Composition for newborns or infants

Abstract

The present invention addresses the problem of providing a novel functionality of Bifidobacterium longum subsp. infantis M-63 strain (NITE BP-02623).　In a composition to be ingested by healthy newborns who are born in full term or healthy infants, one or more components selected from cells of Bifidobacterium longum subsp. infantis M-63 strain (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium are contained as active ingredients. The problem is solved by subjecting the composition to an application for reducing the number of bacteria belonging to the family Enterobacteriaceae in the intestinal flora, an application for promoting the proliferation of bacteria belonging to the genus Bifidobacterium, or an anti-inflammatory application.

Description

Title of Invention: COMPOSITION FOR NEWBORNS OR INFANTS Technical Field

[0001] The present invention relates to a composition taken by a newborn, an infant, or a small child, containing, as an active ingredient, a specific strain of Bifidobacterium spp. Background Art

[0002] Numerous bacteria inhabit the human gut and form a complex microbiota (flora). Bifidobacterium spp. (hereinafter also referred to as bifidobacteria) are known to be the most dominant in gut microbiotas of infants and small children, and this fact is believed to be closely related to maintenance of the health of the infants and small children. In general, a gut microbiota forms a relatively stable ecosystem, but gut microbiotas are still unstable in newborns, infants, and small children. In particular, the gut microbiota in the neonatal period is easily disturbed, and a risk of infection is high. Accordingly, establishing a gut microbiota in which Bifidobacterium spp. are dominant in a newborn, an infant, or a small child, maintaining the gut microbiota, and obtaining an excellent intestinal environment are important for protecting the health of the infant or small child.

[0003] Bifidobacterium longum subsp. infantis, which is a gut bacterium, has been attracting attention as one of probiotics in recent years, and it is reported that, when Bifidobacterium longum subsp. infantis is administered to a newborn or an infant, Bifidobacterium longum subsp. infantis proliferates and colonizes in the gut, improving the intestinal environment, for example by establishing a gut microbiota in which bifidobacteria are dominant or by decreasing inflammatory cytokines in feces (PTL 1, NPLs 1 to 7, and the like). Moreover, strain M-63, of Bifidobacterium longum subsp. infantis, is also known to have an action of promoting development of the intestinal tract of an infant or a small child and an action of improving mental health disorder of a person taking same (PTLs 2 and 3). Citation List Patent Literature

[0004] PTL 1:WO2012 / 092155 PTL 2:JP2021-183574A PTL 3:WO2018 / 155565 Non Patent Literature

[0005] NPL 1:Ishizeki et al., Anaerobe, 23, 38-44, (2013) NPL 2:Roze et al., British Journal of Nutrition, 107, 1616-1622 (2012) NPL 3:Smilowitz et al., BMC Pediatr., 17, 133, (2017) NPL 4:Frese et al., mSphere, 2 (6), e00501-17, (2017) NPL 5:Henrick et al., Pediatr Res., 86, 749-757, (2019) NPL 6:J. De Andres et al., Benef Microbes, 9 (4), 573384, (2018) NPL 7:Escribano et al., Pediatr. Res. 83 (6), (2018) Summary of Invention Technical Problem

[0006] A problem of the present invention is to provide a new function obtained when Bifidobacterium longum subsp. infantis strain M-63 is used as a probiotic material for a newborn, an infant, or a small child. Solution to Problem

[0007] As a result of extensive studies to solve the problem, the present inventors have found that, in healthy full-term newborns who have taken Bifidobacterium longum subsp. infantis strain M-63, an effect of decreasing bacteria belonging to the family Enterobacteriaceae and reducing diversity of bacteria in an intestinal microbiota is obtained, which results in an increase in Bifidobacterium spp. and an increase in anti-inflammatory factors metabolized by Bifidobacterium spp., thereby exerting an anti-inflammatory effect, and the present invention has been thus completed.

[0008] That is, a first aspect of the present invention is a composition which is to be taken by a healthy full-term newborn, infant, or small child for decreasing bacteria belonging to the family Enterobacteriaceae in the gut microbiota, the composition containing one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium. In other words, the first aspect of the present invention is a composition for decreasing bacteria belonging to the family Enterobacteriaceae in the gut microbiota of a healthy full-term newborn, infant, or small child, the composition containing one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium.

[0009] A second aspect of the present invention is a composition which is to be taken by a healthy full-term newborn, infant, or small child for promoting proliferation of Bifidobacterium spp., the composition containing one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium. In other words, the second aspect of the present invention is a composition for promoting proliferation of Bifidobacterium spp. in the gut microbiota of a healthy full-term newborn, infant, or small child, the composition containing one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium.

[0010] A third aspect of the present invention is a composition which is to be taken by a healthy full-term newborn, infant, or small child for anti-inflammation, the composition containing one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium. In the third aspect of the present invention, an antiinflammatory effect is preferably obtained by increasing one kind or two or more kinds selected from phenylalanine, tryptophan, and a tryptophan metabolite and / or decreasing one kind or two kinds selected from IFN-y and IL-1£ in the gut. That is, a preferred mode of the third aspect of the present invention may be restated as a composition for increasing one kind or two or more kinds selected from phenylalanine, tryptophan, and a tryptophan metabolite and / or a composition for decreasing one kind or two or more kinds selected from IFN-y and IL—1p in the gut of a healthy full-term newborn, infant, or small child, the composition containing one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium.

[0011] It is preferred that the compositions of these aspects further contain a human milk oligosaccharide. The human milk oligosaccharide is preferably one or more kinds selected from 2'-fucosyllactose, 3-fucosyllactose, 3'-sialyllactose, 6'-sialyllactose, lacto-N-tetraose, lacto-N-neotetraose, and difucosyllactose. The compositions of these aspects are preferably taken at 1.0x108 to 5.0x109 cfu / kg body weight / day in terms of the bacterial cells. The compositions of these aspects are preferably taken together with breast-feeding. The compositions of these aspects are preferably a food product or a drink, and more preferably formula. The compositions of these aspects are preferably pharmaceutical products. Advantageous Effects of Invention

[0012] According to the present invention, various functions obtained when Bifidobacterium longum subsp. infantis strain M-63 is used as a probiotic material for a newborn, an infant, or a small child are newly provided. Brief Description of Drawings

[0013] [FIG. 1] FIG. 1 shows box and whisker plots showing a-diversity indices of fecal microbiotas in a B. infantis M-63 group (left) and a placebo group (right) during a study period, each graph showing differences of fecal microbiota diversity indices between the groups, as assessed by the Faith's PD index, Shannon index, Chao1 index, and observed OTUs index. Each box plot represents the median value, quartile range, minimum value, and maximum value. Differences in a-diversity between the groups were analyzed using the Wilcoxon rank sum test. The relationship *p < 0.05 indicates statistical significance. [FIG. 2] FIG. 2 shows plots showing p-diversity indices of the fecal microbiotas in the B. infantis M-63 group (left) and the placebo group (right) during the study period. Each chart is based on analysis by time point on principal coordinate analysis (PCoA) plots of bacterial p-diversity based on Bray-Curtis dissimilarity, Jaccard distance, unweighted UniFrac distance, and weighted UniFrac distance. The p-diversity is analyzed by PERMANOVA. [FIG. 3] FIG. 3 shows characteristics of gut microbiota types of subjects according to principal coordinate analysis (PCoA) based on the Jensen-Shannon divergence (JSD). [FIG. 4] FIG. 4 shows the optimal number of clusters for the gut microbiota types of the subjects based on the Calinski-Harabasz index by means of Partitioning Around Medoids (PAMs) clustering using the JSD. [FIG. 5] FIG. 5 shows respective fecal microbiota compositions for the gut microbiota types. Type 1: Bifidobacterium-dominant microbiota 1; Type 2: Bifidobacterium-dominant microbiota 2; Type 3: Bifidobacterium-Bacteroides mixed microbiota; Type 4: Enterobacteriaceae-dominant microbiota; Type 5: Enterococcus-Clostridium mixed microbiota; and Type 6: Streptococcus-dominant microbiota. [FIG. 6] FIG. 6 shows graphs showing distribution of each gut microbiota type in each of the B. infantis M-63 group (left) and the placebo group (right) (before intake of a test food; 1 week after intake of the test food; 1 month after birth; and 3 months after birth). [FIG. 7] FIG. 7 shows graphs showing fecal metabolite levels in each of the gut microbiota types (types 1-6 from left to right). (a) Trp, (b)ILA, (c) IAld, (d) IAA, (e) IPA, (f) Tyr, (g) HPLA, and (h) Phe. Data obtained before intake of the test food and at 1 month after birth were used for analysis. Comparisons among the type groups were performed using the Kruskal-Wallis test with the Dunn's post hoc test, and p values were corrected using the Bonferroni correction. The relationship *p < 0.05 indicates statistical significance. [FIG. 8] FIG. 8 shows graphs showing fecal metabolite levels in each of the gut microbiota types (types 1-6 from left to right). (i) PLA, (j) Leu, (k) LeuA, (l) N-Lac-Phe, (m) MTCA, (n) Kyn, (o) KynA, and (p) Ser. Data obtained before intake of the test food and at 1 month after birth were used for analysis. Comparisons among the type groups were performed using the Kruskal-Wallis test with the Dunn's post hoc test, and p values were corrected using the Bonferroni correction. The relationship *p < 0.05 indicates statistical significance. [FIG. 9] FIG. 9 is a graph showing bacterium counts of Bifidobacterium spp. in a culture pellet after 24-hour cultivation of feces supplemented with a test sample (n = 4). Multiple comparisons were performed using the Tukey-Kramer HSD test, and p values of 0.05 or less are considered statistically significant. [FIG. 10] FIG. 10 is a graph showing concentrations of a metabolite (acetic acid) in a culture supernatant after 24-hour cultivation of feces supplemented with the test sample (n = 4). Multiple comparisons were performed using the Tukey-Kramer HSD test, and p values of 0.05 or less are considered statistically significant. [FIG. 11] FIG. 11 is a graph showing concentrations of a metabolite (4-hydroxyphenyllactic acid (HPLA)) in the culture supernatant after 24-hour cultivation of feces supplemented with the test sample (n = 4). Multiple comparisons were performed using the Tukey-Kramer HSD test, and p values of 0.05 or less are considered statistically significant. [FIG. 12] FIG. 12 is a graph showing concentrations of a metabolite (indole-3-lactic acid (ILA)) in the culture supernatant after 24-hour cultivation of feces supplemented with the test sample (n = 4). Multiple comparisons were performed using the Tukey-Kramer HSD test, and p values of 0.05 or less are considered statistically significant. Description of Embodiments

[0014] Next, the present invention is explained in detail. However, the present invention is not limited to the following embodiments and can be freely changed within the scope of the present invention. Note that the compositions of the first to third aspects of the present invention are together referred to as "the composition of the present invention".

[0015] The composition of the present invention contains, as an active ingredient, one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium (which are sometimes together referred to as "bacterial cells and the like of B. infantis strain M-63").

[0016] Bifidobacterium longum subsp. infantis strain M-63 is a bacterium which was deposited for an international deposit under the Budapest Treaty on January 26, 2018 to NITE Patent Microorganisms Depositary (NPMD), National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba 292-0818) and given an accession number of NITE BP-02623.

[0017] Bifidobacterium longum subsp. infantis strain M-63 in the present specification is not limited to the strain itself deposited or registered at a certain organization under the bacterial name (also referred to as "deposited strain" below for the convenience of explanation), but includes substantially equivalent strains thereof (also referred to as "derived strains" or "induced strains"). That is, the bacterium is not limited to the strain itself deposited to NPMD with the accession number, but includes substantially equivalent strains thereof.       The "substantially equivalent strains of the deposited strain" of the bacterium are strains which belong to the same species as that of the deposited strain, have a genome sequence similarity (Average Nucleotide Identity value) of preferably 99.0% or more, more preferably 99.5% or more, further preferably 99.9% or more, particularly preferably 100% identity to the deposited strain, and preferably have the identical bacteriological properties to those of the deposited strain. Examples of the substantially equivalent strains of the deposited strain of the bacterium may be strains derived from the deposited strain as the parent strain. The derived strains include a strain bred from the deposited strain and a strain naturally generated from the deposited strain. Breeding methods include modification by a genetic engineering technique and modification by a mutagenesis. The mutagenesis includes X-ray irradiation, ultraviolet irradiation, and a treatment with a mutagen such as N-methyl-N'-nitro-N-nitrosoguanidine, ethyl methanesulfonate, and methyl methanesulfonate. The strain naturally generated from the deposited strain is a strain which is naturally generated from the deposited strain during use. Examples of such a strain include a mutant naturally generated during culture of the deposited strain (for example, passage culture). The derived strains may be constructed with a kind of modification or constructed with two or more kinds of modification.

[0018] As the bacterium contained in the composition of the present invention, a commercially available product may be used. Alternatively, one appropriately produced and obtained may be used, and one obtained by culturing the bacterium described above may also be used. The culture method is not particularly limited as long as the bacterium can proliferate. As the culture method, for example, a method which is generally used for culturing lactic acid bacteria can be used directly or with appropriate modification. The culture temperature may be, for example, 25°C to 50°C and is preferably 35°C to 42°C. The culture can be conducted preferably under anaerobic conditions and can be conducted, for example, while flowing an anaerobic gas such as carbon dioxide gas. The culture can also be conducted under microaerophilic conditions such as static liquid culture. The culture can be conducted, for example, until the bacterium proliferates to a desired degree.

[0019] A medium used for the culture is not particularly limited as long as the bacterium can proliferate. As the medium, for example, a medium which is generally used for culturing lactic acid bacteria can be used directly or with appropriate modification. That is, as a carbon source, for example, saccharides such as galactose, glucose, fructose, mannose, cellobiose, maltose, lactose, sucrose, trehalose, starch, a starch hydrolysate, and molasses can be used depending on assimilation properties. As a nitrogen source, for example, ammonia, ammonium salts such as ammonium sulfate, ammonium chloride, and ammonium nitrate, and nitrates can be used. In addition, as an inorganic salt, for example, sodium chloride, potassium chloride, potassium phosphate, magnesium sulfate, calcium chloride, calcium nitrate, manganese chloride, ferrous sulfate, and the like can be used. In addition, an organic component such as peptone, soybean powder, a defatted soybean cake, meat extract, and yeast extract may also be used. Specific examples of the medium which is usually used for culturing Bifidobacterium longum subsp. infantis strain M-63 include a reinforced clostridial medium, a de Man, Rogosa, and Sharpe medium (MRS medium), a modified MRS medium (mMRS medium), a TOS propionate medium (TOSP medium), a TOS propionate mupirocin medium (TOSP Mup medium), a Gifu Anaerobic Medium (GAM) medium, and a Yeast Extract-casein Hydrolysate Acid (YCFA) medium.

[0020] The form of Bifidobacterium longum subsp. infantis strain M-63 contained in the composition of the present invention may be any of bacterial cells, a culture of the bacterium, and a treated product of the bacterium. The bacterial cells may be living bacterial cells, dead bacterial cells, or a mixture of living bacterial cells and dead bacterial cells, but preferably contain living bacterial cells. The form of Bifidobacterium longum subsp. infantis strain M-63 contained in the composition of the present invention is particularly preferably bacterial powder of living bacterial cells. The bacterial powder of living bacterial cells can be obtained by drying living bacterial cells under conditions under which the bacterium does not die.

[0021] As the culture of the bacterium, for example, the culture obtained through culture may be used directly. Alternatively, a diluted or concentrated culture may be used, or bacterial cells collected from the culture may also be used. In addition, as the culture, a culture supernatant or a culture fraction may also be used. When a culture supernatant is used, for example, a supernatant of a culture solution obtained by culturing in a GAM medium at 37°C for 16 hours can be preferably used. As the treated product of the bacterium, crushed, heated, or dried bacterial cells or culture, a diluted product thereof, a dried product thereof, or a fraction thereof can be used. A heat-treated product of bacterial cells (heat-sterilized cells) is obtained, for example, by treating the bacterium at 70°C to 100°C for 10 to 40 minutes or at 90°C to 150°C for 5 to 30 seconds. Note that pressure may be applied during the heat treatment. During the heat treatment, the temperature does not have to be constant and should be in the temperature range for a predetermined period. As the heat-sterilized cells of the bacterium, the cells after the heat treatment may be used directly, or cells which have been subjected to treatment such as crushing, heat drying, freeze drying, or spray drying may also be used.

[0022] The amount of the bacterial cells and the like of B. infantis strain M-63 contained in the composition of the present invention is not particularly limited and is appropriately set according to the form of the composition, and for example, the bacterial cell amount of the bacterium (in terms of the bacterial cells) is preferably 1x104 to 1x1013 cfu / g or 1x104 to 1x1013 cfu / mL, more preferably 1x105 to 1x1012 cfu / g or 1x105 to 1x1012 cfu / mL, further preferably 1x106 to 1x1011 cfu / g or 1x106 to 1x1011 cfu / mL. In the present specification, "cfu" refers to the colony forming unit. When dead bacterial cells are used, cfu / g or cfu / mL may be replaced with cells / g or cells / mL. When a culture supernatant is used as the culture of the bacterium, the amount thereof is preferably 0.1 to 100 mass%, more preferably 1 to 90 mass%, further preferably 10 to 80 mass% of the entire composition. The amount of the bacterial cells and the like of B. infantis strain M-63 contained in the entire composition of the present aspect is preferably 0.001 mass% or more and less than 100 mass%, more preferably 0.005 to 95 mass%, further preferably 0.01 to 85 mass%. These ranges may be usually ranges of content employed when the composition is distributed as an oral composition.

[0023] The composition of the first aspect of the present invention has an action of decreasing bacteria belonging to the family Enterobacteriaceae in a gut microbiota, and is thus used for obtaining such an effect. This is because, in the gut of a subject who has taken the composition of the present invention, Bifidobacterium spp. become dominant, thereby relatively decreasing bacteria belonging to the family Enterobacteriaceae. Therefore, as the second aspect, the present invention provides a composition used to obtain an effect of promoting proliferation of Bifidobacterium spp. The present inventors have found that the composition of the present invention reduces the diversity of bacterial species inhabiting a gut microbiota, as demonstrated in the Examples described later. Specifically, colonization of bacteria other than Bifidobacterium spp. is suppressed, thereby reducing the number of bacterial species. Meanwhile, colonization of Bifidobacterium spp. is maintained or enhanced. Accordingly,   Bifidobacterium spp.  become dominant,   and bacteria   belonging to   the   family Enterobacteriaceae are decreased in the gut microbiota.

[0024] Examples of the bacteria belonging to the family Enterobacteriaceae decreased by the composition of the present invention include bacteria belonging to the genus Arsenophonus, the genus Biostraticola, the genus Candidatus Blochmannia, the genus Brenneria, the genus Buchnera, the genus Budvicia, the genus Buttiauxella, the genus Cedecea, the genus Citrobacter, the genus Cosenzaea, the genus Cronobacter, the genus Dickeya, the genus Edwardsiella, the genus Enterobacter, the genus Erwinia, the genus Escherichia, the genus Ewingella, the genus Gibbsiella, the genus Hafnia, the genus Klebsiella, the genus Kluyvera, the genus Leclercia, the genus Leminorella, the genus Lonsdalea, the genus Mangrovibacter, the genus Moellerella, the genus Morganella, the genus Obesumbacterium, the genus Pantoea, the genus Pectobacterium, the genus Candidatus Phlomobacter, the genus Phaseolibacter, the genus Photorhabdus, the genus Plesiomonas, the genus Pragia, the genus Proteus, the genus Providencia, the genus Rahnella, the genus Raoultella, the genus Saccharobacter, the genus Salmonella, the genus Samsonia, the genus Serratia, the genus Shigella, the genus Shimwellia, the genus Sodalis, the genus Tatumella, the genus Thorsellia, the genus Trabulsiella, the genus Wigglesworthia, the genus Xenorhabdus, the genus Yersinia, or the genus Yokenella. It is sufficient that the abundance or existence proportion of one or more species or strains belonging to one kind or two or more kinds of these genera decreases in the gut microbiota. It is known that dominance of bacteria belonging to the family Enterobacteriaceae in the gut microbiota is unfavorable to health of an infant or a small child. In addition, some bacteria belonging to the family Enterobacteriaceae are pathogenic. Therefore, the composition of the present invention having an action of decreasing bacteria belonging to the family Enterobacteriaceae is beneficial to health of a subject who has taken the composition.

[0025] The term "decrease" of bacteria herein means that when the composition of the present invention is applied in vivo or in vitro, the number of bacteria belonging to the family Enterobacteriaceae or the existence proportion thereof with respect to the entire microbiota is decreased as compared with a case where the composition is not applied. The extent of such decrease is not particularly limited, but is a decrease to preferably 95% or less, more preferably 90% or less, and further preferably 85% or less with respect to the number or existence proportion of bacteria in a case where the composition of the present invention is not applied. The "existence proportion" herein can be restated as the "occupancy rate" in the entire bacterial group detected in a gut microbiota. Here, as long as the existence proportion of the bacteria belonging to the family Enterobacteriaceae in the gut microbiota decreases, a case where the existence proportion of another bacterium in the gut microbiota increases may be encompassed.

[0026] Bifidobacterium spp. the proliferation of which is promoted by the composition of the present invention are not limited to Bifidobacterium longum subsp. infantis strain M-63, and may include other of Bifidobacterium longum subsp. infantis strains, Bifidobacterium longum subsp. longum, Bifidobacterium breve, Bifidobacterium bifidum, Bifidobacterium adolescentis, Bifidobacterium catenulatum, Bifidobacterium pseudocatenulatum, Bifidobacterium animalis, Bifidobacterium lactis, Bifidobacterium pseudolongum, and the like, and it is sufficient that some species or strains among them proliferate. Among these, Bifidobacterium longum subsp. infantis is usually particularly prone to proliferate.

[0027] The term "promotion of proliferation" herein means that when the composition of the present invention is applied in vivo or in vitro, the bacterium count of Bifidobacterium spp. or the existence proportion thereof with respect to the entire microbiota is increased as compared with a case where the composition is not applied. The extent of such increase in the number of bacteria is not particularly limited, but is an increase of preferably 1% or more, more preferably 5% or more, and further preferably 10% or more with respect to the bacterium count of Bifidobacterium spp. in a case where the composition of the present invention is not applied. Here, as long as the existence proportion of the Bifidobacterium spp. in the gut microbiota increases, a case where the existence proportion of another bacterium in the gut microbiota decreases may be encompassed.

[0028] When bacteria belonging to the family Enterobacteriaceae decrease and proliferation of Bifidobacterium spp. is promoted in a gut microbiota by the composition of the present invention, the gut microbiota is adjusted to an excellent environment at an early stage. When the gut microbiota becomes an excellent environment due to the composition of the present invention, in the subject of intake (administration), for example, effects such as suppression of increase in bacteria such as Escherichia coli in the gut, intestinal regulation, relief from constipation, improvement of intestinal tract barrier function, suppression of inflammation of the intestinal tract, relief, alleviation, or improvement of a symptom of irritable bowel syndrome (IBS) or ulcerative colitis (UC), improvement of metabolism of dietary fiber, normal development of immune function, and improvement of a symptom of atopic eczema in infancy can also be obtained.

[0029] The composition of the third aspect of the invention has an anti-inflammatory effect and is thus used for obtaining such an effect. The term "anti-inflammatory" herein refers to an action that suppresses inflammation so as to prevent excessive immune responses (anti-inflammatory effect), and may be brought about by an increase in an inflammation-suppressing factor and / or a decrease in an inflammatory factor in the gut, particularly in feces. Specifically, the action may be an action that is brought about by an increase in one kind or two or more kinds selected from phenylalanine, tryptophan, and a tryptophan metabolite and / or by a decrease in one kind or two kinds selected from IFN—y and IL-1£ in the gut. The tryptophan metabolite is a substance metabolized by bacteria using tryptophan as a precursor, and examples thereof include indole-3-lactic acid (ILA), indole-3-aldehyde (IAld), and indole-3-acetic acid (IAA). IFN-Y and IL-1P are known as inflammatory factors, and phenylalanine, tryptophan, and tryptophan metabolites are known to contribute to production of a substance involved in suppressing inflammation. As demonstrated in the Examples described later, in the gut of an infant having a gut microbiota type in which Bifidobacterium spp. are dominant, inflammation-suppressing factors are detected at high levels. As described above, in the gut microbiota of a subject who has taken the composition of the present invention, Bifidobacterium spp. become dominant, inflammation-suppressing factors may be more readily secreted and may increase in the gut. Therefore, in the gut of a subject who has taken the composition of the present invention, an increase in inflammation-suppressing factors may be expected, and an anti-inflammatory effect may be anticipated.

[0030] The subject to which the composition of the present invention is administered (or which takes the composition) is not particularly limited as long as the subject is an animal, and is usually a mammal, preferably a human. The subject to which the composition of the present invention is administered (or which takes the composition) is a healthy full-term newborn, infant, or small child, preferably a newborn or an infant, more preferably a newborn. When a non-human animal is the subject, the child may be synonymous with an offspring. Here, a healthy full-term child refers to a child born at 37 weeks or later with a birth weight of 2500 g or more. That is, the child refers to a child excluding low birth weight infants and pre-term infants in which the degree of development of the gut is different. In addition, a newborn refers to a child which is younger than four weeks old, and an infant refers to a child who is 28 days old or older and younger than one year old. A small child refers to a child between one year old and before entering school or before seven years old.

[0031] Another aspect of the first aspect of the present invention is a composition for decreasing bacteria belonging to the family Enterobacteriaceae in the gut microbiota of a healthy full-term newborn, infant, or small child, the composition containing the bacterial cells and the like of B. infantis strain M-63. Another aspect of the first aspect of the present invention is use of the bacterial cells and the like of B. infantis strain M-63 for producing a composition for decreasing bacteria belonging to the family Enterobacteriaceae in the gut microbiota of a healthy full term newborn, infant, or small child. Another aspect of the first aspect of the present invention is use of the bacterial cells and the like of B. infantis strain M-63 in promoting decrease of bacteria belonging to the family Enterobacteriaceae in the gut microbiota of a healthy full-term newborn, infant, or small child. Another aspect of the first aspect of the present invention is the bacterial cells and the like of B. infantis strain M-63 for use in decreasing bacteria belonging to the family Enterobacteriaceae in the gut microbiota of a healthy full-term newborn, infant, or small child. Another aspect of the first aspect of the present invention is a method for decreasing bacteria belonging to the family Enterobacteriaceae in a gut microbiota, the method including administering the bacterial cells and the like of B. infantis strain M-63 to a healthy full-term newborn, infant, or small child.

[0032] Another aspect of the second aspect of the present invention is a composition for promoting proliferation of Bifidobacterium spp. in the gut microbiota of a healthy full-term newborn, infant, or small child, the composition containing the bacterial cells and the like of B. infantis strain M-63. Another aspect of the second aspect of the present invention is use of the bacterial cells and the like of B. infantis strain M-63 for producing a composition for promoting proliferation of Bifidobacterium spp. in the gut microbiota of a healthy full-term newborn, infant, or small child. Another aspect of the second aspect of the present invention is use of the bacterial cells and the like of B. infantis strain M-63 in promoting proliferation of Bifidobacterium spp. in the gut microbiota of a healthy full-term newborn, infant, or small child. Another aspect of the second aspect of the present invention is the bacterial cells and the like of B. infantis strain M-63 for use in promoting proliferation of Bifidobacterium spp. in the gut microbiota of a healthy full-term newborn, infant, or small child. Another aspect of the second aspect of the present invention is a method for promoting proliferation of Bifidobacterium spp. in a gut microbiota, the method including administering the bacterial cells and the like of B. infantis strain M-63 to a healthy full-term newborn, infant, or small child.

[0033] Another aspect of the third aspect of the present invention is use of the bacterial cells and the like of B. infantis strain M-63 for producing an anti-inflammatory composition that is taken by a healthy full-term newborn, infant, or small child. Another aspect of the third aspect of the present invention is use of the bacterial cells and the like of B. infantis strain M-63 for an anti-inflammatory effect in a healthy full-term newborn, infant, or small child. Another aspect of the third aspect of the present invention is the bacterial cells and the like of B. infantis strain M-63 for use for an anti-inflammatory effect in a healthy full-term newborn, infant, or small child. Another aspect of the third aspect of the present invention is an anti-inflammatory method including administering the bacterial cells and the like of B. infantis strain M-63 to a healthy full-term newborn, infant, or small child.

[0034] Note that, "administering the bacterial cells and the like of B. infantis strain M-63 to a subject child" may be synonymous with "causing a subject child to take the bacterial cells and the like of B. infantis strain M-63." The intake may be voluntary (free intake) or may be forced (forced intake). That is, the administration step may be specifically, for example, a step of blending the bacterial cells and the like of B. infantis strain M-63 in food, drink, or feed, supplying same to a subject child, and thus causing the subject child to freely take the bacterial cells and the like of B. infantis strain M-63.

[0035] The timing of intake (administration) of the composition of the present invention and the intake (administration) period are not particularly limited, but the intake (administration) is preferably started on the seventh day after birth or later. In addition, the composition is continuously taken (administered) preferably for one week or longer, more preferably one month or longer, further preferably three months or longer.

[0036] The composition of the present invention itself may be in the form of a food product, a drink, a pharmaceutical product, or the like, or may be in a form which is contained in a food product, a drink, a pharmaceutical product, or the like as an additive. The route of intake (administration) of the composition of the present invention may be an oral or parenteral route, but is usually an oral route. The parenteral intake (administration) is transdermal, intravenous, or rectal administration, inhalation, or the like.

[0037] The amount of intake (dosage) of the composition of the present invention is appropriately selected on the basis of the age (in month) of the subject of intake (administration), the gender, the status, other conditions, and the like. The amount of intake (dosage) of the composition of the present invention is, as the amount of intake (dosage) in terms of the bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 according to the present invention, for example, preferably 1.0x108 to 5.0x109 cfu / kg body weight / day, more preferably 5.0x108 to 5.0x109 cfu / kg body weight / day, further preferably 1.7x109 to 3.3x109 cfu / kg body weight / day. The effects described above of the composition of the present invention are obtained even at such a small amount of intake (dosage) as compared to those of related-art probiotics using Bifidobacterium spp., and the composition is thus useful because the burden to the subject child is small. Regardless of the amount or the period of intake (administration), the composition of the present invention can be taken (administered) once a day or in multiple divided portions.

[0038] It is preferred that the composition of the present invention further include an oligosaccharide. Oligosaccharides are assimilated by Bifidobacterium spp., thereby enhancing the actions of B. infantis strain M-63 and promoting proliferation of Bifidobacterium spp. The oligosaccharide herein refers to a saccharide oligomer in which two or more monosaccharide units are linked by a glycoside bond. In the oligosaccharide in the present invention, the number of sugar residues mutually linked by a glycoside bond is two or more, preferably two or more and ten or less, particularly preferably three or more and five or less. Although the oligosaccharide is not particularly limited, the oligosaccharide is usually assimilated by Bifidobacterium spp., and specific examples thereof include raffinose,    lactulose, maltotriose, stachyose,    a galactooligosaccharide, a fructooligosaccharide, kestose, nystose, a soybean oligosaccharide, lactosucrose, a xylooligosaccharide, an isomaltooligosaccharide, a coffee bean manno oligosaccharide, gluconic acid, polydextrose, inulin, and a human milk oligosaccharide. Among these, preferable examples of the oligosaccharide with the number of sugar residues of three or more and five or less include maltotriose, stachyose, a galactooligosaccharide, a fructooligosaccharide, kestose, nystose, and a human milk oligosaccharide.

[0039] A particularly preferable example of the oligosaccharide that may be contained in the composition of the present invention is a human milk oligosaccharide. By taking the human milk oligosaccharide together, it is believed that the actions of B. infantis strain M-63 are further enhanced, bacteria belonging to the family Enterobacteriaceae are decreased, proliferation of Bifidobacterium spp. in the gut microbiota is further improved, and an anti-inflammatory effect is enhanced. The human milk oligosaccharide is not particularly limited as long as it is an oligosaccharide normally contained in human milk, and examples thereof include a fucosylated oligosaccharide, a sialylated oligosaccharide, an acetylated oligosaccharide, and galactosyl lactose. Examples of the fucosylated oligosaccharide include 2'-fucosyllactose (2'-FL), 3-fucosyllactose (3-FL), lacto-N-fucopentaose-I, lacto-N-fucopentaose-II, lacto-N-fucopentaose-III, difucosyllactose, lactodifucotetraose, and difucosyllacto-N-tetraose. Examples of the sialylated oligosaccharide include 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), sialyllacto-N-tetraose a, sialyllacto-N-tetraose b, sialyllacto-N-tetraose c, and disialyllacto-N-tetraose. Examples of the acetylated oligosaccharide include lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and lacto-N-hexaose (LNH). Examples of the galactosyl lactose include 3'-galactosyl lactose, 4'-galactosyl lactose, and 6'-galactosyl lactose. Among these, from the viewpoint of an assimilation facilitation effect, one kind or two or more kinds selected from 2'-fucosyllactose, 3-fucosyllactose, 3'-sialyllactose, 6'-sialyllactose, lacto-N-tetraose, lacto-N-neotetraose, and difucosyllactose are particularly preferable.

[0040] Note that the human milk oligosaccharide to be contained in the composition of the present invention may be purified or may be a mixture, provided that the effects of the present invention are not impaired. An amount of intake of the human milk oligosaccharide is generally considered to be preferably about 1 g to about 15 g per day, more preferably about 2 g to about 10 g per day, still more preferably about 3 g to about 7 g per day, and the human milk oligosaccharide may be contained in the composition of the present invention so as to achieve such an amount of intake. In a certain embodiment, it is in a range.

[0041] The composition of the present invention is preferably taken together with breast-feeding when the subject child is in the lactation period. By receiving breast-feeding, breast milk components such as human milk oligosaccharides are taken, and it is believed that the actions of B. infantis strain M-63 are further enhanced, bacteria belonging to the family Enterobacteriaceae are decreased, proliferation of Bifidobacterium spp. in the gut microbiota is further improved, and an anti-inflammatory effect is enhanced. As long as breast-feeding is received together, mixed feeding with formula is acceptable, but the above-mentioned effects are obtained more easily as the proportion of breast-feeding is increased. Note that, "breast-feeding" refers to feeding breast milk to a newborn, an infant, or a small child for nutrition.

[0042] When the composition of the present invention is an orally taken composition, the composition is preferably the form of a food product or a drink. The form and the property of the food product or the drink are not particularly limited as long as the food product or the drink does not impair the effects of the present invention and can be orally taken, and the food product or the drink can be produced by a general method using a material which is generally used for a food product or a drink except that the bacterial cells and the like of B. infantis strain M-63 are contained.

[0043] The food product and the drink should be appropriately selected according to the age in months or years of the subject child, and the food product or the drink is not limited to any particular form such as liquid, paste, gel solid, or powder, and examples thereof include: tablet candies; liquid foods (nutrition products for tube feeding); wheat products such as bread, macaroni, spaghetti, noodles, cake mixes, frying flour, and breadcrumbs; instant foods such as instant noodles, cup noodles, retort-pouched / prepared foods, prepared canned foods, microwaveready foods, instant soups / stews, instant miso soups / clear Japanese soups, canned soups, freeze-dried foods, and other instant foods; processed agricultural products such as canned agricultural products, canned fruits, jam / marmalade, pickles, cooked beans, dried agricultural products, and cereals (processed grain); processed fishery products such as canned fishery products, fish hams / sausages, fishery paste products, fishery delicacies, and soy sauce-simmered foods (Tsukudani); processed livestock products such as canned livestock products / pastes, and livestock hams / sausages; milk / dairy products such as processed milk, milk beverages, yogurts (fermented milk), lactic acid bacteria beverages, cheeses, ice creams, creams, and other dairy products; oils and fats such as butter, margarine, and vegetable oils; basic condiments such as soy sauce, soybean paste, sauces, processed tomato condiments, sweet cooking rice wine, and vinegars; compound seasonings / foods such as cooking mixes, curry roux, sauces, dressings, noodle broths, spices, and other compound seasonings; frozen foods such as frozen food materials, semi-cooked frozen foods, and cooked frozen foods; confectioneries such as caramels, candies, chewing gums, chocolates, cookies, biscuits, cakes, pies, snacks, crackers, Japanese-style confectioneries, rice confectioneries, bean confectioneries, desserts, jellies, and other confectioneries; refreshment beverages such as carbonated drinks, natural juices, fruit juices, fruit juice-containing soft drinks, fruit pulp-containing drinks, fruit piece-containing fruit juices, vegetable drinks, soy milk, soy milk drinks, coffee drinks, tea drinks, powdered drinks, concentrated drinks, sports drinks, nutritional drinks, alcohols, and other refreshment beverages; other commercial foods such as baby foods, granular rice seasoning, and seasonings for Chazuke; nutritional compositions such as supplements and formula (including powdered formula, liquid formula, and the like); enteral nutrition products; and functional foods (foods for specified health use and foods with nutrient function claims).

[0044] Among these, a nutritional composition is preferable. In the present invention, the "nutritional composition" is not particularly limited as an aspect of the food product or the drink, but is preferably formula, a liquid food, or the like, more preferably formula. The subject of intake is not limited and may be an infant, a small child, a child, or an adult, but is preferably an infant or a small child. The formula includes powdered formula and liquid formula. The powdered formula is defined by the Ministerial Ordinance on Milk and Milk Products Concerning Compositional Standards, etc. as "the product which is obtained from a product made by processing raw milk, cow's milk, special cow's milk, or food made from them as raw materials, or by processing them as principal raw materials, and by adding the necessary nutrients for infants and then processing the product into powder." The liquid formula is defined by the Ministerial Ordinance as "the product which is obtained from a product made by processing raw milk, cow's milk, special cow's milk, or food made from them as raw materials, or by processing them as principal raw materials, and by adding the necessary nutrients for infants and then processing the product into liquid." The formula also includes formula which contains nutrient components such as various proteins, carbohydrates, lipids (oils and fats), minerals, and vitamins and which is processed into powder or liquid. The formula further includes "powdered infant formula," "liquid infant formula," and "powdered formula for pregnant and parturient women and nursing mothers" of the food for special dietary uses as defined under the Health Promotion Act, and also includes the forms of powdered formula for small children, nutritional powder for adults, nutritional powder for the elderly, and the like.

[0045] The composition of the present invention, particularly when the composition is a nutritional composition such as formula, may further include proteins, carbohydrates, lipids (oils or fats), vitamins, and minerals. Preferable examples of protein sources include a milk protein, a soybean protein, a rice protein, a pea protein, and an oat protein, or mixtures thereof. The milk protein may be a form of a milk protein concentrate, a milk protein isolate, or a whey protein or casein, or a mixture thereof. The protein may be an intact protein or a hydrolyzed protein that is either partially hydrolyzed or extensively hydrolyzed, and from the viewpoint of digestion in the intestinal tract, a hydrolyzed protein is preferred. The protein may be supplied as a form of free amino acids. The protein may account for about 5% to about 20% of the energy of the composition of the present invention.

[0046] The protein source may be a source of glutamine, threonine, cysteine, serine, proline, or a combination of these amino acids. Glutamine may be used by intestinal cells as an energy source. Threonine, serine, and proline are amino acids that are important for production of mucin, which contributes to intestinal barrier function. Cysteine is a major precursor of glutathione, which is important for antioxidant defense of a body.

[0047] As the carbohydrate, a carbohydrate that is easily digestible is preferred, and examples thereof include lactose, maltodextrin, hydrolyzed or modified starch or cornstarch, glucose polymers, corn syrup, corn syrup solids, high-fructose corn syrup, rice-derived carbohydrates, pea-derived carbohydrates, potato-derived carbohydrates, tapioca, sucrose, glucose, fructose, sucrose, honey, sugar alcohols (for example, maltitol, erythritol, and sorbitol), or mixtures thereof, with maltodextrin having a low dextrose equivalent (DE) being particularly preferred. The carbohydrate may be contained in the composition of the present invention in an amount providing about 35% to about 55% of the energy of the composition.

[0048] Examples of the lipid include medium-chain triglycerides (MCT) and long-chain triglycerides (LCT), and inclusion of a long-chain triglyceride (LCT) is preferred. In general, the lipid may be contained in the composition of the present invention in an amount providing about 35% to about 50% of the energy of the composition. The lipid may contain certain essential fatty acids (omega-3 and omega-6 fatty acids). Preferably, these polyunsaturated fatty acids may be contained in an amount providing less than about 30% of the total energy of the lipid source.

[0049] Preferable LCT sources may include rapeseed oil, sunflower seed oil, palm oil, soybean oil, milk fat, corn oil, high-oleic oil, and soy lecithin. A preferable source of MCT may be fractionated coconut oil. A lipid profile of the composition of the present invention is preferably designed such that the ratio between omega-6 (n-6) and omega-3 (n-3) polyunsaturated fatty acids satisfies the equation: (n-6) / (n-3) = about 5 to about 15.

[0050] Examples of the vitamins which may be contained in the composition of the present invention include vitamins A, B-complex (such as B1, B2, B6, and B12), C, D, E, and K, niacin, and acid vitamins such as pantothenic acid, folic acid, and biotin.

[0051] Examples of the minerals which may be contained in the composition of the present invention include calcium, iron, zinc, magnesium, iodine, copper, phosphorus, manganese, potassium, chromium, molybdenum, selenium, nickel, tin, silicon, vanadium, and boron.

[0052] The composition of the present invention may also contain a carotenoid such as lutein, lycopene, zeaxanthin, and beta-carotene. The total amount of carotenoids contained may vary from about 0.001 pg / mL to about 10 pg / mL. Lutein may be contained at a lutein level of about 0.001 pg / mL to about 10 pg / mL, preferably about 0.044 pg / mL to about 5 pg / mL. Lycopene may be contained at a lycopene level of about 0.001 pg / mL to about 10 pg / mL, preferably about 0.0185 pg / mL to about 5 pg / mL. Beta-carotene may be contained at a beta-carotene level of about 0.001 pg / mL to about 10 pg / mL, for example, about 0.034 pg / mL to about 5 pg / mL.

[0053] The composition of the present invention may contain an additional probiotic material in addition to bacterial cells and the like of B. infantis strain M-63. Examples of the additional probiotic material that may be used include Bifidobacterium animalis subsp. lactis (B. animalis subsp. lactis) BB-12, Bifidobacterium lactis (B. lactis) HN019, Bifidobacterium lactis (B. lactis) Bi07, Bifidobacterium infantis (B. infantis) ATCC 15697, Lactobacillus rhamnosus (L. rhamnosus) GG, Lactobacillus rhamnosus (L. rhamnosus) HN001, Lactobacillus acidophilus (L. acidophilus) LA-5, Lactobacillus acidophilus (L. acidophilus) NCFM, Lactobacillus fermentum (L. fermentum) CECT5716, Bifidobacterium longum (B. longum) BB536, Bifidobacterium longum (B. longum) AH1205, Bifidobacterium longum (B. longum) AH1206, Bifidobacterium breve (B. breve) M-16V, MCC1274, Lactobacillus reuteri (L. reuteri) ATCC 55730, Lactobacillus reuteri (L. reuteri) ATCC PTA-6485, and Lactobacillus reuteri (L. reuteri) DSM 17938.

[0054] When the composition of the present invention is in a supplement form, the supplement can be formulated into a solid preparation such as powder, granules, tablets, and capsules; a liquid preparation such as a solution, syrup, a suspension, and an emulsion; or the like. The composition can be formulated in accordance with the explanations for components, carrier, and method for formulating a pharmaceutical product described below.

[0055] The food product or the drink may be provided in the form of feed. Examples of the feed include pet food, livestock feed, and fish farming feed. The form of the feed is not particularly limited, and the feed may contain, in addition to the bacterial cells and the like of B. infantis strain M-63, grain such as corn, wheat, barley, rye, or milo; vegetable oil cake such as soybean oil cake, rapeseed oil cake, coconut oil cake, and linseed oil cake; bran such as wheat bran, barley bran, rice bran, or defatted rice bran; a manufacturing by-product such as corn gluten meal or corn germ meal; animal feed such as fish powder, skim milk powder, whey, yellow grease or tallow; yeast such as torula yeast or brewer's yeast; mineral feed such as tricalcium phosphate or calcium carbonate; an oil or a fat; a single amino acid; a saccharide; or the like, for example.

[0056] When the composition of the invention has the form of a food product or a drink (including feed), the composition can be provided / sold as a food product or a drink labeled with use related to improvement of a gut microbiota, for example. In addition, the bacterial cells and the like of B. infantis strain M-63 according to the present specification can be used for producing these food products, drinks, and the like.

[0057] The act of "labeling" includes all the acts for informing a consumer of the use, and any expression capable of evoking / leading to an inference of the use corresponds to the act of "labeling" in the present invention, regardless of the purposes of labeling, the content of labeling, the object to be labeled, the media, and the like. The "label" is preferably with an expression which allows a consumer to directly recognize the use. Specific examples include an act of transferring an article in which the use is described on a product related to the food product or the drink or packaging of such a product, delivering such an article, displaying such an article for transfer or delivery or importing such an article, or an act of displaying or distributing an advertisement of such a product, a price list or a transaction document with a description of the use thereon or providing information including such contents with a description of the use by an electromagnetic method (the Internet or the like).

[0058] The content of the label is preferably a label approved by an administrative authority or the like (for example, a label approved on the basis of various systems provided by administrative authorities and provided in a manner based on the approval). It is preferable to attach such content of the label to packaging, a container, a catalogue, a brochure, a promotional material at a sales site, such as POP, other documents, or the like.

[0059] Examples of the "label" also include labels with health foods, functional foods, enteral foods, food for special dietary uses, food with health claims, foods for specified health use, foods with nutrient function claims, foods with function claims, and quasi-drugs. Among these, in particular, the label includes labels approved by the Consumer Affairs Agency, such as labels approved by the systems for foods for specified health uses, foods with nutrient function claims, or foods with function claims, and labels approved by a similar system. Specific examples include a label with foods for specified health uses, a label with qualified foods for specified health uses, a label indicating influence on the structure or the function of a body, a label with reduction of disease risk, and a label with a scientifically grounded function. More specifically, typical examples include labels with food for specified health uses (especially labels with health uses) provided by the Cabinet Office Ordinance on Labeling Permission for Special Dietary Uses under the Health Promotion Act (Cabinet Office Ordinance No. 57 on August 31, 2009) and similar labels. The labels are, for example, labels with "decreasing bad bacteria in the stomachs of infants and small children," "increasing good bacteria in the stomachs of infants and small children," "contributing to health of the stomachs of infants and small children," and "suppressing intestinal inflammation in infants and small children."

[0060] In an embodiment, the composition of the present invention can be a pharmaceutical product. The administration route of the pharmaceutical product may be an oral or parenteral route, but is preferably an oral route. The parenteral intake (administration) is transdermal, intravenous, or rectal administration, inhalation, or the like. Regarding the form of the pharmaceutical product, the composition can be appropriately formulated into a desired dosage form depending on the administration method. For example, in the case of oral administration, the composition can be formulated into a solid preparation such as powder, granules, tablets, and capsules; a liquid preparation such as a solution, a syrup, a suspension, and an emulsion. The composition can also be formed into an enteric coated agent by enteric coating or the like. In the case of parenteral administration, the composition can be formulated into a suppository, ointment, an injection, or the like. For the formulation, a component which is generally used for formulation such as an excipient, a pH adjuster, a colorant, and a taste-masking agent can be used in addition to the bacterial cells and the like of B. infantis strain M-63. Another medicinal component, a component having an action of improving a gut microbiota which is known or will be found in the future can also be used, for example. In addition, the formulation can be appropriately conducted by a known method depending on the dosage form. For the formulation, a carrier which is generally used for formulation may be appropriately blended for formulation. Examples of the carrier include an excipient, a binder, a disintegrating agent, a lubricant, a stabilizer, and a taste- and odor-masking agent.

[0061] Examples of the excipient include: saccharide derivatives such as lactose, sucrose, glucose, mannitol, and sorbitol; starch derivatives such as cornstarch, potato starch, a-starch, dextrin, and carboxymethyl starch; cellulose derivatives such as crystalline cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, carboxymethylcellulose, and carboxymethyl cellulose calcium; gum arabic; dextran; pullulan; silicate derivatives such as light silicic anhydride, synthetic aluminum silicate, and magnesium aluminometasilicate; phosphate derivatives such as calcium phosphate; carbonate derivatives such as calcium carbonate; and sulfate derivatives such as calcium sulfate.

[0062] Examples of the binder include, in addition to the excipients, gelatin, polyvinyl pyrrolidone, and macrogol.

[0063] Examples of the disintegrating agent include, in addition to the excipients, chemically modified starch or cellulose derivatives such as croscarmellose sodium, sodium carboxymethyl starch, and cross-linked polyvinyl pyrrolidone.

[0064] Examples of the lubricant include: talc; stearic acid; metal stearates such as calcium stearate and magnesium stearate; colloidal silica; waxes such as Veegum, and spermaceti wax; boric acid; glycols; carboxylic acids such as fumaric acid and adipic acid; sodium carboxylates such as sodium benzoate; sulfates such as sodium sulfate; leucine; lauryl sulfates such as sodium lauryl sulfate and magnesium lauryl sulfate; silicic acid such as silicic anhydride and silicic acid hydrate; and starch derivatives.

[0065] Examples of the stabilizer include: paraoxybenzoate esters such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol, and phenylethyl alcohol; benzalkonium chloride; acetic anhydride; and sorbic acid.

[0066] Examples of the taste- and odor-masking agent include sweeteners, acidulants, and aromas. Note that, the carrier used in the case of a liquid preparation for oral administration is a solvent such as water or the like.

[0067] The timing for taking the pharmaceutical product of the present invention is not particularly limited, and examples thereof include before a meal, after a meal, between meals, and before bedtime. Examples

[0068] The present invention is described in more detail below with reference to Examples, but the present invention is not limited to the Examples.

[0069] <Test Example 1> (1) Clinical trial of administration of B. infantis strain M-63 to newborns This trial was conducted in accordance with the Declaration of Helsinki and was approved by the Matsumoto City Hospital Research Ethics Committee on September 27, 2019. The trial was registered in the UMIN Clinical Trials Registry (UMIN000038351). A total of 111 full-term infants born at Matsumoto City Hospital participated as study subject children. Prior to the trial, an investigator provided a detailed explanation of the trial, informed consent was obtained from all study participants, and written consent forms were obtained. Healthy full-term newborns were divided into two groups: one thereof was named an M-63 group (analysis subjects n=56); and the other was named a placebo group (analysis subjects n=53). The M-63 group continuously took bacterial powder of living bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (manufactured by MORINAGA MILK INDUSTRY CO., LTD.) at one billion cells / day, and the placebo group continuously took 1 g / day of sterilized dextrin, each until the age of three months. These test food products were suspended in sterile water and provided for intake in sterilized feeding bottles at room temperature. Fecal samples were collected from diapers of the infants into collection tubes (TechnoSuruga Laboratory Co., Ltd.) before intake (up to 7 days after birth), at 1 week after the start of intake, and at 1 month and 3 months of age. The collected fecal samples were stored at -80°C until analysis.

[0070] (2) Fecal DNA extraction and microbial analysis Fecal DNA extraction and microbial analysis were performed using standard methods. Specifically, DNA was extracted from fecal samples using glass bead disruption and sample homogenization with a GENE PREP STAR PI-480 system (KURABO INDUSTRIES LTD., Osaka, Japan). The V3-V4 region of the bacterial 16S rRNA gene was amplified and sequenced using an Illumina MiSeq system (Illumina, San Diego, CA, USA). After removal of sequences aligned to GRCh38 and PhiX reads, the remaining sequences were analyzed using the QIIME 2 software package version 2017.10 (https: / / qiime2.org / ). DADA2 was employed to remove potential chimeric sequences and to trim read bases. Taxonomic classification was performed using the Greengenes 13.8 database, and a diversity and p diversity were calculated using the QIIME 2 software. PCoA and partitioning around medoid (PAM) clustering were used for analysis using R software version 3.6.0. Microbiota type clustering was performed at the genus level. The Jensen-Shannon divergence and PAM clustering were applied to sample clustering, and optimal microbiota-type clustering was determined using the Calinski-Harabasz (CH) index. Hierarchical clustering analysis was performed using the MeV              suite              version              4.9 (https: / / sourceforge.net / projects / mev-tm4 / ),            and dissimilarity was calculated on the basis of the Pearson correlation of microbiota-type transition data.

[0071] (3) Fecal cytokine analysis by electrochemiluminescence method Interleukin-1p (IL-1p) and interleukin-8 (IL-8) levels were evaluated using U-PLEX Biomarker Group 1 (hu) Assays (Meso Scale Discovery, Rockville, MD). Interferon-Y (IFN-Y), interleukin-6 (IL-6), and tumor necrosis factor-a (TNF-a) were measured using the S-PLEX Proinflammatory Panel 1 (Human) kit (Meso Scale Discovery, Rockville, MD). Further, interleukin-5 (IL-5) was quantified using S-PLEX Human IL-5 Kit (Meso Scale Discovery, Rockville, MD), and interleukin-22 (IL-22) was measured using S-PLEX Human IL-22 Kit (Meso Scale Discovery, Rockville, MD). Procedures were carried out according to instructions by the manufacturer. Briefly, fecal samples (50 to 100 mg per subject) stored at -80°C were diluted 10-fold with a buffer obtained by mixing PBS and a protease inhibitor (NACALAI TESQUE, INC., Kyoto, Japan) at a ratio of 100:1. After dilution, samples were stirred using a bead crusher (TAITEC, Saitama, Japan) with 5-mm stainless steel beads (QIAGEN, Valencia, CA) for three cycles of 2 minutes each. After centrifugation, the supernatant was collected, and each cytokine was measured using a corresponding kit. A standard and samples were measured in duplicate using a Meso Scale Discovery (MSD) Quick Plex assay, followed by analysis using MSD software. Cytokine levels were normalized by fecal weight, and values below the respective detection limits of the assay kits were taken as zero.

[0072] (4) Extraction and quantification of fecal metabolites Ten to forty milligrams of each fecal sample was collected, and 200 pL of a methanol solution was added thereto. After crushing with 300 mg of zirconia beads at 2,000 rpm for 30 seconds, centrifugation was performed at 10, 000xg at 4°C for 10 minutes, and the supernatant was collected. After filtration of the entire amount of the supernatant using a Nanosep 3 K Omega micro concentrator (manufactured by Pall Corporation), centrifugation was performed at 9100xg at 4°C for 120 minutes. The obtained filtrate was collected and processed with a centrifugal evaporator for 30 to 60 minutes until the filtrate was dried. The pretreated samples were all stored at -20°C prior to measurement. Fecal metabolite concentrations were measured by liquid chromatography-tandem mass spectrometry (LC-MS / MS) using a TSQ-FORTIS (manufactured by Thermo Fisher Scientific Inc.) coupled with a Vanquish HPLC system. The metabolites analyzed were indole-3-lactic acid (ILA), indole-3-aldehyde (IAld), indole-3-acetic acid (IAA), indole-3-propionic acid (IPA), 4-hydroxyphenyllactic acid (HPLA), 3-phenyllactic acid (PLA), tryptophan (Trp), tyrosine (Tyr), and phenylalanine (Phe). For LC-MS / MS quantification, an XBridge (registered trademark) C8 column (4.6 mm x 150 mm, 3.5 pm) (Waters Corporation, Milford, MA, USA) was used. The mobile phase included (A) water containing 0.05% (v / v) formic acid and (B) methanol, and the flow rate was 0.2 mL / min. The gradient elution profile was as follows: (i) 2% B for 2 minutes; (ii) increase from 2% to 65% until 40 minutes; (iii) increase from 65% to 99% until 45 minutes; (iv) hold at 99% until 55 minutes; (vii) decrease from 99% to 2% until 60 minutes; and (viii) hold at 2% until 75 minutes. All chemical reagents used were of analytical grade, and one sample from each experiment was analyzed.

[0073] (5) Statistics analysis Differences in the microbiota between groups at the phylum and genus levels were evaluated using ALDEx2. Significance was determined at a q value of < 0.05. Two groups were compared using the Wilcoxon rank-sum test, and the distribution of infants within each microbiota type or cluster was analyzed using the Fisher's exact test. The Kruskal-Wallis test was used to identify the presence of groups with the same distribution, and the Dunn's multiple comparison test with Bonferroni correction was used to identify a specific difference between groups. Statistical analysis was performed using R software (version 3.6.0) and IBM SPSS Statistics (version 28.0), and the p value was set to < 0.05.

[0074] (6) Results Results are shown in Table 1 to 3 and FIG. 1 to FIG. 8. As shown in Table 1, a significant reduction in bacteria belonging to the family Enterobacteriaceae was observed in the B. infantis M-63 group compared with the placebo group at 1 month of age. a diversity of the gut microbiota in each group was calculated using several indices, and as shown in FIG. 1, the B. infantis M-63 group exhibited significantly lower diversity across all indices at 1 month of age. In addition, the case of analysis using principal coordinates analysis (PCoA) plots of p diversity also showed marked differences in gut microbiota composition between the B. infantis M-63 group and the placebo group as shown in FIG. 2.

[0075] To evaluate the evolution of the infant gut microbiota during the intervention period, principal coordinates analysis (PCoA) was performed, revealing classification into six distinct microbiota types (FIG. 3 and FIG. 4). A summary of the gut microbiota composition of each microbiota type (FIG. 5) showed that Types 1 and 2 were characterized by a gut microbiota dominated by Bifidobacterium spp., whereas Type 3 was characterized by a gut microbiota in which Bifidobacterium spp. and Bacteroides spp. were mixed, representing a gut microbiota profile typical of healthy infants. In contrast, Types 4, 5, and 6 were dominated by facultative anaerobic bacteria and exhibited marked changes in gut microbiota composition. Specifically, Type 4 exhibited a gut microbiota dominated by the family Enterobacteriaceae, Type 5 exhibited a microbiota in which Enterococcus spp. and Clostridium spp. were mixed, and Type 6 exhibited a gut microbiota dominated by Streptococcus spp. Examination of the distributions of microbiota types in the two groups revealed a marked disparity (FIG. 6). Before intake of the test food product, no significant bias was observed in the distribution of microbiota types within each group. However, one week after administration of B. infantis M-63, the microbiota types clearly converged toward Bifidobacterium-dominant Types 1 and 2. The B. infantis M-63 group consistently maintained Type 1 or Type 2, with nearly all infants ultimately settling into either Bifidobacterium-dominant Type 1 or 2, or Type 3 in which Bifidobacterium spp. and Bacteroides spp. were mixed.

[0076] The intestinal inflammatory status was evaluated by measuring fecal cytokine levels (Table 2). No differences in detection rates of the targeted cytokines between the two groups were observed at either time point, before intake of the test food product or at 1 month of age; however, the cytokine concentrations showed different trends between the groups. Specifically, at 1 month of age, significant decreases in IFN-Y and IL-1P levels were observed in the B. infantis M-63 group compared with the placebo group. These results suggested that B. infantis M-63 exerts an antiinflammatory effect by decreasing the concentrations of IFN-Y and IL-1p. Analysis of metabolites in the fecal samples showed a significant increase in the level of phenylalanine in the B. infantis M-63 group (Table 3). Although no statistically significant differences were observed, the phenyllactic acid and tryptophan levels showed an increasing trend in the B. infantis M-63 group at 1 month of age. However, no significant differences were observed between the two groups at 1 month of age for tryptophan metabolites such as indole-3-lactic acid and indole-3-aldehyde.

[0077] An association between fecal metabolites and characteristics of the gut microbiota was examined (FIG. 7 and FIG. 8). ILA did not show a significant difference between the B. infantis M-63 group and the placebo group; however, infants with Bifidobacterium-dominant intestinal microbiota Types 1 and 2 and infants with gut microbiota Type 3, in which Bifidobacterium spp. and Bacteroides spp. were mixed, exhibited a significant increase in the ILA level as compared with infants with non-Bifidobacteriumdominant types. These findings suggest an association between the abundance of Bifidobacterium spp. and ILA. Furthermore, IAld and IAA also showed significant increases in Bifidobacterium-dominant Types 2 and 3. Other aromatic lactic acids (ALAs) such as HPLA and PLA also exhibited significantly higher levels in the Bifidobacterium-dominant gut microbiota. On the other hand, no significant differences were observed in production levels of amino acids Trp, Phe, and Tyr depending on characteristics of the gut microbiota. These results suggested that the type of the gut microbiota greatly influences metabolite production and that the Bifidobacterium-dominant gut microbiota promotes production of beneficial substances such as ALAs.

[0078] [Table 1] Table 1: Relative abundance measurement values of infant fecal microbiota determined by 16S rRNA amplicon sequencing pre intervention 1 week after ingestion 1 month of age 3 months of age M-63 Median (IQR) % Placebo Median (IQR) % M-63 Median (IQR) % Placebo Median (IQR) % M-63 Median (IQR) % Placebo Median (IQR) % M-63 Median (IQR) % Placebo Median (IQR) % Phylum Actinobacteria 1.41 (0.12-34.4) 0.15(0.00-34.8) 65.0 (53.4-75.0) 28.4 (0.19-52.5) “ 77.5(64.0-82.5) 43.5 (2.15-56.5) “ 71.7 (48.3-80.8) 46.8 (23.4-62.9) f Firmicutes 43.7(18.5-98.8) 34.4(14.4-99.7) 26.2 (12.5-36.8) 43.5 (28.3-65.9) 16.4(10.9-21.1) 32.2(17.9-45.2) 15.2 (8.95-22.3) 23.5(13.4-40.2) Proteobacteria 0.34 (0.00-22.2) 6.01 (0.00-33.7) 0.51 (0.00-4.85) 7.43 (0.05-28.9) * 0.69 (0.00-3.28) 8.22 (1.42-20.6) “ 2.97 (1.32-6.30) 7.67 (2.14-16.7) Genus Bifidobacterium 0.19(0.06-33.2) 0.13(0.00-39.0) 65.0 (52.9-75.0) 28.4 (0.08-52.5)" 77.5(63.3-82.3) 43.5 (0.24-56.4) “ 71.4 (46.6-80.6) 44.2 (23.4-62.6) t Enterobacteriaceae; 0.07 (0.00-19.8) 0.30 (0.00-27.7) 0.12 (0.00-3.73) 4.53 (0.00-19.1) 0.18(0.00-2.74) 3.82 (0.12-16.6)* 2.69 (0.72-4.51) 6.73(1.26-16.5) Enterococcus 0.00 (0.00-3.27) 0.00(0.00-6.91) 0.00 (0.00-0.78) 0.08 (0.00-5.61) 0.00(0.00-2.30) 0.27 (0.00-3.28) 1.33 (0.00-10.4) 1.34(0.25-3.59) Lactococcus 0.14(0.00-0.48) 0.19(0.00-0.74) 0.00 (0.00-0.00) 0.00 (0.00-0.00) 0.00(0.00-0.00) 0.00 (0.00-0.00) 0.00 (0.00-0.00) 0.00 (0.00-0.00) Staphylococcus 3.14(0.41-14.6) 1.55(0.38-7.12) 9.14(3.46-19.3) 9.91 (2.99-23.6) 0.76(0.22-1.77) 0.97 (0.12-3.10) 0.12 (0.00-0.38) 0.13(0.00-0.55) Streptococcus 1.18(0.14-20.3) 5.85(0.18-47.5) 6.34 (0.99-13.0) 8.38 (2.52-21.9) 7.65(2.73-12.4) 10.9(1.71-18.5) 1.72 (0.61-3.53) 2.61 (0.82-8.46) Veiilonelia 0.00 (0.00-0.00) 0.00(0.00-0.00) 0.00 (0.00-0.00) 0.00 (0.00-0.00) 0.00(0.00-1.33) 0.32 (0.00-3.93) 1.95 (0.00-5.18) 1.18(0.00-3.36) Data are expressed as the median (IQRs) of the taxa with a median relative abundance of 0.1% in at least one group. Intergroup differecens were analyzed by ALDEx2. tq<0.1, *q<0.05, **q<0.01 IQR: Interquartile Range

[0079] [Table 2] Table 2: Fecal cytokine levels in infants in B. infantis M-63 group and placebo group pre intervention one month of age M-63 Placebo M-63 Placebo M-63 Placebo M-63 Placebo Median (IQR), pg / g feces detection rate (%) Median (IQR), pg / g feces detection rate (%) IFN-y 0.35 (0.00-3.44) 0.68 (0.00-3.74) 67.9 67.9 0.00 (0.00-0.18) 0.02 (0.00-0.50) * 35.7 47.2 IL-5 0.00 (0.00-0.00) 0.00 (0.00-0.00) 23.2 22.6 0.00 (0.00-0.16) 0.00 (0.00-0.00) 30.4 20.8 IL-22 0.00 (0.00-0.48) 0.00 (0.00-0.76) 30.4 32.1 0.00 (0.00-0.06) 0.00 (0.00-0.00) 25.0 13.2 TNF-a 1.12 (0.00-4.35) 1.31 (0.34-5.62) 66.1 73.6 0.00 (0.00-0.73) 0.00 (0.00-0.89) 44.6 41.5 bO IL-1p 282.3(56.6-1842.6) 885.0 (180.1-2583.9) 87.5 90.6 60.4 (27.5-158.8) 99.8 (36.5-735.7) * 100 94.3 IL-8 38.1 (14.6-157.5) 30.5 (12.5-83.9) 85.7 88.7 11.3 (0.00-21.5) 14.4 (3.97-55.9) 62.5 71.7 IQR: interquartile range, IFN: interferon, IL: interleukin. TNF: tumor necrosis factor IFN-y, IL-5, IL-6, IL-22 and TNF-a were measured by the S-PLEX kit, and IL-1 p and IL-8 were measured by the U-PLEX kit. Detection rate was defined as the number of samples above the kit's detection limit for each cytokine. Values below the detection limit were assigned as 0. No statistical significance was observed in the detection rate of each cytokine at any time point between the two groups by Fischer's exact test. Intergroup differences between the two groups were analyzed by Wilcoxon rank sum test. * p < 0.05 indicates statistically significant. Table 3: Fecal metabolites in infants in B. infantis M-63 group an d placebo group pre intervention 1 month of age M-63 (n=19) Placebo (n-23) M-63 (n=25) Placebo (n=16) Median (IQR), AUC Median (IQR), AUC Median (IQR), AUC Median (IQR), AUC Trp (x1Q5) 5.55 (2.05-7.80) 5.88 (2.79-12.4) 10.7(3.39-24.2) 4.16(2.03-12.4) ILA (x103) 0.88 (0.37-20.6) 1.95 (0.11-14.6) 54.4 (20.9-98.0) 33.8 (12.9-59.8) lAld (xio3) 2.42(1.67-4.48) 3.68 (2.38-8.00) 6.99 (3.68-13.4) 6.23 (3.23-28.1) IAA (xio3) 1.91 (1.08-2.82) 2.59 (1.31-3.34) 2.86 (2.26-3.94) 3.02 (1.63-7.80) IPA 0.00 (0.00-0.00) 0.00 (0.00-84.0) 0.00 (0.00-208) 0.00 (0.00-0.00) Tyr (xio5) 1.90 (0.73-4.22) 3.12 (1.60-5.57) 3.19(0.53-6.36) 2.45 (0.67-4.05) HPLA (x103) 3.23 (0.52-24.1) 2.37 (0.82-12.1) 34.5(22.7-49.8) 25.6 (16.5-43.1) Phe (xio6) 1.18(0.87-2.34) 1.95 (1.29-2.72) 4.26 (1.90-8.05) 1.63 (1.25-2.37) * PLA (x103) 1.90 (0.76-7.89) 5.18(0.47-13.4) 19.1 (10.6-39.4) 9.48 (5.27-16.2) Leu (xio4) 1.49 (0.91-2.71) 2.51 (1.53-3.43) 5.03 (2.63-9.28) 2.18 (1.50-3.59) * LeuA (xio3) 4.11 (2.81-10.7) 3.83 (2.14-9.76) 8.69(5.58-28.0) 10.2 (5.15-17.2) N-Lac-Phe (X103) 1.03 (0.47-2.01) 0.60 (0.25-3.16) 4.63 (2.87-8.52) 0.81 (0.42-1.24)* MTCA (xio2) 4.92(1.92-19.2) 6.46 (3.38-20.2) 9.09 (7.17-13.0) 2.64(1.91-5.09)* Kyn (X1Q2) 7.11 (4.18-9.18) 7.51 (5.50-10.3) 11.9 (6.84-18.5) 6.31 (4.02-9.66) * KynA (xio3) 5.39 (3.13-12.3) 6.94 (4.50-11.2) 16.3 (6.69-23.3) 10.9 (5.33-15.3) Ser (X105) 1.28 (0.57-1.62) 1.49 (1.05-2.51) 3.06 (1.56-5.67) 1.25 (0.66-2.54)* IQR: interquartile range. AUC: are under the curve, Trp: tryptophan, ILA: indole -3-lactic acid, I Aid: indole-3-aldehyde, IAA: indole-3-acetic acid IPA: indole-3-propionic acid, Tyr: tyrosine, HPLA: hydroxyphenyl-lactic acid, Phe: phenylalanine, Leu: ieucine, LeuA: leucine acid N-Lac-Phe: N-lactoyl-phenylalanine, MTCA: l-methyl-tetrahydro-p-carboiine-3-carboxylic acid, Kyn: kynurenine, KynA: kynrenine acid, Ser: serine Intergroup differences between the two groups were analyzed by Wilcoxon rank sum test. * p < 0.05 indicates statistically significant. [Table 3]

[0081] <Test Example 2> Evaluation of combination of B. infantis strain M-63 and human milk oligosaccharide by fecal culture (1) Pretreatment of specimen Fecal samples were obtained from four healthy small children aged 3 to 5 years. The samples were collected immediately after defecation and were promptly transferred to an anaerobic condition at 10°C or lower. Within 8 hours after defecation, the collected feces were diluted tenfold with physiological saline and stored at -80°C until use.

[0082] (2) Fecal culture 2'-Fucosyllactose (2'-FL), which is the most abundant and representative human milk oligosaccharide in breast milk, was used. A culture experiment was conducted following the procedure described below to simulate a colonic environment. A Bio Jr. 8 multi vessel 100 mL bioreactor (BJR-25NA1S-8M, manufactured by Biott Corporation) was used, and operated in accordance with the manual thereof. The culture medium used was 100 mL of an YCFA medium with the composition shown in Table 4. All culture medium components other than B. infantis strain M-63 and 2'-FL were dissolved in purified water and sterilized by autoclaving. B. infantis strain M-63 was added to the autoclaved culture medium in the form of viable cell powder (manufactured by MORINAGA MILK INDUSTRY CO., LTD.). 2'-FL (manufactured by KYOWA HAKKO BIO CO. LTD.) dissolved in purified water and subsequently sterilized by filtration was added to the autoclaved culture medium. The culture temperature was set at 37°C, and anaerobic conditions were maintained throughout the cultivation period by injecting filter-sterilized CO2 to each culture vessel. After adjusting the pH to 7.0, 100 pL (equivalent to 10 mg of feces) of each fecal sample diluted with physiological saline was added, and anaerobic cultivation was initiated. In order to simulate the colonic pH of infants, the pH was controlled during the cultivation period by neutralization with 1M Na2CO3 when the pH dropped below 5.5. Twenty-four hours after the start of cultivation, the culture medium was collected and centrifuged at 8,000 rpm for 3 min at 4°C, and the supernatant and pellet were collected separately.

[0083] [Table 4] Culture medium components Unit Content (per 100 ml) Control 2'-FL 2'-FL+M-63 Casitone g 1.0 1.0 1.0 Yeast extract g 0.25 0.25 0.25 NaHCO3 g 0.4 0.4 0.4 KH2PO4 g 0.045 0.045 0.045 NaCI g 0.09 0.09 0.09 (NH4)2SO4 g 0.09 0.09 0.09 MgSO4-7H2O g 0.045 0.045 0.045 CaCl2 g 0.09 0.09 0.09 Resazurin mg 0.1 0.1 0.1 Hemin mg 1.0 1.0 1.0 Biotin pg 1.0 1.0 1.0 Vitamin B12 (Cobalamin) pg 1.0 1.0 1.0 p-Aminobenzoic Acid pg 3.0 3.0 3.0 Folic Acid pg 5.0 5.0 5.0 Pyridoxamine Dihydrochloride pg 15.0 15.0 15.0 Vitamin B1 Hydrochloride pg 5.0 5.0 5.0 Riboflavin pg 5.0 5.0 5.0 Acetic acid ml 0.2 0.2 0.2 Propionic acid ml 0.07 0.07 0.07 n-Valeric acid ml 0.012 0.012 0.012 Iso-Valeric acid ml 0.012 0.012 0.012 Iso-butyric acid ml 0.012 0.012 0.012 2'-Fucosyllactose (2'-FL) g 0 1.0 1.0 B. infantis M-63 (M-63) colony forming unit (cfu) 0 0 1010

[0084] (3) DNA extraction and bacterium count DNA was extracted from the pellet collected in (2) using a GENE PREP STAR PI-480 automated extractor (Kurabo Industries Ltd., Japan). Using the extracted DNA as a template, quantitative PCR was performed with the FW primer (SEQ ID NO: 1) and RV primer (SEQ ID NO: 2) shown in Table 5 using an Applied Biosystems 7500 Fast & 7500 real-time PCR system (manufactured by Thermo Fisher Scientific), and the count of Bifidobacterium spp. was determined. PCR conditions included denaturation at 95°C for 5 seconds, followed by annealing at 55°C for 20 seconds and extension at 72°C for 30 seconds, with the number of cycles being 40.

[0085] [Table 5] Target organisms Sequences (5’ ^ 3’) Annealing temperature (°C) Extension temperature (°C) Bifidobacterium FW CTCCTGGAAACGGGTGG 55 72 RV GGTGTTCTTCCCGATATCTACA

[0086] (4) Quantification of metabolites in culture supernatant Metabolites (acetic acid, 4-hydroxyphenyllactic acid, and indole-3-acetic acid) in the culture supernatant collected in (2) were quantified according to the following procedure. The acetic acid concentration was quantified by HPLC (Shimadzu Organic Acid Analysis System, Shimadzu Corporation, Kyoto, Japan). Analysis was performed at 45°C for 30 minutes using Shim-pack SCR-102H columns (300 mm x 8 mm ID column, 3 columns connected in series), with Shimpack SCR-102H (50 mm x 6 mm ID) as a guard column at a flow rate of 0.8 mL / min. A p-toluenesulfonic acid solution at a concentration of 5 mmol / L was used as a solvent, and a solution of 5 mmol / L of p-toluenesulfonic acid, 100 pmol / L of EDTA, and 20 mmol / L of Bis-Tris was used as a reaction solution. Quantification of 4-hydroxyphenyllactic acid (HPLA) and indole-3-lactic acid (ILA) concentrations was performed by liquid chromatography-tandem mass spectrometry (LC-MS / MS) using a TSQ-FORTIS (manufactured by Thermo Fisher Scientific Inc.) coupled with a Vanquish HPLC system. For LC-MS / MS quantification, an XBridge (registered trademark) C8 column (4.6 mm x 150 mm, 3.5 pm) (Waters Corporation, Milford, MA, USA) was used. The mobile phase used consisted of (A) water containing 0.1% (v / v) formic acid and (B) methanol, and the flow rate was set to 0.2 mL / min. The gradient elution profile was as follows: (i) 30% B for 5 minutes; (ii) increase from 30% to 95% until 42 minutes; (iii) hold at 95% until 47 minutes; (iv) decrease from 95% to 30% until 50.5 minutes; and (vii) hold at 30% until 60 minutes. All chemical reagents used were of analytical grade.

[0087] (5) Results FIG. 9 shows bacterium counts of Bifidobacterium spp. measured by quantitative PCR after 24-hour cultivation. 2'-FL alone did not exhibit an effect of promoting proliferation of Bifidobacterium spp.; however, when combined with B. infantis strain M-63, a significant effect of promoting proliferation of Bifidobacterium spp. was observed.

[0088] FIG. 10 to FIG. 12 show concentrations of metabolites in the supernatants after 24-hour cultivation. Compared with the case of 2'-FL alone, in a case where 2'-FL and B. infantis strain M-63 were combined, significantly increased production of acetic acid, HPLA, and ILA was observed. These results have indicated that B. infantis strain M-63 enhances effects of 2'-FL, which is a representative human milk oligosaccharide, and is useful for improving the intestinal environment through proliferation of Bifidobacterium spp. and production of beneficial metabolites.

Claims

1. A composition to be taken by a healthy full-term newborn, infant, or small child for decreasing bacteria belonging to the family Enterobacteriaceae in a gut microbiota, the composition comprising one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium.

2. A composition to be taken by a healthy full-term newborn, infant, or small child for promoting proliferation of Bifidobacterium spp., the composition comprising one kind or two or more kinds selected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium.

3. A composition to be taken by a healthy full-term newborn, infant, or small child for anti-inflammation, the composition comprising one kind or two or more kindsselected from bacterial cells of Bifidobacterium longum subsp. infantis strain M-63 (NITE BP-02623), a culture of the bacterium, and a treated product of the bacterium.

4. The composition according to claim 3, wherein an antiinflammatory effect is obtained by increasing one kind or two or more kinds selected from phenylalanine, tryptophan, and a tryptophan metabolite and / or decreasing one kind or two kinds selected from IFN-Y and IL-1£ in a gut.

5. The composition according to any one of claims 1 to 3, further comprising a human milk oligosaccharide.

6. The composition according to claim 5, wherein the human milk oligosaccharide is one or more kinds selected from 2'-fucosyllactose, 3-fucosyllactose, 3'-sialyllactose, 6'-sialyllactose, lacto-N-tetraose, lacto-N-neotetraose, and difucosyllactose.

7. The composition according to any one of claims 1 to 3, which is taken at 1.0x108 to 5.0x109 cfu / kg bodyweight / day in terms of the bacterial cells.

8. The composition according to any one of claims 1 to 3, which is taken together with breast-feeding.

9. The composition according to any one of claims 1 to 3, which is a food product or a drink.

10. The composition according to claim 8, which is formula.

11. The composition according to any one of claims 1 to 3, which is a pharmaceutical product.

Images