Fungal endophyte

AU2025234010A1Pending Publication Date: 2026-09-17GRASSLANZ TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
AU2025234010
Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-05
Filing Date
2025-03-04
Publication Date
2026-09-17

Smart Images

  • Figure 00000051_0000
    Figure 00000051_0000
  • Figure 00000052_0000
    Figure 00000052_0000
  • Figure 00000052_0001
    Figure 00000052_0001
Patent Text Reader

Abstract

Disclosed are Epichloë endophytes that produce bioactive secondary metabolites in symbiotic association with a host plant, particularly a grass host plant. Also disclosed are methods of using these endophytes to confer pest resistance on host plants without conferring alkaloid toxicosis, and combinations comprising these endophytes and host plants or parts thereof, including seeds.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD The present invention generally relates to Epichloe endophytes that produce bioactive secondary metabolites in symbiotic association with host plants, particularly grass plants, and that remains viable in host plant seed for an extended period of time. The invention also generally relates to methods of using Epichloe endophytes to confer pest resistance on host plants without causing alkaloid toxicosis in grazing livestock, and to combinations comprising this endophyte and host plants or parts thereof, including seeds. BACKGROUND OF THE INVENTION Lolium perenne, commonly known as perennial ryegrass, is a major forage grass in New Zealand. Lolium perenne in New Zealand is found naturally infected with asexual wild-type symbiotic Epichloe fungal endophytes (e.g., Epichloe festucae var. loll!) (‘wild-type’ is also commonly referred to as ‘standard endophyte’ or ‘common toxic endophyte’). Epichloe festucae var. lolii mediates the production, in planta, of various types of secondary metabolite, typically alkaloidal compounds, a number of which confer beneficial properties to their ryegrass hosts. In particular, at least three different types of alkaloid are produced in planta by the wild-type endophyte (ergot alkaloids, pyrrolopyrazines, and indole diterpenes), which are known to improve resistance of the host plant to various insect pests. Clavines are the simplest compounds of the ergot-alkaloid class produced in planta by Epichloe endophytes. Clavines are involved as intermediates in the early stages of ergot alkaloid biosynthesis, which progresses through the production of lysergic acid and its amides to complex ergopeptines such as ergovaline (Young et al., 2015). While certain Epichloe endophytes express clavine compounds only, others are known to express a wider range of ergot alkaloid derivatives. In some endophytes, accumulation of chanoclavine can reach concentration levels equivalent to those observed for the ergopeptine alkaloids. Ergot alkaloids of the clavine class appear to be less effective in reducing insect damage than compounds from the animal-toxic ergopeptine class but have been shown to deter the feeding of fall armyworm (Spodoptera frugiperda) (Clay K and Cheplick 1989). Ergovaline is an ergot alkaloid compound produced in planta within ryegrass infected with wild-type strains of Epichloe festucae var. lolii as well as with certain commercial strains. Ergovaline has been shown to provide ryegrass with resistance to adult black beetle (Heteronychus arator), a major pasture pest in northern New Zealand (Ball et al., 1997). Epichloe endophytes that colonize ryegrass are also known to produce the pyrrolopyrazine alkaloid peramine in planta. Peramine has been shown to confer insect protection against the Argentine stem weevil (Listronotus bonariensis), a major pasture pest in New Zealand (Rowan et al., 1990). Epichloe endophytes are also known to produce lolitrems, indole diterpene alkaloids, including lolitrem B in planta in ryegrass. Lolitrem B is known to reduce the larval growth of Argentine stem weevil (Dymock et al., 1989). Rare examples of Epichloe festucae var. lolii (recently classified also as Epichloe LpTG-3 (Lolium perenne Taxonomic Group 3)) (Hettiarachchige et al., 2015) in planta produce epoxyjanthitrem alkaloids. These indole diterpene compounds produced by the endophyte in planta in ryegrass are associated with improved resistance of the host plant to a species of porina (Wiseana cervinata) (Finch et al., 2020). The potential benefits of different levels and / or different types of these various alkaloids for the agricultural production of forage grasses, and subsequently the production of livestock grazing on those forage grasses, were recognized in the 1980s and 1990s. This recognition led to the development and commercialization of a number of Epichloe endophyte / plant associations, symbioses in which the endophyte strains produced, in planta, varying types and amounts of alkaloids which confer various levels of biotic and / or abiotic resistance to the host plant. Unfortunately, certain alkaloids produced in planta by Epichloe New Zealand wild-type endophyte and some commercial strains in ryegrass in New Zealand can have detrimental effects on animals that consume the infected plants as feed. Heat stress, for example, including the associated symptoms of reduced weight gain, higher body temperature and increased respiration rate, is caused or exacerbated by the ingestion of ergovaline present in ryegrass grazed by livestock. Another detrimental consequence of Epichloe endophyte presence within forage ryegrass is the neurological impairment “ryegrass staggers”, known to affect New Zealand livestock since the early 1900s. Ryegrass staggers are caused by consumption of the tremorgenic indole diterpene mycotoxins lolitrem B and epoxyjanthitrems produced by the endophyte in planta (Gallagher et al., 1981; Gallagher et al., 1982; Finch et al., 2020). Importantly, ryegrass grown in New Zealand that is not infected with a selected or wild-type Epichloe endophyte is susceptible to attack by a number of different insect pests, including Argentine stem weevil, which is a major pasture pest (Popay and Hume, 2011; Prestidge et al., 1982; Mortimer and di Menna, 1983). Given the high level of pest pressure on forage grasses in New Zealand, particularly forage ryegrass, establishing and maintaining robust and productive grazing areas (e.g., paddocks, pastures, fields) for livestock depends on the presence of high levels of Epichloe infected forage plants. Such plants are delivered to the end user farmer via host plant seed that is infected with viable endophyte. To ensure efficacy on-farm in terms of protecting the host grass plant from biotic and abiotic stresses, such as insect pests and drought, seed sold to farmers needs to be infected with a high level of viable endophyte. Typically, maintaining this high level of viable endophyte in stored seed requires cold storage facilities, adding to the cost of production for the seed companies. To continue maintaining this high level of viability, seed entering the supply chain moving from seed producer to end user must be kept cold and at a controlled humidity level, further adding to costs. In many cases, endophyte containing seed moving through the supply chain is not maintained cold or at a controlled humidity level for various reasons. Rather, the endophyte containing seed is subjected to ambient storage conditions (e.g., ambient temperatures and ambient humidity) for various periods of time, leading to a reduction in endophyte viability. Additionally, the viability of Epichloe endophytes in stored seed is reduced over time, with viability levels of many available endophytes becoming greatly reduced within a relatively short period of storage time. Accordingly, there is a need in the art for strains of Epichloe endophyte that will form symbioses with host plants, particularly ryegrass plant hosts, that will confer on the host plant, advantages in terms of insect pest resistance as described above, while avoiding some of the disadvantages associated with detrimental effects on livestock. There is also a need in the art for strains of Epichloe endophyte that will maintain high levels of viability in seed when subjected to varying temperature and humidity conditions and / or over long periods of time. It is an object of the present invention to provide at least one Epichloe endophyte strain which when combined with a host plant confers the benefits of at least some level of pest protection and / or disease protection on the host plant without causing ryegrass staggers and / or that remains viable in a high percentage of infected seed under ambient storage conditions and / or that remains viable in a high percentage of infected seed for an extended period of time and / or that will at least provide the public with a useful choice. In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. SUMMARY OF THE INVENTION In one aspect, the present invention relates to an isolated strain of Epichloe endophyte comprising a B11 allele size of 181 base pairs (bp) and an ans049 allele size of 306 bp. In another aspect, the invention relates to an isolated strain of Epichloe endophyte that is AR153 (DSM 34880). In another aspect the invention relates to a combination comprising an isolated strain of Epichloe endophyte as described herein and a host plant. In another aspect the invention relates to a plant seed infected with an isolated strain of Epichloe endophyte as described herein. In another aspect the invention relates to a population of plant seeds infected with an isolated strain of Epichloe endophyte as described herein. In another aspect the invention relates to a method of making an artificial host plant / Epichloe endophyte combination that does not induce Epichloe toxicosis in animals upon consumption, the method comprising artificially infecting a host plant with an Epichloe endophyte as described herein. In another aspect the invention relates to a method of conferring at least some level of pest protection on a host plant comprising artificially infecting the host plant with AR153 to form a host plant / Epichloe endophyte combination. In another aspect the invention relates to a method of making a population of plant seeds comprising an Epichloe endophyte that remains viable in at least 70% of the population for at least 1 -year postharvest comprising artificially infecting a host plant with an Epichloe endophyte comprising a B11 allele of size 181 bp and an ans049 allele of size 306 bp to form a host plant / Epichloe endophyte combination and growing the combination under conditions that produce seeds. Various embodiments of the different aspects of the invention as discussed above are also set out below in the detailed description of the invention, but the invention is not limited thereto. Other aspects of the invention may become apparent from the following description that is given by way of example only and with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described by way of example only and with reference to the drawings in which: FIGURE CAPTIONS Figure 1. Mean ryegrass staggers (RGS) scores of lambs grazing novel and control endophytes in cultivar Samson ryegrass over the duration of the trial. Error bars represent the ± SEM. WT = wildtype. Figure 2. Respiration rate (breathes per 30 seconds) and rectal temperature (°C) of lambs grazing novel and control endophytes in cultivar Samson ryegrass at the first heat stress assessment (Day 19). Bars within graphs sharing common letters are not significantly different (p<0.05). Error bars represent the ± SEM. WT = wild-type. Figure 3. Respiration rate (breathes per 30 seconds) and rectal temperature (°C) of lambs grazing novel and control endophytes in cultivar Samson ryegrass at the second heat stress assessment (Day 39). Wild-type endophyte is not represented as no lambs remained on this treatment. Bars within graphs sharing common letters are not significantly different (p<0.05). Error bars represent the ± SEM. WT = wild-type. Figure 4. Mean live weight change (g / day) of lambs grazing novel and control endophytes in cultivar Samson ryegrass over Days 0 to 23 and Days 23 to 42. Bars within graphs sharing common letters are not significantly different (p<0.05). Error bars represent the ± SEM. WT = wild-type. Figure 5. Viable endophyte in seed stored at Lincoln, Canterbury under ambient conditions for the means of 2 seed lines of AR153, 3 seed lines of AR37 and 3 seed lines of AR1. The dotted line shows 70% threshold, below which the proprietary forage seed industry has agreed that seed should not be sold as “infected with an Epichloe endophyte” as it will be less efficacious in the field. DETAILED DESCRIPTION OF THE INVENTION Definitions The following definitions are presented to better define the present invention and as a guide for those of ordinary skill in the art in the practice of the present invention. The term “plant” as used herein encompasses whole plants and all parts of a plant from all stages of a plant life cycle including but not limited to vegetative and reproductive cells and tissues, propagules, seeds, embryos, shoots, stems, leaves, leaf sheaths and blades, inflorescences, roots, anthers, ligules, palisade, mesophyll, epidermis, auricles, palea, lemma and tillers. The term, “Epichloe!’ as used herein refers to Epichloe, a genus of endophytic fungi comprising fungal endophytes from two previously named genera; the members of the anamorphic form genus Neotyphodium and the members of the teleomorphic genus Epichloe (Leuchtmann et al., 2014). The term, “Epichloe endophyte” as used herein refers to an endophyte of the genus Epichloe that is known in the art, or that has been shown herein, to form a symbiotic association with a host plant. The abbreviation “ppm” as used herein means ‘parts per million’ dry weight of the host plant infected with the endophyte, e.g., mg per kg dry weight (mg / kg DM). The terms “Epichloe toxicosis”and “Epichloe alkaloid toxicosis” and grammatical variations thereof as used herein refer to Epichloe endophyte-derived alkaloid toxicosis which can result in reductions in animal productivity (e.g. weight gain and milk production), a reduced ability to regulate body temperature particularly when under heat stress, impaired neurology (“ryegrass staggers”) and increased faecal soiling of the breech area of sheep (“dags”) leading to higher incidence of myiasis (“flystrike”). In one embodiment, Epichloe toxicosis is ryegrass staggers. The terms, “artificially infecting” and "artificial inoculation" as used herein encompass any inoculation of a plant, particularly a plant, preferably a grass plant, preferably a Lolium spp. (ryegrasses) plant, a Festuca spp. Plant, a Festulolium spp. or a Schedonorus spp. plant with an Epichloe endophyte as described herein, preferably AR153, to form a plant / fungal symbiotic association that is not known from nature. In some embodiments the Lolium spp. plant is L. perenne, L. boucheanum, and / or L. multiflorum. In some embodiments the Festuca spp. plant is Festuca arundinacea. In some embodiments the Schedonorus spp. plant is Schedonorus arundinaceus. The term “non-endogenous” as used herein with reference to a host plant in combination or in association with an Epichloe endophyte means that the host plant is not an endogenous host of the endophyte; i.e., that the host plant is a “non-endogenous” plant for that combination. Preferably the combination or association is a stable symbiotic combination or association. To be clear, a combination of a non-endogenous host plant and an Epichloe endophyte as described herein means an artificial combination that is not found in nature. The term “in planta” as used herein in the context of fungal endophytes means a combination of an isolated strain of Epichloe endophyte as described herein and a host plant, wherein the endophyte is living symbiotically within the host plant and preferably wherein the endophyte is in a stable plant / fungal symbiosis with the host plant. The terms “ans014”, “ans015”, “ans016”, “ans017”, “ans019”, “ans024”, “ans025”, “ans030”, “ans031”, “ans032”, “ans033”, “ans035”, “ans036”, “ans044”, “ans047”, “ans049”, “ans054”, “ans056”, “egs002”, “egs004”, “egs0010”, “egs027”, “B10” and “B11 ” as used herein specifically refer to the alleles having these labels as shown in Table 1. The term, “conferring at least some level of pest protection on a host plant” as used herein encompasses measurably reducing the incidence, severity and / or duration of the effects of a pest on a host plant that is infected with an Epichloe endophyte as described herein as compared to a host plant lacking an Epichloe endophyte (a control plant), and / or a host plant having a different Epichloe endophyte. In some embodiments the pest is an insect pest. Preferably a measurable reduction of the incidence, severity and / or duration is a statistically significant reduction with a P-value of 0.05 or less. The terms, “a level sufficient to confer pest protection” and “a level sufficient to confer pest resistance” and grammatical variations thereof as used herein with reference to levels of alkaloids mean any level of an alkaloid produced by the host plant-endophyte symbiosis that is sufficient to produce a measurable reduction in the incidence, severity or duration of a pest infestation, infection or detrimental effect on the host plant as compared to a host plant lacking an Epichloe endophyte (a control plant), and / or a host plant having a different Epichloe endophyte. In some embodiments the pest is an insect pest. The phrase “does not induce Epichloe toxicosis in animals upon consumption” means that no measurable symptoms of Epichloe toxicosis are observed or are present in the animals for greater than about 2 hours after consumption of an Epichloe endophyte as described herein / host plant combination. Preferably the animals are livestock animals, preferably sheep and / or cattle. Feeding encompasses providing harvested plant / endophyte combination material to an animal as well as grazing an animal on an area of land comprising the plant / endophyte combination. The term “detectable levels” when used herein with reference to an alkaloid produced in planta by a host grass infected with an Epichloe endophyte (including but not limited to lolitrem B, ergovaline, chanoclavine and peramine) means less than 0.1 ppm (mg / kg dry weight) of the alkaloid. The term “subjected to ambient storage conditions”, and grammatical variations thereof as used herein with reference to Epichloe endophyte infected seeds, means that the seeds have been stored under variable environmental conditions and have not been maintained at a controlled level of temperature and / or of humidity. Importantly, seeds that are subjected to ambient storage conditions have not been maintained under controlled temperatures of about 0°C to about 4°C. In some embodiments seeds that have been subjected to ambient storage conditions have been maintained at temperatures from at least 4°C to about 30°C. Importantly, seeds that are subjected to ambient storage conditions have not been maintained under controlled levels of humidity of about 0% to about 40% humidity, preferably of about 0% to about 30%, preferably of about 0% to about 20% humidity. In some embodiments seeds that have been subjected to ambient storage conditions have been maintained at humidity levels from at least 20% humidity to about 100% humidity, preferably from at least 30%, preferably from about 40% humidity to about 100% humidity. The term “an extended period of time” as used herein means a period of at least 12 months after harvest, preferably at least 13, 14, 15, 16, 17, 18, 19, preferably at least 20 months after harvest over which an Epichloe endophyte as described herein remains viable in at least 70% of the seeds in a population of Epichloe endophyte infected seeds. A population of Epichloe endophyte infected seeds is a population of seeds that are produced where, at harvest, all, or substantially all, of the seeds in the population are infected with an Epichloe endophyte. The term “statistically significant” as used herein refers to the likelihood that a result or relationship is caused by something other than random chance. A result may be found to be statistically significant using statistical hypothesis testing as known and used in the art. Statistical hypothesis testing provides a "P-value" as known in the art, which represents the probability that the measured result is due to random chance alone. It is believed to be generally accepted in the art that levels of significance of 5% (0.05) or lower are considered to be statistically significant. The term “comprising” as used in this specification means “consisting at least in part of”. When interpreting statements in this specification that include that term, the features prefaced by that term in each statement, all need to be present but other features can also be present. Related terms such as “comprise” and “comprised” are to be interpreted in the same manner. The term "consisting essentially of" as used herein means the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. The term “consisting of” as used herein means the specified materials or steps of the claimed invention, excluding any element, step, or ingredient not specified in the claim. The term "about" when used in connection with a referenced numeric indication refers to the referenced numeric indication plus or minus up to 10% of that referenced numeric indication. For example, "about 100" refers to from 90 to 110 and “about six” refers to from 5.4 to 6.6. It is intended that reference to a range of numbers disclosed herein (for example, 1 to 10) also incorporates reference to all rational numbers within that range (for example, 1, 1.1,2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example, 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are hereby expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner. Detailed Description Many cool-season grasses (Poaceae, subfam. Pooideae) possess seed transmitted Epichloe fungal endophytes that are known for their bioprotective properties, and especially for production of anti-pest alkaloids such as lolines (Zhang et al., 2010) and peramine (Koulman et al., 2007). Asexual Epichloe (previously termed Neotyphodium species) are primarily or entirely transmitted vertically, whereas the sexual structures (stromata) of other related Epichloe species can give rise to horizontally transmissible spores (ascospores) (Zhang et al., 2010). Symbiotic associations between Epichloe fungi and host grasses are common, and molecular phylogenetic evidence suggests that the species specificity observed in these symbiotic associations is due to the co-evolution of these groups of plants and fungal endophytes (Schardl et al., 2008). Symbiotic associations formed between host plants and their Epichloe fungal endophytes are based on complex and intimate biological interactions which lead to a high degree of species specificity for both the endophyte and host (Simpson and Mace, 2012). As a result of a lengthy research program, the applicants have identified Epichloe endophytes that produce in combination with a host plant (i.e., “in planta"), levels of alkaloid compounds that confer pest protection on the host plant, as compared to an un-infected control plant, while inducing no symptoms of Epichloe toxicosis and / or while not inducing ryegrass staggers in the animals feeding on the combination. As known in the art, a small animal bioassay may be used to test Epichloe endophyte-grass combinations for their potential to induce ryegrass staggers (Johnson et al., 2013). Toxic Epichloe endophytes, which express tremorgenic complex indole diterpene compounds (IDTs), are known to induce a long-term tremor response in this assay (up to 96 hours), whereas less toxic endophytes, that express tremorgenic simple IDTs, induce only a short-term tremor response in mice. During the work detailed herein, the inventors observed that similar to mice administered with Epichloe endophyte strain AR1 extracts, mice administered with an Epichloe endophyte strain AR153 extracts developed short-term tremors but no long-term tremors (data not shown). Specifically, the inventors observed that although a greater dose rate of AR153 was administered, AR153 induced a much lower tremor score in mice. Given the similar IDT profile of AR1 and AR153, this difference was surprising and demonstrates that AR153 is of lower toxicity. Further, as detailed herein, in grazing livestock safety trials, animals were exposed to grazing conditions considered to be the worst-case scenario for inducing toxicosis / staggers. Under these conditions AR1 pastures can induce significant ryegrass staggers in sheep (up to 3 on the RGS scale). Chemical analysis of AR1 shows the presence of simple IDTs which are known to be tremorgenic, so it is not surprising that AR1 induces ryegrass staggers in the field (Example 8) as well as a tremor response in the mouse bioassay. However, chemical analysis of AR153 showed that it contains the same range and concentrations of simple IDTs as that observed for AR1. Hence, it was quite surprising to the inventors that AR153 showed a much lower response in the mouse bioassay and induced no ryegrass staggers in sheep tested under the worst-case scenario conditions used in safety testing (Example 8). Additionally, also as a result of a lengthy research program, the applicants have further identified Epichloe endophytes that remain viable in at least 70% of endophyte infected seed for at least 1 year, preferably for at least 16 months, preferably for at least 18 months, preferably for at least 20 months after the endophyte infected seed is produced. As disclosed herein, the identified Epichloe endophytes produce “in planta" levels of alkaloid compounds that confer pest protection on a host plant, as compared to an Epichloe endophyte free control plant, while inducing no symptoms of Epichloe toxicosis in the animals feeding on the combination and also remain viable in at least 70% of endophyte infected host plant seed for at least 1 year, preferably for at least 16 months, preferably for at least 18 months, preferably for at least 20 months after the endophyte infected seed is produced Accordingly, in one aspect, the present invention relates to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp. In one embodiment the Epichloe endophyte comprises at least one additional SSR allele selected from the group consisting of an ans017 allele of size 297 bp, an ans025 allele of size 293 bp, an ans054 allele of size 266 bp, and an egs027 allele of size 346 bp, preferably at least two, three, preferably all four additional SSR allele(s). In one embodiment the Epichloe endophyte comprises at least two additional SSR alleles, or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, at least 22 additional SSR alleles, or all 23 additional SSR alleles selected from the group consisting of a B10 allele of size 179 bp, an ans014 allele of size 291 bp, an ans015 allele of size 281 bp, an ans016 allele of size 273 bp, an ans017 allele of size 297 bp, two copies of an ans019 allele of size 176 bp, an ans024 allele of size 209 bp, an ans025 allele of size 293 bp, an ans030 allele of size 300 bp, an ans031 allele of size 294 bp, an ans032 allele of size 193 bp, an ans033 allele of size 155 bp, an ans035 allele of size 216 bp, an ans036 allele of size 242 bp, an ans044 allele of size 252 bp, an ans047 allele of size 283 bp, an ans054 allele of size 266 bp, an ans056 allele of size 238 bp, an egs002 allele of size 266 bp, an egs004 allele of size 327 bp, an egs010 allele of size 350 bp, and an egs027 allele of size 346 bp. In one embodiment the Epichloe endophyte produces in planta detectable levels of chanoclavine and peramine (Table 5a). In one embodiment the Epichloe endophyte does not produce in planta detectable levels of ergovaline or lolitrem B or both. In one embodiment the Epichloe endophyte does not produce, in planta, more than about 0.1 ppm ergovaline or more than about 0.1 ppm lolitrem B or both. In one embodiment the isolated strain of Epichloe endophyte produces in planta at least 1 ppm chanoclavine. In one embodiment the isolated strain of Epichloe endophyte produces in planta at least 10 ppm peramine. In one embodiment the Epichloe endophyte does not produce in planta detectable levels of epoxyjanthitrems. In one embodiment the production or lack thereof, in planta, of chanoclavine, peramine, lolitrem B, ergovaline and / or epoxyjanthitrem(s) is determined under controlled conditions, preferably at 22°C, preferably in a glasshouse or other controlled environment. In one embodiment the Epichloe endophyte is AR153 (DSM 34880). Epichloe endophyte strain AR153 as described herein was isolated from perennial ryegrass collected in Italy and was deposited at Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (Leibniz-lnstitut DSMZ-Deutsche Sammlung von Mikroorganismen und ZellkuIturen), Braunschweig, Germany on the following date for strain: AR153 (DSM 34880) on 13 December 2023, according to the Budapest Treaty for purposes of patent procedure. In another aspect, the invention relates to an isolated strain of Epichloe endophyte that is AR153 (DSM 34880). In one embodiment AR153 comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp. In one embodiment AR153 comprises at least one additional SSR allele selected from the group consisting of an ans017 allele of size 297 bp, an ans025 allele of size 293 bp, an ans054 allele of size 266 bp, and an egs027 allele of size 346 bp, preferably at least two, three, preferably all four additional SSR allele(s). In one embodiment AR153 comprises at least two additional SSR alleles, or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, at least 22 additional SSR alleles, or all 23 additional SSR alleles selected from the group consisting of a B10 allele of size 179 bp, an ans014 allele of size 291 bp, an ans015 allele of size 281 bp, an ans016 allele of size 273 bp, an ans017 allele of size 297 bp, two copies of an ans019 allele of size 176 bp, an ans024 allele of size 209 bp, an ans025 allele of size 293 bp, an ans030 allele of size 300 bp, an ans031 allele of size 294 bp, an ans032 allele of size 193 bp, an ans033 allele of size 155 bp, an ans035 allele of size 216 bp, an ans036 allele of size 242 bp, an ans044 allele of size 252 bp, an ans047 allele of size 283 bp, an ans054 allele of size 266 bp, an ans056 allele of size 238 bp, an egs002 allele of size 266 bp, an egs004 allele of size 327 bp, an egs010 allele of size 350 bp, and an egs027 allele of size 346 bp. In one embodiment AR153 produces in planta detectable levels of chanoclavine and peramine (Table 5a). In one embodiment AR153 does not produce in planta detectable levels of ergovaline or lolitrem B or both. In one embodiment AR153 does not produce, in planta, more than about 0.1 ppm ergovaline or more than about 0.1 ppm lolitrem B or both. In one embodiment AR153 produces in planta at least 1 ppm chanoclavine. In one embodiment AR153 produces in planta at least 10 ppm peramine. In one embodiment the Epichloe endophyte does not produce in planta detectable levels of epoxyjanthitrems. In one embodiment the production or lack thereof, in planta, of chanoclavine, peramine, lolitrem B, ergovaline and / or epoxyjanthitrem(s) is determined under controlled conditions, preferably at 22°C, preferably in a glass house or other controlled environment. In another aspect the invention relates to a combination comprising an isolated strain of Epichloe endophyte and a host plant comprising a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp. Specifically contemplated as embodiments of this aspect of the invention, are all of the embodiments related to SSR alleles, additional SSR alleles and alkaloid production (or lack thereof) as set out in the previous aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp and to an isolated strain of Epichloe endophyte that is AR153. In one embodiment the host plant is non-endogenous host plant. In one embodiment the host plant is a grass plant or part thereof, preferably a Lolium spp. plant, preferably L. perenne, L. boucheanum, or L. multiflorum, or a cultivar thereof, preferably L. perenne cultivar Grasslands Samson, Reason or Align, preferably L. multiflorum cultivar Manta. In one embodiment, the host plant is a Festuca spp plant. In one embodiment the Festuca spp is Festuca arundinacea. In one embodiment, the host plant is a Festulolium spp plant. In one embodiment the host plant is a Schedonorus spp plant. In one embodiment, the Schedonorus spp is Schedonorus arundinaceus. In one embodiment the part thereof of the host plant is a plant cell line or plant callus. In one embodiment the part thereof is a seed. In one embodiment the combination produces insufficient alkaloids in planta to cause Epichloe alkaloid toxicosis in an animal that feeds on the combination. In one embodiment the combination produces no detectable levels of lolitrem B or ergovaline or both in planta. In one embodiment the combination does not cause detectable levels of Epichloe alkaloid toxicosis in an animal that feeds on the combination. In one embodiment the Epichloe alkaloid toxicosis is ryegrass staggers. In one embodiment the combination does not cause detectable levels of ryegrass staggers in an animal that feeds on the combination. In one embodiment the animal is a grazing animal. In one embodiment the grazing animal is a livestock animal, preferably a sheep or a cow. In one embodiment the Epichloe endophyte is AR153. In another aspect the invention relates to a host plant infected with an isolated strain of Epichloe endophyte comprising a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp. Specifically contemplated as embodiments of this aspect of the invention related to a host plant infected with an isolated strain of Epichloe endophyte are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, and to combinations comprising an isolated strain of Epichloe endophyte and a host plant. In one embodiment the Epichloe endophyte is AR153. In another aspect the invention relates to a plant seed infected with an isolated strain of Epichloe endophyte comprising a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp| In one embodiment the plant seed has been artificially infected with the Epichloe endophyte. In one embodiment the plant seed is a seed of a Lolium species, a Festuca species or a Schedonorus species as contemplated in any previous aspect of the invention. In one embodiment the Epichloe endophyte is AR153. Specifically contemplated as embodiments of this aspect of the invention related to a plant seed are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant or host plants infected with an isolated strain of Epichloe endophyte. In another aspect the invention relates to a population of plant seeds infected with an isolated strain of Epichloe endophyte comprising a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp. In one embodiment the Epichloe endophyte is viable in at least 70% of the plant seeds for at least one year, preferably for at least 13, 14, 15, 16, 17, 18, 19, preferably for at least 20 months. In one embodiment, viability is at ambient storage conditions. In one embodiment the plant seeds have been subjected to ambient storage conditions for at least one year, preferably for at least 13, 14, 15, 16, 17, 18, 19, preferably for at least 20 months postharvest. In one embodiment the ambient temperatures under ambient storage conditions range from at least 4°C to about 30°C. In one embodiment the mean annual temperature under ambient storage conditions is at least 12°C. In one embodiment the mean annual temperature under ambient storage conditions is about 12°C. In one embodiment the ambient humidity under ambient storage conditions ranges from at least 70% to about 91%. In one embodiment the mean annual humidity under ambient storage conditions is at least 81%. In one embodiment the mean annual humidity under ambient storage conditions is about 81%. In one embodiment the plant seeds have been artificially infected with the Epichloe endophyte. In one embodiment the plant seeds are seeds of a Lolium species, a Festuca species, or a Schedonorus species as contemplated in any previous aspect of the invention. In one embodiment the endophyte is AR153. Specifically contemplated as embodiments of this aspect of the invention related to a population of plant seeds are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte and a plant seed infected with an isolated strain of Epichloe endophyte. In another aspect the invention relates to a population of plant seeds infected with an isolated strain of Epichloe endophyte that is AR153. In one embodiment, AR153 is viable in at least 70% of the plant seeds, and wherein the plant seeds have been subjected to ambient storage conditions for at least one year, preferably for at least 13, 14, 15, 16, 17, 18, 19, preferably for at least 20 months post-harvest. Specifically contemplated as embodiments of this aspect of the invention related to a population of plant seeds infected with AR153 are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte and a population of plant seeds infected with an isolated strain of Epichloe endophyte. In another aspect the invention relates to a method of making an artificial host plant / Epichloe endophyte combination that does not induce Epichloe toxicosis in animals upon consumption the method comprising artificially infecting a host plant with an isolated strain of Epichloe endophyte comprising a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp. In some embodiments, artificial inoculation into a host plant may be carried out using seedlings that have been germinated for about 2 weeks. Preferably the seedlings have been germinated for 4 to 9 days. Outside of this range, seedlings may still form effective associations but in some cases may be too young or too old for establishment of a mutualistic association. Seeds need to be free of non-target fungi and bacteria to ensure that the seedlings are not overcome by microbial contamination. In one embodiment, artificial inoculation may be carried out using basal inoculation of host plant seedlings. To effectively establish the Epichloe symbiont / host plant association, inoculation of the endophyte should be made into the host plant meristem by incision of the plant and insertion of cultured fungal mycelium. In some embodiments, the method further comprises quantitative chemical analysis of the host plant / Epichloe combination. In one embodiment the combination produces about 1 ppm to about 10 ppm chanoclavine. In one embodiment the combination produces about 10 ppm to 40 ppm peramine. In one embodiment the combination produces no detectable levels of ergovaline. In one embodiment the combination produces no detectable levels of lolitrem B. Quantitative chemical analysis of a host plant / Epichloe combination, particularly to identify alkaloids that are produced in the combination, is believed to be within the skill of those in the art in view of the disclosure of the present specification and common general knowledge. In some embodiments, the method comprises selecting a host plant / Ep / c / i / oecombination that produces, in planta, about 1 ppm to about 10 ppm chanoclavine, 10 ppm to 40 ppm peramine, and no detectable levels of lolitrem B, ergovaline, or both. In one embodiment the Epichloe endophyte does not produce in planta detectable levels of epoxyjanthitrems. In one embodiment the production or lack thereof, in planta, of chanoclavine, peramine, lolitrem B, ergovaline and / or epoxyjanthitrem(s) is determined under controlled conditions, preferably at 22°C, preferably in a glass house or other controlled environment. Specifically contemplated as embodiments of this aspect of the invention related to a method of making an artificial host plant / Epichloe endophyte combination are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte, a population of plant seeds an isolated strain of Epichloe endophyte and a population of plant seeds infected with AR153. In another aspect the invention relates to a method of conferring at least some level of pest protection on a host plant comprising artificially infecting the host plant with an isolated Epichloe endophyte comprising a B11 allele of size 181 bp and an ans049 allele of size 306 bp to form a host plant / Epichloe endophyte combination. In one embodiment the isolated Epichloe endophyte is AR153. In one embodiment, the pest is an insect pest. In one embodiment the level of pest protection reduces consumption of the host plant / Epichloe endophyte combination by insect pests when compared to the consumption of the uninfected host plant by insect pests. The term “uninfected host plant” and grammatical variations thereof as used herein means a host plant of the same species and / or subspecies and / or cultivar, that is not infected with the Epichloe endophyte. In one embodiment the level of pest protection reduces consumption of the host plant / Epichloe endophyte combination by insect pests when compared to the same species and / or subspecies and / or cultivar of the host plant that is infected with a different Epichloe endophyte. In one embodiment the insect pest is selected from the group consisting of: (1) species of aphids selected from the group consisting of Rhopalosiphum padi, Schizaphis graminum, Rhopalosiphum maidis, Metopoliphium dirhodum, Sitobion spp., Sitobion avenae, Sitobion fragariae, and Diuraphis noxis; (2) species of grass and cereal flies selected from the group consisting of Oscinella frit, Oscinella pusilia, Mayetiola destructor, Cerodontha spp., Cerodontha australis, Cerodontha angustipennis, Formia fumigata, Meromyze americana, Haplodiplosis marginata, Chlorops pumilionis, Tipula spp. Chromatomyia fuscula, Cephus pygmaeus, Chromatomyia fuscula, and Contarinia tritici; (3) species of thrips selected from the group consisting of Limothrips cerealium, Limothrips denticornis, Aptinothrips rufus, and Stenothrips graminum; (4) species of grasshoppers and crickets selected from the group consisting of Locusta migratoria, Phaulacridium marginale, Phaulacridium vittatum, Melanoplus spp., and Teleogryllus commodus; (5) species of bugs Nyssius huttonior Blissus leucopertus; (6) weevils of Sphenophorus spp.; (7) species of armyworm and cutworm selected from the group consisting of Pseudaletia unipuncta, Spodoptera spp., Mythimna separata; Persectania aversa, and Agrostis ipsilon; (8) Oulema melanopus leaf bugs; (9) species of white grubs selected from the group consisting of Popillia japonica, Costelytra zealandica, Phylloperthaspp., Rhizotrogus majalis, and Anisoplia segetum; (10) species of mealybug selected from the group consisting of Phenacoccus hordei, Balanococcus poae, Ripersella rumicis, and Porphyrophora tritici; (11) species of wireworms Conoderus spp., or Limonius spp.; (12) Zabrus tenebrioides beetles; (13) species of mites selected from the group consisting of Penthaleus spp., Halotydeus destructor, and Aceria spp.; (14) species of stored product pests selected from the group consisting of Sitophilus oryzae, Sitophilus granarius, Sitotroga cerealella, Rhyzopertha dominica, Cryptolestes spp., Oryzaephilus surinamensis, Cadra cautella, Plodia interpunctella, Tribolium confusum, Tribolium castaneum, and Lasioderma erricorne; (15) Philaenus spumarius froghoppers; (16) species of nematodes selected from the group consisting of root lesion nematodes of Pratylenchus spp. selected from the group consisting of P. thornei, P. crenatus, P. neglectus and P. penetrans, cereal cyst nematodes of Heterodera spp. and Punctodera spp. selected from the group consisting of H. avenae, H. latipons, H. hordecalis, H. filipjevi, H. mani, H. bifenestra, H. pakistanensis and P. punctata, root knot nematodes of Meloidogyne spp. selected from the group consisting of M. chitwoodi, M. naasi, M. artiellia, M. microtyla, M. ottersoni, M. graminicola, M. graminis, M. kikuyensis and M. spartinae, stem nematodes of Ditylenchus spp. selected from the group consisting of D. dipsicai and D. radicicola; and the seed gall nematode Anguina tritici; (17) species of slugs selected from the group consisting of Deroceras reticulatum, Arion hortensis agg. and A. subfuscus. In one embodiment the insect pest is Argentine stem weevil (Listronotus bonariensis), black beetle (Heteronychus arator), or root aphid (Aploneura lentisci), or a combination thereof. In one embodiment protection against Argentine stem weevil (Listronotus bonariensis) is protection against Argentine stem weevil adults and larvae. Specifically contemplated as embodiments of this aspect of the invention related to a method of conferring at least some level of pest protection on a host plant are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with AR153 and a method of making an artificial host plant / Epichloe endophyte combination. In another aspect the invention relates to a method of reducing the average level of Epichloe toxicosis experienced by an animal consuming an Epichloe infected host plant comprising feeding the animal with a host plant that is artificially infected with an Epichloe endophyte comprising a B11 allele of size 181 bp and an ans049 allele of size 306 bp. In one embodiment the reduction in the average level of Epichloe toxicosis is at least 70%, preferably at least 80%, 85%, 90%, 95%, 99%, preferably about 100%. In one embodiment the reduction is a complete reduction to no Epichloe toxicosis being experienced by the animal. In one embodiment the Epichloe endophyte is AR153. In one embodiment the host plant is a Lolium spp. plant, Festuca spp plant, or Schedonorus spp plant as contemplated herein for any previous aspect of the invention. In one embodiment the Epichloe toxicosis is ryegrass staggers. Specifically contemplated as embodiments of this aspect of the invention related to a method of reducing the average level of Epichloe toxicosis experienced by an animal consuming an Epichloe infected host plant are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with AR153, a method of making an artificial host plant / Epichloe endophyte combination and a method of conferring at least some level of pest protection on a host plant. In another aspect the invention relates to a method of reducing the average level of Epichloe toxicosis experienced by an animal consuming an Epichloe infected host plant, the method comprising planting an area of land with a host plant or with the seed of a host plant that has been artificially infected with an Epichloe endophyte comprising a B11 allele of size 181 bp and an ans049 allele of size 306 bp, and then feeding the animal with the host plant or parts thereof from the area of land and / or feeding the animal by grazing the animal on the area of land. In one embodiment the reduction in the average level of Epichloe toxicosis experienced by the animal is an average reduction relative to the average level of Epichloe toxicosis experienced by the same type of animal consuming the host plant that is infected with a selected or wild-type Epichloe endophyte. In one embodiment the Epichloe toxicosis is ryegrass staggers. In one embodiment the average level of ryegrass staggers is reduced by at least 70%, 75%, 80, 85%, 90, 95%, at least 99%, or by 100%. In one embodiment the endophyte is Epichloe endophyte AR153. In one embodiment the host plant is a Lolium spp. plant, Festuca spp plant, or Schedonorus spp plant as contemplated herein for any previous aspect of the invention. In one embodiment the area of land is a pre-determined area of land on which deterrence or reduction of pest damage is desired. In one embodiment the area of land, or pre-determined area of land is a verge, divider, clearing, field, meadow, pasture or paddock. In one embodiment the area of land is used in agriculture. In one embodiment, at least 10%, preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, preferably about 99%, preferably about 100% the area of land is planted. In one embodiment, at least 10%, preferably about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, preferably about 99%, preferably 100% the area of land is planted. In one embodiment the area of land is planted with a population of seeds of the host plant that has been infected with AR153, wherein the population of seeds comprises at least 70% viable endophyte, preferably wherein the population of seeds is at least 1 year, preferably at least 13, 14, 15, 16, 17, 18, or 19 months, preferably at least 20 months old. Specifically contemplated as embodiments of this aspect of the invention related to a method of reducing the average level of Epichloe toxicosis experienced by an animal consuming an Epichloe infected host plant are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with AR153, a method of making an artificial host plant / Epichloe endophyte combination and a method of conferring at least some level of pest protection on a host plant. In another aspect the invention relates to a method of increasing the yield of a livestock animal comprising artificially infecting a host plant with an Epichloe endophyte comprising a B11 allele of size 181 bp and an ans049 allele of size 306 bp to form a host plant / Epichloe endophyte combination, and feeding the combination to an animal, wherein consumption of the combination by the animal does not result in Epichloe toxicosis in the animal. Specifically contemplated as embodiments of this aspect of the invention related to a method of increasing the yield of a livestock animal all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with AR153, a method of making an artificial host plant / Epichloe endophyte combination and a method of conferring at least some level of pest protection on a host plant. In another aspect the invention relates to a method of making a population of plant seeds comprising an Epichloe endophyte that remains viable in at least 70% of the population for at least 12 months under ambient storage conditions after the seeds are harvested comprising artificially infecting a host plant with an Epichloe endophyte comprising a B11 allele of size 181 bp and an ans049 allele of size 306 bp to form a host plant / Epichloe endophyte combination and growing the combination under conditions that produce seeds. Specifically contemplated as embodiments of this aspect of the invention related to a method of making a population of plant seeds are all of the embodiments set forth above in the aspects of the invention directed to an isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp, an isolated strain of Epichloe endophyte that is AR153, combinations comprising an isolated strain of Epichloe endophyte and a host plant, host plants infected with an isolated strain of Epichloe endophyte, a plant seed infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with an isolated strain of Epichloe endophyte, a population of plant seeds infected with AR153, a method of making an artificial host plant / Epichloe endophyte combination, a method of conferring at least some level of pest protection on a host plant, and a method of increasing the yield of a livestock animal. Various aspects of the invention will now be illustrated in non-limiting ways by reference to the following examples. EXAMPLES EXAMPLE 1 Detection of fungal endophyte strain Source and geographic origin of AR153. The isolated strain of Epichloe endophyte described herein was obtained from a wild ryegrass plant (Lolium perenne) collected from a field site in Italy (plant source accession number 56027). The collected plant was assessed for the presence of Epichloe endophyte using the immuno-detection method of Simpson et al. (2012). Seeds from the Epichloe endophyte-infected plant were harvested and dispatched to New Zealand for further examination. As detailed further herein, selecting the inventive strain AR153 detailed herein required the screening of >3000 seed accessions from around the globe. Current methodologies only allow for the screening of 30-40 accessions in one experiment, taking 3-4 months to complete the analyses required to determine the alkaloids produced and the genetic distinctiveness from already catalogued strains. Our current collection contains 191 characterized strains. EXAMPLE 2 Detection of genetic variation of fungal endophyte strains Endophyte strain AR153 was characterized and distinguished for genetic variation by DNA ‘fingerprinting’ based on genotypic data derived from up to 24 selected simple sequence repeat (SSR) marker loci using primer sequences of Table 1. These primer sequences had previously been shown to generally amplify Epichloe endophyte polymorphic DNA sequences from when the endophytes are in planta (Moon et al., 1999; Kirkby et al., 2011; Simpson et al., 2012; Card et al., 2014). Samples of about 100 mg fresh weight of basal tiller were used to extract total genomic DNA (plant + endophyte), following the plant DNA isolation procedure of the FastDNA kit as recommended by the manufacturer (MP Biomedicals, Solon, Ohio, USA) for plant samples. SSR amplification was conducted with oligonucleotide primer pairs, using one of the following two polymerase chain reaction (PCR) protocols. In both protocols, PCR was carried out using an iCycler thermocycler (BioRad, Hercules, California, USA). Protocol 1 was as described by Moon (Moon et al., 1999), except that an annealing temperature of 60°C was used. In this protocol forward primers were labelled at the 5’ terminus with the fluorophore 6-FAM™ (Applied Biosystems, Foster City, California, USA). In Protocol 2 forward primers were synthesized with an 18 nucleotide M13 tail sequence at the 5’-terminus (5’-TGTAAAACGACGGCCAGT-3’) (SEQ ID NO: 1), to facilitate universal labelling of PCR products by a 6-FAM™-labelled M13 primer (Schuelke, 2000). Reverse primers were synthesized with the sequence 5’-GTTTCTT-3’ (SEQ ID NO: 2) at the 5’-terminus end to promote non-templated adenylation at the 3’-terminus end of PCR product (Brownstein et al., 1996). A 10 pL PCR reaction volume was used, containing approximately 10 ng of total genomic DNA, 2.5 mM magnesium chloride, 1x PCR buffer, 0.05 mM of each dNTP, 0.0375 pM forward primer, 0.15 pM reverse primer, 0.15 pM of fluorescent-labelled M13 primer and 0.75 U of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, California). PCR was carried out using the following profile: (1) 94°C for 4:00 minutes, (2) 30 cycles of: 94°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 seconds, (3) 8 cycles of: 94°C for 30 seconds, 53°C for 30 seconds and 72°C for 30 seconds, (4) 72°C for 30 minutes (after Schuelke, 2000). PCR products were analyzed by capillary electrophoresis on a SeqStudio™ Genetic Analyzer using a SeqStudio™ Cartridge v2 (Applied Biosystems) with 7 s injection time and 20 min run time. GS600 LIZ (Applied Biosystems) was used as an internal size standard. Data were transferred as .fsa files to Genemarker analysis software (SoftGenetics LLC, Pennsylvania, USA) for analysis and genotype scoring. The inventors note here that in their experience, allele sizes will vary in some analyses according to a number of factors. For example, estimates of fragment (allele) sizes based on capillary 5 electrophoresis are affected by factors including, but not limited to, the type of instrument, the length of the capillary array, the type of polymer used and environmental variables including ambient temperature. Accordingly, the SSR allele sizes in bp that are reported in this example (Table 1) are associated with the analysis platform described and also include a confidence interval of ■ 0.8 bp. Plants examined above were then further characterized by performing chemical analyses. Six 10 infected seedlings were further examined for the presence of alkaloids, attributable to the presence of endophytes, such as indole diterpenes, ergot alkaloids, peramine and lolines. Table 1. SSR primer sequences. All primer pairs used with PCR protocol 2 have additional sequences appended to the 5’ terminus of the primer sequence: forward primers (5’-TGTAAAACGACGGCCAGT-3’) (SEQ ID NO: 1); reverse primers 5’-GTTTCTT-3’ (SEQ ID NO: 2). SSR Primer sequences (5' - 3') PCR protocol SEQ ID NO CGCTCAGGGCTACATACACCAT B10 forward GG CTCATCGAGTAACGCAGGCGA 1 3 reverse CG 4 C ATG G ATG G AC AAG AG ATTG C A B11 forward CG TTCACTGCTACAATTCTGTCCA 1 5 reverse GC 6 ans014 forward CAATCATTCTGAACCAAAACCA 2 7 reverse CCTTATACGCAGGACCAAAGAC 8 GTCTAAAC AG C AC AG AG CG AG ans015 forward A 2 9 reverse ACCCGAGTCAAGTTGCATTATT 10 ans016 forward CACAAAGACAAACG CCAAAAG 2 11 reverse GCAAAGCTCACAGACAAAGGTC 12 ans017 forward GCCATCCGATAACCTGTCTCTA 2 13 reverse TCGTTTCGGTTCGATTAAGAGT 14 ans019 forward TACCTCTGCACGGTGTATTCC TGCATAACACTCACCTTATAGT 2 15 reverse CG 16 ans024 forward CTGGACTACCTCCTCCACAATC 2 17 reverse GCCCGCATTAAAGAAATAAGG 18 CAGCCCTAI I I IAFGTTTGAAG ans025 forward G 2 19 reverse GCICCIGCI I I I Al ICCIGCIA 20 G C ATAG G AAGTGCTGTTAATTT ans030 forward GA 2 21 reverse AGAGTAGAACCTGCTTGCGTTA 22 ans031 forward reverse ACTCGGAGACATGAAAACCATC GACGTGCTCTGTGATGTTGAAT 2 23 24 GATTCACCTCATCTACCATCTA ans032 forward CC 2 25 reverse GGTCGAGTTTATATCTCCGATG 26 GCGTTGAGGAGGCTAGATAGA ans033 forward A 2 27 reverse TTCCAAGCTGAACAAAAGTCAA 28 ans035 forward CGGTGCTCTTTACC Illi GAC 1 2 29 reverse CATATAAGAGGCCCATCTCACC 30 ans036 forward ATTTGCAGCAGAGATGATGTGT CCTGCACCGGACTGTTAGTAAT 2 31 reverse 32 ans044 forward TCCAGAAGTAGTCGGGATCAGT 2 33 reverse ATGAGAGGGGAATTGAAGACAA 34 ans047 forward TCACCTCTCTCGACGTTGTCTA 2 35 reverse TCTCGTAAAACCCAATTCCATC 36 ans049 forward ATCTCGGCTCTAACAAAGTTCG GCATATACGGACGTGCTACCTA 2 37 reverse 38 ans054 forward CTTGTGATGAGAATCGTCAAGC 2 39 reverse CCCTACCGAAACTACATCGTTC 40 ans056 forward AGACCATCATGTGAGCGACTT 2 41 reverse GTGATGCCCTCTATGTGTATGC 42 TAAGGCGAGGTCAGTTATTAGC egs002 forward TT CTCIlli GGGACCTACCTAGTC 2 43 reverse AA 44 TATACAGACTACGAACACCCTC egs004 forward CC GGATGTTACTGAATGAAAACTC 2 45 reverse CC 46 ATTCCTTGTCCTGTTGTCTCAAA egs010 forward C ATGGTTGCTCGAAAAGACTTAC 2 47 reverse TC 48 GATGACGTATCTTGATGCTACC egs027 forward AC CGTGTATAAAGTTCGGGATCCT 2 49 reverse AT 50 Table 2. SSR allele sizes for strain AR153 in base pairs (bp) ± 0.8. SSR Allele Allele size (bp) B10 174 B11 178 ans014 313 ans015 303 ans016 293 ans017 318 ans019 198 ans024 230 ans025 312 ans030 323 ans031 315 ans032 214 ans033 179 ans035 240 ans036 265 ans044 275 ans047 308 ans049 329 ans054 286 ans056 262 egs002 288 egs004 349 egs010 375 egs027 367 EXAMPLE 3 Genome sequence PacBio library preparation, sequencing, processing and assembly 5 For PacBio sequencing, DNA was extracted from the AR153 sample. A single 20Kb SMRTbell template library was prepared from the extracted AR153 genomic DNA and run according to the manufacturer’s specifications by BGI (Hong Kong, China) and sequenced on a single SMRT cell on the PacBio RSII platform in February 2023 under Project ID: F22FTSAPHT1900_FUNgqmdD. 10 This resulted in 1,877,139 raw subreads averaging around 10,500 bases in length. The open-source bioinformatics software Flye version 2.92 (Kolmogorov et al., 2019) was used to assemble the raw PacBIO subreads into a draft genome of over 35 million bases with 46 scaffolds. DNBseq paired-end library preparation and sequencing Combining data from multiple sequencing platforms helped to improve the overall accuracy of the genomic data. Therefore, the same genomic DNA preparation as used for PacBIO genome sequencing was also sequenced by short insert library DNBseq in February 2023. From the DNA extraction, a short inserted paired-end (PE150) DNA library was prepared following the experimental procedure for a DNA Short-insert Library Construction Protocol and Bioinformatic analysis workflow according to the manufacturer’s specifications by BGI Inc. (Hong Kong, China) under project ID: F22FTSAPHT1900 FUNcwnkR. This produced 8,019,091 raw read pairs for AR153, resulting in 2,405,727,300 base pairs. This indicated an expected coverage of over 68 reads for each base on the 35 million base pair AR153 genome. The open-source bioinformatics software trimmomatic version 0.38 (Bolger et al., 2014) was used to trim the resulting DNAseq reads. The quality window used a minimum base quality of 30 (1 in a 1,000 probability of error) over a sliding window of 4 bases, but otherwise with default settings. Only reads with at least 35 bases remaining in both reads of each pair were kept. FastQC version 0.11.8 (Andrews 2010) was used to calculate quality statistics of the raw and trimmed reads. The AR153 reference genome The trimmed DNBseq reads were mapped to the AR153 draft genome derived from the PacBIO subreads using “mem” algorithm of bwa version 0.7.17-r1188 (Li and Durbin 2009) with default settings to generate a sequence alignment (SAM) file (Li et al., 2009). The SAM file was then converted to a sorted (by mapping coordinate) binary alignment (BAM) file using the “view” and “sort” executables in samtools versions 1.8 (Li et al., 2009). Pilon version 1.24 (Walker et al., 2014) was used (default parameters) to improve the draft AR153 genome assembly using the DNBseq reads (from the BAM file) to correct sequencing errors introduced by PacBIO sequencing and assembly. The resulting polished AR153 genome sequence statistics are outlined in Table 3. Table 3. Sequencing statistics for the AR153 reference genome. Sequence statistic Length (bp) Total number of sequences 46 Total number of residues 35,044,485 Average length of sequences 761,836 Minimum sequence length 524 Maximum sequence length 6,837,306 Allele analysis Genome alleles were identified in the genomic sequences guided by the same primer sequences used in the SSR assay (Example 2), with primer DNA sequence mismatch tolerance of 2 base pairs. Genome lengths in base pairs are given in Table 4. Table 4. Genomic DNA allele sizes for strain AR153 in base pairs (bp). Genomic allele Genomic sequence length (bp) B10 179 B11 181** ans014 291 ans015 281 ans016 273 ans017 297* ans019 176 and 176* ans024 209 ans025 293* ans030 300 ans031 294 ans032 193 ans033 155 ans035 216 ans036 242 ans044 252 ans047 283 ans049 306** ans054 266* ans056 238 egs002 266 egs004 327 egs010 350 egs027 346* 5 *defining alleles of AR153 by genome a B11 allele size of 181 bp, an ans017 allele size of 297 bp, an ans025 allele size of 293 bp, an ans049 allele size of 306 bp, an ans054 allele size of 266 bp, and an egs027 allele size of 346 bp. ** The corresponding genomic sizes for the minimum allele set for discrimination of AR153, according to SSR (B11 and ans049), are a B11 allele size of 181 bp and an ans049 allele size of 10   306 bp. *** all alleles by genome EXAMPLE 4 Isolation of fungal endophyte AR153 was isolated from endophyte-infected ryegrass seed accession #56027 following surface disinfection of plant tissue as generally known in the art, with small amendments from Christensen et al. (2002). Ryegrass tillers were removed from plants by cutting at the base and trimming to about 5 cm before surface disinfecting. Tiller sections were surface disinfected by a quick rinse in 96% ethanol and agitating in a 4.2% sodium hypochlorite solution for one minute followed by rinsing twice in sterile tap water. Tiller sections were allowed to dry on sterile filter papers (Whatman® quantitative filter paper, ashless, Grade 41) within a sterile environment before being sectioned transversely with the aid of forceps and a scalpel. Tiller sheath rings were separated and transferred to Petri plates containing potato dextrose agar (PDA, Oxoid Limited, England) plus 0.1 g / L chloramphenicol. The Petri plates were incubated in the dark at 22-25°C for 3-5 weeks. Cultures could be sub-cultured on the same medium or PDA without the antibiotic, chloramphenicol. Cultures were examined for colony growth rates, colony morphology and their ability to produce conidia (asexual spores) (see Example 5). The selection of AR153 for further examination was based on genotype and secondary metabolite profiles. The AR153 culture was prepared, and sometimes sub-cultured in the manner of this example and used for testing the inoculation and possible enduring infection in seedlings of Lolium perenne (and other Lolium species) as described below. EXAMPLE 5 Endophyte descriptions Fungal colony morphology was examined as described by Card et al. (2014). In summary, endophytes were sub-cultured onto PDA and incubated for 4 weeks at 22°C in the dark, with radial dimensions measured using a digital caliper. An average measurement was calculated from five replicate colonies per endophyte strain. Each of the replicate colonies from each strain was then examined and their morphological characteristics described with respect to the shape and color of their colonies, and the degree of colony immersion within the agar medium. Endophyte strains were additionally sub-cultured on 4% water agar. After 4 weeks incubation, at 22°C in the dark, hyphae were observed under a stereo (or dissecting) microscope, at a magnification of 63x, for the presence of conidia (asexual spores). In vitro characteristics of fungal strains, when grown on PDA, were consistent with published descriptions of Epichloe festucae var. lolii, syn. Neotyphodium lolii (Christensen et al., 1993; Glenn et al., 1996), being slow to moderately slow growing. Colonies raised from the agar, white, cottony, slightly to strongly convoluted, felty, with abundant aerial hyphae. Colony reverse tan to cream at margin. EXAMPLE 6 Inoculation of Epichloefungal endophytes into Lolium perenne Seeds of Lolium perenne, cultivar Samson, were surface sterilized and inoculated with an isolated Epichloe endophyte as described herein using methodology as described by Latch and Christensen (1985). Seeds were surface disinfected by immersion in a 50% sulfuric acid solution for 15 minutes followed by a five times rinse with tap water and immersion in a 4.2% sodium hypochlorite solution for 15 minutes followed by two rinses in sterile water. Seeds were dried in a laminar flow cabinet on sterile Whatman filter paper before transferring to Petri plates containing 4% water agar. The seeds on plates were allowed to germinate in the dark at 22-25°C for 4-9 days and the resulting etiolated seedlings were inoculated before being returned to the incubator for a further 7 days in the dark. Petri plates were then placed under white fluorescent lights at room temperature for at least 7 days before planting them in commercial potting mix and transferring them to a glasshouse. Plants were grown for ca. 6 weeks before identifying endophyte-infected individuals using the method of Simpson et al. (2012). Plants were further grown in the field and endophyte-infected plants were examined for phenotype in comparison with the typical uninfected plants and in particular to determine whether inflorescences and seed heads would be formed and examine if endophyte was transmitted as viable endophyte to harvested seeds. The same procedures were used for Lolium perenne cultivars Reason (diploid) and GPT16018 / Align (tetrapioid) and L. multiflorum cultivar Manta. EXAMPLE 7 Alkaloid expression in glasshouse The Epichloe endophyte strain AR153 in planta does not produce lolitrem B or epoxyjanthitrems; lolitrem B and epoxyjanthitrems when produced at high levels can induce Epichloe toxicosis. In planta the endophyte strain AR153 also produces peramine and chanoclavine but does not produce any of the ergot alkaloids including ergovaline which is responsible for heat stress and production losses. Accordingly, animals consuming host plants comprising AR153 endophytes are not susceptible to forms of Epichloe toxicosis as would be observed in animals consuming selected or wild-type Epichloe endophytes that do produce lolitrem B and / or ergovaline (Table 5a). Table 5a. Profile of known Epichloe endophyte alkaloids produced in planta for AR153, wild-type, and selected commercialized strains. “D” = alkaloid detected, = alkaloid not detected. Epichloe endophyte strain Epichloe endophyte alkaloids Peramine Chanoclavine Ergovaline Lolitrem B Epoxyjanthitrems Wild-type D D D D - AR1 D - - - - AR37 - - - - D AR128 - - - - D AR153 D D - - - NEA2 D D D D - NEA3 D D D - - NEA6 D D D - - The alkaloid profile of AR153 has been compared to that of the wild-type Epichloe endophyte in a replicated glasshouse trial. The trial consisted of 21 perennial ryegrass plants of cultivar Samson infected with the wild-type endophyte strain, and 27 plants of the same cultivar infected with AR153. Plants were grown in 1 L pots containing commercial potting mix for 3 months post-inoculation with the endophyte strain. Plants were trimmed to 5 cm above ground level after 1 month, and then to 1 cm above ground level 4 weeks prior to harvesting for alkaloid profiling. Presence / absence of the indole diterpenes and ergot alkaloids was determined by LC-QQQ-MS analysis using published methods (Lukito et al. 2019). The average peak areas for detected alkaloids are shown in Table 5b. Table 5b. Chanoclavine, ergovaline, and lolitrem B average area counts for the LC-MS / MS analysis of wild-type and AR153 infected Samson perennial ryegrass plants. Epichloe endophyte strain Epichloe endophyte alkaloids (peak area counts) Chanoclavine Ergovaline Lolitrem B Wild-type 2126 13307 131928 AR153 20101 0 0 A range of agronomic trialing of ryegrass was conducted in which the endophyte alkaloid production of AR153 was compared to other commercial or common toxic endophyte strains. These trials were conducted under different conditions in field trials at secure locations around New Zealand. In New Zealand, the North Island field site was near Hamilton in the Waikato and the South Island field site was in Canterbury at Lincoln. The North Island site is relatively warm in winter with moderate rates of grass growth in this season, while the South Island site is cold in winter with little growth in this season. Summers can be warm and dry at both sites, with ryegrass persistence being poorest at the northern site The experimental layout and management of the North Island trial is best described by Hume et al. (2007), while the South Island trial is best described by Fletcher et al. (2017). The trials included: Wild-type, AR1, AR37, AR128, and AR153 in association with cultivar Grasslands Samson diploid perennial ryegrass (Lolium perenne), although one Lincoln trial did not include AR128. 5 Samples of ryegrass were cut at ground level (50 tillers per plot at Hamilton and 5-10 random positions per plot at Lincoln) and analyzed for alkaloids according to published protocols (Fletcher et al., 2017). Table 5c. Concentrations (mg / kg DM) of known Epichloe endophyte alkaloids produced in planta for AR153, wild-type, and selected commercialized strains under agronomic trialing at Hamilton trial site. Epichloe endophyte strain Epichloe endophyte alkaloids (ppm) Peramine Chanoclavine Ergovaline Lolitrem B Epoxyjanthitrems Wild-type 27.5 0.3 1.1 2.9 ND AR1 31.5 ND ND ND ND AR37 ND ND ND ND 78.3 AR128 ND ND ND ND 36.4 AR153 22.1 2.8 ND ND ND 10 LOQ (limit of quantification) = 0.1 ppm LOD (limit of detection) = 0.02 ppm ND = not detected (below the limit of detection). Table 5d. Concentrations (mg / kg DM) of known Epichloe endophyte alkaloids produced in planta for AR153, wild-type, and selected commercialized strains under small plot testing for chemical safety at Lincoln trial site. Epichloe endophyte strain Epichloe endophyte alkaloids (ppm) Peramine Chanoclavine Ergovaline Lolitrem B Epoxyjanthitrems Wild-type 22.6 0.2 1.1 1.9 ND AR1 27.9 ND ND ND ND AR37 ND ND ND ND 43.4 AR153 19.7 1.3 ND ND ND 15 LOQ (limit of quantification) = 0.1 ppm LOD (limit of detection) = 0.02 ppm ND = not detected (below the limit of detection). Table 5e. Concentrations (mg / kg DM) of known Epichloe endophyte alkaloids produced in planta for AR153, wild-type, and selected commercialized strains under animal safety grazing trial at Lincoln trial site. Epichloe endophyte strain Epichloe endophyte alkaloids (ppm) Peramine Chanoclavine Ergovaline Lolitrem B Epoxyjanthitrems Wild-type 30.8 0.3 1.6 2.1 ND AR1 32.4 ND ND ND ND AR37 ND ND ND ND 78.1 AR128 0.1 ND ND ND 48.6 AR153 22.2 1.5 ND ND ND LOQ (limit of quantification) = 0.1 ppm LOD (limit of detection) = 0.02 ppm ND = not detected (below the limit of detection). EXAMPLE 8 Animal Safety Grazing Evaluation Background An animal safety grazing evaluation trial of cultivar Grasslands Samson (commonly referred to as ‘Samson’), diploid perennial ryegrass (Lolium perenne) infected with endophyte strain AR153 was completed in 2020 / 21 at AgResearch Lincoln. The positive (toxic) and negative controls were Samson infected with wild-type endophyte and Samson endophyte-free (Nil), respectively. Samson AR37, Samson AR128 and Samson AR1 were included as comparators. Methods The methodology was based in part on protocols previously used by Fletcher et al. (2017). These protocols have been developed and modified over many years in the evaluation of novel grassendophyte associations for animal safety (Thom et al., 2012). The six treatments were sown in three replicated pasture plots of 0.175 ha each. Sowing of pastures occurred over a 9-day period from 14 September 2020. Pastures established well and were managed with applications of broadleaf herbicide, nitrogen fertilizer and irrigation during the spring and summer, in addition to light mechanical toppings. This ensured pure ryegrass pastures with standardized herbage mass were available prior to the commencement of the grazing trial in late summer. Ryegrass tillers (50 per plot) were collected mid-January 2021 for immuno-blotting to confirm the rates of endophyte infection (Simpson et al., 2012). Infection rates were very good, with all plots being in the 90-100% range except the endophyte-free control which had a low level (1%) of contamination. This confirmed all treatments met the required endophyte infection for a valid test. Prior to beginning any field work, Animal Ethics approval was sought and granted to allow the use of animals in this research (AgResearch Animal Ethics Committee application #15125). Weaned Romney ewe lambs (4-5 months old) were shorn, drenched to control internal parasites and dipped to prevent flystrike (myiasis) prior to being made available for the trial. Lambs were weighed to identify an even group of sheep, from which mobs of ten lambs with similar mean weights were then allocated to each plot. Mean lamb live weight was 32.8-34.2 kg at the beginning of the trial. Lambs were weighed again on day 23 and on completion of the trial (day 42). Plots were stocked with lambs on 1 February 2021 (day 0). The earliest symptoms of ryegrass staggers were observed in lambs on the wild-type treatment on day 10, so ryegrass staggers scoring began on day 11 and at two- or three-day intervals thereafter. Ryegrass staggers scoring involved running individual mobs of lambs 400 m along a laneway (Keogh 1973). Lambs showing a marked lack of coordination, such that they could not complete the run, were scored a 4. The remaining lambs were penned to assess the tremors associated with ryegrass staggers from scores 0 (no tremors) to 3 (marked tremors and some lack of coordination). Lambs that scored a 4 were removed from the trial for ethical reasons and replaced with spare lambs to maintain grazing pressure. For the purpose of comparing treatments, lambs removed due to severe ryegrass staggers (score = 4) maintained their staggers score in the dataset for the remainder of the trial. In total, lambs that remained for the full 42 days of the trial were scored 14 times for ryegrass staggers. Lambs were assessed for their ability to thermoregulate under heat load on day 19 and day 39. This involved mobbing lambs into a purpose-built tunnel house with an ambient temperature of approximately 25°C. Following three hours under these conditions, the temperature was increased to 35-40°C through the adjustment of ventilation. Respiration rate and rectal temperature were measured at this time. Sheep that had previously been removed due to developing severe ryegrass staggers, did not participate in any subsequent heat stress assessment. Ryegrass herbage samples cut at ground level were taken from 10 locations in each plot 2 days after plots were stocked (day 2), on day 22 and on day 43. Samples were frozen overnight and sent to AgResearch Palmerston North for freeze drying, preparation and alkaloid analysis. Herbage was analyzed for peramine, ergovaline, lolitrem B and epoxyjanthitrems, by minor modifications of established methods (Fletcher et al., 2017). Results Ryegrass staggers Ryegrass staggers developed quickly, with the symptoms first identified in lambs grazing the wild-type (toxic) control on day 10 (Figure 1). On day 16, the mean ryegrass staggers score on this treatment exceeded 2.3, thus meeting the required level for a valid trial. The environmental conditions were also sufficient to induce a mean ryegrass staggers score of >1.2 in AR1 sheep. Under the worst-case scenario of animal safety testing, this is not unusual, and it provides additional confidence that toxicity could be detected in endophytes that do not produce long-term tremorgens such as lolitrem B and epoxyjanthitrems. No ryegrass staggers were measured in sheep grazing AR153 which was the same as the negative control (Nil endophyte) on every scoring date. At day 39, there were no remaining lambs grazing wild-type as all had been removed with severe ryegrass staggers. Approximately 30% of lambs remained on AR128 and AR37 treatments, 80% remained the AR1 treatment, and 100% remained on AR153 and Nil treatments. At the completion of the trial (day 42), 100%, 100%, 87%, 30% and 20% of lambs remained on Nil, AR153, AR1, AR37 and AR128 treatments, respectively. Heat stress assessment During the day 19 heat stress assessment the respiration rate of wild-type lambs was significantly greater than all other treatments (Figure 2). The respiration rate of AR153 lambs was significantly less than both wild-type and AR37 lambs and not different to all other treatments including the negative control. The rectal temperature of wild-type lambs was significantly greater than all other treatments which were not different to each other (Figure 2). At the day 39 heat stress assessment, there were no remaining wild-type lambs as all had been removed with severe ryegrass staggers. AR153 lambs had a similar respiration rate to Nil and AR1, which was lower than AR37 and AR128 (Figure 3). The rectal temperature of AR153 lambs was similar to Nil, AR1 and AR37, and less than AR128 (Figure 3). Live weight change Over the first 23 days of the trial, lambs grazing AR153 grew 271 g / day which was similar to all other treatments except wild-type lambs which grew 102 g / day (Figure 4). At the completion of the trial (day 42) all wild-type lambs had been removed with severe ryegrass staggers. Although AR37 lambs appeared to lose considerably more live weight compared to other treatments over the second half of the trial, the differences were not statistically significant between any treatment (Figure 4). Endophyte alkaloid analysis Herbage samples were collected in three harvests. Herbage samples collected at the beginning of the trial were analyzed for chanoclavine, ergovaline, lolitrem B, peramine and epoxyjanthitrems for all treatments. This identified epoxyjanthitrem contamination (from AR37) within just one plot (a wild-type plot) at approximately 7% contamination. Evidential DNA testing of the wild-type seed line identified AR37 contamination of approximately 3% which is very unlikely to be sufficient in influencing the toxicity of the wild-type treatment. No other contamination was identified in any treatment. For the wild-type control, averaged over all harvests, ergovaline concentration was 0.9 ppm and lolitrem B concentration was 2.2 ppm which was within expected values for this type of trial, and at concentrations that would be toxic to animals (Table 6). Samples of AR153 contained peramine and chanoclavine, while no ergovaline or lolitrem B were detected (Table 6). The peramine concentration of AR153 at each harvest was lower than AR1 and wild-type which were not different to each other (Table 6). AR153 and wild-type both produced chanoclavine, with wild-type producing approximately 20% that of AR153. Table 6. Mean peramine, chanoclavine, ergovaline, lolitrem B and total epoxyjanthitrems concentration (mg / kg DM) of all endophyte treatments at the first harvest date, and of relevant endophyte treatments on the following harvest dates, for cultivar Samson ryegrass. Endophyte Peramine Chanoclavin e Ergovaline Lolitrem B Total epoxyjanthitrem s First Harvest Nil ND ND ND ND AR1 22.3 ±0.8 a ND ND ND AR153 18.2 ±0.6 b 1.6 ± 0.1 a ND ND AR128 ND ND ND ND 22.6 ±1.6 a AR37 ND ND ND ND 24.9 ±3.8 a Wild-type 23.7 ± 1.1 a 0.3 ±0.0 b 0.9 2.2 Second Harvest AR1 23.9 ±0.6 a AR153 13.7 ±0.3 b 1.8 ±0.2 a AR128 32.1 ±1.2 a AR37 34.3 ±2.8 a Wild-type 22.2 ±2.0 a 0.3 ±0.0 b 0.8 2.0 Third Harvest AR1 19.1 ±0.6 a AR153 13.6 ±0.3 b 2.1 ±0.0 a AR128 45.6 ±6.1 a AR37 55.9 ±4.5 a Wild-type 19.1 ±0.4 a 0.4 ±0.0 b 0.9 2.3 LOQ (limit of quantification) = 0.1 ppm LOD (limit of detection) = 0.02 ppm ND = not detected (below the limit of detection) For each compound, means that are greater than zero within columns at each harvest followed by the same letter are not statistically different. 5 Discussion Within 2 weeks of commencing grazing, lambs grazing the Samson wild-type control exhibited symptoms of ryegrass staggers indicating that environmental conditions were conducive for the production of toxic levels of endophyte alkaloids along with ryegrass staggers typical of what is experienced at this trial site using this methodology. The ryegrass staggers in the well-characterized 10 AR37 was also high, and similar to what has been reported in some years relative to staggers for wildtype (Fletcher and Sutherland 2009). The high level of ryegrass staggers in wild-type, combined with high rates of tiller infection in all treatments and separation between controls (wild-type and Nil), confirmed that this grazing trial was a valid test for animal safety. No symptoms of ryegrass staggers were detected in lambs grazing AR153 despite lambs needing to 15 graze deep into the base of the pasture over a 7-week period. This result made the AR153 treatment equivalent to lambs grazing Nil endophyte ryegrass plots. Lambs grazing AR1 had a low level of ryegrass staggers peaking at 1.3. As expected, the ryegrass staggers of AR128 and AR37 lambs lagged behind those of wild-type lambs but all three peaked similarly on day 42 (3.6-4.0). There was good separation in lamb respiration rate and rectal temperature between the Nil and wildtype controls at the initial heat stress assessment (day 19). Respiration rate for AR153 was equivalent to Nil and AR1. Rectal temperature of lambs of the wild-type treatment were greater than all other treatments which were not different to each other. Although the wild-type treatment was not represented at the second assessment, the Nil and AR153 lambs had a lower respiration rate than AR128 and AR37. Also, Nil and AR153 lambs had lower rectal temperatures than AR128. Wild-type had the lowest weight gain of all treatments over the first 23 days, and there were no statistical differences between the other treatments (Nil, AR1, AR153, AR128 and AR37). While there were no statistical differences between treatments in the second half of the grazing period, AR153 was numerically similar to Nil and AR1 (NB. by this stage, all lambs had been removed from the wild-type treatment due to high levels of ryegrass staggers (score 4)). The peramine concentration of AR153 herbage was on average 6.6 mg / kg lower than that of AR1 and wild-type. Lambs grazing AR153 did not exhibit RGS indicating that lolitrem E is non-tremorgenic at the concentration measured in the pastures (0.3 mg / kg). This is consistent with the results of testing lolitrem E in a mouse bioassay (Data not shown). Some of the later pathway terpendoles induced short term tremors in the mouse bioassay and may be responsible for the RGS detected in AR1. These compounds were largely absent in AR153, which may explain the absence of RGS on this treatment. AR153 produced some ergot alkaloids but not the known vasoconstrictor, ergovaline. AR153 did not induce heat stress to the level of wild-type under elevated ambient temperature. Like wild-type, AR153 produced chanoclavine but at higher concentrations. Chanoclavine has been shown to provide limited protection to black beetle and is of very low toxicity to mice. Conclusion Lambs grazing perennial ryegrass infected with AR153 - exhibited no signs of ryegrass staggers over a 7-week intensive grazing period, being equivalent to lambs grazing ryegrass with no endophyte (Nil) and better than lambs grazing the AR1, AR128 and AR37 selected endophytes and wild-type endophyte. - were equivalent in their ability to thermoregulate under heat load to lambs grazing endophyte-free ryegrass and AR1-infected ryegrass for all measurements. - had equivalent liveweight change to lambs grazing endophyte-free ryegrass and the other three selected endophytes, and better than lambs grazing ryegrass infected with wild-type endophyte. EXAMPLE 9 Effect of AR153 on the insect pest Argentine stem weevil The AR153 Epichloe endophyte described herein entered the insect testing phase in 2019-20. Here we report the efficacy of this endophyte against a major insect pest. We tested endophyte AR153 against Argentine stem weevil (Listronotus bonariensis) in replicated pot trials. Control treatments were endophyte-free ryegrass (Nil) and ryegrass infected with AR37. Other endophytes were also included in some trials. All trials used the perennial ryegrass cultivar Samson (Lolium perenne) as the test host grass, with Epichloe infection rates of 100% in endophyte-infected treatments and 0% for the Nil (endophyte-free) treatment. For Argentine stem weevil trials, adult insects were collected from the field and then 5-6 were caged onto ryegrass plants for up to 2 weeks. Adult weevil feeding and egg laying (oviposition) were recorded, and the cage covers were removed. Larval damage to ryegrass tillers (tillers are ‘branches’ of a ryegrass plant) was determined at approximately 3 weeks, with extent of damage scored as: 1 = ‘minor damage’ to the outside of the tiller; 2 = ‘moderate damage’, where the larva has penetrated and partially mined the tiller; and 3 = ‘severe damage’, where the larva has extensively mined the tiller and / or the meristem (tiller growing point) has been destroyed. The endophyte treatments in this trial were AR153, AR37 and a Nil endophyte control. Adult feeding, the number of eggs laid (oviposition), and larval damage were recorded (Table 7). Adult feeding was significantly lower on plants infected with the AR153 endophyte (P<0.05). Egg numbers were not affected by endophyte status in this experiment (P>0.05). Table 7. Argentine stem weevil adult feeding and oviposition (egg laying), and larval damage, on perennial ryegrass infected with AR153 and AR37 or endophyte-free (Nil). Within columns, means followed by the same letter are not significantly different (P<0.05). Adult feeding & oviposition             Larval damage (% of tillers) Endophyte ---------------------------- ------------------------------------ treatment          No. No. eggs / plant All levels of damage Moderate & scars / tiller                                             severe damage AR153 8.3 b 1.5 8.1 b 6.9 b AR37 15.2 a 2.6 7.7 b 3.6 b Nil 14.0 a 6.1 27.7 a 25.8 a LSD 5%          5.05           NS+                 12.48              9.93 1 NS = not significant (P>0.05). The percentage of tillers with all levels of larval damage, and most importantly those with moderate and severe damage, was similar across the endophyte-infected treatments and all had significantly less damage than Nil (P<0.003 All damage; P<0.001 Severe damage). This trial has shown that AR153 provides strong resistance to Argentine stem weevil adults and larvae. EXAMPLE 10 Survival of endophyte in stored seed Background Endophyte is delivered to the end user (pastoral farmer) via seed that is infected with viable endophyte. Seed sold to farmers needs to be equal to or greater than 70% infected with viable endophyte, to ensure efficacy on-farm in terms of protecting the host grass plant from biotic and abiotic stresses. To maintain high levels of viable endophyte in stored seed that is awaiting sowing, cold storage facilities need to be utilized which increases the cost of production for the seed companies and leads to higher seed costs for the consumer. In addition, endophytes with good storage characteristics are likely to maintain high viability when at ambient conditions in the supply chain. Methods The experiment was undertaken in ambient conditions at Kimihia Research Centre, near Lincoln, Canterbury, New Zealand. Perennial ryegrass seed of a commercial line was placed into a cardboard box approximately 560 mm long, 300 mm wide and 110 mm deep (termed ‘the Background Seed’). Samples of the seed containing the endophyte strains to be tested for longevity (AR153 and controls) were placed in paper envelopes approximately 135 mm long and 80 mm wide. The envelopes were then buried vertically in the box of the Background Seed, such that the identification label on the envelope was above the Background Seed, and the sample was buried, inside the envelope, under the surface of the Background Seed. Envelopes were approximately 50 mm apart, with the intervening space filled with the Background Seed. Envelopes were also a minimum of 50 mm from the sides of the cardboard box. The assumption was that the Background Seed was in equilibrium with ambient relative humidity and temperature. The test seed in the envelopes would then equalize to the moisture content and temperature of the Background Seed, such that the moisture content and temperature of all the packets would be similar to each other, and representative of ambient Canterbury seed storage. Temperature and relative humidity (as this determines the seed moisture content) are the key environmental factors known to affect endophyte longevity in stored seed (Hume et al. 2013). Other factors that may influence endophyte longevity are the grass genetic background, seed line within a cultivar, and method of prior storage. To control for these latter factors, and or to reduce the likelihood that one of these factors overly influenced the results, comparisons were made in the same grass genetic background (cultivar Samson), multiple seed lines were tested, and all seed lines had previously been stored under optimal low temperature and low relative humidity conditions in the Margot Forde Germplasm Centre at Palmerston North. At particular times, starting at day zero, seeds were removed from the treatment envelopes (two AR153 test lines) at every test date, and controls at selected test dates (three AR1 lines, two AR128 lines, four AR37 lines). The removed seed was subjected to a viable endophyte test in which 100 seedlings were examined for the presence of live endophyte using immuno-blotting (Simpson et al., 2012), for each data point for each seed line. Due to resource constraints, not all treatments were tested at every date. The air temperature and relative humidity for this district (Lincoln) is presented in Table 8. On average, 5 temperature ranges from approximately 7°C in winter to 17°C in summer, with relative humidity ranging from approximately 73% in late spring to 87% in winter. These seasonal variations in temperature and relative humidity are typical of those occurring in New Zealand (Hume et al., 2011). Table 8. Mean air temperature and mean relative humidity for Lincoln (Broadfield weather station) for the years of the seed storage experiment (April 2021 to March 2023) and long-term means (2000 to 10   2022). Air temperature °C Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual mean 2000-2022 long term mean 16.9 16.8 15.2 12.5 10.0 7.3 6.6 8.0 10.0 11.6 13.6 15.7 12.0 2021 13.7 10.2 8.5 7.4 8.8 10.0 12.5 14.5 16.1 2022 17.2 16.3 15.5 13.2 11.1 8.2 6.7 9.0 10.3 11.4 15.3 16.4 2023 17.8 18.4 15.2 Relative humidity % Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual mean 2000-2022 long term mean 76.5 81.0 84.1 83.8 85.5 86.8 86.7 84.6 76.6 77.5 73.4 75.8 81.0 2021 79.1 88.1 91.0 85.3 78.0 73.4 82.5 73.4 80.2 2022 80.2 86.5 90.3 86.2 90.3 86.3 90.6 87.7 82.3 78.2 76.2 77.2 2023 77.4 82.9 83.0 Results The endophyte viability tests showed a marked difference between the endophytes, with AR153 seed maintaining high endophyte viability for at least 18 months, while by 13 months, endophyte viability of 15 AR1, AR128 and AR37 were below the 70% threshold for commercial use (Figure 5). Discussion The genetic propensity for endophyte to remain viable in stored seed (‘Seed Storage’) is a valuable trait, as seed is routinely stored for a year or more after harvest and before sale to the end user. The seed industry standard for viable endophyte at sale (and by implication at sowing into a pasture) is 70% or 20 greater (i.e. 70% or more of the plants derived from the sown seed will contain endophyte). If a new endophyte genotype does not routinely remain viable in stored seed, the proprietor of the endophyte must store the seed at controlled low temperature and humidity, to extend storage life. This is both expensive and complex for a seed business, and undesirable. The seed storage experiment undertaken with AR153 indicates a useful increase in storage life over commercial endophytes such as AR1 and AR37. This predicts that AR153 will be more ‘user friendly’ to seed companies that grow, process and store endophytic seed in bulk; to farmer retailers, who may hold endophytic seed in store, and to end user farmers, who are more likely to sow seed with a higher percentage of viable endophyte. AR153 will therefore reduce the costs of maintaining high levels of viable endophyte in stored seed, and increase the likelihood that seed sown by farmers will be efficacious. Although the invention has been described by way of example and with reference to particular embodiments, it is to be understood that modifications and / or improvements may be made without departing from the scope of the invention. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. INDUSTRIAL APPLICATION The isolated Epichloe endophyte strain, plant / Epichloe endophyte combinations, seeds infected with the Epichloe endophyte, and methods of making and using the Epichloe endophyte according to the invention as disclosed herein all have industrial application for the production of plants that are used for animal consumption. REFERENCES Andrews S. 2010. FastQC: a quality control tool for high throughput sequence data. Available online at: http: / / www.bioinformatics.babraham.ac.uk / proiects / fastqc Ball O-JP, Miles CO, Prestidge RA. 1997. Ergopeptine alkaloids and Neotyphodium lolii-mediated resistance in perennial ryegrass against adult Heteronychus arator (Coleoptera: Scarabaeidae). Journal of Economic Entomology 90: 1382-1391. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114-2120. Brownstein MJ, Carpten JD, Smith JR. 1996. Modulation of non-templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. BioTechniques 20: 1004-1010 Card SD, Faville MJ, Simpson WR, Johnson RD, Voisey CR, de Bonth ACM, Hume DE. 2014. Mutualistic fungal endophytes in the Triticeae - survey and description. FEMS Microbiol Ecology 88: 94-106. Christensen MJ, Bennett RJ, Schmid J. 2002. Growth of Epichloe / Neotyphodium and p-endophytes in leaves of Lolium and Festuca grasses. Mycological Research 106: 93-106 Christensen MJ, Leuchtmann A, Rowan DD, Tapper BA. 1993. Taxonomy of Acremonium Endophytes of Tall Fescue (Festuca- Arundinacea), Meadow Fescue (F-Pratensis) and Perennial Rye- Grass (Lolium-Perenne). Mycological Research 97: 1083-1092 Clay K., Cheplick G.P. 1989. Effect of ergot alkaloids from fungal endophyte-infected grasses on fall armyworm (Spodoptera frugiperda). J. Chern. Ecol. 15:169-182. Dymock JJ, Prestidge RA, Rowan DD. 1989. The effects of lolitrem B on Argentine stem weevil larvae. Proceedings of the New Zealand Plant Protection Conference 42: 73-75. Fletcher LR, Sutherland BL. 2009. Sheep responses to grazing ryegrass with AR37. Proceedings of the New Zealand Grassland Association 71:127-132. Fletcher LR, Finch SC, Sutherland BL, de Nicolo G, Mace WJ, Van Koten C, Hume DE. 2017. The occurrence of ryegrass staggers and heat stress in sheep grazing ryegrass-endophyte associations with diverse alkaloid profiles. New Zealand Veterinary Journal 65: 232-41. Finch SC, Prinsep MR, Popay AJ, Wilkins AL, Webb NG, Bhattarai S, Jensen JG, Hawkes AD, Babu JV, Tapper BA, Lane GA. 2020. Identification and structure elucidation of epoxyjanthitrems from Lolium perenne infected with the endophytic fungus Epichloe festucaevar. lolii and determination of the tremorgenic and anti-insect activity of epoxyjanthitrem I. Toxins 12: 526. Gallagher RT, White EP, Mortimer PH. 1981. Ryegrass staggers: isolation of potent neurotoxins lolitrem A and lolitrem B from staggers-producing pastures. New Zealand Veterinary Journal 29: 189190. Gallagher RT, Smith GS, di Menna ME, Young PW. 1982. Some observations on neurotoxin production in perennial ryegrass. New Zealand Veterinary Journal 30: 203- 204. Glenn AE, Bacon CW, Price R, Hanlin RT. 1996. Molecular phylogeny of Acremonium and its taxonomic implications. Mycologia 88: 369-383. Hettiarachchige IK, Ekanayake PN, Mann RC, Guthridge KM, Sawbridge Tl, Spangenberg GC, Forster JW. 2015. Phylogenomics of asexual Epichloe fungal endophytes forming associations with perennial ryegrass. BMC Evolutionary Biology 15: 72. Hume DE, Ryan DL, Cooper BM, Popay AJ. 2007. Agronomic performance of AR37-infected ryegrass in northern New Zealand. Proceedings of the New Zealand Grassland Association 69: 201-205. Hume DE, Schmid J, Rolston MP, Vijayan P, Hickey MJ. 2011. Effect of climatic conditions on endophyte and seed viability in stored ryegrass seed. Seed Science and Technology 39: 481-489. Hume DE, Card SD, Rolston MP. 2013. Effects of storage conditions on endophyte and seed viability in pasture grasses. In: Michalk DL, Millar GD, Badgery WB, Broadfoot KM (eds). Proceedings of the 22nd International Grassland Congress, Sydney, 15-19 September 2013. New South Wales Department of Primary Industry, Orange, Australia, pp 405-408. Johnson LJ, De Bonth ACM, Briggs LR, Caradus JR, Finch SC, Fleetwood DJ, Fletcher LR, Hume DE, Johnson RD, Popay AJ, Tapper BA, Simpson WR, Voisey CR, Card SD. 2013. The exploitation of epichloae endophytes for agricultural benefit. Fungal Diversity 60: 171-188. Keogh RG. 1973. Induction and prevention of ryegrass staggers in grazing sheep. New Zealand Journal of Experimental Agriculture 1: 55-57. Kirkby KA, Pratley JE, Hume DE, Faville MJ, An M, Wu H. 2011. Incidence of endophyte Neotyphodium occultans in Lolium rigidum from Australia. Weed Research 51: 261 -272. Kolmogorov M, Yuan J, Lin Y, Pevzner PA. 2019. Assembly of long, error-prone reads using repeat graphs. Nature Biotechnology 37: 540-546. Koulman A, Lane GA, Christensen MJ, Fraser K, Tapper BA. 2007. Peramine and other fungal alkaloids are exuded in the guttation fluid of endophyte-infected grasses. Phytochemistry 68: 355-360. Latch GCM, Christensen MJ. 1985. Artificial Infection of Grasses with Endophytes. Annals of Applied Biology 107: 17-24 Leuchtmann A, Bacon CW, Schardl CL, White Jr JF, Tadych M. 2014. Nomenclatural realignment of Neotyphodium species with genus Epichloe. Mycologia 106: 202-215. Li H, Durbin R. 2009. Fast and accurate short read alignment with Burrows - Wheeler transform. Bioinformatics 25: 1754-1760. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. 2009. The Sequence Alignment / Map format and SAMtools. Bioinformatics 25:2078-2079. Lukito Y, Chujo T, Hale TK, Mace W, Johnson LJ, Scott B. 2019. Regulation of subtelomeric fungal secondary metabolite genes by H3K4me3 regulators CclA and KdmB. Molecular Microbiology 112: 837-853. https: / / doi.Org / 10.1111 / mmi.14320. Moon CD, Tapper BA, Scott B. 1999. Identification of Epichloe endophytes in planta by a microsatellite-based PCR fingerprinting assay with automated analysis. Applied and Environmental Microbiology 65: 1268-1279. Mortimer PH, di Menna ME. 1983. Ryegrass staggers: further substantiation of a Lolium endophyte aetiology and the discovery of weevil resistance of ryegrass pastures infected with Lolium endophyte. Proceedings of the New Zealand Grassland Association 44: 240-243. Popay AJ, Hume DE. 2011. Endophytes improve ryegrass persistence by controlling insects. In: Pasture Persistence Symposium. Grassland Research and Practice Series No. 15 (ed C. F. Mercer) (New Zealand Grassland Association, Dunedin): 149-156. Prestidge RA, Pottinger RP, Barker GM. 1982. An association of Lolium endophyte with ryegrass resistance to Argentine stem weevil. Proceedings of the Thirty Fifth New Zealand Weed and Pest Control Conference 35: 119-122. Rowan DD, Dymock JJ, Brimble MA. 1990. Effect of fungal metabolite peramine and analogs on feeding and development of Argentine stem weevil (Listronotus bonariensis). Journal of Chemical Ecology 16: 1683-1695. Schardl CL, Craven KD, Speakman S, Stromberg A, Lindstrom A, Yoshida R. 2008. A novel test for host-symbiont codivergence indicates ancient origin of fungal endophytes in grasses. Systematic Biology 57: 483-498. Schuelke M. 2000. An economic method for the fluorescent labelling of PCR fragments. Nature Biotechnology 18: 233-234. Simpson WR, Mace WJ. 2012. Novel associations between Epichloe endophytes and grasses: Possibilities and outcomes. In 'Epichloe, endophytes of cool season grasses: Implications, utilization and biology.' (Eds CA Young, GE Aiken, RL McCulley, JR Strickland, CL Schardl.) pp. 35-39. (The Samuel Roberts Noble Foundation: Ardmore, Oklahoma). Simpson WR, Schmid J, Singh J, Faville MJ, Johnson RD. 2012. A morphological change in the fungal symbiont Neotyphodium loll! induces dwarfing in its host plant Lolium perenne. Fungal Biology 116: 234-240. Thom ER, Popay AJ, Hume DE, Fletcher LR. 2012. Evaluating the performance of endophytes in farm systems to improve farmer outcomes - A review. Crop and Pasture Science 63: 927-943. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, ... & Earl AM. 2014. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLOSONE9: e112963. Young C., Schardl C., Panaccione D., Florea S., Takach J., Charlton N., Moore N., Webb J., Jaromczyk J. 2015. Genetics, genomics and evolution of ergot alkaloid diversity. Toxins 7:1273-1302. Zhang, DX, Nagabhyru P, Blankenship JD, Schardl CL. 2010. Are loline alkaloid levels regulated in grass endophytes by gene expression or substrate availability? Plant Signaling and Behavior 5:14195    1422. MICROORGANISM DEPOSITS DESCRIPTION OF THE MICROORGANISM DEPOSITS MADE UNDER THE BUDAPEST TREATY The following biological deposit has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure. Deposit Identification Reference International Depository Designation Date of Deposit AR153 DSM 34880 13 December 2023 The Certificate of Deposit and Statement of Viability for the above deposited micro-organism is appended below. swjassstoss Ws W WSWAWsStA’W? j WSM<WOSi(stSSWiW asWVSs »««!»»■ w? & W®" S?As<5w»$ Mtm*MS              r««»«W«. 8MWW Ata stosss asss!.. taaaa&saass M isssass^sa ssssss ssaato y X ) assaswsts. &AWas*sj. Sit, mgsAWs VAA <^S$                               W 3                             &< M33v1 $              ^>': $&&s ..... tv,:WaAMSs w      AW Ws' saw t va'aw As a s^wWAsW S$S Sas <K<w SWsWWASS SMiS AaasSAA!WS *ass ass Asssa<s sat s AwwW       tassSasAsas^ass-; iss saa St *SAWjss$sa !tW AsxS x^:saassAs .Aassssja saWWassiWat. -^- V. WSAWtt MWWWKM Sdass     WWa.sWs<AS SwsAsss ass WfcSBsw&sm ssst WWtsws (s»Wt A £$$$«$&             ? & i / -:4- / :: / .,::.. laws. 3833 / 3’ J3 1 SasSs                  a ass-sW, iss       MgssM. as siass; stos Siaas wsss asassssaSsSsWs iSaAtoWWaWa; -Mtei a-aa^SS W S' X 58 X " > 'S       &<MWW®84 i&xsjSVsXS®       $XSS 5$ :X WS>: A::«. AW »1 >« &      «m www®» mwa» W ssxsssssssssSss: i4ssssSs4 w>iS®i Sfew w s®<wwW ( X J * ^^4 *< s m «4ss« 8i»WTAA» AO»tt tSsis           J^ssSssy               «5» sjsssssx>-',<5»s;ssss Stafchsfe ?; (fa* W& Wi ««<S<;>x5 %¥ X «s WS3 - s i 4¼ SWs SV. s.:X   S' ;S: SSX^SSiSt eiWsm^ W ssSssxx^Sws WsiSSisSS ss^jf j     w; sse«M Ssy   SssxxssSfewsS SMWw ^ssSxxsSj' <w vf Wssv iSsjxssSS SsxS is SSS5SKS* Sv Wim® *4^ss4 SsjskS s'sjsssii wssSw Sis: &«&;>&£ 'W^S sSS iJXSVi-XXS is; vs (sisss ^''»$£4^ ssS'ss^sssS V,                      SSS.SWWV ^:^:-                                              SS? < Mt $         Xi- SMS W :■ .■■ . ■; Ssssss ^:^.,.^.3 s Was && 44 SA■s^ss,. sssis    is <si •s&kis Sx> sSsssss              ^ssssssaj vssisssSy ssj sss^ssssj. umwwm & KSS^SSSsSSS^ 555555--:-555 n-r^j- ^ataemc® fesfe -34 w -?®5 sNmsw w®mj m>wu wmssTm.^ S«g®sS® OMAM«MWS.; MO SJSSSSS W SSS55S55!VWS S4s< W®®Ws^ W'’ W                  MiKWW        14&   *   ^54555 S'® 5Ws®      w &« ^Wwsj5®«ss® S'      SsbwssSSS:^ ( / s^ssssAcMssSs^^ sv, SSSS^SAS^^ wsss «» «®»»WWMW wwW   sg-® y S?sm^s^®sj;    < s: :s >. s <s• X«sss                85i«4M«ss&e- SssyssSsss w Maw$&SwKR 55x4         sisss^SS jysiSWS: MM'tMLS x '!■'< :        S >4 5^ >'SS «5S »5«            :^S -55XS5 SxSSSg              WS&S SXx,' ..5           5-5-.5555,v. 5.555555-.. k'55'5555'' -55.55 \> '5 ^'S Sxi®,« SO J ^s^\' x « «»A"' \^^®«.wssF^KAs^®.<to AsfSsSAxS&XSSS&WSSX^ w» ^ss A«M** taw^ -wto w4 swssS was         A® M&ag. Wi!A. to w w. & mmworw $«ta TOsOoy iOsiO T<ssbO Osivs Wss'^Wl V' X ** ^w®ww Awmsm SSsis Si W W-O «* sXWs-'; vww mww' W iisfeisSy siW- sssi&xs&sissss Sissiiisxi      ii      «<» issSssi i®            i |           *. iSs Sissi iisix, Ssi ^s^wssiw «ss ?xi' ^sSis i / SsSS^fWiS: »i;wsws)is§    wo ?w «®w Ts^r so M V. WSWAii Wist WW Mf A wow ? 1¾ SOsSsO; siWsOsiWwsikAxsww y> isyssssss six Sstsssisssssi iisyOO AsiSOj' is <s sisSssSO siOstsS <                  J Wi iWsk'W Wsw         sW       ss-isss « m Oxssi ss s issssO   Os iis w issss ssOss   iiO ssiW        <s <O Si <ix' ¢^         w is Xsfe i$Ws W sssi iiiiX sW is w® w* *WW *«« ito '■'■'SSs » s««sx As SjsjsSsssSsSs O. } iii Si ;i O SS\Six^sS:^:^s                       SSsSs sf *S SSS

Claims

What we claim is:

1. An isolated strain of Epichloe endophyte wherein the endophyte comprises a B11 allele of size 181 base pairs (bp) and an ans049 allele of size 306 bp.

2. The isolated strain of claim 1 wherein the Epichloe endophyte comprises at least one additional SSR allele selected from the group consisting of an ans017 allele of size 297 bp, an ans025 allele of size 293 bp, an ans054 allele of size 266 bp, and an egs027 allele of size 346 bp, preferably at least two, three, preferably all four additional SSR allele(s).

3. The isolated strain of claim 1 or claim 2 wherein the Epichloe endophyte comprises at least two additional SSR alleles, or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, at least 22 additional SSR alleles, or all 23 additional SSR alleles selected from the group consisting of a B10 allele of size 179 bp, an ans014 allele of size 291 bp, an ans015 allele of size 281 bp, an ans016 allele of size 273 bp, an ans017 allele of size 297 bp, two copies of an ans019 allele of size 176 bp, an ans024 allele of size 209 bp, an ans025 allele of size 293 bp, an ans030 allele of size 300 bp, an ans031 allele of size 294 bp, an ans032 allele of size 193 bp, an ans033 allele of size 155 bp, an ans035 allele of size 216 bp, an ans036 allele of size 242 bp, an ans044 allele of size 252 bp, an ans047 allele of size 283 bp, an ans054 allele of size 266 bp, an ans056 allele of size 238 bp, an egs002 allele of size 266 bp, an egs004 allele of size 327 bp, an egs010 allele of size 350 bp, and an egs027 allele of size 346 bp.

4. The isolated strain of any one of claims 1 to 3 wherein the Epichloe endophyte comprises a B10 allele of size 179 bp, an ans014 allele of size 291 bp, an ans015 allele of size 281 bp, an ans016 allele of size 273 bp, an ans017 allele of size 297 bp, two copies of an ans019 allele of size 176 bp, an ans024 allele of size 209 bp, an ans025 allele of size 293 bp, an ans030 allele of size 300 bp, an ans031 allele of size 294 bp, an ans032 allele of size 193 bp, an ans033 allele of size 155 bp, an ans035 allele of size 216 bp, an ans036 allele of size 242 bp, an ans044 allele of size 252 bp, an ans047 allele of size 283 bp, an ans054 allele of size 266 bp, an ans056 allele of size 238 bp, an egs002 allele of size 266 bp, an egs004 allele of size 327 bp, an egs010 allele of size 350 bp, and an egs027 allele of size 346 bp.

5. The isolated strain of any one of claims 1 to 4 wherein the Epichloe endophyte is AR153 (DSM 34880).

6. The isolated strain of any one of claims 1 to 5 wherein the Epichloe endophyte does not produce in planta detectable levels of ergovaline or lolitrem B or both.

7. The isolated strain of claim 6, wherein the Epichloe endophyte does not produce in planta detectable levels of epoxyjanthitrems.

8. A combination comprising an isolated strain of Epichloe endophyte of any one of claims 1 to 7 and a host plant.

9. A host plant comprising an isolated strain of Epichloe endophyte of any one of claims 1 to 7.

10. The combination of claim 8 or the host plant of claim 9, wherein the host plant is a grass plant or part thereof selected from the group consisting of a Lolium spp. plant, preferably L.perenne, L. boucheanum, or L. multiflorum, or a cultivar thereof, preferably L. perenne cultivar Grasslands Samson, Reason or Align, preferably L. multiflorum cultivar Manta, a Festuca spp plant, preferably F. arundinacea, a Festulolium spp plant and a Schedonorus spp plant, preferably S. arundinaceus.

11. A plant seed comprising an isolated strain of Epichloe endophyte of any one of claims 1 to 7.

12. A population of plant seeds of claim 11.

13. The plant seed of claim 11 or the population of claim 12 wherein the seed or seeds are from a grass plant or part thereof, preferably a Lolium spp. plant, preferably L. perenne, L.boucheanum, or L. multiflorum, or a cultivar thereof, preferably L. perenne cultivar Grasslands Samson, Reason or Align, preferably L. multiflorum cultivar Manta.

14. The population of plant seeds of claim 12 or 13 wherein the Epichloe endophyte is viable in least 70% of the plant seeds, and wherein the plant seeds have been subjected to ambient storage conditions for at least one year, preferably for at least 13, 14, 15, 16, 17, 18, 19, preferably for at least 20 months post-harvest.

15. A method of making an artificial host plant / Epichloe endophyte combination that does not induce Epichloe toxicosis in animals upon consumption, or that induces minimal Epichloe toxicosis in animals upon consumption, the method comprising artificially infecting a host plant with an isolated strain of Epichloe endophyte as defined in any one of claims 1 to 7.

16. A method of conferring at least some level of pest protection on a host plant comprising artificially infecting the host plant with an isolated Epichloe endophyte as defined in any one of claims 1 to 7 to form a host plant / Epichloe endophyte combination.

17. A method of reducing the average level of Epichloe toxicosis experienced by an animal grazing on an Epichloe infected host plant comprising feeding the animal with a host plant that is artificially infected with an isolated strain of Epichloe endophyte as defined in any one of claims 1 to 7.

18. The method of claim 17 wherein the reduction in the average level of Epichloe toxicosis is at least 70%, preferably at least 80%, 85%, 90%, 95%, 99%, preferably about 100%.

19. The method of claim 17 or 18 wherein the Epichloe toxicosis is ryegrass staggers.

20. A method of making a population of plant seeds comprising an Epichloe endophyte that remains viable in at least 70% of the population for at least 12 months under ambient storage conditions after the seeds are harvested comprising artificially infecting a host plant with an Epichloe endophyte as defined in any one of claims 1 to 7 to form a host plant / Epichloe endophyte combination and growing the combination under conditions that produce seeds.