Polypeptide oligonucleotide conjugate for inhibiting expression of target gene in central nervous system and use thereof

Abstract

The present invention relates to a polypeptide oligonucleotide conjugate having a structure as shown in the following formula (I) or (II), or a pharmaceutically acceptable salt thereof or a stereoisomer thereof, and the use thereof. The polypeptide oligonucleotide conjugate of the present invention can be used for inhibiting the expression of one or more target genes in a tissue cell of the central nervous system, and has the advantages of having a good in-vivo effect, a long action time and good isafety.

Description

In some embodiments, the unmodified amino acid sequence of the peptide ligand is TFFYGGCRGKRNNFKTEEY, wherein the LA in P-LA is linked to the amino acid residue (i.e., lysine) at position 10 from the N-terminus of the peptide ligand. In some embodiments, the LA in P-LA is linked to the norleucine residue in the peptide ligand. In some embodiments, the unmodified amino acid sequence of the peptide ligand is TFFYGGSRGZRNNFKTEEY, wherein the LA in P-LA is linked to the amino acid residue (i.e., norleucine) at position 10 from the N-terminus of the peptide ligand. In some embodiments, the LA in P-LA is linked to an amino acid residue containing a side-chain carboxyl group in the peptide ligand. In some embodiments, the LA in P-LA is linked to a glutamic acid residue or an aspartic acid residue in the peptide ligand. In some embodiments, LE is selected from the following structures: 100002 RO’ -I-N H OR RO’ RO RO OR hN RO OR OR OR each R is independently selected from: H or a hydroxyl-protecting group; each n2 is independently selected from an integer from 0 to 10. 5 In some embodiments, LE is selected from: RO OR OR RO’ OR In some embodiments, LA is selected from the following structures: 100002 N"' N O ' H .-H , N N' O NH2        / H O 1-N 5 H nh2 O • In some embodiments, the LB in formula (I) is selected from the following structures: H              O -A O                     1 LB-1 O N H LB-1-1 LB-1-2 LB-2 N LB-2-1 O O 100002 O O X O X j LB-3 O X N i       H O O X O O X N H O M H             O xIV^W^ i       jO                           i       1 LB-4 wherein i, j, h, q, s and e are each independently selected from: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; c is selected from: 0, and 1; X is selected from: O, S, and CH2; Y is absent or selected from: C=O, and CH2. In some embodiments, the LB in formula (I) is selected from the following structures: 10 O O X O X^^X^jf i j H                          J O 100002 O O X X O N-^ H \_ X O N H N H i J”' J ' O O 100002 o i, j and e are each independently selected from: 0, 1, 2, 3, and 4; c is selected from: 0, and 1; k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; X is selected from: CH2, and O. In some embodiments, the LB in formula (I) is selected from the following structures: O                O 10 100002 O NH O 2 O O O O O O 5 O O      O N 8    H 100002 o o In some embodiments, the LB in formula (II) has the structure shown below: 0 L^ X  , n 5 wherein X is selected from: O, S, and CH2; L is selected from the following structures: VYB / X     H ' / Y  h  N O 0                   H           0 ................>'%......'Y......Y'l ...............B-9'1 0                         1 J ..... HNx  H                0 LB-5 0                              0 NNN 1     J 0                NH -B -y- T 0                          1        J 100002 O                   O X xVn 1     j NH / Y   tl  H      'X     ^X       O O                         1        j O X N i      H o O O O X wherein i, j, h, q, s, f and e are each independently selected from: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; c is selected from: 0, and 1; X is selected from: O, S, and CH2; Y is absent or selected from: C=O, and CH2. In some embodiments, the LB in formula (II) has the structure shown below: O O X NH N H N H O , X is selected from: O, and CH2. 10 In some embodiments, L is selected from the following structures: 100002 5 H N N H N H O X O N-4J H \. O H N O O i and e are each independently selected from: 0, 1, 2, 3, and 4; k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; X is selected from: CH2, and O. In some embodiments, L is selected from the following structures: O 100002 100002 O N H N H O N 2 H O     O Aj-pk ,, 8     H O N H O       O In some embodiments, the LC in formula (II) has the structure shown below: or wherein i, j, h and e are each independently selected from: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; c is selected from: 0, and 1; X is selected from: O, S, and CH2; 10 Y is absent or selected from: C=O, and CH2. In some embodiments, the LC in formula (II) is selected from the following structures: 100002 i and j are each independently selected from: 0, 1, 2, 3, and 4; c is selected from: 0, and 1; X is selected from: CH2, and O. 5 In some embodiments, the LC in formula (II) is selected from the following structures: In some embodiments, the peptide-oligonucleotide conjugate is selected from the following compounds: HO 100002 100002 100002 100002 100002 100002 HO HO HO i, j and e are each independently selected from: 0, 1, 2, 3, and 4; c is selected from: 0, and 1; k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; 10 X is selected from: CH2, and O; each n1 is independently selected from: 0, 1, 2 and 3. In some embodiments, the oligonucleotide drug is selected from: small interfering RNAs (siRNAs), antisense oligonucleotides (ASOs), and peptide nucleic acids (PNAs). In some embodiments, the oligonucleotide drug is a small interfering RNA (siRNA), and LE is linked to the phosphate group or phosphorothioate group at the 3'- and / or 5'-terminus of the sense strand of 100002                                                   24 2010.2 the siRNA. The peptide-oligonucleotide conjugate described herein is prepared by a method comprising: subjecting an alkyne-containing linker-nucleic acid sense strand molecule and an azide-modified peptide to a click chemistry reaction to obtain a peptide-sense strand conjugate, and then annealing the peptide-sense strand conjugate and the corresponding nucleic acid antisense strand to obtain the peptide-oligonucleotide conjugate; the peptide is a peptide ligand for the LRP-1 receptor; the alkyne-containing linker-nucleic acid sense strand molecule has the structure of formula (III) or 10 formula (IV) below: (III) (IV) wherein ------------- is the sense strand of the oligonucleotide drug; LA, LB, LC, LE, n, a and b are as described above; 15 R3 is selected from: ethynyl, and H In some embodiments, the alkyne-containing linker-nucleic acid sense strand molecule is selected from the following structures: 100002 100002 100002 100002 wherein i, j and e are each independently selected from: 0, 1, 2, 3, and 4; 5 c is selected from: 0, and 1; k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; X is selected from: CH2, and O. In some embodiments, the alkyne-containing linker-nucleic acid sense strand molecule is selected from the following structures: 10 100002 □-P-0 100002 In some embodiments, the azide-modified peptide is selected from the following structures: L57(H20A;K19N3)                O L57(lle14Nle)-AZK L57(H20A;Leu15Nle)-AZK L57(lle14Nle)-AZK 100002 R-S' K—G N-R ,F—N ,1 K e-e ho-y , F-T / Y-F G-G O N^E^^MA^ H OH NH2 N3 Ang2(K10PEG2N3) N3 R-N-N-F-K-T-E-E-Y—OH H--T-F-F-Y-G-G-S-R-G-NH O Ang2(K10AZK) In a second aspect, the present invention provides the use of the peptide-oligonucleotide conjugate, comprising the following: Use of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof described herein, as an active ingredient in the preparation of a drug for inhibiting the expression of a target gene in the central nervous system. In some embodiments, the target gene in the central nervous system is selected from one or more of the following: APP, MC4R, ATXN2, C9orf72, TARDBP, MAPT, HTT, SNCA, FUS, ATXN3, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and NLRP3. Use of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof described herein, as an active ingredient in the preparation of a drug for treating a central nervous system (CNS) disease. In some embodiments, the target of the central nervous system (CNS) disease is selected from the following: APP, MC4R, ATXN2, C9orf72, TARDBP, MAPT, HTT, SNCA, FUS, ATXN3, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and NLRP3. In some embodiments, the central nervous system disease is selected from the following: Alzheimer's disease, cachexia, cerebral amyloid angiopathy, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, spinocerebellar ataxia, prion disease, and Lafora disease. 100002 In a third aspect, the present invention provides a drug for inhibiting the expression of a target gene in the central nervous system, prepared from an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient comprises the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof described herein. In a fourth aspect, the present invention provides a drug for treating a central nervous system disease, prepared from an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient comprises the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof described herein. In a fifth aspect, the present invention provides a method for inhibiting the expression of a target gene in the central nervous system, comprising: administering a safe and effective amount of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof described herein; or administering a safe and effective amount of the drug described herein for inhibiting the expression of the target gene in the central nervous system. In a sixth aspect, the present invention provides a method for treating a central nervous system disease, comprising: administering a safe and effective amount of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof described herein; or administering a safe and effective amount of a drug for treating a central nervous system disease. The present invention conjugates a peptide ligand of the LRP-1 receptor to an oligonucleotide drug via a linking group to obtain a peptide-oligonucleotide conjugate based on a novel LRP-1-targeting peptide. The conjugate can be used to deliver nucleic acid drugs such as small interfering RNAs (siRNAs) for the treatment of central nervous system (CNS) diseases, and to inhibit the expression of one or more target genes in CNS tissue cells, with favorable in vivo efficacy, long duration of action and high safety. DESCRIPTION OF EMBODIMENTS For ease of understanding of the present invention, the present invention will be described more fully below. The present invention may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided for a more thorough and complete understanding of the disclosure of the present invention. Experimental methods for which no specific conditions are indicated in the following embodiments are generally performed under conventional conditions, such as those described in the fourth edition 100002 of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook and published in 2013, or as recommended by manufacturers. The common chemical reagents used in the embodiments are all commercially available products. Experimental methods for which no specific conditions are indicated in the following embodiments are generally performed under conventional conditions or as recommended by manufacturers. The common chemical reagents used in the embodiments are all commercially available products. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the Description of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" as used herein encompasses any and all combinations of one or more of the related listed items. Furthermore, as used herein, the term “or” is used in an inclusive sense, meaning “and / or”, unless explicitly stated otherwise. The term “based on” is not exclusive and allows for being based on other factors not described, unless explicitly stated otherwise. Furthermore, throughout the Description, the terms “a,” “an,” and “the” include plural referents. The term “in” includes both “in” and “on”. The term "alkyl" as used herein includes branched and straight-chain saturated aliphatic hydrocarbon groups having a specific number of carbon atoms. For example, "C1-C6 alkyl" includes groups having 1, 2, 3, 4, 5 or 6 carbon atoms in a straight-chain or branched arrangement. For example, "C1-C6 alkyl" specifically includes methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, pentyl and hexyl. "Alkylene" has one less hydrogen atom than the corresponding "alkyl". The term “cycloalkyl” as used herein refers to a saturated or partially unsaturated monocyclic, bicyclic, or polycyclic hydrocarbon group in which ring atoms are carbon atoms; bicyclic or polycyclic rings include spiro, fused, and bridged rings. For example, “cycloalkyl” includes, but is not limited to, the following groups: cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like. The term “heterocycloalkyl” or “heterocyclyl” as used herein refers to a saturated or partially unsaturated monocyclic, bicyclic, or polycyclic substituent (including spiro, bridged, condensed and fused rings), in which one or more ring atoms are heteroatoms selected from N, O, or S(O)m (wherein m is an integer from 0 to 2) and the remaining ring atoms are carbon; bicyclic or polycyclic rings include spiro, fused, and bridged rings. For example: morpholinyl, piperidinyl, tetrahydropyrrolyl, pyrrolidinyl, dihydroimidazolyl, dihydroisoxazolyl, dihydroisothiazolyl, dihydrooxadiazolyl, 100002                                                   34 dihydrooxazolyl, dihydropyrazinyl, dihydropyrazolyl, dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dihydrotetrazolyl, dihydrothiadiazolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, tetrahydrofuranyl, tetrahydrothienyl, and the like, and their N-oxides. The attachment of a heterocyclic substituent can be achieved via a carbon atom or via a heteroatom. The drug or method provided herein for inhibiting the expression of a target gene in the central nervous system and the drug or method provided herein for treating a central nervous system disease comprises (administering to a patient or subject) an active ingredient (i.e., the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof as described herein) within a safe and effective dosage range, together with a pharmaceutically acceptable excipient. When administering the drug, a safe and effective amount of the active ingredient is administered to a mammal (such as a human) in need of treatment, where the dosage administered is a pharmaceutically effective dosage. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health status, which are all within the skill range of skilled physicians. Among them, "safe and effective amount" means: the amount of active ingredient is sufficient to significantly improve the condition without causing serious side effects. "Pharmaceutically acceptable excipient" refers to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. “Compatibility” as used herein means that the components in a composition can be mixed with the active ingredient (the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof) of the present invention and with each other, without significantly reducing the efficacy of the active ingredient. The pharmaceutically acceptable excipient includes, but is not limited to, one or more of the following materials: at least one of solvents, vehicles, fillers, extenders, binders, humectants, disintegrants, release-retarding agents, absorption accelerators, adsorbents, diluents, solubilizers, emulsifiers, lubricants, wetting agents, suspending agents, flavoring agents, and fragrances. Examples of pharmaceutically acceptable excipients include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose and cellulose acetate), gelatin, talc, solid lubricants (such as stearic acid and magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil and olive oil), polyols (such as propylene glycol, glycerol, mannitol and sorbitol), emulsifiers (such as Tween®), wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, and pyrogen-free water. In the nucleic acid sequence expressions, the names, abbreviations and structures of the nucleotide monomers used are as follows: 100002                                                   35 A Adenosine-3'-phosphate C Cytidine-3'-phosphate G Guanosine-3'-phosphate U Uridine-3'-phosphate dA 2'-Deoxyadenosine-3'-phosphate dT 2'-Deoxythymidine-3'-phosphate dC 2'-Deoxycytidine-3'-phosphate dG 2'-Deoxyguanosine-3'-phosphate mA 2'-O-methyladenosine-3'-phosphate mC 2'-O-methylcytidine-3'-phosphate mG 2'-O-methylguanosine-3'-phosphate mU 2'-O-methyluridine-3'-phosphate fA 2'-Fluoroadenosine-3'-phosphate fC 2'-Fluorocytidine-3'-phosphate fG 2'-Fluoroguanosine-3'-phosphate fU 2'-Fluorouridine-3'-phosphate VPU 2'-O-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate VPU-S 2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate Invab Inverted abasic residue Ghd 2'-O-hexadecyluridine-3'-phosphate Uhd 2'-O-hexadecylguanosine-3'-phosphate * Phosphorothioate linkage The specific structures are as follows: 100002 100002 Based on existing technology, those skilled in the art will understand that the pharmaceutically 5 acceptable salt of the siRNA may be a sodium salt or a potassium salt, for example, the sodium salt of the siRNA is generated during purification. The present invention will be further described in detail below with reference to specific embodiments. Embodiment 1. Peptide Synthesis 10 Peptide synthesis was performed at a 0.2 mmol scale on a PurePep Chorus 4-channel peptide synthesizer by conventional solid-phase peptide synthesis methods, such as those described by Adam G et al. in Standard practices for Fmoc-based solid-phase peptide synthesis in the Nowick laboratory. The main steps were conducted under the following conditions: (1) Resin swelling: Fmoc-Tyr-Wang Resin and Rink-Amide-MBHA-Resin were swollen in N,N-dimethylformamide at room temperature 15 for 30 min; (2) Deprotection: The resin was treated with a solution of 20% piperidine in N,N-dimethylformamide at 50°C for 2 min; (3) Amino acid condensation: Fmoc amino acid (5 eq., resin = 1 eq.) was coupled using O-(6-chlorobenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium 100002 hexafluorophosphate (5 eq.) as the condensing agent and N,N-diisopropylethylamine (5 eq.) as the base at 50°C for 10 min; (4) N-terminal acetylation: 5% N-acetylimidazole was applied at room temperature for 1 h; (5) Cleavage from the resin with trifluoroacetic acid: After synthesis, the resin was treated with a cleavage reagent containing trifluoroacetic acid (trifluoroacetic acid / triisopropylsilane / water               =                95:2.5:2.5;                trifluoroacetic acid / triisopropylsilane / 1,2-ethanedithiol / water = 92.5:2.5:2.5:2.5) for over 2 h, then the resin was filtered off and the filtrate was collected; (6) Precipitation and purification: Pre-chilled anhydrous diethyl ether was added to the filtrate, the mixture was centrifuged to obtain a white precipitate, and the precipitate was washed 3 times with anhydrous diethyl ether and dried under reduced pressure at room temperature to give a crude peptide as an off-white powder. The crude peptide was dissolved in an acetonitrile / water system and purified by high-performance liquid chromatography (HPLC). For the peptide bearing a 6-azidohexanoyl modification on the lysine side chain, the synthesis process and conditions were essentially the same as described above, with the following differences: (1) Fmoc-Lys(Mtt)-OH was used instead of the conventional Fmoc-Lys(Boc)-OH amino acid raw material; (2) After solid-phase synthesis, the Mtt protecting group was selectively removed from the lysine side-chain amino group using a solution of 2% trifluoroacetic acid in dichloromethane, followed by reaction with 6-azidohexanoic acid under the conventional amino acid condensation conditions described above, and then the peptide was cleaved. Furthermore, for the peptide bearing 2-(2-(2-aminoethoxy)ethoxy)acetyl and 6-azidohexanoyl modifications on the lysine side chain, first, the Mtt protecting group was selectively removed from the lysine side-chain amino group using a solution of 2% trifluoroacetic acid in dichloromethane; then, the peptide was reacted with 2-(2-(2-aminoethoxy)ethoxy)acetic acid under the conventional amino acid condensation and Fmoc deprotection conditions described above; finally, the peptide was cleaved after reaction with 6-azidohexanoic acid. Embodiment 2. Synthesis of Peptide Ang2(K10N3) Wang resin Ang2(K10Mtt)-Wang Resin 2% TFA in DCM Ang2(K10NH2)-Wang Resin tBu HN-G-R-S-G-G-Y-F—F-T-Ac Pbf TFA cleavage Ang2(K10N3)-Wang Resin Ang2(K10N3) On the PurePep Chorus 4-channel peptide synthesizer, Ang2(K10Mtt)-Wang Resin was synthesized 100002 at a 0.2 mmol scale under the conditions described in Embodiment 1. To Ang2(K10Mtt)-Wang Resin, dichloromethane (20 mL) and trifluoroacetic acid (0.4 mL) were added, the mixture was shaken at room temperature for 15 min, and the resin was washed 3 times with dichloromethane to obtain Ang2(K10NH2)-Wang Resin. The Ang2(K10NH2)-Wang Resin was transferred into N,N-dimethylformamide (15 mL), and then 6-azido-hexanoic acid (157 mg, 1 mmol), O-(6-chlorobenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (414 mg, 1 mmol) and N,N-diisopropylethylamine (129 mg, 1 mmol) were added successively. The mixture was shaken at room temperature for 1 h, washed with N,N-dimethylformamide and dichloromethane, cleaved with trifluoroacetic acid at room temperature for 2 h, precipitated with diethyl ether, and purified by HPLC to obtain the target peptide Ang2(K10Ns) (150 mg, white powdery solid) (theoretical molecular weight: 2482.70, measured molecular weight: 1242.30 [M+2H]2+). Embodiment 3. Synthesis of Peptide Ang2-Ang2-AZK tBu tBu Boc Boc tBu O—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T—H Wang resin tBu Pbf Pbf Ang2-Wang resin TFA cleavage DMF: H2O = 1: 1 hoye.e BMPS DIPEA, DMF tBu tBu Boc Boc tBu o—Y-E-E-T-K-F-N-N-R K-G-R-S-G-G-Y-F-F-T tBu                   Pbf Pbf Wang resin Maleimido-Ang2-Wang resin OH—Y-E-E-T-K-F-N-N-R K-G-R-S-G-G-Y-F-F-T — Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T^O AZK-Ang2-Cys H2N" Maleimido-Ang2 O Nr ,k.g rs'G NH2 N- Ang2-Ang2-AZK On the PurePep Chorus 4-channel peptide synthesizer, Ang2-Wang resin was synthesized at a 0.2 mmol scale under the conditions described in Embodiment 1. The Ang2-Wang resin was mixed with N-succinimidyl 3-maleimidopropionate (1.5 eq.) and reacted for 1 h to give Maleimido-Ang2-Wang resin. The resin was cleaved with trifluoroacetic acid (trifluoroacetic acid / triisopropylsilane / water = 95:2.5:2.5), precipitated with diethyl ether and purified by HPLC to give Maleimido-Ang2. Maleimido-Ang2 (1 eq.) and AZK-Ang-Cys (1.1 eq.) were dissolved in a mixed solution of N,N-dimethylformamide / water =1:1, and reacted at room temperature for 2 h. After complete reaction was confirmed by liquid chromatography-mass spectrometry (LC-MS), the mixture was evaporated under reduced pressure. The residue was dissolved in an acetonitrile / water system and purified by HPLC to give the target peptide Ang2-Ang2-AZK (25 mg, theoretical molecular weight: 5010.46, measured molecular weight: 1002.8 [M+5H]5+). Using the methods described in Embodiments 1-3, azide-modified peptides shown in Table 1-1 were 100002                                                   40 2010.2 synthesized. Their theoretical and measured molecular weights are shown in Table 1-1 below. Table 1-1 Peptide Name Peptide Sequence Structure Theoreti cal Molecul ar Weight Measured Molecular Weight Ang1 (K10N3) H z^Z^ N^Z .—'     O H / Ac—T-F-F-Y-G-G-C-R-G—NZ  n / 7~ R-N-N-F-K-T-E-E-Y—OH O 2498.76 1250.4 [M+2H]2+ Ang2-AZK h2n HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T-^^*^^^^N3 O 2455.68 819.55 [M+3H]3+ L57-AZK NH? Ac T-W-P-K-H-F-D-K-H-T---F-Y-S—1—L-K-L-G-K-H-NH        Na 2679.13 894.05 [M+3H]3+ Reversed Ang2-AZK 0 O ZI 1 1 LU 1 LU 1 H 1 Z 1 t Z 1 z 1 tr z i 0 1 tr 1 co 1 0 1 0 1 1 t t H 1 o < 2496.73 1249.41 [M+2H]2+ Ang2(K10 AZK) / N3 HO-Y-E-E-T-K-F-N-N-R C^HN-G-R-S-G—G—Y—F—F—T—H 2326.49 582.60 [M+4H]4+ Ang2(S7K N3) _ Z'n3 H ^...Z NZ\ ,—'     O H / Ac-T-F-F-Y-G-G--N~C V-R-G-K R-N-N-F-K-T-E-E-Y—OH O 2523.80 1263.30 [M+2H]2+ Ang2(K15 N3) i IZ       LU \         1 /          LU 4           1 IZ 1 z 1 z 1 tr: z l 0 I l w i 0 1 0 1 1 T T H 1 o 2482.70 1242.85 [M+2H]2+ Ang2(K10P eg2N3) H N.,Z 0 Ac-T—F—F—Y-G-G-S-R-G^   Z—      0 HN—\ \—R-N-N-F-K-T-E-E-Y-OH O 2627.86 1314.75 [M+2H]2+ Ang2(K10 N3) HO—Y-E-E-T-K-F-N-N-R O~HN-G-R-S-G-G-Y-F-F-T-Ac 2482.70 1242.30 [M+2H]2+ 100002 Ang2-Ang2 -AZK o    OVOH                                  NH2    N3 .             '           N. ' E E    T ' F N N R .       R   '           . F F    ' Y-FF T     O g-g R-S K-G N-R F—N T-K E-E HO-Y 5010.46 1002.8 [M+5H]5+ Unmodified amino acid sequences corresponding to the azide-modified peptides in Table 1-1 are shown in Table 1-2. Table 1-2 Unmodified Amino Acid Sequences Peptide Name Peptide Sequence Structure Unmodified Amino Acid Sequence (from N-terminus to C-terminus) and Number Ang1 (K10N3) ~ <~-n3 H .—'     O H / Ac-T-F-F-Y-G-G-C-R-G—N f —R-N-N-F-K-T-E-E-Y—OH O TFFYGGCRGKRN NFKTEEY (SEQ ID NO: 1) Ang2-AZK H2N HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T—^N3 O TFFYGGSRGKRN NFKTEEY (SEQ ID NO: 2) L57-AZK NH? Ac T-W-P-K-H—F-D-K-H-T---F-Y-S—1—L—K-L-G-K-H-NH         3 TWPKHFDKHTFY SILKLGKH (SEQ ID NO: 3) Reversed Ang2-AZK °yNH2 n3 Ac-T-F—F-Y-G-G-S-R-G-K--R-N-N-F-K-T-E-E-Y— H TFFYGGSRGKRN NFKTEEY (SEQ ID NO: 2) Ang2(K10A ZK) / N, HO—Y-E-E-T-K-F-N-N-R O HN-G-R-S—G-G-Y-F—F-T--H TFFYGGSRGZRN NFKTEEY (SEQ ID NO: 4), wherein Z represents L-norleucine Ang2(S7KN3 ) I o > 1 UJ 1 UJ 1 H co                              1 Z V y° i * )                   1 V <      1 1 IZ 1 0 1 0 1 1 T T i— 1 < TFFYGGKRGKRN NFKTEEY (SEQ ID NO: 5) Ang2(K15N3 ) ___Z^N3 H NZ\ .— /    O H / Ac—T-F-F-Y-G-G-S-R-G-K R-N-N—F—N—< \—T-E-E-Y—OH O TFFYGGSRGKRN NFKTEEY (SEQ ID NO: 2) 100002 Ang2(K10Pe g2N3) o^^^A3 H n     S'""- 0 Ac-T-F-F-Y-G-G-S-R-Gx    / — /     0 HN— \-R-N-N-F-K-T-E-E-Y—OH O TFFYGGSRGKRN NFKTEEY (SEQ ID NO: 2) Ang2(K10N3 ) HO—Y-E-E-T-K-F-N-N-R o'An G-R-S-G-G—Y—F—F—T-Ac TFFYGGSRGKRN NFKTEEY (SEQ ID NO: 2) Ang2-Ang2-AZK o    OVOH                                  NH2    N3 O^^     ^ Y-F ~T     O zG-G R-S K-G N-R F—N zT—K E-E HO--Y TFFYGGSRGKRN NFKTEEY-TFFYG GSRGKRNNFKTE EY (SEQ ID NO: 6) Embodiment 4 Synthesis of Compound B08 ho. 17                                                       B08-1 B08-2 O B08-3                                                      B08 1. Synthesis of Compound B08-1 Compound    [2-[2-(Fmoc-amino)ethoxy]ethoxy]acetic    acid (10 g, 26.0 mmol), N,N-diisopropylethylamine         (6.7         g,         52.0         mmol),         and 10 O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10.8 g, 28.6 mmol) were dissolved in N,N-dimethylformamide (100 mL) and stirred at room temperature for 5 min. Then, Compound 17 (11.4 g, 27.3 mmol) was dissolved in N,N-dimethylformamide (20 mL) and added to the above reaction mixture. The reaction system was stirred at room temperature for 2 h. The reaction mixture was added to saturated sodium bicarbonate and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (dichloromethane / methanol = 100:1, 2% triethylamine) to give a colorless oil (17.4 g, yield: 85.2%). LCMS: 786.9, found: 808.9 [M+Na]+. 100002 2. Synthesis of Compound B08-2 B08-1 (8.0 g, 10.2 mmol) was dissolved in ethyl acetate (76 mL), and diethylamine (12.6 g) was added. The reaction system was stirred at room temperature overnight. The reaction mixture was concentrated under reduced pressure and separated by column chromatography (dichloromethane / methanol = 20:1, 0.5% triethylamine ^ 10:1, 0.1% triethylamine) to give a white foamy solid (3.8 g, yield: 66.2%). LCMS: 564.7, found: 565.8 [M+H]+. 3. Synthesis of Compound B08-3 B08-2 (2.0 g, 3.5 mmol) was dissolved in acetonitrile (35 mL), and ethyl trifluoroacetate (1.3 g, 8.8 mmol) was added. The reaction system was stirred at room temperature overnight. The reaction mixture was concentrated and purified by column chromatography (dichloromethane / methanol = 30:1, 0.1% triethylamine) to give a white foamy solid (1.87 g, yield: 79.9%). LCMS: 660.7, found: 682.7 [M+Na]+. 4. Synthesis of Compound B08 B08-3 (1.5 g, 2.3 mmol) and N,N-diisopropylethylamine (0.9 g, 6.8 mmol) were dissolved in anhydrous dichloromethane (10 mL). Cyanoethyl-N,N-diisopropylchlorophosphoramidite (0.6 g, 2.7 mmol) was added, and the reaction system was stirred at room temperature for 1 h. The reaction mixture was concentrated at 30°C and separated by column chromatography (petroleum ether, 2% triethylamine^ petroleum ether / ethyl acetate = 4:1, 2% triethylamine) to give an off-white foamy solid (0.8 g, yield: 38.8%). LCMS: 860.9, found 861.9 [M+H]+. Embodiment 5 Synthesis of Compound B12 B12 1. Synthesis of Compound B12-1 Compound 6-heptynoic acid (0.35 g, 2.77 mmol), N,N-diisopropylethylamine (0.90 g, 6.94 mmol) 100002                                                   44 and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.16 g, 3.05 mmol) were dissolved in N,N-dimethylformamide (15 mL) and stirred at room temperature for 5 min. Then, Compound B08-2 (1.64 g, 2.91 mmol) was dissolved in N,N-dimethylformamide (15 mL) and added to the above reaction mixture. The reaction system was stirred at room temperature for 2 h. The reaction mixture was added to saturated sodium bicarbonate and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (dichloromethane / methanol = 100:1, 2% triethylamine) to give a colorless oil (0.5 g, yield: 26.8%). LCMS: 672.8, found: 695.0[M+Na]+. 2. Synthesis of Compound B12 Compound B12-1 (0.5 g, 0.74 mmol) and N,N-diisopropylethylamine (0.3 g, 2.25 mmol) were dissolved         in         anhydrous         dichloromethane         (10         mL). Cyanoethyl-N,N-diisopropylchlorophosphoramidite (0.21 g, 0.89 mmol) was added, and the reaction system was stirred at room temperature for 1 h. The reaction mixture was concentrated at 30°C and separated by column chromatography (petroleum ether, 2% triethylamine ^ petroleum ether / ethyl acetate = 4:1, 2% triethylamine) to give an off-white foamy solid (0.39 g, yield: 60.1%). LCMS: 873.0, found 874 [M+H]+. Embodiment 6 Synthesis of Dipeptide Linker BPL-1 1.                  Preparation of               methyl N6-(tert-butoxycarbonyl)-N2-(6-((tert-butoxycarbonyl)amino)hexanoyl)-L-lysinate (Compound A3): At room temperature, a mixture of methyl N6-(tert-butoxycarbonyl)-L-lysinate (5.0 g, 19.2 mmol, 1.0 eq.), boc-6-aminocaproic acid (4.89 g, 21.1 mmol, 1.1 eq.), and N,N-diisopropylethylamine (5.46 g, 42.3 mmol, 2.2 eq.) in dichloromethane was stirred thoroughly. Then, 1-hydroxybenzotriazole (5.71 g, 42.3 mmol, 2.2 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (8.08 g, 42.3 mmol, 2.2 eq.) were added and reacted for 1 h. The reaction was monitored by thin-layer 100002                                                   45 chromatography (dichloromethane / methanol = 30:1, Rf = 0.3) and LCMS until completion. The reaction mixture was diluted with dichloromethane and extracted. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, and dried over anhydrous sodium sulfate. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane: methanol) to give the product methyl N6-(tert-butoxycarbonyl)-N2-(6-((tert-butoxycarbonyl)amino)hexanoyl)-L-lysinate (8.5 g, yield: 93.8%). MS (ES+): m / z=474 (M+H)+. Step 2. Preparation of methyl (6-aminohexanoyl)-L-lysinate (Compound A4): At room temperature, methyl N6-(tert-butoxycarbonyl)-N2-(6-((tert-butoxycarbonyl)amino)hexanoyl)-L-lysinate (1.0 g, 2.11 mmol, 1.0 eq.) was mixed with a solution of hydrogen chloride in 1,4-dioxane (10 mL, 2 mol / L) and reacted for 1.5 h. The reaction was monitored by LCMS until completion. The reaction mixture was concentrated under reduced pressure. Water (30 mL) was added and sodium hydroxide solution was added to adjust the pH to approximately 7-8. The aqueous phase was concentrated under reduced pressure using an oil pump. The solid obtained was stirred and washed with a solution of dichloromethane / methanol = 10 / 1, and filtered. The filtrate was concentrated under reduced pressure to give methyl (6-aminohexanoyl)-L-lysinate as a pale yellow oil (450 mg, yield: 77.9%). MS (ES+): m / z=274 (M+H)+. Step                 3.                 Preparation                 of                 methyl N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-(((((1R,8S,9r)-bicyclo[6.1. 0]non-4-en-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysinate (Compound A5): Under nitrogen atmosphere, a solution of methyl (6-aminohexanoyl)-L-lysinate (450 mg, 1.65 mmol, 1.0 eq.), ((1R,8S,9S)-bicyclo[6.1.0]non-4-yn-9-yl)methyl (2,5-dioxopyrrolidin-1-yl) carbonate (960 mg, 3.29 mmol, 2.0 eq.) and N,N-diisopropylethylamine (468 mg, 3.63 mmol, 2.2 eq.) in N,N-dimethylformamide (5 mL) was stirred at room temperature for 1 h. The reaction was monitored by thin-layer chromatography (dichloromethane / methanol = 10:1, Rf = 0.4) and LCMS until completion. The mixture was cooled to room temperature and the solvent was concentrated under reduced pressure. The residue was diluted with water (20 mL) and extracted with dichloromethane / methanol = 10 / 1 (30 mL). The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography (eluent: dichloromethane / methanol = 30 / 1) to give methyl N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1. 100002 0]non-4-en-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysinate as a white solid (280 mg, yield: 27.1%). MS (ES+): m / z=626 (M+H)+. Step                         4.                         Preparation                         of N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1. 0]non-4-en-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine    (Compound A6):    Methyl N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1. 0]non-4-en-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysinate (280 mg, 0.448 mmol, 1.0 eq.) was added to a mixed solvent of tetrahydrofuran, methanol and water (6 mL), followed by addition of an aqueous solution (1 mL) of lithium hydroxide (13 mg, 0.538 mmol, 1.2 eq.). The mixture was stirred at room temperature for 1 h. The reaction was monitored by LCMS until completion. The reaction mixture was concentrated under reduced pressure. Water (30 mL) was added, and then 1 mol / L dilute hydrochloric acid solution was added to adjust the pH to approximately 3-4. Then, the mixture was diluted with water (20 mL) and extracted with dichloromethane (30 mL). The organic layer was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phase was concentrated           under           reduced           pressure           to           give N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1. 0]non-4-en-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine as a white solid (220 mg, yield: 80.2%). MS (ES+): m / z=612 (M+H)+. Step              5.              Preparation              of             2,5-dioxopyrrolidin-1-yl N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1.0 ]non-4-yn-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine            salt            (BPL-1): N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1. 0]non-4-en-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine (220 mg, 0.36 mmol, 1.0 eq.), N-hydroxysuccinimide      (49.7      mg,      0.43      mmol,      1.2      eq.),      and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (82.5 mg, 0.432 mmol, 2.2 eq.) were added to dichloromethane. The mixture was stirred at room temperature for 1.5 h. The reaction was monitored by LCMS until completion. The reaction mixture was diluted with dichloromethane and extracted. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, and dried over anhydrous sodium sulfate. The organic phase was concentrated under      reduced      pressure.      A      white      solid,      2,5-dioxopyrrolidin-1-yl N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)methoxy)carbonyl)-N2-(6-((((1R,8S,9r)-bicyclo[6.1.0 100002                                                   47 2010.2 ]non-4-yn-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine salt (200 mg, yield: 78.7%), was given and used directly in the next step without purification. MS (ES+): m / z=709 (M+H)+. Embodiment 7 Synthesis of Dipeptide Linker BPL-2 Step 1.                  Preparation of               methyl (S)-22-(2,2-dimethyl-4,13-dioxo-3,8,11-trioxa-5,14-diazaoctadecan-18-yl)-2,2-dimethyl-4,3,20-trio xa-3,8,11-trioxa-5,14,21-triazatricosan-23-oate (Compound B1): At room temperature, a mixture of methyl     (6-aminohexanoyl)-L-lysinate     (3.0     g,     10.9     mmol,     1.0     eq.), 2,2-dimethyl-4-oxo-3,8,11-trioxo-5-azatridecan-13-oic acid (6.35 g, 24.2 mmol, 2.2 eq.) and N,N-diisopropylethylamine (5.7 mL, 32.9 mmol, 3.0 eq.) in dichloromethane was stirred thoroughly. Then,     1-hydroxybenzotriazole     (3.7     g,     27.5     mmol,     2.5     eq.)     and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (5.24 g, 27.5 mmol, 2.5 eq.) were added and reacted for 1 h. The reaction was monitored by thin-layer chromatography (dichloromethane / methanol = 20:1, Rf = 0.3) and LCMS until completion. The reaction mixture was diluted with dichloromethane and extracted. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, and dried over anhydrous sodium sulfate. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent:   dichloromethane:   methanol) to give the product methyl (S)-22-(2,2-dimethyl-4,13-dioxo-3,8,11-trioxa-5,14-diazaoctadecan-18-yl)-2,2-dimethyl-4,3,20-trio xa-3,8,11-trioxa-5,14,21-triazatricosan-23-oate (3.9 g, yield: 46.8%), MS (ES+): m / z=764 (M+H)+. Step                 2.                 Preparation                 of                 methyl N2-(6-(2-(2-(2-(2-(2-aminoethoxy)ethoxy)acetamido)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)a cetyl)-L-lysinate      (Compound      B2):      At      room      temperature,      methyl 22-(2,2-dimethyl-4,13-dioxo-3,8,11-trioxa-5,14-diazaoctadecan-18-yl)-2,2-dimethyl-4,3,20-trioxa-3 ,8,11-trioxa-5,14,21-triazatricosan-23-oate (3.9 g, 5.11 mmol, 1.0 eq.) was mixed with a solution of 100002 hydrogen chloride in dioxane (40 mL, 2 mol / L) and reacted for 1.5 h. The reaction was monitored by LCMS until completion. The reaction mixture was concentrated under reduced pressure, then water (30 mL) was added and sodium hydroxide solution was added to adjust the pH to approximately 7-8. The aqueous phase was concentrated under reduced pressure using an oil pump. The resulting solid was stirred and washed with a solution of dichloromethane / methanol = 10 / 1, and filtered. The filtrate was      concentrated      under      reduced      pressure      to      give      methyl N2-(6-(2-(2-(2-(2-(2-aminoethoxy)ethoxy)acetamido)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)a cetyl)-L-lysinate as a pale yellow oil (2.9 g, yield: 85.8%). MS (ES+): m / z=564 (M+H)+. Step                 3.                 Preparation                 of                 methyl (S)-2-(6,15-dioxo-8,11 -dioxo-5,14-diazaicos-20-yn-1 -yl)-4,11,20-trioxo- 13,16-dioxo-3,10,19-triaza hexadec-25-ynoate (Compound B3): At room temperature, a mixture of methyl N2-(6-(2-(2-(2-(2-(2-aminoethoxy)ethoxy)acetamido)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)a cetyl)-L-lysinate (440 mg, 0.691 mmol, 1.0 eq.), 6-heptynoic acid (178 mg, 1.41 mmol, 2.04 eq.) and N,N-diisopropylethylamine (263 pL, 1.52 mmol, 2.2 eq.) in dichloromethane was stirred thoroughly. Then,     1-hydroxybenzotriazole (205 mg,     1.52 mmol, 2.2 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (290 mg, 1.52 mmol, 2.2 eq.) were added and reacted for 1 h. The reaction was monitored by thin-layer chromatography (dichloromethane / methanol = 20:1, Rf = 0.2) and LCMS until completion. The reaction mixture was diluted with dichloromethane and extracted. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, and dried over anhydrous sodium sulfate. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent:   dichloromethane:   methanol) to give the product methyl (S)-2-(6,15-dioxo-8,11 -dioxo-5,14-diazaicos-20-yn-1 -yl)-4,11,20-trioxo- 13,16-dioxo-3,10,19-triaza hexadec-25-ynoate (310 mg, yield: 57.6%). MS (ES+): m / z=780 (M+H)+. Step                         4.                         Preparation                         of (S)-2-(6,15-dioxo-8,11 -dioxo-5,14-diazaicos-20-yn-1 -yl)-4,11,20-trioxo- 13,16-dioxo-3,10,19-triaza hexadec-25-ynoic            acid           (Compound           B4):            Methyl (S)-2-(6,15-dioxo-8,11 -dioxo-5,14-diazaicos-20-yn-1 -yl)-4,11,20-trioxo- 13,16-dioxo-3,10,19-triaza hexadec-25-ynoate (310 mg, 0.398 mmol, 1.0 eq.) was added to a mixed solvent of tetrahydrofuran, methanol and water (6 mL), followed by the addition of an aqueous solution (1 mL) of lithium hydroxide (20.1 mg, 0.478 mmol, 1.2 eq.). The mixture was stirred at room temperature for 1 h. The 100002 reaction was monitored by LCMS until completion. The reaction mixture was concentrated under reduced pressure, water (25 mL) was added, and the pH was adjusted to approximately 3-4 with dilute hydrochloric acid (1 mol / L). The mixture was diluted with water (20 mL) and extracted with dichloromethane (25 mL). The organic layer was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phase was concentrated under reduced pressure to give (S)-2-(6,15-dioxo-8,11 -dioxo-5,14-diazaicos-20-yn-1 -yl)-4,11,20-trioxo- 13,16-dioxo-3,10,19-triaza hexadec-25-ynoic acid as a white solid (290 mg, yield: 95.4%). 1H NMR (500 MHz, CDCh) 8 6.90 (s, 2H), 6.83 (d, J = 8.3 Hz, 1H), 6.55 (s, 2H), 4.15-4.10 (m, 1H), 3.69-3.62 (m, 4H), 3.55 (s, 8H), 3.50 (t, J = 4.8 Hz, 10H), 3.41-3.35 (m, 10H), 2.45-2.36 (m, 4H), 2.32 (t, J = 6.8 Hz, 2H), 2.24 (t, J = 6.9 Hz, 2H), 2.15 (dt, J = 7.1, 6.2 Hz, 7H), 1.89 (dd, J = 15.2, 8.1 Hz, 4H), 1.72-1.64 (m, 4H), 1.52-1.46 (m, 4H). MS (ES+): m / z=766 (M+H)+. Step 5. Preparation of BPL-2: Compound B4 (290 mg, 0.38 mmol) was dissolved in dichloromethane (4 mL).    N-hydroxysuccinimide    (52 mg, 0.46 mmol, 1.2 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (88 mg, 0.46 mmol, 1.2 eq.) were added successively. The mixture was stirred at room temperature for 1.5 h. The reaction was monitored by LCMS until completion. The reaction mixture was diluted with dichloromethane and extracted. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, and dried over anhydrous sodium sulfate. The organic phase was concentrated under reduced pressure. A white viscous solid, BPL-2 (310 mg, yield: 94.5%), was given and used directly in the next step without further purification. MS (ES+): m / z = 864 (M+H)+. Embodiment 8 Synthesis of Dipeptide Linker BPL-3 Step                 1.                 Preparation                 of                 methyl (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)-21-(1-((1R,8S,9s)-bicyclo[6.1.0]hept-4-yl)-3,12-dio 100002 xo-2,7,10-trioxa-4,13 -diazaheptadecan- 17-yl)-3,12,19-trioxy-2,7,10-trioxa-4,13,20-triazadocosan-2 2-oate   (Compound C1):   Under nitrogen protection, a solution of methyl N2-(6-(2-(2-(2-(2-(2-aminoethoxy)ethoxy)acetamido)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)a cetyl)-L-lysinate (900 mg, 1.59 mmol, 1.0 eq.), ((1R,8S,9S)-bicyclo[6.1.0]non-4-yn-9-yl)methyl (2,5-dioxopyrrolidin-1-yl) carbonate (928 mg, 3.19 mmol, 2.0 eq.) and N,N-diisopropylethylamine (450 mg, 3.49 mmol, 2.2 eq.) in N,N-dimethylformamide (10 mL) was stirred at room temperature for 1 h. The reaction was monitored by thin-layer chromatography (dichloromethane / methanol = 10:1, Rf = 0.3) and LCMS until completion. The mixture was cooled to room temperature and the solvent was concentrated under reduced pressure. The residue was diluted with water (30 mL) and extracted with dichloromethane / methanol = 10 / 1 (30 mL). The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography (eluent: dichloromethane / methanol = 30 / 1) to give methyl (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)-21-(1-((1R,8S,9s)-bicyclo[6.1.0]hept-4-yl)-3,12-dio xo-2,7,10-trioxa-4,13 -diazaheptadecan- 17-yl)-3,12,19-trioxy-2,7,10-trioxa-4,13,20-triazadocosan-2 2-oate as a white solid (580 mg, yield: 39.8%). MS (ES+): m / z=916 (M+H)+. Step                         2.                         Preparation                         of (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-but-9-yl)-21-(1-((1R,8S,9)-bicyclo[1.1.0]non-4-but-9-alkyl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17 -yl)-3,12,19-trioxa-2,7,10-trioxa-4,13,20-triazado cosan-22-oic             acid             (Compound             C2):             Methyl (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)-21-(1-((1R,8S,9s)-bicyclo[6.1.0]hept-4-yl)-3,12-dio xo-2,7,10-trioxa-4,13 -diazaheptadecan- 17-yl)-3,12,19-trioxy-2,7,10-trioxa-4,13,20-triazadocosan-2 2-oate (300 mg, 0.327 mmol, 1.0 eq.) was added to a mixed solvent of tetrahydrofuran, methanol and water (7.5 mL), followed by the addition of an aqueous solution (0.5 mL) of lithium hydroxide (9.5 mg, 0.40 mmol, 1.2 eq.). The mixture was stirred at room temperature for 1 h. The reaction was monitored by LCMS until completion. The reaction mixture was concentrated under reduced pressure. Water (25 mL) was added, and then 1 mol / L dilute hydrochloric acid was added to adjust the pH to approximately 3-4. Then, the mixture was diluted with water (25 mL) and extracted with dichloromethane (30 mL). The organic layer was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phase was concentrated under reduced pressure to give (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-but-9-yl)-21-(1-((1R,8S,9)-bicyclo[1.1.0]non-4-but-9-alkyl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17 -yl)-3,12,19-trioxa-2,7,10-trioxa-4,13,20-triazado 100002                                                      51 cosan-22-oic acid as a white solid (260 mg, yield: 88.4%). MS (ES+): m / z=902 (M+H)+. Step                         3.                         Preparation                         of 2,5-dioxopyrrolidin-1-yl-(S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)-21-(1-((1R,8S,9s)-bicyclo[ 6.1.0]non-4-yn-9-yl)-3,12-dioxo-2,7,10-trioxo-4,13-diazaheptadecan-17 -yl)-3,12,19-trioxo-2,7,10-t rioxo-4,13,20-triazadocosan-22-oate                                                      (BPL-3): (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-but-9-yl)-21-(1-((1R,8S,9)-bicyclo[1.1.0]non-4-but-9-alkyl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxa-2,7,10-trioxa-4,13,20-triazado cosan-22-oic acid (260 mg, 0.288 mmol, 1.0 eq.), N-hydroxysuccinimide (40 mg, 0.35 mmol, 1.2 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (121 mg, 0.634 mmol, 2.2 eq.) were dissolved in dichloromethane. The mixture was stirred at room temperature for 1.5 h. The reaction was monitored by LCMS until completion. The reaction mixture was diluted with dichloromethane and extracted. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, and dried over anhydrous sodium sulfate. The organic phase    was     concentrated    under    reduced    pressure.     A    white     solid 2,5-dioxopyrrolidin-1-yl-(S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)-21-(1-((1R,8S,9s)-bicyclo[ 6.1.0]non-4-yn-9-yl)-3,12-dioxo-2,7,10-trioxo-4,13-diazaheptadecan-17 -yl)-3,12,19-trioxo-2,7,10-t rioxo-4,13,20-triazadocosan-22-oate (200 mg, yield: 69.7%) was given and used directly in the next step without purification. MS (ES+): m / z=999 (M+H)+. Embodiment 9 Synthesis of Dipeptide Linker BPL-4 NHBoc NC^ KOH, Dioxane / H2O HCI in EtOH EDCI, HOBt, DIEA, DCM LiOH THF / MeOH / H2O 1. Synthesis of Compound D2: D1 (10 g, 52.2 mmol, 1.0 eq.) was dissolved in 1,4-dioxane (100 mL). Subsequently, acrylonitrile (9.7 g, 183.7 mmol, 3.5 eq.) and an aqueous solution (3 mL) of potassium hydroxide (292 mg, 5.22 mmol, 0.1 eq.) were added while stirring. The mixture was stirred 100002                                                   52 2010.2 at room temperature for 2 h. The reaction mixture was concentrated under reduced pressure, diluted with water (60 mL) and extracted with dichloromethane (100 mL). The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give a yellow oil. The residue was purified by silica gel column chromatography (eluent: petroleum ether: ethyl acetate = 8:1) to give D2 as a transparent oily liquid (15.2 g; yield: 97.2%). MS (ES+): m / z=326 (M+H)+. 2. Synthesis of Compound D3: D2 (5 g, 16.8 mmol, 1.0 eq.) was dissolved in 10 M hydrochloric acid / ethanol (50 mL), heated in an oil bath to 79°C, and stirred overnight. The reaction was monitored by TLC (petroleum ether:ethyl acetate = 1:1, Rf = 0.2) and LC-MS until completion. The reaction mixture was concentrated under reduced pressure, diluted with water (50 mL), adjusted to pH 9 with saturated sodium carbonate solution, and extracted with dichloromethane. The organic layer was washed twice with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to yield crude D3 (3.49 g, yield: 71.3%). MS (ES+): m / z=292 (M+H)+. 3. Synthesis of Compound D4: At room temperature, D3 (3.2 g, 10.99 mmol, 1.0 eq.) was dissolved in dichloromethane (25 mL), followed by the addition of dodecanedioic acid mono-tert-butyl ester (3.77 g, 13.2 mmol, 1.2 eq.), N,N-diisopropylethylamine (3.8 mL, 21.98 mmol, 2.0 eq.), 1-hydroxybenzotriazole      (2.23      g,      16.49      mmol,      1.5      eq.),      and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (3.15 g, 16.49 mmol, 1.5 eq.). The mixture was reacted at room temperature for 1 h. The reaction was monitored by TLC (petroleum ether:ethyl acetate = 2:1, Rf = 0.5) and LC-MS until completion, and then the reaction mixture was diluted with dichloromethane. The organic layer was washed twice each with saturated sodium bicarbonate and saturated ammonium chloride, then dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: petroleum ether / ethyl acetate = 2:1) to give D4 as a pale yellow oil (4.8 g, yield: 78%). MS (ES+): m / z=560 (M+H)+. 4. Synthesis of Compound D5: D4 (2.57 g, 4.59 mmol, 1.0 eq.) was dissolved in a mixed solvent of tetrahydrofuran, methanol and water (tetrahydrofuran / methanol / water = 1:1:1, 25 mL). Then an aqueous solution (5 mL) of lithium hydroxide (264 mg, 11.02 mmol, 2.4 eq.) was added. The mixture was stirred at room temperature for 1 h. The reaction was monitored by LCMS until completion. The reaction mixture was concentrated under reduced pressure, diluted with water (30 mL), adjusted to pH 3-4 with 1 mol / L dilute hydrochloric acid, and extracted with dichloromethane (30 mL). The 100002 organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give a yellow oily crude product. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 20 / 1) to give D5 (2.0 g, yield: 86.5%). MS (ES+): m / z=504 (M+H)+. 5. Synthesis of Compound D6: At room temperature, D5 (700 mg, 1.39 mmol, 1.0 eq.), N-(2-(2-(2-(2-aminoethoxy)ethoxy)ethyl)hept-6-ynamide (783 mg, 3.06 mmol, 2.2 eq.), N,N-diisopropylethylamine (846 uL, 4.87 mmol, 3.5 eq.), and 1-hydroxybenzotriazole (469 mg, 3.48 mmol, 2.5 eq.) were dissolved in dichloromethane (8 mL), followed by the addition of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (666 mg, 3.48 mmol, 2.5 eq.). The mixture was stirred for reaction at room temperature for 1.5 h. The reaction was monitored by TLC (dichloromethane:methanol = 15:1, Rf = 0.3) and LC-MS until completion. The reaction mixture was diluted with dichloromethane. The organic layer was washed twice each with saturated sodium bicarbonate solution and saturated ammonium chloride solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 15 / 1) to give D6 as a colorless transparent oil (1.15 g, yield: 84.5%). MS (ES+): m / z=980 (M+H)+. 6. Synthesis of Compound D7: At room temperature, D6 (1.15 g, 1.17 mmol, 1.0 eq.) was dissolved in a solution of 20% trifluoroacetic acid in dichloromethane (12 mL). The system was reacted at room temperature for 2 h. The reaction was monitored by TLC (dichloromethane:methanol = 10:1, Rf = 0.3) and LC-MS until completion. The reaction mixture was concentrated under reduced pressure, diluted with water (30 mL), adjusted to approximately pH 9 with sodium carbonate solution, and extracted with dichloromethane. The organic phase was concentrated under reduced pressure to give a crude product, which was purified by reverse-phase HPLC (RP-HPLC) to give D7 as a white oil (620 mg, yield: 57.4%). 1H NMR (500 MHz, CDCl3) 5 6.70 (s, 2H), 6.59 (d, J = 8.0 Hz, 1H), 6.32 (s, 2H), 4.12 (s, 1H), 3.73 - 3.60 (m, 4H), 3.59 - 3.52 (m, 9H), 3.50 (dd, J = 9.0, 4.8 Hz, 9H), 3.43 - 3.27 (m, 10H), 2.42 - 2.35 (m, 4H), 2.26 (t, J = 7.0 Hz, 2H), 2.15 (dd, J = 15.3, 7.5 Hz, 10H), 1.89 (s, 2H), 1.69 (dt, J = 15.3, 7.6 Hz, 4H), 1.51 (ddd, J = 22.2, 16.1, 6.3 Hz, 8H), 1.20 (d, J = 15.9 Hz, 12H), MS (ES+): m / z=924 (M+H)+. 7. Synthesis of Compound BPL-4: D7 (620 mg, 0.67 mmol) was dissolved in dichloromethane (20 mL). N-Hydroxysuccinimide (93 mg, 0.81 mmol, 1.2 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (154 mg, 0.81 mmol, 1.2 eq.) were 100002                                                   54 added while stirring. The mixture was reacted at room temperature for 2 h. The reaction was monitored by LC-MS until completion. The reaction mixture was diluted with dichloromethane (20 mL). The organic phase was washed twice with saturated ammonium chloride solution and concentrated under reduced pressure to give BPL-4 as a white solid, which was used directly in the next step without purification. MS (ES+): m / z=1021 (M+H)+. Embodiment 10 Synthesis of Solid Support Q20-CPG Q20-1 HATU,DIEA,DCM NaOH,THF,MeOH,H 2O Q20-4 Q20-7 Q20-CPG 1:                  Preparation Step of               methyl 1 -(2,2-dimethyl-4-oxo-3,8,11 -trioxa-5-azatridecan- 13-hydroxy)piperidine-4-carboxylate (Compound Q20-2) A mixture of 2,2-dimethyl-4-oxo-3,8,11-trioxa-5-azatridecan-13-oic acid (5.0 g, 18.99 mmol, 1.0 eq.), methyl piperidine-4-carboxylate (2.72 g, 18.99 mmol, 1.0 eq.), N,N-diisopropylethylamine (4.90 g, 37.98 mmol, 2.0   eq.), and   2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.66 g, 22.78 mmol, 1.2 eq.) in dichloromethane (50 mL) was stirred at room temperature for 30 min. The solvent was concentrated under reduced pressure. The residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to give methyl 1-(2,2-dimethyl-4-oxo-3,8,11-trioxa-5-azatridecan-13-hydroxy)piperidine-4-carboxylate as a yellow oil (12.7 g, crude). LCMS(ESI): m / z =389[M+H]+. Step 2: Preparation of methyl 1-(2-(2-(2-aminoethoxy)acetyl)piperidine-4-carboxylate hydrochloride (Compound Q20-3): A                        solution                        of                        methyl 100002                                                   55 1 -(2,2-dimethyl-4-oxo-3,8,11 -trioxa-5-azatridecan- 13-hydroxy)piperidine-4-carboxylate (crude) in hydrogen chloride dioxane (40 mL) was stirred at room temperature for 1 h. The solvent was removed in vacuo. The residue was used directly in the next step without purification (crude). LCMS(ESI): m / z =289[M+H]+. Step 3: Preparation of methyl 1-(2-(2-(6-heptanamido)ethoxy)acetyl)piperidine-4-carboxylate (Compound Q20-4) A mixture of methyl 1-(2-(2-(2-aminoethoxy)acetyl)piperidine-4-carboxylate hydrochloride (crude), 6-heptynic acid (2.35 g, 18.69 mmol), N,N-diisopropylethylamine (7.23 g, 56.06 mmol), and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.52 g, 22.42 mmol) in dichloromethane (50 mL) was stirred at room temperature for 30 min. The solvent was concentrated under reduced pressure. The residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: ethyl acetate      to      dichloromethane / methanol      =      20 / 1)      to      give      methyl 1-(2-(2-(6-heptanamido)ethoxy)acetyl)piperidine-4-carboxylate as a yellow oil (8.19 g, crude). LCMS(ESI): m / z =397[M+H]+. Step 4: Preparation of  1-(2-(2-(6-heptanamido)ethoxy)acetyl)piperidine-4-carboxylic  acid (Compound Q20-5) A mixture of methyl 1-(2-(2-(6-heptanamido)ethoxy)acetyl)piperidine-4-carboxylate (8.19 g, 20.6 mmol, 1.0 eq.) and sodium hydroxide (1.24 g, 30.94 mmol, 1.5 eq.) in tetrahydrofuran / methanol / water (20 mL / 10 mL / 10 mL) was stirred at room temperature for 1 h. The solvent was concentrated under reduced pressure. The residue was adjusted to pH 3 with 1 M hydrochloric acid solution, and extracted with dichloromethane. The organic phase was dried over anhydrous        sodium        sulfate        and        concentrated        to        give 1-(2-(2-(6-heptanamido)ethoxy)acetyl)piperidine-4-carboxylic acid as a yellow oil (6.0 g, crude). LCMS(ESI): m / z =383[M+H]+. Step                          5:                           Preparation                          of N-(2-(2-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-2-oxoethoxy)ethoxyethyl)-1-(2-(-2-(2-(hept-6-ynamido)ethyl)acetyl)piperidine-4-carboxamide (Compound Q20-6) A mixture of 1-(2-(2-(6-heptanamido)ethoxy)acetyl)piperidine-4-carboxylic acid (1.1 g, 2.87 mmol, 100002                                                   56 2010.2 1.0                                                                                                       eq.), 2-(2-(2-aminoethoxy)ethoxy-1-(2S,4R)-2-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydro xypyrrolidin-1-yl)ethan-1-one (1.22 g, 2.15 mmol, 0.75 eq.), N,N-diisopropylethylamine (1.11 g, 8.62 mmol, 3.0 eq.) and    2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.31 g, 3.45 mmol, 1.2 eq.) in dichloromethane (10 mL) was stirred at room temperature for 1 h. The mixture was separated and purified by RP-HPLC (column: UniSil 10-120 C18,           30           x           250           mm)           to           give N-(2-(2-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-2-oxoethoxy)ethoxyethyl)-1 -(2-(-2-(2-(hept-6-ynamido)ethyl)acetyl)piperidine-4-carboxamide as a white solid (320 mg, yield: 12%). LCMS (ESI): m / z =627[(M-303)+H]+. Step                         6:                         Preparation                         of 4-(((3R,5S)-5-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(2-(2-(-2-(2-(hept-6-ynamido)eth oxy)ethyl)acetyl)piperidine-4-carboxamido)ethoxy)acetyl)pyrrolidin-3-yl)oxy)-4-oxobutanoic acid (Compound Q20-7) A                                      mixture                                      of N-(2-(2-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-2-oxoethoxy)ethoxyethyl)-1-(2-(-2-(2-(hept-6-ynamido)ethyl)acetyl)piperidine-4-carboxamide   (320 mg, 0.34 mmol, 1.0 eq.), succinic anhydride (207 mg, 2.07 mmol, 6.0 eq.), triethylamine (418 mg, 4.14 mmol, 12.0 eq.) and 4-dimethylaminopyridine (4.1 mg, 0.034 mmol, 0.1 eq.) in dichloromethane (5 mL) was stirred overnight at room temperature. The mixture was washed three times with 10% sodium bicarbonate solution, then extracted with dichloromethane. The organic phase was washed with 10% sodium bicarbonate solution and acetonitrile. The organic phase was concentrated to give 4-(((3R,5S)-5-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(2-(2-(-2-(2-(hept-6-ynamido)eth oxy)ethyl)acetyl)piperidine-4-carboxamido)ethoxy)acetyl)pyrrolidin-3-yl)oxy)-4-oxobutanoic acid as a yellow solid (380 mg, crude). 1H NMR (500 MHz, MeOD) 57.42-7.12 (m, 9H), 6.93-6.71 (m, 4H), 5.55-5.28 (m, 1H), 4.40 (dd, J = 44.2, 7.2 Hz, 2H), 4.32 - 4.16 (m, 3H), 3.91 - 3.82 (m, 2H), 3.77 (s, 6H), 3.72 - 3.60 (m, 8H), 3.54 (td, J = 13.4, 6.2 Hz, 6H), 3.35 (dd, J = 14.8, 9.4 Hz, 4H), 3.18-3.05 (m, 6H), 3.02-2.82 (m, 1H), 2.64 -2.41 (m, 6H), 2.39-2.24 (m, 1H), 2.17 (dtd, J = 17.2, 12.8, 5.6 Hz, 5H), 1.81-1.60 (m, 5H), 1.51 (dt, J = 14.4, 7.0 Hz, 3H).LCMS(ESI): m / z =727[(M-303)+H]+. Step 7: Preparation of Q20-CPG 100002 To solution of 4-(((3R,5S)-5-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(2-(2-(-2-(2-(hept-6-ynamido)eth oxy)ethyl)acetyl)piperidine-4-carboxamido)ethoxy)acetyl)pyrrolidin-3-yl)oxy)-4-oxobutanoic acid (380 mg, 0.37 mmol, 1.0 eq.) in N,N-dimethylformamide (10 mL) were added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (169 mg, 0.44 mmol, 1.2 eq.), 1-hydroxybenzotriazole (70 mg, 0.52 mmol, 1.4 eq.) and N,N-diisopropylethylamine (191 mg, 1.48 mmol, 4.0 eq.). The mixture was stirred at room temperature for 5 min. The solid support CPG-NH2 (1.9 g, loading: 1.19 g / mmol) was then added to the reaction mixture and the mixture was stirred overnight at room temperature. The mixture was filtered. The filter cake was washed successively with dichloromethane, acetonitrile, and dichloromethane, then dried in vacuo for 1 h. The residue was added to a mixed solution of pyridine / acetic anhydride (7.5 mL / 2.5 mL) and the mixture was stirred at room temperature for 3 h. The mixture was filtered. The filter cake was washed successively with dichloromethane, acetonitrile and dichloromethane, and then dried in vacuo for 1 h to give a pale yellow solid support Q20-CPG (2.08 g). Embodiment 11 Synthesis of Solid Support Q22-CPG HATU. HOBt, DIEA, DMF DMAP. Et3N, DCM Step 1. A mixture of B4 (5.0 g, 6.53 mmol, 1.0 eq.), Q22-1 (2.26 g, 6.86 mmol, 1.05 eq.), N,N-diisopropylethylamine     (1.68      g,      13.06     mmol,     2.0     eq.)      and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (3.72 g, 9.8 mmol, 1.5 eq.) in N,N-dimethylformamide (10 mL) was stirred at room temperature for 2 h. The reaction mixture was diluted with ethyl acetate, washed twice each with water, saturated sodium carbonate solution and saturated ammonium chloride solution, then washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to give crude Q22-2 (6.14 g). MS (ES+): m / z=1079.46 (M+H)+. 100002 Step 2. Crude Q22-2 (6.14 g) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (5 mL) was added while stirring. The system was stirred for reaction at room temperature for 1 h. The reaction mixture was concentrated under reduced pressure. The residue was diluted with dichloromethane, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to give crude Q22-3 (5.53 g). MS (ES+): m / z= 1023.25(M+H)+ Step 3. A mixture of crude Q22-3 (5.53 g), B08-2 (3.2 g, 5.67 mmol), N,N-diisopropylethylamine (1.4 g, 10.8 mmol) and    2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (3.07 g, 8.1 mmol) in N,N-dimethylformamide (10 mL) was stirred at room temperature for 2 h. The reaction mixture was diluted with ethyl acetate, washed twice each with water and saturated sodium carbonate solution, then washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by RP-HPLC to give the white oily target product Q22-4 (5.1 g; three-step reaction yield: 49.7%). 1H NMR (500 MHz, DMSO-d6) 8 7.90 - 7.77 (m, 5H), 7.61 (t, J = 5.9 Hz, 2H), 7.35 - 7.26 (m, 4H), 7.21 - 7.17 (m, 4H), 6.91 - 6.84 (m, 4H), 4.97 (s, 1H), 4.42 - 4.36 (m, 1H), 4.27 (d, J = 14.0 Hz, 1H), 4.19 (td, J = 8.6, 5.1 Hz, 2H), 4.11 (t, J = 13.4 Hz, 2H), 4.06 (s, 1H), 3.85 (d, J = 1.7 Hz, 4H), 3.73 (s, 7H), 3.62 - 3.46 (m, 17H), 3.46 - 3.35 (m, 9H), 3.19 (p, J = 7.5, 6.6 Hz, 9H), 3.10 - 3.01 (m, 5H), 2.90 (d, J = 12.7 Hz, 1H), 2.72 (d, J = 2.6 Hz, 2H), 2.54 (s, 1H), 2.43 - 2.30 (m, 1H), 2.18 - 2.04 (m, 11H), 2.01 (dd, J = 12.5, 5.9 Hz, 1H), 1.84 (ddd, J = 12.9, 8.3, 4.4 Hz, 1H), 1.64 (s, 2H), 1.56 (p, J = 7.5 Hz, 5H), 1.43 (ddq, J = 24.8, 17.3, 10.1, 8.8 Hz, 14H), 1.22 (q, J = 7.5 Hz, 4H).MS (ES+):m / z= 1267.30[(M-303)+H]+. Step 4. Q22-4 (5.1 g, 3.25 mmol, 1 eq.) was dissolved in dichloromethane (20 mL). Succinic anhydride (1.95 g, 19.5 mmol, 6.0 eq.), triethylamine (3.94 g, 39 mmol, 12.0 eq.) and 4-dimethylaminopyridine (39 mg, 0.325 mmol, 0.1 eq.) were added successively while stirring. The system was reacted at room temperature overnight. The reaction system was diluted with dichloromethane, then washed three times with 10% sodium bicarbonate solution and once with saturated sodium chloride solution. The organic phase was dried over anhydrous sodium sulfate and then concentrated to give a brown oil. 1H NMR (500 MHz, CDCl3) 8 7.57 (dt, J = 20.0, 5.0 Hz, 1H), 7.35 (d, J = 10.0 Hz, 2H), 7.29 - 7.19 (m, 6H), 7.22 - 7.17 (m, 3H), 7.08 - 6.90 (m, 4H), 6.69 -6.59 (m, 1H), 6.50 - 6.39 (m, 1H), 5.46 - 5.38 (m, 1H), 4.58 - 4.43 (m, 2H), 4.33 - 4.01 (m, 4H), 3.98 (d, J = 5.0 Hz, 4H), 3.79 - 3.78 (m, 7H), 3.67 - 3.60 (m, 16H), 3.57 (q, J = 5.0 Hz, 8H), 3.52 -3.49 (m, 2H), 3.48 - 3.43 (m, 5H), 3.43 - 3.38 (m, 2H), 3.38 - 3.31 (m, 1H), 3.27 (dq, J = 10.0, 5.0 Hz, 4H), 3.16 - 3.11 (m, 1H), 3.06 (s, 1H), 2.58 - 2.50 (m, 5H), 2.46 - 2.36 (m, 1H), 2.31 (dd, J = 100002 10.0, 5.0 Hz, 1H), 2.26 - 2.17 (m, 10H), 2.11 (td, J = 10.0, 5.0 Hz, 1H), 1.98 (t, J = 5.0 Hz, 2H), 1.84 (dt, J = 10.0, 5.0 Hz, 2H), 1.75 (dt, J = 15.0, 5.0 Hz, 6H), 1.65 (dt, J = 15.0, 5.0 Hz, 4H), 1.55 (dq, J = 15.0, 5.0 Hz, 9H), 1.39 - 1.33 (m, 4H). 13C NMR (126 MHz, CDCI3) S 174.77, 174.60, 173.25, 173.11, 173.02, 172.93, 172.20, 169.98, 169.87, 168.55, 168.04, 167.58, 167.51, 158.66, 158.47, 144.85, 135.86, 129.95, 128.00, 127.84, 126.84, 113.27, 113.13, 86.06, 84.18, 84.16, 73.19, 70.96, 70.92, 70.61, 70.54, 70.12, 70.04, 70.01, 70.00, 68.69, 55.22, 52.78, 52.19, 45.02, 39.44, 39.26, 39.07, 38.69, 38.57, 36.24, 35.90, 35.86, 32.87, 32.48, 31.22, 30.57, 29.32, 29.14, 28.72, 27.97, 26.51, 25.30, 25.25, 24.79, 22.73, 18.20, 9.05.MS (ES+):m / z= 1367.35[(M-303)+H]+. The above oil (5.26 g) was dissolved in N,N-dimethylformamide. N,N-diisopropylethylamine (1.63 g, 12.6 mmol), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.44 g, 3.78 mmol) and 1-hydroxybenzotriazole (510 mg, 3.78 mmol) were added while stirring. The mixture was stirred at room temperature for 5 min, and controlled pore glass (CPG, 5.3 g, loading: 1.2 mmol / g) was added to the reaction mixture. The system was stirred overnight at room temperature and filtered. The filter cake was washed successively with dichloromethane, acetonitrile, and dichloromethane, then dried in vacuo for 1 h. The dried solid support was added to a mixed solution of pyridine / acetic anhydride (20 mL / 7 mL) and the mixture was shaken at room temperature for 3 h. The mixture was filtered. The filter cake was successively washed with dichloromethane, acetonitrile, and dichloromethane and then dried in vacuo for 1 h to give a light yellow solid support Q22-CPG (10.2 g). Embodiment 12 Synthesis of Solid Support DT-Linker CPG 100002 NHFmoc 17                                                 DT-Linker-1                           DT-Linker-2                                         DT-Linker-3 HATU, HOBt, DIEA, DMF Step 1. Synthesis of Compound DT-Linker-1 Compound 3-(2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)ethoxy)propanoic acid (4.0 g, 11.3 mmol),        N,N-diisopropylethylamine        (3.6        g,        27.9        mmol), 5   2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (4.3 g, 11.3 mmol) were dissolved in N,N-dimethylformamide (40 mL) and the mixture was stirred at room temperature for 5 min. Compound 17 (3.93 g, 9.37 mmol) was dissolved in N,N-dimethylformamide (10 mL). The mixture was added to the above solution. The reaction system was stirred at room temperature for 1 h. The reaction mixture was diluted with saturated sodium bicarbonate solution and extracted with 10 dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (dichloromethane / methanol = 50:1, 0.5% triethylamine) to give a colorless oil (6.5 g, yield: 76.4%). LCMS: 756, Found 779 [M+23]+. Step 2. Synthesis of Compound DT-Linker-2 DT-Linker-1 (6.5 g, 8.60 mmol) was dissolved in ethyl acetate (76 mL), and diethylamine (12.6 g) 15 was added. The system was stirred overnight at room temperature. The reaction mixture was concentrated under reduced pressure. The residue was separated by column chromatography (dichloromethane / methanol = 20:1, 0.5% triethylamine ^ 10:1, 0.1% triethylamine) to give a white foamy solid (3.1 g, yield: 67.5%). LCMS: 534, found 535 [M+H]+. 1HNMR (500 MHz, Chloroform-d) 5 7.36 (d, J = 6.3 Hz, 2H), 7.33 - 7.13 (m, 7H), 6.81 (dt, J = 10.8, 6.3 Hz, 4H), 4.57 -20   4.24 (m, 2H), 4.17 - 3.91 (m, 1H), 3.78 (t, J = 5.4 Hz, 8H), 3.63 (h, J = 5.9, 5.0 Hz, 1H), 3.54 - 3.33 (m, 3H), 3.17 (dt, J = 21.6, 5.2 Hz, 1H), 2.88 - 2.64 (m, 3H), 2.47 (s, 3H), 2.29 - 1.96 (m, 3H). Step 3. Synthesis of Compound DT-Linker-3 (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-5-(tert-butoxy)-5-oxopentanoic acid (2.8 g, 100002                                                      61 6.59     mmol),     N,N-diisopropylethylamine     (1.4     g,     10.8     mmol)     and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (2.7 g, 7.10 mmol) were dissolved in N,N-dimethylformamide (20 mL) and the mixture was stirred at room temperature for 5 min. DT-Linker-2 (2.9 g, 5.43 mmol) was dissolved in N,N-dimethylformamide (9 mL). The mixture was added to the above solution. The reaction system was stirred at room temperature for 2 h. The reaction mixture was diluted with saturated sodium bicarbonate solution and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (dichloromethane / methanol = 50:1, 0.5% triethylamine) to give an off-white solid (4.48 g, yield: 87.7%). LCMS: 941, found 640 [M-DMTr+H]+. Step 4. Synthesis of Compound DT-Linker-4 DT-Linker-3 (4.48 g, 4.76 mmol) was dissolved in ethyl acetate (70 mL), and diethylamine (6.94 g) was added. The system was stirred overnight at room temperature. The reaction mixture was concentrated under reduced pressure and separated by column chromatography (dichloromethane / methanol = 50:1, 0.5% triethylamine) to give an orange foamy solid (3.46 g, yield: 101.1%). LCMS: 719, found 720 [M+H]+. Step 5. Synthesis of Compound DT-Linker-5 6-Azidohexanoic acid (906 mg, 5.77 mmol), N,N-diisopropylethylamine (1.9 g, 14.7 mmol) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (2.4 g, 6.31 mmol) were dissolved in N,N-dimethylformamide (20 mL). The mixture was stirred at room temperature for 5 min. DT-Linker-4 (3.46 g, 4.81 mmol) was dissolved in N,N-dimethylformamide (15 mL). The mixture was added to the above solution. The reaction system was stirred at room temperature for 1 h. The reaction mixture was diluted with saturated sodium bicarbonate solution and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (dichloromethane / methanol = 50:1, 0.5% triethylamine) to give a yellow oil (2.8 g, yield: 68.0%). LCMS: 858, found 881[M+Na]+. Step 6. Synthesis of Compound DT-Linker-6 DT-Linker-5 (2.8 g, 3.26 mmol) was dissolved in tetrahydrofuran (17 mL), methanol (8.5 mL) and water (8.5 mL). Lithium hydroxide monohydrate (1.38 g, 32.6 mmol) was added while stirring. The reaction system was stirred at room temperature overnight. Acetic acid (9 eq.) was added to the reaction mixture for neutralization, followed by concentration and extraction with dichloromethane. The organic layer was separated, dried, concentrated and separated by column chromatography (dichloromethane / methanol = 30:1, 0.1% triethylamine ^ 5:1, 0.1% triethylamine) to give an off-white oil (850 mg, yield: 32.7%). LCMS: 802, found 801 [M-H]-. Step 7: Synthesis of Compound DT-Linker-7 A mixture of Compound DT-Linker-6 (2.4 g, 2.99 mmol, 1.0 eq.), N,N-diisopropylethylamine (965 100002 mg, 7.48 mmol, 2.5 eq.), N-(2-(2-aminoethoxy)ethyl)-2,2,2-trifluoroacetamide hydrochloride (601 mg, 2.99 mmol, 1.0 eq.) and O-(6-chlorobenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.85 g, 4.49 mmol, 1.5 eq.) in N,N-dimethylformamide (20 mL) was stirred at room temperature for 1 h. The reaction mixture was diluted with water, and then extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 20 / 1) to give DT-Linker-7 as a yellow oil (1.75 g, yield: 59.3%). LCMS (ESI): m / z = 985 [M+H]+. Step 8: Preparation of Compound DT-Linker-8 A mixture of Compound DT-Linker-7 (1.75 g, 1.78 mmol, 1.0 eq.), succinic anhydride (534 mg, 5.34 mmol, 3.0 eq.), 4-dimethylaminopyridine (22 mg, 0.18 mmol, 0.1 eq.) and triethylamine (1.17 g, 11.55 mmol, 6.5 eq.) in dichloromethane (20 mL) was stirred overnight at room temperature. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated to give DT-Linker-8 as a dark purple oil (1.72 g, yield: 89.6%). LCMS (ESI): m / z = 1085 [M+H]+. Step 9: Synthesis of Solid Support DT-Linker-CPG A     mixture     of    DT-Linker-8     (1.25     g,     1.15     mmol,     1.0     eq.), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (525 mg, 1.38 mmol, 1.2 eq.), 1-hydroxybenzotriazole (218 mg, 1.61 mmol, 1.4 eq.) and N,N-diisopropylethylamine (594 mg, 4.61 mmol, 4.0 eq.) in dimethylformamide (60 mL) was stirred at room temperature for 5 min. Blank solid support CPG (6.25 g, loading: 1.19 g / mmol) was added to the reaction mixture, and the mixture was stirred overnight at room temperature on a shaker. The mixture was filtered. The filter cake was washed three times successively with dichloromethane, acetonitrile, and dichloromethane, and dried in vacuo for 1 h. The filter cake was added to a mixed solution of pyridine (45 mL) and acetic anhydride (15 mL) and the mixture was shaken on a shaker for 2 h. The mixture was filtered again. The filter cake was washed three times successively with dichloromethane, acetonitrile, and dichloromethane. The filter cake was dried in vacuo for 1 h to give DT-Linker-CPG as a yellow solid (6.43 g). Embodiment 13 siRNA Synthesis and Annealing On the LGC MerMade 12-channel nucleic acid synthesizer, oligonucleotide synthesis was performed at a 10-40 pmol scale using solid-phase oligonucleotide synthesis methods. An ammonolysis reagent 100002                                                   63 2010.2 was added to the synthesized oligonucleotide and the mixture was incubated at 45-80°C to separate the oligonucleotide from the solid support, releasing it into solution. The crude oligonucleotide was then precipitated with ethanol. After high-speed centrifugation, the supernatant was discarded. This was repeated twice to give the crude oligonucleotide and the precipitate was resuspended in 5 diethylpyrocarbonate-treated water. The crude oligonucleotide was purified by ion-pairing HPLC, and the collected product was dried to powder in a vacuum centrifugal dryer. The purified product was dissolved in diethylpyrocarbonate-treated water and analyzed by TOF LC-MS. After the purified peptide-sense strand conjugate was obtained, the nucleotide concentration was determined by dissolving it in diethylpyrocarbonate-treated water. The volume required for an 10 equimolar amount of sense and antisense strands was calculated. Equimolar amounts of the peptide-sense strand and the antisense strand were mixed thoroughly, heated at 75°C for 5 min, and annealed through natural cooling to room temperature to prepare the peptide-siRNA double strand. After the product was annealed through cooling to room temperature, it was diluted with 10 volumes of diethylpyrocarbonate-treated water and then transferred to a Millipore 15 mL ultrafiltration 15 centrifuge tube (molecular weight cutoff: 3 kDa) for ultrafiltration. This step aimed to remove residual chemical reagents (such as n-hexylamine) from the peptide and nucleic acid preparation process. The ultrafiltration centrifuge tube was centrifuged at 4000 RPM for approximately 40 min. Once the product volume was reduced to about 1 mL, the product was collected from the ultrafiltration tube and any residual product in the tube was washed with 20 diethylpyrocarbonate-treated water (3 mL). The ultrafiltered product was sterilized by filtration through a 0.22 pm membrane. The collected product was then dried to powder in a vacuum centrifugal dryer. After dissolution in an appropriate solvent, it could be used for subsequent in vivo and in vitro experiments. Embodiment 14 Synthesis of Peptide-Oligonucleotide Conjugate Ang2(K10N3)-12006.2-2 100002 1. Using conventional nucleotide monomers and special monomer B04, synthesis and purification were performed using the standard solid-phase oligonucleotide program according to the method of Embodiment 13 to obtain an oligonucleotide sense strand 12006SM2-B04 (33 mg, 4.56 pmol) modified with B04 at the 3'-terminus (theoretical molecular weight: 7230.8, measured molecular weight: 7230.8). 2. Synthesis of siRNA-BCN: In 30 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM2-B04 (33 mg, 4.56 pmol) was dissolved; in 15 mL of N,N-dimethylformamide, BCN-NHS (93 mg, 320 pmol) was dissolved. The N,N-dimethylformamide solution of BCN-NHS was mixed with the phosphate buffer of 12006SM2-B04, and the mixture was shaken at 40°C for 30 min. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (4.5 mL) and pre-chilled ethanol (150 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 3 mL). Then, the mixture was purified by HPLC and freeze-dried to give 12006SM2-B04-BCN as a white powder solid (23.4 mg, 3.16 pmol, yield: 69.3%) (theoretical molecular weight: 7407.02, measured molecular weight: 7408.14). 3. In 2.5 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM2-B04-BCN (5 mg, 0.85 pmol) was dissolved; in 1 mL of N,N-dimethylformamide, Ang2(K10N3) (2.5 mg, 1.0 pmol) was dissolved. The phosphate buffer of 12006SM2-B04-BCN was mixed with the N,N-dimethylformamide solution of Ang2(K10N3). The mixture was shaken for 2 h under nitrogen atmosphere, and the reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.3 mL) and pre-chilled ethanol (10 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 2 mL). Then, the mixture was purified by HPLC and freeze-dried to give Ang2(K10N3)-B04-12006SM2 as a white powder solid (3.5 mg, 0.35 pmol, yield: 41%) (theoretical molecular weight: 9889.73, measured molecular weight: 9890.58). 4. Ang2(K10N3)-B04-12006SM2 was mixed with 12006AM2 and annealed according to the method in Embodiment 13 to give Ang2(K10N3)-12006.2-2. Embodiment 15 Synthesis of Peptide-Oligonucleotide Conjugate Ang2(K10N3)-12006.1-1 100002 1. Using conventional nucleotide monomers and special monomer B12, synthesis and purification were performed using the standard solid-phase oligonucleotide program according to the method of Embodiment 13 to obtain an oligonucleotide sense strand 12006SM1-B12 modified with an alkyne group at the 3'-terminus (theoretical molecular weight: 7388.78, measured molecular weight: 7387.59). 2. In 2.5 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM1-B12 (10 mg, 1.35 pmol) was dissolved; in 1 mL of N,N-dimethylformamide, Ang2(K10N3) (5 mg, 2.0 pmol) was dissolved. The phosphate buffer of 12006SM1-B12 was mixed with the N,N-dimethylformamide solution of Ang2(K10N3). Under nitrogen atmosphere, copper(II) sulfate pentahydrate (6.8 mg, 27 pmol), tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 5.9 mg, 13.5 pmol), and sodium L-ascorbate (NaVc, 10.3 mg, 54 pmol) were added and reacted at 40°C for 1 h. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.3 mL) and pre-chilled ethanol (10 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 2 mL). Then, the mixture was purified by HPLC and freeze-dried to give Ang2(K10N3)-B12-12006SM1 as a white powder solid (4.6 mg, 0.47 pmol, yield: 35%) (theoretical molecular weight: 9868.88, measured molecular weight: 9869.42). 3. Ang2(K10N3)-B12-12006SM1 was mixed with 12006AM1 and annealed according to the method in Embodiment 13 to give Ang2(K10N3)-12006.1-1. Embodiment 16 Synthesis of BiAng2(K10N3)-12006.1-1 100002 0.1M pH 7.4 PB buffer / DMF, 40°C. 60 min Ang2(K10N3) BPL-2 CuSO4-5H2O (20 eq.), THPTA (10 eq.), NaVc (40 eq.) 1. Using conventional nucleotide monomers and special monomer B08, synthesis and purification were performed using the standard solid-phase oligonucleotide program according to the method of Embodiment 13 to obtain an oligonucleotide sense strand 12006SM1-B08 modified with an amino 5 group at the 3'-terminus (theoretical molecular weight: 7279.63, measured molecular weight: 7279.64). 2. In 20 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM1-B08 (160 mg, 22 pmol) was dissolved; in 10 mL of N,N-dimethylformamide, BPL-2 (569 mg, 660 pmol) was dissolved. The N,N-dimethylformamide solution of BPL-2 was mixed with the phosphate buffer of 12006SM1-B08, 10 and the mixture was shaken at 40°C for 60 min. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (3 mL) and pre-chilled ethanol (90 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 5 mL). Then, the mixture was purified by HPLC 15 and freeze-dried to give 12006SM1-B08-BPL-2 as a white powder solid (120 mg, 14.9 pmol, yield: 68%) (theoretical molecular weight: 8028.56, measured molecular weight: 8027.78). 3. In 10 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM1-B08-BPL-2 (20 mg, 2.5 pmol) was 100002                                                   67 dissolved; in 10 mL of N,N-dimethylformamide, Ang2(K10N3) (30 mg, 12 pmol) was dissolved. The N,N-dimethylformamide solution of Ang2(K10N3) was mixed with the phosphate buffer of 12006SM1-B08-BPL-2. Under nitrogen atmosphere, copper(II) sulfate pentahydrate (12.5 mg, 50 pmol), tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 10.9 mg, 25 pmol) and sodium L-ascorbate (NaVc, 19.1 mg, 100 pmol) were added and reacted at 40°C for 2 h. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.3 mL) and pre-chilled ethanol (90 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 2 mL). Then, the mixture was purified by HPLC and freeze-dried to give BiAng2(K10N3)-B08-12006SM1 as a white powder solid (9.4 mg, 0.72 pmol, yield: 29%) (theoretical molecular weight: 12993.25, measured molecular weight: 12992.92). 4. BiAng2(K10N3)-B08-12006SM1 was mixed with 12006AM1 and annealed according to the method in Embodiment 13 to give BiAng2(K10N3)-12006.1-1. Embodiment 17 Synthesis of BiAng2-12006.2-2 ss Ang2-AZK Cu(I)-free click reaction 12006AM2 Annealing 1. In 4 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM2-B04 (9 mg, 1.24 pmol) was dissolved; in 4 mL of N,N-dimethylformamide, BPL-3  (61 mg, 70 pmol) was dissolved. The N,N-dimethylformamide solution of BPL-3 was mixed with the phosphate buffer of 12006SM2-B04, and the mixture was shaken at room temperature for 60 min. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.8 mL) and pre-chilled ethanol (30 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 100002                                                   68 2010.2 15000 rpm), and the supernatant was discarded. Then, the mixture was purified by HPLC to give 12006SM2-B04-BPL-3 (3.9 mg, 0.48 pmol, yield: 38.7%) (theoretical molecular weight: 8115.89, measured molecular weight: 8115.57). 2. In 2.5 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM2-B04-BPL-3 (3.9 mg, 0.48 pmol) was dissolved; in 1.5 mL of N,N-dimethylformamide, Ang2-AZK (4.7 mg, 1.91 nmol) was dissolved. The phosphate buffer of 12006SM2-B04-BPL-3 was mixed with the N,N-dimethylformamide solution of Ang2-AZK. The mixture was shaken for 2 h under nitrogen atmosphere. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.7 mL) and pre-chilled ethanol (20 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 2 mL). Then, the mixture was purified by HPLC and freeze-dried to give BiAng2-B04-12006SM2 as a white powder solid (3.1 mg, 0.24 pmol, yield: 47.9%) (theoretical molecular weight: 13027.26, measured molecular weight: 13027.09). 3. BiAng2-B04-12006SM2 was mixed with 12006AM2 and annealed according to the method in Embodiment 13 to give BiAng2-12006.2-2. Embodiment 18 Synthesis of BiAng2-2-12006.2-2 Ang2-AZK Cu(i)-free click reaction 12006AM2 Annealing 1. Synthesis of siRNA-BCN: In 5 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM2-B04 (9 mg, 1.24 pmol) was dissolved; in 5 mL of N,N-dimethylformamide, BPL-1 (61 mg, 70 pmol) was dissolved. The N,N-dimethylformamide solution of BPL-1 was mixed with the phosphate buffer of 12006SM2-B04, and the mixture was shaken at room temperature for 60 min. The reaction was 100002 monitored by LC-MS until completion. Then, 3 M sodium chloride solution (1 mL) and pre-chilled ethanol (30 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 3 mL). Then, the mixture was purified by HPLC and freeze-dried to give 12006SM2-B04-BPL-1 as a white powder solid (6.8 mg, 0.87 pmol, yield: 70.2%) (theoretical molecular weight: 7826.58, measured molecular weight: 7826.49). 2. Cu(I)-free click chemistry reaction: In 3.5 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM2-B04-BPL-1 (6.8 mg, 0.87 pmol) was dissolved; in 2 mL of N,N-dimethylformamide, Ang2-AZK (8.5 mg, 3.5 pmol) was dissolved. The phosphate buffer of 12006SM2-B04-BPL-1 was mixed with the N,N-dimethylformamide solution of Ang2-AZK. The mixture was shaken for 2 h under nitrogen atmosphere at room temperature. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.5 mL) and pre-chilled ethanol (15 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 2 mL). Then, the mixture was purified by HPLC and freeze-dried to give BiAng2-2-B04-12006SM2 as a white powder solid (3.8 mg, 0.31 pmol, yield: 35.6%) (theoretical molecular weight: 12735.94, measured molecular weight: 12736.97). 3. BiAng2-2-B04-12006SM2 was mixed with 12006AM2 and annealed according to the method in Embodiment 13 to give BiAng2-2-12006.2-2. Embodiment 19 Synthesis of BiAng2(K10N3)-Q22-12006.3-5 100002 1. Synthesis of 12006SM5-Q22: Using the solid support Q22-CPG, synthesis and purification were performed using the standard solid-phase oligonucleotide program according to the method of Embodiment 13 to obtain an oligonucleotide sense strand 12006SM5-Q22 modified with a bis-alkyne 5 group at the 3'-terminus (theoretical molecular weight: 8276.07, measured molecular weight: 8275.66) 2. Synthesis of BiAng2(K10Ns)-Q22-12006SM5: In 3 mL of phosphate buffer (0.1 M, pH 7.4), 12006SM5-Q22 (25.5 mg, 3.08 pmol) was dissolved; in 3 mL of N,N-dimethylformamide, Ang2(K10N3) (30.6 mg, 12.3 pmol) was dissolved. The phosphate buffer of 12006SM5-Q22 was 10 mixed with the N,N-dimethylformamide solution of Ang2(K10N3). Under nitrogen atmosphere, copper(II) sulfate pentahydrate (23.1 mg, 92.4 pmol), tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 20.1 mg, 46.2 pmol), and sodium L-ascorbate (NaVc, 35.3 mg, 184.8 pmol) were added and reacted at 40°C for 1 h. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.6 mL) and pre-chilled ethanol (20 mL) were added to the reaction 15 mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water 100002 (approximately 2 mL). Then, the mixture was purified by HPLC and freeze-dried to give BiAng2(K10N3)-Q22-12006SM5 as a white powder solid (18.3 mg, 1.38 pmol, yield: 44.8%) (theoretical molecular weight: 13241.48, measured molecular weight: 13241.31). 4. BiAng2(K10N3)-Q22-12006SM5 was mixed with 12006AM3 and annealed according to the 5 method in Embodiment 13 to give BiAng2(K10N3)-Q22-12006.3-5. Embodiment 20 Synthesis of Dual-Target Compound BiAng2(K10N3)-12006-8022 HO 2006SM2-8022SM2-DT BiAng2(K10N3)-12006SM2-8022SM2 BiAng2(K10N3)-12006-8022 1. Synthesis of 12006SM2-DT: Using the solid support DT-Linker CPG, synthesis and purification were performed using the standard solid-phase oligonucleotide program according to the method of 10 Embodiment 13 to obtain an oligonucleotide sense strand 12006SM2-DT modified with azide and primary amine reactive groups at the 3'-terminus (theoretical molecular weight: 7588.29, measured molecular weight: 7587.44). 100002 2. Synthesis of 8022SM2-B12: Synthesis was performed using the method of Embodiment 15 to obtain an oligonucleotide sense strand 8022SM2-B12 modified with a single alkyne group at the 3'-terminus (molecular weight: 7445.06, measured: 7444.33). 3. Synthesis of 12006SM2-8022SM2-DT: 12006SM2-DT (20 mg, 2.64 pmol, 1 eq.) and 8022SM2-B12 (20.6 mg, 2.77 pmol, 1.05 eq.) were dissolved in 2 mL of phosphate buffer (0.1 M, pH 7.4). Under nitrogen protection, a solution of copper(II) sulfate pentahydrate (13.2 mg, 52.8 pmol, 20 eq.) and tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 11.5 mg, 26.4 pmol, 10 eq.) in N,N-dimethylformamide (2 mL) and sodium L-ascorbate (NaVc, 20.2 mg, 105.6 pmol, 40 eq.) were added. The mixture was reacted at 40°C for 1 h. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (0.4 mL) and pre-chilled ethanol (15 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (approximately 2 mL) and ultrafiltered to give crude 12006SM2-8022SM2-DT (40 mg, theoretical molecular weight: 15,033.38; measured molecular weight: 15,033.49). 4. The crude 12006SM2-8022SM2-DT was dissolved in 5 mL of phosphate buffer (0.1 M, pH 7.4), followed by the addition of a N,N-dimethylformamide solution (5 mL) of BPL-2 (92 mg, 105.6 pmol). The mixture was reacted at 40°C for 1 h. The reaction was monitored by LC-MS until completion. Then, the mixture was ultrafiltered to give crude 12006SM2-8022SM2-DT-BPL-2 (32 mg, theoretical molecular weight: 15779.31, measured molecular weight: 15781.37). 5. The crude 12006SM2-8022SM2-DT-BPL-2 (10 mg) was dissolved in 5 mL of phosphate buffer (0.1 M, pH 7.4). Ang2(K10N3) (7.8 mg, 3.14 pmol) was dissolved in 3 mL of N,N-dimethylformamide. The two solutions were mixed. Under nitrogen protection, a solution of copper(II) sulfate pentahydrate (3.2 mg, 12.6 pmol) and tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 2.7 mg, 6.3 pmol) in N,N-dimethylformamide (2 mL) and sodium L-ascorbate (NaVc, 4.8 mg, 25.2 pmol) were added. The mixture was reacted for 1 h at 40°C. The reaction was monitored by LC-MS until completion. Then, 3 M sodium chloride solution (1 mL) and pre-chilled ethanol (30 mL) were added to the reaction mixture. After thorough shaking, the mixture was centrifuged for 3 min (4°C, 15000 rpm), the supernatant was discarded, and the precipitate was dissolved in diethylpyrocarbonate-treated water (2 mL). Then, the mixture was purified by HPLC and freeze-dried to give BiAng2(K10N3)-12006SM2-8022SM2 as a white powder solid (5.2 mg, 0.27 100002                                                   73 umol) (theoretical molecular weight: 20,744.72; measured molecular weight: 20,745.9). 6. BiAng2(K10N3)-12006SM2-8022SM2, 12006AM2 and 8022AM4 were mixed and annealed according to the method in Embodiment 13 to give BiAng2(K10N3)-12006-8022. The structures and sequences of the peptide-oligonucleotide conjugates and C16-modified 5 nucleotides synthesized by the present invention using the above methods are shown in Tables 2-1 and 2-2 below. Table 2-1 Name Type of Structure Modified Sense Strand Sequence 5'->3' Modified Antisense Strand Sequence 5'->3' 12006.2-2 / mC*mA*mCmA mAmGfUmUfCf UdTmUmGmA mGmCmAmAm AmUmA VPU*fA*mU mUmUmGm CmUmCmAm AdAmGfAm AfCmUmUm G*mU*mG Ang2-12006.2-2 Ang2-B04-BCN-siRNA Reversed-Ang2-12006.2-2 Reversed-Ang2-B04-BCN-si RNA Ang2(K10AZK)-12006.2-2 Ang2(K10AZK)-B04-BCN-si RNA Ang2(K10N3)-12006.2-2 Ang2(K10N3)-B04-BCN-siR NA L57-12006.2-2 L57-B04-BCN-siRNA BiAng2-12006.2-2 BiAng2-B04-BCN-siRNA BiAng2-2-12006.2-2 BiAng2-2-B04-BCN-siRNA Ang2-Ang2-12006.2-2 Ang2-Ang2-B04-BCN-siRN A BiAng2(K10N3)-12006.2-2 BiAng2(K10N3)-B08-siRNA 12006.1-1 / mC*mA*mCmA mAmGfUmUfCf UdTmUmGmA mGmCmAmGm AmUmA VPU*fA*mU mCmUmGmC mUmCmAm AdAmGfAm AfCmUmUm G*mU*mG BiAng2-12006.1-1 BiAng2-B08-siRNA BiAng2(K10N3)-12006.1-1 BiAng2(K10N3)-B08-siRNA BiL57-12006.1-1 BiL57-B08-siRNA Ang2(K10N3)-12006.1-1 Ang2(K10N3)-B 12-siRNA L57-12006.1-1 L57-B12-siRNA C16(6-G)-12006.1-1 / mC*mA*mCmA mAGhdfUmUf CfUdTmUmGm AmGmCmAmG mAmUmA VPU*fA*mU mCmUmGmC mUmCmAm AdAmGfAm AfCmUmUm G*mU*mG 100002 C16(7-U)-12006.2-2 / mC*mA*mCmA mAmGUhdmUf CfUdTmUmGm AmGmCmAmA mAmUmA VPU*fA*mU mUmUmGm CmUmCmAm AdAmGfAm AfCmUmUm G*mU*mG C16(6-G)-12006.3-5 / mC*mA*mCmA mAGhdmUmUf CfUfUfUmGfA mGmCmAmGm AmUmA VPU-S*fA*m UmCmUmG mCmUmCmA mAdAmGfA mAfCmUmU mG*mU*mG Bi-Sym-Ang2(K10N3)-1200 6.1-1 Bi-Sym-Ang2(K10N3)-2-B08 -siRNA mC*mA*mCmA mAmGfUmUfCf UdTmUmGmA mGmCmAmGm AmUmA VPU*fA*mU mCmUmGmC mUmCmAm AdAmGfAm AfCmUmUm G*mU*mG Bi-Sym-Ang2(K10Peg2N3)- 12006.1-1 Bi-Sym-Ang2(K10Peg2N3)-2 -B08-siRNA Ang2(S7KN3)-12006.1-1 Ang2(S7KN3)-B12-siRNA Ang2(K15N3)-12006.1-1 Ang2(K15N3)-B12-siRNA BiAng1(K10N3)-12006.1-1 BiAng1(K10N3)-B08-siRNA BiAng2(K10N3)-12006.3-1 BiAng2(K10N3)-B08-siRNA mC*mA*mCmA mAmGfUmUfCf UdTmUmGmA mGmCmAmGm AmUmA VPU-S*fA*m UmCmUmG mCmUmCmA mAdAmGfA mAfCmUmU mG*mU*mG BiAng2(S7KN3)-12006.3-1 BiAng2(S7KN3)-B08-siRNA BiAng2(K10N3)-12006.3-5 BiAng2(K10N3)-B08-siRNA mC*mA*mCmA mAmGmUmUf CfUfUfUmGfA mGmCmAmGm AmUmA VPU-S*fA*m UmCmUmG mCmUmCmA mAdAmGfA mAfCmUmU mG*mU*mG BiAng2(K10N3)-Q22-12006 .3-5 BiAng2(K10N3)-Q22-siRNA 100002 BiAng2(K10N3)-12006-802 2 BiAng2(K10N3)-Bi-siRNA 12006SM2 (siRNA-1): mC *mA*mCmA mAmGfUmUfCf UdTmUmGmA mGmCmAmAm AmUmA; 8022SM2 (siRNA-2): mU*mG*mGm GmAmUmCmA fUmCfAmUfAm AmGmUmUmG mUmAmA 12006AM2 (siRNA- 1):VP U*fA*mUmU mUmGmCm UmCmAmAd AmGfAmAfC mUmUmG*m U*mG; 8022AM4 (siRNA-2): VPU-S*fU*m AmCmAmA mCmUmUm AmUdGmAf UmGfAmUm CmCmCmA* mA*mC BiAng2(K10N3)-Q22-AD17 47580 BiAng2(K10N3)-Q22-siRNA mG*mA*mGm CmAmAmGmU fGfAfCmAmAm AmUmGmUmU mG*mG*mA VPU*dC*mC mAdAmCdA mUmUmUm GdTmCfAmC mUmUmGm CmUmC*mU *mU Unmodified sequences corresponding to the modified nucleotide sequences in Table 2-1 are shown in Table 2-2 below. Table 2-2 Unmodified Nucleotide Sequences Name Nucleotide Sequence (5’-3’) 12006.2-2 Sense strand CACAAGUUCUTUGAGCAAAUA (SEQ ID NO: 7) Antisense strand UAUUUGCUCAAAGAACUUGUG (SEQ ID NO: 8) 12006.1-1 Sense strand CACAAGUUCUTUGAGCAGAUA (SEQ ID NO: 9) Antisense strand UAUCUGCUCAAAGAACUUGUG (SEQ ID NO: 10) 12006.3-5 Sense strand CACAAGUUCUUUGAGCAGAUA (SEQ ID NO: 11) Antisense strand UAUCUGCUCAAAGAACUUGUG (SEQ ID NO: 12) 100002 12006.3-1 Sense strand CACAAGUUCUTUGAGCAGAUA (SEQ ID NO: 13) Antisense strand UAUCUGCUCAAAGAACUUGUG (SEQ ID NO: 14) 8022.4-2 Sense strand UGGGAUCAUCAUAAGUUGUAA (SEQ ID NO: 15) Antisense strand UUACAACUUAUGAUGAUCCCAAC (SEQ ID NO: 16) AD1747580 Sense strand GAGCAAGUGACAAAUGUUGGA (SEQ ID NO: 17) Antisense strand UCCAACAUUUGTCACUUGCUCUU (SEQ ID NO: 18) The specific structures of peptide-oligonucleotide conjugates are as follows: Ang2-B04-BCN-siRNA HO—Y-E-E-T-K-F-N-N-R K-G-R-S-G-G-Y-F-F-T~]f NH2 O 10 Reversed Ang2-B04-BCN-siRNA O HN-G-R-S-G-G-Y-F-F-T--H Ang2(K10AZK)-B04-BCN-siRNA O HN-G-R-S-G-G-Y-F-F-T-Ac Ang2(K10N3)-B04-BCN-siRNA L57-B04-BCN-siRNA 100002 BiL57-B03-siRNA Ang2(K10N3)-B12-siRNA 100002 0 0 100002 BiAng2(K10N,)-Q22-siRNA siRNA-1 BiAng2(K10N3)-Bi-siRNA siRNA-2 The sense strand molecular weights and purities of the peptide-oligonucleotide conjugates and C16-modified nucleotides synthesized by the present invention are shown in Table 3 below. 5                                                  Table 3 Name Theoretical Molecular Weight of Sense Strand Measured Molecular Weight of Sense Strand Purity of Double-Strande d Conjugate (%) 12006.2-2 / / 90.0 Ang2-12006.2-2 9864.72 9864.72 96.0 Reversed-Ang2-12006.2-2 9903.76 9904.54 96.5 Ang2(K10AZK)-12006.2-2 9734.52 9736.46 95.0 Ang2(K10Ns)-12006.2-2 9889.73 9890.58 90.0 L57-12006.2-2 10088.18 10086.88 96.1 BiAng2-12006.2-2 13027.26 13027.09 93.9 BiAng2-2-12006.2-2 12735.94 12736.97 95.9 Ang2-Ang2-12006.2-2 12418.47 12418.47 95.8 BiAng2-12006.1-1 12939.94 12938.86 94.4 BiAng2(K10Ns)-12006.1-1 12993.25 12992.92 93.1 BiL57-12006.1-1 13386.85 13385.50 94.8 Ang2(K10N3)-12006.1-1 9868.88 9869.42 87.0 L57-12006.1-1 10066.91 10066.67 90.5 C16(6-G)-12006.1-1 7164.93 7164.34 99.01 C16(7-U)-12006.2-2 7160.97 7160.52 91.57 C16(6-G)-12006.3-5 7156.86 7156.06 93.3 Bi-sym-Ang2(K10N3)-12006.1-1 13153.8 13150.0 97.6 Bi-sym-Ang2(K10Peg2N3)-12006.1-1 13444.1 13440.6 99.0 100002 Ang2(S7KN3)-12006.1-1 9911.85 9911.2 98.6 Ang2(K15Ns)-12006.1-1 9868.88 9868.43 96.4 BiAng1(K10N3)-12006.1-1 13025.37 13023.6 97.15 BiAng2(K10N3)-12006.3-1 12993.98 12992.92 95.7 BiAng2(S7KN3)-12006.3-1 13075.44 13074.96 97.5 BiAng2(K10N3)-12006.3-5 12985.17 12985.62 93.9 BiAng2(K10N3)-Q22-12006.3-5 13241.48 13241.31 99.8 BiAng2(K10N3)-12006.2-2 13027.26 13027.43 98.9 BiAng2(K10N3)-12006-8022 20745.9 20745.9 94.7 BiAng2(K10N3)-Q22-AD1747580 13439.70 13439.62 98.3 Embodiment 21 Testing the Effects of Linkage Sites on the In Vivo Activity of Peptide-siRNA in Wild-Type Mice via Intrathecal Injection 1. Drug Preparation Following freeze-drying to obtain the APP-targeting peptide-siRNA double-stranded powder (peptide-oligonucleotide conjugate), the peptide-siRNA drug was prepared in a sterile environment using artificial cerebrospinal fluid (CSF) as the solvent, with a stock solution concentration of 20 mg / mL. 2. Grouping and Administration Four-week-old female C57 wild-type mice of similar body weight were selected as experimental animals and randomized into different groups, with 6 mice per group for drug administration. After anesthetizing the mice, the peptide-siRNA drug was administered via intrathecal injection at a dose of 10 mg / kg (approximately 0.25 mg per mouse). On the day of drug injection, mice were observed for condition after recovery from anesthesia, and body weight was recorded daily. 3. Sampling and Testing Mice were euthanized on Day 10 of administration, and tissue samples were collected from the cerebral cortex, brainstem, hypothalamus, hippocampus, and cervical spinal cord. Tissue samples were preserved in RNA Later to prevent RNA degradation. RNA was subsequently extracted from each brain tissue using TRI REAGENT (MRC, Cat. No.: TR118). The extracted RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara, Cat. No.: RR047A). The prepared QPCR system was added to a 96-well PCR plate, the plate was sealed with sealing film, and QPCR was conducted on a StepOnePlus real-time PCR System (Applied Biosystems) to detect mAPP (mouse APP) expression. Besides, the content of the mAPP-targeting antisense strand in brain 100002 tissue was detected by LC-MS. Mice were euthanized on Day 10 of administration and tissue samples were collected to detect mAPP expression levels and content. Results are shown in Table 4. At a dose of 10 mg / kg, the in vivo activity of APP siRNA varied among different peptide delivery systems. C16(7-U)-12006.2-2 (the nucleotide residue at position 7 of the sense strand was modified with a hexadecyl fatty chain) was used as the positive control, while 12006.2-2 was a naked strand sequence without conjugation to peptide or C16. Multiple peptide-siRNA sequences demonstrated significant target gene degradation effects in mice. Table 4. Effects of Different Linkage Sites on Ang2 on the In Vivo Activity of Peptide-siRNAs in Mice Peptide-siRNA Residual mAPP RNA (%) Cerebral Cortex Brainste m Hypothal amus Hippocam pus Cervical Spinal Cord 12006.2-2 120.49 23.08 44.21 53.26 20.87 Ang2-12006.2-2 20.59 10.38 17.82 21.72 5.64 Reverse-Ang2-12006.2-2 59.58 26.84 56.18 53.59 3.81 Ang2(K10AZK)-12006.2-2 14.09 23.32 22.54 21.43 2.08 C16(7-U)-12006.2-2 41.06 9.19 16.94 23.29 7.00 The results in Table 4 showed that Ang2-12006.2-2 (siRNA conjugated to the N-terminus of the Ang2 peptide) exhibited favorable activity in various brain tissues, particularly in the cerebral cortex, where its activity was superior to that of the positive control C16(7-U)-12006.2-2. The naked chain 12006.2-2 exhibited favorable activity only in the cervical spinal cord. This indicates that the Ang2 peptide delivers mAPP-targeting siRNA to mouse brain tissue cells to exert efficacy and its delivery effect is superior to that of C16. Further testing on how the Ang2 linkage methods affect delivery efficiency showed that the peptide-siRNA with mAPP siRNA linked to the amino acid at position 10 of Ang2 (Ang2(K10AZK)-12006.2-2) exhibited optimal activity; delivery efficiency was reduced for mAPP siRNA when mAPP siRNA was linked to the C-terminus of Ang2 (Reverse-Ang2-12006.2-2) compared to Ang2(K10AZK)-12006.2-2. These results indicate that linkage at the amino acid at position 10 of Ang2 delivers mAPP siRNA more effectively to brain tissue cells in mice, allowing the mAPP-targeting siRNA to exert better efficacy. Embodiment 22 Testing the Effects of Linking Monopeptides or Dipeptides on the In Vivo Activity of Peptide-siRNA in Wild-Type Mice via Intrathecal Injection This Embodiment tested the effects of Ang2 linkage methods, tandem dipeptides, and parallel dipeptides on the in vivo activity of peptide-siRNA. Following intrathecal injection into 4-week-old 100002 female C57 wild-type mice according to the method of Embodiment 21, mice were euthanized on Day 11 and different brain tissues were collected to detect mAPP expression levels. Results are shown in Table 5. Table 5. Effects of Different Forms of Monopeptides / Dipeptides on In Vivo Activity of Peptide-siRNA in Mice Peptide-siRNA Residual mAPP RNA (%) Cerebral Cortex Brainste m Hypothala mus Hippoca mpus Cervical Spinal Cord Ang2-12006.2-2 39.43 16.00 36.32 51.53 5.82 Ang2(K10Ns)-12006.2-2 24.59 13.53 23.70 21.73 7.70 L57-12006.2-2 37.81 12.85 16.54 26.24 5.12 Ang2-Ang2-12006.2-2 22.49 9.74 20.63 25.34 4.77 BiAng2-12006.2-2 16.69 14.32 20.31 22.94 3.46 BiAng2-2-12006.2-2 54.26 11.97 16.11 28.54 3.62 The results in Table 5 showed that all peptide-siRNAs exhibited good activity in the brainstem and cervical spinal cord. In the cerebral cortex, compared with linking mAPP siRNA to the N-terminus of Ang2 and to the C-terminus of L57, linking mAPP siRNA to the lysine at position 10 of Ang2 (Ang2(K10N3)), tandem dipeptide (Ang2-Ang2), or parallel dipeptide (BiAng2) significantly enhanced the activity of peptide-siRNA, with the BiAng2-12006.2-2 group exhibiting the highest activity. This demonstrates that linking dipeptides to siRNA enhances its delivery efficiency, and further indicates that the linkage site on the peptide significantly impacts the activity of peptide-siRNA. It was also found that BiAng2-2-12006.2-2 exhibited poor activity compared to other peptide-siRNAs, indicating that the structure of the linker segment also significantly impacts the activity of peptide-siRNA. Embodiment 23 Testing the Effects of Dipeptide Linkage Sites on the In Vivo Activity of Peptide-siRNA in Wild-Type Mice via Intracisterna Magna Injection This embodiment tested the impact of different dipeptide linkage methods on the activity of peptide-siRNA. Except for the route of administration, other experimental methods were the same as those in Embodiment 21. This Embodiment employed intracisterna magna injection for drug administration, with each mouse receiving a dose of 0.25 mg. Following drug administration, mice were euthanized on Day 17, and various brain tissues were collected to detect mAPP expression levels. Results are shown in Table 6. Table 6. Effects of Different Linkage Forms of Dipeptides on Activity of Peptide-siRNA in Mice 100002 Peptide-siRNA Residual mAPP RNA (%) Cerebral Cortex Brainst em Hypothal amus Hippocam pus Cervical Spinal Cord BiAng2-12006.1-1 15.26 5.69 37.01 22.00 10.72 BiAng2(K10N3)-12006.1 -1 7.28 2.72 14.37 13.80 3.95 The results in Table 6 showed that Ang2 in parallel configuration exhibited excellent drug delivery efficacy across various brain tissues. Among these, linking siRNA to the lysine at position 10 of Ang2 (BiAng2(K10N3)-12006.1-1) displayed higher activity than linking siRNA to the N-terminus. Embodiment 24 Testing the Effects of Linking Monopeptides or Dipeptides on the In Vivo Activity of Peptide-siRNA in Wild-Type Rats via Intracisterna Magna Injection This embodiment tested the in vivo activity of the peptide-siRNA of the present invention in rats. Except for the route of administration and experimental animals, other experimental methods were the same as those in Embodiment 21. In this Embodiment, the drug was administered to rats via intracisterna magna injection at a dose of 1 mg per rat. Rats were euthanized on Days 21 and 42, and different brain tissues were collected to detect rAPP (rat APP) expression levels. Results are shown in Tables 7 and 8. Table 7. Effects of Different Forms of Ang2 on the Activity of Peptide-siRNA in Rats over 21 Days Peptide-siRNA Residual rAPP RNA (%) Cerebral Cortex Brainst em Hypothala mus Hippocam pus Cervical Spinal Cord BiAng2-12006.1-1 17.74 25.48 39.86 19.81 17.54 BiAng2(K10N3)-12006.1 -1 5.66 8.62 20.49 6.34 7.37 Ang2(K10N3)-12006.1-1 6.45 18.01 42.17 11.19 13.76 The results in Table 7 showed that on Day 21, Ang2(K10N3)-12006.1-1 in its monopeptide form exhibited significantly enhanced activity compared with BiAng2-12006.1-1, which was linked to the N-terminus of Ang2 in a dipeptide form. This further demonstrates that linking siRNA to lysine at position 10 of Ang2 confers higher activity. Simultaneously, it was discovered that the peptide-siRNA in the dual Ang2(K10N3) form (BiAng2(K10N3)-12006.1-1) exhibited further enhanced activity compared with the peptide-siRNA in the single Ang2(K10N3) form (Ang2(K10N3)-12006.1-1), further demonstrating that linking dipeptides to siRNA enhances its delivery efficiency. Table 8. Effects of Different Forms of Ang2 on the Activity of Peptide-siRNA in Rats over 42 Days Peptide-siRNA Residual rAPP RNA (%) Cerebral Brainst Hypothala Hippocam Cervical Cortex em mus pus Spinal 100002 Cord BiAng2-12006.1-1 13.77 23.61 34.56 21.71 21.44 BiAng2(K10N3)-12006.1-1 10.13 7.42 12.35 8.66 6.62 The results in Table 8 showed that on Day 42, BiAng2(K10N3)-12006.1-1 and BiAng2-12006.1-1 still maintained extremely high target inhibition activity, indicating that using the Ang2 peptide to deliver siRNA can achieve very long-lasting efficacy. Moreover, on Day 42, the peptide-siRNA in the dual Ang2(K10N3) form (BiAng2(K10N3)-12006.1-1) maintained activity better than the BiAng2-12006.1-1 in the dipeptide form. Embodiment 25 Testing the In Vivo Activity of Peptide-siRNA via Intrathecal Injection in Wild-type Mice This Embodiment compared the in vivo activity of the peptide-siRNA (BiAng2(K10N3)-12006.1-1) of the present invention with that of the hexadecyl chain-modified oligonucleotide C16(6-G)-12006.1-1 in mice (C16(6-G)-12006.1-1 was modified with a hexadecyl fatty chain at the nucleotide residue at position 6 of its sense strand; hexadecyl modification at the nucleotide residue at position 6 is an effective strategy to enhance nucleic acid delivery efficiency). Naked siRNA without conjugation to peptide or C16 was used as a control. In this Embodiment, the drug was administered to mice via intrathecal injection at a dose of 0.25 mg per mouse. Other experimental methods were the same as those in Embodiment 21. Mice were euthanized on Days 14 and 28, respectively, and different brain tissues were collected to detect mAPP expression levels. Results are shown in Table 9. Table 9. Comparison of In Vivo Activity of Peptide-siRNA and C16-siRNA in Mice Peptide-siRNA Residual mAPP RNA on Day 14 (%) Residual mAPP RNA on Day 28 (%) Cerebral Cortex Brainstem Cerebral Cortex Brainstem 12006.1-1 67.19 66.50 62.33 56.69 BiAng2(K10N3)-12006.1-1 41.92 31.05 39.34 22.03 C16(6-G)-12006.1-1 44.28 28.83 55.55 29.93 The results in Table 9 showed that on Day 14, the activity of BiAng2(K10N3)-12006.1-1 in the dipeptide form was comparable to that of C16(6-G)-12006.1-1 delivered via C16; on Day 28, the activity of BiAng2(K10N3)-12006.1-1 was higher. This indicates that siRNA delivered by peptide Ang2 exhibits greater persistence and specificity compared to siRNA delivered by C16. Embodiment 26 Testing the In Vivo Activity of Low-Dose Peptide-siRNA via Intracisterna Magna Injection in Wild-Type Rats This Embodiment compared the in vivo activity of the peptide-siRNA (BiAng2(K10N3)-12006.1-1) of the present invention with that of the hexadecyl chain-modified oligonucleotide 100002 C16(6-G)-12006.1-1 in rats (C16(6-G)-12006.1-1 was modified with a hexadecyl fatty chain at the nucleotide residue at position 6 of its sense strand; hexadecyl modification at the nucleotide residue at position 6 is an effective strategy to enhance nucleic acid delivery efficiency). Naked siRNA without conjugation to peptide or C16 was used as a control. In this Embodiment, the drug was administered to rats via intracisterna magna injection at a reduced dose of 0.3 mg per rat. Other experimental methods were the same as those in Embodiment 21. Rats were sacrificed on Day 14, and different brain tissues were collected to detect rAPP expression levels. Results are shown in Table 10. Table 10. Comparison of In Vivo Activity of Low-Dose Peptide-siRNA and C16-siRNA in Rats over 14 Days Peptide-siRNA Residual rAPP RNA (%) Cerebral Cortex Brainste m Hypothal amus Hippoca mpus Cervical Spinal Cord 12006.1-1 34.71 41.74 52.10 42.23 32.94 BiAng2(K10N3)-12006.1 -1 9.28 13.28 25.34 11.95 8.96 C16(6-G)-12006.1-1 26.37 12.53 41.14 19.63 20.68 The results in Table 10 showed that, at a low dose, on Day 14, the activity of BiAng2(K10Ns)-12006.1-1 in the dipeptide form was significantly higher than that of C16(6-G)-12006.1-1 delivered via C16. This indicates that siRNA delivered via peptide Ang2 exhibits greater specificity and efficiency compared to siRNA delivered via C16. Additionally, administration at lower doses can reduce toxic side effects. Therefore, the peptide Ang2 of the present invention is an ideal carrier for delivering siRNA to the central nervous system. Embodiment 27 Testing the In Vivo Activity of Symmetrical or Asymmetrical Peptide-siRNA via Intracisterna Magna Injection in Wild-Type Rats In this Embodiment, the in vivo activity of peptide-siRNA (BiAng2(K10N3)-12006.1-1) of the present invention was compared with that of two peptide-siRNAs containing a symmetric dipeptide linker structure (Bi-sym-Ang2(K10N3)-12006.1-1 and Bi-sym-Ang2(K10Peg2N3)-12006.1-1) in rats. In this Embodiment, the drug was administered to rats via intracisterna magna injection at a dose of 0.3 mg per rat. Other experimental methods were the same as those in Embodiment 21. Rats were sacrificed on Day 26, and different brain tissues were collected to detect rAPP expression levels. Results are shown in Table 11. Table 11. Effects of Different Forms of Dipeptides on the In Vivo Activity of APP-targeting Peptide-siRNA in Rats over 26 Days Peptide-siRNA Residual rAPP RNA (%) 100002 Cerebral Cortex Brainste m Hypotha lamus Cervical Spinal Cord BiAng2(K10N3)-12006.1-1 10.3284 17.65 20.47 10.17 Bi-sym-Ang2(K10N3)-12006.1 -1 11.8858 20.19 26.61 6.562 Bi-sym-Ang2(K10Peg2N3)-12006.1 -1 19.0382 77.67 30.25 18.98 The results in Table 11 showed that the activity of BiAng2(K10N3)-12006.1-1 was comparable to that of Bi-sym-Ang2(K10N3)-12006.1-1, indicating that the symmetry of the dipeptide linker structure has no significant effect on activity. The activity of Bi-sym-Ang2(K10N3)-12006.1-1 was superior to that of Bi-sym-Ang2(K10Peg2N3)-12006.1-1, indicating that the linker length between the two peptides has a significant effect on activity. Embodiment 28 Testing the In Vivo Activity of Peptide-siRNA with Different Linkage Methods via Intracisterna Magna Injection in Wild-type Mice In this Embodiment, the activity of BiANG2(S7KN3)-12006.3-1 (Ang2 peptide in which the serine at position 7 was replaced with lysine was linked to APP-targeting siRNA in a bivalent form) was compared with that of BiANG2(K10N3)-12006.3-1. In this Embodiment, the drug was administered to mice via intracisterna magna injection at a reduced dose of 0.1 mg per mouse. Other experimental methods were the same as those in Embodiment 21. Mice were sacrificed on Day 28, and different brain tissues were collected to detect mAPP expression levels. Results are shown in Table 12. Table 12. Effects of Different Forms of Peptides on the In Vivo Activity of APP-targeting Peptide-siRNA in Mice over 28 Days Peptide-siRNA Residual mAPP RNA (%) Cerebral Cortex Brainstem Hypothalam us Cervical Spinal Cord BiAng2(K10N3)-12006.3-1 16.40 10.69 32.46 24.10 BiAng2(S7KN3)-12006.3-1 30.71 8.99 37.39 17.51 The results in Table 12 showed that, compared to the amino acid at position 7, the lysine at position 10 in the Ang2 peptide exhibited superior ability to deliver siRNA when used as an siRNA linkage site. Embodiment 29 Testing the In Vivo Activity of Different Forms of Peptide-siRNAs via Intracisterna Magna Injection in Wild-type Rats This Embodiment compared the ability of the LRP-1 ligands Ang1 and Ang2 to deliver siRNA, The corresponding two peptide-siRNA conjugates,    BiAng2(K10N3)-12006.1-1    and BiAng1(K10N3)-12006.1-1, both used the lysine at position 10 of the peptide as the siRNA linkage site and both had a dipeptide structure. In this Embodiment, the drug was administered to rats via 100002 intracisterna magna injection at a dose of 0.3 mg per rat. Other experimental methods were the same as those in Embodiment 21. Rats were sacrificed on Day 28, and different brain tissues were collected to detect rAPP expression levels. Results are shown in Table 13. Table 13. Effects of Different Forms of Peptides on the In Vivo Activity of APP-targeting Peptide-siRNA in Rats over 28 Days Peptide-siRNA Residual rAPP RNA (%) Cerebral Cortex Brainstem Hypothalam us Cervical Spinal Cord BiAng2(K10Ns)-12006.1 -1 10.50 23.33 33.50 9.40 BiAng1(K10Ns)-12006.1-1 14.88 28.64 39.79 11.03 The results in Table 13 showed that 28 days after administration, the delivery efficiency of the Ang2 peptide was slightly better than that of Ang1. Embodiment 30 Testing the In Vivo Activity of Peptide-siRNAs Containing Different Linkers via Intracisterna Magna Injection in Wild-type Mice This Embodiment compared the in vivo activity of the peptide-siRNA (BiAng2(K10N3)-12006.1-1) of the present invention with that of the peptide-siRNA (BiAng2(K10N3)-Q22-12006.3-5) using a Q22 linker in mice. In this Embodiment, the drug was administered to mice via intracisterna magna injection at a reduced dose of 0.1 mg per mouse. Other experimental methods were the same as those in Embodiment 21. Mice were sacrificed on Day 14, and different brain tissues were collected to detect mAPP expression levels. Results are shown in Table 14. Table 14. Comparison of the Effects of Different Linkers on the In Vivo Activity of APP-targeting Peptide-siRNA in Mice over 14 Days Peptide-siRNA Residual mAPP RNA (%) Cerebral Cortex Brainste m Hypothala mus Cervical Spinal Cord BiAng2(K10N3)-12006.3-5 40.50 6.75 32.61 22.43 BiAng2(K10N3)-Q22-12006.3-5 14.60 10.22 27.79 21.86 The results in Table 14 showed that on Day 14, the activity of BiAng2(K10N3)-Q22-12006.3-5 was higher than that of BiAng2(K10N3)-12006.3-5, indicating that the linker structure also significantly impacts the activity of the peptide-siRNA. Embodiment 31 Comparison of the Effects of Different Injection Methods on the In Vivo Activity of Peptide-siRNA in Wild-Type Mice This Embodiment compared the in vivo activity of the peptide-siRNA (BiAng2(K10N3)-12006.3-5) of the present invention with that of the hexadecyl chain-modified oligonucleotide 100002                                                   88 C16(6-G)-12006.3-5 in mice (C16(6-G)-12006.3-5 was modified with a hexadecyl fatty chain at the nucleotide residue at position 6 of its sense strand; hexadecyl modification at the nucleotide residue at position 6 is an effective strategy to enhance nucleic acid delivery efficiency). In this Embodiment, the drug was administered to mice using two different injection methods: intrathecal (IT) injection and intracisterna magna (ICM) injection, at a dose of 0.25 mg per mouse. Other experimental methods were the same as those in Embodiment 21. Mice were sacrificed on Day 7, and different brain tissues were collected to detect mAPP expression levels. Results are shown in Table 15. Table 15. Comparison of the Effects of Injection Methods on the In Vivo Activity of APP-targeting Peptide-siRNA in Mice over 7 Days Peptide-siRNA Residual mAPP RNA 7 Days After IT Injection (%) Residual mAPP RNA 7 Days After ICM Injection (%) Cerebral Cortex Hypothala mus Cervical Spinal Cord Cerebral Cortex Hypotha lamus Cervical Spinal Cord C16(6-G)-12006.3-5 71.97 37.21 16.41 41.48 38.15 30.78 BiAng2(K10N3)-Q22-12006.3 -5 39.56 27.54 9.92 28.79 35.18 12.72 The results in Table 15 showed that, at the same dose, ICM injection resulted in higher efficacy than IT injection. On Day 7, BiAng2(K10N3)-12006.3-5 in the dipeptide form exhibited significantly higher activity in various brain regions of mice compared to C16(6-G)-12006.3-5 delivered via C16. This indicates that using this peptide to deliver siRNA results in higher delivery efficiency compared to C16 delivery. Embodiment 32 Testing the In Vivo Activity of SNCA-targeting Peptide-siRNA via Injection in Wild-type Mice In this embodiment, AD1747580 (WO2023192977A2)—a siRNA targeting a-synuclein (SNCA) with known efficacy for treating Parkinson’s disease—was conjugated to the dual ANG2 peptide of the present invention, and the activity of this peptide-siRNA was tested in mice. In this Embodiment, the peptide-siRNA was administered to mice via intracisterna magna injection at a dose of 0.25 mg per mouse. Other experimental methods were the same as those in Embodiment 21. Mice were sacrificed on Day 14, and different brain tissues were collected to detect mSNCA (mouse SNCA) expression levels. Results are shown in Table 16. Table 16. In Vivo Activity of SNCA-targeting Peptide-siRNA Peptide-siRNA Residual mSNCA RNA (%) 100002 Cerebral Cortex Brainste m Hypothala mus Cervical Spinal Cord BiAng2(K10N3)-Q22-AD174758O 11.22 6.58 10.32 6.86 The results in Table 16 showed that at a dose of 0.25 mg, BiAng2(K10N3)-Q22-AD1747580 exhibited a significant inhibitory effect on the target gene in various brain regions. This indicates that the peptide of the present invention can knock down various targets in the central nervous system. Embodiment 33 Testing the In Vivo Activity of Peptide-siRNA Simultaneously Targeting Two Genes via Intracisterna Magna Injection in Wild-type Mice This Embodiment evaluated the dual-target peptide-siRNA conjugate BiAng2(K10N3)-12006-8022 in mice. The conjugate used a bivalent Ang2(K10N3) structure to simultaneously deliver an siRNA targeting the amyloid precursor protein (APP) gene and an siRNA targeting the melanocortin 4 receptor (MC4R). BiAng2(K10N3)-12006.2-2 was used as a single-target peptide-siRNA control targeting APP. In this Embodiment, the drug was administered to mice via intracisterna magna injection at a dose of 15 nmol per mouse. Other experimental methods were the same as those in Embodiment 21. Mice were sacrificed on Day 21, and different brain tissues were collected to detect mAPP and mMC4R (mouse MC4R) expression levels. Results are shown in Table 17. Table 17. In Vivo Activity Results of Peptide-siRNA Simultaneously Targeting APP and MC4R in Mice over 21 Days Peptide-siRNA Residual mAPP RNA (%) Residual mMC4R RNA (%) Cerebral Cortex Brai nste m Hypoth alamus Cervica l Spinal Cord Brainst em Hypoth alamus Cervic al Spinal Cord BiAng2(K10N3)-12006.2-2 10.14 4.54 25.32 4.58 120.81 128.83 102.62 BiAng2(K10N3)-12006-8022 12.50 5.73 26.51 10.65 39.58 59.94 61.09 The results in Table 17 indicated that on Day 21, the single-target peptide-siRNA targeting mAPP (BiAng2(K10N3)-12006.2-2) and the dual-target dual-peptide-siRNA simultaneously targeting mAPP and mMC4R (BiAng2(K10N3)-12006-8022), both exhibited significant inhibitory effects on mAPP. Furthermore, the dual-target dual-peptide-siRNA simultaneously targeting mAPP and mMC4R (BiAng2(K10N3)-12006-8022) also exhibited an inhibitory effect on mMC4R, indicating that the peptide-siRNA of the present invention can be used to deliver dual-gene siRNA. Embodiment 34 Safety Testing of Peptide-siRNA in Wild-type Mice The results of the above embodiments showed that BiAng2(K10N3)-Q22-12006.3-5 in the dipeptide 100002                                                   90 form exhibited extremely high inhibition activity against the target gene APP in various brain tissues of mice and rats. In this embodiment, the BiAng2(K10N3)-Q22-12006.3-5 peptide-siRNA was administered into wild-type C57 / Bl6 mice via intracisterna magna injection at a dose of 0.7 mg. Each treatment group consisted of 6 mice, and mice receiving artificial cerebrospinal fluid injection served as negative controls. The safety of the peptide-siRNA was evaluated by evaluating the Functional Observational Battery (FOB) scores in mice 24 and 48 h after intracisterna magna injection, based on 7 distinct criteria. Criteria for FOB: (1) the mouse is smart, alert, and responsive; (2) the mouse stands or arches its back in the absence of stimulation; (3) the mouse exhibits any movement in the absence of stimulation; (4) the mouse exhibits forward movement after being lifted; (5) the mouse exhibits any movement after being lifted; (6) the mouse responds to tail pinch; (7) the mouse breathes evenly. If the mouse met any of the 7 criteria, a subscore of 0 was assigned; otherwise, a subscore of 1 was assigned. Following evaluation against all 7 criteria, the scores for each mouse were summed and averaged within each treatment group. Results are shown in Table 18. Table 18. FOB Scores in Mice After Peptide-siRNA Injection Peptide-siRNA FOB 24h FOB 48h Artificial cerebrospinal fluid 0.00 0.00 BiAng2(K10N3)-Q22-12006.3-5 0.30 0.00 The results in Table 18 showed that after a high dose of peptide-siRNA was administered into the mouse brain via intracisterna magna injection, slight FOB abnormalities were observed at 0.5 h postdose. Over time, the behaviors of mice returned to normal, and their FOB scores were 0 at 24 h. This indicates that the peptide-siRNA exhibits good tolerability in mice. Table 19. Blood Chemistry Test Results of Mice After Peptide-siRNA Injection Peptide-siRNA ALT (U / L) AST (U / L) ALP (U / L) CREA (pmol) UREA (pmol) Artificial cerebrospinal fluid 41.67 167.83 194.27 14.93 10.32 BiAng2(K10N3)-Q22-12006.3-5 35.50 95.80 165.47 12.63 9.83 Blood samples were collected from mice 15 days postdose for chemistry tests to measure liver injury indicators (ALT, AST, ALP) and kidney injury indicators (CREA and UREA). The results in Table 19 showed that BiAng2(K10N3)-Q22-12006.3-5 did not cause liver or kidney injury, indicating that the peptide-siRNA of the present invention exhibits good safety. The above embodiments only express several embodiments of the present invention, which are 100002                                                      91 described in more specific and detailed manners, but shall not be construed as a limitation on the scope of the present invention. It is to be pointed out that ordinarily skilled persons in the art may make several modifications and improvements without departing from the concept of the present invention, which all fall within the protection scope of the present invention. Therefore, the 5 protection scope of the present invention shall be subject to the attached claims. 100002

Claims

1. A peptide-oligonucleotide conjugate having the structure of formula (I) or (II) below, or apharmaceutically acceptable salt or stereoisomer thereof:(I)(II)wherein       AS        is an oligonucleotide drug;P is a peptide ligand for the LRP-1 receptor, selected from unmodified or modified peptides;LE is a group for linking the oligonucleotide drug, which comprises a hydroxyl or a protected10hydroxyl;each LA is independently selected from the following structures:oMMh<MHchM mOCH=CH—^-C=C—^S—6O, N N'HOON'NH100001;LB is a linking unit formed by linking one or more of the following groups without violating chemical bonding principles: alkylene, cycloalkyl, heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-;LC is a linking unit formed by linking one or more of the following groups without violating chemical bonding principles: alkylene, cycloalkyl, heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-;R1 is selected from: H, and C1-C10 alkyl;R2 is selected from: C1-C10 alkyl;each n is independently selected from: 1, 2 and 3;a and b are each independently 0 or 1, and at least one of them is 1;m is an integer selected from 0 to 12;each n1 is independently selected from: 0, 1, 2 and 3.

2. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the unmodified amino acid sequence of the peptide ligand is TFFYGGCRGKRNNFKTEEY, TFFYGGSRGKRNNFKTEEY, TWPKHFDKHTFYSILKLGKH, TFFYGGKRGKRNNFKTEEY or TFFYGGSRGZRNNFKTEEY, wherein Z represents L-norleucine.

3. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 2, wherein the peptide ligand has one or more of the following structural variations:(1) an L-amino acid residue in the amino acid sequence is replaced by a D-amino acid residue;(2) an amino acid residue in the amino acid sequence is replaced by a methylated amino acid residue;(3) the N-terminal amino group in the amino acid sequence is acylated or not acylated;(4) the C-terminal carboxyl group in the amino acid sequence is amidated or not amidated;(5) any aromatic amino acid residue in the amino acid sequence can be replaced by a non-aromatic100001                                                    94OHamino acid residue;(6) any two amino acid sequences are linked via a linking group, wherein the N-terminus of one amino acid sequence is linked to the C-terminus of the other amino acid sequence via the linking group;Opreferably, the linking group is:

4. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the LA in P-LA is linked to the N-terminus of the peptide ligand;alternatively, the LA in P-LA is linked to the amino acid residue at position 7, 10 or 15 from the N-terminus of the peptide ligand, preferably to the amino acid residue at position 10.

5. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the LA in P-LA is linked to the C-terminus of the peptide ligand;6. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the LA in P-LA is linked to an amino acid residue containing a side-chain amino group in the peptide ligand.

7. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the LA in P-LA is linked to a lysine residue or a norleucine residue in the peptide ligand.

8. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the unmodified amino acid sequence of the peptide ligand is TFFYGGSRGKRNNFKTEEY, and the LA in P-LA is linked to the amino acid residue at position 10 or 15 from the N-terminus of the peptide ligand;alternatively, the unmodified amino acid sequence of the peptide ligand is TFFYGGKRGKRNNFKTEEY, and the LA in P-LA is linked to the amino acid residue at position 7, 10 or 15 from the N-terminus of the peptide ligand;alternatively, the unmodified amino acid sequence of the peptide ligand is TFFYGGCRGKRNNFKTEEY, and the LA in P-LA is linked to the amino acid residue at position 10 from the N-terminus of the peptide ligand;100001                                                    95alternatively, the unmodified amino acid sequence of the peptide ligand isTFFYGGSRGZRNNFKTEEY, and the LA in P-LA is linked to the amino acid residue at position 10from the N-terminus of the peptide ligand.

9. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer5 thereof according to claim 1, wherein the LA in P-LA is linked to an amino acid residue containing aside-chain carboxyl group in the peptide ligand.

10. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomerthereof according to claim 9, wherein the LA in P-LA is linked to a glutamic acid residue or anaspartic acid residue in the peptide ligand.10   11. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomerthereof according to any one of claims 1-10, wherein LE is selected from the following structures:H N HORn=n N JROA N HORRO’ROROORhNROORJWV Ieach R is independently selected from: H or a hydroxyl-protecting group;15 each n2 is independently selected from an integer from 0 to 10.

12. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomerthereof according to claim 11, wherein LE is selected from:100001RO’JVWORORRO’13. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to any one of claims 1-10, wherein LA is selected from the following structures:O 'N''NHcl„nh2.-H, N N'NOHHNH2 ONH2OI-NHH2N|~N5 HOONN?N^N;N ;14. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer10 thereof according to any one of claims 1-10, wherein the LB in formula (I) is a linking unit formed bylinking one or more of the following groups without violating chemical bonding principles: C1-C10alkylene, C5-C10 cycloalkyl, 5- to 10-membered heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-,-C(=O)-, -C(=S)-, -NR1-, -O-, and -S-, wherein R1 is selected from: H, and C1-C6 alkyl;preferably, the LB in formula (I) is a linking unit formed by linking one or more of the following15 groups without violating chemical bonding principles: C1-C6 alkylene, C5-C7 cycloalkyl, 5- to7-membered heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-,wherein R1 is selected from: H, and C1-C3 alkyl;preferably, the LB in formula (I) is selected from the following structures:100001sYLB-1H                  0        / *   ^X4<LB-1-10H00LB-2-1XIjLB-30H NH NNI       HLB-1-2LB-200H N0H N0XLB-4100001wherein i, j, h, q, s and e are each independently selected from: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;c is selected from: 0, and 1;X is selected from: O, S, and CH2;Y is absent or selected from: C=O, and CH2.

15. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 14, wherein the LB in formula (I) is selected from the following structures:10OOO100001Oi rOXN HO N-^ H \.OOH NO5100001i, j and e are each independently selected from: 0, 1, 2, 3, and 4;c is selected from: 0, and 1;k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;X is selected from: CH2, and O.5   16. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomerthereof according to claim 15, wherein the LB in formula (I) is selected from the following structures:OO10ON H NH100001O2OOOON HO      ON8    HON8    HO1000011017. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to any one of claims 1-10, wherein the LB in formula (II) is a linking unit formed by linking one or more of the following groups without violating chemical bonding principles: C1-C10 alkylene, C5-C10 cycloalkyl, 5- to 10-membered heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-, wherein Ri is selected from: H, and C1-C6 alkyl;preferably, the LB in formula (II) is a linking unit formed by linking one or more of the following groups without violating chemical bonding principles: C1-C6 alkylene, C5-C7 cycloalkyl, 5- to 7-membered heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-, wherein Ri is selected from: H, and C1-C3 alkyl;preferably, the LB in formula (II) has the structure shown below:i NHjOHN15LB-5wherein X is selected from: O, S, and CH2;L is selected from the following structures:1 \ H* NO100001OO0Os Y0NHOOOOH NH NH NNHN"4i      H o1       j OOOH NHNHH Nwherein i, j, h, q, s, f and e are each independently selected from: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;c is selected from: 0, and 1;X is selected from: O, S, and CH2;Y is absent or selected from: C=O, and CH2.

18. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer10thereof according to claim 17, wherein the LB in formula (II) has the structure shown below:OON HNHoro0r        nHN           XNH H, X is selected from: O, and CH2.10000119. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 17, wherein L is selected from the following structures:H NOONHN HXOOOON Hi and e are each independently selected from: 0, 1, 2, 3, and 4;100001k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;X is selected from: CH2, and O.

20. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 19, wherein L is selected from the following structures:1010000110ON HN HOOO8OO821. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to any one of claims 1-10, wherein the LC in formula (II) is a linking unit formed by linking one or more of the following groups without violating chemical bonding principles: C1-C10 alkylene, C5-C10 cycloalkyl, 5- to 10-membered heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-, wherein Ri is selected from: H, and C1-C6 alkyl;preferably, the LC in formula (II) is a linking unit formed by linking one or more of the following groups without violating chemical bonding principles: C1-C6 alkylene, C5-C7 cycloalkyl, 5- to 7-membered heterocyclyl, -C(=O)NR1-, -C(=O)O-, -C(=O)S-, -C(=O)-, -C(=S)-, -NR1-, -O-, and -S-, wherein Ri is selected from: H, and C1-C3 alkyl;preferably, the LC in formula (II) has the structure shown below:100001H              O-A Y hO                    1wherein i, j, h and e are each independently selected from: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;c is selected from: 0, and 1;X is selected from: O, S, and CH2;Y is absent or selected from: C=O, and CH2.

22. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 21, wherein the LC in formula (II) is selected from the following structures:N HX0i, j and e are each independently selected from: 0, 1, 2, 3, and 4;c is selected from: 0, and 1;X is selected from: CH2, and O.

23. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 22, wherein the LC in formula (II) is selected from the followingstructures:

024. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer100001thereof according to claim 1, wherein the peptide-oligonucleotide conjugate is selected from thefollowing compounds:HO100001100001100001100001100001100001HOHOi, j and e are each independently selected from: 0, 1, 2, 3, and 4;c is selected from: 0, and 1;5 k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;X is selected from: CH2, and O;each n1 is independently selected from: 0, 1, 2 and 3.

25. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the peptide-oligonucleotide conjugate is selected from the10 following compounds:HO—Y-E-E-T-K-F-N-N-R---K-G-R-S-G-G-Y-F-F-T--|[''' nH2         Ang2-B04-BCN-siRNA0Reversed Ang2-B04-BCN-siRNA100001Ang2(K10N3)-B04-BCN-siRNAAc—T-W-P-K-H-F-D-K-H-T---F-Y-S—I—L-K-L-G-K-H-NHL57-B12-siRNA100001Ang2(K10N3)-B12-siRNAHO—Y-E-E-T-k-F-N-N-R SBi-Sym-Ang2(K10N3)-3-B08-siRNAO HN-G-R-S-G-G-Y-F-F-T-Ac1000011000010 HN-G-R-S-G-G-Y-F-F-T-AcU HN-G-K-a-G-G-Y-l--1--I “AC100001Bi-Sym-Ang2(K1 0N3)-2-Bi-siRNA-2Bi-Sym-Ang2(K10N3)-3-Bi-siRNA-2Bi-Sym-Anq2(K10PEG2N3)-2-B08-siRNA-2HN-G-R-S-G-G-BiAng2(K10PEG2N3)-B08-siRNA-2Bi-Ang2 K10PEG2N,)-2-Bi-siRNA-2Bi-Sym-Ang2(K10PEG2N3)-2-Bi-siRNA-2Bi-Ang2(K10N3)-Bi-siRNA-2HO100001BiAng2(K10N3)-Q20-Bi-siRNA-210000126. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 1, wherein the peptide-oligonucleotide conjugate is selected from the following compounds:HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T-^^^NH2         Ang2-B04-BCN-siRNAO100001HO—Y-E-E-T-k-F-N-N-R oz H Reversed Ang2-B04-BCN-siRNA ZO N               9                           ft               SS N. / XH                 n " 0 P 0 __________ NX   X O H       \      0 XXr^         y-^   ■        as H                 HO HN-G-R-S-G-G-Y-F-F-T Ang2(K10AZK)-B04-BCN-siRNAo             -N U               N'” If HO—Y-E-E-T-k-F-N-N-R                        \ \'X        H C) HN-G-R-S-G-G-Y-F-F-T-Ac 5 Os, ,OH 0           I X ZS, X. xY. ,E. ,K. ,N, ,R, ,G, „S O                  N E T F N K R XT H ZY~F 1       O G-G R-S k-g ,N-r ,F-N .T-K E-E HO-Y ____. H n-X X>—■ N 3L / Y h2n                    H HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T— O                     __. H N—< X> n" X / Y H2N                   H HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T—X'"'^ O ,N „ h2n        N— / HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T—X^*^ O N x x h2n       N— / HO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-T—X^*^ O H2N HO—Y-E-E-T-K-F-N-N-R K-G-R-S-G-G-Y-F-F-T—X""*^     ,N~Hi        C b N h2n HO—Y-E-E-T-K-F-N-N-R K-G-R-S-G-G-Y-F-F-T—N-, b       n\ X nh2 Ac—T-W-P-K-H-F-D-K-H-T F-Y-S—I—L—K—L—G-K-H-NH        .N~71         C N.. X-v^vX nh2 Ac—T-W-P-K-H-F-D-K-H-T F-Y-S—I—L—K—L—G—K—H—NH       ,. / ½ N, 11 10 / 0 o p-o __________________ / V A H       \      o ’              AS H                 HO Ang2(K10N3)-B04-BCN-siRNA °            SS N' A vH Xn        n^'-o-p-o- NH2 nA X O H      O 6  ------------- v,g f                                  X    ~          AS G Y F Y               H                HO O Ang2-Ang2-B04-BCN-siRNA \ Y_H             ? H         ?                   °           ss 0^n^0oxz°X-Nzz-szsXn<~ / ^ A z-O-P-0------------ Jh H      X °        AS H0 0          0 X Xo^K^o^OzXX BiAng2-B04-BCN-siRNA X >h XB      I / s / ^X°   °       ss XL X Ns / X / vAx7   N . O-p-0 ___________ °yNH H      X 9        AS J                 HO 0         1 Ah m H BiAng2-2-B04-BCN-siRNA ,O 1               H        0     0z<~0^X      1?          ss z                                Av' °t-° ______________ H            O         NH H            X     ~           AS vX,              H0 rN^o^oXNX 0        BiAng2-B08-siRNA zO ’            h       0    o AoX    °        ss Z      zXzxzxI        .N,..-Oyo- H          O       L H         P    -         AS rX           H0 H              II X If'N '' / '''O^ °        BiL57-B08-siRNA100001L57-B12-siRNAAng2(K10N3)-B12-siRNAU HN-U-K-5-U-U-Y-h- —h--I-Ac0 HN-G-R-S-G-G-Y—F — F — T-AcBi-Sym-Ang2(K10PEG2N3)-2-B08-siRNA1000010HO0—R-N-N-F-K-T-E-E-Y-OHBiAng2(K10N3)-Q20-Bi-siRNA27. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to any one of claims 1-10, wherein the oligonucleotide drug is selected from: small interfering RNAs, antisense oligonucleotides, small activating RNAs, and peptide nucleic acids.

28. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer 10 thereof according to any one of claims 1-10, wherein the oligonucleotide drug is a small interferingRNA, and LE is linked to the phosphate group or phosphorothioate group at the 3'- and / or 5'-terminus of the sense strand of the small interfering RNA.

29. A peptide-oligonucleotide conjugate, or a pharmaceutically acceptable salt or stereoisomer100001thereof, wherein the peptide-oligonucleotide conjugate is prepared by a method comprising: subjecting an alkyne-containing linker-nucleic acid sense strand molecule and an azide-modified peptide to a click chemistry reaction to obtain a peptide-sense strand conjugate, and then annealing the peptide-sense strand conjugate and the corresponding nucleic acid antisense strand to obtain the5   peptide-oligonucleotide conjugate; the peptide is a peptide ligand for the LRP-1 receptor;the alkyne-containing linker-nucleic acid sense strand molecule has the structure of formula (III) or formula (IV) below:10(III)(IV)wherein ------------ is the sense strand of the oligonucleotide drug;LA, LB, LC, LE, n, a and b are as described in any one of claims 1-26;HoHR3 is selected from: ethynyl, and              .15   30. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomerthereof according to claim 29, wherein the alkyne-containing linker-nucleic acid sense strandmolecule is selected from the following structures:100001100001100001100001wherein i, j and e are each independently selected from: 0, 1, 2, 3, and 4;5 k is selected from: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;c is selected from: 0, and 1;X is selected from: CH2, and O.

31. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 30, wherein the alkyne-containing linker-nucleic acid sense strand 10 molecule is selected from the following structures:10000110000132. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 29, wherein the azide-modified peptide is selected from the followingstructures:A—NH2L57(H20A;K19N3)100001L57(lle14Nle)-AZKL57(Leu15Nle)-AZKL57(lle14Nle)-AZK1—T---F-Y-S—I—L-K-L-G-K-A-NHL57(H2Q A: Leu15Nle)-AZKF-T yY-F ,G-G R-SON^E^T'K'F^N'R^R^GY^F^H                                      OOHNH2N3K-G N-R , F-N ,T~K ,E-EHO YAng2(K10PEG2N3)N3R-N-N-F-K-T-E-E-Y—OHH--T-F-F-Y-G-G-S-R-G-NHAng2(K10AZK)33. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 32, wherein the azide-modified peptide is selected from the following structures:100001L57(K16N3)             d0Ac—T-W-P-K-H-F-D-K-H-T---F-Y-S—I—L—K~L~G~K~H~NHnh2 .....Ac—T-W-P-K-H—F-D-K-H-T---F-Y-S-Z-L-K-L-G-K-H-NHL57(lle14Nle)-AZKL57(Leu15Nle)-AZKoL57(H20A;K19N3)R-S ,K~G n-r ,f-n ,t-k e-eHO Yf-t / Y-F P'GOOHN^E'rS'V^'R^'Y^FH                                    ONH2N3OAng2(K10PEG2N3)R-N-N-F-K-T-E-E-Y—OHH--T-F-F-Y-G-G-S-R-G-NH OAng2(K10AZK)34. The peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to claim 29, wherein the azide-modified peptide is selected from the following structures:100001Ac—T-W-P-K-H-F-D-K-H-T---F-Y-S—I—L-K-L-G-K-H-NHL57-AZKHO—Y-E-E-T-K-F-N-N-R--K-G-R-S-G-G-Y-F-F-TAng2-AZKAc-T-F—F-Y-G-G-S-R-G-K---R-N-N-F-K-T-E-E-Y—NHReversed Ang2-AZK100001HO—Y-E-E-T-K-F-N-N-Rn3O HN-G-R-S-G-G-Y-F—F-T—HAng2(K10AZK)Ang2(K15Ns)oAng2(K10Peg2Ns)Ang2(K10N3)G G R-S K-G N-R,F-N ,t-k ,e-e HO YF-T / Y-FON^Vr^WW' HOHNHN3Ang2-Ang2-AZK.

35. Use of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt orstereoisomer thereof according to any one of claims 1-34, as an active ingredient in the preparation ofa drug for inhibiting the expression of a target gene in the central nervous system.

36. The use according to claim 35, wherein the target gene in the central nervous system is selectedfrom one or more of the following: APP, MC4R, ATXN2, C9orf72, TARDBP, MAPT, HTT, SNCA,FUS, ATXN3, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and NLRP3.

37. Use of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to any one of claims 1-34, as an active ingredient in the preparation of a drug for treating a central nervous system disease.

38. The use according to claim 37, wherein the central nervous system disease is selected from the following: Alzheimer's disease, cachexia, cerebral amyloid angiopathy, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, frontotemporal dementia, spinocerebellar ataxia, prion disease, and Lafora disease.

39. A drug for treating a central nervous system disease, wherein the drug is prepared from an active ingredient and a pharmaceutically acceptable excipient, and the active ingredient comprises the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or a stereoisomer thereof according to any one of claims 1-34.

40. A method for inhibiting the expression of a target gene in the central nervous system, comprising: administering a safe and effective amount of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or stereoisomer thereof according to any one of claims 1-34; or administering a safe and effective amount of the drug according to claim 39.

41. The method according to claim 40, wherein the target gene in the central nervous system is selected from one or more of the following: APP, MC4R, ATXN2, C9orf72, TARDBP, MAPT, HTT, SNCA, FUS, ATXN3, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and NLRP3.

42. A method for treating a central nervous system disease, comprising: administering a safe and effective amount of the peptide-oligonucleotide conjugate or a pharmaceutically acceptable salt or100001stereoisomer thereof according to any one of claims 1-34; or administering a safe and effective amount of the drug according to claim 39.

43. The method according to claim 42, wherein the central nervous system disease is selected from the following: Alzheimer's disease, cachexia, cerebral amyloid angiopathy, Parkinson's disease, 5 Huntington's disease, amyotrophic lateral sclerosis, frontotemporal dementia, spinocerebellar ataxia, prion disease, and Lafora disease.100001

Images