Use of FBP1 mRNA in tumor treatment

Abstract

A use of FBP1 mRNA in tumor treatment. Provided is a use of an FBP1 protein, an mRNA, or an expression vector thereof for preparing a preparation or a composition, the preparation or the composition being used for: (a) dephosphorylating TERT S227, and (b) treating tumors related to TERT S227 high phosphorylation. Also provided is a pharmaceutical composition containing the FBP1 protein, the mRNA, or the expression vector thereof. The pharmaceutical composition, used alone or in combination with other mRNAs or oncogene-silencing siRNAs, can effectively promote or synergistically promote tumor cell senescence, thereby enhancing the tumor treatment effect, and providing a new strategy for the prevention and / or treatment of cancers or tumors related to TERT S227 high phosphorylation and / or FBP1 low-expression.

Description

TECHNICAL FIELD The present invention belongs to the field of biomedicine, and specifically relates to the use of FBP1 mRNA in tumor therapy. BACKGROUND Telomeres are composed of repeated TTAGGG nucleotide sequences and form a “cap” structure that maintains chromosome integrity. During each round of DNA replication, telomeres gradually shorten. Loss of telomere function leads to fusion of chromosome ends during mitosis, forming dicentric chromosomes and subsequent chromosome breakage anaphase bridges. The two resulting daughter cells each contain an asymmetric chromatid, and the two chromatids that do not contain telomeres will initiate breakage-fusion-bridge cycles in the next mitosis, ultimately leading to senescence and apoptosis of normal cells. In cancer cells, telomere length and elongation mainly depend on highly activated telomerase, which synthesizes telomeric repeats in most human cancers, and also depend on alternative telomere length regulation in 5%-15% of cancers. Telomerase activity is regulated by telomerase reverse transcriptase (TERT), which is the catalytic protein subunit of telomerase and regulates telomerase activity at both the transcriptional level and the post-translational modification level. Phosphorylation of TERT can significantly increase telomerase activity. For assembly of catalytically active telomerase, TERT in the cytoplasm must be transported into the nucleus. AKT-mediated phosphorylation of TERT at serine (Ser, S) 227 promotes binding of importin a to the nuclear localization signal (NLS) of TERT. However, it remains unclear whether TERT phosphorylation and subsequent telomere function are differentially regulated in normal cells and cancer cells. Therefore, mediating senescence of cancer cells to thereby mediate apoptosis of cancer cells is a new research direction in the art. However, it remains unclear in the art through which effective pathway or method cancer cells can be treated and / or alleviated effectively by mediating cell senescence to thereby mediate apoptosis of cancer cells. Therefore, development of a new method that can effectively promote senescence of cancer cells, inhibit cell proliferation, and thereby effectively treat and / or alleviate cancer is of great significance in the art. SUMMARY OF THE INVENTION The present invention provides a new method that can effectively promote cancer cell senescence and effectively treat and / or alleviate cancer. In the first aspect of the present invention, it provides a use of an FBP1 protein, an mRNA encoding FBP1, or an expression vector comprising a nucleic acid encoding FBP1 in the preparation of a formulation or composition for: (a) dephosphorylating TERT S227; (b) treating a tumor having TERT S227 hyperphosphorylation. In another preferred embodiment, the TERT S227 hyperphosphorylation refers to a detected phosphorylation level C1 of TERT S227 being significantly higher than a normal value C0 of TERT S227 phosphorylation level. In another preferred embodiment, the significantly higher refers to: C1 / C0 > 1.5, preferably > 2, more preferably > 3. In another preferred embodiment, the tumor is a tumor cell having TERT S227 hyperphosphorylation and / or low FBP1 expression. In another preferred embodiment, the low FBP1 expression refers to a detected FBP1 expression level Y1 being significantly lower than a normal value Y0 of FBP1 expression level. In another preferred embodiment, the significantly lower refers to: Y1 / Y0 < 2 / 3, preferably < 1 / 2, more preferably < 1 / 3. In another preferred embodiment, the tumor is selected from the group consisting of: oral cancer, oropharyngeal cancer, nasopharyngeal cancer, respiratory system cancer, urogenital system cancer, gastrointestinal cancer, central or peripheral nervous system tissue cancer, endocrine or neuroendocrine system cancer or hematopoietic system cancer, glioma, sarcoma, epithelial cancer, lymphoma, melanoma, fibroma, meningioma, brain cancer, kidney cancer, biliary tract system cancer, pheochromocytoma, islet cell carcinoma, Li-Fraumeni tumor, thyroid cancer, parathyroid cancer, pituitary tumor, adrenal tumor, osteogenic sarcoma tumor, neuroendocrine system tumor, breast cancer, lung cancer, head and neck cancer, prostate cancer, esophageal cancer, tracheal cancer, liver cancer, bladder cancer, gastric cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer, and skin cancer. In another preferred embodiment, the formulation or composition is further used for treating a tumor having low FBP1 expression. In another preferred embodiment, the formulation or composition is used for: (i) reducing nuclear transport of TERT; (ii) reducing telomerase activity; (iii) reducing telomerase length; (iv) promoting tumor cell senescence; (v) inhibiting tumor cell growth. In another preferred embodiment, the formulation is a laboratory formulation. In another preferred embodiment, the composition is a pharmaceutical composition. In the second aspect of the present invention, it provides is a pharmaceutical composition, comprising: (a1) an FBP1 protein, an mRNA encoding FBP1, or an expression vector comprising a nucleic acid encoding FBP1 ; and (b) a pharmaceutically acceptable carrier. In another preferred embodiment, the FBP1 protein, mRNA, or expression vector thereof is encapsulated in the pharmaceutically acceptable carrier. In another preferred embodiment, the pharmaceutically acceptable carrier is a lipid particle. In another preferred embodiment, the pharmaceutically acceptable carrier is a lipid nanoparticle (LNP). In another preferred embodiment, the pharmaceutical composition is a lipid particle. In another preferred embodiment, the pharmaceutical composition is a lipid nanoparticle. In another preferred embodiment, the lipid nanoparticle encapsulates the FBP1 protein, mRNA, or expression vector thereof. In another preferred embodiment, the lipid nanoparticle further comprisecomprises an element targeting tumor cells. In another preferred embodiment, the FBP1 mRNA is selected from the group consisting of: wild-type FBP1 mRNA, FBP1 mRNA variants, sequence-modified FBP1 mRNA, and combinations thereof. In another preferred embodiment, the nucleotide sequence of the FBP1 mRNA comprises SEQ ID NO: 5. In another preferred embodiment, the pharmaceutical composition further comprises mRNA of another tumor suppressor gene. In another preferred embodiment, the tumor suppressor gene is selected from the group consisting of: PTEN, FBW7, p53, VHL, RB1, and combinations thereof. In another preferred embodiment, the pharmaceutical composition further comprises mRNA selected from the group consisting of: PTEN mRNA, FBW7 mRNA, p53 mRNA, VHL mRNA, RB1 mRNA, and combinations thereof. In another preferred embodiment, the mRNA is selected from the group consisting of: wild-type mRNA, mRNA variants, sequence-modified mRNA, and combinations thereof. In another preferred embodiment, the nucleotide sequence of the PTEN mRNA comprises SEQ ID NO: 6. In another preferred embodiment, the nucleotide sequence of the FBW7 mRNA comprises SEQ ID NO: 7. In another preferred embodiment, the nucleotide sequence of the p53 mRNA comprises SEQ ID NO: 8. In another preferred embodiment, the nucleotide sequence of the VHL mRNA comprises SEQ ID NO: 9. In another preferred embodiment, the nucleotide sequence of the RB1 mRNA comprises SEQ ID NO: 10. In another preferred embodiment, the pharmaceutical composition further comprises a nucleic acid drug that inhibits an oncogene. In another preferred embodiment, the nucleic acid drug comprises siRNA. In another preferred embodiment, the oncogene comprises a gene mutation selected from the group consisting of: KRAS G12C, KRAS G12D, p110a E542K, pl 10a E545K, p110a H1047R, BRAF V600E, EGFR L858R, EGFR L861Q, EGFR G719X, EGFR S768I, and combinations thereof. In another preferred embodiment, the pharmaceutical composition further comprises siRNA selected from the group consisting of the following siRNA (compriscomprising the siRNA sequences, variants thereof, and sequence-modified versions of the siRNA): siKRAS G12C, siKRAS G12D, sip110a E542K, sip110a E545K, sip110a H1047R, siBRAF V600E, siEGFR L858R, siEGFR L861Q, siEGFR G719X, siEGFR S768I, and combinations thereof. In another preferred embodiment, the siRNA comprises: siRNA sequences designed against the mutation, variants thereof, and sequence-modified versions of the siRNA sequences. In another preferred embodiment, the nucleotide sequence of siKRAS G12C comprises SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or combinations thereof. In another preferred embodiment, the nucleotide sequence of siKRAS G12D comprises SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or combinations thereof. In another preferred embodiment, the nucleotide sequence of sip110a E542K comprises SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or combinations thereof. In another preferred embodiment, the nucleotide sequence of sip110a E545K comprises SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or combinations thereof. In another preferred embodiment, the nucleotide sequence of sip110a H1047R comprises SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or combinations thereof. In another preferred embodiment, the nucleotide sequence of siBRAF V600E comprises SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, or combinations thereof. In another preferred embodiment, the nucleotide sequence of siEGFR L858R comprises: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or combinations thereof. In another preferred embodiment, the nucleotide sequence of siEGFR L861Q comprises SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or combinations thereof. In another preferred embodiment, the nucleotide sequence of siEGFR G719X comprises SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, or combinations thereof. In another preferred embodiment, the nucleotide sequence of siEGFR S768I comprises SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, or combinations thereof. In another preferred embodiment, the pharmaceutical composition further comprises an additional drug for treating tumors. In another preferred embodiment, the lipid nanoparticle comprises: an ionizable lipid, lecithin, a phospholipid, and a PEG lipid. In another preferred embodiment, the lipid nanoparticle is an ionizable lipid. In another preferred embodiment, the encapsulation efficiency of the encapsulation is > 80%, and the average particle size of the encapsulated stock solution after encapsulation is 50-150 nm. In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. In another preferred embodiment, the pharmaceutically acceptable excipient is selected from the group consisting of a diluent, an excipient, a surfactant, a lubricant, a disintegrant, and combinations thereof. In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the group consisting of an injection, a lyophilized preparation, an aerosol inhalation preparation, and a smear-type preparation. In another preferred embodiment, the pharmaceutical composition is administered by injection, i.e., intravenous, intratumoral, intramuscular, subcutaneous, or intraperitoneal injection. In another preferred embodiment, the pharmaceutical composition is administered transdermally, for example by transdermal smearing or electroporation-mediated administration. In another preferred embodiment, the pharmaceutical composition is used for preparing a medicament for preventing and / or treating cancer or a tumor. In the third aspect of the present invention, it provides a reagent combination, comprising: (a) an FBP1 protein, an mRNA encoding FBP1, or an expression vector comprising a nucleic acid encoding FBP1 ; and (b) a detection reagent for detecting TERT S227 phosphorylation. In another preferred embodiment, the detection reagent is a TERT S227 phosphorylation antibody or a TERT S227 non-phosphorylation antibody. In another preferred embodiment, the detection reagent is a TERT S227 phosphorylation antibody. In another preferred embodiment, the expression vector is a tumor-targeting expression vector. In another preferred embodiment, the expression vector is a lipid nanoparticle (LNP) containing FBP1 mRNA. In another preferred embodiment, the reagent combination is used for detecting the phosphorylation level of TERT S227. In the fourth aspect of the invention, it provides a use of the pharmaceutical composition of the second aspect of the invention, for preparing a medicament, wherein the medicament is used for preventing and / or treating cancer or a tumor. In another preferred embodiment, the cancer or tumor is a cancer or tumor having TERT S227 hyperphosphorylation and / or low FBP1 expression. In another preferred embodiment, the cancer or tumor comprises oral cancer, oropharyngeal cancer, nasopharyngeal cancer, respiratory system cancer, urogenital system cancer, gastrointestinal cancer, central or peripheral nervous system tissue cancer, endocrine or neuroendocrine system cancer or hematopoietic system cancer, glioma, sarcoma, epithelial cancer, lymphoma, melanoma, fibroma, meningioma, brain cancer, kidney cancer, biliary tract system cancer, pheochromocytoma, islet cell carcinoma, Li-Fraumeni tumor, thyroid cancer, parathyroid cancer, pituitary tumor, adrenal tumor, osteogenic sarcoma tumor, neuroendocrine system tumor, breast cancer, lung cancer, head and neck cancer, prostate cancer, esophageal cancer, tracheal cancer, liver cancer, bladder cancer, gastric cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer, or skin cancer. In the fifth aspect of the present invention, it provides is a kit, comprising the reagent combination according to the third aspect of the present invention. In another preferred embodiment, the kit further comprises a mutant FBP1 protein, mRNA, or an expression vector thereof, and the mutant FBP1 protein, mRNA, or expression vector thereof has no dephosphorylation function. In another preferred embodiment, the mutation of the mutant FBP1 protein, mRNA, or expression vector thereof is selected from the group consisting of N273A, C129S, and combinations thereof. In another preferred embodiment, the mutation site of the mutant FBP1 protein, mRNA, or expression vector thereof is selected from the group consisting of N273, C129, R244, D128, and combinations thereof. In the sixth aspect of the present invention, it provides an in vitro dephosphorylation method, comprising: (s1) contacting a phosphorylated TERT S227 protein with an FBP1 protein, thereby dephosphorylating TERT S227. In another preferred embodiment, the method is non-diagnostic and non-therapeutic. In the seventh aspect of the present invention, it provides a method for treating and / or alleviating a tumor, comprising: (a1) administering a therapeutically effective amount of the pharmaceutical composition of the second aspect of the present invention to a subject in need thereof. In another preferred embodiment, the patient in need thereof is a patient having TERT S227 hyperphosphorylation and / or low FBP1 expression. In another preferred embodiment, the patient in need thereof suffers from a tumor selected from the group consisting of oral cancer, oropharyngeal cancer, nasopharyngeal cancer, respiratory system cancer, urogenital system cancer, gastrointestinal cancer, central or peripheral nervous system tissue cancer, endocrine or neuroendocrine system cancer or hematopoietic system cancer, glioma, sarcoma, epithelial cancer, lymphoma, melanoma, fibroma, meningioma, brain cancer, kidney cancer, biliary tract system cancer, pheochromocytoma, islet cell carcinoma, Li-Fraumeni tumor, thyroid cancer, parathyroid cancer, pituitary tumor, adrenal tumor, osteogenic sarcoma tumor, neuroendocrine system tumor, breast cancer, lung cancer, head and neck cancer, prostate cancer, esophageal cancer, tracheal cancer, liver cancer, bladder cancer, gastric cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer, and skin cancer. It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features specifically described below (e.g., in the examples) can be combined with each other to constitute new or preferred technical solutions. Due to space limitations, they are not repeated one by one herein. BRIEF DESCRIPTION OF THE DRAWINGS Figures 1a-j show that FBP1 acts as a protein phosphatase to dephosphorylate TERT S227. Figures 2a-f show that FBP1 C129 mediates TERT dephosphorylation. Figures 3a-e show that FBP1 inhibits TERT nuclear translocation and activity. Figures 4a-h show that FBP1 inhibits tumor growth by inhibiting TERT activity. Figures 5a-c show that FBP1 expression is negatively correlated with TERT S227 levels in ccRCC patients. Figures 6a-d show that FBP1 inhibits tumor growth and promotes mouse survival in liver cancer. Figures 7a-k show various safety evaluations of LNP in mice. Figures 8a-c show that FBP1 inhibits tumor growth in kidney cancer. Figure 9 shows that the combination of FBP1 mRNA and PTEN mRNA enhances tumor inhibition. Figure 10 shows that the combination of FBP1 mRNA and FBW7 mRNA enhances tumor inhibition. Figure 11 shows that the combination of FBP1 mRNA and VHL mRNA enhances tumor inhibition. Figure 12 shows that the combination of FBP1 mRNA and p53 mRNA enhances tumor inhibition. Figure 13 shows that the combination of FBP1 mRNA and RB1 mRNA enhances tumor inhibition. Figure 14 shows that the combination of FBP1 mRNA and siKRAS G12C enhances tumor inhibition. Figure 15 shows that the combination of FBP1 mRNA and siKRAS G12D enhances tumor inhibition. Figure 16 shows that the combination of FBP1 mRNA and sipllOa E542K, sipllOa E545K, and sipl 10a H1047R enhances tumor inhibition. Figure 17 shows that the combination of FBP1 mRNA and siBRAF V600E enhances tumor inhibition. Figure 18 shows that the combination of FBP1 mRNA and siEGFR L858R enhances tumor inhibition. Figure 19 shows that the combination of FBP1 mRNA and siEGFR L861Q or siEGFR G719X or siEGFR S768I enhances tumor inhibition. DETAILED DESCRIPTION OF THE INVENTION Through extensive and intensive research and massive screening, the present inventors unexpectedly found that TERT is regulated by the metabolic enzyme FBP1. FBP1 dephosphorylates TERT S227 (pS227), thereby inhibiting nuclear translocation and telomerase activity of TERT, reducing telomere length, inhibiting tumor cell proliferation, and promoting tumor cell senescence. Specifically, the studies of the present invention show that LNP-mediated delivery of FBP1 mRNA significantly inhibits tumor growth in tumors such as liver cancer, kidney cancer, lung cancer, pancreatic cancer, breast cancer, melanoma, colorectal cancer, bile duct cancer, and gastric cancer. In addition, the present invention designs targeting siRNAs against oncogenic mutations present in patients (which do not target the corresponding wild-type proteins), and these also have good therapeutic effects. Furthermore, combined delivery of FBP1 mRNA and the siRNA or other mRNA having therapeutic or alleviating effects exhibits a synergistic effect and can better inhibit tumor growth. The present invention was completed on this basis. FBP1 FBP1 generally refers to fructose-1,6-bisphosphatase 1, an enzyme involved in gluconeogenic metabolism. Gluconeogenesis is a metabolic pathway that generates glucose from non-carbohydrate precursors. FBP1 catalyzes the hydrolysis of fructose-1,6-bisphosphate into fructose-6-phosphate and inorganic phosphate. This enzyme is crucial for maintaining blood glucose levels, especially during fasting or when energy demand is high, when glucose needs to be synthesized from non-carbohydrate sources. Dysregulation of FBP1 activity is associated with various metabolic diseases, comprising diabetes and cancer. In mammals, FBP1 and FBP2 encode the liver and muscle isoforms of FBPase, respectively. FBP1 is mainly expressed in the liver and kidney, is universally deficient in almost 100% of clear cell renal cell carcinomas (ccRCC), and is downregulated in hepatocellular carcinoma (HCC) and other types of cancer. Low FBP1 expression promotes the progression of liver cancer and is associated with poorer overall survival and higher tumor recurrence rates. In addition, studies have shown that FBP1 interacts with hypoxia-inducible factors (HIFs) in ccRCC or enhancer of zeste homolog 2 (EZH2) in HCC and ccRCC cells in an enzyme activity-independent manner and inhibits their effects. Furthermore, FBP1 also acts as a protein phosphatase, dephosphorylating histone H3 at serine 15 to regulate gene expression. However, whether the enzymatic activity of FBP1 has other functions that directly regulate tumor cell proliferation remains unclear. PTEN PTEN (phosphatase and tensin homolog) is an important tumor suppressor gene that encodes a phosphatase. Initially, PTEN was found to be a gene frequently mutated in various common human tumors. With deeper research, scientists discovered the importance of PTEN in the cellular signal transduction network. As a phosphatase, it inhibits cell proliferation and promotes cell apoptosis by negatively regulating the PI3K / AKT signaling pathway. The PI3K / AKT pathway is crucial for processes such as cell proliferation, survival, and metabolism. In addition, PTEN has also been found to play roles in regulating the cell cycle, cell adhesion, and apoptosis. Research on PTEN not only plays a key role in understanding the occurrence and development of tumors, but also helps discover new therapeutic strategies and drug targets, because abnormal PTEN function is closely related to the occurrence and development of various cancers. FBW7 FBW7 (also known as F-box and WD repeat domain-containing 7) is an important protein belonging to a component of the SCF (Skp1 -Cullin-F-box protein) ubiquitin ligase complex. It plays a key regulatory role in cells, especially in regulating protein degradation and cell cycle regulation. Through its F-box domain, FBW7 interacts with other members of the SCF complex and ubiquitinates target proteins, thereby marking these proteins for degradation by the proteasome. This process plays an important regulatory role in the stability and function of various proteins in cells. In terms of cell cycle regulation, FBW7 has been found to regulate many cell cycle proteins, such as cyclin E, cyclin D, Myc, and Jun, controlling cell cycle progression by regulating their degradation. In addition, FBW7 is also associated with mutations in many tumor-related genes, especially with the occurrence and development of some cancers. FBXW7 is mutated in 6%-8% of tumors and is a good prognostic marker. FBXW7 mutations are associated with p53 gene mutations. FBXW7 and p53 synergistically inhibit tumor invasion and metastasis, and FBXW7 is also an important tumor suppressor gene. VHL The VHL gene refers to the Von Hippel-Lindau gene, an important gene in the human genome located on chromosome 3. The VHL gene encodes a protein called VHL protein, which performs important regulatory functions in cells. The main function of the VHL gene is to inhibit tumor growth and development. It plays an important role in processes such as angiogenesis and apoptosis by regulating the sensing and stabilization of oxygen molecules in cells. When the VHL gene is mutated or deleted, regulation of these processes is lost, which may lead to tumor occurrence. Mutation of the VHL gene is one of the main causes of VHL disease (Von Hippel-Lindau disease). This hereditary disease causes patients to develop multiple tumors, comprising retinoblastoma, cerebroma, hemangioblastoma, and cystic pancreatic lesions. VHL gene mutations are also associated with other types of tumors, such as renal cell carcinoma. Therefore, research on the VHL gene is of great significance, not only helping to better understand the pathogenesis of VHL disease, but also providing important clues for the diagnosis, treatment, and prevention of related diseases. Genetic testing and genetic counseling can also help family members with VHL gene mutations undergo monitoring and management to reduce the risk of related diseases. p53 The p53 gene is a crucial tumor suppressor gene in the human genome. It is called the “guardian gene” because its main function is to monitor the genetic stability of cells and, under DNA damage or other cellular stress conditions, promote cells to enter a repair state or apoptosis (cell self-destruction) to prevent abnormal cell proliferation. The role of the p53 gene in tumors is mainly manifested in the following aspects: 1) Maintaining genome stability: The p53 gene promotes DNA repair or guides cells into the apoptotic pathway by monitoring intracellular DNA damage, such as ultraviolet irradiation and exposure to chemical carcinogens, thereby preventing accumulation of DNA damage and maintaining genome stability. 2) Inhibiting abnormal cell proliferation: When cells undergo DNA damage or other abnormal conditions, the p53 gene can prevent uncontrolled proliferation of abnormal cells by regulating pathways such as the cell cycle, cell proliferation, and apoptosis, thereby preventing tumor occurrence. 3) Promoting apoptosis: When cells are subjected to severe DNA damage or other severe cellular stress, the p53 gene can promote cells to enter the apoptotic pathway to eliminate potentially cancerous cells, thereby inhibiting tumor development. Overall, the p53 gene plays a very important role in cell biology and is one of the key factors maintaining cell health and avoiding carcinogenesis. Mutation or loss of function of the p53 gene is one of the important causes of tumor occurrence, and abnormalities of the p53 gene can be observed in many tumors. Therefore, due to its important role in cell biology and oncology, the p53 gene has become one of the key targets of much scientific research and anticancer drug development. RB1 The RB1 gene is an important gene in the human genome, located on chromosome 13, and encodes a protein called retinoblastoma protein (Rb protein). The discovery of the RB1 gene is closely related to the pathogenesis of retinoblastoma (a childhood eye tumor). The main function of the RB1 gene is to inhibit cell proliferation. It controls cell growth and division by regulating the progression of the cell cycle. Rb protein can interact with cell cycle proteins, especially bind to E2F transcription factors, preventing their activation of cell cycle-related genes, thereby inhibiting cells from entering S phase (DNA synthesis phase). The role of the RB1 gene in cancer is mainly reflected in the following aspects: 1) Tumor suppression: The RB1 gene is considered a tumor suppressor gene. When the RB1 gene is mutated or inactivated, the inhibitory effect on cell proliferation is lost, and cells may proliferate uncontrollably, leading to tumor occurrence. 2) Retinoblastoma: RB1 gene mutation is the main cause of hereditary retinoblastoma. This childhood eye tumor is usually caused by a mutation in the RB1 gene that causes loss of normal tumor suppressor function of the biallelic RB1 gene, leading to excessive proliferation of retinal mother cells. 3) Other cancers: In addition to retinoblastoma, abnormalities of the RB1 gene are also associated with other types of tumors, comprisingcomprising osteosarcoma, breast cancer, prostate cancer, and the like. BRAF V600E Mutation The BRAF V600E mutation is a common oncogenic mutation, usually occurring in exon 15 of the BRAF gene. This mutation causes an amino acid change from valine (V) to glutamic acid (E) in the BRAF protein, and is therefore called the V600E mutation. The protein kinase encoded by the BRAF gene plays an important role in cell signal transduction pathways, especially in the RAS / RAF / MEK / ERK signaling pathway. This pathway participates in processes such as cell proliferation, growth, and differentiation. However, when the BRAF gene has the V600E mutation, this pathway may be abnormally activated, leading to excessive cell proliferation and cancer occurrence. The BRAF V600E mutation has been widely observed in various cancers, comprising melanoma, leukemia, thyroid cancer, colorectal cancer, non-small cell lung cancer, and other malignant tumors. The mechanism of this mutation is that the negative charge of the acidic glutamic acid residue gives it phosphate analog properties. This mimics phosphorylation of nearby T599 threonine and S602 serine residues in the BRAF activation segment, which are used to activate the wild-type form of the protein. The glutamic acid residue of the mutant thus acts to activate BRAF by inhibiting the interaction between the glycine-rich loop and the activation segment of BRAF. Reduced inhibition of BRAF leads to increased basal activity and is therefore oncogenic. Clinically, detection of the BRAF V600E mutation can serve as one of the important indicators for diagnosing specific types of cancer, formulating individualized treatment plans, and evaluating therapeutic effects. EGFR Epidermal growth factor receptor (EGFR) is one of the four members of the ERBB receptor tyrosine kinase family, also known as HER1 or ERBB1. Because its high expression and activation can enhance downstream signal transduction, EGFR plays an important role in the proliferation, survival, angiogenesis, and migration of various cells, especially epithelial cells. Mutations in the tyrosine kinase binding domain of the EGFR gene are considered a positive prognostic and predictive indicator. Most patients with EGFR mutation-positive tumors respond well to tyrosine kinase inhibitors (TKIs) such as gefitinib or erlotinib. Recent clinical trials have also shown that for non-small cell lung cancer patients with EGFR mutation-positive tumors, clinically validated use of TKI drugs instead of platinum-containing initial chemotherapy has become the most effective first-line treatment. Exon 19 in-frame deletion mutations and exon 21 L858R mutations are the two most important types of EGFR sensitivity mutations, accounting for 90% of all clinically important mutations associated with EGFR sensitivity. In addition, EGFR also has other oncogenic mutations, comprising L861Q, G719X, S768I, and the like. KRAS KRAS is a membrane-bound GTPase. When receiving extracellular signals, single-molecule KRAS GTPase performs downstream signal transduction by switching between an activated GTP-bound state and an inactivated GDP-bound state. Under normal conditions, when GTP is hydrolyzed, it changes to the inactive GDP-bound state. In tumors, RAS-GTP continuously activates multiple downstream signaling pathways, comprising RAS-RAF-MEK-ERK, PI3K-AKT-mTOR, and RALGDS-RAL pathways. It plays an important role in regulating cell proliferation, differentiation, and anti-apoptosis. In NSCLC, 97% of KRAS mutations occur in exons 2 and 3, at codons 12, 13, and 61, with the highest proportion being G12C (40%). Various amino acid changes lead to heterogeneity in different KRAS mutant proteins and their biological behaviors. Different KRAS mutation subtypes affect different downstream pathways. KRASG12C or KRASG12V often has Ral signaling pathway activation and is less dependent on AKT than wild-type KRAS. Other KRAS mutant proteins are more dependent on AKT for signal transduction than wild-type KRAS. KRASG12D has PI3K and MEK signaling pathway activation. KRASG12C lung cancer has higher ERK1 / 2 phosphorylation levels than KRASG12D. According to whether tumor activity depends on the KRAS pathway for maintenance, tumors can be divided into two categories: one type is KRAS-driven tumors, mostly well-differentiated epithelial phenotypes; the other type does not depend on KRAS to maintain tumor activity, commonly seen in epithelial-mesenchymal transition (EMT). KRASG12C mainly occurs in lung cancer, and KRASG12D mainly occurs in colorectal cancer and pancreatic cancer. PI3K PI3K belongs to the lipid kinase family and is mainly divided into three classes (I / II / III). Among them, class I phosphoinositide 3 -kinases (Class I PI3Ks) are dimers composed of a catalytic subunit and a regulatory subunit. Due to different catalytic subunits, they are divided into four subtypes: PI3Ka / p / y / 8, corresponding to catalytic subunits p110a / p / Y / 8 (the genes corresponding to the catalytic subunits are PIK3CA / B / G / D). In addition, according to differences in regulatory subunits and functions, Class I PI3Ks can be further divided into Class IA (PI3Ka / p / 8) and Class IB (PI3Ky). The PIK3CA gene encodes the catalytic subunit pl 10a. In cancer, p110a has multiple mutations, mainly comprising E542K, E545K, and H1047R. These mutations cause abnormal function of the p110a protein, thereby affecting normal regulation of the PI3K signaling pathway. siRNA of the Present Invention Oncogenic mutations in genes or proteins such as BRAF, EGFR, KRAS, and PI3K increase the occurrence and development of malignant tumors, but their wild-type forms play important roles in normal cell signal transduction and biological functions. Therefore, the present inventors conceived that targeting only oncogenic mutations of genes or proteins such as BRAF, EGFR, KRAS, and PI3K, without targeting their wild-type forms, can achieve the purpose of treating diseases without affecting maintenance of normal cell functions. Therefore, in the present invention, the inventors designed siRNAs specifically targeting BRAF, EGFR, KRAS, and PI3K mutations, and delivered them to tumors via lipid nanoparticles to achieve tumor treatment. Pharmaceutical Composition and Use Thereof In one aspect of the present invention, a pharmaceutical composition is further provided. In one embodiment of the present invention, the pharmaceutical composition is an mRNA pharmaceutical composition. There are many current delivery methods for mRNA. Scientists have established methods such as liposome transport, polymer transport, peptide chain transport, virus-like replicon particle transport, and cationic nanoemulsion transport. In addition, naked mRNA can also be directly injected into cells. The most commonly used delivery method is lipid nanoparticle transport, which has advantages such as low toxicity and high delivery efficiency. The “active component” in the pharmaceutical composition of the present invention refers to the FBP1 mRNA of the present invention. In a preferred embodiment, the “active component” further comprises mRNA selected from: PTEN mRNA, FBW7 mRNA, VHL mRNA, p53 mRNA, and RB1 mRNA. In a preferred embodiment, the “active component” further comprises siRNA selected from: siKRAS G12C, siKRAS G12D, sipllOa E542K, sipllOa E545K, sipllOa H1047R, siBRAF V600E, and siEGFR (L858R, L861Q, G719X, S768I). The “active component,” formulation, and / or composition of the present invention can be used for preventing and / or treating diseases or disorders such as infectious diseases, rare genetic diseases, neurodegenerative diseases, retinopathies, cancer, or tumors. “Safe and effective amount” means: the amount of active component is sufficient to significantly improve the condition or symptoms without causing serious side effects. “Pharmaceutically acceptable carrier” means: one or more compatible solid or liquid fillers or gel substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. “Compatibility” herein means that the components in the composition can be mixed with the active component of the present invention and with each other without significantly reducing the efficacy of the active component. The pharmaceutical composition can be liquid or solid, such as powder, gel, or paste. Preferably, the composition is liquid, preferably an injectable liquid. Examples of pharmaceutically acceptable carriers comprise cellulose and derivatives thereof (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, and the like. The pharmaceutical composition may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, and sterile powders for redissolving into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof. The pharmaceutical composition of the present invention can be prepared into dosage forms such as injections, lyophilized preparations, aerosol inhalation preparations, smear-type preparations, and the like. The pharmaceutical composition of the present invention can be delivered (administered) by any suitable route, comprising oral, parenteral, and topical methods. The pharmaceutical composition of the present invention can also be administered by injection, i.e., intravenous, intratumoral, intramuscular, intradermal, subcutaneous, or intraperitoneal injection. In addition, the pharmaceutical composition of the present invention can be administered transdermally. Transdermal administration methods via topical routes can be formulated into applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, gelants, paints, powders, and aerosols. In addition, the pharmaceutical composition of the present invention can be actively administered to intradermal, subcutaneous, intramuscular, tumor, tissue organ, central nervous system, and other sites via electrodes / electric fields / potential differences. The pharmaceutical composition of the present invention can be co-administered with another active agent. Co-administration includes administering the compound of the present invention and the active agent within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of each other. Co-administration also includes simultaneous, approximately simultaneous (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other), or sequential administration of the compound of the present invention and the active agent in any order. In some embodiments, co-administration can be accomplished by co-formulation, i.e., preparing a single 5 pharmaceutical composition comprising both the active component of the present invention (the mRNA transcription template construct or optimized mRNA of the present invention) and the active agent. In other embodiments, the active component of the present invention and the active agent can be formulated separately. 10        The present invention also provides a use of the pharmaceutical composition for preparing a medicament, wherein the medicament is used for preventing and / or treating diseases, comprising but not limited to diseases having TERT S227 hyperphosphorylation and / or low FBP1 expression, such as cancers or tumors having TERT S227 hyperphosphorylation and / or low FBP1 expression. In a 15 preferred embodiment, the cancer or tumor comprises: The main advantages of the present invention comprise: (1) The LNP-mediated FBP1 mRNA of the present invention can mediate TERT dephosphorylation, thereby promoting cell senescence, inhibiting cell 20 proliferation, and thereby effectively mediating apoptosis of tumor cells, providing a new strategy and approach for clinically exploring new cancer treatment methods based on molecular typing of tumor patients. (2) The LNP-mediated FBP1 mRNA of the present invention can also be used in combination with other tumor suppressor gene mRNAs and siRNAs designed 25 against oncogenic mutations, thereby synergistically inhibiting tumor growth and providing a new reference for clinical precision chemotherapy and targeted therapy. The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to 30 illustrate the present invention and are not intended to limit the scope of the present invention. In the following examples, experimental methods without specifying specific conditions are generally performed under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are percentages by weight and parts by weight. Materials and Methods Cell Culture The cell lines Huh7, HEK-293T, HEK-293S, HK2, LN18, 786-O, A549, MIAPACA-2, H358, MCF7, MCF10A, T-47D, A375, H3255, and the like used in the present invention were obtained from authenticated National Cell Culture Collection Centers and ATCC. Huh7, HK2, and HEK-293T cells were cultured in DMEM comprising 10% FBS (Gibco, Carlsbad, CA) and 1% penicillin-streptomycin (Invitrogen, Thermo Fisher Scientific). 786-O cells were cultured in RPMI 1640 medium containing 10% FBS and 1% penicillin-streptomycin. The cell lines used in the present invention were not found in the commonly misidentified cell line database maintained by the International Cell Line Authentication Committee or the BioSample database maintained by NCBI. These cell lines were identified by short tandem repeat profiling, and the results were correct, with no mycoplasma contamination. Co-Immunoprecipitation Cells were washed with cold PBS, centrifuged, and lysed in cell pellets by adding lysis buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 5 mM EDTA, 10% glycerol, 1 mM NaVOs, 50 mM NaF, and pro tease inhibitor cocktail) at 4°C for 30 minutes. After centrifugation at 12,000 g for 15 minutes, the supernatant was transferred to a pre-cooled centrifuge tube. 2 mg of protein was incubated with the corresponding antibody overnight, and then mixed with protein A / G beads for 2 hours (or Flag-beads overnight). The beads were washed three times with lysis buffer and then subjected to immunoblot analysis. Protein Purification After constructing the prokaryotic expression vector, E. coli BL21 -DE3 strain was used to induce expression of the relevant proteins. When the OD value of the bacterial cells at 600 nm reached 0.8-0.9, IPTG was added to a final concentration of 0.1 mM, the bacterial growth temperature was lowered from 37°C to 16°C (His-tag) or 25°C (GST-tag), and after further culture overnight for 16 h, the bacteria were collected by centrifugation. An appropriate amount of lysis buffer and nuclease were added to each tube and placed on ice for 30 min to degrade nucleic acids. The bacteria were sonicated on ice. After centrifugation at 12,000 g at 4°C for 30 min, the supernatant was collected, and the entire supernatant was used to bind to the corresponding beads. The protein was then eluted with an imidazole gradient (His-tag) or GSH (GST-tag), concentrated, and measured for concentration. SDS gel electrophoresis was then performed, followed by Coomassie brilliant blue staining and western blot to detect protein expression. TERT protein was purified using HEK293S cells. Strep-MBP-TEV-tagged TERT was expressed in HEK293S. After centrifugation of in vitro cultured HEK293S cells, protease inhibitors (2 pg / mL DNase I, 0.5 pg / mL pepstatin, 2 pg / mL leupeptin, 1 pg / mL aprotinin, and 1 mM PMSF) were added, and the cells were resuspended and lysed in Buffer 1 (20 mM Tris 8.0, 150 mM NaCl, 3 mM DTT). After sonication and incubation on ice for 60 min, centrifugation was performed at 10,000 g at 4°C. The supernatant was incubated with streptavidin beads at 4°C for 90 min. Strep-MBP-TEV-TERT protein was eluted with 10 mM D-desthiobiotin. The eluted protein was cleaved overnight with recombinant TEV protease (v / v = 1:20), and then TERT protein was further separated and purified using AKTA (Superdex 200 column). CRISPR / Cas9 System for Gene Editing by Knocking in Mutations in Tumor Cells The CRISPR / Cas9 technology can be used to achieve site-specific gene knock-in mutations, making experiments more efficient and accurate. The inventors will use this technology to perform knock-in mutations in relevant cell lines. The specific experimental process includes gRNA design, CRISPR / Cas9 vector construction, donor vector construction, cell transfection, resistance screening, positive clone identification, monoclonal cell culture, and cell line construction. Preparation of TERT-pS227 Antibody The peptide RRGGS(phos)ASRS-C (SEQ ID NO: 41) (KLH-conjugated) was used as an antigen and injected into rabbits. A total of five immunizations were performed. The first immunization dose was 0.75 mg, and subsequent immunizations used half of the first dose. Finally, serum was purified using the peptides RRGGS(phos)ASRS-C and RRGGSASRS-C. Glutathione S-Transferase Pulldown Assay (GST Pulldown) The corresponding protein was mixed with glutathione magnetic beads in binding buffer (50 mM Tris-HCl, pH 7.5; 1% Triton X-100; 150 mM NaCl; 1 mM DTT; 0.5 mM EDTA; 100 pM PMSF; 100 pM leupeptin; 1 pM aprotinin; 100 pM sodium vanadate; 100 pM sodium pyrophosphate; 1 mM sodium chloride) at 4°C overnight. The glutathione magnetic beads were washed three times with binding buffer and then subjected to immunoblot analysis. Metabolic Flux Analysis Two million 786-O cells were plated in each 10 cm culture dish and cultured for 12 hours in medium with or without [U-13Ce]-glucose. For mouse studies, before sacrifice, [U-nC6]-glucose was injected via tail vein every 15 minutes at a dose of 1.5 g / kg. Tissues were quickly frozen in liquid nitrogen. Samples were thawed in an ice bath to reduce sample degradation, and then 400 pl of 80% methanol solution was added to each tube of cell samples, followed by sonication. After centrifugation at 14,000 g for 15 minutes at 4°C, all supernatant was collected and concentrated, 100 pl of 80% methanol solution was added, and LC-MS analysis was performed. Protein Mass Spectrometry Analysis To identify interacting proteins, protein bands were excised from SDS-PAGE gels by Coomassie brilliant blue staining and digested overnight with 200 ng trypsin (Promega) in 50 mM ammonium hydroxide buffer containing RapiGest (Waters Corporation) at 37°C. The digested protein samples were analyzed using high-sensitivity LC-MS / MS with an Orbitrap Elite mass spectrometer (Thermo Fisher Scientific). Protein identification was performed by comparing fragment spectra with the UniProt protein database (EMBL-EBI) using the Mascot search engine (version 2.3; Matrix Science) and Proteome Discoverer software program (version 1.4; Thermo Fisher). Immunofluorescence Cells were fixed with 4% formaldehyde for 15 minutes, then treated with 0.25% Triton X-100 for 10 minutes to increase cell membrane permeability. After blocking with 5% bovine serum albumin (BSA) for 30 minutes, cells were incubated with primary antibody overnight at 4°C, and then incubated with fluorescent dye-labeled secondary antibody and DAPI. Immunofluorescence microscopic images were obtained using a Zeiss confocal microscope system (LSM900). QFISH Detection of Telomere Length Cells were treated with 1 og / mL colcemid for 90 minutes to be in metaphase. Cells were incubated in cold 0.56% potassium chloride solution, then fixed in methanol:acetic acid (3:1) and spread on glass slides, and air-dried overnight. Slides were rehydrated with 2* SSC buffer, treated with 100 ug mL RNase A for 1 hour, and then treated with pepsin (50 U / ml) at 37°C for 10 minutes. After fixation in 4% formaldehyde for 5 minutes, slides were dehydrated in 70%, 85%, and 100% ethanol for 1 minute each and air-dried. After heating the slides at 85°C for 5 minutes, hybridization was performed with 200 nM TelC-Cy3 probe for 2 hours. After washing, coverslips were mounted onto slides using ProLong Gold antifade reagent. Images were acquired using a Zeiss confocal microscope (LSM900) equipped with a 63x oil objective. TRF Analysis for Telomere Length Genomic DNA was isolated from the indicated cells using a QIAamp DNA mini kit (Qiagen). The isolated genomic DNA (2 mg) was digested overnight with HinfI and RsaI (20 U each) at 37°C. DNA was separated by 0.8% agarose gel electrophoresis. The gel was denatured in 0.5 M NaOH and 1.5 M NaCl at 25°C with shaking for 30 minutes, then neutralized by washing twice with 0.5 M Tris (pH 7.5) and 1.5 M NaCl at 25°C with shaking for 15 minutes each. The gel was then transferred to a nylon membrane for Southern blot. DNA was cross-linked to the membrane using a UV crosslinker at a setting of 120 mJ cm-2. The membrane was pre-hybridized in DIG Easy Hyb Granules buffer for 1 hour, hybridized with DIG-labeled telomere probe at 42°C for 4 hours, and then washed three times with 2X SSC buffer containing 0.1% SDS for 15 minutes each. The membrane was then incubated in buffer containing DIC-AP antibody for 40 minutes, and then developed using CSPD ready-to-use. C-Circle Assay Genomic DNA was extracted using a QIAamp DNA mini kit (Qiagen). Diluted DNA (16 ng) was mixed with 0.2 mg / ml bovine serum albumin, 0.1% Tween, 4 mM dithiothreitol (DTT), 1 mM each dNTP (except dCTP), 1 x ¢29 buffer (NEB), and 7.5 U ¢29 DNA polymerase (NEB). The mixture was incubated at 30°C for 8 hours, and then at 65°C for 20 minutes. qPCR was used to quantify telomeric DNA levels in samples treated or not treated with ¢29 DNA polymerase (labeled RCA+ and RCA-, respectively). C-Circle was calculated by ACt(RCA+) / ACt(RCA-). The primers used in this assay are shown in Table 1 below. Table 1 SEQ ID NO: Sequence (5’-3‘) Telo-F 1 GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT Telo-R 2 TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA 36B4-F 3 CAGCAAGTGGGAAGGTGTAATCC 36B4-R 4 CCATTCTATCATCAACGGGTACAA Phosphocysteine Intermediate Capture Assay Purified active AKT1 protein (SignalChem) (20 ng) was incubated with biotin-labeled TERT S227 polypeptide (1 mM) in 25 pl kinase buffer (CST) with 10 pCi [y-32P]ATP at 30°C for 30 minutes. The reaction buffer was incubated with 20 pl streptavidin magnetic beads to collect [y-32p]ATP-labeled TERT S227 peptide, and then the beads were washed three times with phosphatase buffer (20 mM Tris-HCl (pH 8.5), 75 mM NaCl, 10 mM magnesium acetate, 0.57 mM EDTA, 0.033% BSA, and 1 mM DTT). WT His-FBP1 (1 pg) or His-FBP1 C129S (1 pg) protein was rapidly mixed with [y-32p]ATP—labeled TERT S227 peptide in 25 pl phosphatase buffer at room temperature for 10 seconds. The phosphocysteine intermediate capture assay was terminated by adding SDS buffer, and samples were then analyzed by SDS-PAGE without heating. The 32P-labeled covalent phosphocysteine intermediate during catalysis can be visualized by autoradiography. Molecular Dynamics Simulation The crystal structure of human liver FBP1 complexed with AMP (PDB: 5ZWK) was obtained from the Protein Data Bank (www.rcsb.org / ). The structure of TERT was predicted using AlphaFold (https: / / alphafold.ebi.ac.uk / entry / O14746). A set of one hundred models was generated, and the model with the lowest DOPE score was selected for further analysis. Subsequently, FBP1 was minimized and refined by molecular dynamics (MD) simulation using the Amber 16 software package and ff14SB force field. The protein was dissolved in a truncated octahedral TIP3P water box containing 30,819 water molecules. Four Mg2+ ions were introduced to neutralize the system charge. The simulation began with two stages of minimization: first, 3,000 steps of steepest descent with a harmonic force of 50 kcal / mobA2 restraining the solute to its position, followed by 3,000 steps of conjugate gradient. Subsequently, in the NVT ensemble, the temperature was gradually increased from 50 to 300 K over 100 ps, with the solute restrained by a harmonic potential of 5 kcal / mol-A2. MD simulation was performed in the NPT ensemble, in which positional restraints were gradually released over 100 ps. The production run continued for 1000 ns, with pressure coupling set to 1 atm and constant temperature at 300 K. A 2 fs time  step was used, and all hydrogen-containing bonds were constrained using the SHAKE algorithm. Long-range electrostatic interactions were modeled using the particle mesh Ewald (PME) method. MD trajectories were analyzed using VMD (http: / / www.ks.uiuc.edu / ), and molecular representations were created using PyMOL (https: / / pymol.org / 2 / ). Polypeptide-Protein Molecular Docking The crystal structure of human liver FBP1 complexed with AMP (PDB: 5ZWK) was retrieved from the Protein Data Bank. The structure of TERT was predicted by AlphaFold.  The  S227-phosphorylated TERT (TERT pS227) peptide was constructed and minimized via Schrodinger (https: / / www.schrodinger.com / ). Molecular docking of the FBP1 tetramer and TERT pS227 peptide was performed using the HPEPDOCK web server (http: / / huanglab.phys.hust.edu.cn / hpepdock / ). The optimal binding mode was selected from the top 10 conformations obtained by docking for further analysis. The best binding mode was determined based on docking scores and experimental data. Docking results were analyzed using PyMOL. Cell Proliferation Assay Cell proliferation was evaluated by Cell Counting Kit-8 (CCK8). Cells were seeded in 96-well plates at a density of 1,500 cells per well, and absorbance was then measured at 450 nm. Colony Formation Assay Cells were seeded in 6-well plates at a density of 4,000 cells per well and cultured for 7-10 days. After washing with PBS, cells were fixed with 4% formaldehyde for 15 minutes and then stained with 0.4% crystal violet for 20 minutes. After staining, cells were washed with PBS and air-dried to visualize colonies. In Vitro Phosphatase Assay TERT pS227 polypeptide (Biotin-APGARRRGG-pS-ASRSLPLPKRP (SEQ ID NO: 42)) was synthesized by Nanjing Yuanpeptide Biotechnology Co., Ltd. Purified WT His-FBP1, His-FBP1 C129S, His-FBP1 N273A, or His-FBP1 G260R protein (1 pg each) was incubated with TERT pS227 peptide (100 pM) in 25 pl phosphatase reaction buffer (25 mM Tris-HCl, pH 7.4; 140 mM NaCl; 10 mM DTT) at 37°C for 30 minutes. Phosphate released from the peptide was measured using a malachite green assay kit (Sigma). Telomerase Assay Telomerase activity was measured using a Telomerase Activity Quantification qPCR Assay Kit (ScienCell, #8928) according to the manufacturer's instructions. FBP1 Activity Assay The activity of FBP1 protein was measured using BioVision's fructose-1,6-bisphosphatase activity assay kit (K590) according to the manufacturer's instructions. Km and Vmax values were calculated using GraphPad Prism 10 software. Cell Senescence Staining P-galactosidase staining was performed on 6-well plates (for in vitro studies) and 12 pm frozen sections obtained from xenograft tumors using a P-galactosidase staining kit (Beyotime Biotechnology) according to the manufacturer's instructions. Nuclear-Cytoplasmic Separation Nuclear and cytoplasmic separation was performed using a nuclear / cytoplasmic separation kit (Beyotime Biotechnology) according to the manufacturer's instructions. CRISPR / Cas9 System for Gene Editing by Knocking in Mutations in Tumor Cells The CRISPR / Cas9 technology can be used to achieve site-specific gene knock-in mutations, making experiments more efficient and accurate. The inventors will use this technology to perform knock-in mutations in relevant cell lines. The specific experimental process includes gRNA design, CRISPR / Cas9 vector construction, donor vector construction, cell transfection, resistance screening, positive clone identification, monoclonal cell culture, and cell line construction. LNP Preparation Ionizable lipid SM102 and DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine) were purchased from Shanghai Huabao Biochemical Co., Ltd.; DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine)-PEG2000                 and DSPE-PEG2000-cRGD were purchased from Xi'an Ruixi Biotechnology Co., Ltd.; C16-TAT (C16-GGRKKRRQRRRPQ (SEQ ID NO: 43)) was purchased from Nanjing Yuanpeptide Biotechnology Co., Ltd. Briefly, a lipid mixture in ethanol (SM102, DSPC, cholesterol, and DSPE-PEG2000 at a molar ratio of 50:10:38.5:1.5) and a targeting peptide mixture (DSPE-PEG-cRGD, C16-TAT, and lipid mixture at a weight ratio of 1:1:10) were injected into a microfluidic device (Shanghai Weina (Shanghai) Biotechnology Co., Ltd.) for self-assembly of LNPs. The formed LNPs were dialyzed twice against PBS buffer (pH 7.4) containing 2% sucrose, for 12 hours each time, to remove ethanol. LNPs without FBP1 mRNA were used as control LNPs. The dose for animal studies was 0.5 mg / kg body weight. Animal Experiments Animal experiments were performed in accordance with the laboratory animal care and use guidelines approved by the Institutional Review Board of the First Affiliated Hospital, Zhejiang University School of Medicine. Six-week-old male nude mice were provided by GemPharmatech (Nanjing, China). Mice were housed under specific pathogen-free conditions with a 14-hour light / 10-hour dark cycle. The environmental temperature was 21 -23°C and humidity was 50%, with free access to drinking water and food. 2*106 Huh7 cells or 8*106 786 -O cells were suspended in 75 gL DMEM or RPMI 1640 and subcutaneously injected together with 75 gL Matrigel. Tumor size was measured every other day, and tumor volume was calculated using the equation V (mm3) = 0.52 x length x width. Immunohistochemistry Samples from human HCC (80 males and 10 females, aged 21-73 years) and ccRCC (58 males and 22 females, aged 35-75 years), as well as adjacent normal tissue samples and clinical information, were obtained from the First Affiliated Hospital, Zhejiang University School of Medicine. The study using human samples in the present invention was approved by the Research Ethics Committee of the First Affiliated Hospital, Zhejiang University School of Medicine, and complied with all relevant ethical regulations. All tissue samples were collected in compliance with informed consent policies. All patients received standardized treatment after surgery. Paraffin sections of human samples were stained with anti-FBP1 or TERT pS227 antibodies. Non-specific IgG was used as a negative control. Staining of tissues was quantitatively scored according to the percentage of positive cells and staining intensity. Example 1 FBP1 Dephosphorylates TERT S227 FBP1 acts as a protein phosphatase to dephosphorylate TERT protein. To determine whether FBP1 has a previously unknown tumor suppressor activity, in this example FBP1 was immunoprecipitated from HCC cell line Huh7 cells, and it was found that TERT interacts with FBP1, and this interaction was weakened by using shRNA to reduce FBP1 expression (Figure 1a). In vitro GST pulldown experiments showed that purified bacterially expressed GST-FBP1 can directly bind to Flag-TERT purified from 293T cells (Figure 1b). These results indicate that FBP1 directly interacts with TERT. Results of expressing different FBP1 truncation mutants in 786-O ccRCC cells showed that the 236-275 truncation eliminates binding of FBP1 to TERT (Figure 1c). Mutating hydrophobic amino acids or residues exposed on the protein surface in this region, IP experiments showed that mutation of asparagine (Asp, N) 273 to alanine (Ala, A) reduces binding of FBP1 to TERT (Figure 1d). In addition, treatment of TERT immunoprecipitates with calf intestinal alkaline phosphatase (CIP) reduced binding of TERT to FBP1 (Figure 1e). TERT activity is strictly controlled by phosphorylation. AKT-mediated phosphorylation of TERT at serine (Ser, S) 227 transports TERT into the nucleus, and this nuclear transport is essential for TERT function. To determine whether FBP1 has a function different from its metabolic activity and acts as a protein phosphatase to dephosphorylate TERT, the present invention mixed purified active AKT1 with purified TERT expressed in HEK293S cells, added [y-32P]ATP for protein phosphorylation experiments, and then incubated it with purified bacterially expressed His-FBP1 for protein dephosphorylation experiments. Autoradiography showed that AKT1-phosphorylated TERT, but not TERT S227A mutant, could be significantly dephosphorylated by FBP1 (Figure 1f). In addition, immunoblot analysis using a specifically validated TERT pS227 antibody showed that FBP1 dephosphorylated S227-phosphorylated TERT but not TERT S227A (Figure 1g). Purified wild-type (WT) FBP1 and FBP1 G260R dephosphorylated TERT polypeptide containing S227 phosphorylation (Figure 1h). Correspondingly, overexpression of WT FBP1 and FBP1 G260R, but not FBP1 N273A, in 786-O ccRCC cells resulted in dephosphorylation of TERT at S227 (Figure 1i). Conversely, knocking out FBP1 in Huh7 cells enhanced TERT S227 phosphorylation (Figure 1j). Example 2 FBP1 C129 Mediates TERT S227 Dephosphorylation Reduced cysteine (Cys, C) in the catalytic domain of protein phosphatases is essential for dephosphorylating protein substrates, and mutation of this cysteine usually produces a “substrate trap,” leading to increased binding of the substrate to the phosphatase. C129 of FBP1 is essential for dephosphorylation of histone H3. Molecular docking analysis of FBP1 with phosphorylated TERT polypeptide (Figure 2a) showed that TERT pS227 can dock near C129 (4.1 A) adjacent to the catalytic domain of FBP1 (Figure 2a). Mutating C129 to serine (Ser) failed to dephosphorylate TERT pS227 polypeptide (Figure 2b). Consistent with these in vitro results, expression of WT Flag-FBP1 inhibited 786-O cells (Figure 2c). These results indicate that FBP1 C129 is essential for dephosphorylation of TERT pS227. The reduced cysteine residue in the catalytic domain of protein phosphatases forms a covalent phosphocysteine intermediate, accompanied by rapid release of the dephosphorylated protein substrate. To determine the mechanism of FBP1-mediated TERT dephosphorylation, the present invention performed in vitro phosphorylation experiments. Incubation of [y-32P]-phosphorylated TERT S227 polypeptide with purified WT FBP1 or FBP1 C129S showed that only WT FBP1 was labeled with [y-^P] (Figure 2d). These results indicate that FBP1 forms a covalent phosphorylated cysteine intermediate during TERT pS227 dephosphorylation. To determine whether FBP1 requires reduced-state C129 to dephosphorylate TERT pS227, the present invention incubated purified FBP1 with purified AKT-phosphorylated TERT peptide in the presence of the oxidizing agent H2O2. H2O2 treatment eliminated FBP1 -mediated dephosphorylation of TERT pS227 peptide (Figure 2e). However, the reducing agent dithiothreitol (DTT) eliminated this effect. These results indicate that C129 of FBP1, in the reduced state, forms a covalent phosphocysteine intermediate that functions in TERT pS227 dephosphorylation. Protein phosphatases having a catalytic cysteine residue usually have a CX5R motif (X can be any amino acid), forming a pocket in the catalytic domain for dephosphorylation of substrate proteins. Although FBP1 does not have CX5R, structural analysis showed that C129, R244, and aspartic acid (Asp, D) 128 of FBP1 form a pocket, and these three amino acids potentially interact with the phosphate group of phosphorylated TERT S227 peptide. Mutation of R244 or D128 of FBP1 to alanine (Ala) reduced the ability of FBP1 to dephosphorylate TERT S227 peptide (Figure 2f). These results provide sufficient evidence that FBP1 is a protein phosphatase that dephosphorylates TERT pS227. Example 3 FBP1 Inhibits TERT Nuclear Translocation and Its Function Next, the present invention investigated whether FBP1 -mediated TERT pS227 dephosphorylation affects nuclear transport of TERT. The present invention found that expression of WT FBP1, but not FBP1 C129S or FBP1 N273A, in 786-O cells reduced telomerase activity in a time-dependent manner (Figure 3a) as well as by Southern blot analysis (Figure 3b). Consistent with the effect of FBP1 -regulated TERT dephosphorylation on telomere length in tumor cells, expression of WT FBP1 in 786-O cells increased cell senescence, manifested as increased P-galactosidase activity (Figure 3c). These results indicate that FBP1 dephosphorylates TERT and inhibits its accumulation and activity in the nucleus, thereby shortening telomere length and inducing cell senescence. Consistent with these results, expression of the phosphorylation-mimicking TERT S227D mutant in 786-O cells largely eliminated WT FBP1 -mediated inhibition of telomerase activity (Figure 3d) and reduction of telomere length (Figure 3e). These results indicate that FBP 1 dephosphorylates TERT pS227, thereby reducing accumulation of TERT in the nucleus, telomerase activity, and telomere length, and promoting tumor cell aging. Example 4 FBP1 Inhibits Tumor Growth by Inhibiting TERT Activity To determine the effect of FBP1 -regulated TERT on tumor cell proliferation, the present invention subcutaneously injected 786-O cells overexpressing WT FBP1, FBP1 C129S, or FBP1 N273A into nude mice. WT FBP1 expression significantly inhibited tumor growth (Figure 4a), accompanied by reduced tumor volume (Figure 4b) and reduced tumor mass (Figure 4c), as well as enhanced cell senescence in tumors (Figure 4d). In contrast, FBP1 C129S and FBP1 N273A lost their effects in inhibiting tumors and inducing cell senescence (Figures 4a-d). Notably, when FBP1 deficiency and FBP1 C129S expression were present, re-expression of rTERT S227A in 786-O cells inhibited tumor growth to a lesser extent than in the presence of WT FBP1 expression (Figures 4e, 4f), indicating that FBP1 has a tumor suppressor function dependent on and independent of protein phosphatase activity. Conversely, when FBP1 deficiency or expression of WT FBP1 and FBP1 C129S was present, re-expression of rTERT S227D promoted tumor growth. These results indicate that FBP1 inhibits tumor growth by dephosphorylating TERT pS227. In addition, hematoxylin-eosin (H&E) staining of tumor tissues showed that overexpression of WT FBP1 increased formation of anaphase bridges (Figure 4g), a hallmark of telomere dysfunction. Re-expression of TERT S227D, but not rTERT S227A, significantly attenuated the effect of WT FBP1 expression on anaphase bridge formation (Figure 4h). Therefore, FBP1 -mediated TERT dephosphorylation disrupts telomere function, leading to tumor cell aging and inhibition of tumor growth. Next, the present invention performed IHC analysis on 80 human ccRCC samples and adjacent normal tissues. Compared with normal tissues, decreased FBP1 and increased TERT S227 phosphorylation levels were detected in tumor specimens (Figure 5a). In addition, FBP1 expression levels were negatively correlated with TERT S227 phosphorylation levels in ccRCC and HCC specimens (Figure 5b). Notably, patients with higher TERT S227 phosphorylation levels in tumors had shorter survival than patients with lower phosphorylation levels (Figure 5c). These results support the role of FBP1 -regulated TERT dephosphorylation in human ccRCC clinical settings and reveal the relationship between FBP1 expression, TERT S227 phosphorylation levels, and clinical aggressiveness of ccRCC. Example 5 FBP1 mRNA LNP Delivery Effectively Inhibits Tumor Growth Delivery of messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNPs) as carriers has become a novel therapeutic approach for preventing and treating various diseases. To test the therapeutic potential of FBP1, the present invention designed ionizable cationic lipids and encapsulated FBP1 mRNA (Figure 7a). Intravenous injection of LNPs into mice did not cause obvious side effects, as reflected in H&E staining of heart, liver, spleen, lung, and kidney tissues (Figure 7b) and functional test results of liver, heart, and kidney (Figures 7c -h). Injection of [U-13Ce]-glucose into the tail vein of mice showed that LNP-FBP1 mRNA delivery significantly inhibited glycolytic flux in tumor tissues (Figure 7i) and moderately reduced glycolysis in the liver (Figure 7j), but did not reduce it in the kidney (Figure 7k). As expected, LNP-WT FBP1 treatment significantly inhibited growth of 786-O cell-derived tumors, accompanied by reduced tumor volume (Figure 8a) and weight (Figure 8b). In addition, expression of WT FBP1, but not FBP1 C129S or FBP1 N273A, reduced TERT S227 phosphorylation levels (Figure 8c). Compared with expression of FBP1 mutants, WT FBP1 -LNPs significantly reduced Ki67 expression (Figure 8c). Similarly, LNP-WT FBP1 treatment, but not LNP-FBP1 C129S or LNP-FBP1 N273A, significantly alleviated Huh7 cell-derived tumor growth (Figures 6a-b) and prolonged mouse survival (Figure 6c). Figure 6d shows the relationship between FBP1 and TERT S227 phosphorylation in normal cell nuclei, ccRCC cell nuclei, and HCC cell nuclei, and the cellular processes mediated thereby. These results indicate that LNP-mediated WT FBP1 mRNA delivery effectively inhibits tumor growth, providing a promising therapeutic strategy for treatment of ccRCC and HCC patients. Example 6 In this example, the present invention investigated the therapeutic effects of lipid nanoparticle-mediated delivery of FBP1 mRNA, PTEN mRNA, and FBW7 mRNA alone and in combination in mouse animal models, as well as the therapeutic effects of lipid nanoparticle-mediated delivery of siRNA targeting KRAS G12C / G12D mutations, BRAF V600E mutation, EGFR L858R mutation, L861Q, G719X, S768I, and p110a E542K, E545K, H1047R mutations in mouse-related disease models. 6.1 Experimental Methods Various cancer cell lines were used to construct subcutaneous tumor-bearing models (cell-derived xenograft, CDX) in 6-week-old male nude mice. Three days after injection of 2*106 cells / 100 pl, tail vein injection of lipid nanoparticles (liposome nanoparticle, LNP) containing FBP1 mRNA or FBP1 mRNA plus PTEN mRNA, FBW7 mRNA, VHL mRNA, p53 mRNA, or RB1 mRNA was started. mRNA was synthesized by in vitro transcription, capped and tailed, and modified with UTR pseudouridine and m5C; injections were performed every 2 days, and mouse tumor growth curves were observed and recorded. siRNA sequences targeting KRAS G12C / G12D mutation, BRAF V600E mutation, EGFR L858R mutation, and p110a E542K, E545K, H1047R mutations were designed and chemically modified with methylation and cholesterol to enhance their stability. Breast cancer cell line MCF7 (p110a E545K mutation), breast cancer cell line T-47D (p110a H1047R mutation), breast cancer cell line MCF10A with knock-in mutation (p110a E542K mutation), lung cancer cell line H358 (KRAS G12C mutation), pancreatic cancer cell line MIAPACA-2 (KRAS G12D mutation), melanoma cell A375 (BRAF V600E mutation), lung cancer cell line H3255 (EGFR L858R), and lung cancer cell line A549 with knock-in 5 mutations (EGFR L861Q, G719X, S768I) were used to construct subcutaneous tumor-bearing models. Three days after injection of 2*106 cells / 100 pl, tail vein injection of LNP containing FBP1 mRNA or FBP1 mRNA plus one of the above siRNAs was started, injections were performed every 2 days, and mouse tumor growth curves were observed and recorded. 10       The nucleic acid sequences used in this example are shown in Table 2 below. Table 2 SEQ ID NO: Sequence FBP1 mRNA 5 atggctgaccaggcgcccttcgacacggacgtcaacaccctgacccgcttcgtcatggaggagggcaggaa ggcccgcggcacgggcgagttgacccagctgctcaactcgctctgcacagcagtcaaagccatctcttcggc ggtgcgcaaggcgggcatcgcgcacctctatggcattgctggttctaccaacgtgacaggtgatcaagttaag aagctggacgtcctctccaacgacctggttatgaacatgttaaagtcatcctttgccacgtgtgttctcgtgtcag aagaagataaacacgccatcatagtggaaccggagaaaaggggtaaatatgtggtctgttttgatccccttgat ggatcttccaacatcgattgccttgtgtccgttggaaccatttttggcatctatagaaagaaatcaactgatgagc cttctgagaaggatgctctgcaaccaggccggaacctggtggcagccggctacgcactgtatggcagtgcca ccatgctggtccttgccatggactgtggggtcaactgcttcatgctggacccggccatcggggagttcattttgg tggacaaggatgtgaagataaaaaagaaaggtaaaatctacagccttaacgagggctacgccagggactttg accctgccgtcactgagtacatccagaggaagaagttccccccagataattcagctccttatggggcccggtat gtgggctccatggtggctgatgttcatcgcactctggtctacggagggatatttctgtaccccgctaacaagaag agccccaatggaaagctgagactgctgtacgaatgcaaccccatggcctacgtcatggagaaggctggggg aatggccaccactgggaaggaggccgtgttagacgtcattcccacagacattcaccagagggcgccggtgat cttgggatcccccgacgacgtgctcgagttcctgaaggtgtatgagaagcactctgcccagtga PTEN mRNA 6 atgacagccatcatcaaagagatcgttagcagaaacaaaaggagatatcaagaggatggattcgacttagact tgacctatatttatccaaacattattgctatgggatttcctgcagaaagacttgaaggcgtatacaggaacaatatt gatgatgtagtaaggtttttggattcaaagcataaaaaccattacaagatatacaatctttgtgctgaaagacatta tgacaccgccaaatttaattgcagagttgcacaatatccttttgaagaccataacccaccacagctagaacttatc aaacccttttgtgaagatcttgaccaatggctaagtgaagatgacaatcatgttgcagcaattcactgtaaagctg gaaagggacgaactggtgtaatgatatgtgcatatttattacatcggggcaaatttttaaaggcacaagaggcc ctagatttctatggggaagtaaggaccagagacaaaaagggagtaactattcccagtcagaggcgctatgtgt attattatagctacctgttaaagaatcatctggattatagaccagtggcactgttgtttcacaagatgatgtttgaaa ctattccaatgttcagtggcggaacttgcaatcctcagtttgtggtctgccagctaaaggtgaagatatattcctcc aattcaggacccacacgacgggaagacaagttcatgtactttgagttccctcagccgttacctgtgtgtggtgat atcaaagtagagttcttccacaaacagaacaagatgctaaaaaaggacaaaatgtttcacttttgggtaaataca ttcttcataccaggaccagaggaaacctcagaaaaagtagaaaatggaagtctatgtgatcaagaaatcgatag catttgcagtatagagcgtgcagataatgacaaggaatatctagtacttactttaacaaaaaatgatcttgacaaa gcaaataaagacaaagccaaccgatacttttctccaaattttaaggtgaagctgtacttcacaaaaacagtagag gagccgtcaaatccagaggctagcagttcaacttctgtaacaccagatgttagtgacaatgaacctgatcattat agatattctgacaccactgactctgatccagagaatgaaccttttgatgaagatcagcatacacaaattacaaaa gtctga FBW7 mRNA 7 atgaatcaggaactgctctctgtgggcagcaaaagacgacgaactggaggctctctgagaggtaacccttcct caagccaggtagatgaagaacagatgaatcgtgtggtagaggaggaacagcaacagcaactcagacaacaa gaggaggagcacactgcaaggaatggtgaagttgttggagtagaacctagacctggaggccaaaatgattcc cagcaaggacagttggaagaaaacaataatagatttatttcggtagatgaggactcctcaggaaaccaagaag aacaagaggaagatgaagaacatgctggtgaacaagatgaggaggatgaggaggaggaggagatggacc aggagagtgacgattttgatcagtctgatgatagtagcagagaagatgaacatacacatactaacagtgtcacg aactccagtagtattgtggacctgcccgttcaccaactctcctccccattctatacaaaaacaacaaaaatgaaa agaaagttggaccatggttctgaggtccgctctttttctttgggaaagaaaccatgcaaagtctcagaatatacaa gtaccactgggcttgtaccatgttcagcaacaccaacaacttttggggacctcagagcagccaatggccaagg gcaacaacgacgccgaattacatctgtccagccacctacaggcctccaggaatggctaaaaatgtttcagagc tggagtggaccagagaaattgcttgctttagatgaactcattgatagttgtgaaccaacacaagtaaaacatatg atgcaagtgatagaaccccagtttcaacgagacttcatttcattgctccctaaagagttggcactctatgtgctttc attcctggaacccaaagacctgctacaagcagctcagacatgtcgctactggagaattttggctgaagacaacc ttctctggagagagaaatgcaaagaagaggggattgatgaaccattgcacatcaagagaagaaaagtaataa aaccaggtttcatacacagtccatggaaaagtgcatacatcagacagcacagaattgatactaactggaggcg aggagaactcaaatctcctaaggtgctgaaaggacatgatgatcatgtgatcacatgcttacagttttgtggtaa ccgaatagttagtggttctgatgacaacactttaaaagtttggtcagcagtcacaggcaaatgtctgagaacatta gtgggacatacaggtggagtatggtcatcacaaatgagagacaacatcatcattagtggatctacagatcgga cactcaaagtgtggaatgcagagactggagaatgtatacacaccttatatgggcatacttccactgtgcgttgta tgcatcttcatgaaaaaagagttgttagcggttctcgagatgccactcttagggtttgggatattgagacaggcc agtgtttacatgttttgatgggtcatgttgcagcagtccgctgtgttcaatatgatggcaggagggttgttagtgga gcatatgattttatggtaaaggtgtgggatccagagactgaaacctgtctacacacgttgcaggggcatactaat agagtctattcattacagtttgatggtatccatgtggtgagtggatctcttgatacatcaatccgtgtttgggatgtg gagacagggaattgcattcacacgttaacagggcaccagtcgttaacaagtggaatggaactcaaagacaata ttcttgtctctgggaatgcagattctacagttaaaatctgggatatcaaaacaggacagtgtttacaaacattgca aggtcccaacaagcatcagagtgctgtgacctgtttacagttcaacaagaactttgtaattaccagctcagatga tggaactgtaaaactatgggacttgaaaacgggtgaatttattcgaaacctagtcacattggagagtgggggga gtgggggagttgtgtggcggatcagagcctcaaacacaaagctggtgtgtgcagttgggagtcggaatggga ctgaagaaaccaagctgctggtgctggactttgatgtggacatgaagtga p53 mRNA 8 atggaggagccgcagtcagatcctagcgtcgagccccctctgagtcaggaaacattttcagacctatggaaac tacttcctgaaaacaacgttctgtcccccttgccgtcccaagcaatggatgatttgatgctgtccccggacgatat tgaacaatggttcactgaagacccaggtccagatgaagctcccagaatgccagaggctgctccccccgtggc ccctgcaccagcagctcctacaccggcggcccctgcaccagccccctcctggcccctgtcatcttctgtccctt cccagaaaacctaccagggcagctacggtttccgtctgggcttcttgcattctgggacagccaagtctgtgactt gcacgtactcccctgccctcaacaagatgttttgccaactggccaagacctgccctgtgcagctgtgggttgatt ccacacccccgcccggcacccgcgtccgcgccatggccatctacaagcagtcacagcacatgacggaggtt gtgaggcgctgcccccaccatgagcgctgctcagatagcgatggtctggcccctcctcagcatcttatccgag tggaaggaaatttgcgtgtggagtatttggatgacagaaacacttttcgacatagtgtggtggtgccctatgagc cgcctgaggttggctctgactgtaccaccatccactacaactacatgtgtaacagttcctgcatgggcggcatg aaccggaggcccatcctcaccatcatcacactggaagactccagtggtaatctactgggacggaacagctttg aggtgcgtgtttgtgcctgtcctgggagagaccggcgcacagaggaagagaatctccgcaagaaaggggag cctcaccacgagctgcccccagggagcactaagcgagcactgcccaacaacaccagctcctctccccagcc aaagaagaaaccactggatggagaatatttcacccttcagatccgtgggcgtgagcgcttcgagatgttccga gagctgaatgaggccttggaactcaaggatgcccaggctgggaaggagccaggggggagcagggctcact ccagccacctgaagtccaaaaagggtcagtctacctcccgccataaaaaactcatgttcaagacagaagggc ctgactcagactga VHL mRNA 9 atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagta cggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccgg aggaactgggcgccgaggaggagatggaggccgggcggccgcggcccgtgctgcgctcggtgaactcgc gcgagccctcccaggtcatcttctgcaatcgcagtccgcgcgtcgtgctgcccgtatggctcaacttcgacgg cgagccgcagccctacccaacgctgccgcctggcacgggccgccgcatccacagctaccgaggtcaccttt ggctcttcagagatgcagggacacacgatgggcttctggttaaccaaactgaattatttgtgccatctctcaatgt tgacggacagcctatttttgccaatatcacactgccagtgtatactctgaaagagcgatgcctccaggttgtccg gagcctagtcaagcctgagaattacaggagactggacatcgtcaggtcgctctacgaagatctggaagacca cccaaatgtgcagaaagacctggagcggctgacacaggagcgcattgcacatcaacggatgggagattga RB1 mRNA 10 atgccgcccaaaaccccccgaaaaacggccgccaccgccgccgctgccgccgcggaacccccggcaccg ccgccgccgccccctcctgaggaggacccagagcaggacagcggcccggaggacctgcctctcgtcaggc ttgagtttgaagaaacagaagaacctgattttactgcattatgtcagaaattaaagataccagatcatgtcagaga gagagcttggttaacttgggagaaagtttcatctgtggatggagtattgggaggttatattcaaaagaaaaagga actgtggggaatctgtatctttattgcagcagttgacctagatgagatgtcgttcacttttactgagctacagaaaa acatagaaatcagtgtccataaattctttaacttactaaaagaaattgataccagtaccaaagttgataatgctatg tcaagactgttgaagaagtatgatgtattgtttgcactcttcagcaaattggaaaggacatgtgaacttatatatttg acacaacccagcagttcgatatctactgaaataaattctgcattggtgctaaaagtttcttggatcacatttttatta gctaaaggggaagtattacaaatggaagatgatctggtgatttcatttcagttaatgctatgtgtccttgactatttt attaaactctcacctcccatgttgctcaaagaaccatataaaacagctgttatacccattaatggttcacctcgaac acccaggcgaggtcagaacaggagtgcacggatagcaaaacaactagaaaatgatacaagaattattgaagt tctctgtaaagaacatgaatgtaatatagatgaggtgaaaaatgtttatttcaaaaattttataccttttatgaattctc ttggacttgtaacatctaatggacttccagaggttgaaaatctttctaaacgatacgaagaaatttatcttaaaaata aagatctagatgcaagattatttttggatcatgataaaactcttcagactgattctatagacagttttgaaacacag agaacaccacgaaaaagtaaccttgatgaagaggtgaatgtaattcctccacacactccagttaggactgttat gaacactatccaacaattaatgatgattttaaattcagcaagtgatcaaccttcagaaaatctgatttcctattttaa caactgcacagtgaatccaaaagaaagtatactgaaaagagtgaaggatataggatacatctttaaagagaaat ttgctaaagctgtgggacagggttgtgtcgaaattggatcacagcgatacaaacttggagttcgcttgtattacc gagtaatggaatccatgcttaaatcagaagaagaacgattatccattcaaaattttagcaaacttctgaatgacaa catttttcatatgtctttattggcgtgcgctcttgaggttgtaatggccacatatagcagaagtacatctcagaatct tgattctggaacagatttgtctttcccatggattctgaatgtgcttaatttaaaagcctttgatttttacaaagtgatcg aaagttttatcaaagcagaaggcaacttgacaagagaaatgataaaacatttagaacgatgtgaacatcgaatc atggaatcccttgcatggctctcagattcacctttatttgatcttattaaacaatcaaaggaccgagaaggaccaa ctgatcaccttgaatctgcttgtcctcttaatcttcctctccagaataatcacactgcagcagatatgtatctttctcc tgtaagatctccaaagaaaaaaggttcaactacgcgtgtaaattctactgcaaatgcagagacacaagcaacct cagccttccagacccagaagccattgaaatctacctctctttcactgttttataaaaaagtgtatcggctagcctat ctccggctaaatacactttgtgaacgccttctgtctgagcacccagaattagaacatatcatctggacccttttcc agcacaccctgcagaatgagtatgaactcatgagagacaggcatttggaccaaattatgatgtgttccatgtatg gcatatgcaaagtgaagaatatagaccttaaattcaaaatcattgtaacagcatacaaggatcttcctcatgctgt tcaggagacattcaaacgtgttttgatcaaagaagaggagtatgattctattatagtattctataactcggtcttcat gcagagactgaaaacaaatattttgcagtatgcttccaccaggccccctaccttgtcaccaatacctcacattcct cgaagcccttacaagtttcctagttcacccttacggattcctggagggaacatctatatttcacccctgaagagtc catataaaatttcagaaggtctgccaacaccaacaaaaatgactccaagatcaagaatcttagtatcaattggtg aatcattcgggacttctgagaagttccagaaaataaatcagatggtatgtaacagcgaccgtgtgctcaaaaga agtgctgaaggaagcaaccctcctaaaccactgaaaaaactacgctttgatattgaaggatcagatgaagcag atggaagtaaacatctcccaggagagtccaaatttcagcagaaactggcagaaatgacttctactcgaacacg aatgcaaaagcagaaaatgaatgatagcatggatacctcaaacaaggaagagaaatga siKRAS G12C 11 GAGCTTGTGGCGTAGGCAA 12 GCTTGTGGCGTAGGCAAGA 13 GTTGGAGCTTGTGGCGTAG siKRAS G12D 14 GAGCTGATGGCGTAGGCAA 15 GCTGATGGCGTAGGCAAGA 16 GGAGCTGATGGCGTAGGCA sipllOa E542K 17 CGAGATCCTCTCTCTAAAA 18 GATCCTCTCTCTAAAATCA 19 CTCTCTCTAAAATCACTGA sipllOa E545K 20 TCTCTGAAATCACTAAGCA 21 TCACTAAGCAGGAGAAAGA 22 CACTAAGCAGGAGAAAGAT sipllOa H1047R 23 GCAAGACATGGTGGCTGGA 24 GATGCAAGACATGGTGGCT 25 GAATGATGCAAGACATGGT siBRAF V600E 26 AGCTACAGTGAAATCTCGA 27 TGGTCTAGCTACAGTGAAA 28 TAGCTACAGTGAAATCTCG siEGFR L858R 29 GATTTTGGGCTGGCCAAAC 30 ATCACAGATTTTGGGCTGG 31 TTGGGCTGGCCAAACTGCT siEGFR L861Q 32 TGGCCAAACTGCTGGGTGC 33 GGCTGGCCAAACTGCTGGG 34 CAAACTGCTGGGTGCGGAA siEGFR G719X 35 AAGTGCTGGGCTCCGGTGC 36 AGATCAAAGTGCTGGGCTC 37 TGCTGGGCTCCGGTGCGTT siEGFR 38 TGATGGCCAGCGTGGACAA S768I 39 CCTACGTGATGGCCAGCGT 40 GCCAGCGTGGACAACCCCC 6.2 Experimental Results 6.2.1 LNP Delivery of mRNA A subcutaneous tumor-bearing model was constructed using the liver cancer cell line Huh7. As shown in Figure 9, LNP delivery of FBP1 mRNA or PTEN mRNA significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. The results in Figure 10 show that LNP delivery of FBP1 mRNA or FBW7 mRNA significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. The results in Figure 11 show that LNP delivery of FBP1 mRNA or VHL mRNA significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. The results in Figure 12 show that LNP delivery of FBP1 mRNA or p53 mRNA significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. The results in Figure 13 show that LNP delivery of FBP1 mRNA or RB1 mRNA significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. In addition, the present invention also constructed subcutaneous tumor-bearing models using pancreatic cancer cell lines, lung cancer cell lines, and breast cancer cell lines, and similar results and consistent conclusions were obtained. 6.2.2 LNP Delivery of FBP1 mRNA and siRNA A subcutaneous tumor-bearing mouse model was constructed using the lung cancer H358 cell line. As shown in Figure 14, LNP delivery of FBP1 mRNA or siKRAS G12C significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. A subcutaneous tumor-bearing mouse model was constructed using the pancreatic cancer MIAPACA-2 cell line. As shown in Figure 15, LNP delivery of FBP1 mRNA or siKRAS G12D significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. Mouse subcutaneous tumor-bearing models were constructed using the breast cancer cell line MCF7 (p110a E545K mutation), the breast cancer cell line T -47D (p110a H1047R mutation), and the breast cancer cell line MCF10A with a knock-in mutation (p110a E542K mutation). As shown in Figure 16, LNP delivery of FBP1 mRNA or sip110a E542K, sip110a E545K, or sip110a H1047R alone significantly inhibited tumor growth, and the combination of FBP1 mRNA with the mutant siRNA further inhibited tumor growth. A subcutaneous tumor-bearing model was constructed using the melanoma cell A375 (BRAF V600E mutation). As shown in Figure 17, LNP delivery of FBP1 mRNA or siBRAF V600E significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. A subcutaneous tumor-bearing model was constructed using the lung cancer cell line H3255 (EGFR L858R). As shown in Figure 18, LNP delivery of FBP1 mRNA or siEGFR L858R significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. A subcutaneous tumor-bearing model was constructed using the lung cancer cell line A549 with knock-in mutations (EGFR L861Q, G719X, S768I). As shown in Figure 19, LNP delivery of FBP1 mRNA or siEGFR L861Q, G719X, or S768I significantly inhibited tumor growth, and the combination of the two further inhibited tumor growth. Discussion Telomere dysfunction promotes the development of cancer. The present invention demonstrates herein a previously unknown mechanism in which TERT is regulated by the metabolic enzyme FBP1. FBP1 directly interacts with TERT. Structural and mutational analyses identified the hydrophobic N273 of FBP1 as being involved in binding to TERT. Importantly, FBP1 acts as a protein phosphatase and dephosphorylates S227 of TERT in a manner dependent on FBP1 C129 but not on the metabolic activity of FBP1. Molecular dynamics simulation analysis showed that phosphorylated TERT S227 is in close proximity to the catalytic domain of FBP1, forming a binding pocket with C129 of FBP1, which pocket is formed with R244 and D128 of FBP1. C129 of FBP1 in its reduced state generates a covalent phosphorylated-C129 intermediate, indicating that the phosphate group of TERT pS227 is transferred to FBP1 C129, followed by release of dephosphorylated TERT, before hydrolysis of the C129 thioether phosphate intermediate and after release of phosphate. Dephosphorylated TERT cannot be transported into the nucleus, resulting in inhibited telomerase activity, reduced telomere length, inhibited tumor cell proliferation, and senescence, without involvement of ALT. Although FBP1 C129S or FBP1 N273A does not alter the metabolic activity of FBP1, it largely loses efficacy in inhibiting tumor growth, accompanied by increased TERT S227 phosphorylation levels, telomere length, and Ki67 expression, and reduced formation of anaphase bridges responsible for promoting tumor cell proliferation. The residual tumor-inhibiting effects of these mutants may be attributed to other protein phosphatase activity-related or unrelated functions of FBP1, comprising its regulation of iKBa and AKT. The human genome has at least 539 protein kinases for protein phosphorylation, but only 189 identified protein phosphatases for dephosphorylation, suggesting that protein phosphatases are less specific in substrate selection, and cells may utilize unknown and conventional mechanisms unrelated to protein phosphatases to dephosphorylate proteins. Among about 2,700 of the 25,000 human enzymes, 1,653 are metabolic enzymes, far exceeding the total number of protein kinases and phosphatases. Many previous studies have shown that metabolic enzymes can have additional functions and use proteins as their substrates. It is well known that conventional protein phosphatases use reduced cysteine in the catalytic domain to form a covalent phosphorylated-cysteine intermediate. This process is accompanied by rapid release of the dephosphorylated protein substrate. Consistently, the present invention demonstrates that C129 of FBP1 is in a reduced state and forms a covalent phosphorylated-C129 intermediate for dephosphorylation of TERT S227. Therefore, the additional activity of FBP1 has a similar structural basis and catalytic mechanism to conventional protein phosphatases in dephosphorylating protein substrates. The results of the present invention are consistent with other publications showing that metabolic enzymes can have multifaceted roles and regulate protein substrates through direct dephosphorylation and phosphorylation. Compared with normal cells, tumor cells utilize metabolic enzymes not only to serve the metabolic needs of the cells, but also to govern many metabolism-independent and instrumental cellular activities. It has been demonstrated that metabolic enzymes, such as hexokinase 2  (HK2), phosphoenolpyruvate carboxykinase 1  (PCK1), choline kinase a2 (CHKa2), 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase        3        (PFKFB3), phosphoglycerate kinase 1 (PGK1), ketohexokinase (KHK) isoform A (KHK-A), and pyruvate kinase M2 (PKM2), can act as protein kinases to phosphorylate a variety of protein substrates, thereby promoting tumor growth. In the current report, the present invention reports that FBP1, originally described as a gluconeogenic enzyme, is found to be a true protein phosphatase that dephosphorylates TERT by directly regulating cell division independent of the classical metabolic function of FBP1. Considering that downregulation or deficiency of FBP1 frequently occurs in ccRCC, HCC, and many other types of cancer, and is generally associated with advanced tumor stage, highly malignant phenotype, and worse prognosis of cancer patients, the findings of the present invention provide key insights into the selective advantage of unlimited proliferation of tumor cells, which is due to the loss of FBP1-mediated telomerase inhibition. Therefore, these findings reveal that FBP1 protein phosphatase activity differentially regulates TERT activity in tumors and normal cells through a previously unknown and critical mechanism. The present invention found the correlation between reduced FBP1 expression and increased TERT S227 phosphorylation levels and shortened survival time of ccRCC and HCC patients, as well as the effect of effectively inhibiting tumor growth by LNP-based FBP1 mRNA delivery, highlighting the potential of treating human cancers by regulating FBP1 protein phosphatase activity and expression. The studies of the present invention demonstrate that FBP1 interacts with TERT through its hydrophobic residue N273. FBP1 acts as a protein phosphatase and dephosphorylates S227  (pS227) of TERT, thereby inhibiting nuclear translocation and telomerase activity of TERT, reducing telomere length, and inhibiting tumor cell proliferation and promoting tumor cell senescence. Expression of an FBP1 protein phosphatase activity-deficient mutant promoted mouse tumor growth, accompanied by increased TERT S227 phosphorylation levels and telomere length. In addition, the present invention also demonstrates that LNP-mediated FBP1 mRNA delivery significantly inhibits tumor growth in liver cancer, kidney cancer, lung cancer, pancreatic cancer, breast cancer, melanoma, and other tumors. At the 5 same time, the siRNAs designed in the present invention against oncogenic mutations present in patients (which do not target the corresponding wild-type proteins) also have good therapeutic effects, and combined delivery with FBP1 mRNA exhibits a synergistic effect, which can better inhibit tumor growth. These results in animal models provide new ideas and references for clinical precision 10 therapy and targeted therapy. All documents mentioned in the present invention are incorporated by reference in this application, as if each document were individually incorporated by reference. In addition, it should be understood that after reading the above teaching 15 content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

1. Use of an FBP1 protein, an mRNA encoding FBP1, or an expression vector comprising a nucleic acid encoding FBP1 in the preparation of a formulation or composition for:(a) dephosphorylating TERT S227; and / or(b) treating a tumor having TERT S227 hyperphosphorylation.

2. The use of claim 1, wherein the formulation or composition is used for:(i) reducing nuclear transport of TERT;(ii) reducing telomerase activity;(iii) reducing telomerase length;(iv) promoting tumor cell senescence;(v) inhibiting tumor cell growth.

3. A pharmaceutical composition, wherein the pharmaceutical composition comprises:(a) an FBP1 protein, an mRNA encoding FBP1, or an expression vector comprising a nucleic acid encoding FBP1 ; and(b) a pharmaceutically acceptable carrier.

4. The pharmaceutical composition of claim 3, wherein the pharmaceutical composition further comprises:(a2) mRNA selected from the group consisting of PTEN mRNA, FBW7 mRNA, p53 mRNA, VHL mRNA, RB1 mRNA, and combinations thereof; and / or(a3) siRNA selected from the group consisting of siKRAS G12C, siKRAS G12D, sipllOa E542K, sipllOa E545K, sipllOa H1047R, siBRAF V600E, siEGFR L858R, siEGFR L861Q, siEGFR G719X, siEGFR S768I, and combinations thereof;wherein the mRNA is mRNA selected from the group consisting of wild-type mRNA, mRNA variants, sequence-modified mRNA, and combinations thereof; and the siRNA is selected from the group consisting of siRNA sequences designed against the mutations, variants thereof, sequence-modified versions of the siRNA sequences, and combinations thereof.

5. A reagent combination, wherein the reagent combination comprises:(a) an FBP1 protein, an mRNA encoding FBP1, or an expression vector comprising a nucleic acid encoding FBP1 ; and(b) a detection reagent for detecting TERT S227 phosphorylation.

6. Use of the pharmaceutical composition of claim 3, wherein it is used for preparing a medicament, wherein the medicament is used for preventing and / or treating cancer or a tumor.

7. The use of claim 6, wherein the cancer or tumor is a cancer or tumor having TERT S227 hyperphosphorylation and / or low FBP1 expression.

8. The use of claim 6, wherein the cancer or tumor comprises: oral cancer, oropharyngeal cancer, nasopharyngeal cancer, respiratory system cancer, urogenital system cancer, gastrointestinal cancer, central or peripheral nervous system tissue cancer, endocrine or neuroendocrine system cancer or hematopoietic system cancer, glioma, sarcoma, epithelial cancer, lymphoma, melanoma, fibroma, meningioma, brain cancer, kidney cancer, biliary tract system cancer, pheochromocytoma, islet cell carcinoma, Li-Fraumeni tumor, thyroid cancer, parathyroid cancer, pituitary tumor, adrenal tumor, osteogenic sarcoma tumor, neuroendocrine system tumor, breast cancer, lung cancer, head and neck cancer, prostate cancer, esophageal cancer, tracheal cancer, liver cancer, bladder cancer, gastric cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer, or skin cancer.

9. A kit, comprising the reagent combination of claim 5.

10. An in vitro dephosphorylation method, comprising:(s1) contacting a phosphorylated TERT S227 protein with an FBP1 protein, thereby dephosphorylating TERT S227.

Images