antibody response by at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% as compared to a non-native nucleic acids that do not contain the microRNA binding sites. The present disclosure provides a method of reducing or inhibiting accelerated blood clearance (ABC) in a subject that is repeatedly administered, comprising administering to the subject the nonnative nucleic acid of the present disclosure encapsulated in lipid nanoparticles (LNPs), wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell, such that the accelerated blood clearance in the subject is reduced or inhibited upon repeated administration. In some embodiments, the method of reducing or inhibiting accelerated blood clearance in a subject that is repeatedly administered comprises: (1) administering to a subject a first dose of the non-native nucleic acid of the present disclosure encapsulated in lipid nanoparticles, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell; and (2) administering a second dose of the non-native nucleic acid of the present disclosure encapsulated in lipid nanoparticles, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell to reduce or inhibit accelerated blood clearance. In some embodiments, the lipid nanoparticles encapsulating the non-native nucleic acid of the present disclosure comprise a PEG-lipid. In some embodiments, the microRNA expressed in the immune cell in any one of the above embodiments is a microRNA expressed in high abundance or specifically expressed in immune cell. In some embodiments, the microRNA expressed in high abundance or specifically expressed in the immune cell in any of the above embodiments is miR-142. In some embodiments, the microRNA expressed in high abundance or specifically expressed in the immune cell in any of the above embodiments is miR-142-3p. In some embodiments, one or more miR-142 binding sites in any of the above embodiments are located in the ploy(A) tail. In some embodiments, one or more miR-142-3p binding sites in any of the above embodiments are located in the ploy(A) tail. The present disclosure provides a method of reducing or inhibiting the production of an IgM molecule binding to polyethylene glycol (PEG) in a subject that is repeatedly administered, comprising administering to the subject the non-native nucleic acid of the present disclosure encapsulated in lipid nanoparticles (LNPs), wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell, such that the production of an IgM molecule binding to polyethylene glycol (PEG) in the subject is reduced or inhibited upon repeated administration. In some embodiments, the lipid nanoparticles encapsulating the non-native nucleic acid comprise a PEG-lipid. The present disclosure provides a method of reducing or inhibiting the production of an IgG antibody (anti-PEG IgG antibody, anti -PEG IgG antibody) binding to polyethylene glycol (PEG) in a subject being repeatedly administered, comprising administering to the subject a non-native nucleic acid of the present disclosure encapsulated in lipid nanoparticles (LNP s), wherein the nonnative nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in immune cell, such that upon repeated administration, the production of the anti-PEG IgG antibody in the subject is reduced or inhibited. In some embodiments, the lipid nanoparticles encapsulating the non-native nucleic acid comprise a PEG-lipid. In some embodiments, the non-native nucleic acid administered in any of the above methods is mRNA. In some embodiments, the non-native nucleic acid administered in any of the above methods is DNA. In some embodiments, the genetic engineering vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector. In some embodiments, the microRNA bound by the one or more microRNA binding sites comprised in the non-native nucleic acid administered in any of the above methods comprises one or more of miR-142-3p, miR-142-5p, miR- 126, miR-146-3p, miR-146-5p and miR-155. In some embodiments, the microRNA to which the one or more microRNA binding sites comprised in the non-native nucleic acid administered in any of the above methods can bind comprises one or more of miR-142-3p, miR-142-5p and miR-126. In some embodiments, the microRNA to which the one or more microRNA binding sites comprised in the non-native nucleic acid administered in any of the above methods can bind is miR-142-3p. In some embodiments, the non-native nucleic acid administered in any of the above methods comprises 2-6 microRNA binding sites capable of binding to miR-142-3p. In some embodiments, the non-native nucleic acid administered in any of the above methods comprises three microRNA binding sites capable of binding to miR-142-3p. In some embodiments, the subject to be administered in any of the above methods is a mammal. For example, human, non-human primates (e.g., simians, chimpanzee, monkeys, and orangutan), etc. In an optional specific example, the subject is a human. In some embodiments, the frequency of administrations of any of the above methods is one, two, three, four, or more. In some embodiments, the time interval in any of the above methods upon a plurality of administrations is no more than 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week. In some embodiments, the administration in any of the above methods is an intranasal adiministration, intratracheal administration, or injection (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous). In some embodiments, the administration in any of the above methods is an intravenous injection or an intramuscular injection. Examples To make the objectives and technical solutions of the present disclosure clearer, they are described in details below in view of the particular Examples. Apparently, the described Examples are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by a person of ordinary skill in the art based on the Examples in the present invention without creative efforts shall fall within the protection scope of the present invention. Unless otherwise specified, the reagents and instruments used in the Examples are all conventional choices in the art. The experimental methods without specific conditions in the Examples are implemented according to conventional conditions, such as the conditions described in references and books, or the methods recommended by manufacturers. Example 1. Construction of Template Plasmid for the Preparation of mRNA According to Table 1, the 5‘-UTR, the nucleotide sequence encoding luciferase (Fluc), the 3‘-UTR and ploy(A) tail of each mRNA were introduced into the pCDNA3.0-Kana plasmid (GENEWIZ INC., Suzhou) by subcloning technology (e.g., subcloning technology based on PCR technology and restriction endonuclease digestion or In-fusion technology), thereby constructing plasmids corresponding to different mRNAs encoding Fluc. The mRNAs designated as 437-Fluc, 439-Fluc, 440-Fluc, 443-Fluc, 444-Fluc and 445-Fluc in Table 1 all contained microRNA binding sites and the microRNA binding sites were located in the ploy(A) tail only. At the same time, plasmids corresponding to the mRNA designated as C-Fluc was also prepared as a control. The mRNA designated as C-Fluc encodes luciferase but did not contain a microRNA binding site, the DNA sequence corresponding to 5‘-UTR is set forth in SEQ ID NO: 4, the DNA sequence corresponding to 3‘-UTR is set forth in SEQ ID NO: 3, and the DNA sequence corresponding to ploy(A) tail is set forth in SEQ ID NO: 6. Table 1 mRNA designation DNA sequence corresponding to 5’-UTR DNA sequence corresponding to 3’-UTR DNA sequence corresponding to the poly(A) tail containing microRNA binding sites microRNA bound by the microRNA binding sites 437-Fluc SEQ ID NO: 4 SEQ ID NO: 3 AAAAAAAAAAAAAAATCCATAAA GTAGGAAACACTACAGCTGTCCAT AAAGTAGGAAACACTACAGCTGT CCATAAAGTAGGAAACACTACAA AAAAAAAAAAAGAAAAAAAAAA AAAAAAAAGAAAGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA (SEQ ID NO: 7) miR-142-3p 439-Fluc SEQ ID NO: 4 SEQ ID NO: 3 AAAAAAAAAAAAAAAAAAATCCA TAAAGTAGGAAACACTACAGCTG TCCATAAAGTAGGAAACACTACA GCTGTCCATAAAGTAGGAAACACT ACAAAAAAAAAGAAAAAAAAAA AAAAAAAAGAAAGAAAAAAAAA miR-142-3p AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA (SEQ ID NO: 8) 440-Fluc SEQ ID NO: 4 SEQ ID NO: 3 AAAAAAAAAAAAAAATCCATAAA GTAGGAAACACTACAGCTGTCCAT AAAGTAGGAAACACTACAAAAAA AAAAAAAGAAAAAAAAAAAAAA AAAAGAAAGAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA (SEQ ID NO: 9) miR-142-3p 443-Fluc SEQ ID NO: 4 SEQ ID NO: 3 AAATCCATAAAGTAGGAAACACT Acaaaaaaaaaaaaaaaaaaaa AAAAAGAAAAAAAAAAAAAAAA AAGAAAGAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA (SEQ ID NO: 10) miR-142-3p 445-Fluc SEQ ID NO: 4 SEQ ID NO: 3 AAAAAAAAAAAAAAATCCATAAA GTAGGAAACACTACAAAAATCCA TAAAGTAGGAAACACTACAAAAA TCCATAAAGTAGGAAACACTACA AAAAGAAAAAAAAAAAAAAAAA AGAAAGAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA (SEQ ID NO: 11) miR-142-3p 444-Fluc SEQ ID NO: 4 SEQ ID NO: 3 AAAAAAAAAAAAAAACAAACACC ATTGTCACACTCCAGCTGCAAACA CCATTGTCACACTCCAGCTGCAAA CACCATTGTCACACTCCAAAAAAA AAAAAAGAAAAAAAAAAAAAAA AAAGAAAGAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAA (SEQ ID NO: 12) miR-122 The microRNA binding sites were underlined in Table 1. Example 2. Preparation of mRNA Sample 1. The plasmid prepared in Example 1 was taken, ensure that the superhelix rate of the plasmid was 85% or more. 2. The plasmid was digested for linearization, and then purified using a DNA fragment purification and recovery kit (Takara, 9761) and DNA magnetic beads (Remibecy, SP703) (removing RNase, proteins, etc.). 3. The linearized plasmid of step 2 was transcribed in vitro with an IVT reaction. 4. The product of in vitro transcription was purified using the Hieff NGS ® RNA Cleaner kit (YEASEN, 12602 ES56). 5. The purified product of in vitro transcription was subjected to a Cap1 type capping reaction using a Cellscript (C-ASF3507) kit. 6. The product of the above capping reaction was purified by using the Hieff NGS®RNA Cleaner kit (YEASEN, 12602 ES56) to obtain different mRNAs encoding Fluc, which contained Cap1 type cap structure, a 5‘-UTR, a 3‘-UTR, a ploy(A) tail and microRNA binding sites, and all of the uridines was replaced by N1-methylpseudouridine, and the mRNAs encoding Fluc, which contained Cap1 type cap structure, 5‘-UTR, a 3‘-UTR and a ploy(A) tail without microRNA binding sites and all of the uridines were replaced by N1-methylpseudouridine. Example 3. Preparation of Lipid Nanoparticles Encapsulating the Luciferase-Encoding mRNA (Fluc mRNA) (1) Encapsulation: The mRNAs prepared in Example 2 were encapsulating a microfluidic device and a microfluidic chip (SN. 000038) to prepare a crude product of lipid nanoparticles encapsulating the corresponding mRNAs. The aqueous phase was acetic acid-sodium acetate buffer (pH5.0) containing the corresponding mRNA, the alcohol phase contained cationic lipid compound 2-5, DSPC, cholesterol, DMG- PEG2000 and ethanol, and the molar ratio of compound 2-5, DSPC, cholesterol and DMG- PEG2000 was 48:10:40.5:1.5. (2) Solution Exchange by Dialysis: a. 2 packets of 1xPBS prefabricated powder were taken into a beaker, dissolved and mixed with a small amount of DEPC water, 160g of sucrose was continuously added, water was added to a constant volume of 2 L, and blended to obtain a 1xPBS+8% (m / V) sucrose solution as a dialysis solution. b. Dialysis: the encapsulated crude product was loaded into a dialysis bag, immersed in a beaker containing 1L of dialysis solution, respectively, the beaker was wrapped with aluminum foil paper and the dialysis was performed at 100 rpm for 1 h at room temperature, then, the dialysis was continued for 1 h after replacing the dialysis solution. c. sterilizing and filtering the dialyzed sample with a 0.22 pm PES filter membrane to obtain lipid nanoparticles encapsulating corresponding mRNA. Upon testing, the lipid nanoparticles had a particle size ranging from 80 nm to 100 nm and an encapsulation rate of 80% or more. Example 4. Detection of the Expression Level of Luciferase (Fluc) in Mice Female BALB / c mice aged 6-8 weeks were administered by tail vein injection (IV), each mouse was injected with 10pg of corresponding lipid nanoparticles encapsulating luciferaseencoding mRNA (Fluc mRNA) prepared in Example 3, and each lipid nanoparticle was injected into 3 mice. After 6h, 200pL of D-Luciferin luciferase developing substrate (catalog number: 122799; manufacturer: Perkin Elmer) was injected into the mice, after the injection of the substrate, the mice were anesthetized by isoflurane inhalation anesthesia, after the injection of the substrate for 10 min, the animals were placed in supine position, and the signal distribution and intensity of luciferase in the mice and in various organs were observed under the in vivo imaging system (IVIS). The results were shown in FIG. 1A-FIG. 1C. As compared to the mice administered with the control mRNA without the microRNA binding sites (i.e., Fluc mRNA designated C-Fluc), the total flux of Fluc in the liver of the mice administered with the Fluc mRNA with the miR-142-3p binding sites added in the ploy(A) tail was not changed significantly, and the total flux of Fluc in the spleen was decreased significantly. miR-142-3p is a microRNA expressed in high abundance in immune cell (immune organ), and the above data showed that the addition of miR-142-3p binding sites in the ploy(A) tail of mRNA can significantly reduce its expression in an immune organ (such as spleen). As compared to the mice administered with the control mRNA without the microRNA binding site (i.e., Fluc mRNA designated as C-Fluc), the total Flux of Fluc in the spleen of the mice administered with the Fluc mRNA with the miR-122 binding site added in the ploy(A) tail was not changed significantly, and the total Flux of Fluc in the liver was decreased significantly. miR-122 is a microRNA expressed in high abundance in hepatocyte, and the above data showed that the addition of miR-122 binding site in the ploy(A) tail of mRNA can significantly reduce its expression in liver. Example 5. Detection of Expression Level of Human Erythropoietin (hEPO) in Rat Serum after Multiple Administration 1. Preparation of Lipid Nanoparticles encapsulating mRNA Encoding hEPO (hEPO mRNA) Plasmids corresponding to different mRNAs encoding hEPO were constructed with reference to Example 1, wherein the nucleotide sequence encoding the luciferase (Fluc) was replaced with the nucleotide sequence encoding hEPO, and the corresponding mRNAs were designated as C-hEPO, 437-hEPO, 439-hEPO, 440-hEPO, 443-hEPO, 444-hEPO and 445-hEPO. Lipid nanoparticles encapsulating different mRNAs encoding hEPO (hEPO mRNA) were further prepared with reference to Examples 2-3. 2. Serum Acquisition: Female SD rats of about 180g were administered by tail vein injection of (IV), each rat was injected with the corresponding lipid nanoparticles encapsulating the mRNAs encoding hEPO prepared in step 1 of this Example at an mRNA dose of 1 mg / kg, and each lipid nanoparticle was injected to 3 rats, and was administered once a week for multiple consecutive doses. Whole blood was collected from the rats and the serum was obtained 6h and 120 h after each injection of lipid nanoparticles. 3. The concentration of hEPO in serum in rats 6h after administration was detected by enzyme-linked immunosorbent assay (ELISA), in which the coated antibody was recombinant Anti-EPO antibody (Cat. No.: ab272358 manufacturer: Abcam). The results are shown in FIG. 2. After the third administration, the hEPO expression level in the serum of the rat administered with the control mRNA without the microRNA binding site (i.e., hEPO mRNA designated as C-hEPO) was decreased significantly, and the hEPO expression level in the serum of the rat administered with the mRNA with the miR-142-3p binding sites added in the ploy(A) tail was still high, indicating that no obvious ADA phenomenon occurred in the mRNA with the miR-142-3p binding sites added in the ploy(A) tail. Rats without significant ADA after the third administration were subjected continued administration, and it was found that they maintained high expression after the sixth administration, indicating that the expression level of mRNA with miR-142-3p binding sites added in the ploy(A) tail was not decreased significantly with the increase of the number of administrations, and the addition of miR-142-3p binding site in the ploy(A) tail of mRNA could significantly reduce ADA. Example 6. Detection of Anti-PEG IgG Antibody Level in Serum of Rats after Multiple Administrations The titer of anti-PEG IgG antibody in the serum of rats obtained 120h after the administration in Example 5 was detected by ELISA, in which the coated antigen was DMG- PEG2000. The results are shown in FIG. 3. After the first and second administrations, the titers of antiPEG IgG antibodies in the control group and the experimental groups were at a low level. After the third administration, the titer of anti-PEG IgG antibody in the serum of rats administered with control mRNA without microRNA binding site (i.e., hEPO mRNA designated as C-hEPO) was significantly increased, while the titer of anti-PEG IgG antibody in the serum of rats administered with mRNAs with miR-142-3p binding sites added in the ploy(A) tail was still maintained at a low level, indicating that the addition of miR-142-3p binding sites in the ploy(A) tail of mRNAs could significantly reduce the anti-PEG IgG antibody in rats, thereby reducing the ABC phenomenon mediated by anti-PEG antibody. Sequences: SEQ ID NO: 1 TCCATAAAGTAGGAAACACTACA SEQ ID NO:2 ACCAGCCTTGGGAAATTACAATGTTTTACAATAAACAGAAAGCCAAGCGG SEQ ID NO:3 TCTTCACCCAGTCTGTCTCTTAGAATTTATTTCCCACTGACACAAACAAGCCATTT TGTCTGCTTGTATAACCC SEQ ID NO:4 ATACATAGTTTACTTTCATTTTTGACTCTGAGGCTCTTTCCAACGCTGTAAAAAAG GACAGAGGCTGTTCCCT SEQ ID NO:5 ACACTACACACTACACACTAC SEQ ID NO:6 AAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAGAAAG AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA SEQ ID NO:13 CAAACACCATTGTCACACTCCA
Claims
1. A non-native nucleic acid comprising a 3‘-UTR and one or more microRNA binding sites located downstream of the 3'-UTR.
2. The non-native nucleic acid of claim 1, further comprising a ploy(A) tail, wherein the ploy(A) tail is located downstream of the 3'-UTR, and the one or more microRNA binding sites are located at one of the following positions:(1) after the 3'-UTR and before the poly(A) tail;(2) in the poly(A) tail; and(3) after the 3'-UTR and before the poly(A) tail, and in the poly(A) tail.
3. The non-native nucleic acid of claim 1 or 2, wherein the microRNA binding sites located in the poly(A) tail is at the 5' end, between the 5' end and the 3' end, and / or at the 3' end of the poly(A) tail.
4. The non-native nucleic acid of any one of claims 1-3, wherein the microRNA binding sites are the same.
5. The non-native nucleic acid of any one of claims 1-4, wherein the microRNA binding sites are different, and the microRNA binding sites bind to the same microRNA or different microRNAs.
6. The non-native nucleic acid of claim 5, wherein the different microRNAs are from the same cell, tissue and / or organ, or the different microRNAs are from different cells, tissues and / or organs.
7. The non-native nucleic acid of any one of claims 1-6, wherein the one or more microRNA binding sites are capable of binding to a microRNA expressed in a target cell, target tissue, and / or target organ to reduce or inhibit the expression of the nonnative nucleic acid in the target cell, target tissue, and / or target organ.
8. The non-native nucleic acid of claim 7, wherein the target cell, target tissue, and / or target organ comprises one or more of an immune cell, liver, lung, heart, nervous system, pancreas, kidney, muscle, an endothelial cell, an epithelial cell, a embryonic stem cell, and an abnormal cell;preferably, the target cell is an immune cell.
9. The non-native nucleic acid of any one of claims 1-8, wherein the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-122, miR-126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27;preferably, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p, miR-126, miR-146-3p, miR-146-5p and miR-155;preferably, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p and miR-126.
10. The non-native nucleic acid of any one of claims 1-9, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p, miR-142-5p, miR-126 or miR-122;preferably, the microRNA to which the one or more microRNA binding sites can bind is miR-142-3p.
11. The non-native nucleic acid of any one of claims 1-10, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p and one or more of: miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.
12. The non-native nucleic acid of any one of claims 1-10, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-5p and one or more of: miR-142-3p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.
13. The non-native nucleic acid of any one of claims 1-10, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-126 and one or more of: miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27.
14. The non-native nucleic acid of any one of claims 1-10, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-122 and one or more of: miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.
15. The non-native nucleic acid of any one of claims 1-14, comprising 1, 2, 3 or 4 microRNA binding sites.
16. The non-native nucleic acid of any one of claims 1-15, wherein there is a spacer sequence between the microRNA binding sites.
17. The non-native nucleic acid of any one of claims 1-16, further comprising one or more of: 5‘-UTR and a coding region encoding a polypeptide or protein of interest;preferably, the non-native nucleic acid further comprises a coding region encoding a polypeptide or protein of interest;preferably, the non-native nucleic acid further comprises a 5‘-UTR and a coding region encoding a polypeptide or protein of interest.
18. The non-native nucleic acid of claim 17, wherein the 3‘-UTR is heterologous to the coding region encoding the polypeptide or protein of interest.
19. The non-native nucleic acid of claim 17, wherein the 5‘-UTR is heterologous to the coding region encoding the polypeptide or protein of interest.preferably, both the 5‘-UTR and the 3‘-UTR are heterologous to the coding region encoding the polypeptide or protein of interest.
20. The non-native nucleic acid of any one of claims 2-19, wherein the nucleotides constituting the ploy(A) tail comprise at least 20, at least 40, at least 80, at least 100 or at least 120 A nucleotides;preferably, the nucleotides constituting the poly(A) tail comprise at least 20, at least 40, at least 80, at least 100, or at least 120 continuous A nucleotides.preferably, the nucleotides constituting the poly(A) tail comprise one or more nucleotides other than A nucleotide.
21. The non-native nucleic acid of any one of claims 1-20, further comprising at least one microRNA binding site located in the 3'-UTR and / or in the 5‘-UTR.
22. The non-native nucleic acid of any one of claims 1-21, wherein the non-native nucleic acid is mRNA;preferably, the nucleotide sequence of the DNA corresponding to the 3'-UTR is setforth in SEQ ID NO: 2 or 3;preferably, the nucleotide sequence of the DNA corresponding to the 5‘-UTR is set forth in SEQ ID NO: 4.
23. The non-native nucleic acid of claim 22, wherein the nucleotide sequence of the DNA corresponding to the microRNA binding site is set forth in ACACTAC, SEQ ID NO: 1 or 13.
24. The non-native nucleic acid of any one of claims 1-23, wherein the non-native nucleic acid is mRNA, and the mRNA comprises a cap structure;preferably, the cap structure is selected from at least one of m7GpppG, m27,3'' OGpppG, m7Gppp(5')N1 and m7Gppp(m2'"O)N1.
25. The non-native nucleic acid of any one of claims 22-24, containing a modified nucleotide;preferably, the non-native nucleic acid contains a modified nucleoside;preferably, the modified nucleoside comprises at least one of a modified uridine, a modified cytidine, a modified adenosine, and a modified guanosine.preferably, 100% of the uridines in the non-native nucleic acid are modified.
26. The non-native nucleic acid of any one of claims 1-21, wherein the non-native nucleic acid is DNA27. A genetic engineering vector, comprising the non-native nucleic acid of any one of claims 1-26, or the genetic engineering vector comprises a polynucleotide capable of being transcribed into the non-native nucleic acid of any one of claims 1-26.
28. A host cell comprising the genetic engineering vector of claim 27.
29. A delivery carrier comprising the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, or the host cell of claim 28.
30. The delivery carrier of claim 29, wherein the delivery carrier is a lipid nanoparticle (LNP), a cationic liposome, a cationic protein or a lipopolyplex.
31. A pharmaceutical composition comprising the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, the host cell of claim 28, or the delivery carrier of any one of claims 29-30, and a pharmaceutically acceptable carrier.
32. The pharmaceutical composition of claim 31, comprising a plurality of said delivery carrier;or the pharmaceutical composition comprises a plurality of said mRNAs.
33. Use of the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, the host cell of claim 28, the delivery carrier of any one of claims 29-30, or the pharmaceutical composition of claim 31 or 32 in the preparation of a medicament;preferably, the medicament is used for gene therapy, gene vaccination, protein replacement therapy, antisense therapy or treatment by interfering RNA;preferably, the medicament is used for the treatment and / or prevention of a disease;preferably, the medicament is used for the treatment and / or prevention of one or more of the following diseases: rare diseases, cancers, infectious diseases, autoimmune diseases, metabolic diseases, neurological diseases, cardiovascular diseases, transplant rejection, inflammation, genetic diseases and musculoskeletal diseases;preferably, the medicament is a nucleic acid medicament, wherein the nucleic acid comprises one or more of RNA and DNA;preferably, the DNA comprises one or more of: a plasmid and an antisense oligonucleotide;preferably, the RNA comprises one or more of: antisense oligonucleotide, messenger RNA, ribosomal RNA, microRNA, transfer RNA, small interfering RNA, small nuclear RNA, small hairpin RNA, single guide RNA and Cas9 mRNA.
34. A method for preventing or treating a disease, comprising administering to a subject the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, the host cell of claim 28, the delivery carrier of any one of claims 29-30, or the pharmaceutical composition of claim 31 or 32.
35. A method of reducing or inhibiting the expression of a non-native nucleic acid in an undesired cell, tissue and / or organ, comprising administering to a subject the nonnative nucleic acid of any one of claims 1-26, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in the undesired cell, tissue and / or organ.
36. The method of reducing or inhibiting the expression of non-native nucleic acids in an undesired cell, tissue and / or organ of claim 35, wherein the undesired cell is an immune cell.
37. A method of reducing or inhibiting the activation of undesired immune cell, comprising administering to a subject the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, or the delivery carrier of any one of claims 29-30, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in the immune cell.
38. The method of reducing or inhibiting the activation of undesired immune cell of claim 37, wherein the method can reduce or inhibit the activation of undesired immune cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a nonnative nucleic acid that does not contain the microRNA binding sites.
39. The method of reducing or inhibiting the activation of undesired immune cell of claim 37 or 38, wherein the activated undesired immune cell is selected from one or more of: T cells, B cells, plasma cells and NK cells.
40. A method of reducing or inhibiting the production of undesired cytokine, comprising administering to a subject the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, or the delivery carrier of any one of claims 29-30, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell.
41. The method of reducing or inhibiting the production of undesired cytokine of claim 40, wherein the method can reduce or inhibit the production of undesired cytokine by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, atleast 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% as compared to a non-native nucleic acid that does not contain the microRNA binding sites.
42. A method of reducing or inhibiting an anti-drug antibody response in a subject that is repeatedly administered, comprising administering to the subject the non-native nucleic acid of any one of claims 1-26, the genetic engineering vector of claim 27, or the delivery carrier of any one of claims 29-30, wherein the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell, such that the anti-drug antibody response in the subject is reduced or inhibited upon repeated administration.
43. A method of reducing or inhibiting accelerated blood clearance in a subject that is repeatedly administered, comprising administering to the subject the non-native nucleic acid of any one of claims 1-26, wherein the non-native nucleic acid is encapsulated in a lipid nanoparticle, the non-native nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to a microRNA expressed in an immune cell, such that accelerated blood clearance in the subject is reduced or inhibited upon repeated administration.
44. A method of reducing or inhibiting the production of polyethylene glycol-binding IgM molecule in a subject that is repeatedly administered, comprising administering to the subject the non-native nucleic acid of any one of claims 1-26, wherein the non-native nucleic acid is encapsulated in a lipid nanoparticle, and the nonnative nucleic acid encodes a polypeptide or protein of interest and comprises one or more microRNA binding sites capable of binding to microRNAs expressed in an immune cell, such that the production of polyethylene glycol-binding IgM molecule in the subject is reduced or inhibited upon repeated administration.
45. The method of claim 43 or 44, wherein the lipid nanoparticle encapsulating the non-native nucleic acid comprises a PEG-lipid.
46. The method of any one of claims 34-45, wherein the non-native nucleic acid is mRNA.
47. The method of any one of claims 34-45, wherein the non-native nucleic acid is DNA.
48. The method of any one of claims 34, 37-42 and 47, wherein the genetic engineering vector is a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.
49. The method of any one of claims 34-48, wherein the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-122, miR-126, miR-142-3p, miR-142-5p, miR-144, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27;preferably, the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p, miR-126, miR-146-3p, miR-146-5p and miR-155.
50. The method according to claim 49, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p, miR-142-5p, miR-126 or miR-122.
51. The method of claim 49 or 50, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-3p and one or more of: miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.
52. The method of claim 49 or 50, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-142-5p and one or more of: miR-142-3p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.
53. The method of claim 49 or 50, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-126 and one or more of: miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27.
54. The method of claim 49 or 50, wherein the microRNA to which the one or more microRNA binding sites can bind comprises miR-122 and one or more of: miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-126, miR-16, miR-21, miR-223, miR-24 and miR-27.
55. The method of claim 49 or 50, wherein the microRNA to which the one or more microRNA binding sites can bind comprises one or more of: miR-142-3p, miR-142-5p and miR-126.
56. The method of claim 49, 50 or 55, wherein the microRNA to which the one or more microRNA binding sites can bind is miR-142-3p.
57. The method of any one of claims 49, 50 and 55-56, wherein the non-native nucleic acid comprises 2-6 microRNA binding sites capable of binding to miR-142-3p;preferably, the non-native nucleic acid comprises three microRNA binding sites capable of binding to miR-142-3p.
58. The method according to any one of claims 34-57, wherein the subject is a mammal; preferably, the mammal is a human.
59. The method of any one of claims 34-58, wherein the frequency of administrations is one, two, three, four or more.
60. The method of any one of claims 34-59, wherein the time interval of administration is no more than 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week.
61. The method of any one of claims 34-60, wherein the administration is intravenous injection or intramuscular injection.