Lipid nanoparticles comprising ginsenoside or derivative thereof, and use thereof

Abstract

The present invention relates to lipid nanoparticles comprising ginsenoside or a derivative thereof, and use thereof, and, specifically, to: lipid nanoparticles containing vegetable ginsenoside or a derivative thereof included in ginseng or red ginseng, instead of animal cholesterol for the delivery of therapeutic or vaccine nucleic acids; gene-inorganic nanoparticles in which the corresponding lipid nanoparticles are encapsulated, and a preparation method therefor; and a nucleic acid delivery composition comprising same.

Description

Invention Title LIPID NANOPARTICLES   COMPRISING   GINSENOSIDE   OR DERIVATIVE THEREOF, AND USE THEREOF Technical Field [1]     The present invention relates to a lipid nanoparticle containing a ginsenoside or a derivative thereof and use thereof, and specifically, to a lipid nanoparticles containing a plant-derived ginsenoside or a derivative thereof, found in ginseng or red ginseng, as a substitute for animal cholesterol to deliver a nucleic acid (mRNA, DNA, small RNA, etc.) for therapeutics or vaccines; a nucleic acid-inorganic nanoparticle encapsulated in the lipid nanoparticle; a method for producing the same; and a composition for nucleic acid delivery containing the same. [2] Background Art [3]     Gene therapies have been developed as therapeutics that treat or prevent diseases by deleting existing genes, adding new information to existing genes, or modifying existing genes with new information, and delivering the resulting genes to the cells of patients in the form of plasmid DNA (pDNA) or mRNA (messenger RNA) (Dunbar, C. E et al., Science 2018 1:12) . [4] Gene therapies aim to cure diseases by correcting genetic defects in patients who suffer from genetic diseases or rare diseases . Due to recent technological innovations and investments in research and development, the global gene therapy market has been growing at an average annual rate of 10%, and gene therapies have emerged as a blue chip in the new pharmaceutical market. Among these, mRNA is emerging as a promising therapeutic tool in the fields of vaccine development and protein replacement therapy. The principle of gene therapy is to introduce genes into cells in the form of pDNA or mRNA using viruses, liposomes, antisense technology, etc., so that the genes function as therapeutics (Dunbar, C. E et al ., Science 2018 1:12) . [5] Although gene therapies have a relatively short history compared to other types of therapy, they have the advantage of being easy to develop into therapeutics for diseases caused by specific genes, so research results and new drug approvals are rapidly expanding. In addition, gene therapeutics such as mRNA therapeutics have the potential to expand disease treatment targets because they can undergo various modifications within the cytoplasm and thus regulate almost all proteins within the cell by controlling their half-life or increasing or decreasing the amount of protein translated therefrom. However, in order for these gene therapeutics to produce the desired protein by reaching target cells without being degraded by enzymes such as RNase in vivo, it is also important to develop gene delivery systems with high encapsulation efficiency, stability, biocompatibility, etc. [6] Over the past decade, messenger RNA (mRNA) therapy has emerged as a promising strategy for a variety of applications, ranging from protein replacement therapy to vaccination . [7] mRNA therapeutics have advantages over DNA therapeutics or viral therapeutics in terms of safety, efficiency, and productivity. First, because mRNA occurs in the cytoplasm, the probability of mutations caused by infection or genomic DNA insertion is lower. Second, since mRNA can undergo various modifications within the cytoplasm, the intracellular stability thereof can be increased by controlling its half-life or increasing the amount of protein being translated therefrom. Third, mRNA has the advantage of being easy to use in in vitro experiments, which allows for rapid development and GMP production, and facilitates mass production (Wang, Y., Su et al. Molecular therapy 2013 358 — 367). [8] mRNA refers to RNA that transmits genetic information from DNA to ribosomes and expresses a protein through translation from mRNA. Recombinant mRNA, which is used for the development of therapeutic agents or vaccines, is produced from linear DNA by RNA polymerase and a promoter, such as T7 or SP6 (but not limited thereto) , and then undergoes 5’ capping and poly(A) adenylation through in vitro transcription. The mRNA thus produced has a structure similar to mature mRNA in the cytoplasm and consists of a 5’ cap, a 5’ UTR (untranslated region), a 3’ UTR, poly(A) tail, and a target gene to be expressed. Thereamong, the untranslated region (5’ or 3’ untranslated region) affects the stability and translational activation of the mRNA depending on the sequence, thus increasing the half-life and expression level. In addition, Poly(A) tail prevents the degradation of mRNA in the cytoplasm, thereby increasing the stability and expression level. Therefore, it is important to find the optimal untranslated region sequence and poly(A) tail length so that mRNA therapeutics express proteins efficiently and stably in vivo (Pardi, N et al. Nature reviews 2018 261-279) . [9] Though mRNA serves as a versatile clinical intervention, it requires a delivery platform to reach the cytoplasm of target cells and achieve the functional outputs necessary for clinical efficacy. LNP-based mRNA therapies for gene addition / replacement, gene expression control, and gene editing applications have been studied in a wide variety of diseases including congenital disorders, cancer immunotherapy, and corneal diseases.

[10] For many of these applications, intravenous (IV) or intraperitoneal (IP) injections are preferred to achieve systemic therapeutic impact or organ-specific delivery. However, there are drug delivery barriers that arise when attempting to deliver mRNA-containing LNPs (mRNA-LNPs) via IV or IP administration. Notably, intravenously injected mRNA-LNPs experience significant accumulation and mRNA delivery to the liver.

[11] Though hepatic delivery and expression of therapeutic mRNA are desired in certain applications (e.g., replacement plasma protein expression, gene editing for liver diseases, etc.), sufficient delivery to other organs (e.g., spleen, lungs, gastrointestinal tract, uterus, etc.) is necessary for the treatment of many diseases .

[12] The currently most widely used nucleic acid carrier is lipid nanoparticles, which are composed of ionizable lipids, phospholipids, cholesterol, polyethylene glycol (PEG) lipids, etc. In particular, cholesterol plays a role in enhancing the stability of the lipid nanoparticle structure by supporting the maintenance of the lipid bilayer structure. Although cholesterol plays an important role as described above, there are problems that need to be overcome in order for cholesterol to be used as a carrier component. First, because cholesterol is easily oxidized, the stability of lipid-based drugs can be a problem. For example, among the oxidation by-products of cholesterol, substances such as 25-hydroxycholesterol, 7-keto-cholesterol, 7a- and 7^-hydroxycholesterol, cholesterol-3p,5a,6p-triol, and 5- and 7-hydroperoxides tend to be toxic to some biological systems. In addition, there are reports that 27-hydroxycholesterol, a primary metabolite of cholesterol, increases the growth of estrogen receptor (ER)-positive tumors by functioning as an endogenous selective estrogen receptor modulator (SERM). Also, most cholesterol available on the market is animal cholesterol from eggs or wool grease, which is extracted from animal sources. These animal sources may not be suitable for human medicine due to the potential for viral contamination.

[13] Meanwhile, until recently, not only lipid nanoparticles but also inorganic nanoparticles including metal nanoparticles and magnetic nanoparticles, have also been developed and applied as nucleic acid carriers. However, there are problems related to the stability of inorganic nanoparticles and difficulties in cell penetration due to the high negative charge resulting from the binding of biomolecules to inorganic nanoparticles. Therefore, it is necessary to introduce an encapsulating agent that can function as a buffer. Lipid nanoparticles can be used as such an encapsulating agent.

[14] To date, many pharmaceuticals have been developed using lipid nanoparticles containing animal cholesterol as nucleic acid carriers for COVID-19 vaccines or cancer vaccines. Under this technical background, the inventors of the present application identified lipid nanoparticles containing a plant-based raw material as a substitute for animal cholesterol and developed a combination of various delivery carriers, thereby completing the present invention.

[15]

[16] Summary of the Invention

[17] An object of the present invention is to provide a lipid nanoparticle containing a plant-based raw material.

[18] Another object of the present invention is to provide a composition for nucleic acid delivery including the lipid nanoparticle .

[19] Still another object of the present invention is to provide a method for producing the lipid nanoparticle.

[20] Yet another object of the present invention is to provide a nucleic acid-inorganic nanoparticle / lipid nanoparticle complex to enhance cell penetration and expression of nucleic acids anchored to the surface of inorganic nanoparticles..

[21] To achieve the above objects, the present invention provides a lipid nanoparticle including: an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[22] The present invention also provides a lipid nanoparticle encapsulating a nucleic acid-bound inorganic nanoparticle, wherein the lipid nanoparticle includes: an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[23] The present invention also provides a composition for nucleic acid delivery including the lipid nanoparticle.

[24] The present invention also provides a composition for nucleic acid delivery including, as an active ingredient, a complex in which a nucleic acid-bound inorganic nanoparticle is encapsulated in a lipid nanoparticle including an ionizable lipid, a phospholipid, a water-soluble polymer, and a ginsenoside or a derivative thereof to enhance the cell penetration and expression level of the nucleic acid-bound inorganic nanoparticle.

[25] Furthermore, the present invention provides a method for producing lipid nanoparticles, including a step of dissolving an ionizable lipid, a phospholipid, a watersoluble polymer and a ginsenoside or a derivative thereof in a solvent.

[26] Brief Description of Drawings

[27] FIG. 1 shows the results of analyzing the physicochemical properties of lipid nanoparticles produced according to the present invention. Specifically, (A) is an electron microscope image of a lipid nanoparticle (Gin_Rg2- LNP) / mRNA complex containing ginsenoside Rg2, (B) is an electron microscope image of a lipid nanoparticle (Gin_PPD- LNP) / mRNA complex containing protopanaxadiol, a phytosterol, (C) shows a change in size of Gin_Rg2_LNP with or without mRNA, and (D) shows a change in size of Gin_PPD-LNP with or without mRNA ((a) without mRNA, and (b) with mRNA).

[28] FIG. 2 shows the results of electrophoresis performed to analyze encapsulation efficiency depending on the ratio between lipid nanoparticles (Gin_Rg2-LNP, or Gin_PPD-LNP) produced according to the present invention and mRNA. Specifically, (A) shows the results of analyzing the encapsulation efficiency of Gin_Rg2-LNP depending on the mass ratio between LNP and mRNA, (B) shows the results of analyzing the encapsulation efficiency of  Gin_PPD-LNP depending on the mass ratio between LNP and mRNA, and (C) shows the results of analyzing the encapsulation efficiency of Gin_PPD-LNP depending on the volume ratio between an LNP-containing solvent and an mRNA-containing solvent.

[29] FIG. 3 shows the results of testing the stability of (A) lipid nanoparticle  Gin_Rg2_LNP / mRNA  and (B) lipid nanoparticle Gin_PPD_LNP / mRNA complexes, produced according to the present invention, against RNA-degrading enzyme (RNase).

[30] FIG. 4 shows the results of evaluating the cytotoxicity of ginsenoside Rg2 and the phytosterol protopanaxadiol (PPD), which are the components of the developed lipid nanoparticles. Specifically, (A) shows the results of cell counting kit assay (CCK-8), and (B) shows optical microscope images of cells after treatment.

[31] FIG. 5 shows the results of evaluating the cytotoxicity of the developed lipid nanoparticles (Gin_Rg2-LNP, and Gin_PPD-LNP). Specifically, (A) shows the results of cell counting kit assay (Cell Counting Kit-8, CCK-8), and (B) shows optical microscope images of cells after lipid nanoparticle treatment.

[32] FIG. 6 shows optical microscope images showing the results of observing GFP expressed in lung cancer cell line A549 when 1 pg of GFP mRNA was delivered using each of Gin_Rg2-LNP and Gin_PPD-LNP.

[33] FIG. 7 shows optical microscope images showing the results of observing GFP expressed in cervical cancer cell line HeLa when 1 pg of GFP mRNA was delivered using each of Gin_Rg2-LNP and Gin_PPD-LNP.

[34] FIG. 8 is a figure showing the results of comparing the expression levels of GFP mRNA and Gin_Rg2-LNP in HeLa cells depending on the mixing ratio therebetween.

[35] FIG. 9 is a figure showing the results of comparing the expression levels of GFP mRNA and Gin_PPD-LNP in HeLa cells depending on the mixing ratio therebetween.

[36] FIG. 10 is optical microscope images showing the results of evaluating the optimization of mRNA delivery and expression in HeLa cells depending on the amount of PEG lipid contained in each of Gin_Rg2-LNP and Gin_PPD-LNP.

[37] FIG. 11 shows the results of comparing the mRNA expression levels when 1 pg of GFP mRNA was delivered using each of the lipid nanoparticles (Gin_Rg2-LNP, and Gin_PPD-LNP) of the present invention and commercial lipid nanoparticle synthesis kits.

[38] FIG. 12 shows the results of confirming the luminescence value resulting from luciferase expression after delivering luciferase mRNA, encapsulated in each of the lipid nanoparticles (Gin_Rg2-LNP, and Gin_PPD-LNP) of the present invention, to A549 cells.

[39] FIG. 13 shows the results of analyzing the change in surface charge of a complex, obtained by attaching GFP mRNA to the surface of a gold nanoparticle (AuNP) and then encapsulating the gold nanoparticle in Gin_PPD-LNP, and the results of observing the complex with a transmission electron microscope. Specifically, (A) shows the change in zeta potential of GFP mRNA-AuNP@Gin_PPD-LNP depending on the synthesis steps ( (a) AuNP, (b) GFP mRNA-AuNP, and (c) GFP mRNA-AuNP@Gin_PPD-LNP), and (B) is a transmission electron microscope image of GFP mRNA-AuNP@Gin_PPD-LNP.

[40] FIG. 14 shows the results of comparing GFP expression in lung cancer cell line A549 depending on whether mRNA-AuNP was encapsulated in lipid nanoparticles. Specifically, (A) shows cells treated with GFP mRNA-AuNP, and (B) shows cells treated with GFP mRNA-AuNP@Gin_PPD-LNP.

[41] FIG. 15 is fluorescence microscope images showing the results of observing GFP and mCherry expressed by delivering GFP mRNA and mCherry mRNA, encapsulated alone or in combination in PPD-LNP, to HEK293T.

[42] FIG. 16 shows the results of analyzing, by flow cytometry, the fluorescence intensity of each of GFP and mCherry expressed by delivering GFP mRNA and mCherry mRNA, encapsulated alone or in combination in PPD-LNP, to HEK293T.

[43] FIG. 17 shows the results of verifying the in vivo mRNA delivery and expression of each of Gin_Rg2-LNP and Gin_PPD-LNP by observing the luciferase expressed by administering luciferase mRNA to hairless mice by intramuscular injection.

[44] FIG. 18 is a graph showing the luminescence efficiency of luciferase in vivo expressed as total flux.

[45] FIG. 19 is fluorescence microscope images showing the results of observing GFP expression to verify folate-PPD-LNP that targets folate receptors in HeLa cells.

[46] FIG. 20 is fluorescence microscope images showing the results of observing GFP expression to verify HA-PPD-LNP that targets CD44 in A549 cells.

[47]

[48] Detailed Description and Preferred Embodiments of the Invention

[49] Unless otherwise defined, all technical and scientific terms used in the present specification have the same meanings as commonly understood by those skilled in the art to which the present disclosure pertains. In general, the nomenclature used in the present specification is well known and commonly used in the art.

[50] During studies on the cancer cell growth inhibition and death functions of tumor suppressor genes, the inventors of the present application have recognized the need for effective delivery carriers for these genes, and in particular, have determined that it is necessary to overcome the uncertainty regarding toxicity, etc., in the case of animal cholesterol.

[51] Accordingly, ginsenosides and their derivatives, including phytosterols such as protopanaxadiol (PPD) and protopanaxatriol (PPT), which are substitutes for animal cholesterol, are phytochemicals that are plant-based raw materials mainly found in ginseng and the like. It is known that these compounds have high biocompatibility and physiological activity, exhibit, for example, anticancer, anti-inflammatory, and antioxidant properties, and also have good effects on diabetes and hypertension.

[52] The present inventors have found that a ginsenoside or its derivative, phytosterol, can not only play a role in strengthening the structure of lipid nanoparticles but also have the potential to exhibit synergistic effects with nucleic acids for therapeutics or vaccines. To date, many pharmaceuticals have been developed using lipid nanoparticles containing animal cholesterol as nucleic acid carriers for COVID-19 vaccines or cancer vaccines. The present inventors have developed lipid nanoparticles for nucleic acid delivery using a ginsenoside or a derivative thereof, which is a plant-based raw material, as a substitute for cholesterol.

[53] In the present invention, lipid nanoparticles were synthesized using a ginsenoside or its derivative thereof, phytosterol, which is a plant-based raw material, as a substitute for cholesterol, and then loaded with nucleic acid and its expression in various cells was examined. It was confirmed that lipid nanoparticles containing a ginsenoside or a derivative thereof had no cytotoxicity, had better expression levels than intracellular genetic transduction reagents such as lipofectamine, and also had excellent protein expression levels even when compared to commercial lipid nanoparticle synthesis kits containing cholesterol for in vivo nucleic acid delivery.

[54] In addition, the present inventors have found that a complex in which a nucleic acid-bound inorganic nanoparticle is encapsulated in a lipid nanoparticle containing a ginsenoside derivative enhances penetration and expression of the nucleic acid in a cell compared to the case without the lipid nanoparticle, thereby completing the present invention .

[55] In one aspect, the present invention relates to a lipid nanoparticle including: an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[56] The term “lipid nanoparticles” refers to a lipid-based particle with a size in the range of micrometers or less and may include any vesicular structure formed by one or more lipid components.

[57] The term “lipid” refers to a group of oils, fats, and fat-like substances that are soluble in relatively nonpolar solvents but almost insoluble in aqueous solvents . Lipids are the major organic compounds that make up cells, and the terms “lipid” and “fat” may be used interchangeably. Fats may include triglycerides, a type of lipid.

[58] The term “ionizable lipid”, which is used interchangeably with “lipid analog (lipidoid)”, refers to amine-containing lipids that may be easily protonated, and may be, for example, a lipid whose charge state changes depending on the surrounding pH.

[59] The ionizable lipid may be protonated (positively charged) at a pH below the pKa of a cationic lipid and may be substantially neutral at a pH above the pKa. In one example, the lipid nanoparticle may include a protonated ionizable lipid and / or an ionizable lipid exhibiting neutrality.

[60] The term “ionizable lipid” may be used interchangeably with the term “ionic lipid”. The ionizable lipid is an ionizable compound having properties similar to lipids, and may interact with active ingredients (e.g., anionic drug and / or nucleic acid) contained in the lipid nanoparticle so that the active ingredients may be encapsulated in the lipid nanoparticle with high efficiency.

[61] The ionizable lipid is exemplified in detail in U.S. Patent Publication No. 2018 / 0311176, No. 2019 / 0032051, etc., and may be, for example, but is not limited to, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium      bromide       (DDAB),       N-(1-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),          1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),       1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),                      1,2-dilinoleylcarbamoyloxy-3- dimethylaminopropane    (DLin-C-DAP),    1,2-dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyoxy- 3-morpholinopropane      (DLin-MA),      1,2-dilinoleoyl-3- dimethylaminopropane    (DLinDAP),    1,2-dilinoleylthio-3- dimethylaminopropane       (DLin-S-DMA),       1-linoleoyl-2- linoleyloxy-3-dimethylaminopropane    (DLin-2-DMAP),    1,2- dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt          (DLin-TAP.Cl),          1,2-dilinoleyloxy-3-(N- methylpiperazino)propane     (DLin-MPZ),     or     3-(N,N- dilinoleylamino)-1,2-propanediol      (DLinAP),      3-(N,N- dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane    (DLin-EG-DMA),    1,2- dilinolenyloxy-N,N-dimethylaminopropane   (DLinDMA),   2,2- dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane    (DLin-K- DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di ( (9Z,12Z)-octadeca-9,             12-dienyl)tetrahydro-3aH- cyclopenta[d][1,3]dioxol-5-amine (ALN100),  (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl                    4- (dimethylamino)butanoate (MC3),  1,  1’-(2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane,     p-L-arginyl-2,3-L- diaminopropionic acid-N-palmityl-N-oleylamide trihydrochloride,          N‘,N‘-dioctadecyl-N-4,8-diaza-10- aminodecanoylglycine amide

[71] ,   1,2-dilinoleyloxy-3- dimethylaminopropane, DLin-KC2-DMA, amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2- DMA, 1), 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), dilinoleylmethyl-4-dimethylaminobutyrate     (DLin-MC3-DMA), DLin-D-DMA,       C12-200,       98N12-5,       (20Z,23Z)-N,N- dimethylnonacosa-20,23-dien-10-amine,         (17Z,20Z)-N,N- dimemylhexacosa-17,2 0-dien-9-amine,            (1Z,19Z)-N5N- dimethylpentacosa-16,19-dien-8-amine,         (13Z,16Z)-N,N- dimethyldocosa-13,16-dien-5-amine,             (12Z,15Z)-N,N- dimethylhenicosa-12,15-dien-4-amine,          (14Z,17Z)-N,N- dimethyltricosa-14,17-dien-6-amine,           (15Z,18Z)-N,N- dimethyltetracosa-15,18-dien-7-amine,         (18Z,21Z)-N,N- dimethylheptacosa-18,21-dien-10-amine,        (15Z,18Z)-N,N- dimethyltetracosa-15,18-dien-5-amine,         (14Z,17Z)-N,N- dimethyltricosa-14,17-dien-4-amine,           (19Z,22Z)-N,N- dimethyloctacosa-19,22-dien-9-amine,          (18Z,21Z)-N,N- dimethylheptacosa-18,21-dien-8-amine,         (17Z,20Z)-N,N- dimethylhexacosa-17,20-dien-7-amine,          (16Z,19Z)-N,N- dimethylpentacosa-16,19-dien-6-amine,         (22Z,25Z)-N,N- dimethylhentriaconta-2 2,2 5-dien-10-amine,     (21Z,24Z)-N,N- dimethyltriaconta-21,2 4-dien-9-amine,              (18Z)-N,N- dimethylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos- 17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine,        1-[(11Z,14Z)-1- nonylicosa-11,14-dien-1-yl]pyrrolidine,           (20Z)-N,N- dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethyleptacos-15-en-10-amine,    (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine,          (24Z)-N,N- dimethyltritriacont-24-en-10-amine,                (20Z)-N,N- dimethylnonacos-20-en-10-amine,                     (22Z)-N,N- dimethylhentriacont-22-en-10-amine,                (16Z)-N,N- dimethylpentacos-16-en-8-amine,    (12Z,15Z)-N,N-dimethyl-2- nonylhenicosa-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecan-8-amine,            1-[ (1S,2R)-2- hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine,       N,N- dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine,N,N-dimeth-yl-1-[ (1S,2S)-2-{ [ (1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine,N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine,                             N,N-dimethyl-[(1R,2S)-2- undecylcyclopropyl]tetradecan-5-amine,    N,N-dimethyl-3-{7- [(1   S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine,   1 [ (1R,2S)-2-heptylcyclopropyl]-N, N-dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6- amine, N, N-dimethyl-1-[(1S,2R)-2- octylcyclopropyl]pentadecan-8-amine,       R-N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propa-n-2-amine,    S-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1- yloxy]-3-(octy-loxy)propan-2-amine,          1-{2-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]-1-Roctyloxy)methyl]ethyl}pyrro-lidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[ (5Z)-oct-5-en-1-yloxy]propan-2-amine,         1-{2- [ (9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1- [ (octyloxy)methyl]ethyl}azet-idine, (2S)-1- (hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2- amine,           (2S)-1- (heptyloxy)-N,N-dimethyl-3-[(9Z, 12Z) - octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine,         N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3- (octyloxy)propan-2-amine;  (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)- octadeca-6,9,12-trien-1-yloxy]-3-(o-ctyloxy)propan-2-amine, (2S)-1- [ (11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1- (hexyloxy)-3-[ (11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-di-methylpropan-2-amine,    1 [ (11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3- (octyloxy)propan-2-amine,  1- [ (13Z,16Z)-docosa-13,16-dien-1- yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine,      (2S)-1- [(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[ (13Z)-docos-13-en-1-yloxy]- 3- (hexyloxy)-N,N-dimethylpropan-2-amine, 1- [ (13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3—(octyloxy)propan-2-amine,      1- [(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3- (octyloxy)propan-2-amine,              (2R)—N,N-dimethyl-H(1- metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9, 12-dien-1- yloxy]propan-2-amine, (2R) -1- [ (3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di-en-1-yloxy]propan-2-amine,            N,N-dimethyl-1-(octyloxy)-3-({8-[ (1S,2S)-2- {[(1R,2R)-2-pentylcyclopropyl]- methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-trien- 10-amine, 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”), dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide (DMRIE), DMRIE-HP, Lipofectamine (DOSPA), 3b-(N—(N‘,N'-dimethylaminoethane)-carbamoyl) cholesterol (“DC-Choi”), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”), 1,2-dioleoyl-3-dimethylammonium-propane (“DODAP”), DMDMA, cationic lipid-based transfection reagents TransIT-TKO, LIPOFECTIN, Lipofectamine, OLIGOFECTAMINE or DHARMAFECT, DSDMA, DODMA, DLinDMA, DLenDMA, gamma-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DM A, DLin-K-C4-DMA, DLen-C2K-DMA, y-DLen-C2K-DMA, DLin-M-C2-DMA (MC2), DLin-M-C3-DMA (MC3), or DLin-MP-DMA (1-B11), or a mixture of two or more thereof.

[62] In a specific embodiment according to the present invention, the ionizable lipid may be heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate.

[63] The term “phospholipid” refers to a complex lipid containing phosphate ester within the molecule. The phospholipid is a main component of biological membranes, such as the cell membrane, endoplasmic reticulum, mitochondria, and myelin sheath around nerve fibers. The phospholipid has a hydrophilic head and two hydrophobic tails. When phospholipids are exposed to water, they arrange themselves into a two-layered sheet (bilayer) with all of their tails pointing toward the center of the sheet.

[64] The phospholipid is exemplified in detail in U.S. Patent Publication No. 2018 / 0311176, No. 2019 / 0032051, etc., and may be, for example, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine,   diacylphosphatidic acid,   N- dodecanoyl       phosphatidylethanolamine,       N-succinyl phosphatidylethanolamine,                         N-glutaryl phosphatidylethanolamine, or lysylphosphatidylglycerol.

[65] In a specific embodiment according to the present invention, the phospholipid may be 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

[66] In some cases, the lipid nanoparticle may further include a non-cationic lipid. The non-cationic lipid may include an amphiphilic lipid, a neutral lipid, or an anionic lipid. The non-cationic lipid may be, for example, but is not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine                           (DOPC), dipalmitoylphosphatidylcholine                        (DPPC), dioleoylphosphatidylglycerol                          (DOPG), dipalmitoylphosphatidylglycerol       (DPPG),       dioleoylphosphatidylethanolamine                              (DOPE), palmitoyloleoylphosphatidylcholine                    (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(-maleimidomethyl)-cyclohexane-1-carboxylate    (DOPE-mal),    dipalmitoyl    phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine      (DSPE),      16-O- monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine    (SOPE),    cholesterol, phosphatidylglycerols ,                          cardiolipins, diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl       phosphatidylethanolamines,       N-succinyl phosphatidylethanolamines,                                N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,                               or palmitoyloleyolphosphatidylglycerol (POPG).

[67] The water-soluble polymer is included to ensure in vivo stability and may include, for example, a polyethylene glycol derivative. The term “polyethylene glycol derivative” may be used interchangeably with the term “PEG lipid”.

[68] The polyethylene glycol derivative is exemplified in detail in U.S. Patent Publication No. 2018 / 0311176, No. 2 019 / 0 032 051, etc., and may be, for example, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEGphospholipid, PEG-ceramide (Cer) , or a mixture of two or more thereof. As a non-limiting example, PLGA may be conjugated to a lipid-terminating PEG forming PLGA-DSPE-PEG, and PEG lipid is selected from PEG-c-DOMG and 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG), PEG-c-DOMG, 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol         (PEG-DSG)         1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DPG), PEG-lipid conjugates such as, e.g., PEG coupled to dialkyloxypropyls (e.g., PEG-DAA conjugates), PEG coupled to diacylglycerols (e.g., PEGDAG conjugates), PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, and PEG conjugated to ceramides, cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates, polyamide oligomers (e.g., ATTA-lipid conjugates), and mixtures thereof. In some embodiments, the PEG may be PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG- dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), PEG-c-DOMG, PEG-DMG, or a mixture of two or more thereof, without being limited thereto.

[69] In a specific embodiment according to the present invention, the polyethylene glycol derivative may be 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol.

[70] The ginsenoside may be a plant-derived ginsenoside, for example, Rg2 or Rh2, or an isomer thereof. Here, Rg2 may be a protopanaxadiol-based ginsenoside, and Rh2 may be a protopanaxadiol-based ginsenoside. The isomer may be an optical isomer, and may include, for example, S- and R-optical isomers.

[71] The ginsenoside derivative may be a phytosterol obtained by removing sugar from ginsenoside Rg2 or Rh2.

[72] The phytosterols may be, for example, selected from the group consisting of protopanaxadiol (PPD) , protopanaxatriol (PPT), and mixtures thereof, without being limited thereto.

[73] The ionizable lipid, phospholipid, water-soluble polymer and ginsenoside or derivative thereof included in the lipid nanoparticle may be present at a molar ratio of, for example, 30 to 70:7 to 13:1 to 1.5:20 to 85, respectively.

[74] The ionizable lipid, phospholipid, water-soluble polymer and ginsenoside or derivative thereof included in the lipid nanoparticle may be, for example, ionizable lipid, phospholipid, PEG lipid, and ginsenoside, respectively, and in    this    case,    the   molar    ratio    of    ionizable lipid:phospholipid:PEG lipid:ginsenoside may be, for example, 50:10:1.5:78, 50:10:1.5:39, or 50:10:0.75:39, without being limited thereto.

[75] In a specific embodiment according to the present invention, the ginsenoside or the derivative thereof, phytosterol, may be included in an amount of 1.48 mg or 0.74 mg, and the lipid nanoparticle may include ionizable lipid, phospholipid, PEG lipid, and phytosterol. In this case, the molar    ratio    of    ionizable    lipid:phospholipid:PEG lipid:phytosterol     is     preferably,     for     example, 50:10:1.5:45.81, or 50:10:1.5:22.9, or 50:10:0.75:22.9, without being limited thereto.

[76] Nucleic acid may be delivered by the lipid nanoparticle. The term “nucleic acid” is used interchangeably with, for example, the terms “polynucleotide”, “nucleotide”, “nucleotide sequence”, and “oligonucleotide”. The nucleic acid may include polymeric forms of nucleotides with any length, deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and perform any known or unknown functions . A polynucleotide may include one or more modified nucleotides such as methylated nucleotides and nucleotide analogs. Modifications of the nucleotide structure may be possible before or after assembly of polymers.

[77] Preferably, the nucleic acid is a polymer that comprises or consists of nucleotide monomers covalently linked to each other by phosphodiester bonds of the sugar / phosphate backbone. The term “nucleic acid” includes modified nucleic acids such as base-modified, sugar-modified or backbone-modified DNA or RNA molecules.

[78] DNA is an abbreviation for deoxyribonucleic acid. It is a nucleic acid molecule, namely, a polymer consisting of nucleotides. These nucleotides are usually deoxy-adenosinemonophosphate,     deoxy-thymidine-monophosphate,     deoxy guanosine-monophosphate and deoxy-cytidine-monophosphate monomers, which are composed of a sugar moiety (deoxyribose), a base moiety and a phosphate moiety, and polymerize by a characteristic backbone structure. The backbone structure is typically formed by phosphodiester bonds between the sugar moiety of the nucleotide, i.e., deoxyribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers, i.e., the order of the bases linked to the sugar / phosphate-backbone, is called the DNA-sequence. DNA may be single-stranded or double-stranded. In the double stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g., by A / T-base-pairing and G / C-base-pairing.

[79] RNA includes, for example, mRNA. RNA is the usual abbreviation for ribonucleic acid. It is a nucleic acid molecule, i.e., a polymer consisting of nucleotide monomers. These nucleotides are usually adenosine-monophosphate, uridine-monophosphate, guanosine-monophosphate and cytidinemonophosphate monomers, which are connected to each other along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar, i.e., ribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers is called the RNA-sequence. Usually, RNA may be obtainable by transcription of a DNA-sequence, e.g., inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or the mitochondria. In vivo, transcription of DNA usually results in so-called premature RNA, which has to be processed into so-called messenger-RNA, usually abbreviated as mRNA. Processing of the premature RNA, e.g., in eukaryotic organisms,     comprises    a    variety    of    different posttranscriptional-modifications such as splicing, 5'-capping, polyadenylation, export from the nucleus or the mitochondria and the like. Messenger RNA usually provides a nucleotide sequence that may be translated into an amino acid sequence of a particular peptide or protein. Typically, mRNA comprises a 5’-cap, optionally a 5‘UTR, an open reading frame, optionally a 3‘UTR and a poly(A) sequence. Aside from messenger RNA, several non-coding types of RNA exist which may be involved in regulation of transcription and / or translation .

[80] An open reading frame may typically be a sequence of several nucleotide triplets, which may be translated into a peptide or protein. An open reading frame preferably contains a start codon, i.e., a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG or AUG), at its 5‘-end and a subsequent region, which usually exhibits a length which is a multiple of 3 nucleotides. An ORF is preferably terminated by a stop-codon (e.g., TAA, TAG, TGA) . Typically, this is the only stop codon in the open reading frame. Thus, an open reading frame in the context of the present invention is preferably a nucleotide sequence, consisting of a number of nucleotides that may be divided by three, which starts with a start codon (e.g., ATG or AUG) and which preferably terminates with a stop codon (e.g., TAA, TGA, or TAG or UAA, UGA, UAG, respectively) . The open reading frame may be isolated or it may be incorporated in a longer nucleic acid sequence, for example in a vector or an mRNA. An open reading frame may also be termed “polypeptide” or “protein coding region”.

[81] In some cases, the nucleic acid may be a modified nucleic acid, for example, LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro-modified nucleic acid, 8-aza7-deaza-dA), ppG (8-aza7-deaza-dG), isodC     (2'-deoxypseudoisocytidine),     fdU     (5-fluoro-2'- deoxyuridine),   or ENA   (2'-O,4'-C-ethylene-crosslinked nucleic acid) , or a combination of two or more thereof, without being limited thereto.

[82] The term “LNA” includes a class of nucleic acid analogues in which the ribose ring is “locked” by a methylene bridge connecting the 2‘-O atom and the 4‘-C atom. LNA nucleosides contain the common nucleobases (T, C, G, A, U, and mC) and are able to form base pairs according to standard Watson-Crick base pairing rules.

[83] The term “PNA” includes a non-naturally occurring and artificially synthesized nucleic acid comprising various naturally-occurring or non-naturally-occurring nucleobases attached to a backbone of repeating N-(2-aminoethyl)-glycine units linked by amide bonds. The purine and pyrimidine bases are attached to the uncharged backbone through methylene carbonyl linkages .

[84] The term “ZNA” includes oligonucleotides conjugated with one or a plurality of cationic spermine moieties that decrease electrostatic repulsions with target nucleic acid strands and increase the affinity of the oligonucleotides for their targets.

[85] The term "LDNA" includes an oligonucleotide comprising a non-naturally occurring triazole linkage.

[86] The term "TNA" refers to non-naturally occurring nucleic acids discovered during investigations into nucleic acids that obey Watson-Crick base-pairing rules and are bound to alternative sugar-phosphate backbones. TNAs have a repeat unit that is one atom shorter than natural nucleic acids, yet they can base pair with DNA, RNA, and itself.

[87] The nucleic acid may be single- or double-stranded. In addition to DNA, RNA, mRNA, small RNA (siRNA), etc., it may also be double stranded with a modified nucleic acid, for example, LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro-modified nucleic acid, 8-aza-7-deaza-dA), ppG (8-aza-7-deaza-dG), iso-dC (2'-deoxypseudoisocytidine), fdU (5-fluoro-2'-deoxyuridine), or ENA (2'-O,4'-C-ethylene cross-linked nucleic acid), or a combination of two or more thereof.

[88]

[89] In another aspect, the present invention provides a method for producing lipid nanoparticles, including a step of dissolving an ionizable lipid, a phospholipid, a watersoluble polymer and a ginsenoside or a derivative thereof in a solvent.

[90] The solvent may be, for example, an alcohol, without being limited thereto. Specifically, the solvent may be ethanol.

[91] The method for synthesis of the lipid nanoparticles may be performed by rapid mixing using a T-shaped or Y-shaped microfluidic system, extrusion using a mini-extruder, synthesis using ultrasound, or stirring, without being limited thereto.

[92] The volume ratio between an ethanol solvent containing the lipid nanoparticles and an aqueous solution containing nucleic acid may be 1:3, 2:3, or 1:1  (v / v), and this ratio may be optimized depending on whether the lipid nanoparticle includes a ginsenoside or includes a phytosterol.

[93] The ionizable lipid is exemplified in detail in U.S. Patent Publication No. 2018 / 0311176, No. 2019 / 0032051, etc., and may be, for example, but is not limited to, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N, N-dimethylammonium       bromide       (DDAB),       N-(1-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),          1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),       1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),                      1,2-dilinoleylcarbamoyloxy-3- dimethylaminopropane    (DLin-C-DAP),    1,2-dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyoxy- 3-morpholinopropane      (DLin-MA),      1,2-dilinoleoyl-3- dimethylaminopropane    (DLinDAP),    1,2-dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2- linoleyloxy-3-dimethylaminopropane    (DLin-2-DMAP),    1,2- dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt          (DLin-TAP.Cl),          1,2-dilinoleyloxy-3-(N- methylpiperazino)propane     (DLin-MPZ),     or     3-(N,N- dilinoleylamino)-1,2-propanediol      (DLinAP),      3-(N,N- dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane    (DLin-EG-DMA),    1,2- dilinolenyloxy-N,N-dimethylaminopropane   (DLinDMA),   2,2- dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane    (DLin-K- DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di ( (9Z,12Z)-octadeca-9,             12-dienyl)tetrahydro-3aH- cyclopenta[d][1,3]dioxol-5-amine (ALN100),  (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl                    4- (dimethylamino)butanoate (MC3),  1,  1’-(2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane,     |3-L-arginyl-2,3-L- diaminopropionic               acid-N-palmityl-N-oleylamide trihydrochloride,          N',N’-dioctadecyl-N-4 , 8-diaza-10- aminodecanoylglycine amide

[71] ,   1,2-dilinoleyloxy-3- dimethylaminopropane, DLin-KC2-DMA, amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2- DMA, 1), 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA), DLin-D-DMA, C12-200, 98N12-5, (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-2 2,2 5-dien-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,2 4-dien-9-amine, (18Z)-N,N-dimethylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1-nonylicosa-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethyleptacos- 15-en-10-amine,    (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine,          (24Z)-N,N- dimethyltritriacont-24-en-10-amine,                (20Z)-N,N- dimethylnonacos-20-en-10-amine,                     (22Z)-N,N- dimethylhentriacont-22-en-10-amine,                (16Z)-N,N- dimethylpentacos-16-en-8-amine,    (12Z,15Z)-N,N-dimethyl-2- nonylhenicosa-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecan-8-amine,            1-[(1S,2R)-2- hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine,       N,N- dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine,N,N-dimeth-yl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine,N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine,                             N,N-dimethyl-[(1R,2S)-2- undecylcyclopropyl]tetradecan-5-amine,    N,N-dimethyl-3-{7- [(1   S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine,   1 [ (1R,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine,                             N,N-dimethyl-1-[(1S,2R)-2- octylcyclopropyl]pentadecan-8-amine,       R-N,N-dimethyl-1- [ (9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propa-n-2-amine,    S-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1- yloxy]-3-(octy-loxy)propan-2-amine,          1-{2-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]-1-Roctyloxy)methyl]ethyl}pyrro-lidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[ (5Z)-oct-5-en-1-yloxy]propan-2-amine,         1-{2- [ (9Z,12Z)-octadeca-9,12-dien-1-yloxy] -1 [ (octyloxy)methyl]ethyl}azet-idine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-ylo-xy]propan-2-amine,           (2S)-1- (heptyloxy)-N,N-dimethyl-3-[(9Z, 12Z) - octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[ (9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine,         N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3- (octyloxy)propan-2-amine;  (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)- octadeca-6,9,12-trien-1-yloxy]-3-(o-ctyloxy)propan-2-amine, (2S)-1- [ (11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1- (hexyloxy)-3-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-di-methylpropan-2-amine,    1 [ (11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine,  1- [ (13Z,16Z)-docosa-13,16-dien-1- yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine,      (2S)-1- [ (13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpro-pan-2-amine,         (2S)-1- [ (13Z)-docos-13-en-1- yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine,    1- [ (13Z)- docos-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine,         1- [(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3- (octyloxy)propan-2-amine,              (2R)—N,N-dimethyl-H(1- metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1- yloxy]propan-2-amine, (2R) -1- [ (3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di-en-1-yloxy]propan-2-amine,            N,N-dimethyl-1-(octyloxy) - 3-({8-[ (1S,2S)-2- {[(1R,2R)-2-pentylcyclopropyl]- methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-trien-10-amine, 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”), dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide (DMRIE), DMRIE-HP, Lipofectamine (DOSPA), 3b-(N—(N‘,N‘-dimethylaminoethane)-carbamoyl) cholesterol (“DC-Choi”), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”), 1,2-dioleoyl-3-dimethylammonium-propane (“DODAP”), DMDMA, cationic lipid-based transfection reagents TransIT-TKO, LIPOFECTIN, Lipofectamine, OLIGOFECTAMINE or DHARMAFECT, DSDMA, DODMA, DLinDMA, DLenDMA, gamma-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DM A, DLin-K-C4-DMA, DLen-C2K-DMA, y-DLen-C2K-DMA, DLin-M-C2-DMA (MC2), DLin-M-C3-DMA (MC3), or DLin-MP-DMA (1-B11), or a mixture of two or more thereof.

[94] In a specific embodiment according to the present invention, the ionizable lipid may be heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate.

[95] The phospholipid is exemplified in detail in U.S. Patent Publication No. 2018 / 0311176, No. 2019 / 0032051, etc., and may be, for example, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinyl phosphatidylethanolamine, N-glutaryl phosphatidylethanolamine, or lysylphosphatidylglycerol.

[96] In a specific embodiment according to the present invention, the phospholipid may be 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

[97] In some cases, the lipid nanoparticle may further include a non-cationic lipid. The non-cationic lipid may include an amphiphilic lipid, a neutral lipid, or an anionic lipid. The non-cationic lipid may be, for example, but is not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O- monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine     (SOPE),    cholesterol, phosphatidylglycerols ,                          cardiolipins, diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl       phosphatidylethanolamines,       N-succinyl phosphatidylethanolamines,                                N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,                               or palmitoyloleyolphosphatidylglycerol (POPG).

[98] The water-soluble polymer is included to ensure in vivo stability and may include, for example, a polyethylene glycol derivative. The term “polyethylene glycol derivative” may be used interchangeably with the term “PEG lipid”.

[99] The polyethylene glycol derivative is exemplified in detail in U.S. Patent Publication No. 2018 / 0311176, No. 2 019 / 0032051, etc., and may be, for example, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEGphospholipid, PEG-ceramide (Cer), or a mixture of two or more thereof. As a non-limiting example, PLGA may be conjugated to a lipid-terminating PEG forming PLGA-DSPE-PEG, and PEG lipid is selected from PEG-c-DOMG and 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG), PEG-c-DOMG, 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG) 1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DPG), PEG-lipid conjugates such as, e.g., PEG coupled to dialkyloxypropyls (e.g., PEG-DAA conjugates), PEG coupled to diacylglycerols (e.g., PEGDAG conjugates), PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, and PEG conjugated to ceramides, cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates, polyamide oligomers (e.g., ATTA-lipid conjugates), and mixtures thereof. In some embodiments, the PEG may be PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), PEG-c-DOMG, PEG-DMG, or a mixture of two or more thereof, without being limited thereto.

[100] In a specific embodiment according to the present invention, the polyethylene glycol derivative may be 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol.

[101] The ginsenoside may be a plant-derived ginsenoside, for example, Rg2 or Rh2, or an isomer thereof. Here, Rg2 may be a protopanaxadiol-based ginsenoside, and Rh2 may be a protopanaxadiol-based ginsenoside. The isomer may be an optical isomer, and may include, for example, S- and R-optical isomers.

[102] The ginsenoside derivative may be a phytosterol obtained by removing sugar from ginsenoside Rg2 or Rh2.

[103] The phytosterols may be, for example, selected from the    group    consisting    of    protopanaxadiol    (PPD), protopanaxatriol (PPT), and mixtures thereof, without being limited thereto.

[104] The ionizable lipid, phospholipid, water-soluble polymer and ginsenoside or derivative thereof included in the lipid nanoparticle may be, for example, ionizable lipid, phospholipid, PEG lipid, and ginsenoside, respectively, and in    this    case,    the   molar    ratio    of    ionizable lipid:phospholipid:PEG lipid:ginsenoside may be, for example, 50:10:1.5:78, or 50:10:1.5:39, or 50:10:0.75:39, without being limited thereto .

[105] In a specific embodiment according to the present invention, the ginsenoside or the derivative thereof, phytosterol, may be included in an amount of 1.48 mg or 0.74 mg, and the lipid nanoparticle may include ionizable lipid, phospholipid, PEG lipid, and phytosterol. In this case, the molar    ratio    of    ionizable    lipid:phospholipid:PEG lipid:phytosterol     is     preferably,     for     example, 50:10:1.5:45.81, or 50:10:1.5:22.9, or 50:10:0.75:22.9, without being limited thereto.

[106] The nucleic acid may be bound to an inorganic nanoparticle. In this case, the nucleic acid-bound inorganic nanoparticle may be encapsulated in the lipid nanoparticle. Based thereon, a nucleic acid-inorganic nanoparticle / lipid nanoparticle complex may be produced.

[107] The present invention relates to a complex in which a nucleic acid-inorganic nanoparticle conjugate is encapsulated in a lipid nanoparticle, wherein the lipid nanoparticle includes: an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof .

[108] Examples of the inorganic nanoparticle include, but are not limited to, metal nanoparticles including gold, silver, platinum, or the like, metal oxide nanoparticles including iron oxide, zinc oxide, titanium oxide, silicon oxide, or the like, and quantum dot nanoparticles including chalcogenides .

[109] Methods of binding the nucleic acid to the inorganic nanoparticle may include a method capable of directly binding the nucleic acid to the surface of the inorganic nanoparticle, and a method capable of indirectly binding the nucleic acid. Examples of the method capable of directly binding include, but are not limited to, methods of binding by electrostatic attraction due to differences in surface charge, methods of inducing binding between a nucleic acid with terminal thiol groups and a metal nanoparticle, methods using coupling reagents            such            as            1-ethyl-3-(3- dimethylaminopropyl)carbodiimide      (EDC)      and      N- hydroxysuccinimide (NHS), which may induce chemical binding between carboxyl groups on the surface of an inorganic nanoparticle and amine groups at the ends of a gene, and click chemistry-based binding methods using alkynes and azides .

[110] Examples of the method of indirectly binding the nucleic acid to the inorganic nanoparticle include, but are not limited to, a method of modifying the surface of an inorganic nanoparticle with a sequence such as an antisense leader sequence and then inducing binding with a nucleic acid containing a leader sequence that may be complementary to the antisense sequence, a method of inducing binding using biomolecules such as streptavidin-biotin, and a method of inducing binding using small or large molecule compounds.

[111] For the production of the nucleic acid-inorganic nanoparticle / lipid nanoparticle complex for nucleic acid delivery, the mass ratio (w / w) between nucleic acid and the components of the lipid nanoparticle may be, for example, 1:2 to 1:20, specifically 1:2, 1:5, 1:10, or 1:20, but the ratio for effective nucleic acid delivery and expression is preferably 1:2 or 1:5.

[112] In another aspect, the present invention relates to a composition for nucleic acid delivery including the lipid nanoparticle .

[113] In another aspect, the present invention relates to a composition for gene delivery including a nucleic acidinorganic nanoparticle   encapsulated in   the   lipid nanoparticle .

[114] The nucleic acid may include a nucleic acid for therapeutics or vaccines .

[115] The term “nucleic acid” may mean, for example, DNA or RNA.   The terms “polynucleotide”,   “nucleotide”, “nucleotide sequence”, and “oligonucleotide” are used interchangeably. The nucleic acid may include polymeric forms of nucleotides with any length, deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure and perform any known or unknown functions. A polynucleotide may include one or more modified nucleotides such as methylated nucleotides and nucleotide analogs. Modifications of the nucleotide structure may be possible before or after assembly of polymers .

[116] Preferably, the nucleic acid is a polymer that comprises or consists of nucleotide monomers covalently linked to each other by phosphodiester bonds of the sugar / phosphate backbone. The term “nucleic acid” includes modified nucleic acids such as base-modified, sugar-modified or backbone-modified DNA or RNA molecules.

[117] DNA is an abbreviation for deoxyribonucleic acid. It is a nucleic acid molecule, namely, a polymer consisting of nucleotides. These nucleotides are usually deoxy-adenosinemonophosphate,     deoxy-thymidine-monophosphate,     deoxy guanosine-monophosphate and deoxy-cytidine-monophosphate monomers, which are composed of a sugar moiety (deoxyribose), a base moiety and a phosphate moiety, and polymerize by a characteristic backbone structure. The backbone structure is typically formed by phosphodiester bonds between the sugar moiety of the nucleotide, i.e., deoxyribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers, i.e., the order of the bases linked to the sugar / phosphate-backbone, is called the DNA-sequence. DNA may be single-stranded or double-stranded. In the double stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g., by A / T-base-pairing and G / C-base-pairing.

[118] RNA includes, for example, mRNA. RNA is the usual abbreviation for ribonucleic acid. RNA is a nucleic acid molecule, i.e., a polymer consisting of nucleotide monomers. These nucleotides are usually adenosine-monophosphate, uridine-monophosphate, guanosine-monophosphate and cytidinemonophosphate monomers, which are connected to each other along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar, i.e., ribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers is called the RNA-sequence. Usually, RNA may be obtainable by transcription of a DNA-sequence, e.g., inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or the mitochondria. In vivo, transcription of DNA usually results in so-called premature RNA, which has to be processed into so-called messenger-RNA, usually abbreviated as mRNA. Processing of the premature RNA, e.g., in eukaryotic organisms,     comprises    a    variety    of    different posttranscriptional-modifications such as splicing, 5'-capping, polyadenylation, export from the nucleus or the mitochondria and the like. Messenger RNA usually provides the nucleotide sequence that may be translated into an amino acid sequence of a particular peptide or protein. Typically, mRNA comprises a 5’-cap, optionally a 5‘UTR, an open reading frame, optionally a 3′UTR and a poly(A) sequence. Aside from messenger RNA, several non-coding types of RNA exist which may be involved in regulation of transcription and / or translation .

[119] An open reading frame may typically be a sequence of several nucleotide triplets, which may be translated into a peptide or protein. An open reading frame preferably contains a start codon, i.e., a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG or AUG), at its 5'-end and a subsequent region, which usually exhibits a length which is a multiple of 3 nucleotides. An ORF is preferably terminated by a stop codon (e.g., TAA, TAG, TGA) . Typically, this is the only stop codon in the open reading frame. Thus, an open reading frame in the context of the present invention is preferably a nucleotide sequence, consisting of a number of nucleotides that may be divided by three, which starts with a start codon (e.g., ATG or AUG) and which preferably terminates with a stop codon (e.g., TAA, TGA, or TAG or UAA, UGA, UAG, respectively) . The open reading frame may be isolated or it may be incorporated in a longer nucleic acid sequence, for example in a vector or an mRNA. An open reading frame may also be termed “polypeptide” or “protein coding region”.

[120] In some cases, the nucleic acid may be a modified nucleic acid, for example, LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro-modified nucleic acid, 8-aza7-deaza-dA), ppG (8-aza7-deaza-dG), isodC     (2'-deoxypseudoisocytidine),     fdU     (5-fluoro-2'- deoxyuridine),   or ENA   (2'-O,4'-C-ethylene-crosslinked nucleic acid) , or a combination of two or more thereof, without being limited thereto.

[121] The term “LNA” includes a class of nucleic acid analogues in which the ribose ring is “locked” by a methylene bridge connecting the 2‘-O atom and the 4' -C atom. LNA nucleosides contain the common nucleobases (T, C, G, A, U, and mC) and are able to form base pairs according to standard Watson-Crick base pairing rules.

[122] The term “PNA” includes a non-naturally occurring and artificially synthesized nucleic acid comprising various naturally-occurring or non-naturally-occurring nucleobases attached to a backbone of repeating N-(2-aminoethyl)-glycine units linked by amide bonds. The purine and pyrimidine bases are attached to the uncharged backbone through methylene carbonyl linkages .

[123] The term “ZNA” includes oligonucleotides conjugated with one or a plurality of cationic spermine moieties that decrease electrostatic repulsions with target nucleic acid strands and increase the affinity of the oligonucleotides for their targets .

[124] The term "LDNA" includes an oligonucleotide comprising a non-naturally occurring triazole linkage.

[125] The term "TNA" refers to non-naturally occurring nucleic acids discovered during investigations into nucleic acids that obey Watson-Crick base-pairing rules and are bound to alternative sugar-phosphate backbones. TNAs have a repeat unit that is one atom shorter than natural nucleic acids, yet they can base pair with DNA, RNA, and itself.

[126] The nucleic acid may be single- or double-stranded. In addition to DNA, RNA, mRNA, small RNA (siRNA), etc., it may also be double stranded with a modified nucleic acid, for example, LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro-modified nucleic acid, 8-aza-7-deaza-dA), ppG (8-aza-7-deaza-dG), iso-dC (2'-deoxypseudoisocytidine), fdU (5-fluoro-2'-deoxyuridine), or ENA (2'-O,4'-C-ethylene cross-linked nucleic acid), or a combination of two or more thereof.

[127] The nucleic acid may be targets associated with human diseases, such as p53 (tumor suppressor protein 53), Rb (RB transcriptional corepressor 1), DAPK1 (Death Associated Protein Kinase 1), WIF1 (Wnt Inhibitory Factor 1), KRAS (KRAS proto-oncogene), without being limited thereto.

[128] For the production of the nucleic acid-inorganic nanoparticle / lipid nanoparticle complex for nucleic acid delivery, the mass ratio (w / w) between nucleic acid and the components of the lipid nanoparticle may be, for example, 1:5 to 1:20, specifically 1:5, 1:10, or 1:20, but the ratio for effective nucleic acid delivery and expression is preferably 1:10 or 1:20.

[129] Specifically, the composition may include mRNA. In one embodiment, the composition may include one or more types of mRNA. In one embodiment, the composition may include multiple types of mRNA. In one embodiment, the composition may include two or more types of mRNA. When the composition includes multiple types of mRNA, mRNAs may be included at a molar ratio of, for example, 0.5 to 2:1, for example, 1:1.

[130] The composition may further include at least one pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention, and may be saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture of two or more thereof, and the composition may further include other common additives such as antioxidants, buffers, and bacteriostatic agents as needed. In addition, the composition may be prepared into an injectable formulation such as an aqueous solution, suspension, or emulsion by adding a diluent, dispersant, surfactant, binder and lubricant thereto. In particular, the composition is preferably formulated into a lyophilizate. The lyophilizate may be prepared using a method commonly known in the art to which the present invention pertains, and a stabilizer for lyophilization may be added. Furthermore, the composition is preferably formulated depending on each disease or ingredient using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

[131] The content and administration method of the active ingredient contained in the composition of the present invention may be determined by those skilled in the art based on the severity of the patient’s symptoms and disease. In addition, the composition may be formulated in various forms such as powders, tablets, capsules, solutions, injections, ointments, and syrups, and may be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.

[132] The composition of the present invention may be administered orally or parenterally. The route of administration of the composition according to the present invention includes, but is not limited to, for example, bronchial, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual or topical administration. The dosage of the composition according to the present invention varies depending on the patient’s weight, age, gender, health conditions, diet, administration time, administration mode, excretion rate, or severity of the disease, and may be easily determined by those skilled in the art. In addition, the composition of the present invention may be formulated into a suitable dosage form for clinical administration using known techniques .

[133]

[134] Hereinafter, the present invention will be described in more detail through examples. These examples are only to illustrate the present invention, and it will be obvious to those skilled in the art that the scope of the present invention should not be construed as being limited by these examples .

[135]

[136] Preparation Example 1:   Preparation of Lipid Nanoparticles Containing Ginsenoside Rg2 (Gin_Rg2-LNP)

[137] Lipid nanoparticle structures were synthesized by dissolving ginsenoside Rg2 and a mixture of heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate as    an    ionizable    lipid,    1,2-dioleoyl-sn-glycero-3- phosphoethanolamine as a phospholipid, and 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 as a PEG derivative in ethanol at a molar ratio of 50:10:1.5:78, or 50:10:1.5:39,         or        50:10:0.75:39         (ionizable lipid:phospholipid:PEG lipid:ginsenoside).

[138] Next, complexes for each condition were formed by mixing nucleic acid with the lipid nanoparticles at a mass ratio of 1:5, 1:10, or 1:20 (w:w) . At this time, for solvents, ethanol containing the lipid nanoparticles and an aqueous solution containing nucleic acid were mixed with each other at a ratio of 1:3 (v / v), and the mixture was allowed to react at room temperature for 15 minutes. Thereafter, the reaction mixture was sonicated for about 1 minute to improve the dispersion of the mRNA-lipid nanoparticle complex, and then used for characterization and intracellular expression analysis .

[139]

[140] Preparation Example 2:   Preparation of Lipid Nanoparticles Containing Phytosterol (Protopanaxadiol (PPD)), A Ginsenoside Derivative (Gin_PPD-LNP)

[141] Lipid nanoparticle structures were synthesized by dissolving protopanaxadiol (PPD) and a mixture of heptadecan-9-yl                                8-[2-hydroxyethyl-(6-oxo-6- (undecoxy)hexyl)amino]octanoate as an ionizable lipid, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine as a phospholipid, and       1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 as a PEG derivative in ethanol at a molar ratio of 50:10:1.5:45.81, or 50:10:1.5:22.9, or 50:10:0.75:22.9 (ionizable lipid:phospholipid:PEG lipid:phytosterol).

[142] Next, complexes for each condition were formed by mixing nucleic acid with the lipid nanoparticles at a mass ratio of 1:5, 1:10, or 1:20 (w:w) . At this time, for solvents, ethanol containing the lipid nanoparticles and an aqueous solution containing nucleic acid were mixed with each other at a ratio of 1:3, 2:3, or 1:1  (v / v), and the mixture was allowed to react at room temperature for 15 minutes. Thereafter, the reaction mixture was sonicated for about 1 minute to enhance the dispersion of the mRNA-lipid nanoparticle complex, and then used for characterization and intracellular expression analysis.

[143] Preparation Example 3: Preparation of Nucleic Acid- Gold (Au) Nanoparticles (Au NP)) Encapsulated in Lipid Nanoparticles Containing Phytosterol

[144] 20 pg of gold nanoparticles, 10 pl of citrate buffer, and 15 pmol of a thiol-modified antisense reader sequence were mixed together and reacted at room temperature for 5 minutes or more, thereby producing gold nanoparticles surface-functionalized with the antisense leader sequence. The antisense leader sequence was modified with a thiol group to enable stable conjugation to the surface of the gold nanoparticle,      and     was      the      sequence      5’ - GTTGGTTGGTTTGTTACCTGGGAAGGTATAAACCTTTAATAAAAAAAAAA-SH-3’, but the functional group for binding to the nanoparticles is not limited to a thiol group, and the antisense leader sequence is also not limited to the above sequence. The ratio between the amount of the gold nanoparticles and the amount of the antisense leader sequence for surface modification may vary depending on the purpose of the experiment. Thereafter, the unbound antisense leader sequence in the supernatant was removed by centrifugation.

[145] Next, the obtained precipitate (antisense leader- gold nanoparticle complex) was dispersed in 40 pl of HEPES buffer, and then 18.75 pmol of mRNA containing a leader sequence was added to the solution. At this time, the leader sequence includes a sequence complementary to the antisense leader sequence bound to the surface of the gold nanoparticles,              and             is             5’- ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATC TGTTCTCTAAACGAACAAACTAAA-3’, but is not limited thereto and is one included in the mRNA structure produced in Example 41 below. Next, the mixture was heated in a heat block at 90°C for 30 seconds to anneal the mRNA, and then the binding between the antisense leader sequence on the surface of the gold nanoparticles and the leader sequence of the mRNA was induced at about 70°C for 30 minutes. At this time, the treatment ratio of mRNA may vary depending on the purpose of the experiment, etc. Thereafter, unbound mRNA present in the supernatant was removed by centrifugation, thereby synthesizing mRNA-gold nanoparticles   (mRNA-AuNP) for encapsulation in LNP.

[146] Gin_PPD-LNP synthesized in Preparation Example 2 and mRNA-AuNP synthesized by the above-described method were mixed together at a ratio of 1:5 (mass ratio = mRNA: LNP), and then 12.7 pl of sodium acetate was added thereto. Next, the mixture was thoroughly vortexed for 1 minute, and then allowed to react at room temperature for 15 minutes. Thereafter, the mixture was sonicated for 1 minute to enhance encapsulation and dispersion. At this time, the amount of sodium acetate added or the reaction time can be adjusted depending on the purpose of the experiment.

[147]

[148] Example 1: Observation of Structure of Lipid Nanoparticles and Analysis of Encapsulation Efficiency of Nucleic Acid

[149] The structures and morphologies of the lipid nanoparticles (Gin_Rg2-LNP, and Gin_PPD-LNP) synthesized in the Preparation Examples were observed using a transmission electron microscope, and the results are shown in FIGS. 1(A) and 1(B). As can be seen in the images, it was observed that the synthesized lipid nanoparticles were spherical in shape and about 50 nm to 250 nm in size and had a high degree of dispersion. In particular, Gin_Rg2-LNP was observed to have a layered structure.

[150] FIGS. 1(C) and 1(D) show the results of measuring particle size changes by dynamic light scattering (DLS), and it was confirmed that the sizes of two types of lipid nanoparticles (Gin_Rg2-LNP and Gin_PPD-LNP) increased after mRNA was encapsulated therein. Meanwhile, the reason why the size was measured to be larger than the size observed with an electron microscope is believed to be because the size including the hydrodynamic diameter was analyzed through DLS.

[151] In addition, electrophoresis was performed to determine the degree of encapsulation of mRNA in the lipid nanoparticles, and the results are shown in FIG. 2. First, as shown in FIG. 2(A), in the case of Gin_Rg2_LNP, a residual band of mRNA was observed at a mass ratio of nucleic acid to lipid nanoparticle of 1:5, but no residual band was observed at 1:10 and 1:20, so it was determined that the encapsulation efficiency at 1:10 and 1:20 was 100%. In this case, the ratio between the solvent containing LNP and the solvent containing the gene was fixed at 1:3. Meanwhile, as shown in FIG. 2(B), in the case of Gin_PPD_LNP, all residual bands were detected even when the mass ratio of the gene to the lipid nanoparticles was varied, so the volume ratio of the genecontaining solvent to the LNP-containing solvent was set at 1:3, 2:3, and 1:1 (3:3), and electrophoresis was performed. In this case, the mass ratio of nucleic acid to the lipid nanoparticles was fixed at 1:20. As a result, as shown in FIG. 2(C), it was confirmed that the highest encapsulation efficiency with the least residual band was observed at a 1:1 ratio .

[152]

[153] Example 2:  Analysis of Stability against RNA- Degrading Enzyme (RNase)

[154] FIG. 3 shows the results of testing the stability of mRNA encapsulated in the lipid nanoparticles. To this end, the experiment was conducted under the following conditions. 1 pg of GFP mRNA and 1 pg of LNP+ GFP mRNA ( (A) Gin_Rg2- LNP / GFP mRNA, and (B) Gin_PPD-LNP / GFP mRNA) were each treated with 0.025 pg, 0.005 pg and 0.01 pg of RNase, and the stability of the mRNA-lipid nanoparticle complexes was evaluated. The samples treated with RNase were reacted at 37°C for 1 hour, and then treated with Proteinase K for 10 minutes to inhibit the activity of RNase and terminate the reaction. After completion of the reaction, the samples were analyzed by electrophoresis on an agarose gel (1.5%, 0.5 X TBE) . As a result, it was confirmed that the GFP mRNA not encapsulated in the lipid nanoparticles was degraded and thus the corresponding band disappeared, whereas the GFP mRNA- lipid nanoparticle complex was not degraded and thus the corresponding band (red box in FIG. 3) was observed on the electrophoresis . This demonstrated that the stability of the mRNA against the external factor was ensured by the lipid nanoparticles .

[155]

[156] Example 3 : Evaluation of Toxicity  of Lipid Nanoparticles

[157] To confirm the biocompatibility of the lipid nanoparticles as a gene delivery carrier, toxicity tests were performed, and the results are shown in FIGS. 4 and 5. To obtain the results, the experiment was conducted as follows. First, A549 cells, a lung cancer cell line, and HeLa cells, a cervical cancer cell line, were seeded in 24-well plates at a density of 0.05 x 106 cells per well, and then cultured in an incubator 37°C under 5% CO2 for 24 hours. To evaluate the toxicity of Rg2 and PPD, which are components of the delivery carrier, the Rg2 and PPD used in Preparation Examples 1 and 2 were each dispersed in distilled water, and each cell line was treated with each dispersion and then incubated in an incubator at 37°C under 5% CO2 for 24 hours. Thereafter, the absorbance (450 nm) of living cells was measured using the Cell Counting Kit assay (CCK-8). As shown in FIG. 4, it was confirmed that the cell count of the group treated with each of Rg2 and PPD decreased slightly by up to 10% compared to that of the untreated control group, indicating that Rg2 or PPD as a delivery carrier is not cytotoxic .

[158] Next, evaluation of the toxicity of the lipid nanoparticles (Gin_Rg2-LNP, and Gin_PPD-LNP) was performed under the cell conditions described above, and the results are shown in FIG. 5. Referring to the results, it was confirmed that the cell count in the group treated with the lipid nanoparticles decreased by up to about 10% compared to that in the control group, indicating that the lipid nanoparticles, as a nucleic acid delivery carrier, are not cytotoxic .

[159]

[160] Example 4:  Verification of Protein Expression Following mRNA Delivery

[161] 4-1. Production of GFP and luciferase mRNA

[162] A GFP mRNA construct for GFP expression was prepared based on the mRNA construct preparation method previously developed by the present inventors (International Patent Application Publication No. WO / 2023 / 063769).

[163] To produce GFP mRNA, PCR was performed in a total of 20 pl containing 10 pmole of a forward primer (5'-TCCACTAGTAACGGCCGCCA-3') corresponding to the sequence upstream of the T7 promoter, 10 pmole of a poly-dT-conjugated reverse primer (5'- TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTGTCATTCTCCTAAGAAGCTA-3') complementary to the 3' UTR and nucleotide polyA 65, and 10 pl of 2X pfu Master Mix (Biofact, Daejeon, South Korea). The PCR reaction conditions were as follows: one cycle at 95°C for 2 min; 30 cycles, each consisting of 95°C for 20 sec, 60°C 40 sec, and 72°C for 2 min and 30 sec; and 72°C for 5 min) . The amplified PCR product was electrophoresed on a 1.5% agarose gel, and then purified using the Qiaquick® Gel Extraction Kit (QIAGEN, Germany) and used as a template for IVT. IVT was performed using the Takara IVT proTM T7 mRNA Synthesis Kit (Takara, Japan) according to the manufacturer's instructions. 1 pg of the constructed PCR product as a template, 2 pl of 10X transcription buffer, 2 pl of 10X ATP, 2 pl of 10X CTP, 2 pl of 10X GTP, 2 pl of 10X UTP, and 2 pl of 10X enzyme mix were mixed together to make a total volume of 20 pl, and the mixture was reacted at 37°C for 2 hours to synthesize mRNA. After the reaction, 4 pl of DNase I was added and the mixture was reacted at 37°C for 15 minutes to remove the DNA template. After the IVT reaction, the reaction solution was purified by the LiCl precipitation method and finally eluted in 100 pl of RNase-free distilled water. To increase mRNA stability, 2 pl of 10X capping buffer, 1 pl of GTP (10 mM), 1 pl of SAM (4 mM), 1 pl of vaccinia capping enzyme (10 U / pl), and 1 pl of mRNA cap 2’-O-methyltransferase (50 U / pl) were added to 10 pg of the above-synthesized RNA to make a total volume of 20 pl, and the mixture was reacted at 37°C for 2 hours to synthesize to add an anti-reverse cap analog (ARCA) to the 5' end, followed by methylation, thereby synthesizing more stable mRNA. The purified mRNA was quantified using NanoDrop.

[164] Luciferase mRNA was produced in the same manner as in Example 4-1 above, quantified, and then used for expression testing.

[165]

[166] 4-2. Confirmation of mRNA Delivery and Expression

[167] The GFP mRNA produced in Example 4-1 was encapsulated in the lipid nanoparticles synthesized in each of Preparation Examples 1 and 2, and verification of delivery into cells and protein expression was performed, and the results are shown in FIG. 6 through FIG. 12. First, the results of GFP expression after delivering mRNA to A549 cells are shown in FIG. 6. To this end, A549 cells were seeded into a 24-well plate at a density of 0.05 x 106 cells per well and then cultured in an incubator at 37°C under 5% CO2 for 24 hours. Then, a complex of GFP mRNA and Gin_Rg2-LNP or Gin_PPD-LNP at a ratio of 1:10 was prepared, the cells were treated with the complex and incubated in an incubator at 37°C under 5% CO2 for 24 hours, followed by observation of fluorescence. At this time, green fluorescence could be observed with high efficiency in the cells treated with each of the two carriers.

[168] In addition, an experiment was conducted to confirm GFP expression in HeLa cells, a cervical cancer cell line, after mRNA delivery, and the results are shown in FIGS. 7 to 9. First, the results shown in FIG. 7 are optical microscope images showing the results of observing the fluorescent protein expressed under conditions where the ratio of GFP mRNA to Gin_Rg2-LNP or Gin_PPD-LNP was 1:20, and high green fluorescence could be observed in both carriers. In particular, as shown in FIGS. 8 and 9, in the case of HeLa cells, unlike the conditions of A549, expression was not observed at 1:5 in the two carriers, and very weak expression was observed at a mixing ratio of 1:10, whereas high expression efficiency was observed at 1:20. When compared with the electrophoresis results shown in FIG. 2(A), it was confirmed that no residual band was detected at both 1:10 and 1:20 on the electrophoresis, indicating a high mRNA loading rate, but differences in expression in the cell were observed, indicating that the mixing ratio for delivery and expression needs to be optimized.

[169] To optimize mRNA delivery and expression, additional experiments were conducted to compare expression depending on the PEG lipid content of Gin_Rg2-LNP or Gin_PPD-LNP, and the results are shown in FIG. 10. When LNP was synthesized using a PEG lipid in an amount of 0.19 mg, which is half the commonly used PEG lipid amount of 0.38 mg, and GFP mRNA was encapsulated in the synthesized LNP and then delivered to HeLa cells, a stronger green fluorescence image could be observed in the HeLa cells. Since this means that more GFP was expressed at half the existing PEG lipid content, the content of PEG lipid for delivery and expression was optimized based on these results.

[170] FIG. 11 shows the results of comparing the delivery and expression efficiency between a currently commercially available nucleic acid delivery lipid nanoparticle synthesis kit and the lipid nanoparticles produced in the present invention. In this case, the GFP expression for 1 pg of GFP mRNA delivered into A549 cells via each delivery carrier was compared. As a result of observation by fluorescence microscopy, it could be confirmed that GFP expression was higher in both delivery carriers than in the commercial kit. Therefore, it was confirmed that the gene delivery carrier developed in the present invention can also be used to deliver nucleic acids for therapeutics or vaccines.

[171] FIG. 12 shows the results of analyzing expression after the delivery of mRNA other than GFP mRNA. 1 pg of luciferase mRNA produced in Example 4-1 was encapsulated in the lipid nanoparticles synthesized in each of Preparation Examples 1 and 2 at a mixing ratio of 1:10, A549 cells were treated with the lipid nanoparticles, and after 24 hours, luciferase expression was analyzed. As a result, it was confirmed that the luminescence value was higher in Gin_Rg2-LNP or Gin_PPD-LNP than in naked mRNA, suggesting that Gin_Rg2-LNP or Gin_PPD-LNP can be used as a carrier for the delivery and expression of other types of mRNA in addition to GFP mRNA.

[172]

[173] Example 5: Verification of Protein Expression Following Delivery of mRNA-Gold Nanoparticles (mRNA-AuNP) Encapsulated in Phytosterol-Based Lipid Nanoparticles (Gin_PPD-LNP)

[174] 5-1. Characterization of mRNA-AuNP (mRNA-AuNP@PPD-LNP) Encapsulated in Gin_PPD-LNP

[175] The change in surface charge depending on the synthesis step of mRNA-AuNP@PPD-LNP in Preparation Example 3 was analyzed through zeta potential, and the results are shown in FIG. 13(A). First, as shown in (a) of FIG. 13(A), the gold nanoparticles had a negative charge of -26 mV, and GFP mRNA-bound mRNA-AuNP was analyzed to have a slightly more negative charge of about -32 mV. In contrast, it was confirmed that, when mRNA-AuNP was encapsulated in PPD-LNP, the charge of the particle shifted to a positive charge, which was about +37 mV. Thus, the present inventors constructed a positively charged complex capable of penetrating into cells. Next, electron microscopy analysis was performed to observe whether the gold nanoparticles were present inside the lipid nanoparticles, and the results are shown in FIG. 13(B). In this case, the black dot represents the gold nanoparticle (red arrow) , and this dot was not observed in FIG. 1B, so the difference could be seen. Then, the thin film surrounding the black particle was analyzed to represent the lipid nanoparticle (yellow arrow).

[176]

[177] 5-2. Confirmation of Delivery and Expression through mRNA-AuNP@PPD-LNP

[178] FIG. 14 shows the result of analyzing GFP expression after treating A549 cells with the complex in which GFP mRNA-AuNP obtained by binding through the antisense leader sequence and the leader sequence was encapsulated in PPD-LNP. First, in the case of GFP mRNA-AuNP not encapsulated in PPD-LNP, as shown in FIG. 14(A), GFP expression did not occur, and thus no green fluorescence was observed. This was believed to be because the particle did not penetrate the cell due to the repulsion between the cell and the particle, caused by the high negative charge mentioned above. However, in contrast, green fluorescence was observed after treatment with GFP mRNA-AuNP@PPD-LNP, which was believed to be because GFP was expressed due to delivery of GFP mRNA into the cell. This is analyzed to be because GFP mRNA-AuNP@PPD-LNP could penetrate the cell as the surface charge changed to a positive charge after encapsulation. Accordingly, it was determined that even a negatively charged nucleic acidinorganic nanoparticle structure can be utilized as a carrier for the delivery and expression of nucleic acid if it is encapsulated in PPD-LNP based on phytosterol, a ginsenoside derivative .

[179]

[180] Example 6: Verification of Delivery and Expression of Multiple mRNAs

[181]

[182] After encapsulating two or more types of mRNA in LNP, delivery and protein expression were verified, and the results are shown in FIGS. 15 and 16. In this case, referring to Preparation Example 2, an mRNA-PPD-LNP complex was synthesized by mixing a mixture solution of GFP mRNA and mCherry mRNA at a 1:1 molar ratio with a PPD-LNP solution. To confirm mRNA delivery and expression, HEK293T cells were cultured in a 24-well plate and then treated with GFP mRNA / mCherry mRNA-PPD-LNP. Then, GFP expression and mCherry expression were observed using a fluorescence microscope, and fluorescence expression was quantified and measured by flow cytometry.

[183] Referring to FIG. 15, when GFP mRNA and mCherry mRNA were encapsulated separately in PPD-LNP and delivered to HEK293T cells, and then observed under a fluorescence microscope, green fluorescence from GFP and red fluorescence from mCherry were observed in the respective cells (FIGS. 15(b) and 15(c)). However, when GFP mRNA and mCherry mRNA were mixed and encapsulated together in PPD-LNP, and cells were treated with the PPD-LNP, both green fluorescence and red fluorescence were observed in the cells, indicating that the different mRNAs were delivered and expressed simultaneously (FIG. 15 (d)).

[184] Next, GFP mRNA and mCherry mRNA delivery and expression were analyzed using flow cytometry (FIG. 16). In this case, GFP expression was analyzed using the FITC fluorescence channel, and mCherry expression was analyzed using the PE fluorescence channel. Referring to FIGS. 16(b) and 16 (c), it could be confirmed that, when cells were treated with GFP mRNA alone, the fluorescence intensity in the FITC part on the x-axis increased, and when cells were treated with mCherry mRNA alone, the fluorescence intensity in the PE part on the y-axis increased. However, it was confirmed that, when cells were co-treated with GFP mRNA and mCherry mRNA, the fluorescence intensity of both FITC and PE increased as shown in FIG. 16(d), verifying that both types of mRNA were simultaneously delivered into the cell and expressed.

[185]

[186] Example 7: Verification of mRNA Delivery and Expression In Vivo

[187]

[188] In vivo mRNA delivery and expression of Gin_Rg2-LNP and Gin_PPD-LNP obtained in Preparation Example 1 and Preparation Example 2 were verified, and the results are shown in FIGS. 17 and 18. In this case, 10 pg of luciferase mRNA was encapsulated in each of Gin_Rg2-LNP and Gin_PPD-LNP, and then administered by intramuscular injection to hairless mice. Next, in vivo expression was verified using the IVIS Lumina III live imaging system. (IACUC: KMEDI-24031903-00).

[189] Referring to FIG. 17, it was confirmed that, compared to the control group (A) which was not administered luciferase mRNA, in the case of (B), the luciferase protein was expressed starting 6 hours after administration and luminescence was observed in the thigh muscle of the hairless mouse. Even 54 hours after administration, the luciferase protein was expressed in vivo and luminescence was observed.

[190] The luminescence efficiency of the Luciferase protein was expressed as flux, and the results are shown in FIG. 18. The luminescence efficiency also showed a trend similar to the images in FIG. 17, and luminescence was detected even 54 hours after administration. Also, similar to FIG. 17, it was confirmed that the Rg2-LNP condition had higher luminescence efficiency and exhibited sustained protein expression, compared to the PPD-LNP condition.

[191]

[192] Example 8:  LNP Surface Modification for Targeted Delivery of mRNA and Verification of Targeting Function

[193]

[194] In order to impart targeting functions such as cell selectivity to the produced LNP, an LNP carrier with cell selectivity was synthesized by modifying the surface of the LNP with a small molecule or a large molecule, and the function thereof was verified.

[195] First, to target the folate receptor (FR), LNP surface-modified with folate was synthesized. In this case, referring to Preparation Example 2, the PEG lipid (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000) used in the synthesis of PPD-LNP was replaced with a PEG lipid (folate-PEG-lipid) containing a folate functional group, thereby producing folate-PPD-LNP. Subsequently, GFP mRNA was encapsulated in the folate-PPD-LNP and FR-positive HeLa cells with the GFP mRNA-encapsulated folate-PPD-LNP. Then, GFP expression was analyzed and the results are shown in FIG. 19. As a result of observing the treated HeLa cells with a fluorescence microscope, it was confirmed that GFP expression was higher in folate-PPD-LNP than in PPD-LNP (FIGS. 19 (B) and 19(C)) .

[196] In addition, HA-PPD-LNP surface-modified with a hyaluronic acid (HA) polymer targeting CD44 was synthesized in the following manner. First, referring to Preparation Example 2, the PEG lipid (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000) used in the synthesis of PPD-LNP was replaced with an amine-PEG lipid substituted with an amine functional group, thereby producing amine-PPD-LNP. Thereafter, GFP mRNA was encapsulated in amine-PPD-LNP to form        a        complex,        and        N-ethyl-N’-(3- dimethylaminopropyl)carbodiimide hydrochloride was added to and mixed with the complex using a shaker for 1 minute, and then N-hydroxysuccinimide was added to and mixed with the complex using a shaker for 30 minutes, thereby activating the amine functional group. Subsequently, HA was added thereto, followed by shaking overnight, thereby producing HA-PPD-LNP. Next, CD44-overexpressed A549 cells were treated with the complex, and GFP expression was observed using a fluorescence microscope. The results are shown in FIG. 20. In this case, it was observed that GFP expression was higher when GFP mRNA encapsulated in HA-PPD-LNP was delivered than when GFP mRNA encapsulated in PPD-LNP or amine-PPD-LNP was delivered, verifying the cell targeting characteristics of HA-PPD-LNP (FIGS. 20(B), 20(C) and 20(D)).

[197] Industrial Applicability

[198] According to the present invention, it was confirmed that the lipid nanoparticle containing a ginsenoside or a derivative thereof ensures safety due to lack of cytotoxicity, has excellent ability to protect encapsulated mRNA from RNA-degrading enzyme, has excellent expression levels compared to intracellular genetic transduction reagents such as lipofectamine, and has excellent protein expression levels compared to commercial lipid nanoparticle synthesis kits containing cholesterol for in vivo gene delivery, indicating that the lipid nanoparticle containing a ginsenoside or a derivative thereof can be useful as a nucleic acid carrier. Furthermore, the complex in which the nucleic-inorganic nanoparticle with high negative charge characteristics is encapsulated in the lipid nanoparticle containing a ginsenoside derivative penetrated into cells and expressed the protein, suggesting that the complex can be useful as an organic / inorganic complex for nucleic acid delivery.

[199]

[200] Although the present invention has been described in detail with reference to specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.

Claims

1. A lipid nanoparticle comprising:an ionizable lipid;a phospholipid;a water-soluble polymer; anda ginsenoside or a derivative thereof.

2. The lipid nanoparticle according to claim 1, wherein the ionizable lipid is heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate .

3. The lipid nanoparticle according to claim 1, wherein the     phospholipid     is     1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

4. The lipid nanoparticle according to claim 1, wherein the water-soluble polymer is a polyethylene glycol derivative.

5. The lipid nanoparticle according to claim 4, wherein the polyethylene glycol derivative is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol.

6. The lipid nanoparticle according to claim 1, wherein the ginsenoside is Rg2 or Rh2,

7. The lipid nanoparticle according to claim 1, wherein the ginsenoside derivative is a phytosterol.

8. The lipid nanoparticle according to claim 7, wherein the phytosterol is selected from the group consisting of protopanaxadiol (PPD), protopanaxatriol (PPT), and a mixture thereof .

9. The lipid nanoparticle according to claim 1, wherein a nucleic acid bound to an inorganic nanoparticle is further encapsulated in the lipid nanoparticle.

10. The lipid nanoparticle according to claim 9, wherein the inorganic nanoparticle is a metal nanoparticle, a metal oxide nanoparticle, or a quantum dot nanoparticle.

11. A composition for nucleic acid delivery comprising thelipid nanoparticle according to any one of claims 1 to 10.

12. The composition according to claim 11, wherein a mass ratio between the nucleic acid and the lipid nanoparticle is 1:5 to 1:

20.

13. The composition according to claim 11, wherein the nucleic acid comprises one or more mRNAs.

14. A method for producing lipid nanoparticles, comprising a step of dissolving an ionizable lipid, a phospholipid, a water-soluble polymer, and a ginsenoside or a derivative thereof in a solvent.

15. The method according to claim 14, wherein the solvent is ethanol.

16. A complex in which a nucleic acid-bound inorganic nanoparticle structure is encapsulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises: an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

Images