Compositions and methods for treating cogntive decline and / or memory deficits
Patent Information
- Application Number
- AU2025224800
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-02
- Filing Date
- 2025-02-20
- Publication Date
- 2026-09-03
AI Technical Summary
Current treatments for Alzheimer's disease (AD) are inadequate due to a lack of understanding of the molecular and cellular mechanisms of Purkinje neurons, which are critical for fear conditioning and associative memory, and no therapeutics have been developed to manipulate this pathway, leading to cognitive decline and memory deficits.
Elevating asprosin concentrations to outcompete Aβ for Ptprd binding, restoring receptor activity and normalizing downstream signaling pathways, and using agents that increase Ptprd activity or decrease Aβ-induced inhibition of Ptprd activity to treat cognitive decline, memory deficits, Aβ-mediated neurological pathogenesis, and AD.
Asprosin supplementation rescues fear-conditioned and associative memory deficits in AD mouse models by restoring Ptprd activity, offering a therapeutic approach for cognitive decline and AD.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
PATENT COMPOSITIONS AND METHODS FOR TREATING COGNITIVE DECLINE AND / OR MEMORY DEFICITS RELATED APPLICATION
[0001] This application claims priority from U.S. Provisional Application Nos.63 / 555,680, filed February 20, 2024 and 63 / 702,370, filed October 2, 2024, the subject matter of which are incorporated herein by reference in their entirety. SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on February 18, 2024, is named UH-033258WO ORD.st.26 and is 30,354 bytes in size. BACKGROUND
[0003] Alzheimer’s Disease (AD) is a devastating and ultimately fatal disease. Therefore, the elucidation and the identification of novel memory pathways and potential therapeutic targets are of paramount importance in combating this neurodegenerative disorder. Despite extensive research efforts, effective treatments for AD remain elusive, emphasizing the need for a deeper understanding of the underlying molecular mechanisms and the identification of new therapeutic strategies.
[0004] The cerebellum can integrate information from thousands of stimuli through the Purkinje neurons. These specialized neurons are critical to the function of the cerebellum and serve as the primary output neurons of the cerebellar cortex, relaying processed information to other part of the brain. Purkinje neurons specifically are known to play an integral role in the formation of fear conditioned, associative memory. However, the molecular and cellular mechanisms of how Purkinje neurons modulate the associative fear memory network are largely unknown. Furthermore, fear conditioning is a form of classical conditioning that is evolutionarily needed to assess and evolve against threats. This type of associative memory is one of the first types of memories lost in Alzheimer’s disease. However, because there has yet to be a target identified that mediates the mechanism of fear conditioning through Purkinje neurons, no therapeutics have yet been developed to manipulate this pathway.SUMMARY
[0005] Embodiments described herein relate to compositions and methods of treating and / or preventing one or more of cognitive decline and / or memory deficits, amyloid β (Aβ) mediated neurological pathogenesis, cachexia, and Alzheimer's disease (AD) in a subject in need thereof.
[0006] We identified that membrane bound receptor protein tyrosine phosphatase delta (Ptprd) is a central nervous system (CNS) receptor for asprosin, a fasting-induced protein hormone. In mice, Purkinje neuron-specific genetic ablation of Ptprd leads to a deficit in fear-conditioned memory similar to that caused by AD. It has been shown that AD damages Purkinje neurons, and we have shown that this damage results in a decrease in Ptprd activity.
[0007] We found that while plasma and cerebrospinal fluid (CSF) asprosin levels are unchanged in AD, the pathological accumulation of Aβ interferes with asprosin-Ptprd signaling by binding to Ptprd and inhibiting its activity. This suggests that normal asprosin levels are insufficient to activate Ptprd in the presence of Aβ. Remarkably, plasma asprosin supplementation was sufficient to fully recover associative memory deficits in two independent AD mouse models. Additionally, using AD mouse models, we demonstrated that asprosin gain-of-function through a viral vector is able to fully rescue fear-conditioned memory deficits or associative memory deficits as well as novel object recognition memory deficits.
[0008] Our findings demonstrate that elevating asprosin concentrations can outcompete Aβ for Ptprd binding, restoring receptor activity and normalizing downstream signaling pathways. Therefore, the therapeutic benefit of asprosin supplementation in AD arises not from correcting an asprosin deficiency but from overcoming Aβ-mediated inhibition of Ptprd, and an agent, such as asprosin, that increases or promotes Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity can be used for treating and / or preventing one or more of cognitive decline and / or memory deficits, Aβ mediated neurological pathogenesis, cachexia, and AD in a subject in need thereof.
[0009] We further found that the obesity-associated cytokine Tgf-β1 activates Fbn1 transcription in adipocytes, driving overproduction asprosin. Remarkably, a single exposure to elevated Tgf-β1 reshapes chromatin at the Fbn1 locus, cementing its overexpression in a manner that is unrelenting, even after normalization of Tgf-β1 levels. The relentingoverexpression of Fbn1 even after Tgf-β1 normalization results in an enduring plasma asprosin elevation that can potentially treat and / or prevent one or more of cognitive decline and / or memory deficits, Aβ mediated neurological pathogenesis, cachexia, and AD in a subject in need thereof.
[0010] Accordingly, in some embodiments, a method of treating and / or preventing cognitive decline and / or memory deficits in a subject in need thereof can include administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject. The memory deficits treated can include, for example, associative memory deficits and novel object recognition memory deficits.
[0011] Other embodiments relate to a method of treating Aβ mediated neurological pathogenesis in a subject in need thereof. The method can include administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject.
[0012] Other embodiments relate to a method of treating cachexia in a subject in need thereof. The method can include administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject.
[0013] In some embodiments, the subject treated for cachexia has or is at increased risk of AD, cognition deficiency disorder, age-associated memory impairment, or dementia.
[0014] Still other embodiments relate to a method of treating AD in a subject in need thereof. The method can include administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject.
[0015] In some embodiments, the agent can increase Ptprd dephosphorylation of signal transducer and activator of transcription 3 (STAT3) and / or decrease Aβ induced STAT3 transcriptional activity in the cerebellum and, particularly, Purkinje neurons of the subject.
[0016] In some embodiments, the agent can include a Ptprd agonist and / or promote expression of a Ptprd agonist in the subject.
[0017] In some embodiments, the agent can be administered systemically to the subject.
[0018] In some embodiments, the agent comprises asprosin and / or an analogue thereof and / or can increase or promote expression of asprosin and / or an analogue thereof.
[0019] In some embodiments, the agent can be administered at an amount effective to increase plasma levels of asprosin and / or an analogue thereof in the subject.
[0020] In some embodiments, the asprosin and / or analogue thereof can be administered by expressing the asprosin and / or analogue thereof in a cell or tissue of the subject.
[0021] In some embodiments, the asprosin and / or analogue is expressed with a secretory peptide that promotes secretion of the asprosin and / or analogue thereof from the cell or tissue.
[0022] In some embodiments, the asprosin and / or analogue thereof and secretory peptide are expressed in the cell or tissue using a viral and / or non-viral vector.
[0023] In some embodiments, the vector includes an expression cassette that includes a polynucleotide encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence and a polyadenylation (poly(A)) tail signal.
[0024] In some embodiments, the regulatory elements include elongation factor-1 (EF- 1) promoter or cytomegalovirus (CMV) promoter.
[0025] In some embodiments, the regulatory elements can further include a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
[0026] In some embodiments, the poly(A) tail signal includes a simian virus 40 (SV40) poly(A) tail signal.
[0027] In some embodiments, the expression cassette can further include a polynucleotide encoding an interleukin-2 (IL2) peptide.
[0028] In some embodiments, the vector includes an EF-1 promoter, a polynucleotide encoding IL2, a polynucleotide encoding asprosin or an analogue thereof, WPRE, and SV40poly(A).
[0029] In some embodiments, the vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.
[0030] In some embodiments, the adeno-associated viral vector can include at least one of AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S,AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV-RPF2, or AAV3b.
[0031] In some embodiments, the vector can include a polynucleotide having a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 1.
[0032] In some embodiments, the vector can be administered to the subject by at least one of cutaneous, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, intravenous, intracoronary, intramyocardial, or intra-arterial administration.
[0033] In other embodiments, the agent can include recombinant asprosin and / or an analogue thereof that is systemically administered to the subject.
[0034] In still other embodiments, the agent can include TGF-β1 and / or an analogue thereof that is administered to the subject at amount effective to promote expression and / or increase plasma levels of asprosin and / or the analogue thereof in the subject.
[0035] Other embodiments described herein relate to a vector for expressing asprosin and / or an analogue thereof in a subject and, particularly, an adeno-associated viral (AAV) vector for expressing asprosin and / or an analogue thereof in a subject. The vector can include an expression cassette that includes a polynucleotide encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence and a polyadenylation (poly(A)) tail signal.
[0036] The vector can be used for treating cognitive decline and / or memory deficits, such as associative and novel object recognition memory deficits, Aβ mediated neurological pathologies, cachexia, and / or Alzheimer’s disease in a subject in need thereof.
[0037] In some embodiments, the subject has or is at increased risk of Alzheimer’s disease, cognition deficiency disorder, age-associated memory impairment, or dementia. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Fig.1 illustrates a map of the plasmid AV0-BWS-IL2-His-Asp, which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising an EF-1promoter (SEQ ID NO: 4), a nucleic acid encoding IL-2 signal peptide (SEQ ID NO: 3), a nucleic acid encoding asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises an ampicillin resistance gene (AmpR) promoter.
[0039] Fig.2 provides the double stranded nucleotide of the plasmid AV0-BWS-IL2- His-Asp (SEQ ID NO:1) of Fig.1, which includes a nucleic acid encoding IL-2 signal peptide (SEQ ID NO: 3), and a nucleic acid encoding asprosin (SEQ ID NO: 2).
[0040] Figs.3(A-I) illustrate Purkinje neuron-specific Ptprd is necessary for mammalian associative memory. (A) Schematic representation of the cued and contextual fear conditioning assay. (B) Fear acquisition on Day 1 in 3-month-old male mice, comparing Pcp2-cre (n=7), PtprdFlox / Flox(n=7) and Pcp2-cre;PtprdFlox / Flox(n=8) (C) Percent freezing during contextual fear conditioning on Day 2 in 3-month-old male mice, comparing control groups (Pcp2-cre (n = 5), PtprdFlox / Flox(n=7)) and Pcp2-cre;PtprdFlox / Flox(n = 6) (D) Percent freezing during Day 2 habituation in 3-month-old male mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) and Pcp2-cre;PtprdFlox / Flox(n=8) mice. (E) Average percent freezing during cue presentation, comparing 3-month-old male control mice (Pcp2- cre (n=7), PtprdFlox / Flox(n=7)) and Pcp2-cre;PtprdFlox / Flox(n=8) mice. (F) Fear acquisition on Day 1 in 3-month-old female mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) and Pcp2-cre;PtprdFlox / Flox(n=11) (G) Percent freezing during contextual fear conditioning on Day 2 in 3-month-old female mice, comparing control groups (Pcp2-cre (n = 7), PtprdFlox / Flox(n=7)) and Pcp2-cre;PtprdFlox / Flox(n = 5) (H) Percent freezing during Day 2 habituation in 3-month-old female mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) and Pcp2-cre;PtprdFlox / Flox(n=11) mice. (I) Average percent freezing during cue presentation in 3-month-old female mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) and Pcp2-cre;PtprdFlox / Flox(n=11) mice. Data are represented as mean ± SEM in (B,F) and mean ± SEM with individual data points in (C-E,G-I). Two-way ANOVA was used in (B,F) and one-sided unpaired t-test was used in (C-E,G-I). *, p<0.05; **, p<0.01; ****, p<0.0001.
[0041] Figs.4(A-L) illustrate Ptprd activity is downregulated in Alzheimer’s disease (A) Plasma asprosin levels in human donors categorized as healthy controls (n = 11), individuals with mild cognitive impairment (MCI) (n = 15), and individuals with Alzheimer’sdisease (AD) (n = 15). (B) CSF asprosin levels in human donors categorized as healthy controls (n = 19), individuals with MCI (n = 18), and individuals with AD (n = 13). (C) Representative western blot and relative quantification of β-actin and Ptprd in the whole cerebellum of males with Alzheimer’s disease compared to age- and sex-matched healthy controls. (D) Representative western blot and relative quantification of β-actin and Ptprd in the whole cerebellum of females with Alzheimer’s disease compared to age- and sex-matched healthy controls. (E) Plasma asprosin levels in 6-month-old male and female 5xFAD mice (n = 16) compared to age- and sex-matched WT controls (n = 14). (F) Representative western blot and relative quantification of β-actin and Ptprd in the whole cerebellum of male 5xFAD mice compared to age- and sex-matched WT controls (n = 5–6 per group). (G) Representative images of the anterior Crus 1 region, showing Calbindin (green) and p-Stat3 (red) staining in WT and 5xFAD mice. (H-L) Quantification of overlap between Purkinje neurons (stained for Calbindin, green) and p-Stat3 (red). Regions of Interest selected from cerebellar regions known to be involved in associative memory (n = 4-6 / group). Data are represented as mean ± SEM with individual data points in (A-F,H-L). One-way ANOVA analysis was used in (A,B) and two-sided unpaired t-tests (E,F), paired (C,D) or one-sided unpaired t-tests (H-L) were used in. *, p<0.05; **, p<0.01; ****, p<0.0001.
[0042] Figs.5(A-I) illustrate asprosin can out compete Aβ to restore Ptprd activity in Purkinje neurons (A) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid, measured 24 hours after the addition of 300 nM Aβ1-40or reverse-sequence Aβ40-1control. Results represent three technical replicates and 12 biological replicates per group. (B) STAT3-response element- driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid and 400 ng of either an empty vector or an IL2-his-asprosin-expressing plasmid. Media was changed 24 hours post-transfection, followed by the addition of 200 nM Aβ1-40 or reverse-sequence Aβ40-1control. Luciferase activity was measured 6 hours after treatment (three technical replicates, 10 biological replicates per group). (C) STAT3-response element- driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid, measured 24 hours after the addition of 300 nM Aβ1-40 or GFP control (three technical replicates, 12 biological replicates per group). (D) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid and 400 ng of either an empty vector or an IL2-his-asprosin-expressing plasmid.Media was replaced 24 hours post-transfection, followed by the addition of 300 nM Aβ or GFP control. Luciferase activity was assessed 6 hours after treatment (three technical replicates, 8 biological replicates per group). (E) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid and treated with control or Ptprd siRNA. Luciferase activity was measured after 24 hours of exposure to Aβ1-40or GFP control (three technical replicates, 22 biological replicates per group). (F) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid, measured 24 hours after the addition of 300 nM Aβ1-42 or GFP control (three technical replicates, 12 biological replicates per group). (G) Binding affinity between the reverse-sequence Aβ40-1 and the extracellular domain of Ptprd (Ptprd-ECD) quantified using Surface Plasmon Resonance (SPR). (H) Binding affinity between Aβ1-42 and Ptprd-ECD quantified using SPR. (I) Competitive binding analysis of asprosin and Aβ1-42 to Ptprd-ECD performed using SPR. Data are represented as mean ± SEM (F-H) or mean ± SEM with individual data points (A-E). One-way ANOVA analysis was used in (B,D,E) and two-sided unpaired t-tests (A,C) were used *, p<0.05; **, p<0.01; ****, p<0.0001.
[0043] Figs.6(A-F) illustrate plasma asprosin elevation is sufficient to reactivate Purkinje neuron Ptprd in 5xFAD mice (A) Representative images of the anterior Crus 1 region, showing Purkinje neurons (stained via Calbindin, green) and p-Stat3 (red) and the merge of both stains. (B-E) Quantification of overlap between Purkinje neurons (stained via Calbindin, green) and p-Stat3 (red). Regions of interests were selected from cerebellar regions known to be involved in associative memory (n = 2-4 / group). Data are represented as mean ± SEM with individual data points in (C-F). One-sided unpaired Mann-Whitney U- test (C,D,F) or one-sided unpaired Welch’s t-tests (B,E) (used when SD differed between the groups). *, p<0.05; **, p<0.01; ****, p<0.0001.
[0044] Figs.7(A-J) illustrate asprosin gene therapy restores associative memory in AD (A, B) Body Weight Changes: Body weight change over a three-month period (from 6 to 9 months of age) in (A) male 5xFAD mice (n^=^11 per group) and (B) male APPNL-G-Fmice (n^=^13 per group) treated with either AAV8-Empty control or AAV8-Asprosin (1^×^10¹² genome copies [GC] / mouse). (C, D) Associative Memory in APPNL-G-FMice: Six-month-old male APPNL-G-Fmice were tail-vein-injected with AAV8-Empty or AAV8-Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months of age. (C) Fear acquisition onDay 1 (D) Average percent freezing during cue presentation (n^=^12 per group). (E–G) Associative Memory in Male 5xFAD Mice: Six-month-old wild-type (WT) male mice were tail-vein-injected with AAV8-Empty, and age- and sex-matched 5xFAD mice were tail-vein- injected with either AAV8-Empty or AAV8-Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months. (E) Fear acquisition on Day 1 (F) Day 2 habituation before tone presentation (G) Average percent freezing during cue presentation (n^=^19 for WT group; n^=^11 per 5xFAD group). (H–J) Associative Memory in Female 5xFAD Mice: Six- month-old WT female mice were tail-vein-injected with AAV8-Empty, and age- and sex- matched 5xFAD mice were tail-vein-injected with either AAV8-Empty or AAV8-Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months. (H) Fear acquisition on Day 1 (I) Day 2 habituation before tone presentation (J) Average percent freezing during cue presentation (n^=^10-13 per group). 5xFAD mice were injected with AAV and tested by Bijoya Basu at Case Western Reserve University on Med Associates Fear Conditioning Apparatus, base dimensions: 20cm x 20cm; APPNL-G-Fmice were injected with AAV and tested at Baylor College of Medicine by Hesong Liu on Fusion Stimulus Hub with SuperFlex Open Field system (OmniTech Electronics, Inc), base dimensions: 60cm X 60cm. All fear conditioning data were collected under blinded conditions. Data are represented as mean ± SEM in (C,E,H) and mean ± SEM with individual data points in (A,B,D,F,G,I,J). Two-way ANOVA was used in (C,E,H), one-way ANOVA with post hoc were used in (F,G,I,J) and two-sided unpaired t-tests were used in (A,B,D). *, p<0.05; **, p<0.01; ****, p<0.0001.
[0045] Figs.8(A-H) illustrate Purkinje neuron-specific Ptprd ablation does not impact other memory types (A) Total distance traveled in 15 minutes in the open field test, comparing 3-month-old male control mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=7) mice (B) Open field center-to-periphery ratio, used as a measure of anxiety, comparing 3-month-old male control mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=7) mice (C) Novel object recognition index, comparing 3-month-old male control mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=9)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=7) mice (D) Total time spent in the target quadrant for Barnes maze, comparing 3-month-old male control mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=7)) with age- and sex-matched Pcp2- cre;PtprdFlox / Flox(n=10) mice (E) Total distance traveled in 15 minutes in the open field test, comparing 3-month-old female control mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) with age-and sex-matched Pcp2-cre;PtprdFlox / Flox(n=5) mice. (F) Open field center-to-periphery ratio, used as a measure of anxiety, comparing 3-month-old female control mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=5) mice. (G) Novel object recognition index, comparing 3-month-old female control mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=14)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=10) mice. (H) Total time spent in the target quadrant for Barnes maze, comparing 3-month-old female control mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=12)) with age- and sex-matched Pcp2- cre;PtprdFlox / Flox(n=8) mice. Data are represented as mean ± SEM with individual data points in (a-h) and two-sided unpaired t-test was used. *, p<0.05; **, p<0.01; ****, p<0.0001.
[0046] Figs.9(A-L) illustrate that there are no behavioral differences between the control groups Pcp2-cre and PtprdFlox / Flox(A) Total distance traveled in 15 minutes in the open field test, comparing 3-month-old male mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) (B) Open field center-to-periphery ratio, used as a measure of anxiety, comparing 3-month-old male mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) (C) Novel object recognition index comparing 3-month-old male mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=9)) (D) Total time spent in the target quadrant for Barnes maze comparing 3-month-old male mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=7)) (E) Percent freezing during Day 2 habituation comparing 3-month-old male mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) (F) Average percent freezing during cue presentation comparing 3-month-old male mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) (G) Total distance traveled in 15 minutes in the open field test, 3-month-old female mice (Pcp2- cre (n=4), PtprdFlox / Flox(n=14)) (H) Open field center-to-periphery ratio, used as a measure of anxiety, 3-month-old female mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) (I) Novel object recognition index comparing 3-month-old female mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=14)) (J) Total time spent in the target quadrant for Barnes maze, comparing 3-month-old female mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=12)) (K) Percent freezing during Day 2 habituation comparing 3-month-old female mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) (L) Average percent freezing during cue presentation comparing 3-month-old female control mice (Pcp2- cre (n=7), PtprdFlox / Flox(n=9)) Data are represented as mean ± SEM with individual data points in (A-L) and two-sided unpaired t-test was used. *, p<0.05; **, p<0.01; ****, p<0.0001.
[0047] Figs.10(A-F) illustrate hypothalamic AgRP neuron-specific or forebrain excitatory neuron-specific Ptprd is dispensable for mammalian associative memory (A) Fearacquisition on Day 1 comparing 3-month-old male AgRP-cre (n=8) with age- and sex- matched AgrP-cre;PtprdFlox / Flox(n=6) mice (B) Percent freezing during Day 2 habituation in 3-month-old male mice comparing 3 month old male AgRP-cre (n=8) with age- and sex- matched AgrP-cre;PtprdFlox / Flox(n=6) mice (C) Average percent freezing during both cue presentations comparing 3-month-old male AgRP-cre (n=8) with age- and sex-matched AgRP-cre;PtprdFlox / Flox(n=6) mice (D) Fear acquisition on Day 1 comparing 3-month-old male CaMKIIα-cre (n=11) with age- and sex-matched CaMKIIα-cre;PtprdFlox / Flox(n=9) mice (E) Percent freezing during Day 2 habituation comparing 3-month-old male CaMKIIα-cre (n=11) with age- and sex-matched CaMKIIα-cre;PtprdFlox / Flox(n=9) mice (F) Average percent freezing during cue presentation comparing 3-month-old male CaMKIIα-cre (n=11) with age- and sex-matched CaMKIIα-cre;PtprdFlox / Flox(n=9) mice. Data are represented as mean ± SEM in (A,D) and mean ± SEM with individual data points in (B,C,E,F). Two-way ANOVA was used in (A,D) and two-sided unpaired t-test was used in (B,C,E,F). *, p<0.05; **, p<0.01; ****, p<0.0001.
[0048] Figs.11(A-J) illustrate asprosin supplementation does not impact other memory types in 5xFAD mice (A-D) 6-month-old WT male mice were tail-vein-injected with AAV8- empty and age- and sex-matched 5xFAD mice were tail-vein-injected with AAV8-empty or AAV8-asprosin (1 × 1012GC / mouse) viruses, and at 9 months of age behavioral phenotyping was conducted. (A) Total distance traveled in 15 minutes in the open field test (WT;AAV8- Empty (n=19) 5xFAD;AAV8-Empty (n=11), 5xFAD;AAV8-Asprosin (n=11)). (B) Open field center-to-periphery ratio, used as a measure of anxiety (WT;AAV8-Empty (n=19) 5xFAD;AAV8-Empty (n=11), 5xFAD;AAV8-Asprosin (n=11)) (C) Novel Object Recognition index (WT;AAV8-Empty (n=16) 5xFAD;AAV8-Empty (n=10), 5xFAD;AAV8- Asprosin (n=11)) (D) Total time spent in the target quadrant for Barnes maze (WT;AAV8- Empty (n=19) 5xFAD;AAV8-Empty (n=8), 5xFAD;AAV8-Asprosin (n=8)) (E-H) 6-month- old WT female mice were tail-vein-injected with AAV8-empty and age- and sex-matched 5xFAD mice were tail-vein-injected with AAV8-empty or AAV8-asprosin (1 × 1012GC / mouse) viruses, and at 9 months of age behavioral phenotyping was conducted. (E) Total distance traveled in 15 minutes in the open field test (WT;AAV8-Empty (n=11) 5xFAD;AAV8-Empty (n=8), 5xFAD;AAV8-Asprosin (n=11)) (F) Open field center-to- periphery ratio, used as a measure of anxiety (WT;AAV8-Empty (n=11) 5xFAD;AAV8- Empty (n=8), 5xFAD;AAV8-Asprosin (n=11)) (G) Novel Object Recognition index(WT;AAV8-Empty (n=11) 5xFAD;AAV8-Empty (n=8), 5xFAD;AAV8-Asprosin (n=6)) (H)Total time spent in the target quadrant for Barnes maze (WT;AAV8-Empty (n=12) 5xFAD;AAV8-Empty (n=5), 5xFAD;AAV8-Asprosin (n=4)) (I-J) Plasma asprosin in mice treated with AAV8-Asprosin in (I)WT (WT;AAV8-Empty (n=14) WT;AAV8-Asprosin (n=8)) and (J) 5xFAD (5xFAD;AAV8-Empty (n=10), 5xFAD;AAV8-Asprosin (n=8)) male mice. Data are represented as mean ± SEM in (A-H) and mean ± SEM with individual data points in (A-H). One-way ANOVA analysis was used followed by tukey’s multiple comparison post hoc test (A-H) and one-tailed unpaired t-test (I,J). *, p<0.05; **, p<0.01; ****, p<0.0001.
[0049] Figs.12(A-G) illustrate Asprosin gene therapy restores associative and recognition memory in APPNL-GFmodel (A) Body Weight Changes: Body weight change over a three-month period (from 6 to 9 months of age) in (male APPNL-G-Fmice (n^=^13 per group) treated with either AAV8-Empty control or AAV8-Asprosin (1^×^10¹² genome copies [GC] / mouse). (B-E) 6-month-old WT male mice were tail-vein-injected with AAV8-empty and age- and sex-matched 5xFAD mice were tail-vein-injected with AAV8-empty or AAV8- asprosin (1 × 1012GC / mouse) viruses, and at 9 months of age behavioral phenotyping was conducted (B) Novel object recognition (C) Total time spent in the target quadrant for Barnes maze (D) Y maze € Contextual fear conditioning (F,G) Associative Memory in APPNL-G-FMice: Six-month-old male APPNL-G-Fmice were tail-vein-injected with AAV8-Empty or AAV8-Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months of age. (F) Fear acquisition on Day 1 (G) Average percent freezing during cue presentation (n^=^12 per group).
[0050] Figs.13(A-I) illustrate Tgf-β1 activates Fbn1 transcription in white adipose tissue (A) qPCR showing relative mRNA levels of Fbn1 in differentiated 3T3-L1 cells exposed to 20ng / mL of the indicated cytokines for 48 hours (n=2 for PBS, IFN-y, IL-1B, IL- 6, TNF-a; n=4 for Tgf-β1). (B) Media asprosin detection with sandwich ELISA of differentiated 3T3-L1 cells exposed to PBS (control), 20ng / mL of Tgf-β1, or a cocktail of other cytokines (IFN-y, IL-1B, IL-6, TNF-a) for 48 hours (n=4 per group). (C) qPCR showing relative mRNA levels of Fbn1 in visceral (perigonadal) and subcutaneous (back) adipose tissue depots after 2 IP injection of PBS or 0.5ug Tgf-β1 spaced 6 hours apart in 12- week-old male C57BL / 6 mice (n=5 per group). (D) qPCR showing relative RNA Polymerase II occupancy at the Fbn1 locus following exposure to PBS or 20ng / mL Tgf-β1for 48 hours. DNA was isolated using CUT&RUN with an antibody targeting RNA polymerase II (n=4 per group). (E-F) qPCR showing relative mRNA levels of Fbn1 and Smad7 (respectively) of differentiated 3T3-L1 cells with knockdown of TGFBR2 utilizing pLKO.1 lentivirus and addition of 20ng / mL Tgf-β1 for 48 hours (n=3 for control and control + Tgf-β1, n=2 for TGFBR2 KD + Tgf-β1). (G-H) qPCR showing relative mRNA levels of Fbn1 and Smad7 (respectively) of differentiated 3T3-L1 cells with knockdown of Smad4 utilizing pLKO.1 lentivirus and addition of 20ng / mL Tgf-β1 for 48 hours (n=3 for all groups). (I) 72 hour body weight change of 12-week old male Fbn1NPS / +mice maintained on ad libtum HFD that received two IP injections spaced 8 hours apart of PBS or 0.5 µg of Tgf- β1 (n=6 for WT Tgf-β1, n=5 for all other groups). Error bars represent mean ± s.e.m. *p< 0.05, **p<0.01, ***p<0.001, and ****p<0.0001 by one-way ANOVA (A-B,E-I) and unpaired two-sided t test(C-D)
[0051] Figs.14(A-I) illustrate Tgf-β1 causes persistent elevation of white adipose Fbn1 mRNA and plasma asprosin (A) qPCR showing relative mRNA levels of Fbn1 in differentiated 3T3-L1 cells after addition of PBS or 20ng / mL Tgf-β1 media for 4 days followed by Tgf-β1 Free media for 14 days (n=3 per group). (B) Media asprosin detection with sandwich ELISA of differentiated 3T3-L1 cells exposed to PBS or 20ng / mL Tgf-β1 media for 4 days followed by Tgf-β1 Free media for 14 days (n=7 per group). (C) qPCR showing relative mRNA level of Smad7 in differentiated 3T3-L1 cells after addition of PBS or 20ng / mL Tgf-β1 media for 4 days followed by Tgf-β1 Free media for 14 days (n=3 per group). (D) Mouse plasma sandwich ELISA for total Tgf-β1 in 12 week old male WT C57BL / 6 mice after 4 days of 2 daily injections of PBS or 0.5 µg Tgf-β1 followed by 14 days without intervention (n=10 for PBS group, n=8 for Tgf-β1 group). (E) qPCR showing relative mRNA level of Fbn1 in visceral white adipose tissue in 12-week-old male WT C57BL / 6 mice after 4 days of 2 daily injections of PBS or 0.5 µg Tgf-β1 followed by 14 days without intervention (n=9 for all groups). (F) Mouse plasma sandwich ELISA for asprosin in 12 week old male WT C57BL / 6 mice after 4 days of 2 daily injections of PBS or 0.5 µg Tgf- β1 followed by 14 days without intervention (n=9 for all groups). (G) Visceral adipose tissue lysate sandwich ELISA for asprosin in 12 week old male WT C57BL / 6 mice after 4 days of 2 daily injections of PBS or 0.5 µg Tgf-β1 followed by 14 days without intervention (n=10 per group). (H) qPCR showing relative mRNA level of Smad7 in visceral white adipose tissue in 12 week old male WT C57BL / 6 mice after 4 days of 2 daily injections of PBS or 0.5 µg Tgf-β1 followed by 14 days without intervention (n=10 for all groups). (I) mRNA half-life showing relative abundance of Fbn1 mRNA after addition of 30 µg / mL actinomycin D and 20 ng / mL Tgf-β1. mRNA was sampled at multiple time points and half-life was determined using One phase decay nonlinear fit. Error bars represent mean ± s.e.m. *p< 0.05, **p<0.01, ***p<0.001, and ****p<0.0001 by unpaired two-sided t test (A-H).
[0052] Figs.15(A-G) illustrate Tgf-β1 produces global transcriptomic changes in adipocytes (A) Schematic showing conditions for samples A, B, and C used for RNA-seq. (B) Volcano plot of RNA-sequencing data comparing PBS vs. Tgf-β1 treated differentiated 3T3-L1 cells (A vs. B). Locations of Fbn1 and Smad7 are highlighted. (C) Gene ontology (GO) analysis of upregulated genes after exposure to Tgf-β1 in differentiated 3T3-L1 cells. (D) Tree clustering of RNA-sequencing data showing 4 distinct groups of genes (orange, pink, blue, and green) based on their expression patterns in response to treatment. Fbn1 belongs to the blue group of genes, while Smad7 and Skil belong to the green group of genes. (E) Number of Extracellular Matrix (ECM) genes that belong to the blue and green clusters shown in Fig, 13D. (F) Gene ontology (GO) analysis of upregulated genes after exposure to Tgf-β1 and subsequent Tgf-β1 withdrawal in differentiated 3T3-L1 cells. (G) Table showing select genes in blue group of genes for condition C where expression is high after Tgf-β1 addition and withdrawal and significantly different compared to control (condition A). Number under C / A column shows log(FC). Score was determined using the following equation: score = C / A *-log(C / Ap-value).
[0053] Figs.16(A-F) illustrate Tgf-β1 alters chromatin accessibility to persistently upregulate Fbn1 mRNA and plasma asprosin. (A) Schematic showing conditions for samples A, B, and C used for ATAC-seq. (B) Gene Ontology (GO) pathway analysis of upregulated biological processes from ATAC-sequencing of samples exposed to Tgf-β1. (C) Heatmap generated from ATAC-seq data showing peaks considered significantly (4X) increased from diffBind analysis. Specifically, Tgf-B1 broadly increases chromatin accessibility and many genes retain the increased accessibility even upon Tgf-β1 withdrawal. (D) Chromatin tracks at Fbn1 and Smad7 locus (respectively) from 3 separate conditions (control or untreated; Tgf- β1 added for 4 days; Tgf-β1 added for 4 days followed by Tgf-β1 free media incubation for 14 days). Red boxes highlight differential chromatin accessibility sites as found by diffBind algorithm analysis. (E-F) qPCR showing relative mRNA levels of Fbn1 and Smad7 (respectively) in differentiated 3T3-L1 cells after addition of DMSO, recombinant Tgf-β1, or20uM of A-485 plus recombinant Tgf-β1for 2 days (n=3 per group). Error bars represent mean ± s.e.m. *p< 0.05, **p<0.01, ***p<0.001, and ****p<0.0001 by one-way ANOVA (E- F).
[0054] Figs.17(A-H) illustrate (A) qPCR showing relative mRNA level of Fbn1 in 12 week old male WT C57Bl / 6 mice and 24 week old male DIO mice. RNA was isolated from visceral (perigonadal) and subcutaneous (back) adipose tissue depots (n=5 per group). (B) qPCR showing relative mRNA levels of Fbn1 in differentiated 3T3-l1 cells exposed to a lentivirus overexpressing recombinant active mouse Tgf-β1 or an empty control (n=3 per group). (C) qPCR showing relative mRNA level of Smad7 in 12 week old male WT C57Bl / 6 mice after single injection of Tgf-β1 and harvested adipose tissue 1 hour later (n=2 for PBS injection group, n=3 for Tgf-β1 injection group). (D) qPCR showing relative mRNA level of Fbn1 in visceral white adipose tissue in 12 week old female WT C57Bl / 6 mice injected with 2 doses spaced 8 hours apart of PBS or 0.5ug Tgf-β1 (n=5 per group). (E) Plasma mouse sandwich asprosin ELISA in 12 week old female WT C57Bl / 6 mice injected with 2 doses spaced 8 hours apart of PBS or 0.5ug Tgf-β1 (n=5 per group). (F) Media asprosin detection with sandwich ELISA of differentiated 3T3-L1 cells exposed to Tgf-β1 alone or Tgf-β1 + 30ug / mL actinomycin D. Media was sampled at different time points: 1hr, 2.5hr, 6hr, and 24hr (n=4 per group). (G) Schematic showing CAGE analysis data of FANTOM5 dataset depicting CpG island location and transcriptional start site (TSS) location of FBN1. (H) qPCR showing relative mRNA level of Fbn1 in differentiated 3T3-L1 cells incubated in 20ng / mL Tgf-β1 for 24 hours. 3 different primer sets targeting different regions of FBN1 were utilized (one primer set specifically targeted asprosin specifically) (n=3 per group). Error bars represent mean ± s.e.m. *p< 0.05, **p<0.01, ***p<0.001, and ****p<0.0001 by unpaired two-sided t test (A-F).
[0055] Figs.18(A-B) illustrate (A) Mouse plasma sandwich ELISA of neuropeptide Y (NPY) in 12 week old male WT C57Bl / 6 mice injected with PBS or Tgf-β1 for 4 days, 2 times a day (n=9 per group). (B) Mouse plasma sandwich ELISA of Ghrelin in 12 week old male WT C57Bl / 6 mice injected with PBS or Tgf-β1 for 4 days, 2 times a day (n=9 per group). Error bars represent mean ± s.e.m. *p< 0.05, **p<0.01, ***p<0.001, and ****p<0.0001 by unpaired two-sided t test (A-B).
[0056] Fig.19 illustrates chromatin tracks at Fbn1 loci from 3 separate conditions in 3T3-L1 cells (control or untreated; Tgf-β1 added for 4 days; Tgf-β1 added for 4 daysfollowed by Tgf-β1 Free media incubation for 14 days). Also shown is H3K27Ac ChIP-seq data of 3T3-L1 cells from Mikkelsen et al. Red boxes highlight differential chromatin accessibility sites as found by diffBind algorithm analysis. DETAILED DESCRIPTION
[0057] Unless otherwise defined, scientific and technical terms used herein shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well-known and commonly used in the art.
[0058] For convenience, certain terms employed in the specification, examples, and appended claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
[0059] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0060] The terms "comprise," "comprising," "include," "including," "have," and "having" are used in the inclusive, open sense, meaning that additional elements may be included. The terms "such as", "e.g.,", as used herein are non-limiting and are for illustrative purposes only. "Including" and "including but not limited to" are used interchangeably.
[0061] The term "or" as used herein should be understood to mean "and / or” unless the context clearly indicates otherwise.
[0062] As used herein, the term "about" or "approximately" refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term "about" or "approximately" refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ± 15%, ± 10%, ±9%, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2%, or ± 1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
[0063] As used herein, “one or more of a, b, and c” means a, b, c, ab, ac, bc, or abc. The use of “or” herein is the inclusive or.
[0064] The term "administering" to a patient includes dispensing, delivering or applying an active compound or agent in a pharmaceutical formulation to a subject by any suitable route for delivery of the active compound to the desired location in the subject (e.g., to thereby contact a desired cell), including administration into the cerebrospinal fluid or across the blood-brain barrier, delivery by either the parenteral or oral route, intramuscular injection, subcutaneous or intradermal injection, intravenous injection, buccal administration, transdermal delivery and administration by the rectal, colonic, vaginal, intranasal or respiratory tract route.
[0065] An "effective amount" of an agent is an amount sufficient to achieve a desired therapeutic or pharmacological effect, such as an amount that is capable of increasing plasma levels of asprosin and / or the analogue thereof in a subject. An effective amount of an agent as defined herein may vary according to factors, such as the disease state, age, and weight of the subject, and the ability of the agent to elicit a desired response in the subject. Dosage regimens may be adjusted to provide the optimum therapeutic response. An effective amount is also one in which any toxic or detrimental effects of the active compound are outweighed by the therapeutically beneficial effects.
[0066] The term “encoding” refers to the inherent property of a nucleic acid to serve as a template, whether directly (i.e., a sense strand) or indirectly (i.e., an antisense strand) for synthesis of peptide, polypeptides, proteins, or other nucleic acids (i.e., rRNA, tRNA, microRNA). A nucleic acid can “encode” whether it is the sense strand, antisense strand, or a double-stranded segment thereof. The sense strand directly encodes the rRNA, tRNA, microRNA, or mRNA. The mRNA then serves as the template for translation of a peptide, polypeptide, or protein. The anti-sense strand is generally considered to be the reverse complementary sequence and is sometimes called a “non-coding” strand in the art (although for present purposes “non-coding” is a misnomer because the non-coding strand still “encodes” the genetic information by perpetuating it during semi-conservative replication by acting as a template for the polymerization of a new, sense strand). Within semi-conservative replication two single strands in double-stranded nucleic acids are separated, and a newstrand is polymerized from the information from each of the single-stranded nucleic acids (i.e., single-stranded template), regardless of whether one single-stranded template is the sense strand (e.g., that which is used to transcribe mRNA and thereby, or directly, encode the translate or protein) or the antisense strand. By perpetuating genetic information, the antisense strand is still encoding the genetic information for, for example, a protein. Accordingly, “a nucleic acid encoding X”, includes sense and antisense sequences or strands whether X is a peptide, a polypeptide, or a protein or X is a sequence that encodes a rRNA, tRNA, microRNA, antisense RNA, etc.
[0067] Further to which, “nucleic acid encoding X,” includes RNA, DNA, and combinations thereof, since nucleic acids are synthesized from transcription, reverse- transcription, and replication, as naturally occurring processes and man-made processes (recombinant biology, molecular biology, etc.).
[0068] Accordingly, a recited nucleic acid sequence contemplates and supports the complementary version thereof, the reverse complementary version thereof, and double- stranded versions thereof. That is, “a nucleic acid comprising SEQ ID NO.: X” is to be understood, contemplate, and support “a nucleic acid comprising the reverse complementary of SEQ ID NO.: X” or, using the nomenclature regarding the prime symbol as in “′”, “a nucleic acid comprising SEQ ID NO.: X′,” unless otherwise specified. For example, “the nucleic acid comprising SEQ ID NO.: X” wherein SEQ ID NO.: X is 5′-ATGCC-3′ contemplates and supports the reverse complementary of SEQ ID NO.:X, and specifically 5′-GGCAT-3.
[0069] As noted above, a recited nucleic acid sequence contemplates and supports conversion between RNA and DNA versions thereof. For example, if SEQ ID NO.: X is “5′-ATGCC-3′,” contemplated and supported is 5′-AUGCC-3′, as well as the reverse complementary thereof, 5′-GGCAU-3.
[0070] The term "expression" refers to the process by which nucleic acid is translated into peptides or is transcribed into RNA, which, for example, can be translated into peptides, polypeptides or proteins. If the nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA. For heterologous nucleic acid to be expressed in a host cell, it must initially be delivered into the cell and then, once in the cell, ultimately reside in the nucleus.
[0071] The term "genetic therapy" and grammatical variants thereof (e.g., "gene therapy"), involves the transfer of heterologous DNA to cells of a mammal, particularly a human, with a disorder or conditions for which therapy or diagnosis is sought. The DNA is introduced into the selected target cells in a manner that the heterologous DNA is expressed and a therapeutic product encoded thereby is produced. Alternatively, the heterologous DNA may in some manner mediate expression of DNA that encodes the therapeutic product; it may encode a product, such as a peptide or RNA that in some manner mediates, directly or indirectly, expression of a therapeutic product. Genetic therapy may also be used to deliver nucleic acid encoding a gene product to replace a defective gene or supplement a gene product produced by the mammal or the cell in which it is introduced. The heterologous DNA encoding the therapeutic product may be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof.
[0072] The term "gene" or "recombinant gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences.
[0073] The term "heterologous nucleic acid sequence" is typically DNA that encodes RNA and proteins that are not normally produced in vivo by the cell in which it is expressed or that mediates or encodes mediators that alter expression of endogenous DNA by affecting transcription, translation, or other regulatable biochemical processes. A heterologous nucleic acid sequence may also be referred to as foreign DNA. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which it is expressed is herein encompassed by heterologous DNA. Examples of heterologous DNA include, but are not limited to, DNA that encodes traceable marker proteins, such as a protein that confers drug resistance, DNA that encodes therapeutically effective substances, and DNA that encodes other types of proteins, such as antibodies.
[0074] The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
[0075] The phrases "systemic administration," "administered systemically," "peripheral administration" and "administered peripherally" as used herein mean the administration of a compound, drug or other material other than directly into a target tissue, such that it enters the animal's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
[0076] The term "patient" or "subject" or "animal" or "host" or “individual” refers to any mammal. The subject may be a human but can also be a mammal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, fowl, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like).
[0077] The terms "polynucleotide", "nucleotide", and “nucleic acid” are used interchangeably herein.
[0078] The terms "polynucleotide sequence", "nucleotide sequence", and “nucleic acid sequence” are also used interchangeably herein.
[0079] The terms "peptide" or "polypeptide" are used interchangeably herein and refer to compounds consisting of from about 2 to about 90 amino acid residues, inclusive, wherein the amino group of one amino acid is linked to the carboxyl group of another amino acid by a peptide bond. A peptide can be, for example, derived or removed from a native protein by enzymatic or chemical cleavage, or can be prepared using conventional peptide synthesis techniques (e.g., solid phase synthesis) or molecular biology techniques (see Sambrook et al., MOLECULAR CLONING: LAB. MANUAL (Cold Spring Harbor Press, Cold Spring Harbor, NY, 1989)). A "peptide" can comprise any suitable L-and / or D-amino acid, for example, common a-amino acids (e.g., alanine, glycine, valine), non-a-amino acids (e.g., P- alanine, 4-aminobutyric acid, 6aminocaproic acid, sarcosine, statine), and unusual amino acids (e.g., citrulline, homocitruline, homoserine, norleucine, norvaline, ornithine). The amino, carboxyl and / or other functional groups on a peptide can be free (e.g., unmodified) or protected with a suitable protecting group. Suitable protecting groups for amino and carboxyl groups, and means for adding or removing protecting groups are known in the art. See, e.g., Green & Wuts, PROTECTING GROUPS IN ORGANIC SYNTHESIS (John Wiley & Sons, 1991). The functional groups of a peptide can also be derivatized (e.g., alkylated) using art-known methods.
[0080] Peptides can be synthesized and assembled into libraries comprising a few too many discrete molecular species. Such libraries can be prepared using well-known methods of combinatorial chemistry and can be screened as described herein or using other suitable methods to determine if the library comprises peptides which can sequester asprosin. Such peptides can then be isolated by suitable means.
[0081] The term "peptidomimetic", refers to a protein-like molecule designed to mimic a peptide. Peptidomimetics typically arise either from modification of an existing peptide, or by designing similar systems that mimic peptides, such as peptoids and β-peptides. Irrespective of the approach, the altered chemical structure is designed to advantageously adjust the molecular properties such as, stability or biological activity. These modifications involve changes to the peptide that do not occur naturally (such as altered backbones and the incorporation of nonnatural amino acids).
[0082] The terms "portion", "fragment", "variant", "derivative" and "analog" or “analogue”, when referring to a polypeptide include any polypeptide that retains at least some biological activity referred to herein (e.g., inhibition of an interaction such as binding). Polypeptides as described herein may include portion, fragment, variant, or derivative molecules without limitation, as long as the polypeptide still serves its function. Polypeptides or portions thereof of the present invention may include proteolytic fragments, deletion fragments and in particular, or fragments that more easily reach the site of action when delivered to an animal.
[0083] In some embodiments, a "portion" or "fragment" polypeptide (including a domain) will be understood to mean a polypeptide of reduced length (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more residue(s) (e.g., peptide(s)) relative to a reference polypeptide, respectively, and comprising, consisting essentially of and / or consisting of a polypeptide of contiguous residues, respectively, identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference polypeptide.
[0084] Different nucleic acids or proteins having homology are referred to herein as "homologues." The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. "Homology" refers to the level of similarity between two or more nucleic acid and / or amino acidsequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins. Thus, the compositions and methods described herein further comprise homologues to the nucleotide sequences and polypeptides of this invention. "Orthologous" and "orthologs" as used herein, refers to homologous nucleotide sequences and / or amino acid sequences in different species that arose from a common ancestral gene during speciation. A homologue or ortholog of a nucleotide sequence of this invention has a substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) to the nucleotide sequence described herein.
[0085] The term "sequence identity" refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. "Identity" can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).
[0086] The term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) as compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, "percent identity" can refer to the percentage of identical amino acids in an amino acid sequence as compared to a reference polypeptide.
[0087] The phrase "substantially identical," or "substantial identity" in the context of two nucleic acid molecules, nucleotide sequences, polypeptide sequences, or protein sequences, refers to two or more sequences or subsequences that have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% nucleotide or amino acid residue identity, when compared and aligned for maximumcorrespondence, as measured using one of the following sequence comparison algorithms or by visual inspection. In some embodiments, the substantial identity exists over a region of consecutive nucleotides of a nucleotide sequence of the invention that is about 10 nucleotides to about 20 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 25 nucleotides, about 30 nucleotides to about 40 nucleotides, about 50 nucleotides to about 60 nucleotides, about 70 nucleotides to about 80 nucleotides, about 90 nucleotides to about 100 nucleotides, or more nucleotides in length, and any range therein, up to the full length of the sequence. In some embodiments, the nucleotide sequences can be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides). In some embodiments, a substantially identical nucleotide or protein sequence performs substantially the same function as the nucleotide (or encoded protein sequence) to which it is substantially identical.
[0088] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
[0089] Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG. Wisconsin Package (Accelrys Inc., San Diego, Calif.). An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, e.g., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For purposes of thisinvention "percent identity" may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.
[0090] Two nucleotide sequences may also be considered substantially complementary when the two sequences hybridize to each other under stringent conditions. In some representative embodiments, two nucleotide sequences considered to be substantially complementary hybridize to each other under highly stringent conditions.
[0091] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York (1993). Generally, highly stringent hybridization and wash conditions are selected to be about 5ºC lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
[0092] A polynucleotide and / or recombinant nucleic acid construct described herein can be codon optimized for expression. In some embodiments, a polynucleotide, nucleic acid construct, expression cassette, and / or vector described herein (e.g., that comprises / encodes a fusion or chimeric protein or polypeptide) may be codon optimized for expression in an organism (e.g., an animal, a plant, a fungus, an archaeon, or a bacterium). In some embodiments, the codon optimized nucleic acid constructs, polynucleotides, expression cassettes, and / or vectors of the invention have about 70% to about 99.9% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%.99.9% or 100%) identity or more to the reference nucleic acid constructs, polynucleotides, expression cassettes, and / or vectors but which have not been codon optimized.
[0093] In any of the embodiments described herein, a polynucleotide or nucleic acid construct described herein may be operatively linked or associated with a variety of promoters and / or other regulatory elements for expression in an organism or cell thereof. Thus, in some embodiments, a polynucleotide or nucleic acid construct described herein may further comprise one or more promoters, introns, enhancers, and / or terminators operably linked to one or more nucleotide sequences. In some embodiments, a promoter may beoperably associated with an intron. In some embodiments, a promoter associated with an intron maybe referred to as a "promoter region".
[0094] A polynucleotide sequence (DNA, RNA) is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that polynucleotide sequence. The term "operatively linked" includes having an appropriate start signal (e.g., ATG) in front of the polynucleotide sequence to be expressed and maintaining the correct reading frame to permit expression of the polynucleotide sequence under the control of the expression control sequence, and production of the desired polypeptide encoded by the polynucleotide sequence.
[0095] The term "linked," or "fused" in reference to polypeptides, refers to the attachment of one polypeptide to another. A polypeptide may be linked or fused to another polypeptide (at the N-terminus or the C-terminus) directly (e.g., via a peptide bond) or through a linker (e.g., a peptide linker).
[0096] The term "linker" in reference to polypeptides is art-recognized and refers to a chemical group, or a molecule linking two molecules or moieties, e.g., two domains of a fusion polypeptide protein. A linker may be comprised of a single linking molecule (e.g., a single amino acid) or may comprise more than one linking molecule. In some embodiments, the linker can be an organic molecule, group, polymer, or chemical moiety such as a bivalent organic moiety. In some embodiments, the linker may be an amino acid or it may be a peptide. In some embodiments, the linker is a peptide.
[0097] A "promoter" is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) that is operably associated with the promoter. The coding sequence controlled or regulated by a promoter may encode a polypeptide and / or a functional RNA. Typically, a "promoter" refers to a nucleotide sequence that contains a binding site for RNA polymerase II and directs the initiation of transcription. In general, promoters are found 5', or upstream, relative to the start of the coding region of the corresponding coding sequence.
[0098] Promoters can include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and / or tissue- specific promoters for use in the preparation of recombinant nucleic acid molecules, e.g., "synthetic nucleic acid constructs" or "protein-RNA complex." These various types of promoters are known in the art.
[0099] The choice of promoter may vary depending on the temporal and spatial requirements for expression, and also may vary based on the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge present in the art, the appropriate promoter can be selected for the particular host organism of interest. Thus, for example, much is known about promoters upstream of highly constitutively expressed genes in model organisms and such knowledge can be readily accessed and implemented in other systems as appropriate.
[0100] A “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell and without requiring the addition of exogenous factors or the introduction of a different phenotype to the cell. This constitutive promoter can be cell-specific so long as it is produced in the specific, or target, cell under most or all physiological conditions of the cell.
[0101] The term "recombinant," as used herein, means that a protein is derived from a prokaryotic or eukaryotic expression system.
[0102] The term "therapeutically effective" means that the amount of the composition used is of sufficient quantity to ameliorate one or more causes, symptoms, or sequelae of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination, of the causes, symptoms, or sequelae of a disease or disorder.
[0103] The term "treatment" refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.
[0104] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Preferred vectors are those capable of one or more of, autonomous replication and expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors".
[0105] By way of example, inverted-terminal repeats (ITRs) from adeno-associated viruses (AAVs) constitute a vector when adjoined to the nucleic acid encoding a target protein because the ITRs will provide for the nucleic acid encoding the target protein to be packaged within an AAV virion. ITRs also provide other cis-acting functions for expression of the nucleic acid encoding the target protein in the host cell upon entry of the vector into the host cell. Such cis-acting functions of ITRs include aiding in concatemer formation for genomic insertion; initiation of second strand formation in the case of a single-stranded (ss) AAV (ssAAV) vector; or initiation of replication and transcription in the case of ssAAV and self-complementary (sc) AAV (scAAV) vectors. In this regard, the AAV ITRs can be characterized based on the nucleic acid sequences providing such cis-acting functions from the serotypes of AAVs. That is, an ITR isolated from an AAV2 serotype can be known as an AAV2 ITR, even though the ITR generally does not contribute to the serotype of an AAV.
[0106] “Expression vector” refers to a vector comprising an expressing region. An expressing region includes a recombinant polynucleotide comprising a nucleic acid that controls expression (i.e. a promoter) and a nucleic acid that encodes. The nucleic acid that encodes includes a nucleic acid that encodes a protein. Generally, the promoter is operatively linked to the nucleic acid that encodes the target protein in a manner that is capable of promoting expression of the protein upon entry of the vector into the host cell. In some embodiments, the promoter can be operably linked by ensuring that there is not codon misalignment.
[0107] The term "wild type" (or "WT") refers to the naturally-occurring polynucleotide sequence encoding a protein, or a portion thereof, or protein sequence, or portion thereof, respectively, as it normally exists in vivo. As used herein, the term "nucleic acid" refers to polynucleotides, such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.
[0108] The agents, compounds, compositions, polypeptides, proteins, etc. used in the methods described herein are considered to be purified and / or isolated prior to their use. Purified materials are typically "substantially pure", meaning that a nucleic acid, polypeptide or fragment thereof, or other molecule has been separated from the components that naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and other organic molecules with which it is associated naturally. For example, a substantially pure polypeptide may be obtained by extraction from a natural source, by expression of a recombinant nucleic acid in a cell that does not normally express that protein, or by chemical synthesis. "Isolated materials" have been removed from their natural location and environment. In the case of an isolated or purified domain or protein fragment, the domain or fragment is substantially free from amino acid sequences that flank the protein in the naturally-occurring sequence. The term "isolated DNA" means DNA has been substantially freed of the genes that flank the given DNA in the naturally occurring genome. Thus, the term "isolated DNA" encompasses, for example, cDNA, cloned genomic DNA, and synthetic DNA.
[0109] The term “cognitive decline” refers to a reduction in one or more cognitive abilities, such as memory, awareness, judgement, and mental acuity, across the adult lifespan. The presence and degree of decline varies with the cognitive ability being measured as fluid abilities often show greater declines than crystallized. Cognitive decline is a part of normal healthy aging, but a severe decline is not normative and could be symptomatic of disease. Cognitive decline is the primary symptom of disease-induced dementias, such as Alzheimer’s disease.
[0110] The term “memory deficits” refers to unusual forgetfulness or memory impairment where a subject may not be able to remember new events or facts, recall one or more memories of the past, or both. The memory deficits can be either short term and then resolve (transient) or it may be permanent and depending on the cause, it can get worse over time.
[0111] The term “amyloid beta (Aβ) mediated neurological pathogenesis” or “β amyloid mediated neurological pathogenesis” refers to the origination and development of neurological conditions, diseases, or disorders that are caused by the aggregation and / or accumulation of Aβ peptides.
[0112] The term “Alzheimer's disease " (AD) refers to an age-related, progressive brain disorder associated with general degeneration of the brain and initially manifesting itself with partial amnesia, and later restlessness, disorientation, aphasia, agnosia or apraxia (cognitive decline), dementia and sometimes euphoria or depressions. AD may be associated with neurological and communication disorders and the National Institute of Stroke Neurological and Communicative Disorders and Stroke, and Alzheimer's Disease and Related Disorders Association criteria.
[0113] The term “cachexia”, also known as “wasting syndrome”, refers to a complex metabolic syndrome that is associated with an underlying illness and which is characterized by the loss of body weight, which negatively affects mortality, morbidity, and quality of life.
[0114] Embodiments described herein relate to compositions and methods of treating and / or preventing one or more of cognitive decline and / or memory deficits, amyloid β (Aβ) mediated neurological pathogenesis, cachexia, and Alzheimer's disease (AD) in a subject in need thereof.
[0115] We identified that membrane bound receptor protein tyrosine phosphatase delta (Ptprd) is a central nervous system (CNS) receptor for asprosin, a fasting-induced protein hormone. In mice, Purkinje neuron-specific genetic ablation of Ptprd leads to a deficit in fear-conditioned memory similar to that caused by AD. It has been shown that AD damages Purkinje neurons, and we have shown that this damage results in a decrease in Ptprd activity.
[0116] We found that while plasma and cerebrospinal fluid (CSF) asprosin levels are unchanged in AD, the pathological accumulation of Aβ interferes with asprosin-Ptprd signaling by binding to Ptprd and inhibiting its activity. This suggests that normal asprosin levels are insufficient to activate Ptprd in the presence of Aβ. Remarkably, plasma asprosin supplementation was sufficient to fully recover associative memory deficits in two independent AD mouse models. Additionally, using AD mouse models, we demonstrated that asprosin gain-of-function through a viral vector is able to fully rescue fear-conditioned memory deficits or associative memory deficits as well as novel object recognition memory deficits.
[0117] Our findings demonstrate that elevating asprosin concentrations can outcompete Aβ for Ptprd binding, restoring receptor activity and normalizing downstream signaling pathways. Therefore, the therapeutic benefit of asprosin supplementation in AD arises not from correcting an asprosin deficiency but from overcoming Aβ-mediated inhibition of Ptprd,and an agent, such as asprosin, that increases or promotes Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity can be used for treating and / or preventing one or more of cognitive decline and / or memory deficits, Aβ mediated neurological pathogenesis, cachexia, and AD in a subject in need thereof.
[0118] We further found that the obesity-associated cytokine Tgf-β1 activates Fbn1 transcription in adipocytes, driving overproduction asprosin. Remarkably, a single exposure to elevated Tgf-β1 reshapes chromatin at the Fbn1 locus, cementing its overexpression in a manner that is unrelenting, even after normalization of Tgf-β1 levels. The relenting overexpression of Fbn1 even after Tgf-β1 normalization results in an enduring plasma asprosin elevation that can potentially treat and / or prevent one or more of cognitive decline and / or memory deficits, Aβ mediated neurological pathogenesis, cachexia, and AD in a subject in need thereof.
[0119] Accordingly, in some embodiments, a method of treating cognitive decline and / or memory deficits in a subject in need thereof can include administering to the subject a therapeutically effective amount of at least one agent that can directly or indirectly enhance, increase, and / or promote one or more of Ptprd activity, Ptprd function, Ptprd signaling or Ptprd expression and / or decrease Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling in the subject. The memory deficits treated can include, for example, associative memory deficits and novel object recognition memory deficits associated with AD and / or Aβ mediated neurological pathogenesis.
[0120] The activity, signaling, and / or function of Ptprd can be enhanced, increased and / or promoted in several ways including: direct enhancement of the activity of the Ptprd (e.g., by using small molecules and / or peptide agonists); activation of genes and / or proteins that enhance, increase, and / or promote one or more of, the activity, signaling, and / or function of the Ptprd (e.g., by increasing the expression or activity of the genes and / or proteins); promotion of genes and / or proteins that are downstream mediators of the Ptprd activity (e.g., by enhancing the expression and / or activity of the mediator genes and / or proteins); introduction of genes and / or proteins that positively regulate one or more of, activity, signaling, and / or function of Ptprd (e.g., by using recombinant gene expression vectors, recombinant viral vectors or recombinant polypeptides); or gene replacement with, for instance, a hypermorphic mutant of the Ptprd (e.g., by homologous recombination, overexpression using recombinant gene expression or viral vectors, or mutagenesis).
[0121] In some embodiments, the agent can increase Ptprd dephosphorylation of signal transducer and activator of transcription 3 (STAT3) and / or decrease Aβ induced STAT3 transcriptional activity in the cerebellum and, particularly Purkinje neurons of the subject. For example, the agent can increase Ptprd dephosphorylation of STAT3 in the cerebellum of the subject at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 105%, at least about 110%, at least about 115%, at least about 120%, at least about 125%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% compared to Ptprd dephosphorylation of STAT3 in the cerebellum of the subject prior to administration of the agent. Increased levels may be by about 10% to about 200%, about 20% to about 200%, about 40% to about 200%, about 50% to about 200%, about 70% to about 200%, about 80% to about 200%, about 90% to about 200%, about 100% to about 200%, about 110% to about 200%, about 120% to about 200%, about 130% to about 200%, about 150% to about 200%, about 160% to about 200%, about 170% to about 200% or about 180% to about 200% compared to Ptprd dephosphorylation of STAT3 in the cerebellum of the subject prior to administration of the agent.
[0122] In another example, the agent can decrease Aβ induced STAT3 transcriptional activity in the cerebellum of the subject at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% compared to Aβ induced STAT3 transcriptional activity in the cerebellum the subject prior to administration of the agent.
[0123] In one embodiment, an agent that enhances, increases, and / or promotes one or more of the activity, signaling, and / or function of the Ptprd and / or decreases Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling in the subject can include a peptide or small molecule Ptprd agonist that binds to and / or complexes Ptprd to enhance the activity, signaling, and / or function of Ptprd. Accordingly, therapeutic peptides or small molecules that act as a Ptprd agonist can rescue fear-conditioned memory deficits orassociative memory deficits as well as novel object recognition memory deficits in subjects having and / or at risk of AD.
[0124] In some embodiments, the Ptprd agonist is a therapeutic polypeptide or protein that when introduced into the circulation of a subject in need thereof can bind to and / or complex the membrane bound Ptprd (SEQ ID NO: 7) to induce Ptprd activity and / or signaling in neural cells, such as Purkinje neurons.
[0125] In some embodiments, the Ptprd agonist can include asprosin and / or an analogue thereof. Asprosin is encoded by FBN1 gene and belongs to a post-translationally modified product of fibrillin. Asprosin is released as the C-terminal propeptide (aa2732- 2871) from profibrillin-1 and is cleaved by pro-proteinase furin (Jensen et al., 2014). In some embodiments, asprosin can have an amino acid sequence consisting of SEQ ID NO: 8.
[0126] In some embodiments, the asprosin and / or analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, or at least about 140 consecutive amino acids of SEQ ID NO: 8 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the amino acid sequence of SEQ ID NO: 8.
[0127] For example, the asprosin and / or an analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to about 10 to about 140, about 20 to about 120, about 30 to about 110, about 40 to about 100, about 50 to about 90, about 60to about 80, consecutive amino acids of SEQ ID NO: 8 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the amino acid sequence of SEQ ID NO: 8.
[0128] In other embodiments, the asprosin and / or an analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 8 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the amino acid sequence of SEQ ID NO: 8.
[0129] In still other embodiments, the asprosin and / or an analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 140 consecutive amino acids of an asprosin polypeptide or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the asprosin polypeptide.
[0130] In some embodiments, the nucleic acid that encodes asprosin has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 2 or 1, 2, 3, 4, 5, 6, 7, 8, or 9substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 2 or a reverse complementary sequence thereof.
[0131] In some embodiments, the asprosin and / or an analogue thereof has a binding affinity KDto Ptprd less than about 10 μM, less than about 1 μM, less than about 500 nM, less than about 400 nM, less than about 300 nM, less than about 200 nM, less than about 100 nM, less than about 10 nM, less about 1 nM, or less than about 500 pM.
[0132] The asprosin and / or an analogue thereof described herein can be subject to other various changes, substitutions, insertions, and deletions where such changes provide for certain advantages in its use. In this regard, asprosin and / or an analogue thereof that have an amino acid sequence substantially identical to asprosin and / or an analogue thereof that binds to Ptprd can correspond to or be substantially homologous with, rather than be identical to, the sequence of a recited polypeptide where one or more changes are made and it retains the ability to increase or promote one or more of activity, signaling, and / or function of Ptprd.
[0133] The asprosin and / or an analogue thereof can be in any of a variety of forms of polypeptide derivatives that include amides, conjugates with proteins, cyclized polypeptides, polymerized polypeptides, analogs, fragments, chemically modified polypeptides and the like derivatives.
[0134] The asprosin and / or an analogue thereof can also include conservative substitutions of amino acid residues. It will be appreciated that the conservative substitution can also include the use of a chemically derivatized residue in place of a non-derivatized residue provided that such peptide displays the requisite binding activity.
[0135] "Chemical derivative" refers to a subject peptide having one or more residues chemically derivatized by reaction of a functional side group. Such derivatized molecules include for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine. Also included as chemical derivatives are those polypeptides, which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example:4-hydroxyproline may be substituted for proline; 5-hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine. Polypeptides described herein may also include any polypeptide having one or more additions and / or deletions or residues relative to the sequence of a polypeptide whose sequence is shown herein, so long as the requisite activity is maintained.
[0136] One or more of peptides of asprosin and / or an analogue thereof described herein can also be modified by natural processes, such as posttranslational processing, and / or by chemical modification techniques, which are known in the art. Modifications may occur in the peptide including the peptide backbone, the amino acid sidechains and the amino or carboxy termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given peptide. Modifications comprise for example, without limitation, acetylation, acylation, addition of acetomidomethyl (Acm) group, ADP-ribosylation, amidation, covalent attachment to fiavin, covalent attachment to a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross- linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross- links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer- RNA mediated addition of amino acids to proteins such as arginylation and ubiquitination (for reference see, Protein-structure and molecular properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New-York, 1993).
[0137] Peptides and / or proteins described herein may also include, for example, biologically active mutants, variants, fragments, chimeras, and analogues; fragments encompass amino acid sequences having truncations of one or more amino acids, wherein the truncation may originate from the amino terminus (N-terminus), carboxy terminus (C- terminus), or from the interior of the protein. Analogues of the invention involve an insertion or a substitution of one or more amino acids. Variants, mutants, fragments, chimeras and analogues may function as inhibitors of asprosin mediated orexigenesis and / or glucogenesis (without being restricted to the present examples).
[0138] The asprosin and / or an analogue thereof described herein may be prepared by methods known to those skilled in the art. The asprosin and / or an analogue thereof may be prepared using recombinant DNA. For example, one preparation can include cultivating a host cell (bacterial or eukaryotic) under conditions, which provide for the expression of asprosin and / or an analogue thereof within the cell.
[0139] The purification of the asprosin and / or an analogue thereof may be done by affinity methods, ion exchange chromatography, size exclusion chromatography, hydrophobicity or other purification technique typically used for protein purification. The purification step can be performed under non-denaturating conditions. On the other hand, if a denaturating step is required, the protein may be renatured using techniques known in the art.
[0140] In some embodiments, the asprosin and / or an analogue thereof is an exogenous peptide that can be recombinantly produced and systemically administered to the subject by, for example, parenteral or intravenous administration.
[0141] In some embodiments, the asprosin and / or an analogue thereof can be expressed from a cell, in vivo or ex vivo, using a vector that includes a nucleic acid encoding the asprosin and / or an analogue thereof. A vector (sometimes referred to as gene delivery or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to the cell. The polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy. Vectors include, for example, viral vectors (such as adenoviruses (Ad), adeno-associated viruses (AAV), and retroviruses), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a target cell.
[0142] In some embodiments, the vector can include an expression cassette or expression region. The expression cassette can include a nucleic acid molecule or polynucleotide that includes the asprosin and / or an analogue thereof coding sequences, i.e., nucleic acid encoding asprosin or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence and a polyadenylation (poly(A)) tail signal.
[0143] In some embodiments, the nucleic acid that encodes asprosin has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at leastabout 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 2 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 2 or a reverse complementary sequence thereof.
[0144] The expression cassette may be engineered into a genetic element and / or packaged into the capsid of a viral vector (e.g., a viral particle). Typically, such an expression cassette for generating a viral vector contains the asprosin and / or an analogue thereof sequences described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein. Any of the expression control sequences can be optimized for a specific species using techniques known in the art including, e.g., codon optimization, as described herein.
[0145] The expression cassette typically contains a promoter sequence as part of the expression control sequences. For example, the promoter can include a liver-specific promoter thyroxin binding globulin (TBG). In another example, vectors described herein can include a CB7 promoter. CB7 is a chicken β-actin promoter with cytomegalovirus enhancer elements. Alternatively, other liver-specific promoters may be used. TTR minimal enhancer / promoter, alpha-antitrypsin promoter, LSP (845 nt)25 (requires intron-less scAAV). Although less desired, other promoters, such as viral promoters, constitutive promoters, regulatable promoters (see, e.g., WO 2011 / 126808 and WO 2013 / 04943), or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein.
[0146] In some embodiments, the promoter can include a constitutive viral transcription promoter for the production of a high level of recombinant protein in mammalian cells. For example, the promoter can include a cytomegalovirus (CMV), a simian virus 40 (SV40), or a hybrid thereof. In some embodiments, the promoter can include a constitutive promoter of human origin used to drive ectopic gene expression in vivo. For example, the promoter can include a human Ubiquitin C promoter (UBC) or a human elongation factor-1 (EF-1) promoter, such as an EF-1 alpha promoter.
[0147] In some embodiments, the nucleic acid that encodes EF-1 promoter has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 4 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 4 or a reverse complementary sequence thereof.
[0148] In addition to a promoter, an expression cassette and / or a vector may contain other appropriate control sequences, such as transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. Examples of suitable polyA sequences include, e.g., SV40, bovine growth hormone (bGH), and TK polyA. Examples of enhancers include, e.g., the alpha fetoprotein enhancer, the TTR minimal promoter / enhancer, LSP (TH-binding globulin promoter / alpha1-microglobulin / bikunin enhancer), amongst others. These control sequences can be operably linked to the asprosin and / or an analogue thereof sequences.
[0149] In some embodiments, the expressing region or expression cassette further includes a nucleic acid that encodes a polyadenylation (poly(A)) signal 3′ of the asprosin coding sequence such that the expressed mRNA has a polyA tail. In some embodiments, the nucleic acid that encodes the poly(A) signal comprises a bovine growth hormone (bGH) poly(A) tail signal or a simian virus 40 (SV40) poly(A) tail signal.
[0150] In some embodiments, the nucleic acid that encodes the simian virus 40 (SV40) poly(A) tail signal has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 6 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 6 or a reverse complementary sequence thereof.
[0151] In some embodiments, the expression cassette further comprises regulatory elements that may enhance the expression of the nucleic acid encoding asprosin or an analogue thereof. In one embodiment, the expressing region or expression cassette further comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). TheWPRE can downstream (3′ of), the EF-1 promoter sequence, the asprosin coding sequence and upstream (5′ of) the poly(A) tail signal.
[0152] In some embodiments, the nucleic acid that encodes the WPRE has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 5 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 5 or a reverse complementary sequence thereof.
[0153] In some embodiments, the expressing region is in an anti-sense (e.g., reverse complementary) orientation or in sense orientation. In some embodiments, the vector comprises two or more expressing regions. In some embodiments, the two or more expressing regions comprises one in antisense orientation and another in sense orientation
[0154] In some embodiments, the vector and / or expression cassette may further encode a secretory peptide that is expressed with the asprosin and / or an analogue thereof and promotes secretion / excretion of the asprosin and / or an analogue thereof from a cell or tissue of a subject that is treated. For example, the vector and / or expression cassette may further encode a signal sequence that promotes secretion of the expressed asprosin and / or an analogue thereof from a cell. For example, the nucleic acid can include cDNA encoding asprosin and IL2 signal sequence. In some embodiments, the IL2 is downstream (3′ of), the EF-1 promoter sequence upstream (5′ of) of the asprosin coding sequence and the poly(A) tail signal.
[0155] Vectors can also comprise other components or functionalities that further modulate gene delivery and / or gene expression, or that otherwise provide beneficial properties to the targeted cells. Such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide (such as one or more transcriptional regulatory sequences). Such components also might include markers, such as detectable and / or selectable markers that canbe used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities.
[0156] Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated. A variety of such marker genes have been described, including bifunctional (i.e., positive / negative) markers (see, e.g., Lupton, S., WO 92 / 08796, published May 29, 1992; and Lupton, S., WO 94 / 28143, published Dec.8, 1994). Such marker genes can provide an added measure of control that can be advantageous in gene therapy contexts. A large variety of such vectors are known in the art and are generally available.
[0157] In some embodiments, the vector can include an adenovirus (Ad) vector. An "adenovirus vector" refers to a recombinant vector derived from or comprising at least a portion of an adenovirus genome. Typically, an adenovirus vector can include the complete recombinant adenovirus genome on, for example, a plasmid, cosmid, or baculovirus vector. The nucleic acid molecules can be in the form of RNA or in the form of DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded.
[0158] One of ordinary skill will recognize that elements derived from multiple serotypes may be combined in a single adenoviral vector, such as a human or simian adenovirus. Thus, chimeric adenoviral vectors can be produced that combine desired properties from different serotypes. The adenovirus vector can be derived from one of adenovirus serotypes 2, 1, 5, 6, 19, 3, 11, 7, 14, 16, 21, 12, 18, 31, 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24 to 30, 37, 40, 41, AdHu2, AdHu 3, AdHu4, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6 , AdC7, AdC69, bovine Ad type 3, canine Ad type 2, sheep Ad or porcine Ad type 3. In particular embodiments the adenovirus vector can include a serotype 5 adenovirus (Ad5) vector.
[0159] An adenovirus vector described herein may be based on any type of adenovirus, and in certain embodiments is a human adenovirus, which may belong to any group or serotype. In some embodiments, the recombinant adenovirus is based on a human adenovirus from group A, B, C, D, E, F or G. In other embodiments, the recombinant adenovirus is based on human adenovirus serotype 5, 11, 26, 34, 35, 48, 49, or 50.
[0160] Adenovirus vectors, methods of construction and propagation thereof are well known in the art and are described, for example, in U.S. Pat. Nos.5,559,099, 5,837,511, 5,846,782, 5,851,806, 5,994,106, 5,994,128, 5,965,541, 5,981,225, 6,040,174, 6,020,191 and 6,113,913, and Thomas Shunk, "Adenoviridae and their Replication" [adenovirus and replication thereof], M.S. Horwitz, "Adenoviruses" [ adenovirus ], chapters 67 and 68, respectively, in Virology, B.N.fields et al, 3rd edition, new York Raven Press, ltd., new York (1996), and other references mentioned herein.
[0161] In some embodiments, the vector can include an adeno-associated virus (AAV) viral vector. An AAV viral vector is an AAV DNase-resistant particle having an AAV protein capsid into which is packaged nucleic acid sequences for delivery to target cells. An AAV capsid is composed of 60 capsid (cap) protein subunits, VP1, VP2, and VP3, that are arranged in an icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending upon the selected AAV. AAV serotypes may be selected as sources for capsids of AAV viral vectors (DNase resistant viral particles) including, e.g., AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S, AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV-RPF2, AAV3b, AAVrh64R1, or variants of any of the known or mentioned AAVs or AAVs yet to be discovered. See, e.g., US Published Patent Application No.2007-0036760-A1; US Published Patent Application No.2009-0197338-A1; EP 1310571. See also, WO 2003 / 042397 (AAV7 and other simian AAV), U.S. Pat. No. 7,790,449 and U.S. Pat. No.7,282,199 (AAV8), WO 2005 / 033321 and U.S. Pat. No. 7,906,111 (AAV9), and WO 2006 / 110689, and WO 2003 / 042397 (rh.10). In particular embodiments, the AAV viral vector is an AAV8 serotype AAV viral vector. In exemplary embodiments, the viral vector is an AAV8-IL2-Asprosin vector including an N-terminal his- tagged human asprosin coding region preceded by an IL2 signal peptide under control of an EF1 promoter.
[0162] Alternatively, a recombinant AAV based upon any of the recited AAVs, may be used as a source for the AAV capsid. In some embodiments, an AAV cap for use in the viral vector can be generated by mutagenesis (i.e., by insertions, deletions, or substitutions) of one of the aforementioned AAV Caps or its encoding nucleic acid. In some embodiments, the AAV capsid is chimeric, comprising domains from two or three or four or more of theaforementioned AAV capsid proteins. In some embodiments, the AAV capsid is a mosaic of Vp1, Vp2, and Vp3 monomers from two or three different AAVs or recombinant AAVs. In some embodiments, an rAAV composition comprises more than one of the aforementioned Caps.
[0163] For packaging an expression cassette into virions, the ITRs are the only AAV components required in cis in the same construct as the gene. In one embodiment, the coding sequences for the replication (rep) and / or capsid (cap) are removed from the AAV genome and supplied in trans or by a packaging cell line in order to generate the AAV vector. For example, a pseudotyped AAV may contain ITRs from a source which differs from the source of the AAV capsid. Additionally, or alternatively, a chimeric AAV capsid may be utilized. Still other AAV components may be selected. Sources of such AAV sequences are described herein and may also be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
[0164] Methods for generating and isolating AAV viral vectors that can be used for delivery to a subject are known in the art. See, e.g., U.S. Pat. No.7,790,449; U.S. Pat. No.7,282,199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and U.S. Pat. No.7,588,772 B2]. In a one system, a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding the transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus. More recently, systems have been developed that do not require infection with helper virus to recover the AAV--the required helper functions (i.e., adenovirus E1, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system. In these newer systems, the helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level. In yet another system, thetransgene flanked by ITRs and rep / cap genes are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of each of which is incorporated herein by reference in its entirety: U.S. Pat. Nos.5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol.99: 119-145; Buning et al., 2008, "Recent developments in adeno- associated virus vector technology," J. Gene Med.10:717-733; and the references cited below, each of which is incorporated herein by reference in its entirety. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2012). Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, (1993) J. Virol., 70:520-532 and U.S. Pat. No.5,478,745.
[0165] In some embodiments, an AAV vector plasmid is provided that may be used to prepare a recombinant AAV viral particle having a recombinant genome that includes a nucleotide sequence encoding the asprosin or an analogue thereof operably linked to regulatory elements that promote expression in appropriate tissues. The plasmids provided herein generally have an origin of replication and selectable markers to permit reproduction of the plasmid and use in host cells for generating the recombinant AAV viral particles described herein. An example of a plasmid and its sequence are depicted in Figs.1 and 2. The plasmids provided herein include plasmids comprising the expression cassettes described herein. In particular, the AAV vector plasmids can have a nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the AAV vector plasmid comprises a nucleic acid having a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 1; or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions, additions, deletions, or combinations thereof within.
[0166] In some embodiments, the AAV vector plasmid further comprises a bacterial expressing region. In some embodiments, the bacterial expressing region comprises a bacterial promoter and a nucleic acid that encodes a bacterial selecting region. In some embodiments, the nucleic acid that encodes the bacterial selecting region is operably linked to the bacterial promoter. In some embodiments, the nucleic acid that encodes the bacterial selecting region comprises a nucleic acid that encodes an antibiotic resistance gene or protein. In some embodiments, the antibiotic resistance gene or protein comprises an ampicillin resistance gene (AmpR) or a kanamycin resistance gene sequence (KanR). In some embodiments the bacteria promoter comprises AmpR promoter or a KanR promoter. In some embodiments, the AAV vector plasmid further comprises an origin of replication. In some embodiments, the origin of replication comprises a CMV origin of replication (ori). In some embodiments, the AAV vector plasmid further comprises a eukaryotic expressing region. In some embodiments, the eukaryotic expressing region comprises a eukaryotic promoter and a nucleic acid that encodes a eukaryotic selecting region. In some embodiments, the nucleic acid that encodes a eukaryotic selecting region is operably linked to the eukaryotic promoter. In some embodiments, the eukaryotic promoter comprises nucleic catabolite activator protein (CAP) binding site or a lactose (lac) promoter. In some embodiments, the eukaryotic selecting region comprises a lac operator. In some embodiments the plasmid comprises an M13 reverse primer region.
[0167] Optionally, the nucleic acid encoding asprosin and / or an analogue thereof described herein may be delivered via viral vectors other than rAAV or rAD. For example, other viral vectors that can be used herein include herpes simplex virus (HSV)-based vectors. HSV vectors deleted of one or more immediate early genes (IE) are advantageous because they are generally non-cytotoxic, persist in a state similar to latency in the target cell, and afford efficient target cell transduction. Recombinant HSV vectors can incorporate approximately 30 kb of heterologous nucleic acid.
[0168] Retroviruses, such as C-type retroviruses and lentiviruses, might also be used in the application. For example, retroviral vectors may be based on murine leukemia virus (MLV). See, e.g., Hu and Pathak, Pharmacol. Rev.52:493-511, 2000 and Fong et al., Crit. Rev. Ther. Drug Carrier Syst.17:1-60, 2000. MLV-based vectors may contain up to 8 kb of heterologous (therapeutic) DNA in place of the viral genes. The heterologous DNA may include a tissue-specific promoter and a nucleic acid encoding the asprosin and / or an analogue thereof. In methods of delivery to neural cells, it may also encode a ligand to a tissue specific receptor.
[0169] Additional retroviral vectors that might be used are replication-defective lentivirus-based vectors, including human immunodeficiency (HIV)-based vectors. See, e.g., Vigna and Naldini, J. Gene Med.5:308-316, 2000 and Miyoshi et al., J. Virol.72:8150- 8157, 1998. Lentiviral vectors are advantageous in that they are capable of infecting both actively dividing and non-dividing cells.
[0170] Lentiviral vectors for use in the application may be derived from human and non-human (including SIV) lentiviruses. Examples of lentiviral vectors include nucleic acid sequences required for vector propagation as well as a tissue-specific promoter operably linked to an asprosin and / or an analogue thereof encoding nucleic acid. These former may include the viral LTRs, a primer binding site, a polypurine tract, att sites, and an encapsidation site.
[0171] In some embodiments, a lentiviral vector can be employed. Lentiviruses have proven capable of transducing different types of CNS neurons (Azzouz et al., (2002) J Neurosci.22: 10302-12) and may be used in some embodiments because of their large cloning capacity.
[0172] A lentiviral vector may be packaged into any lentiviral capsid. The substitution of one particle protein with another from a different virus is referred to as “pseudotyping”. The vector capsid may contain viral envelope proteins from other viruses, including murine leukemia virus (MLV) or vesicular stomatitis virus (VSV). The use of the VSV G-protein yields a high vector titer and results in greater stability of the vector virus particles.
[0173] Alphavirus-based vectors, such as those made from semliki forest virus (SFV) and sindbis virus (SIN) might also be used in the application. Use of alphaviruses is described in Lundstrom, K., Intervirology 43:247-257, 2000 and Perri et al., Journal of Virology 74:9802-9807, 2000.
[0174] Recombinant, replication-defective alphavirus vectors are advantageous because they are capable of high-level heterologous (therapeutic) gene expression, and can infect a wide target cell range. Alphavirus replicons may be targeted to specific cell types by displaying on their virion surface a functional heterologous ligand or binding domain that would allow selective binding to target cells expressing a cognate binding partner. Alphavirus replicons may establish latency, and therefore long-term heterologous nucleic acid expression in a target cell. The replicons may also exhibit transient heterologous nucleic acid expression in the target cell.
[0175] In many of the viral vectors compatible with methods of the application, more than one promoter can be included in the vector to allow more than one heterologous gene to be expressed by the vector. Further, the vector can comprise a sequence, which encodes a signal peptide or other moiety, which facilitates expression of the asprosin and / or an analogue thereof from the target cell.
[0176] To combine advantageous properties of two viral vector systems, hybrid viral vectors may be used to deliver a nucleic acid encoding an asprosin and / or an analogue thereof to a target cell, or tissue. Standard techniques for the construction of hybrid vectors are well- known to those skilled in the art. Such techniques can be found, for example, in Sambrook, et al., In Molecular Cloning: A laboratory manual. Cold Spring Harbor, N.Y. or any number of laboratory manuals that discuss recombinant DNA technology. Double-stranded AAV genomes in adenoviral capsids containing a combination of AAV and adenoviral ITRs may be used to transduce cells. In another variation, an AAV vector may be placed into a “gutless”, “helper-dependent” or “high-capacity” adenoviral vector. Adenovirus / AAV hybrid vectors are discussed in Lieber et al., J. Virol.73:9314-9324, 1999. Retrovirus / adenovirus hybrid vectors are discussed in Zheng et al., Nature Biotechnol. 18:176-186, 2000. Retroviral genomes contained within an adenovirus may integrate within the target cell genome and effect stable gene expression.
[0177] Other nucleotide sequence elements, which facilitate expression of the asprosin and / or an analogue thereof and cloning of the vector are further contemplated. For example, the presence of enhancers upstream of the promoter or terminators downstream of the coding region, for example, can facilitate expression.
[0178] In accordance with another embodiment, a tissue-specific promoter can be fused to nucleotides encoding the asprosin and / or an analogue thereof described herein. By fusingsuch tissue specific promoter within the adenoviral construct, transgene expression is limited to a particular tissue. The efficacy of gene expression and degree of specificity provided by tissue specific promoters can be determined, using the recombinant adenoviral system.
[0179] In addition to viral vector-based methods, non-viral methods may also be used to introduce a nucleic acid encoding asprosin and / or an analogue thereof into a target cell. A review of non-viral methods of gene delivery is provided in Nishikawa and Huang, Human Gene Ther.12:861-870, 2001. An example of a non-viral gene delivery method according to the application employs plasmid DNA to introduce a nucleic acid encoding a asprosin and / or an analogue thereof into a cell. Plasmid-based gene delivery methods are generally known in the art.
[0180] Synthetic gene transfer molecules can be designed to form multimolecular aggregates with plasmid DNA. These aggregates can be designed to bind to a target cell. Cationic amphiphiles, including lipopolyamines and cationic lipids, may be used to provide receptor-independent nucleic acid transfer into target cells.
[0181] In addition, preformed cationic liposomes or cationic lipids may be mixed with plasmid DNA to generate cell-transfecting complexes. Methods involving cationic lipid formulations are reviewed in Felgner et al., Ann. N.Y. Acad. Sci.772:126-139, 1995 and Lasic and Templeton, Adv. Drug Delivery Rev.20:221-266, 1996. For gene delivery, DNA may also be coupled to an amphipathic cationic peptide (Fominaya et al., J. Gene Med. 2:455-464, 2000).
[0182] Methods that involve both viral and non-viral based components may be used according to the application. For example, an Epstein Barr virus (EBV)-based plasmid for therapeutic gene delivery is described in Cui et al., Gene Therapy 8:1508-1513, 2001. Additionally, a method involving a DNA / ligand / polycationic adjunct coupled to an adenovirus is described in Curiel, D. T., Nat. Immun.13:141-164, 1994.
[0183] Additionally, the nucleic acid encoding the asprosin and / or an analogue thereof can be introduced into the target cell by transfecting the target cells using electroporation techniques. Electroporation techniques are well known and can be used to facilitate transfection of cells using plasmid DNA.
[0184] The asprosin and / or an analogue thereof can be expressed for any suitable length of time within the target cell, including transient expression and stable, long-term expression. Advantageously, the asprosin and / or an analogue can be expressed in and secreted fromhepatic cells using an AAV8 vector at a level or amount effective to increase plasma levels in the subject being treated. By enhancing plasma levels of asprosin, a hormone capable of autonomously traversing the blood-brain barrier, challenges associated with directly transducing neurons in the CNS can be circumvented eliminating a significant obstacle in human gene therapy applications. Additionally, the use of AAV8 vectors allows for sustained, long-term elevation of plasma asprosin with a single administration, providing a practical and scalable therapeutic strategy.
[0185] In other embodiments, the level of plasma asprosin can be increased to increase Ptprd dephosphorylation of STAT3 and / or decrease Aβ induced STAT3 transcriptional activity in the cerebellum of the subject by systemically administering Tgf-β1 to a subject in need thereof. It was found that systemic administration of Tgf-β1 activates Fbn1 transcription in adipocytes, driving overproduction asprosin. Remarkably, a single exposure to elevated Tgf-β1 reshapes chromatin at the Fbn1 locus, cementing its overexpression in a manner that is unrelenting, even after normalization of Tgf-β1 levels and resulting in an enduring plasma asprosin elevation. Accordingly, method of treating cognitive decline and / or memory deficits, such as associative and novel object recognition memory deficits, Aβ mediated neurological pathologies, cachexia, and / or Alzheimer’s disease in a subject in need thereof can include administering a therapeutically amount of Tgf-β1 to the subject, wherein the amount of Tgf-β1 administered is an amount effective to increase plasma asprosin levels.
[0186] In still other embodiments, an agent that can increase Ptprd dephosphorylation of STAT3 and / or decrease Aβ induced STAT3 transcriptional activity in the cerebellum of the subject can include a small molecule Ptprd agonist. Small molecule Ptprd agonists can include compounds described, for example, in U.S. Patent Publication No.2023 / 0190701, which is incorporated herein by reference in its entirety. Such compounds can include those having formula (I):salt thereof; wherein R1is a hydrogen or -CH3, R2, R3, and R5are each independently hydrogen or -OH, and R4is hydrogen, -OH, or-OCH3. Examples of compounds having formula (I) include quercetin, fisetin, and myricetin.
[0187] In some embodiments, the agents described herein including asprosin and analogues thereof, vectors encoding asprosin and analogues thereof, Tgf-β1, and Ptprd agonists, can be formulated with a pharmaceutically acceptable carrier to provide a pharmaceutical compositions that can delivered to a subject, for example, subcutaneously, intranasally, parenterally, intravenously, intramuscularly, intrathecally, orally, and or by inhalation.
[0188] The pharmaceutical forms that can be injectable include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form can be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars or sodium chloride can be included. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0189] For administration of an injectable aqueous solution, for example, the solution can be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions can be suitable for intravenous, intramuscular, subcutaneous, intracerebroventricular, and intraperitoneal administration. In this connection, a sterile aqueous medium can be employed. For example, one dosage can be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,“Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.
[0190] Sterile injectable solutions can be prepared by incorporating the agent in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions can be prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation can be vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. Supplementary active ingredients can also be incorporated into the compositions. The phrase “pharmaceutically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
[0191] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the AAV vector delivered transgenes can be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
[0192] Such formulations can be used for the introduction of pharmaceutically acceptable formulations of the nucleic acids or the AAV constructs disclosed herein. The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-lives (U.S. Pat. No.5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos.5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).
[0193] Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of theDNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.
[0194] Liposomes can be formed from phospholipids that can be dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 Angstroms, containing an aqueous solution in the core.
[0195] Alternatively, nanocapsule formulations of the AAV vectors can be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 p.m) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.
[0196] The pharmaceutical compositions can be administered to any subject that can experience the beneficial effects of increasing or promoting one or more of Ptprd activity, Ptprd function, Ptprd signaling or Ptprd expression and / or decreasing Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling. Foremost among such animals are humans, although the present invention is not intended to be so limited.
[0197] The Ptprd agonist described herein, including for example a vector encoding asprosin and / or an analogue thereof, can be used in methods and compositions for treating or preventing one or more of disease or disorders associated with aberrant Ptprd activity, Ptprd function, Ptprd signaling or Ptprd expression and / or Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling.
[0198] In some embodiments, individuals to be treated have or are at risk of AD, cognition deficiency disorder, age-associated memory impairment, and / or dementia. For example, cognition deficiency disorder can relate to cognitive impairment leading to problems with a patient’s ability to think, learn, remember, use judgement, and make decisions. Signs of cognitive impairment include memory loss and trouble concentrating, completing tasks, understanding, remembering, following instructions, and solving problems.
[0199] In specific embodiments, the individuals to be treated have cognitive decline and / or memory deficits. Memory deficits can include associative memory deficits and / or novel object recognition memory deficits. Associative memory can refer to the ability to learn and remember the relationship between unrelated items or concepts. Novel object recognition memory can include a subject’s ability to recognize a novel object in the environment. In some embodiments, novel object recognition memory can be indicative of alterations in the working memory, attention, anxiety, and innate preference for novelty in a subject. In some embodiments, subjects to be treated in accordance with a method described herein that are suffering from a progressive decline in several forms of memory, including associative memory and / or novel object recognition, can also have Alzheimer’s disease.
[0200] Cognitive ability / impairment / decline may be determined by art-accepted methods, including, but not limited to, validated instruments that assess global cognition (e.g., the Modified Mini Mental State Examination (3MS-E)), and specific domains such as visual and verbal memory (e.g., the Brief Visuospatial Memory Test (Revised) (BVMT-R) and the Hopkins Verbal Learning Test (Revised) (HVLT-R), respectively), language (e.g., the Generative Verbal Fluency Test (GVFT)) and executive function and attention (e.g., the Digit Span Test (DST)).
[0201] The agents described herein can also be used in methods and compositions for treating or preventing Aβ mediated neurological pathogenesis in a subject. Aβ monomers are easily self-assembled into oligomers, protofibrils and beta-sheet-rich fibers, and are related to the pathogenesis of neurotoxicity. The Aβ mediated neurological pathogenesis can encompass the development all neurological diseases that may be caused by the aggregation and / or accumulation of Aβs. Examples of the Aβ mediated neurological pathogenesis related diseases include, but are not limited to, dementia (e.g., AD, vascular dementia, etc.), mild cognitive impairment, cerebral amyloid angiopathy, Down's syndrome, amyloid stroke, systemic amyloid bodies (DLB), multi-infarct dementia (MID), frontotemporal lobar degeneration (FTLD), Pick's disease, corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, Huntington's disease, and the like. The beta- amyloid mediated neurological pathogenesis-related disease may be selected from all diseases resulting from the aggregation and / or accumulation of beta-amyloids disease, Dutch amyloidosis, tauopathy, dementia with Lewy.
[0202] An important pathological feature of AD, which is a representative neurodegenerative disease, is the formation of peptide aggregates called "senile plaques", which causes synaptic dysfunction and neuronal death. The main component of these senile plaques is Aβ, which is 40 to 42 amino acids in length.
[0203] Therefore, in some embodiments, the pharmaceutical compositions described herein can be administered to a subject for the treatment of AD. Unambiguous diagnosis of AD requires clinical findings of cognitive deficits consistent with AD and post-mortem identification of brain pathologies consistent with AD. The term “probable AD” is used when a subject demonstrates clinical characteristics of AD and when other possible biological causes of dementia (e.g. Parkinson's disease or stroke) are excluded. There are a variety of art-accepted methods for diagnosing probable AD. Typically, methods of diagnosing AD are used in combination. These methods include determining an individual's ability to carry out daily activities and identifying changes in behavior and personality. Dementia of the AD type is also typically characterized by an amnestic presentation (memory deficit) or language, visuospatial or executive function deficits.
[0204] In some embodiments, the individuals to be treated may be in need of an increase in body weight, such as an increase in adipose mass and / or skeletal muscle mass. The individual may be in need of weight gain for a variety of reasons, including because of a medical condition or state or another reason. In cases wherein the individual is in need of weight gain because of a medical condition, the medical condition may or may not be a genetic condition and may or may not be an inherited condition. The cause of being in need of weight gain may be from genetics, metabolism, and / or illness.
[0205] In specific embodiments, an individual in need of weight gain is underweight (BMI of 18.5 or less). The individual that is subjected to methods and compositions of the disclosure may first be identified by a medical practitioner as in need of weight gain, and a therapeutic composition comprising at least one agent described herein may be delivered to the individual for the specific purpose of increasing weight.
[0206] In some embodiments, an individual is determined to be in need of weight gain, such as by measuring their weight and / or by measuring their BMI and / or having an MRI and / or DEXA scan for assessment of adipose mass. The individual may be known to be in need of weight gain or suspected of being in need of weight gain or at risk for being in needof weight gain. An individual may determine themselves that they are in need of weight gain and / or it may be determined by a suitable medical practitioner.
[0207] Once the individual is known to be in need of weight gain or known to be at risk or susceptible to being in need of weight gain, they may be given a suitable and effective amount of a composition including at least one agent described herein. In specific embodiments, the therapeutic agent is provided to the individual, such as in a composition or in multiple compositions. A composition comprising the agent may be specifically formulated for a particular therapeutic application.
[0208] The individual may or may not be monitored by a medical practitioner during the course of the therapeutic agent regimen. The individual may cease to take the therapeutic agent once a desirable weight is achieved and may resume taking the agent if the individual becomes in need of gaining weight at a later point in time. In the event that an individual exceeds a suitable amount of the agent such that too much weight is gained, the individual may decrease their weight by any suitable means, including by decreasing caloric intake.
[0209] In specific embodiments, the individual to be treated has cachexia, also referred to as “wasting syndrome”. Cachexia is typically characterized by anorexia and loss of fat and muscle mass and is known to be associated with several end‐stage organ diseases and advanced dementia. In cases wherein the individual is in need of weight gain because of cachexia, the cachexia can be associated with a chronic disease, such as but not limited to heart failure, inflammatory conditions such as chronic obstructive pulmonary disease (COPD), rheumatoid arthritis, cancer, human immunodeficiency virus, sepsis, renal and hepatic failure, dementia, and AD.
[0210] In certain embodiments, the cachexia is associated with the subject having or being at an increased risk of AD. Weight loss associated with AD is a multifactorial event, related not only to the cognitive impairment that is associated with loss of appetite and reduced food intake but also to AD‐linked alterations of energy consumption due to hypothalamic feeding dysregulation, olfactory changes and psycho‐behavioral disturbances, and the dysphagia (apraxia of swallowing) that is a common feature in the later stages of the disease, and which may also worsen malnutrition.
[0211] It will be appreciated that the amount, volume, concentration, and / or dosage of the agent, e.g., asprosin and / or an analogue thereof or a vector expressing the asprosin and / or an analogue thereof, that is administered to any one animal or human depends on manyfactors, including the subject’s size, body surface area, age, the particular composition to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Specific variations of the above noted amounts, volumes, concentrations, and / or dosages of the asprosin and / or an analogue thereof or a vector encoding the asprosin and / or an analogue thereof can readily be determined by one skilled in the art using the experimental methods described below.
[0212] By way of example, vectors encoding asprosin and / or an analogue thereof can often be administered less frequently than other types of therapeutics. For example, an effective amount of such a vector can range from about 0.01 mg / kg to about 5 or 10 mg / kg, inclusive; administered daily, weekly, biweekly, monthly or less frequently.
[0213] In some embodiments, the subject can be administered a fixed vector genome copy (GC) dose of purified viral vector including >99% of fully packaged viral particles. The fixed vector GC dose of a purified viral vector described herein can range from about 1x109GCs to about 1x1014GCs / kilogram bodyweight. In an exemplary embodiment, a subject is administered AAV8-IL2-Asprosin at a fixed vector GC dose of about 1 x 1012GC / kg.
[0214] In some aspects, administering the agent described to a subject can promote or increase plasma levels of asprosin and / or an analogue thereof compared to a control. In some aspects, administering the agent described herein to a subject increase plasma levels of asprosin and / or an analogue thereof by 5-fold to 100-fold compared to control (e.g., 5-fold to 10-fold, 10-fold to 15-fold, 10-fold to 20-fold, 15-fold to 25-fold, 20-fold to 30-fold, 25-fold to 35-fold, 30-fold to 40-fold, 35-fold to 45-fold, 40-fold to 60-fold, 50-fold to 75-fold, 60- fold to 80-fold, 75-fold to 100-fold compared to a control).
[0215] In some embodiments, a therapeutically effective dose of the agent is delivered to a subject in need thereof at least once daily or at least once weekly for at least two consecutive days or weeks. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof at least once daily or at least once weekly for at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive days or weeks. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof at least once daily or at least once weekly for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive weeks. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof at least once daily or at least once weekly for at most 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive days or weeks. In one aspect, a therapeuticallyeffective dose of the agent is delivered to subject in need thereof at least once daily or at least once weekly for at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive weeks or months. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof is administered at least once for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive months or years, chronically for a subject's entire life span, or an indefinite period of time. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof once a year for 2 consecutive years, 3 consecutive years, or 5 consecutive years. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof once a year for 2 consecutive years. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof once a year for 3 consecutive years. In one aspect, a therapeutically effective dose of the agent is delivered to subject in need thereof once a year for 5 consecutive years.
[0216] In some embodiments, a therapeutically effective dose of the agent achieves a remission, cure, response rate, or resolution rate of cognitive decline and / or memory deficits, such as associative and novel object recognition memory deficits, of at least about 50%. The term “remission”, “cure,” or “resolution rate” refers to the percentage of subjects in need thereof that are cured or obtain remission or complete resolution of cognitive decline or memory deficits in response to a therapeutically effective dose agent. As used herein, the term “response rate” refers to the percentage of subjects in need thereof that respond positively (e.g., reduced severity or frequency of one or more symptoms, such as cognitive decline or memory deficits) to a therapeutically effective dose of the agent.
[0217] In one aspect, a therapeutically effective dose eliminates, reduces, slows, or delays, cognitive decline or memory deficits, such as associative and novel object recognition memory deficits.
[0218] In other embodiments, a therapeutically effective dose of the agent achieves remission, cure, response rate, or resolution rate of cognitive decline or memory deficits, such as associative and novel object recognition memory deficits, of between about 10% and about 99% or more. In one aspect, a therapeutically effective dose achieves remission, cure, response rate, or resolution rate of a cognitive decline or memory deficits between 10% and 100%, such as between 10% and 15%, between 10% and 20%, between 10% and 25%, between 15% and 20%, between 15% and 25%, between 15% and 30%, between 20% and 25%, between 20% and 30%, between 20% and 35%, between 25% and 30%, between 25%and 35%, between 25% and 40%, between 30% and 35%, between 30% and 40%, between 35% and 45%, between 35% and 50%, between 40% and 45%, between 40% and 50%, between 40% and 55%, between 45% and 50%, between 45% and 55%, between 45% and 60%, between 50% and 55%, between 50% and 60%, between 50% and 65%, between 55% and 60%, between 55% and 65%, between 55% and 70%, between 60% and 65%, between 60% and 70%, between 60% and 75%, between 65% and 70%, between 65% and 75%, between 65% and 80%, between 70% and 75%, between 70% and 80%, between 70% and 85%, between 75% and 80%, between 75% and 85%, between 75% and 90%, between 80% and 85%, between 80% and 90%, between 80% and 95%, between 85% and 90%, between 85% and 95%, between 85%and 100%, between 90% and 95%, between 90% and 100%, or between 95% and 100%.
[0219] In another embodiment, a therapeutically effective dose of the agent eliminates, reduces, slows, or delays, one or more cognitive decline or memory deficits symptoms between 10% and 100%, such as between 10% to about 15%, between 10% and 20%, between 10% and 25%, between 15% and 20%, between 15% and 25%, between 15% and 30%, between 20% and 25%, between 20% and 30%, between 20% and 35%, between 25 and 30%, between 25% and 35%, between 25% and 40%, between 30% and 35%, between 30% and 40%, between 35% and 45%, between 35% and 50%, between 40% and 45%, between 40% and 50%, between 40% and 55%, between 45% and 50%, between 45% and 55%, between 45% and 60%, between 50% and 55%, between 50% and 60%, between 50% and 65%, between 55% and 60%, between 55% and 65%, between 55% and 70%, between 60% and 65%, between 60% and 70%, between 60% and 75%, between 65% and 70%, between 65% and 75%, between 65% and 80%, between 70% and 75%, between 70% and 80%, between 70% and 85%, between 75% and 80%, between 75% and 85%, between 75% and 90%, between 80% and 85%, between 80% and 90%, between 80% and 95%, between 85% and 90%, between 85% and 95%, between 85% and 100%, between 90% and 95%, between 90% and 100%, or between 95% and 100%.
[0220] In another embodiment, cognitive decline or memory deficits are assessed on the day of treatment, 1 day post treatment, 3 months post treatment, 6 months post treatment, 1 year post treatment and every year thereafter post treatment.
[0221] In other embodiments, cognitive decline or memory deficits are assessed between 1 day post treatment and 7 days post treatment. In one aspect, symptoms can beassessed between 1 day post treatment and 2 days post treatment, between 1 day post treatment and 3 days post treatment, between 1 day post treatment and 4 days post treatment, between 2 days post treatment and 3 days post treatment, between 2 days post treatment and 4 days post treatment, between 2 days post treatment and 5 days post treatment, between 3 days post treatment and 4 days post treatment, between 3 days post treatment and 5 days post treatment, 3 days post treatment and 6 days post treatment, between 4 days post treatment and 5 days post treatment, between 4 days post treatment and 6 days post treatment, between 4 days post treatment and 7 days post treatment, between 5 days post treatment and 6 days post treatment, between 5 days post treatment and 7 days post treatment, or between 6 days post treatment and 7 days post treatment. In one aspect, symptoms can be assessed between 1 week post treatment and 4 weeks post treatment. In one aspect, symptoms can be assessed between 1 week post treatment and 2 weeks post treatment, between 1 week post treatment and 3 weeks post treatment, between 1 week post treatment and 4 weeks post treatment, between 2 weeks post treatment and 3 weeks post treatment, between 2 weeks post treatment and 4 weeks post treatment, or between 3 weeks post treatment and 4 weeks post treatment. In one aspect, symptoms can be assessed between 1 month post treatment and 12 months post treatment. In one aspect, symptoms can be assessed between 1 month post treatment and 2 months post treatment, between 1 month post treatment and 3 months post treatment, between 1 month post treatment and 4 months post treatment, between 2 months post treatment and 3 months post treatment, between 2 months post treatment and 4 months post treatment, between 2 months post treatment and 5 months post treatment, between 3 months post treatment and 4 months post treatment, between 3 months post treatment and 5 months post treatment, between 3 months post treatment and 6 months post treatment, between 4 months post treatment and 5 months post treatment, between 4 months post treatment and 6 months post treatment, between 4 months post treatment and 7 months post treatment, between 5 months post treatment and 6 months post treatment, between 5 months post treatment and 7 months post treatment, between 5 months post treatment and 8 months post treatment, between 6 months post treatment and 7 months post treatment, between 6 months post treatment and 8 months post treatment, between 6 months post treatment and 9 months post treatment, between 7 months post treatment and 8 months post treatment, between 7 months post treatment and 9 months post treatment, between 7 months post treatment and 10 months post treatment, between 8 months post treatment and 9 months post treatment,between 8 months post treatment and 10 months post treatment, between 8 months post treatment and 11 months post treatment, between 9 months post treatment and 10 months post treatment, between 9 months post treatment and 11 months post treatment, between 9 months post treatment and 12 months post treatment, between 10 months post treatment and 11 months post treatment, between 10 months post treatment and 12 months post treatment, or between 11 months post treatment and 12 months post treatment. In one aspect, symptoms can be assessed between 1 year post treatment and about 20 years post treatment. In one aspect symptoms can be assessed between 1 year post treatment and 5 years post treatment, between 1 year post treatment and 10 years post treatment , between 1 year post treatment and 15 years post treatment, between 5 years post treatment and 10 years post treatment, between 5 years post treatment and 15 years post treatment, between 5 years post treatment and 20 years post treatment, between 10 years post treatment and 15 years post treatment, between 10 years post treatment and 20 years post treatment, or between 15 years post treatment and 20 years post treatment.
[0222] Still other embodiments described herein relate to kits comprising any of the agents described herein. In some aspects, any of the agents disclosed herein can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit can include one or more containers housing the components of the disclosure and instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In some aspects, the agents in a kit can be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes can contain the components in appropriate concentrations or quantities for running various experiments.
[0223] Also disclosed herein are kits for producing vectors, such as AAV vectors. In some aspects, the kit can comprise a container housing an isolated nucleic acid encoding an asprosin protein or an analogue thereof. In some aspects, the kits can further comprise instructions for producing the vector (e.g., AAV vector). In some aspects, the kit further comprises at least one container housing a recombinant vector, wherein the recombinant vector comprises a transgene (i.e., asprosin transgene).
[0224] In some aspects, the kits can include a container housing a recombinant vector as described supra. In some aspects, the kits can further comprises a container housing apharmaceutically acceptable carrier. For example, a kit can comprise one container housing a vector and a second container housing a buffer suitable for injection of the vector into a subject. In some aspects, the container can be a syringe.
[0225] In some embodiments, the kits can be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In some aspects, some of the compositions can be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, “instructions” can define a component of instruction and / or promotion, and typically involve written instructions on or associated with packaging of the disclosure. Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions can be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based communications, etc. The written instructions can be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflect approval by the agency of manufacture, use or sale for animal administration.
[0226] The kits disclosed herein can also contain any one or more of the components described herein in one or more containers. In some aspects, the kits can include instructions for mixing one or more components of the kit and / or isolating and mixing a sample and applying to a subject. The kits can include a container housing agents described herein. The agents can be in the form of a liquid, gel or solid (powder). The agents can be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively, it can be housed in a vial or other container for storage. A second container can have other agents prepared sterilely. Alternatively, the kits can include the active agents premixed and shipped in a syringe, vial, tube, or other container. The kits can have one or more or all of the components required to administer the agents to an animal, such as a syringe, topical application devices, or iv needle tubing and bag, particularly in the case of the kits for producing specific somatic animal models.
[0227] The kits disclosed can have a variety of forms, such as a blister pouch, a shrink wrapped pouch, a vacuum sealable pouch, a sealable thermoformed tray, or a similarpouch or tray form, with the accessories loosely packed within the pouch, one or more tubes, containers, a box or a bag. The kits can be sterilized after the accessories are added, thereby allowing the individual accessories in the container to be otherwise unwrapped. The kits can be sterilized using any appropriate sterilization techniques, such as radiation sterilization, heat sterilization, or other sterilization methods known in the art. The kits can also include other components, depending on the specific application, for example, containers, cell media, salts, buffers, reagents, syringes, needles, a fabric, such as gauze, for applying or removing a disinfecting agent, disposable gloves, a support for the agents prior to administration etc.
[0228] The invention is further illustrated by the following example, which is not intended to limit the scope of the claims. Example 1
[0229] This Example describes a plasmid encoding IL2-ASP. Fig.1 illustrates a map of the plasmid AV0-BWS-IL2-His-Asp which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising an EF-1 promoter (SEQ ID NO: 4), a nucleic acid encoding IL-2 signal peptide (SEQ ID NO: 3), a nucleic acid encoding asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises an ampicillin resistance gene (AmpR) promoter.
[0230] Fig.2 provides the double stranded nucleotide of the plasmid AV0-BWS-IL2- His-Asp (SEQ ID NO:1) which includes a nucleic acid encoding IL-2 signal peptide (SEQ ID NO: 3), a nucleic acid encoding asprosin (SEQ ID NO: 2).
[0231] Using the provided nucleotide sequence, PCR primers were designed:
[0232] Forward: Gtgaggaattggatccgccaccatgtacaggatgc (SEQ ID NO: 9).
[0233] Reverse: ATTATCGATAGAATTCTATTAATGAAGCAAAACCTGGATT (SEQ ID NO: 10).
[0234] The PCR product was purified over 1% agarose gel and cloned into the BamHI / EcoRI sites of AV0.1-BWS (EF1 promoter, WPRE and SV40 polyA) using a kit (In- Fusion Cloning kit, Clontech). As for control AAV, 2.8 kb C346 BamHI / EcoRIwas first cloned into pLPBL-1, excised by AscI digestion and then cloned into AV0.1.
[0235] The integrity of ITR was tested by SmaI digestion. AAV was packaged by 3 plasmids transfection (XX, Rep / Cap, AdΔF6 helper plasmid) into 293T cells by iMFectin(GenDepot). 20 x 15-cm dish for each construct were transfected and cell associated and media secreted AAV were collected separately 3 days after transfection. Cell associated AAV was recovered by cell lysis and media secreted AAV was precipitated by PEG. They were combined and purified by iodixanol density gradient.
[0236] The titer of the AAV vectors were quantified with the primers corresponding to 5IEE (partial sequence of 5’ integration efficiency element in wild type AAV) The following QPCR primers were used:
[0237] Forward: TGCTCTAGAGTGGAGTCGTGACGTGAATTAC (SEQ ID NO: 11).
[0238] Reverse: TGCTCTAGAACGCGTAATGGAGACCCTGCGTGCTC (SEQ ID NO: 12). Example 2
[0239] Recent discoveries have fundamentally challenged traditional views of memory circuitry, revealing a surprising and transformative role for the cerebellum, a brain region historically associated primarily with motor coordination. Once considered subordinate to cortical structures in terms of cognition, the cerebellum is now recognized as an active participant in higher-order functions, including attention, language, and crucially, learning and memory. Functional imaging and behavioral studies have demonstrated that specific cerebellar regions, notably the lateral hemispheric zones known as Crus I and Crus II, exhibit significant activity during tasks involving associative learning and fear conditioning. These regions are thought to integrate multimodal sensory information with emotional and contextual cues, suggesting that the cerebellum acts as a critical hub for connecting sensory, emotional, and cognitive inputs necessary for memory formation and retrieval. Despite this emerging framework, the molecular and cellular mechanisms through which cerebellar Purkinje neurons, the principal and sole output neurons of the cerebellar cortex, contribute to associative memory remain largely unexplored.
[0240] This example addresses this critical gap by focusing on the hormone asprosin, an adipose-derived, fasting-induced hormone with both central and peripheral effects. Asprosin is known to cross the blood-brain barrier and activate cerebellar Purkinje neurons to enhance thirst and hypothalamic AgRP neurons to enhance appetite. It does so by functioning as a ligand for Protein Tyrosine Phosphatase Receptor δ (Ptprd) to modulateneuronal plasticity and activity by influencing downstream signaling pathways. For example, Ptprd, activated by asprosin, dephosphorylates Signal Transducer and Activator of Transcription 3 (Stat3), a transcription factor that regulates genes critical for synaptic adaptation, neuronal survival, and homeostasis. Here, we demonstrate that Purkinje neuron asprosin-Ptprd signaling is essential for associative memory and identify its disruption as a key pathological feature of AD. Utilizing two independent AD mouse models, the 5xFAD transgenic mice and the APPNL-G-Fknock-in mice, we show that peripheral asprosin supplementation reactivates Ptprd signaling in Purkinje neurons and fully restores associative memory deficits. These findings establish asprosin-Ptprd signaling as a critical regulator of cognitive function and introduce a novel therapeutic paradigm that links peripheral metabolic signals to central memory processes.
[0241] By uncovering an unexpected role for the cerebellum in memory restoration, our work highlights it as an untapped therapeutic frontier in neurodegenerative diseases. This study not only identifies a new molecular pathway underlying cognitive decline but also lays the groundwork for a scalable and clinically translatable intervention. The ability to restore associative memory deficits through peripheral administration of asprosin opens new avenues for the treatment of AD and potentially other neurodegenerative disorders characterized by cognitive decline. Methods Mouse Models
[0242] WT C57BL / 6 mice (WT mice; Jackson Laboratory, JAX #:000664), AgRP- IRES-cre (C57BL / 6-Agrptm1(cre)Lowl, Jackson Laboratory JAX #: 012899), Pcp2-cre (B6.129-Tg(Pcp2-Cre)2Mpin / j, Jackson Laboratory, JAX #:004146 ) and CaMKIIα-cre (B6.Cg-Tg(Camk2a-cre)T29-1Stl / J, Jackson Laboratory, JAX #: 005359) were purchased from Jackson Laboratories. Alzheimer’s mouse models 5xFAD mice (B6.Cg- Tg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas / Mmjax, Jackson Laboratory, JAX #034848-JAX) were purchased from Jackson Laboratories and AppNL-G-Fmice were obtained from RIKEN, Japan.
[0243] Homozygous conditionally ready Ptprd floxed mice (Ptprd tm2c(KOMP)Wtsi) were mated with AgRP-IRES-cre (C57BL / 6-Agrptm1(cre)Lowl) to create AgRP neuron specific knock-out of Ptprd. Homozygous conditionally ready Ptprd floxed mice (Ptprdtm2c(KOMP)Wtsi) were mated with Pcp2-cre (B6.129-Tg(Pcp2-Cre)2Mpin / j) to create Purkinje neuron specific knock-out of Ptprd. Homozygous conditionally ready Ptprd floxed mice (Ptprd tm2c(KOMP)Wtsi) were mated with CaMKIIα-cre (B6.Cg-Tg(Camk2a-cre)T29- 1Stl / J) to create CaMKIIα-neuron specific knock-out of Ptprd.
[0244] Mice were housed in micro ventilators on a 12-hour light cycle (6am-6pm) in an animal facility maintained at 20-25°C and 40-60% humidity. Mice had ad libitum access to water and normal chow. Animal housing, husbandry, experiments, and euthanasia were conducted under animal protocols approved by the Case Western Reserve University Institutional Animal Care and Use Committee (protocol# 2018-0042). General health of mice was monitored by the CWRU animal resource center. Human Biofluid Samples
[0245] De-identified cerebrospinal fluid and plasma samples were obtained from the Cleveland Clinic Lou Ruvo Center for Brain Health Aging and Neurodegeneration Biobank (CBH-biobank) which is approved by the Cleveland Clinic Institutional Review Board for sharing human biospecimens for research purposes. This study was reviewed and approved by the Case Western Reserve University Institutional Review Board for utilization of de- identified human biospecimens. CBH-biobank research participants undergo clinical evaluation, including neurological examination and neuropsychological testing, as well as collection of blood and cerebrospinal fluid for research purposes. The CBH-biobank cerebrospinal fluid and plasma samples obtained for our study included; 20 cognitively normal older adults, 20 mildly cognitively impaired adults, 19 Alzheimer’s disease patients, 20 Parkinson disease patients and 1 Frontal Temporal Dementia patient for a total of 80 unique participant samples. Altogether, 160 samples were tested for asprosin levels. Viral Vectors for Asprosin Overexpression
[0246] Six-month old C57BL / 6J 5xFAD or APPNL-G-Fmice were injected intravenously via tail-vein with adeno-associated virus, serotype 8 (AAV8) dissolved in 150 µl USP-grade sterile saline. Control mice injected with AAV8-empty (1 × 1012GC / mouse), while experimental mice received AAV8-Asprosin (1 × 1012GC / mouse), containing a construct encoding N-terminal his-tagged human asprosin, preceded by an IL2 signal peptide anddriven by the EF1α promoter. Body weight was measured three months post-injection to evaluate weight gain as an indicator of elevated plasma asprosin levels. Asprosin ELISA
[0247] A custom-built sandwich ELISA was employed to measure plasma asprosin levels in both humans and mice with Alzheimer's disease, as well as in their respective control groups. For this assay, 25 µL of plasma or 50 µL of CSF was used, with asprosin captured by a fully human anti-asprosin monoclonal antibody, which was developed from a naïve human phage display antibody library by panning against recombinant full-length human asprosin (Texas Therapeutics Institute at the University of Texas Health Science Center at Houston). A mouse anti-asprosin monoclonal antibody, targeting human asprosin amino acids 106-134 (corresponding to human profibrillin amino acids 2838-2865), served as the detection antibody. An HRP-linked anti-mouse secondary antibody was used to generate the detection signal. To create a standard curve, recombinant mouse asprosin produced in mammalian cells (AdipoGen AG-40B-0174T-C010) was used. The blocking, coating, substrate, and stop solutions were purchased from SeraCare. Western Blot Analysis
[0248] Snap-frozen cerebellar tissue from both WT and 5xFAD mice, as well as from humans with Alzheimer’s disease (AD) and unaffected controls, was homogenized using N- PER Neuronal Protein Extraction Reagent (Thermo Fisher Scientific, 87792) supplemented with protease inhibitor (Thermo Fisher Scientific, 78429) and phosphatase inhibitor (Thermo Fisher Scientific, 78420) to produce protein lysates. Protein concentrations were quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23227).
[0249] Subsequently, 25 µg of protein lysate was loaded onto a 4-12% Bolt Bis-Tris Protein Gel (Thermo Fisher Scientific, NW04127BOX) and electrophoresed for approximately 1.5 hours using Bis-Tris running buffer. Precision Plus Protein Kaleidoscope (Bio-Rad, 1610375) was used as the molecular weight ladder. Proteins were transferred onto nitrocellulose membranes using the Invitrogen Power Blotter System for 10 minutes at room temperature.
[0250] Membranes were blocked with Clear Milk Blocking Buffer (Thermo Fisher Scientific, 37587), diluted 1X in TBST, for 1 hour at room temperature. Primary antibodieswere diluted in the same blocking buffer and incubated with the membranes overnight at 4°C. Following primary antibody incubation, membranes were washed with 1X TBST and then incubated with HRP-conjugated mouse or rabbit secondary antibodies, diluted in 1X TBST, for 2 hours at room temperature. Chemiluminescent signals were detected using a 1:1 ratio of HRP substrates (Thermo Fisher Scientific, 34577 and 34094).
[0251] For all western blots, molecular weight markers and experimental samples were run on the same gel. Membranes were cut at approximately 50 kDa, allowing separate incubation of the segments with antibodies against PTPRD and β-actin. Primary antibodies used were Rabbit Polyclonal anti-PTPRD (1:500; ABclonal, A15713) and Mouse Monoclonal anti-β-actin (1:2000; Cell Signaling, 8H10D10). Secondary antibodies included HRP-conjugated anti-rabbit IgG (1:10,000; Cytiva, NA934) and HRP-conjugated anti-mouse IgG (1:10,000; GeneTex, GTX213112-01). Cell Culture and Luciferase Assays
[0252] HEK293T cells were cultured at 37°C in 5% CO₂ in DMEM supplemented with 10% fetal bovine serum (FBS; HyClone) and 100 µg / ml penicillin-streptomycin. For all experiments, HEK293T cells were transfected with the 4xM67 pTATA-TK-Luc plasmid (Addgene, 8688), which contains Stat3-response elements driving luciferase expression.
[0253] To evaluate the effects of amyloid β (Aβ) on PTPRD activity, HEK293T cells seeded at 10,000 cells / well in 96-well plates were transfected with 2 µg of the 4xM67 pTATA-TK-Luc plasmid. The following day, 300 nM of recombinant Aβ1-40(Sigma Aldrich, A1075), Aβ1-42Sigma Aldrich, PP69), reverse-sequence Aβ40-1 (Sigma Aldrich, A2326), or recombinant green fluorescent protein (GFP; USBiological, G8965-10E) was added to the cells. After 24 hours, Stat3-mediated luciferase activity was measured.
[0254] To investigate competition between Aβ and asprosin, HEK293T cells transfected with 2 µg of the 4xM67 pTATA-TK-Luc plasmid were transfected with 400 ng of either an asprosin-expressing plasmid or an empty vector control. Twenty-four hours post- transfection, 300 nM Aβ1-40(Sigma Aldrich, A1075) or GFP was added in fresh media. After 6 hours, Stat3-driven luciferase activity was measured.
[0255] To assess the effect of PTPRD loss on Stat3 activity, HEK293T cells transfected with 2 µg of the 4xM67 pTATA-TK-Luc plasmid were transfected with either 25 nM PTPRD-specific siRNA or pooled scrambled siRNA (Dharmacon, T-2001-02) using themanufacturer’s protocol. Twenty-four hours after siRNA transfection, cells were treated with Aβ1-40or GFP. Forty-eight hours post-transfection (24 hours after protein treatment), cells were lysed to assess siRNA knockdown efficiency, measure phospho-Stat3 levels via western blot, and quantify Stat3-mediated luciferase activity.
[0256] Transfection of HEK293T cells was performed using FuGENE HD transfection reagent (Promega, E2312) according to the manufacturer’s instructions. Cells were lysed using Reporter Lysis 5X Buffer (Promega, E3971), and luciferase activity was measured using Luciferase Assay Reagent (Promega, E1483). All assays were performed following standard manufacturer protocols. Surface plasmon resonance (SPR)
[0257] Surface plasmon resonance (SPR) studies were performed using Biacore T200 (Cytivia) with PTPRD (Acro Biosystems, PTD-H52H9) covalently immobilized on an S series CM5 sensor chip via amine coupling. Recombinant human Aβ1-42 in HFIP (Sigma Aldrich AG968-1MG) was dissolved in PBSP+ (Cytiva) and flowed over the PTPRD bound sensor chips at serial dilution concentrations (1000nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM, 15.625 nM). Recombinant asprosin concentrations from 18.75nM to 300nM in series dilution were co-injected with 25nM of Aβ at 30 μL / min over the Ptprd bound sensor chip at 25ºC to assess competitive binding. Surface was regenerated with Glycine, pH 1.5 for 30s at 30 μL / min. Two different recombinant asprosin preparations were tested (Novus Biologicals NBP3-18164; Biobyrt, orb1784787). Data were analyzed using BiaEvaluation software and redrawn with Origin Software. Immunohistochemistry Staining
[0258] Mice were deeply anesthetized with a ketamine-xylazine cocktail, confirmed by a toe pinch, and transcardially perfused with 30 mL of 1x phosphate-buffered saline (PBS) followed by 30 mL of 4% paraformaldehyde (PFA) in PBS. Brains were extracted, post- fixed in 4% PFA for 24 hours at 4°C, and cryoprotected in 20% sucrose in PBS.
[0259] Brains were sectioned into 30-µm-thick coronal slices using a Leica SM2010 R Sliding Microtome. Sections were stored in cryoprotectant solution (30% ethylene glycol, 20% glycerol in PBS) at -20°C until further use. Prior to staining, sections were rinsed in PBS to remove cryoprotectant, treated with 0.3% H₂O₂ in PBS for 30 minutes, washed, andblocked in 10% Normal Donkey Serum (Jackson ImmunoResearch, AB_2337258) for 1 hour.
[0260] Sections were incubated overnight at 4°C with primary antibodies diluted in 1% Normal Donkey Serum: Rabbit anti-p-Stat3 (1:1000; Cell Signaling, 9145L) and Monoclonal anti-calbindin (1:500; Sigma-Aldrich, C9848-100UL). The next day, sections were washed and exposed to secondary antibodies (1:200 dilution): goat anti-mouse Alexa 488 (Thermo Fisher, A32723) and goat anti-rabbit Alexa 594 (Thermo Fisher, A32740). Following PBS washes, sections were stained with 300 nM DAPI in PBS, rinsed, mounted onto slides, and sealed with Vectashield mounting medium (H-1000).
[0261] Fluorescently labeled sections were imaged using a Zeiss Axio Scan.Z1 slide scanner with consistent acquisition settings across all samples for quantitative analysis. Immunohistochemistry Analysis
[0262] Similar Regions of Interest for analysis and quantification were selected using image processing software (ImageJ). Cerebellar regions were cropped and analyzed for simultaneous expression of phosphorylated Stat3 (red color channel) and Calbindin (green color channel). In the cerebellum, calbindin only stains Purkinje neurons. Each image was filtered to remove noise using non-local means filtering. Pixels containing expression of phosphorylated Stat3 and calbindin were determined through Otsu thresholding. This isolated the cells and removed the background fluorescence present in the images. The overlap of expression between the two channels was determined by counting the number of pixels that passed the Otsu threshold in both channels. The sum total of these pixels represents the total overlap between the two channels within cells. Overlap was calculated by dividing the total number of pixels by the size of the image, generating a measure for expression per unit area. Behavioral Assays Open Field
[0263] The open field assay was used to evaluate general motor activity and anxiety- like behavior, following established protocols. Mice were tested in a 4-arena (50 cm x 50 cm) system (ANYmaze, Stoelting) for 15 minutes, with their order randomized. The apparatus was cleaned with 70% ethanol between trials to minimize olfactory cues.Novel Object Recognition
[0264] The same apparatus as the open field assay was used for the novel object recognition (NOR) test to assess recognition memory. Testing occurred the day after the open field assay. On Day 1, mice were exposed to two identical objects (50 mL Falcon tubes). On Day 2, one object was replaced with a novel object (three 15 mL Falcon tubes attached together). Interaction times with each object on Day 2 were recorded in a blinded manner. The recognition index was calculated as Recognition Index = 100 × (novel object interaction time / total interaction time). The apparatus was cleaned with 70% ethanol between trials. Barnes Maze
[0265] The Barnes maze consisted of a 92 cm diameter circular platform with 20 evenly spaced 5 cm holes, one of which served as the target escape hole under an escape box. The maze was elevated 75 cm above the floor, with uniform illumination at 800 lux. During habituation, each mouse was placed in the maze center under a glass cylinder for 30 seconds before being guided to the escape box, where they explored for 2 minutes and then stayed for 1 minute. Training consisted of three trials on Day 1 and two trials on Day 2. Mice started under a covered box in the maze center and were allowed 2 minutes to find the escape hole. If successful, mice stayed in the escape box for 1 minute; if unsuccessful, they were guided to it. Visual cues around the room aided spatial orientation. A probe trial was conducted 48 hours after training to assess spatial memory. The escape box was removed, and mice explored for 120 seconds. Time spent in the target quadrant and the number of holes searched were recorded. Fear Conditioning
[0266] Fear conditioning was performed using conditioning chambers (20 cm x 20 cm x 30 cm; Med Associates) with three metal walls, a transparent front, a grid floor for foot shocks, and a speaker for auditory cues. Chambers were cleaned with 70% ethanol between subjects.
[0267] On Day 1, mice were acclimated to the chamber for 3 minutes. During the next 30 seconds, a conditioned stimulus (CS; 5000 Hz tone, 80 dB) was presented, co-terminating with an unconditioned stimulus (US; 0.5 mA foot shock, 1 second). This pairing wasrepeated four times with 60-second inter-trial intervals. Mice were returned to their home cages 60 seconds after the last shock.
[0268] On Day 2, cued fear memory or contextual memory was assessed. For cued, mice were placed in a novel context (different chamber with distinct visual and olfactory cues) for 3 minutes to acclimate. Subsequently, the auditory CS tone was presented twice for two 30 second periods with an inter-trial interval of 60 seconds. Freezing during the CS presentation was recorded and averaged.
[0269] For contextual memory, mice were placed in the original chamber (identical to Day 1) for 5 minutes without auditory cues. Freezing behavior was recorded as an indicator of contextual fear memory. After the session, mice were returned to their home cages, and the apparatus was thoroughly cleaned to remove any odors or residues.
[0270] All fear conditioning data were collected under blinded conditions. 5xFAD mice were injected with AAV and tested by Bijoya Basu at Case Western Reserve University on Med Associates fear Conditioning Apparatus, base dimensions: 20cm x 20cm. Apparatus was cleaned with 70% ethanol in between animals. APPNL-G-Fmice were injected with AAV and tested at Baylor College of Medicine by Hesong Liu on Fusion Stimulus Hub with SuperFlex Open Field system (OmniTech Electronics, Inc), base dimensions: 60cm X 60cm. The chambers were cleaned with soapy water between animals. Quantification and Statistical Analysis
[0271] Data was graphed and analyzed using GraphPad Prism (Version 9 and higher). Minimal sample sizes and statistical analysis were planned before the study based on the nature of experiments and preliminary findings. All results are presented as mean ± standard error of the mean (SEM.) and individual data points. Statistical significance of continuous data was tested using unpaired Student’s t-tests or Analysis of Variance (one-way and two- way ANOVA, when appropriate) followed by the Bonferroni multiple test corrections post- hoc analysis using GraphPad Prism 7. Appropriate nonparametric tests were run when data did not meet parametric assumptions. Repeated measures analysis was used in experiments that involved multiple measures of the same variable. Age- and sex-matched mice were randomly assigned to groups for all experiments. Immunohistochemistry and behavioral analysis studies were done in a blinded fashion. Alpha (a) for statistical significance was set at 0.05.Results Purkinje neuron-specific Ptprd is necessary for mammalian associative memory
[0272] In this example, we investigated whether the absence of Ptprd specifically in Purkinje neurons affects cognitive function. To that end, we generated mice with Ptprd ablation in Purkinje neurons (Pcp2-cre;PtprdFlox / Flox) by crossing PtprdFlox / Floxmice with mice expressing Cre recombinase under the control of the Purkinje cell protein 2 (Pcp2) promoter. This genetic approach ensured that Ptprd was specifically ablated in Purkinje neurons while remaining intact in other cell types.
[0273] We began by assessing associative memory using a classical cued fear conditioning paradigm (Fig.3A). Mice underwent four training sessions where a neutral auditory cue (80^dB, 5000^Hz, 30^seconds) co-terminated with a mild foot shock (0.5^mA, 1^second) in a conditioning chamber. After training, mice were returned to their home cages with ad libitum access to food and water. The following day, we evaluated memory retention through two tests: (1) Contextual Memory Test: Mice were placed back into the original conditioning environment for 5^minutes without any auditory cues. Freezing behavior was recorded to assess memory of the context associated with the aversive stimulus. (2) Cued Memory Test: Mice were placed in a novel environment and exposed to the auditory cue without the foot shock. Freezing behavior was measured to evaluate the association between the cue and the aversive event, independent of the context.
[0274] Our results revealed that male Pcp2-cre;PtprdFlox / Floxmice exhibited significantly impaired cued fear-conditioned memory compared to control groups (Pcp2- cre;Ptprd+ / +and PtprdFlox / Floxmice), despite normal fear acquisition during training (Fig.3B– E). No significant differences were observed in contextual fear-conditioned memory between the groups. A similar impairment in cued associative memory was observed in female mice, indicating that the effect is not sexually dimorphic (Fig.3F–I).
[0275] To determine whether the loss of Ptprd in Purkinje neurons affected other cognitive functions, we conducted additional behavioral assays. In the Barnes maze test, which assesses spatial learning and memory, and the Novel Object Recognition (NOR) test, which evaluates recognition memory, Pcp2-cre;PtprdFlox / Floxmice performed comparably to control mice (Fig.8C, D, G, H). Additionally, assessments of anxiety-like behavior and locomotor activity using the Open Field test revealed no significant differences betweengroups (Fig.8A, B, E, F). We have previously shown that Purkinje neuron-specific Ptprd ablation has no impact on motor learning, locomotion and coordination via an extensive battery of tests under baseline and challenge paradigms, nor does it have any impact on Purkinje neuron morphology. Furthermore, no differences were observed between the two control groups (Pcp2-cre;Ptprd+ / +and PtprdFlox / Floxmice), indicating that neither the Cre recombinase expression nor the floxed Ptprd alleles independently affect the behavioral outcomes (Fig.9).
[0276] These results are further corroborated by the findings of Han et al., who demonstrated that Stat3 knockout in Purkinje neurons enhances associative memory. The reciprocal effects of Purkinje neuron-specific Ptprd and Stat3 ablation provide strong evidence for the functional antagonism between Ptprd and Stat3 in regulating associative memory. The specific deficit in cued associative memory, without affecting contextual memory, spatial learning, recognition memory, anxiety-like behavior, or locomotor function, highlights the specialized role of Ptprd-mediated signaling in Purkinje neurons for associative learning processes. Hypothalamic AgRP neuron-specific or forebrain excitatory neuron-specific Ptprd is dispensable for mammalian associative memory
[0277] We sought to determine whether Ptprd expression in AgRP neurons also plays a role in regulating memory, akin to its critical function in Purkinje neurons. To investigate this possibility, we generated mice with a constitutive knockout of Ptprd specifically in AgRP neurons (AgRP-cre;PtprdFlox / Flox) by crossing PtprdFlox / Floxmice with those expressing Cre recombinase under the control of the AgRP promoter. AgRP-cre;PtprdFlox / Floxmice did not demonstrate any differences in associative memory measured via the cued fear conditioning assay when compared to AgRP-cre;Ptprd+ / +mice (Fig.10A-C). These findings demonstrate that Ptprd expression in hypothalamic AgRP neurons is dispensable for mammalian associative memory, in stark contrast to its essential role in Purkinje neurons.
[0278] Forebrain excitatory neurons, particularly those in the hippocampus and cerebral cortex, play well-established roles in various forms of learning and memory, including spatial, contextual, and declarative memory. The hippocampus is crucial for the formation and retrieval of contextual and spatial memories, while the cortex is involved in the storage and processing of complex associative information. Given the significance of cortical andhippocampal excitatory neurons in memory regulation, and the robust expression of Ptprd within both brain structures, we investigated whether Ptprd expression in these neurons influences associative memory as assessed by the cued fear conditioning paradigm. To this end, we generated mice with a conditional knockout of Ptprd in forebrain excitatory neurons using the CaMKIIα-cre mouse line, which drives Cre recombinase expression predominantly in excitatory neurons of the forebrain, including the hippocampus and cortex. Importantly, this model spares the cerebellum entirely allowing a rigorous comparison with Purkinje neuron-specific deletion of Ptprd. Behavioral assessments of CaMKIIα-cre;PtprdFlox / Floxmice revealed no significant deficits in associative memory compared with controls, as measured by the cued fear conditioning assay (Fig.10D-F), suggesting that Ptprd expression in forebrain excitatory neurons is not essential for cued associative memory. Ptprd activity is downregulated in Alzheimer’s disease
[0279] Given that deficits in associative memory are a hallmark of Alzheimer's disease (AD), we investigated whether components of the asprosin-Ptprd signaling axis are perturbed in rodent models or human subjects afflicted by the disease. Initially, we measured asprosin levels in plasma and cerebrospinal fluid (CSF) from human donors with AD and mild cognitive impairment (MCI), comparing them to unaffected control subjects. Our analyses revealed that asprosin concentrations in both plasma and CSF were unchanged in AD and MCI patients relative to controls (Fig.4A–B). Similarly, in the 5xFAD mouse model of AD, plasma asprosin levels were comparable to those of age- and sex-matched WT littermates at 6 months of age (Fig.4E).
[0280] Next, we assessed Ptprd protein expression in cerebellar lysates from 5xFAD mice and human AD donors. Consistent with our findings for plasma and CSF asprosin, Ptprd protein levels in the cerebellum were unaltered in 5xFAD mice compared to WT controls, as well as in human AD donors compared to age- and sex-matched unaffected individuals (Fig.4C-D, F).
[0281] Considering the critical role of Ptprd's phosphatase activity in neuronal signaling, we evaluated Ptprd activity specifically in Purkinje neurons of the cerebellum. For this, we measured levels of phosphorylated Stat3 (p-Stat3) in Purkinje neurons of 5xFAD mice and WT littermates at 6 months of age. Ptprd dephosphorylates Stat3 at Tyrosine 705, leading to decreased Stat3 transcriptional activity. Our previous studies demonstrated thatmice with elevated circulating asprosin exhibit significantly reduced hypothalamic p-Stat3 levels, whereas Ptprd- / -mice and mice with plasma asprosin sequestration using an anti- asprosin monoclonal antibody show increased hypothalamic p-Stat3 levels compared to WT mice. These findings establish p-Stat3 levels as a robust and reliable, bidirectional indicator of Ptprd activity in vivo.
[0282] In this context, we found that 5xFAD mice exhibited significantly higher levels of p-Stat3 in the Purkinje cell layer of the cerebellum (Fig.4G–L), suggesting a downregulation of Ptprd activity in these neurons. This increase in p-Stat3 was consistent across multiple cerebellar regions implicated in associative memory, including Crus I, Crus II, and lobules VI and IX. Functional MRI studies have increasingly highlighted the cerebellum's role in associative memory, particularly within the framework of fear conditioning and learning. Regions such as Crus I and Crus II show significant activation in response to conditioned stimuli during both acquisition and extinction phases, while lobule VI is prominently engaged during the recall of fear memories. The observed elevation of p- Stat3 in Purkinje neurons across key cerebellar regions strongly suggests that Ptprd activity, which normally dephosphorylates Stat3, is significantly reduced in the 5xFAD mouse model of AD. Asprosin Outcompetes Aβ to Restore Ptprd Activity
[0283] To elucidate the mechanism by which Alzheimer's disease (AD) affects Ptprd activity, and to assess whether asprosin can restore Ptprd function under these conditions, we investigated the interaction between β-amyloid (Aβ) and Ptprd. Given that extracellular Aβ aggregates play a central role in AD pathogenesis, we hypothesized that Aβ may impair Ptprd activity by directly interacting with the extracellular domain of the receptor.
[0284] We conducted in vitro experiments using HEK293T cells, which naturally express both Ptprd and Stat3, transfected with Stat3 response element driven luciferase, allowing a readout of Stat3 transcriptional activity. The cells were exposed to either recombinant Aβ1-40or an inactive control peptide, the reverse-sequence Aβ40-1. Given our previous demonstration that Ptprd and Stat3 are inextricably functionally linked, measuring Stat3 transcriptional activity allowed us to infer changes in Ptprd activity. Our results demonstrated that cells treated with Aβ exhibited significantly higher Stat3 transcriptional activity compared to those exposed to the reverse-sequence Aβ control (Fig.5A), suggestingthat Aβ impairs Ptprd activity, leading to enhanced phosphorylation and transcriptional activity of Stat3.
[0285] To determine whether asprosin could rescue Ptprd activity in the presence of Aβ, we enhanced asprosin levels in the culture medium. This was achieved by transfecting cells with a mammalian expression plasmid encoding human asprosin, equipped with an IL-2 signal peptide to promote secretion. Upon elevating media asprosin levels, we observed a significant reversal of the Aβ-induced increase in Stat3 transcriptional activity (Fig.5B). This indicates that asprosin can restore Ptprd function despite the presence of Aβ. To validate these findings, we repeated the experiments using recombinant green fluorescent protein (GFP) as an additional protein control and obtained consistent results (Fig.5C–D). To confirm that Stat3 transcriptional activity accurately reflects Ptprd activity, we performed Ptprd knockdown using small interfering RNA (siRNA). Knocking down Ptprd increased baseline Stat3 activity, and abolished any Aβ-induced increase (Fig.5E), reinforcing that the observed effects are specifically mediated through Ptprd. We found that Aβ1-42, the major pathogenic form of Aβ, mirrored Aβ1-40in its ability to robustly enhance Stat3 transcriptional activity (Fig.5F).
[0286] Further, we investigated the binding interactions between Aβ, asprosin, and Ptprd using surface plasmon resonance (SPR) analysis. SPR revealed that Aβ1-42 directly binds to the extracellular (ligand-binding) domain of Ptprd with a dissociation constant (KD) of 47.44^nM, comparable to the binding affinity previously reported for asprosin (Fig.5H). In contrast, the reverse-sequence Aβ control peptide showed no binding to Ptprd (Fig.5G). Importantly, introducing recombinant asprosin resulted in a dose-dependent decrease in the binding affinity of Aβ for Ptprd, with a half-maximal inhibitory concentration (IC₅₀) of 15.23^nM (Fig.5I), indicating that asprosin can effectively outcompete Aβ for Ptprd binding at relatively low concentrations. While asprosin binding itself would be expected to increase the SPR signal due to its larger molecular weight, the observed decrease in signal reflects Aβ shedding. This suggests that Aβ likely binds Ptprd in a multivalent or high-stoichiometry manner, with potentially hundreds of Aβ molecules interacting with each Ptprd receptor. When asprosin binds, it dislodges numerous Aβ molecules rather than replacing them in a strict 1:1 manner. SPR, however, cannot differentiate between signal reductions caused by Aβ shedding versus increases from asprosin binding. These findings align with our earlier functional results (Fig.5A-F) and further emphasize asprosin's ability to effectively displaceAβ from Ptprd through competitive binding. This dynamic interaction underscores the mechanistic basis for asprosin's capacity to restore Ptprd function, even in the presence of substantial Aβ interference. Plasma asprosin elevation restores Purkinje neuron Ptprd activity in mice with AD
[0287] Building upon our in vitro findings that asprosin can rescue Ptprd activity impaired by Aβ, we investigated whether asprosin supplementation could restore Ptprd function in Purkinje neurons of 5xFAD mice – a well-established Alzheimer's disease model characterized by elevated Aβ levels. To elevate plasma asprosin levels, we employed an adeno-associated virus serotype 8 vector encoding human asprosin linked to an interleukin-2 signal peptide driven by an EF1α promoter (AAV8-Asprosin). This strategy does not lead to central nervous system (CNS) transduction as AAV8 exhibits minimal tropism for the CNS. Instead, it increases human asprosin levels in the periphery by targeting the liver for transgene expression, followed by secretion into the bloodstream facilitated by the IL-2 signal peptide. Asprosin has been previously demonstrated to cross the blood-brain barrier, allowing it to reach and activate its endogenous receptors in the brain without the need for direct CNS transduction. Mice treated with AAV8-Asprosin showed a significant reduction in p-Stat3 levels within Purkinje neurons across multiple cerebellar regions implicated in associative memory, including Crus I, Crus II, and lobules VI, VIII and IX (Fig.6A-F). This decrease in p-Stat3 suggests a reactivation of Ptprd phosphatase activity in these neurons.
[0288] Our findings indicate that elevating plasma asprosin is effectively able to overcome the AD-induced downregulation of Ptprd activity to restore receptor function and normalize downstream signaling in vivo, similar to that observed in in vitro models. Asprosin gene therapy restores associative memory in AD
[0289] To investigate whether asprosin could rescue AD-associated memory deficits secondary to reactivation of its receptor, we assessed 5xFAD mice treated with AAV8- Asprosin or AAV8-Empty control. Both male and female 5xFAD mice treated with AAV8- Asprosin demonstrated a significant increase in plasma asprosin levels and a restoration of associative memory, performing at levels comparable to WT mice treated with AAV8-Empty (Fig.7E-J, Fig.11I, J), indicating a complete recovery of associative memory function (Fig.7E-J). Importantly, no significant differences were observed between treated andcontrol 5xFAD mice in other memory assessments, including the Barnes Maze and Novel Object Recognition tests, or in anxiety and locomotion as measured by the Open Field assay (Fig.11A-H). This specificity underscores the targeted effect of the asprosin-Ptprd pathway on associative memory.
[0290] To further validate these findings, we replicated the experiment using the APPNL-G-Fmouse model of AD at an independent laboratory with a different experimenter. This model avoids amyloid precursor protein (APP) overexpression by employing a knock-in strategy that maintains APP expression at WT levels. Despite normal APP expression, these mice produce elevated levels of pathogenic Aβ due to three familial AD-linked mutations and also exhibit tau pathology. The APPNL-G-Fmice treated with AAV8-Asprosin exhibited significant improvements in associative memory compared to those treated with the AAV8- Empty control (Fig.7C, D). These results confirm that asprosin plays a unique role in modulating the associative memory pathway and demonstrate that associative memory deficits in diverse AD models are recoverable through plasma asprosin supplementation.
[0291] Consistent with asprosin's known orexigenic properties, asprosin supplementation resulted in a significant increase in body weight in both AD mouse models (Fig.7A,B). Unintended weight loss is a common feature in individuals with AD and is associated with increased morbidity and mortality. Our data indicates that asprosin supplementation could serve as a dual therapy for recovery of associative memory deficits and unintended weight loss in individuals with AD.
[0292] Our findings highlight the cerebellum's significant contribution to associative memory and its potential involvement in AD-related cognitive decline. By demonstrating that Ptprd deletion in Purkinje neurons impairs associative memory, we reveal a specific cerebellar mechanism that may be disrupted in AD. This challenges the traditional view that cognitive deficits in AD are solely due to hippocampal and cortical dysfunction and suggests that cerebellar circuits play a more pivotal role in certain forms of memory than previously appreciated. Notably, our experiments showed that Ptprd deletion in forebrain excitatory neurons did not impair associative memory, despite the well-established roles of the hippocampus and cortex in memory processes. This specificity underscores the unique contribution of cerebellar Purkinje neurons to associative learning. Furthermore, the differential impact of Ptprd deletion depending on the neuronal population emphasizes the importance of cell-type-specific expression of Ptprd in cognitive functions. Thus, whileforebrain excitatory neurons are crucial for certain memory types, Ptprd's role in associative memory is predominantly mediated through Purkinje neurons in the cerebellum.
[0293] Mechanistically, we found that Aβ directly binds to the extracellular domain of Ptprd, causing receptor deactivation. Asprosin, a natural agonist of Ptprd, can outcompete Aβ and reactivate the receptor both in vitro and in vivo. Remarkably, plasma asprosin supplementation was sufficient to fully recover associative memory deficits in two independent AD mouse models. Although plasma and CSF asprosin levels are unchanged in AD, the pathological accumulation of Aβ interferes with asprosin-Ptprd signaling by binding to Ptprd and inhibiting its activity. This suggests that normal asprosin levels are insufficient to activate Ptprd in the presence of Aβ. Our findings demonstrate that elevating asprosin concentrations can outcompete Aβ for Ptprd binding, restoring receptor activity and normalizing downstream signaling pathways. Therefore, the therapeutic benefit of asprosin supplementation in AD arises not from correcting an asprosin deficiency but from overcoming Aβ-mediated inhibition of Ptprd.
[0294] Aβ’s extracellular accumulation positions it to directly disrupt hormone-receptor signaling pathways that originate outside the cell. For example, Aβ has been shown to compete with insulin for binding to the insulin receptor (IR), impairing brain insulin signaling and leading to downregulation of IR activity. Similarly, the observed interaction between Aβ and Ptprd reflects a broader mechanism where Aβ interferes with ligand-receptor signaling, undermining pathways critical for neuronal function. This dual role – extracellular plaque formation and active disruption of signaling – highlights Aβ’s multifaceted contribution to neuronal dysfunction in Alzheimer’s disease.
[0295] To rigorously assess asprosin supplementation as a therapeutic strategy across different AD contexts, we utilized two distinct transgenic mouse models: 5xFAD and APPNL-G-F. The 5xFAD model emphasizes Aβ pathology through overexpression of mutant APP and presenilin-1 proteins, leading to rapid and aggressive plaque formation. In contrast, the APPNL-G-Fmodel employs a knock-in strategy that maintains APP expression at WT levels while introducing three familial AD-linked mutations, resulting in elevated levels of pathogenic Aβ and tau pathology, offering varying degrees of relevance to human AD. The success of AAV8-asprosin gene therapy in restoring associative memory across both models enhances confidence in its potential translatability to human patients.
[0296] Our findings may also illuminate the sundowning phenomenon observed in AD, where patients experience clearer thinking in the morning and worsening symptoms later in the day. This pattern aligns with the circadian rhythm of plasma asprosin, which peaks after an overnight fast. The higher morning levels of asprosin could potentially explain the improved memory seen in AD patients during this time. Additionally, this connection may help explain why intermittent fasting, which elevates asprosin levels, has been shown to enhance memory and cognitive function in AD models.
[0297] Importantly, we developed a novel gene therapy using an adeno-associated virus to successfully restore associative memory in two independent AD mouse models, with full recovery observed in both male and female 5xFAD mice. This peripheral gene therapy approach offers several advantages. By enhancing plasma levels of asprosin, a hormone capable of autonomously traversing the blood-brain barrier, we circumvent the challenges associated with directly transducing neurons in the CNS, a significant obstacle in human gene therapy applications. Additionally, the use of AAV8 vectors allows for sustained, long-term elevation of plasma asprosin with a single administration, providing a practical and scalable therapeutic strategy. Additionally, given asprosin’s orexigenic properties, this therapeutic approach led to a significant increase in body weight in both AD models. Since AD progression is often accompanied by unintended weight loss and cachexia, contributing to patient frailty and increased morbidity, asprosin therapy could serve as a dual intervention – ameliorating cognitive deficits while also addressing metabolic and nutritional challenges. Example 3 Asprosin Gene Therapy Restores Associative and Recognition Memory in APPNL-GFAlzheimer’s Model
[0298] We replicated our findings in 5xFAD mice using the APPNL-G-Fmouse model of AD at an independent laboratory. This model avoids amyloid precursor protein (APP) overexpression by employing a knock-in strategy that maintains APP expression at WT levels. Despite normal APP expression, these mice produce elevated levels of pathogenic Aβ due to three familial AD-linked mutations and also exhibit tau pathology. The APPNL-G-Fmice treated with AAV8-Asprosin exhibited significant improvements in associative memory compared to those treated with the AAV8-Empty control (Fig.12F, G) and in recognition memory (Fig.12B). These results confirm that asprosin plays a role in modulating theassociative memory pathway and demonstrate that associative memory deficits in diverse AD models are recoverable through plasma asprosin supplementation.
[0299] Interestingly, the rescue of recognition memory observed in the APPNL-G-Fmodel was absent in the 5xFAD model. Given the greater severity of hippocampal damage in 5xFAD mice, this result suggests that asprosin’s effects on memory recovery may depend on the timing of intervention.
[0300] Consistent with asprosin's known orexigenic properties, asprosin supplementation resulted in a significant increase in body weight in both AD mouse models (Fig.12A). Unintended weight loss is a common feature in individuals with AD and is associated with increased morbidity and mortality. Our data indicates that asprosin supplementation could serve as a dual therapy for recovery of associative memory deficits and unintended weight loss in individuals with AD. Methods Mouse Models
[0301] AppNL-G-Fmice were obtained from RIKEN, Japan. Viral Vectors for Asprosin Overexpression
[0302] Six-month old APPNL-G-Fmice were injected intravenously via tail-vein with adeno-associated virus, serotype 8 (AAV8) dissolved in 150 µl USP-grade sterile saline. Control mice injected with AAV8-empty (1 × 1012GC / mouse), while experimental mice received AAV8-Asprosin (1 × 1012GC / mouse), containing a construct encoding N-terminal his-tagged human asprosin, preceded by an IL2 signal peptide and driven by the EF1α promoter. Body weight was measured three months post-injection to evaluate weight gain as an indicator of elevated plasma asprosin levels. Behavioral Assays Novel Object Recognition
[0303] The same apparatus as the open field assay was used for the novel object recognition (NOR) test to assess recognition memory. Testing occurred the day after the open field assay. On Day 1, mice were exposed to two identical objects (50 mL Falcon tubes). On Day 2, one object was replaced with a novel object (three 15 mL Falcon tubesattached together). Interaction times with each object on Day 2 were recorded in a blinded manner. The recognition index was calculated as Recognition Index = 100 × (novel object interaction time / total interaction time). The apparatus was cleaned with 70% ethanol between trials. Barnes Maze
[0304] The Barnes maze consisted of a 92 cm diameter circular platform with 20 evenly spaced 5 cm holes, one of which served as the target escape hole under an escape box. The maze was elevated 75 cm above the floor, with uniform illumination at 800 lux. During habituation, each mouse was placed in the maze center under a glass cylinder for 30 seconds before being guided to the escape box, where they explored for 2 minutes and then stayed for 1 minute. Training consisted of three trials on Day 1 and two trials on Day 2. Mice started under a covered box in the maze center and were allowed 2 minutes to find the escape hole. If successful, mice stayed in the escape box for 1 minute; if unsuccessful, they were guided to it. Visual cues around the room aided spatial orientation. A probe trial was conducted 48 hours after training to assess spatial memory. The escape box was removed, and mice explored for 120 seconds. Time spent in the target quadrant and the number of holes searched were recorded. Y Maze
[0305] The Y maze used in this study was made from opaque plastic and featured three identical arms (designated A, B, and C), each measuring 35 cm in length, 5.7 cm in width, and 14.6 cm in height, converging symmetrically at a central junction. During each trial, mice were placed at the end of arm A and allowed to explore the maze freely for a period of 5 minutes. Arm entries into were recorded to assess spontaneous alternation behavior, defined as consecutive entries into all three arms without repeating any arm. To eliminate olfactory cues, the maze was thoroughly cleaned with 70% ethanol between trials. Fear Conditioning
[0306] Fear conditioning was performed using conditioning chambers (20 cm x 20 cm x 30 cm; Med Associates) with three metal walls, a transparent front, a grid floor for foot shocks, and a speaker for auditory cues. Chambers were cleaned with 70% ethanol between subjects.
[0307] On Day 1, mice were acclimated to the chamber for 3 minutes. During the next 30 seconds, a conditioned stimulus (CS; 5000 Hz tone, 80 dB) was presented, co-terminating with an unconditioned stimulus (US; 0.5 mA foot shock, 1 second). This pairing was repeated four times with 60-second inter-trial intervals. Mice were returned to their home cages 60 seconds after the last shock.
[0308] On Day 2, cued fear memory or contextual memory was assessed. For cued, mice were placed in a novel context (different chamber with distinct visual and olfactory cues) for 3 minutes to acclimate. Subsequently, the auditory CS tone was presented twice for two 30 second periods with an inter-trial interval of 60 seconds. Freezing during the CS presentation was recorded and averaged.
[0309] For contextual memory, mice were placed in the original chamber (identical to Day 1) for 5 minutes without auditory cues. Freezing behavior was recorded as an indicator of contextual fear memory. After the session, mice were returned to their home cages, and the apparatus was thoroughly cleaned to remove any odors or residues.
[0310] All fear conditioning data were collected under blinded conditions. APPNL-G-Fmice were injected with AAV and tested at Baylor College of Medicine by Hesong Liu on Fusion Stimulus Hub with SuperFlex Open Field system (OmniTech Electronics, Inc), base dimensions: 60cm X 60cm. The chambers were cleaned with soapy water between animals. Example 4
[0311] This example identifies Tgf-β1as a master regulator of Fbn1 transcription in adipocytes, linking its actions directly to increased plasma asprosin levels. Mechanistically, Tgf-β1 induces chromatin remodeling at the Fbn1 locus, ensuring sustained elevation of asprosin even after Tgf-β1 levels normalize. Methods Mice
[0312] Wild-type C57BL / 6 mice (WT mice; JAX# 000664), C57BL / 6J DIO (JAX# 380050), Fbn1NPS / +(C57BL / 6- C57BL / 6-Fbn1em1Chop / J; JAX# 033548), and FVB / NJ (JAX# 001800) were purchased from The Jackson Laboratory (JAX).
[0313] Because female DIO mice used in our breeding study are not available for purchase, we had to generate our own line of mice. To do this, 3 week old female WTC57BL / 6 mice were purchased from JAX and put on Teklad high fat diet (HFD) (60% fat, TD.06414, Envigo) for 6 months. During this time, they were mated with males twice to ensure they were capable of producing viable pups, but those pups were not used in this study. Only after the female mice had been on HFD for 6 months, they were bred with new 12-week-old WT male mice, and these were the pups used for the study. For the Tgf-β1 injection study, 9 week old female FVB / NJ mice were purchased from the Jackson Laboratory and mated with 12 week old WT male mice.
[0314] Age- and sex-matched Littermates from in-house mating served as controls in all experiments, except for WT lean and DIO mice that were bought from the Jackson Laboratory and used for experimentation after acclimation to the mouse housing facility. Mice were housed in micro-ventilator cages on a 12-hour light cycle in animal facility maintained at 20-25ºC and 40-60% humidity. Mice had ad-libitum access to water and normal chow (5V5R, lab Supply), Teklad high fat diet (TD.06414, Envigo), or dustless pellet diet (F0172, Bio-Serv), unless otherwise specified.
[0315] Animal housing, husbandry, and euthanasia were conducted under animal protocols approved by the Case Western Reserve University Institutional Animal Care and Use Committee (protocol# 2018-0042). General health of mice was monitored by the CWRU animal resource center. Tgf-β1 injection into FVB / NJ females
[0316] 9-week-old female FVB / NJ mice were mated with 12-week-old WT male mice or 12-week-old Fbn1NPS / +mice. Time of pregnancy was noted by observation of vaginal plug and exactly 14 days later, subcutaneous injections started. Specifically, 2µg of recombinant Tgf-β1 (Biolegend, 763104) was injected twice daily [morning (8-9am) and afternoon(4- 5pm)] made up in 100 µl of sterile USP-grade saline for about 7 days or until the females gave birth. The pups were weaned and placed on normal chow. Metabolic caging and food intake assessment
[0317] Metabolic caging experiments were performed at the Cardiovascular Research Institute Mouse Metabolic and Phenotyping Core at CWRU (IACUC# 2019-0029). Mice were housed with a 12-h light / dark cycle (7am / 7pm) at 22ºC with controlled humidity. Metascreen software (V2.3.15.11) controlled system data acquisition. Respirometry (VO2,VCO2, H2O vapor) were collected individually using a Promethion metabolic cage system (Sable Systems, Las Vegas, NV, USA). Gas analyzers were calibrated before each run. Gas measurements were multiplexed over 8 cages and baselined to a cage-equivalent volume of room air twice per 5-minute cycle, while maintaining a 2L / min / cage, negative pressure- derived flow rate. Acquired data was processed using Macro Interpreter (V2.34) running Macro V2.33.3-slice1hr. Energy expenditure was calculated using the Weir equation (Weir, 1949).
[0318] For manual food intake measurements, mice were acclimated to dustless pellet diet (F0173, Bio-Serv) for three days in single-housing, after which the 24 hour food intake was measured. For the pups from Tgf-β1 injected female manual food intake, the mice were acclimated to a crushed high fat diet formed into a ball (60% calories from fat, TD.06414, Envigo Teklad) in single housing for three days. The diet was replenished, weighed, and re- weighed to establish a 24-hour food intake. Cell lines and reagents
[0319] Cell lines were incubated at 37℃ with 5% CO2 under humidified conditions. 3T3-L1 cells (CL-173) were purchased from ATCC. Mouse recombinant carrier-free Tgf-β1 (763104), IFN-γ (575302), IL-1B (575102), IL-6 (575702), TNF-α (575202) were all purchased from Biolegend. A-485 (HY-107455) was purchased from MedChemExpress. pLenti-mTgf-β1 (MR227339L4) was purchased from Origene. Differentiation of 3T3-L1 cells
[0320] The differentiation protocol of 3T3-L1 cells used was one previously published utilizing a cocktail consisting of IBMX, rosiglitazone, insulin, and dexamethasone. Briefly, undifferentiated 3T3-L1 cells were plated into 12-well plates at 0.8x105cells / well. Cells were grown to 100% confluency and 48 hours later, a cocktail of differentiation media [High Glucose DMEM, 10% FBS, 1uM Dexamethasone (Cayman Chemical Company, 11015), 0.5mM IBMX (Cayman Chemical Company, 13347), 10 ug / mL Insulin (Sigma-Aldrich, I9278), 30 µM Rosiglitazone (Cayman Chemical Company, 71740)] was added for 48 hours. Then the media was changed to a maintenance media (High Glucose DMEM, 10% FBS, 10 µg / mL Insulin) and kept for 5 days.Quantitative PCR
[0321] For cell culture work, Smad7 and FBN1 expression was measured in differentiated 3T3-L1 cells. For in-vivo tissue, white adipose tissue (visceral perigonadal adipose tissue unless stated otherwise) was excised from mice. Aliquots of these tissues weighing 0.3 grams and cells were used for RNA extraction using the RNeasy kit (Qiagen) following manufacturer’s instructions. For adipose tissue, a tissue homogenizer was utilized. First strand cDNA was synthesized with IscriptTMcDNA synthesis kit (Bio-Rad) and subjected to qPCR analysis.
[0322] Real-time qPCR was performed using Power SYBRTMGreen PCR Master Mix (Thermo Fisher) and the Bio-Rad CFX96 Real-Time system (Bio-Rad). The following primers were used: 18S-Fwd: 5’CTGAGAAACGGCTACCACATC3’ (SEQ ID NO: 134); 18S-Rev: 5’GCCTCGAAAGAGTCCTGTATTG3’ (SEQ ID NO: 14) ; FBN1-Fwd: 5’CTGGGACCTACTCCTTACAAATC3’ (SEQ ID NO: 15); FBN1-Rev: 5’GTTCACCACTGAGGTAGTCTTT3’ (SEQ ID NO: 16); Smad7-Fwd: 5’GCCCTCCCTGGATATCTTCTAT3’ (SEQ ID NO: 17); Smad7-Rev: 5’GATCTTGCTCCGCACTTTCT3’ (SEQ ID NO: 18).
[0323] Specifically for assessing additional transcription start sites on the FBN1 gene specific for asprosin, more primer sets were utilized against FBN1, the primer set listed above was the ‘Asprosin’ primer set as depicted in the figure. The following primers were the other two primer sets shown: FBN1_1-Fwd: 5’CAGGCTCTTCTGTGTCGATATT3’ (SEQ ID NO: 19); FBN1_1-Rev: 5’TGGCTGACAGCTACATTCATAG3’ (SEQ ID NO: 20); FBN1_2- Fwd: 5’GCATTTGTCCTCCAGACTACAT3’ (SEQ ID NO: 21); FBN1_2-Rev: 5’GGTCTGGTTGTCAGCGTAATAG3’ (SEQ ID NO: 22). shRNA knockdown
[0324] For shRNA knockdown of genes, the pLKO.1-TRC lentiviral cloning vector was utilized following Addgene’s protocol (10878, Addgene) previously reported. For controls, the empty vector was utilized. The packaging vectors used to generate lentiviral particles were psPAX2 (12260, Addgene) and pCMV-VSV-G (8454, Addgene) that were transfected into HEK293T cells using Fugene HD.48 hours laters, viral particles were collected and concentrated using Lenti-X Concentrator (Takara, 631231). The sequences of primers used to target each gene are provided. Furthermore, 3 different viruses targeting 3different guide sequences to the same gene were pooled and all transduced to a single sample of cells to maximize knock-down efficacy. mRNA half-life
[0325] 20 g / ml of recombinant mouse Tgf-β1 was added to differentiated 3T3-L1 cells. 24 hours later, 30 µg / ml actinomycin D was added. RNA was collected at 0, 1, 6, 12, and 24 hours post addition of actinomycin D and purified using RNeasy Mini Kit (Qiagen). Half-life was determined using a previously published method, specifically using quantitative PCR with primers against FBN1. A one phase decay non-linear fit model was used to determine half-life. Asprosin ELISA A custom-built sandwich ELISA was used for measuring plasma asprosin. Asprosin in 25 µL plasma (plus 75ul PBS) was captured using a fully human anti-asprosin monoclonal antibody (human anti-asprosin mAb), previously generated from a naïve human phage display antibody library by panning against recombinant full-length human asprosin (Texas Therapeutics Institute at the University of Texas health Science Center at Houston). A mouse anti-asprosin monoclonal antibody (mouse anti-asprosin mAb), against human asprosin amino acids 106-134 (human profibrillin amino acids 2838-2865) served as the detection antibody. An anti-mouse secondary antibody linked to HRP was used to generate a signal, and mammalian-cell produced recombinant mouse asprosin (Biolegend 762002) was used to generate a standard curve.
[0326] For the media asprosin ELISA, 100 µl of media was used. In addition, the capture antibody was the mouse anti-asprosin mAb. The detection antibody was a fully rabbit anti-asprosin monoclonal antibody (rabbit anti-asprosin mAb) that was generated by immunizing rabbits with recombinant full-length human asprosin at RevMAb Biosciences, USA, and cloning variable region genes from positive single memory B cells based on protocols described previously. An anti-rabbit secondary antibody linked to HRP was used to generate a signal. Adeno-associated virus Injection
[0327] Six 14-week-old normal chow fed female WT C57Bl / 6 from JAX were injected intravenously via the tail-vein with adeno-associated virus (AAV) serotype 8 as previouslydescribed dissolved in 150 µl USP-grade sterile saline. Mice injected with AAV8-empty (1 x 1012GC / mouse) served as controls for experimental mice that received AAV8-IL2-asprosin (1 x 1012GC / mouse) containing an N-terminal his-tagged human asprosin coding region preceded by an IL2 signal peptide, under control of an EF1 promoter. 5 weeks after injection, plasma was collected via cheek bleed. The injected females were then set up for matings with 12-week-old WT males. RNA sequencing
[0328] Fully differentiated 3T3-L1 cells were incubated with PBS, recombinant Tgf-β1 for 4 days, or recombinant Tgf-β1 for 4 days plus an additional 14 days in Tgf-β1 free media. Total RNA was extracted using RNeasy Mini Kit (Qiagen #74106). Quality control of total RNA samples was executed using Qubit Fluorometer (Invitrogen) for RNA quantification and Fragment Analyzer 5200 (Agilent) to assess RNA quality using a cut-off of RIN >7.0 to select specimens for further analysis. The NEBNext rRNA Depletion Kit v2 (Human / Mouse / Rat) (New England Biolabs) was completed first. The rRNA-depleted RNA was used as input for the NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England BioLabs) in which libraries were tagged with unique adapter-indexes. Final libraries were validated on the Fragment Analyzer, quantified via qPCr, and pooled at equimolar ratios. Pooled libraries were diluted, denatured and loaded onto the Illumina NextSeq 550 sequencing system, following the Illumina User Guide for a single read run. To analyze gene expression changes, reads were aligned to the mm10 genome build using kallisto v0.46.1. The transcripts were quantified in TPM, which was further processed into gene-level TPM abundance using tximport. Differential gene expression analysis was conducted using edgeR v3.36.0, and significant genes were called based on an adjusted P value of less than 0.05 with a log2 (FC) greater than 1. Gene set enrichment analysis was generated from the c2.cp.keg database using 1,000 permutations. ATAC sequencing
[0329] Fully differentiated 3T3-L1 cells were incubated with PBS, recombinant Tgf-β1 for 4 days, or recombinant Tgf-β1 for 4 days plus an additional 14 days in Tgf-β1 free media. Samples were prepared following protocol provided at ATAC-seq kit (Active Motif #53150). Samples were run on an E-Gel EX 2% Agarose gel (Thermo Fisher Scientific) prior tomanual size selection for fragments less than 1000bp and extraction was done using the Qiagen Qiaquick Gel extraction kit. Insert size distribution was determined with an Agilent TapeStation assay and samples were quantified by qPCR using a commercially available kit (KAPA Biosystems). Sample concentrations were normalized to 1.2 nM and loaded onto an Illumina NovaSeq flow cell at a concentration that yields 50 million passing filter clusters per sample. Samples were sequenced using 150bp paired-end sequencing on an Illumina NovaSeq according to Illumina protocols. The 8bp unique dual index was read during additional sequencing reads that automatically follow the completion of read1. Data generated during the sequencing runs are simultaneously transferred to the YCGA high- performance computing cluster. A positive control (prepared bacteriophage Phi X library) provided by Illumina was spiked into every lane at a concentration of 0.3% to monitor sequencing quality in real time. Signal Intensities were converted to individual base calls during a run using the system’s Real Time Analysis (RTA) software. Base calls were transferred from the machine’s dedicated personal computer to the Yale High Performance Computing cluster via a 1 Gigabit network mount for downstream analysis. Primary analysis - sample de-multiplexing and alignment to the mouse genome - was performed using Illumina’s CASAVA 1.8.2 software suite. The data was returned to the user if the sample error rate is less than 2% and the distribution of reads per sample in a lane is within reasonable tolerance. Peak calling and analysis
[0330] Duplicate reads were filtered using Picard MarkDuplicates version 2.18.2.3 (http: / / broadinstitute.github.io / picard / ). Reads per genome coverage (RPGC)- normalized bigWig and bedgraph files were generated using the bamcoverage functions in deeptools version 3.4.3. Peaks were called using MACS2 version 2.2.7.1 using a qvalue cutoff of 0.001. Peak-gene assignments, gene ontology analysis and peak location distribution for peaks were analyzed using GREAT. Heat maps of chromatin accessibility was generated using the computeMatrix and plotHeatmap functions in deeptools (v3.5.3). RPGC-normalized bigWig files were used as the score files and the peaks that were increased by at least 4-fold on Diffbind with Tgf-β1 treatment were used as the input region file.Diffbind analysis
[0331] PBS added (control), Tgf-β1 activated for 4 days, and Tgf-β1 activated plus an additional 14 days in Tgf-β1 Free media ATAC-sequencing was performed in duplicate (triplicate for the Free condition). Differential binding analysis between the groups was performed using Diffbind package version 2.10.0 (http: / / bioconductor.org / packages / release / bioc / html / DiffBind.html). Functional peaks were defined according to differentially expressed genes obtained from transcriptomic analysis (log2FC >1 between groups). Results Tgf-β1 activates Fbn1 transcription in white adipose tissue
[0332] We previously established that Fbn1 mRNA is elevated in the white adipose tissue of obese mice, correlating with increased plasma asprosin levels. We confirmed this in diet-induced obese (DIO) mice across both visceral and subcutaneous fat depots (Fig.17A). To identify the obesity-associated signal driving Fbn1 transcription, we screened key cytokines from the low-grade inflammatory milieu of obesity. Among them, TGF-β1 emerged as a potent enhancer, significantly increasing Fbn1 mRNA (Fig.13A, Fig.17B) and media asprosin (Fig.13B) in differentiated adipocytes (3T3-L1 cells). We validated this in vivo by injecting recombinant Tgf-β1 intraperitoneally in wild-type (WT) mice, which led to elevated Smad7 mRNA in white adipose tissue, confirming Tgf-β1 signaling activation (Fig.17C). This also increased Fbn1 mRNA in both visceral and subcutaneous fat depots (Fig.13C), a finding consistent in female mice, eliminating sexual dimorphism as a consideration (Figs.13D-E). To determine if Tgf-β1 actively regulates Fbn1 transcription, we performed quantitative PCR (qPCR) on CUT&RUN isolated DNA from 3T3-L1 cells, probing for RNA polymerase II occupancy at the Fbn1 locus. Tgf-β1 exposure resulted in increased RNA polymerase II occupancy at the Fbn1 locus, indicating active transcription (Fig.13D). To determine whether transcription is the predominant process for Tgf-β1- mediated asprosin production by adipocytes, we exposed differentiated 3T3-L1 cells to actinomycin D to block RNA transcription. This resulted in complete inhibition of Tgf-β1- induced media asprosin accumulation (Fig.13F), underscoring the necessity of RNA transcription in this process.
[0333] Asprosin is encoded within the penultimate and ultimate exons of Fbn1, raising the possibility that it could be produced from a distinct transcript separate from fibrillin-1. To explore this, we examined CAGE analysis from the FANTOM5 database, which identified a single transcription start site (TSS) and a single CpG island for the entire FBN1 gene (Fig.13G). We also tested whether Tgf-β1 exposure led to greater accumulation of mRNA specific to the asprosin coding region compared to the rest of the Fbn1 locus. Results showed no additional elevation of asprosin-coding mRNA beyond the rest of Fbn1 mRNA, suggesting the absence of asprosin-specific transcriptional regulation by Tgf-β1 (Fig.13H).
[0334] Tgf-β1 signaling begins when the ligand binds to the Tgf-β type II receptor, which then dimerizes with the type I receptor, activating downstream pathways. Several transcription factors, as well as the coactivator Smad4, are essential in this process. To test if Tgf-β1 uses its canonical pathway to activate Fbn1 transcription, we knocked down Tgfbr2 in 3T3-L1 cells. This significantly reduced Fbn1 and Smad7 mRNA levels upon Tgf-β1 exposure (Figs.13E-F). Similar results were observed with Smad4 knockdown (Fig.13G-H), supporting the conclusion that canonical Tgf-β1 signaling is required for Fbn1 transcription.
[0335] Tgf-β1 has been consistently found to be elevated in obesity, both in animal and human studies. Pharmacologic inhibition of Tgf-β1 in obesity improves body weight and glucose tolerance, implicating Tgf-β1 as a causal factor. To determine if asprosin is essential for Tgf-β1-mediated obesity, we used the Fbn1NPS / +mice, which exhibit a marked deficiency in plasma asprosin. Wild-type mice treated with recombinant Tgf-β1 gained weight, while Fbn1NPS / +mice did not, indicating that asprosin is necessary for Tgf-β1-driven weight gain (Fig.13I). Tgf-β1 causes persistent elevation of white adipose Fbn1 mRNA and plasma asprosin
[0336] During our studies, we identified a surprising persistence in Tgf-β1-induced Fbn1 mRNA elevation even after Tgf-β1 signaling was terminated. Specifically, when 3T3- L1 cells were exposed to recombinant Tgf-β1 for four days and then incubated in Tgf-β1-free media for an additional 14 days, Fbn1 mRNA levels and media asprosin protein remained significantly elevated (Fig.18A-B). In contrast, Smad7 mRNA, which also responds to Tgf- β1, returned to baseline levels (Fig.18C), indicating differential Tgf-β1-induced regulatory mechanisms for Fbn1 and Smad7.
[0337] To confirm this phenomenon in vivo, we injected wild-type (WT) mice with recombinant Tgf-β1 or PBS twice daily for four days, followed by a 14-day period without any intervention. Since the half-life of active Tgf-β1 in circulation is only 2-3 minutes, it should not persist after 14 days. Indeed, we observed no difference in plasma Tgf-β1 levels after this period (Fig.18D). However, despite the absence of enhanced Tgf-β1, Fbn1 mRNA and asprosin protein levels remained elevated in plasma and white adipose tissue, respectively, 14 days after exposure to Tgf-β1 (Figs.18E-G). Notably, there was no change in white adipose tissue Smad7 mRNA (Fig.18H) or in plasma levels of other orexigenic hormones like NPY and ghrelin 14 days after exposure to Tgf-β1 (Figs.18A-B).
[0338] To determine whether the persistence of Fbn1 mRNA elevation could be due to enhanced mRNA stability or delayed decay, we measured the half-life of Fbn1 mRNA after Tgf-β1 exposure in the presence of actinomycin D, which blocks new mRNA synthesis. We found that in 3T3-L1 cells exposed to Tgf-β1, Fbn1 mRNA half-life was 18.54 hours, vastly insufficient to account for the long-lasting Fbn1 mRNA elevation observed (Fig.14I). These results suggest that Tgf-β1 induces persistent elevation of Fbn1 mRNA through a mechanism other than sustained Tgf-β1 signaling or Fbn1 mRNA stability regulation. Tgf-β1 induces broad transcriptomic changes in adipocytes
[0339] To capture the full extent of transcriptomic alterations induced by Tgf-β1, we performed RNA sequencing under three distinct conditions: differentiated 3T3-L1 adipocytes treated with PBS (Condition A), treated with Tgf-β1 for 4 days (Condition B), and treated with Tgf-β1 for 4 days followed by 14 days of deprivation in Tgf-β1-free media (Condition C) (Fig.15A). Comparing Condition A to B, gene ontology analysis of upregulated genes highlighted a strong enrichment for extracellular matrix (ECM) structure organization, including Fbn1 (Figs.15B-C).
[0340] To examine the transcriptomic shifts following Tgf-β1 removal (Condition C), we performed tree clustering analysis, identifying two distinct gene expression patterns. One group, including Smad7, exhibited elevated expression during Tgf-β1 exposure that receded upon its withdrawal. In contrast, another group, including Fbn1, maintained high expression levels even after long-term deprivation (Fig.15D). Notably, SKI-like (Skil), another gene involved in active Tgf-β1 signaling, mirrored the expression pattern of Smad7 (Fig.15D).
[0341] Among the 85 Tgf-β1-induced ECM genes, approximately 75% – including Fbn1 – remained elevated after Tgf-β1 withdrawal, while 25% returned to baseline (Fig.15E). Focusing on the genes that sustained their expression post-withdrawal, gene ontology analysis reaffirmed the strong enrichment of ECM-structure related genes (Fig.15F). To quantify the relative impact of Tgf-β1 on all genes that sustained their expression post-withdrawal, we calculated a fold-change score combining both magnitude and confidence (p-value) across conditions. Notably, Fbn1 ranked 16th out of 878 genes that remained upregulated after Tgf-β1 withdrawal compared to control (Fig.15G).
[0342] These findings underscore Tgf-β1’s role in inducing robust, sustained upregulation of Fbn1 expression, even after the cytokine’s removal, suggesting its central role in remodeling the extracellular matrix in response to transient Tgf-β1 signaling. Tgf-β1 alters chromatin accessibility to persistently upregulate Fbn1 mRNA and plasma asprosin
[0343] Tgf-β1 is a key player in chromatin remodeling, but its impact on the adipose tissue epigenetic landscape remains largely unexplored. Given the persistent elevation of Fbn1 expression following Tgf-β1 exposure, we hypothesized that Tgf-β1 might induce long- lasting chromatin accessibility at the Fbn1 locus. To test this, we performed ATAC-seq on 3T3-L1 cells treated with vehicle (PBS), or exposed to Tgf-β1 for 4 days, or exposed to Tgf- β1 for 4 days followed by 14 days in Tgf-β1-free media (Fig.16A). Ontology analysis of the genes that mapped to peaks significantly elevated in Tgf-β1-treated cells was enriched for terms such as "extracellular matrix organization" (Fig.16B). Notably, many chromatin peaks that increased at least four-fold with Tgf-β1 treatment, including those at the Fbn1 locus, remained elevated above vehicle control even after 14 days in Tgf-β1-free media (Fig.16C).
[0344] We next referenced our RNA-seq results in 3T3-L1 cells to identify specific ATAC-seq peaks that might explain how Tgf-β1-induced chromatin changes drive Fbn1 transcription. At the Fbn1 locus, Tgf-β1 induced open chromatin peaks near the transcription start site (region 1) and downstream of the gene (region 2), which persisted even after prolonged Tgf-β1 withdrawal (Fig.16D). These loci detected on ATAC-seq in our study were precisely aligned with H3K27Ac marks identified previously, suggesting that these loci may be functional enhancers or promoters (Fig.19A). In contrast, Tgf-β1-induced open chromatin peaks at the Smad7 locus regressed to baseline after Tgf-β1 withdrawal, consistentwith a more transient response. These findings suggest that Tgf-β1 induces persistent chromatin accessibility at key Fbn1 loci, driving long-term transcriptional upregulation and sustained plasma asprosin levels, even in the absence of ongoing Tgf-β1 signaling.
[0345] Given that Fbn1 transcription seemed to be dependent on the presence of H3K27Ac, we hypothesized that this histone modification may also explain the distinct Tgf- β1-induced transcriptional patterns observed between Fbn1 and Smad7. Using A-485, a selective p300 / CBP Histone Acetyl Transferase (HAT) inhibitor, we found that it effectively blocked Tgf-β1-induced Fbn1 overexpression (Fig.16E) without affecting Smad7 overexpression (Fig.16F). This demonstrates that p300 / CBP HAT activity is crucial for Tgf- β1-induced Fbn1 transcription but is dispensable for Smad7, highlighting locus-specific differences in Tgf-β1-driven chromatin remodeling and gene expression.
[0346] An in vitro screen of obesity-associated cytokines revealed Tgf-β1 as a key transcriptional activator of Fbn1 in adipocytes, driving heightened media asprosin levels. This finding was confirmed in vivo, demonstrating Tgf-β1's critical role in Fbn1 transcription and plasma asprosin upregulation. We identified Tgf-β receptor II and Smad4 as essential components of this process. Adipocyte transcriptome analysis further highlighted Fbn1 as one of the most strongly Tgf-β1-induced genes.
[0347] One of our most striking discoveries is the persistent elevation of the Fbn1 transcript and plasma asprosin levels, even after Tgf-β1 signaling ceases. Genome-wide analysis revealed two distinct gene response patterns: genes that return to baseline after Tgf- β1 withdrawal and those, like Fbn1, that remain elevated. ATAC-sequencing indicated that this persistence likely results from Tgf-β1-induced chromatin remodeling at the Fbn1 locus, unlike at the Smad7 locus. Elevated Tgf-β1 alters chromatin accessibility, causing sustained Fbn1 transcription and chronic asprosin elevation.
[0348] From the above description of the invention, those skilled in the art will perceive improvements, changes and modifications. Such improvements, changes and modifications within the skill of the art are intended to be covered by the appended claims. All references, publications, and patents cited in the present application are herein incorporated by reference in their entirety.
Claims
Having described the invention, we claim:
1. A method of treating cognitive decline and / or memory deficits in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases receptor protein tyrosine phosphatase delta (Ptprd) activity and / or decreases amyloid beta (Aβ) induced inhibition of Ptprd activity in the subject.
2. The method of claim 1, where the memory deficits include associative memory deficits and novel object recognition memory deficits.
3. A method of treating Aβ mediated neurological pathogenesis in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject.
4. A method of treating cachexia in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject.
5. The method of any of claims 1 to 4, wherein the subject has or is at increased risk of Alzheimer’s disease, cognition deficiency disorder, age-associated memory impairment, or dementia.
6. A method of treating Alzheimer’s disease in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of at least one agent that directly or indirectly increases Ptprd activity and / or decreases Aβ induced inhibition of Ptprd activity in the subject.
7. The method of any of claims 1 to 6, wherein the agent increases Ptprd dephosphorylation of signal transducer and activator of transcription 3 (STAT3) and / or decreases Aβ induced STAT3 transcriptional activity in the cerebellum of the subject.
8. The method of any of claims 1 to 7, wherein the agent comprises a Ptprd agonist and / or promotes expression of a Ptprd agonist in the subject.
9. The method of any of claims 1 to 8, wherein the agent is administered systemically to the subject.
10. The method of any of claims 1 to 9, wherein the agent comprises asprosin and / or an analogue thereof and / or promotes expression of asprosin and / or an analogue thereof.
11. The method of claim 8, wherein the agent is administered at an amount effective to increase plasma levels of asprosin and / or the analogue thereof in the subject.
12. The method of claim 10 or 11, wherein the asprosin and / or analogue thereof is administered by expressing the asprosin and / or analogue in a cell or tissue of the subject.
13. The method of claim 12, wherein the asprosin and / or analogue is expressed with a secretory peptide that promotes secretion of the asprosin and / or the analogue thereof from the cell or tissue.
14. The method of claim 13, wherein the asprosin and / or the analogue thereof and secretory peptide are expressed in the cell or tissue using a viral and / or non-viral vector.
15. The method of claim 14, wherein the vector includes an expression cassette that includes a polynucleotide encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence and a polyadenylation (poly(A)) tail signal.
16. The method of claim 15, wherein the regulatory elements include elongation factor-1 (EF-1) or cytomegalovirus promoter.
17. The method of claim 15 or 16, wherein the regulatory elements include a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
18. The method of any of claims 15 to 17, wherein the poly(A) tail signal comprises a simian virus 40 (SV40) poly(A) tail signal.
19. The method of any of claims 15 to 18, wherein the expression cassette further comprising a polynucleotide encoding an interleukin-2 (IL2) peptide.
20. The method of any of claims 15 to 19, wherein the vector includes an EF-1 promoter, WPRE, SV40poly(A), and a polynucleotide encoding IL2.
21. The method of any of claims 14 to 20, wherein the vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.
22. The method of claim 21, wherein the adeno-associated viral vector comprises at least one of AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S, AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV- RPF2, or AAV3b.
23. The method of any of claims 14 to 22, wherein the vector comprises a polynucleotide having a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:
1.
24. The method of any of claims 14 to 22, wherein the vector is administered to the subject by at least one of cutaneous, subcutaneous, intraperitoneal, intramuscular, intrasternal injection, intravenous, intracoronary, intramyocardial, or intra-arterial administration.
25. The method of any of claims 1 to 11, wherein the agent comprises recombinant asprosin and / or an analogue thereof that is systemically administered to the subject.
26. The method of any of claims 1 to 11, the agent comprises TGF-β1 and / or an analogue thereof that is administered to the subject at amount effective to promote expression and / or increase plasma levels of asprosin and / or the analogue thereof in the subject.
27. A vector comprising an expression cassette that includes a polynucleotide encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence and a polyadenylation (poly(A)) tail signal.
28. The vector of claim 27, wherein the regulatory elements include elongation factor-1 (EF-1) or cytomegalovirus promoter.
29. The vector of claim 27 or 28, wherein the regulatory elements include a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
30. The vector of any of claims 27 to 29, wherein the poly(A) tail signal comprises a simian virus 40 (SV40) poly(A) tail signal.
31. The vector of any of claims 27 to 30, wherein the expression cassette further comprising a polynucleotide encoding an IL2 peptide.
32. The vector of any of claims 27 to 31, including an EF-1 promoter, WPRE, SV40poly(A), and a polynucleotide encoding IL2.
33. The vector of any of claims 27 to 32, wherein the vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.
34. The vector of claim 33, wherein the adeno-associated viral vector comprises at least one of AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S, AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV- RPF2, or AAV3b.
35. The vector of any of claims 27 to 34, configured to promote expression of asprosin and / or an analogue thereof in liver of a subject upon systemic administration to the subject.
36. An adeno-associated viral (AAV) vector comprising an expression cassette that includes a polynucleotide encoding asprosin and / or an analogue thereof and IL2, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence and IL2 and a polyadenylation (poly(A)) tail signal.
37. The AAV vector of claim 36, wherein the regulatory elements include elongation factor-1 (EF-1) or cytomegalovirus promoter.
38. The AAV vector of claim 36 or 37, wherein the regulatory elements include a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
39. The AAV vector of any of claims 36 to 38, wherein the poly(A) tail signal comprises a simian virus 40 (SV40) poly(A) tail signal.
40. The AAV vector of any of claims 36 to 39, wherein the vector comprises a polynucleotide having a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:
1.
41. The vector of any of claims 27 to 40 for use in treating cognitive decline and / or memory deficits in a subject in need thereof.
42. The vector of claim 41, where the memory deficits include associative memory deficits and novel object recognition memory deficits.
43. The vector of any of claims 27 to 40 for use in treating Aβ mediated neurological pathogenesis in a subject in need thereof.
44. The vector of any of claims 27 to 40 for use in treating cachexia in a subject in need thereof.
45. The vector of claim 44, wherein the subject has or is at increased risk of Alzheimer’s disease, cognition deficiency disorder, age-associated memory impairment, or dementia.
46. The vector of any of claims 27 to 40 for use in treating Alzheimer’s disease in a subject in need thereof.