Compound capable of inhibiting binding between CUG repeat RNA and MBNL protein, and medicine

Abstract

Provided is a compound represented by general formula (1) [wherein X1, X2 and X3 each independently represent -CH= or the like; A represents -O- or the like; B represents a single bond, a C1-C5 alkylene group, or the like; C represents a substituted or unsubstituted nitrogen-containing heterocyclic group or the like; and at least one of B and C contains one or more nitrogen atoms], or a pharmaceutically acceptable salt of the compound, or a solvate of the compound or the pharmaceutically acceptable salt.

Description

Title of Invention: COMPOUND CAPABLE OF INHIBITING BINDING BETWEEN CUG REPEAT RNA AND MBNL PROTEIN, AND MEDICINE Technical Field

[0001] The present invention relates to a compound having an activity to inhibit binding between CUG repeat RNA and MBNL protein, and to a medicament. Background Art

[0002] Myotonic Dystrophy type 1 (hereinafter, sometimes abbreviated as "DM1") is the myotonic dystrophy with the highest incidence of onset in adults. DM1 is an autosomal dominant disease that affects skeletal muscle, smooth muscle, the eye, the heart, the endocrine system, the central nervous system, and the like, and its main symptoms are muscle atrophy, muscle weakness, myotonia, cataract, insulin resistance, cardiac conduction system disorder, intellectual disability, and the like (NonPatent Literature 1). In DM1, an MBNL (Muscleblind-like) protein, which is a splicing regulatory factor, binds to the CUG repeat sequence possessed by an abnormal DMPK mRNA that is generated due to abnormal elongation of the CTG repeat sequence in the 3' untranslated region of the myotonin protein kinase (DMPK) gene, and as a result, splicing regulatory factors necessary for normal splicing become deficient, whereby splicing abnormalities are induced, leading to symptoms.

[0003] The CUG repeat RNA possessed by the abnormal DMPK and the MBNL protein are considered to be expressed in a wide range of tissues throughout the body, such as skeletal muscle, smooth muscle, the eye, the heart, the endocrine system, and the central nervous system, and the splicing abnormalities of genes that occur in the respective tissues are associated with symptoms. It has been reported that CLCN1 (Chloride channel protein, skeletal muscle), which is a chloride ion channel, is involved in the myotonia phenomenon, that CACNA1S (Voltage-gated calcium channel subunit alpha 1S), which is a calcium channel, and DMD (Dystrophin) are involved in muscle weakness, that INSR (Insulin-like Growth factor receptor) is involved in insulin resistance, and that NMDA (N-methyl-D-aspartate) and MAPT (Microtubule-associated protein tau) are involved in cognitive function (Non-Patent Literature 2 to 4). Therefore, it is assumed that improving splicing abnormalities leads to the treatment of DM1.

[0004] Most of the current treatments for DM1 remain symptomatic therapies, and treatment is extremely difficult. It has been shown that liberation using a compound having an action of inhibiting the binding between the CUG repeat RNA and the MBNL protein in the DM1 pathological condition leads to improvement of splicing and myotonia symptoms (Non-Patent Literature 5 to 6). On the other hand, there is still no drug that has shown sufficient efficacy in clinical trials and has been approved. Therefore, it is considered that a new treatment method can be provided by a compound that inhibits the binding between the CUG repeat RNA and the MBNL protein. Citation List Non Patent Literature

[0005] [Non-Patent Literature 1] Meola G and Cardani R. Biochim Biophys Acta. 2015 Apr;1852(4):594-606. [Non-Patent Literature 2] N Charlet-B et al., Mol Cell. 2002 Jul;10(1):45-53. [Non-Patent Literature 3] Nakamori et al., Ann Neurol. 2013 Dec;74(6):862-72. [Non-Patent Literature 4] A Lopez-Martinez et al., Genes (Basel). 2020 Sep 22;11(9):1109. [Non-Patent Literature 5] AJ Angelbello et al., Cell Chem Biol. 2021 Jan 21;28(1):34-45. [Non-Patent Literature 6] Nakamori et al., Ann Clin Transl Neurol. 2015 Dec 10;3(1):42-54. [Non-Patent Literature 7] A Mankodi et al., Science, 2000, 289(5485), 1769-73 [Non-Patent Literature 8] Jenquin JR et al., ACS Chem Biol. 2018 Sep 21;13(9):2708-2718. Summary of Invention Technical Problem

[0006] An object of the present invention is to provide a compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof having binding-inhibiting activity that inhibits the binding between CUG repeat RNA and MBNL protein. Solution to Problem

[0007] The present invention includes, for example, the following inventions. [1] A compound represented by general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof, [Chem. 1] (1) wherein X1, X2, and X3 are any of the following combinations: (a) X1, X2, and X3 are -CH=; (b) X1 is -N=, X2 is -CH=, and X3 is -CH=; or (c) X1 is -CH=, X2 is -CH=, and X3 is -N=; A represents -O-, -S-, -NR- with R representing a hydrogen atom or a C1 to C3 alkyl group, or a piperidinediyl group; B represents a single bond, a C1 to C5 alkylene group optionally substituted with a hydroxyl group, or -Y1-NY2-Y3- with Y1 and Y3 each independently representing a C1 to C3 alkylene group, and Y2 representing a hydrogen atom or a C1 to C3 alkyl group; C represents a substituted or unsubstituted aryl group, a substituted or unsubstituted nitrogen-containing heterocyclic group, or a dialkylamino group; provided that at least one of B and C contains one or more nitrogen atoms. [2] The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to [1], wherein A is -O-. [3] The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to [1] or [2], wherein B is a single bond or a C1 to C5 alkylene group. [4] The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [3], wherein C is a substituted or unsubstituted nitrogen-containing heterocyclic group. [5] The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [4], wherein C is a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group. [6] The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [5], wherein C is a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group. [7] The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to [1], wherein X1, X2, and X3 are (a) a combination in which X1, X2, and X3 are -CH=; A represents -O-; B represents a single bond or a C1 to C5 alkylene group; and C represents a substituted or unsubstituted nitrogen-containing heterocyclic group. [8] A compound selected from the group consisting of the following compounds (1) to (104) and (107) to (119), or a pharmaceutically acceptable salt thereof, or a solvate thereof: (1)   3-{5-[(1-ethylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (2)      3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (3)       3-(5-{[(3S)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (4) 3-{5-[(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (5)   3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro- 1,2,4-oxadiazol-5-one, (6)  3-{5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (7)   3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (8)  3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (9)    3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (10) 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (12)   3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (13)       3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (14)  3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (15)      3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (17) 3-{5-[(1-propylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (18)  3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (19)  3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one, (20) ethyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate, (21) 3-(5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (22)         3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (23)     3-{5-[3-(piperidin-1-yl)propoxy]pyrimidin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (24)      3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (25)        3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (26)        3-(5-{[3-(pyrrolidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (27) 3-(5-{[3-(azepan-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (28) phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate, (29) ethyl  4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3- yl]oxy}piperidine-1-carboxylate, (30) 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (31) 3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (32) 3-{5-[(1-pentylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (33)  3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (34)  3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (35)  3-{5-[(1-butylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (36)   3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]methoxy}pyridin-2- yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (37) 3-{5-[(1-benzylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (38) 3-[5-({1-[(2-ethylphenyl)methyl]piperidin-4-yl}methoxy)pyridin- 2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (39)         3-{5-[(1-{[2-(trifluoromethyl)phenyl]methyl}piperidin-4- yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (40) 3-[5-({1-[(3-fluorophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (41)                    3-[5-({1-[(3-bromophenyl)methyl]piperidin-4- yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (42) 3-{5-[(1-acetylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (43)      3-{5-[(1-propanoylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (44) methyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate, (45) propan-2-yl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate, (46) methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (47) ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (48) propyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (49) propan-2-yl    4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3- yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (50) benzyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (51)    3-{5-[3-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (52)     3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (53)       3-{5-[2-(4-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (54)       3-{5-[2-(3-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (55)      3-[5-(2-{7-azaspiro[4.5]decan-7-yl}ethoxy)pyridin-2-yl]-4,5- dihydro-1,2,4-oxadiazol-5-one, (56) 3-[5-(2-{9-oxa-2-azaspiro[5.5]undecan-2-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (57)     tert-butyl     4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3- yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (58)   3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (59)     3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (60)      3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (61)      3-{5-[3-(3-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (62) 3-{5-[3-(morpholin-4-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (63)    3-{5-[3-(1,2,3,6-tetrahydropyridin-1-yl)propoxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one, (64) 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (65)       1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3- yl]oxy}propyl)piperidin-4-one, (66)        3-{5-[3-(3-fluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (67)       3-{5-[3-(4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (68)      3-{5-[3-(4-methoxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (69)   3-(5-{3-[(trans)3,4-dihydroxypiperidin-1-yl]propoxy}pyridin-2- yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (70)    3-{5-[3-(4,4-difluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (71)  3-{5-[3-(4-fluoro-4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one, (72)        3-{5-[3-(4-acetylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (73) methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate, (74)  3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (75)       3-{5-[3-(4-benzylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (76)    3-[5-(3-{3-azabicyclo[3.1.0]hexan-3-yl}propoxy)pyridin-2-yl]- 4,5-dihydro-1,2,4-oxadiazol-5-one, (77)   3-[5-(3-{octahydrocyclopenta[c]pyrrol-2-yl}propoxy)pyridin-2- yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (78)    3-[5-(3-{7-azaspiro[4.5]decan-7-yl}propoxy)pyridin-2-yl]-4,5- dihydro-1,2,4-oxadiazol-5-one, (79)  3-[5-(3-{2-oxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]- 4,5-dihydro-1,2,4-oxadiazol-5-one, (80)   3-[5-(3-{9-oxa-2-azaspiro[5.5]undecan-2-yl}propoxy)pyridin-2- yl]-4,5-dihydro-1,2,4-oxadiazol-5-one, (81)       1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3- yl]oxy}propyl)pyridin-1-ium 4-methylbenzene-1-sulfonate, (82)      3-{5-[(5-methyl-1,3-oxazol-4-yl)methoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (83)  3-{5-[(1,3-thiazol-2-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (84)    3-{5-[3-(pyridin-3-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (85)       1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3- yl]oxy}propyl)piperidin-2-one, (86)      3-{5-[2-methyl-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (87)  3-{5-[2-(dimethylamino)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (88) 3-{5-[3-(dimethylamino)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (89)  3-{5-[4-(dimethylamino)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (90)   3-{5-[4-(piperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (91)     3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (92)  3-{5-[4-(pyrrolidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (93)       3-{5-[4-(3-hydroxypiperidin-1-yl)butoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (94)  3-{5-[4-(morpholin-4-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (95) 3-{5-[4-(4-fluoropiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, (96)     3-{5-[4-(4,4-dimethylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (97) 3-{5-[4-(3-hydroxy-3-methylpiperidin-1-yl)butoxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one, (98)      3-[5-(4-{7-azaspiro[4.5]decan-7-yl}butoxy)pyridin-2-yl]-4,5- dihydro-1,2,4-oxadiazol-5-one, (99) 3-[5-(4-{9-oxa-2-azaspiro[5.5]undecan-2-yl}butoxy)pyridin-2-yl]- 4,5-dihydro-1,2,4-oxadiazol-5-one, (100) methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate, (101)        3-{5-[4-(4-acetylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (102)  3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (103)       3-{5-[4-(4-benzylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (104)   3-(5-{[5-(piperidin-1-yl)pentyl]oxy}pyridin-2-yl)-4,5-dihydro- 1,2,4-oxadiazol-5-one, (107)   3-(5-{[2-(pyridin-4-yl)ethyl]amino}pyridin-2-yl)-4,5-dihydro- 1,2,4-oxadiazol-5-one, (108) 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (109)   3-(5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (110)  3-(5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (111) 3-(5-{[2-(dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (112)        3-(5-{[3-(dimethylamino)propyl]amino}pyridin-2-yl)-4,5- dihydro-1,2,4-oxadiazol-5-one, (113) 3-(5-{[4-(dimethylamino)butyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, (114)   3-{5-[(1-ethylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (115)  3-{5-[(1-benzylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, (116)    3-{5-[(1-ethylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (117)  3-{5-[(1-benzylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one, (118)    3-(5-{4-[2-(pyrrolidin-1-yl)ethyl]piperidin-1-yl}pyridin-2-yl)- 4,5-dihydro-1,2,4-oxadiazol-5-one, and (119)   3-(5-{4-[2-(dimethylamino)ethyl]piperidin-1-yl}pyridin-2-yl)- 4,5-dihydro-1,2,4-oxadiazol-5-one. [9] A compound selected from the group consisting of the following compounds (7), (11), (12), (15), and (16), or a pharmaceutically acceptable salt thereof, or a solvate thereof: (7)   3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate, (12)   3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4- oxadiazol-5-one, (15)      3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro- 1,2,4-oxadiazol-5-one, and (16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one.

[10] A pharmaceutical composition containing, as an active ingredient, the compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [9].

[11] A therapeutic agent for myotonic dystrophy type 1, containing, as an active ingredient, the compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [9].

[12] Use of the compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [9], for the manufacture of a therapeutic agent for myotonic dystrophy type 1.

[13] A binding inhibitor that inhibits the binding between CUG repeat RNA and MBNL protein, containing, as an active ingredient, the compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of [1] to [9]. Advantageous Effects of Invention

[0008] According to the present invention, it is possible to provide a compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof having binding-inhibiting activity that inhibits the binding between CUG repeat RNA and MBNL protein. Description of Embodiments

[0009] Hereinafter, embodiments for carrying out the present invention will be described in detail. However, the present invention is not limited to the following embodiments.

[0010] In the present specification, the "alkyl group" means a monovalent group obtained by removing one hydrogen atom from a saturated hydrocarbon. The alkyl group may be linear or branched. The alkyl group may be a C1 to C6 alkyl group, may be a C1 to C4 alkyl group, or may be a C1 to C3 alkyl group. In the present specification, "Ca to Cb" means that the number of carbon atoms is a to b. Specific examples of the alkyl group include linear alkyl groups such as a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, and an n-hexyl group; and branched alkyl groups such as an isopropyl group (1-methylethyl group), a sec-butyl group, an isobutyl group (2-methylpropyl group), a tert-butyl group, a neopentyl group, an isopentyl group, a sec-pentyl group, a 3-pentyl group, a tert-pentyl group, a 1,1,2-trimethylpropyl group, a 1,2,2-trimethylpropyl group, a 1,1,2,2-tetramethylpropyl group, a 1,1-dimethylbutyl group, a 1,2-dimethylbutyl group, a 1,3-dimethylbutyl group, a 2,2-dimethylbutyl group, a 2,3-dimethylbutyl group, a 3,3-dimethylbutyl group, a 1-ethylbutyl group, and a 2-ethylbutyl group.

[0011] In the present specification, the "substituted alkyl group" means a group in which one or more hydrogen atoms of an alkyl group are substituted with a substituent. Examples of the substituents in the substituted alkyl group include a hydroxy group, a cyano group, a halogen, an amino group, a monosubstituted amino group, a disubstituted amino group, a nitro group, an alkyl group, a cycloalkyl group, an alkoxy group, an aryloxy group, a heteroaryloxy group, a heterocyclic group, an aryl group, an acyl group, and an oxo group. These substituents may be further substituted with another substituent, or may be bonded to each other to form a ring.

[0012] In the present specification, the "dialkylamino group" means a group in which two hydrogen atoms in a primary amino group (-NH2) are each independently substituted with an alkyl group. The dialkylamino group may be a C2 to C12 dialkylamino group, may be a C2 to C8 dialkylamino group, or may be a C2 to C6 dialkylamino group. Specific examples of the dialkylamino group include a dimethylamino group, a methylethylamino group, and a diethylamino group.

[0013] In the present specification, the "cycloalkyl group" means a monovalent group obtained by removing one hydrogen atom from a cyclic saturated hydrocarbon. The cycloalkyl group may be a C3 to C8 cycloalkyl group, may be a C3 to C6 cycloalkyl group, or may be a C3 to C5 cycloalkyl group. Specific examples of the cycloalkyl group include a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, and a cyclohexyl group.

[0014] In the present specification, the "substituted cycloalkyl group" means a group in which one or more hydrogen atoms of a cycloalkyl group are substituted with a substituent. As the substituents in the substituted cycloalkyl group, the above-described substituents can be exemplified.

[0015] In the present specification, the "alkylene group" means a divalent group obtained by removing two hydrogen atoms from a saturated hydrocarbon. The alkylene group may be linear, branched, or cyclic, or may be linear or branched. The alkylene group may be a C1 to C6 alkylene group, may be a C1 to C5 alkylene group, or may be a C1 to C3 alkylene group. Specific examples of the alkylene group include a methylene group, an ethylene group, a propylene group, an isopropylene group, a butylene group, a pentylene group, and a hexylene group.

[0016] In the present specification, the "alkylene group optionally substituted with a hydroxyl group" means an alkylene group, or a group in which one or more hydrogen atoms of an alkylene group are substituted with a hydroxyl group.

[0017] In the present specification, the "nitrogen-containing heterocyclic group" means a non-aromatic or aromatic cyclic monovalent group containing a nitrogen atom in the ring. The number of nitrogen atoms contained in the ring of the nitrogen-containing heterocyclic group may be, for example, 1 to 5, may be 1 to 3, or may be 1 to 2. The nitrogen-containing heterocyclic group may be a monocyclic ring, may be a fused ring, or may be a spiro ring. The nitrogencontaining heterocyclic group may have an unsaturated bond in the ring (unsaturated nitrogen-containing heterocyclic group), or may not have an unsaturated bond (saturated nitrogen-containing heterocyclic group). Specific examples of the monocyclic nitrogen-containing heterocyclic group include non-aromatic nitrogen-containing heterocyclic groups such as an azetidinyl group (for example, a 1-azetidinyl group, a 2-azetidinyl group, a 3-azetidinyl group), a piperidinyl group (for example, a 1-piperidinyl group, a 2-piperidinyl group, a 3-piperidinyl group, a 4-piperidinyl group), a piperazinyl group (for example, a 1-piperazinyl group, a 2-piperazinyl group, a 3-piperazinyl group), a pyrrolidinyl group (for example, a 1-pyrrolidinyl group, a 2-pyrrolidinyl group, a 3-pyrrolidinyl group), and an azepanyl group (for example, an azepan-1-yl group, an azepan-2-yl group, an azepan-3-yl group); and aromatic nitrogen-containing heterocyclic groups such as a pyridyl group (for example, a 2-pyridyl group, a 3-pyridyl group, a 4-pyridyl group), a 1-pyridinium group, a pyrazyl group (for example, a 2-pyrazyl group), a pyrimidyl group (for example, a 2-pyrimidinyl group, a 4-pyrimidinyl group, a 5-pyrimidinyl group), a pyridazyl group (for example, a 3-pyridazinyl group, a 4-pyridazinyl group), a triazinyl group (a 1,3,5- triazinyl group, a 1,2,4-triazinyl group, a 1,2,3-triazinyl group), a pyrrolyl group (for example, a 1-pyrrolyl group, a 2-pyrrolyl group, a 3-pyrrolyl group), a triazolyl group (for example, a 1,2,4-triazol-1-yl group, a 1,2,4-triazol-3-yl group, a 1,2,4-triazol-4-yl group), a pyrazolyl group (for example, a 1-pyrazolyl group, a 3-pyrazolyl group, a 4-pyrazolyl group), and an imidazolyl group (for example, a 1-imidazolyl group, a 2-imidazolyl group, a 4-imidazolyl group). The nitrogencontaining heterocyclic group may be a heterocyclic group containing, in addition to the nitrogen atom, another heteroatom. Specific examples thereof include, as heterocyclic groups containing an oxygen atom, an oxazolyl group (for example, a 2-oxazolyl group, a 4-oxazolyl group, a 5-oxazolyl group), an isoxazolyl group (for example, a 3-isoxazolyl group, a 4-isoxazolyl group, a 5-isoxazolyl group), a morpholyl group (for example, a 2-morpholinyl group, a 3-morpholinyl group, a 4-morpholinyl group), and, as those containing a sulfur atom, a thiazolyl group (for example, a 2-thiazolyl group, a 4-thiazolyl group, a 5-thiazolyl group), and an isothiazolyl group (for example, a 3-isothiazolyl group, a 4-isothiazolyl group, a 5-isothiazolyl group). Specific examples of the fused-ring nitrogen-containing heterocyclic group include an isoquinolyl group (for example, 1-isoquinolyl, 3-isoquinolyl, a 4-isoquinolyl group, a 5-isoquinolyl group, a 6-isoquinolyl group, a 7-isoquinolyl group, an 8-isoquinolyl group), a quinolizinyl group (for example, a 2-quinolizinyl group), a dihydroindolyl group (for example, a 1-dihydroindolyl group, a 2-dihydroindolyl group, a 3-dihydroindolyl group, a 4-dihydroindolyl group, a 5-dihydroindolyl group, a 6-dihydroindolyl group, a 7-dihydroindolyl group), a dihydroisoindolyl group (for example, a 1-dihydroisoindolyl group, a 2-dihydroisoindolyl group, a 3-dihydroisoindolyl group, a 4-dihydroisoindolyl group, a 5-dihydroisoindolyl group, a 6-dihydroisoindolyl group, a 7-dihydroisoindolyl group), a tetrahydroquinolyl group (for example, a 1-tetrahydroquinolyl  group,  a  2-tetrahydroquinolyl  group,  a  3- tetrahydroquinolyl  group,  a  4-tetrahydroquinolyl  group,  a  5- tetrahydroquinolyl  group,  a  6-tetrahydroquinolyl  group,  a  7- tetrahydroquinolyl group, an 8-tetrahydroquinolyl group), a tetrahydroisoquinolyl group (for example, a 1-tetrahydroisoquinolyl group, a 2-tetrahydroisoquinolyl group, a 3-tetrahydroisoquinolyl group, a 4-tetrahydroisoquinolyl group, a 5-tetrahydroisoquinolyl group, a 6-tetrahydroisoquinolyl group, a 7-tetrahydroisoquinolyl group, an 8-tetrahydroisoquinolyl group), a 3-azabicyclo[3.1.0]hexan-3-yl group, and an octahydrocyclopenta[c]pyrrol-2-yl group. Specific examples of the spiro-ring nitrogen-containing heterocyclic group include the groups shown below. [Chem. 2] [wherein * represents a bonding position.]

[0018] In the present specification, the "substituted nitrogen-containing heterocycle" means a group in which one or more elements (elements not constituting the ring) of a nitrogen-containing heterocycle are substituted with a substituent. The substituent may be bonded to a nitrogen atom in the ring of the nitrogen-containing heterocycle, or may be bonded to a carbon atom. As the substituent in the substituted heterocyclic group, the above-described substituents can be exemplified.

[0019] In the present specification, the "aryl group" means a monovalent group of a cyclic aromatic hydrocarbon. The aryl group may be a monocyclic ring, or may be a fused ring. Specific examples of the aryl group include a phenyl group and a naphthyl group.

[0020] In the present specification, the "substituted aryl group" means a group in which one or more elements (elements not constituting the ring) of an aryl group are substituted with a substituent. As the substituent in the substituted aryl group, the above-described substituents can be exemplified.

[0021] In the present specification, the "alkoxy group" means an oxy group to which an alkyl group is bonded. Specific examples of the alkoxy group include a methoxy group, an ethoxy group, a 1-propoxy group, a 2-propoxy group, an n-butoxy group, an i-butoxy group, an s-butoxy group, a t-butoxy group, a pentyloxy group, and a 3-methylbutoxy group.

[0022] In the present specification, the "substituted alkoxy group" means a group in which one or more hydrogen atoms of an alkoxy group are substituted with a substituent. As the substituent in the substituted alkoxy group, the above-described substituents can be exemplified.

[0023] In the present specification, the "aryloxy group" means an oxy group to which an aryl group is bonded. Specific examples of the aryloxy group include a phenoxy group and a naphthyloxy group.

[0024] In the present specification, the "substituted aryloxy group" means a group in which one or more elements (elements not constituting the ring) of an aryloxy group are substituted with a substituent. As the substituent in the substituted aryloxy group, the above-described substituents can be exemplified.

[0025] In the present specification, the "heteroaryloxy group" means an oxy group to which a heteroaryl group is bonded. Specific examples of the heteroaryloxy group include a furyloxy group, a thienyloxy group, a pyrrolyloxy group, an imidazolyloxy group, a pyrazolyloxy group, a thiazolyloxy group, and a piperazinyloxy group.

[0026] In the present specification, the "substituted heteroaryloxy group" means a group in which one or more elements (elements not constituting the ring) of a heteroaryloxy group are substituted with a substituent. As the substituent in the substituted heteroaryloxy group, the above-described substituents can be exemplified.

[0027] In the present specification, the "halogen" means a group consisting of a halogen atom (halogeno group). Examples of the halogen include a fluoro group, a chloro group, a bromo group, and an iodo group.

[0028] In the present specification, the "acyl group" means a group consisting of an atomic group obtained by removing an OH group from a carboxyl group of a carboxylic acid. The acyl group may be a C1 to C10 acyl group, may be a C2 to C8 acyl group, or may be a C2 to C3 acyl group. Specific examples of the acyl group include a formyl group (methanoyl group), an acetyl group (ethanoyl group), an n-propanoyl group, and a benzoyl group.

[0029] The compound of the present invention is a compound represented by general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof: [Chem. 3] A I B i C

[0030] In general formula (1), X1, X2, and X3 are any of the following combinations: (a) X1, X2, and X3 are -CH=; (b) X1 is -N=, X2 is -CH=, and X3 is -CH=; or (c) X1 is -CH=, X2 is -CH=, and X3 is -N=; and it is preferable that (a) X1, X2, and X3 are -CH=. In general formula (1), the ring containing X1, X2, and X3 is a pyridine ring when (a) X1, X2, and X3 are -CH=, is a pyrimidine ring when (b) X1 is -N=, X2 is -CH=, and X3 is -CH=, and is a pyridazine ring when (c) X1 is -CH=, X2 is -CH=, and X3 is -N=.

[0031] In general formula (1), A is -O-, -S-, -NR-, or a piperidinediyl group, and is preferably -O-. In -NR-, R is a hydrogen atom or a C1 to C3 alkyl group.

[0032] When A is a piperidinediyl group, the nitrogen atom in the piperidine ring is preferably bonded to a carbon atom in the second ring from the top in general formula (1). Specific examples of the piperidinediyl group include a 1,4-piperidinediyl group, a 1,3-piperidinediyl group, and a 1,2-piperidinediyl group.

[0033] In general formula (1), B is a single bond, a C1 to C5 alkylene group, or -Y1-NY2-Y3-, is preferably a C1 to C5 alkylene group, and is more preferably a C1 to C3 alkylene group. In -Y1-NY2-Y3-, Y1 and Y3 are each independently a C1 to C3 alkylene group, and Y2 is a hydrogen atom or a C1 to C3 alkyl group. When B is -Y1-NY2-Y3-, Y1 is bonded to A, and Y3 is bonded to C.

[0034] In general formula (1), C is a substituted or unsubstituted aryl group, or a substituted or unsubstituted nitrogen-containing heterocyclic group, is preferably a substituted or unsubstituted nitrogen-containing heterocyclic group, and is more preferably a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group. When C is a substituted or unsubstituted nitrogen-containing heterocyclic group, B may be bonded to a nitrogen atom in the ring of the nitrogen-containing heterocycle, or may be bonded to a carbon atom.

[0035] As the substituent in the substituted aryl group or the substituted nitrogen-containing heterocyclic group of the above-described C, the above-described substituents can be exemplified, and an alkyl group, a cycloalkyl group, a cycloalkylalkyl group, an aryl group, a substituted aryl group, a benzyl group, a substituted benzyl group, an aryloxy group, an acyl group, an alkyloxycarbonyl group, an aryloxycarbonyl group, a benzyloxycarbonyl group, a cycloalkylcarbonyl group, or a cycloalkyloxycarbonyl group is preferable.

[0036] As specific examples of the alkyl group, the cycloalkyl group, the aryl group, the aryloxy group, and the acyl group, the abovedescribed groups can be exemplified. Specific examples of the cycloalkylalkyl group include a cyclopropylmethyl group and a cyclobutylmethyl group. Specific examples of the substituted aryl group include a fluorophenyl group. Specific examples of the substituted benzyl group include a fluorobenzyl group, a bromobenzyl group, a trifluoromethylbenzyl group, and an ethylbenzyl group. Specific examples of the alkyloxycarbonyl group include methyloxycarbonyl, ethyloxycarbonyl, n-propyloxycarbonyl, isopropyloxycarbonyl, and isobutyloxycarbonyl. Specific examples of the aryloxycarbonyl group include phenyloxycarbonyl.       Specific examples of the cycloalkylcarbonyl group include a cyclopropylcarbonyl group. Specific examples of the cycloalkyloxycarbonyl group include cyclopentyloxycarbonyl.

[0037] The above-described C is preferably a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group.

[0038] In general formula (1), at least one of B and C contains one or more nitrogen atoms. The total number of nitrogen atoms contained in A, B, and C may be 1 to 5, may be 1 to 3, or may be 1 to 2. The total number of nitrogen atoms contained in B and C may be 1 to 5, may be 1 to 3, or may be 1 to 2.

[0039] In general formula (1), when C is a substituted or unsubstituted nitrogen-containing heterocyclic group, B is preferably a single bond or a C1 to C5 alkylene group, and when C is a substituted or unsubstituted aryl group, B is preferably -Y1-NY2-Y3-.

[0040] In general formula (1), a combination in which X1, X2, and X3 are -CH=, A is -O-, B is a single bond or a C1 to C5 alkylene group, and C is a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogencontaining heterocyclic group, or a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group, is still more preferable.

[0041] Specific examples of the compound represented by general formula (1) include the above-described compounds (1) to (20) (the compounds of Examples 1 to 20), and the above-described compounds (7), (11), (12), (15), and (16) (the compounds of Examples 7, 11, 12, 15, and 16) are preferred.

[0042] The compound of the present invention can be produced, for example, in accordance with the Examples described below or a known method, using a known compound or an intermediate that can be easily synthesized from a known compound. In the production of the compound of the present invention, when the raw material has a substituent that affects the reaction, the reaction is generally carried out after protecting the raw material in advance with an appropriate protecting group by a known method. The protecting group can be deprotected after the reaction by a known method.

[0043] The meaning of each term used in the present specification is described below. Unless otherwise specified, each term is used in the same meaning whether it is used alone or in combination with another term.

[0044] The abbreviations used in the present specification have the following meanings. BSA: bovine albumin DBU: 1,8-diazabicyclo[5.4.0]-7-undecene DMSO: dimethyl sulfoxide CDI: 1,1'-carbonyldiimidazole KOtBu: potassium tert-butoxide HATU:     O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate HEPES: N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid MeOH: methanol MS: mass spectrometry LCMS: high performance liquid chromatography mass spectrometry ESI: electrospray ionization M: molar concentration (mol / L)

[0045] The compound of the present invention can be used per se as a medicament, but can also be used in the form of a pharmaceutically acceptable salt, a solvate, or a solvate of a salt, formed by a known method. Examples of the pharmaceutically acceptable salt include salts of mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid, salts of organic acids such as acetic acid, malic acid, lactic acid, citric acid, tartaric acid, maleic acid, succinic acid, fumaric acid, p-toluenesulfonic acid, benzenesulfonic acid, and methanesulfonic acid, salts of alkali metals such as lithium, potassium, and sodium, salts of alkaline earth metals such as magnesium and calcium, and salts of organic bases such as ammonium salts. These salts can be formed by a conventional method.

[0046] For example, when the compound of the present invention is a hydrochloride, it can be obtained by dissolving the free base of the compound of the present invention in an alcohol solution of hydrogen chloride, an ethyl acetate solution of hydrogen chloride, a 1,4-dioxane solution of hydrogen chloride, a cyclopentyl methyl ether solution of hydrogen chloride, hydrochloric acid, or a diethyl ether solution of hydrogen chloride.

[0047] The compound of the present invention may take in a solvent molecule to become a solvate when left standing in the atmosphere or when recrystallized, and such a solvate is also encompassed in the compound of the present invention. Examples of such a solvate include solvates with solvent molecules, such as a methanol solvate, an ethanol solvate, an isopropanol solvate, a butanol solvate, a dimethyl sulfoxide solvate, and an acetonitrile solvate, as well as a monohydrate and a dihydrate.

[0048] Some of the compounds of the present invention have an asymmetric carbon, and any of the respective optical isomers and mixtures thereof are included in the present invention. The stereoisomer can be produced, for example, by optically resolving a racemate by a known method using an optically active acid (tartaric acid, dibenzoyltartaric acid, mandelic acid, 10-camphorsulfonic acid, and the like) utilizing its basicity, or by using an optically active compound prepared in advance as a raw material. In addition, it can also be produced by optical resolution using a chiral column or by asymmetric synthesis.

[0049] General formula (1) in the present invention is not limited to a specific isomer, but includes all possible isomers and racemates. For example, the following tautomers and stereoisomers are also encompassed in the compound of the present invention. [Chem. 4]

[0050] The compound of the present invention has binding-inhibiting activity that inhibits the binding between CUG repeat RNA and MBNL protein, as shown in the Test Examples described below.

[0051] Therefore, in one embodiment of the present invention, there is provided a binding inhibitor that inhibits the binding between CUG repeat RNA and MBNL protein, containing the compound of the present invention.

[0052] Furthermore, in one embodiment of the present invention, there is provided a method for inhibiting the binding between CUG repeat RNA and MBNL protein, comprising administering the compound of the present invention to a subject in need thereof.

[0053] Furthermore, in one embodiment of the present invention, there is provided the compound of the present invention for use in inhibiting the binding between CUG repeat RNA and MBNL protein.

[0054] Furthermore, in one embodiment of the present invention, there is provided use of the compound of the present invention in the manufacture of a binding inhibitor that inhibits the binding between CUG repeat RNA and MBNL protein.

[0055] In one embodiment of the present invention, there is provided a therapeutic agent for myotonic dystrophy type 1, containing the compound of the present invention.

[0056] Furthermore, in one embodiment of the present invention, there is provided a method for treating myotonic dystrophy type 1, comprising administering the compound of the present invention to a subject in need thereof.

[0057] Furthermore, in one embodiment of the present invention, there is provided the compound of the present invention for use in the treatment of myotonic dystrophy type 1.

[0058] Furthermore, in one embodiment of the present invention, there is provided use of the compound of the present invention in the manufacture of a therapeutic agent for myotonic dystrophy type 1.

[0059] Examples of the diseases to which the compound of the present invention can be applied include myotonic dystrophy type 1 and spinocerebellar ataxia type 8.

[0060] The "subject" refers to a human or non-human animal that is affected with, or is suspected of being affected with, a disease in which the binding between CUG repeat RNA and MBNL protein is involved, or myotonic dystrophy type 1. In one embodiment of the present invention, the subject is a mammal. In one embodiment of the present invention, the subject is a human.

[0061] The compound of the present invention can be used per se, or as a therapeutic agent for the aforementioned various diseases in mammals such as humans, mice, rats, rabbits, dogs, cats, cows, horses, pigs, and monkeys, by, for example, mixing it with a pharmacologically acceptable carrier or the like to form a pharmaceutical composition containing, for example, 0.001% to 99.5%, preferably 0.1% to 90%, thereof.

[0062] As the carrier, one or more of a pharmaceutically acceptable conventional solid, semisolid, or liquid diluent, filler, and other formulation auxiliaries are used. The pharmaceutical composition according to the present invention is desirably administered in a dosage unit form. The pharmaceutical composition can be administered intratissularly, orally, intravenously, locally (transdermally, ophthalmically, intraperitoneally, intrathoracically, and the like), or rectally. The pharmaceutical composition according to the present invention is administered in a dosage form suitable for these administration methods.

[0063] The dose as a medicament is desirably adjusted in consideration of the patient's condition such as age, body weight, type and degree of disease, administration route, type of the compound of the present invention, whether it is a salt or not, and type of salt, but usually, in the case of oral administration, an amount within the range of 0.01 mg to 5 g / adult per day, preferably within the range of 1 mg to 2000 mg / adult per day, is appropriate as the amount of the active ingredient of the compound of the present invention or a pharmaceutically acceptable salt thereof for an adult. In some cases, a dose less than this is sufficient, and conversely, a dose more than this may be required. Usually, it can be administered once a day or in several divided doses per day, or in the case of intravenous administration, it can be administered rapidly or continuously within 24 hours.

[0064] One or more of hydrogen, carbon, and / or other atoms of the compound of the present invention may be substituted with isotopes of hydrogen, carbon, and / or other atoms, respectively. Examples of such isotopes include 2H, 3H, 11C, 13C, 14C, 15N, 18O, 17O, 31P, 32P, 35S, 18F, 123I, and 36Cl, that is, hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, respectively. A compound substituted with such an isotope is also useful as a pharmaceutical, and encompasses all radiolabeled forms of the compound of the present invention.

[0065] The compound of the present disclosure can be produced from a known compound or an intermediate that can be easily synthesized from a known compound, for example, in accordance with the method described in the present specification or a known method.

[0066] In each step of the following production methods, when the solvent, reagent, and raw material used are commercially available, the commercially available product can be used per se. In addition, the compound obtained in each step of the following production methods and the raw material used may form a salt, and can be converted into another type of salt or a free form by a known method. When the compound obtained in each step of the following production methods and the raw material used are a free form, they can be converted into a target salt by a known method. Examples of such a salt include the same salts as those used for the above-described compound of the present disclosure.

[0067] In the production of the compound of the present disclosure, when the raw material has a substituent that may affect the reaction, a protecting group may be introduced into these substituents in advance by a known method. When a protecting group is introduced into the substituent of the raw material, the target compound can be obtained by removing the protecting group as necessary after the reaction. Examples of such a protecting group include the protecting groups shown in "Greene's Protective Groups in Organic Synthesis" by Wuts and Greene, 4th edition; John Wiley & Sons Inc.; 2006; or "Protecting Groups" by P. J. Kocienski, 3rd edition; Thieme 2005. The protecting group can be appropriately selected and used depending on the properties of the raw material and the reaction conditions.

[0068] The compound obtained in each step of the following production methods can be isolated or purified by a conventional method using a method such as solvent extraction, concentration, distillation, sublimation, recrystallization, reprecipitation, or chromatography, or can also be used in the next step in the state of a reaction mixture or a crude product.

[0069] Unless otherwise specified, the reaction in each step of the following production methods can be carried out by appropriately improving or combining a known method, for example, the method described in "Comprehensive Organic Transformations: A Guide to Functional Group Preparations 2nd Edition" by R. C. Larock, John Wiley & Sons Inc. 1999; "Jikken Kagaku Koza (Courses in Experimental Chemistry)" edited by the Chemical Society of Japan, 4th edition, Maruzen 1992; "Jinmei Hanno ni Manabu Yuki Gosei Senryaku (Strategic Applications of Named Reactions in Organic Synthesis)" by L. Kuerti and B. Czako, supervised and translated by Kiyoshi Tomioka, Kagaku-Dojin 2006; "Saishin Yuki Gosei-ho: Sekkei to Senryaku (Modern Organic Synthesis: Design and Strategy)" by G. S. Zweifel and M. H. Nantz, translated by Tamejiro Hiyama, Kagaku-Dojin 2009, or the method described in the present specification. A more specific production method of the compound of the present disclosure is described below.

[0070] Compound (1) can be produced by the following method. [Chem. 5] nh2oh-hci (X1, X2, X3, A, B, and C are as defined above. E1 represents a leaving group, and examples thereof include a halogen such as fluorine and chlorine, a mesylate, a tosylate, and a trifluoromethanesulfonate. E2 represents a leaving group, and examples thereof include chlorine and imidazole.)

[0071] Route 1 Step 1 This step is a step of obtaining compound A-2 by reacting compound A-1, which is commercially available or synthesized by a known method, with hydroxylamine hydrochloride or hydroxylamine in a solvent such as ethanol, methanol, water, tetrahydrofuran, or dimethyl sulfoxide, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydroxide, potassium hydroxide, potassium     carbonate,     sodium     hydrogen     carbonate, diisopropylethylamine, or triethylamine, at 0 °C to 100 °C, preferably 10 °C to 80 °C, more preferably 20 to 40 °C, for 5 minutes to 48 hours, preferably 10 minutes to 24 hours, more preferably 30 minutes to 6 hours. In addition, compound A-2 may be obtained as a salt of an inorganic acid in some cases.

[0072] Step 2 This reaction is a step of obtaining compound A-4 by reacting compound A-2 with compound A-3, which is commercially available or synthesized by a known method, in a solvent such as acetonitrile, tetrahydrofuran, or dioxane, in the presence of a base such as diisopropylethylamine, triethylamine, or DBU, at 0 °C to 50 °C, preferably 10 °C to 40 °C, more preferably 20 to 30 °C, for 5 minutes to 24 hours, preferably 10 minutes to 12 hours, more preferably 30 minutes to 6 hours.

[0073] Step 3 This reaction is a step in which compound (1) can be obtained by reacting compound A-4 with compound A-5, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, potassium carbonate, sodium hydride, diisopropylethylamine, triethylamine, or DBU, at 0 °C to 120 °C, preferably 30 °C to 80 °C, more preferably 50 to 70 °C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, more preferably 30 minutes to 4 hours.

[0074] In addition, compound (1) can also be produced by the following method. That is, it is a step of converting a cyano group (-CN) into 4,5-dihydro-1,2,4-oxadiazol-5-one after introducing a substituent corresponding to A-B-C. [Chem. 6] Route 2 H-A-B-C A-5 Step 1 OH O hnvnh   eAe2 nh2oh-hci I          A, N^X1      A'd x3^x2           ' Step 2            |           step 3 A B C A-1                          B-1                             B-2 (X1, X2, X3, A, B, C, E1, and E2 are as defined above.)

[0075] Route 2 Step 1 This step is a step of obtaining compound B-1 by reacting compound A-1, which is commercially available or synthesized by a known method, with compound A-5, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU, at 0 °C to 120 °C, preferably 10 °C to 100 °C, more preferably 20 to 30 °C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, more preferably 30 minutes to 6 hours.

[0076] Step 2 This reaction is a step of obtaining compound B-2 from compound B-1, and compound B-2 can be produced by a method similar to that of Step 1 of Route 1 above.

[0077] Step 3 This reaction is a step of obtaining compound (1) from compound B-2, and compound (1) can be produced by a method similar to that of Step 2 of Route 1 above.

[0078] Compound B-1 can also be produced by the following method. [Chem. 7] (X1, X2, X3, A, B, C, and E1 are as defined above. E3 represents a leaving group, and examples thereof include a halogen such as chlorine, bromine, or iodine, a mesylate, a tosylate, and a trifluoromethanesulfonate.)

[0079] Route 3 Step 1 This step is a step of obtaining compound C-2 by reacting compound A-1, which is commercially available or synthesized by a known method, with compound C-1, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU, at 0 °C to 120 °C, preferably 10 °C to 100 °C, more preferably 20 to 30 °C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, more preferably 30 minutes to 6 hours. In addition, the hydroxyl group of compound C-1 may be protected with a known protecting group in some cases, and can also be deprotected by a known method after the addition reaction.

[0080] Step 2 This step is a step of obtaining compound C-3 from compound C-2, and can be carried out in accordance with a known method. For example, compound C-3 can be obtained by reacting compound C-2 with a sulfonic acid esterifying agent such as tosyl chloride, mesyl chloride, or para-toluenesulfonic anhydride, in a solvent such as dichloromethane or tetrahydrofuran, in the presence of a base such as pyridine, diisopropylethylamine, triethylamine, or DBU, at 0 to 50 °C, preferably 10 to 30 °C, for 1 hour to 48 hours, preferably 2 hours to 6 hours.

[0081] Step 3 This step is a step of introducing C into compound C-3 to obtain compound B-1, and can be carried out in accordance with a known method. For example, compound B-1 can be obtained by reacting compound C-2 with a secondary amine such as piperidine or pyrrolidine, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran, in the presence of a base such as sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU, at 40 °C to 120°C, preferably 80 °C to 100 °C, for 1 hour to 48 hours, preferably 3 hours to 12 hours.

[0082] In addition, compound (1) can also be produced by the following method. That is, it is a method of chemically reacting after adding B having a hydroxyl group. [Chem. 8] (X1, X2, X3, A, B, C, E1, and E3 are as defined above.)

[0083] Route 4 Step 1 This step is a step of obtaining compound D-1 by reacting compound A-4 with compound C-1, which is commercially available or synthesized by a known method, in a solvent such as N-methyl-2-pyrrolidone, N,N-dimethylformamide, dimethyl sulfoxide, acetonitrile, or tetrahydrofuran, in the presence of a base such as potassium tert-butoxide, sodium tert-butoxide, sodium hydride, potassium carbonate, diisopropylethylamine, triethylamine, or DBU, at 0 °C to 120 °C, preferably 20 °C to 80 °C, more preferably 50 to 70 °C, for 5 minutes to 48 hours, preferably 10 minutes to 12 hours, more preferably 30 minutes to 6 hours. In addition, the hydroxyl group of compound C-1 may be protected with a known protecting group in some cases, and can also be deprotected by a known method after the addition reaction.

[0084] Step 2 This step is a step of obtaining compound D-2 by converting the hydroxyl group of compound D-1 to introduce a leaving group, and D-2 can be obtained by carrying out the reaction under conditions similar to those of the synthesis of the above-described compound (C-3).

[0085] Step 3 This step is a step of obtaining compound (1) by converting the leaving group of compound D-2 to introduce C, and compound (1) can be produced by a method similar to that of Step 3 of Route 3 above. Examples

[0086] Hereinafter, the present invention will be described in more detail with reference to Examples and Test Examples, but the present invention is not limited thereto.

[0087] MS was measured by LCMS. As the ionization method, the ESI method was used. The observed value of the mass spectrometry is represented by m / z.

[0088] The measurement conditions of LCMS are as follows. Analytical instrument:  ACQUITY UPLC MS / PDA system (manufactured by Waters) Mass spectrometer: ACQUITY QDa detector, or Waters 3100 MS detector Photodiode array detector: ACQUITY PDA detector (UV detection wavelength: 210 to 400 nm) Column: Acquity BEH C18, 1.7 pm, 2.1 x 50 mm Flow rate: 0.5 mL / min Column temperature: 40 °C Solvent; Solution A: 0.1% formic acid / H2O (v / v; the same applies hereinafter) Solution B: 0.1% formic acid / acetonitrile

[0089] The nuclear magnetic resonance (NMR) spectrum was measured with a JNM-ECS400 nuclear magnetic resonance apparatus (manufactured by JEOL RESONANCE Inc.) or a JNM-ECZL400S nuclear magnetic resonance apparatus (manufactured by JEOL Ltd.). The observed peaks are represented by chemical shift values 5 (ppm) (s = singlet, d = doublet, t = triplet, q = quartet, br = broad singlet, m = multiplet, dd = double doublet, ddd = double double doublet, dt = double triplet).

[0090] For the microwave experiment, Initiator (manufactured by Biotage) or Initiator+ (manufactured by Biotage) was used.

[0091] The compound names in the present specification were named using ACD / NAME (registered trademark, Advanced Chemistry Development Inc.), a naming software conforming to the rules of IUPAC, using ChemBioDraw (version 19.1, manufactured by CambridgeSoft), or in accordance with the IUPAC nomenclature.

[0092] Example 1^-{52£(12ethylpiperidin-42yl)methoxy]pyridin-22yl}2 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile To a mixture of (1-ethylpiperidin-4-yl)methanol (528 mg) and N,N-dimethylformamide (2.46 mL), sodium hydride (60%, dispersed in liquid paraffin, 147 mg) was added, and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (300 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel chromatography to obtain the title compound (500 mg). MS (m / z): 246.3 [M+H]+

[0093] [Step 2] Production of 5-[(1-ethylpiperidin-4-yl)methoxy]-N'-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (425 mg) and dimethyl sulfoxide (2.04 mL), KOtBu (686 mg) was added sequentially at room temperature, and the mixture was stirred for 10 minutes. 5-[(1-Ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile (500 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (396 mg). MS (m / z): 279.3 [M+H]+

[0094] [Step 3]       Production of 3-{5-[(1-ethylpiperidin-4- yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 5-[(1-ethylpiperidin-4-yl)methoxy]-N'-hydroxypyridine-2-carboximidamide (396 mg), tetrahydrofuran (4.74 mL), and DBU (0.255 mL), CDI (277 mg) was added, and the mixture was stirred at room temperature overnight. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (98 mg) was obtained by purification by silica gel chromatography. MS (m / z): 305.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 8: 8.39 (d, 1H), 7.89 (d, 1H), 7.57 (dd, 1H), 4.05 (d, 2H), 3.50-3.12 (m, 2H), 2.92-2.82 (m, 2H), 2.74-2.60 (m, 2H), 2.10-1.88 (m, 3H), 1.60-1.42 (m, 2H), 1.17 (t, 3H)

[0095] Example 2 3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridm-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of tert-butyl (3R)-3-{[(6-cyanopyridin-3-yl)oxy]methyl}piperidine-1-carboxylate To a mixture of tert-butyl (3R)-3-(hydroxymethyl)piperidine-1-carboxylate (410 mg) and N,N-dimethylformamide (1.27 mL), sodium hydride (60%, dispersed in liquid paraffin, 76 mg) was added, and the mixture was stirred at room temperature for 15 minutes.   5- Fluoropyridine-2-carbonitrile (155 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel chromatography to obtain the title compound (310 mg). MS (m / z): 318.1 [M+H]+

[0096] [Step 2]        Production of 5-{[(3R)-piperidin-3- yl]methoxy}pyridine-2-carbonitrile hydrochloride To           tert-butyl           (3R)-3-{[(6-cyanopyridin-3- yl)oxy]methyl}piperidine-1-carboxylate (310 mg), a 4 M hydrogen chloride dioxane solution (3.0 mL) was added at room temperature, and the mixture was stirred for 1 hour. The solvent was distilled off under reduced pressure to obtain the title compound (310 mg). MS (m / z): 218.0 [M+H]+

[0097] [Step 3]      Production of 5-{[(3R)-1-ethylpiperidin-3- yl]methoxy}pyridine-2-carbonitrile To a mixture of 5-{[(3R)-piperidin-3-yl]methoxy}pyridine-2-carbonitrile hydrochloride (310 mg), N,N-dimethylformamide (3 mL), and diisopropylethylamine (0.92 mL), iodoethane (217 mg) was added, and the mixture was heated and stirred at 70 °C overnight. The reaction solution was purified by silica gel column chromatography to obtain the title compound (66 mg). MS (m / z): 246.1 [M+H]+

[0098] [Step 4] Production of 3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridine-2-carbonitrile (66 mg) obtained in Step 3 of Example 2 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (48 mg) was obtained. MS (m / z): 305.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.45 (d, 1H), 7.79 (d, 1H), 7.46 (dd, 1H), 4.06 (d, 2H), 3.93 (t, 2H), 2.85 (d, 2H), 3.55-3.20 (m, 3H), 2.222.08 (m, 1H), 1.85-1.60 (m, 3H), 1.15 (t, 3H) Elemental analysis value (as C15H20N4OyHCl) Calculated (%) C: 52.86, H: 6.21, N: 16.44 Found (%) C: 53.30, H: 6.61, N: 16.43

[0099] Example 3 3-(5-{[(3S)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Example 2, using tert-butyl (3S)-3-(hydroxymethyl)piperidine-1-carboxylate (410 mg) instead of tert-butyl (3R)-3-(hydroxymethyl)piperidine-1-carboxylate of Step 1 of Example 2, the title compound (24 mg) was obtained. MS (m / z): 305.1 [M+H]+

[0100] Example 4   3-{5-r(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[(1-benzylpiperidin-4-yl)oxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 1-benzylpiperidin-4-ol (470 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (400 mg) was obtained. MS (m / z): 294.1 [M+H]+

[0101] [Step 2]      Production of 3-{5-[(1-benzylpiperidin-4- yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[(1-benzylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (400 mg) obtained in Step 1 of Example 4 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (390 mg) was obtained. MS (m / z): 353.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 10.75 (br, 1H), 8.48 (d, 1H), 7.95 (d, 1H), 7.70 (dd, 1H), 7.66-7.58 (m, 2H), 7.50-7.44 (m, 3H), 5.10-4.70 (m, 1H), 4.34 (s, 2H), 3.30-3.00 (m, 4H), 2.30-2.18 (m, 2H), 2.14-1.98 (m, 2H)

[0102] Example 5   3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2- yl)-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Production of 5-{2-[benzyl(methyl)amino]ethoxy}pyridine-2- carbonitrile By a method in accordance with Step 1 of Example 1, using 2-[benzyl(methyl)amino]ethan-1-ol (406 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (430 mg) was obtained. MS (m / z): 268.2 [M+H]+

[0103] [Step       2]              Production       of       3-(5-{2- [benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one By a method in accordance with Step 2 and Step 3 of Example 1, using 5-{2-[benzyl(methyl)amino]ethoxy}pyridine-2-carbonitrile (430 mg) obtained in Step 1 of Example 5 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (300 mg) was obtained. MS (m / z): 327.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.43 (d, 1H), 7.92 (d, 1H), 7.61 (dd, 1H), 7.33-7.22 (m, 5H), 4.29 (t, 2H), 3.60 (s, 2H), 2.80 (t, 2H), 2.26 (s, 3H) Elemental analysis value (as C17H18N4O3^0.1H2O) Calculated (%) C: 62.22, H: 5.59, N: 17.07 Found (%) C: 62.06, H: 5.59, N: 16.96

[0104] Example 6  3-{5-[2-(4-acetylpiperazm-1-yDethoxy]pyridm-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1]     Production of tert-butyl 4-{2-[(6-cyanopyridin-3- yl)oxy]ethyl}piperazine-1-carboxylate To a mixture of tert-butyl 4-(2-hydroxyethyl)piperazine-1-carboxylate (1.42 g) and N,N-dimethylformamide (4.10 mL), sodium hydride (60%, dispersed in liquid paraffin, 246 mg) was added, and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (500 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution under ice cooling, and the title compound (1.97 g) was obtained by purification by silica gel column chromatography. MS (m / z): 333.3 [M+H]+

[0105] [Step 2] Production of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride To a mixture of tert-butyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (1.97 g) and methanol (2.85 mL), a 4 M hydrogen chloride dioxane solution (4.44 mL) was added, and the mixture was stirred at room temperature for 30 minutes. Methanol (2.85 mL) and a 4 M hydrogen chloride dioxane solution (4.44 mL) were added, and the mixture was stirred overnight. The precipitate that had deposited was collected by filtration and dried to obtain the title compound (0.97 g). MS (m / z): 233.2 [M+H]+

[0106] [Step 3]       Production of 5-[2-(4-acetylpiperazin-1- yl)ethoxy]pyridine-2-carbonitrile To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (300 mg), dichloromethane (3.28 mL), and diisopropylethylamine (0.85 mL), acetyl chloride (0.084 mL) was added sequentially under ice cooling, and the mixture was stirred at room temperature for 5 hours. A few drops of saturated aqueous sodium hydrogen carbonate solution were added to the reaction solution, and the mixture was concentrated under reduced pressure. The title compound (242 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 275.2 [M+H]+

[0107] [Step 4]     Production of 3-{5-[2-(4-acetylpiperazin-1- yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile (242 mg) obtained in Step 3 of Example 6 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (207 mg) was obtained. MS (m / z): 334.0 [M+H]+ 1H-NMR (400 MHz, D2O) 5: 8.24 (d, 1H), 7.72 (d, 1H), 7.42 (dd, 1H), 4.39 (t, 2H), 3.80-3.67 (m, 4H), 3.42 (t, 2H), 3.25-3.11 (m, 4H), 2.09 (s, 3H)

[0108] Example 7  3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile To a mixture of 3-(piperidin-1-yl)propan-1-ol (387 mg) and N,N-dimethylformamide (3.0 mL), sodium hydride (60%, dispersed in liquid paraffin, 108 mg) was added, and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (220 mg) was added, and the mixture was stirred at room temperature overnight. Water was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel column chromatography to obtain the title compound (336 mg). MS (m / z): 246.2 [M+H]+

[0109] [Step 2]     Production of  N'-hydroxy-5-[3-(piperidin-1- yl)propoxy]pyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (530 mg) and ethanol (3.0 mL), a 2 M aqueous sodium hydroxide solution (3.42 mL) was added, and the mixture was stirred at room temperature for 10 minutes. 5-[3-(Piperidin-1-yl)propoxy]pyridine-2-carbonitrile (336 mg) was added to the reaction solution, and the mixture was stirred for 4 hours. Water was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (236 mg). MS (m / z): 279.3 [M+H]+

[0110] [Step 3] Production of 3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To     a mixture of    N'-hydroxy-5-[3-(piperidin-1- yl)propoxy]pyridine-2-carboximidamide (236 mg), tetrahydrofuran (5.0 mL), and DBU (0.19 mL), CDI (206 mg) was added at room temperature, and the mixture was stirred for 5 hours. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (190 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 305.2 [M+H]+ 1H-NMR (400 MHz, D2O) 8: 8.23 (d, 1H), 7.62 (d, 1H), 7.41 (dd, 1H), 4.24 (t, 2H), 3.69 (br, 2H), 3.43-3.39 (m, 2H), 3.08 (ddd, 2H), 2.39-2.32 (m, 2H), 2.08-2.05 (m, 2H), 1.95-1.79 (m, 3H), 1.65-1.55 (m, 1H) Elemental analysis value (as C15H20N4O3^HCl) Calculated (%) C: 52.86, H: 6.21, N: 16.44 Found (%) C: 52.71, H: 6.31, N: 16.52

[0111] Example 8 3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[3-(pyrrolidin-1-yl)propoxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 3-(pyrrolidin-1-yl)propan-1-ol (349 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (296 mg) was obtained. MS (m / z): 232.2 [M+H]+

[0112] [Step 2]         Production of    3-{5-[3-(pyrrolidin-1- yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[3-(pyrrolidin-1-yl)propoxy]pyridine-2-carbonitrile (296 mg) obtained in Step 1 of Example 8 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (250 mg) was obtained. MS (m / z): 291.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 8: 8.28 (br, 1H), 7.74 (d, 1H), 7.36 (d, 1H), 4.16 (t, 2H), 3.30-3.15 (m, 6H), 2.15-2.06 (m, 2H), 1.94-1.87 (m, 4H)

[0113] Example 9  3-{5-[2-(pyrrolidm-1-yl)ethoxy]pyridm-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[2-(pyrrolidin-1-yl)ethoxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 2-(pyrrolidin-1-yl)ethan-1-ol (325 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (350 mg) was obtained. MS (m / z): 218.0 [M+H]+

[0114] [Step 2] Production of 3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[2-(pyrrolidin-1-yl)ethoxy]pyridine-2-carbonitrile (350 mg) obtained in Step 1 of Example 9 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (330 mg) was obtained. MS (m / z): 277.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.37 (d, 1H), 7.80 (d, 1H), 7.43 (dd, 1H), 4.34 (t, 2H), 3.35 (t, 2H), 3.18-3.12 (m, 4H), 1.92-1.86 (m, 4H)

[0115] Example 10 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Production of 5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (228 mg) obtained in Step 2 of Example 6, N,N-dimethylformamide (3 mL), and diisopropylethylamine (0.65 mL), bromomethylbenzene (0.11 mL) was added at room temperature, and the mixture was stirred overnight. Saturated aqueous sodium hydrogen carbonate solution was added to the reaction solution, and the title compound (235 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 323.3 [M+H]+

[0116] [Step 2]     Production of  3-{5-[2-(4-benzylpiperazin-1- yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile (235 mg) obtained in Step 1 of Example 10 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (105 mg) was obtained. MS (m / z): 382.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.42 (d, 1H), 7.91 (d 1H), 7.61 (dd, 1H), 7.40-7.20 (m, 5H), 4.25 (t, 2H), 3.50 (s, 2H), 3.40-3.20 (m, 4H), 2.76 (t, 2H), 2.45-2.30 (m, 4H) Elemental analysis value (as C20H23N5Oy0.1H2O) Calculated (%) C: 62.68, H: 6.10, N: 18.28 Found (%) C: 62.42, H: 6.09, N: 18.26

[0117] Example 11     phenyl  4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4- oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate hydrochloride [Step 1]      Production of phenyl 4-{2-[(6-cyanopyridin-3- yl)oxy]ethyl}piperazine-1-carboxylate To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (220 mg) obtained in Step 2 of Example 6, dichloromethane (2.40 mL), and diisopropylethylamine (0.62 mL), phenyl carbonochloridate (0.11 mL) was added under ice cooling, and the mixture was stirred at room temperature. A few drops of saturated aqueous sodium hydrogen carbonate solution were added to the reaction solution, and the mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the title compound (254 mg). MS (m / z): 353.2 [M+H]+

[0118] [Step 2] Production of phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using phenyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (254 mg) obtained in Step 1 of Example 11 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (208 mg) was obtained. MS (m / z): 412.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 11.2 (br, 1H), 8.52 (d, 1H), 8.01 (d, 1H), 7.70 (dd, 1H), 7.43-7.38 (m, 2H), 7.27-7.20 (m, 1H), 7.18-7.12 (m, 2H), 4.63 (br, 2H), 4.40-4.00 (m, 2H), 3.75-3.55 (m, 4H), 3.35-3.20 (m, 4H) Elemental analysis value (as C20H21N5O5^HCl) Calculated (%) C: 53.63, H: 4.95, N: 15.64 Found (%) C: 53.19, H: 5.03, N: 15.46

[0119] Example 12  3-{5-[2-(piperidm-1-yl)ethoxy]pyridm-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[2-(piperidin-1-yl)ethoxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 2-(piperidin-1-yl)ethan-1-ol (794 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (758 mg) was obtained. MS (m / z): 232.2 [M+H]+

[0120] [Step 2] Production of 3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[2-(piperidin-1-yl)ethoxy]pyridine-2-carbonitrile (758 mg) obtained in Step 1 of Example 12 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (480 mg) was obtained. MS (m / z): 291.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.40 (d, 1H), 7.88 (d, 1H), 7.56 (dd, 1H), 4.29 (t, 2H), 2.91 (t, 2H), 2.70-2.64 (m, 4H), 1.61-4.54 (m, 4H), 1.46-1.38 (m, 2H)

[0121] Example 13 3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 2-(4-phenoxypiperidin-1-yl)ethan-1-ol (213 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (192 mg) was obtained. MS (m / z): 324.2 [M+H]+

[0122] [Step 2] Production of  3-{5-[2-(4-phenoxypiperidin-1- yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using    5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridine-2-carbonitrile (192 mg) obtained in Step 1 of Example 13 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (39 mg) was obtained. MS (m / z): 383.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.44 (d, 1H), 7.92 (d, 1H), 7.63 (dd, 1H), 7.30-7.20 (m, 2H), 6.98-6.88 (m, 3H), 4.43-4.33 (m, 1H), 4.29 (t, 2H), 2.90-2.80 (m, 4H), 2.48-2.38 (m, 2H), 2.00-1.90 (m, 2H), 1.70-1.60 (m, 2H)

[0123] Example 14 3-{5-[(1-cyclopropanecarbonylpiperidin=42 yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one [Step 1]      Production of tert-butyl 4-{[(6-cyanopyridin-3- yl)oxy]methyl}piperidine-1-carboxylate To a mixture of tert-butyl 4-(hydroxymethyl)piperidine-1-carboxylate (7.94 g) and N,N-dimethylformamide (35 mL), sodium hydride (60%, dispersed in liquid paraffin, 1.47 g) was added, and the mixture was stirred at room temperature for 15 minutes.   5- Fluoropyridine-2-carbonitrile (3.0 g) was added to the reaction solution, and the mixture was stirred for 2 hours. Water was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound (7.8 g). MS (m / z): 262.2 [M-tBu+H]+

[0124] [Step 2]        Production of tert-butyl 4-[({6-[N'- hydroxycarbamimidoyl]pyridin-3-yl}oxy)methyl]piperidine-1-carboxylate To a mixture of hydroxylamine hydrochloride (8.5 g) and dimethyl sulfoxide (49 mL), KOtBu (14 g) was added under ice cooling, and the mixture was stirred for 15 minutes. tert-Butyl 4-{[(6-cyanopyridin-3-yl)oxy]methyl}piperidine-1-carboxylate (7.8 g) was added to the reaction solution, and the mixture was stirred overnight. Water was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (7.72 g). MS (m / z): 351.3 [M+H]+

[0125] [Step 3] Production of tert-butyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate To      a     mixture      of     tert-butyl     4-[({6-[N'- hydroxycarbamimidoyl]pyridin-3-yl}oxy)methyl]piperidine-1-carboxylate (7.72 g), tetrahydrofuran (44 mL), and DBU (3.95 mL), CDI (5.36 g) was added, and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction solution, and 2 M hydrochloric acid was added dropwise to adjust the pH to 5. After 1 hour, the precipitate that had deposited was collected by filtration and dried to obtain the title compound (7.5 g). MS (m / z): 375.2 [M-H]-

[0126] [Step 4] Production of 3-{5-[(piperidin-4-yl)methoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of tert-butyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate (7.5 g) and tetrahydrofuran (30 mL), a 4 M hydrogen chloride dioxane solution (24.9 mL) was added at room temperature, and the mixture was stirred overnight. The solvent was distilled off under reduced pressure, and the precipitate that had deposited was collected by filtration with diethyl ether and dried to obtain the title compound (7.24 g). MS (m / z): 277.2 [M+H]+

[0127] [Step 5] Production of 3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg), cyclopropanecarboxylic acid (53.7 mg), diisopropylethylamine (0.4 mL), and N,N-dimethylformamide (1 mL), HATU (219 mg) was added at room temperature, and the mixture was stirred overnight. The reaction solution was purified by silica gel column chromatography to obtain the title compound (110 mg). MS (m / z): 345.1 [M+H]+

[0128] Example 15  3-{5-[(1-propylpiperidm-4-yl)oxy]pyridm-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1]      Production of tert-butyl 4-[(6-cyanopyridin-3- yl)oxy]piperidine-1-carboxylate To a mixture of tert-butyl 4-hydroxypiperidine-1-carboxylate (7.42 g) and N,N-dimethylformamide (50 mL), sodium hydride (60%, dispersed in liquid paraffin, 1.47 g) was added under ice cooling, and the mixture was stirred for 10 minutes. 5-Fluoropyridine-2-carbonitrile (3.0 g) was added, and the mixture was stirred for 1 hour. Water was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (6.0 g). MS (m / z): 248.2 [M-tBu+H]+

[0129] [Step 2] Production of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride To a mixture of tert-butyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate (6.0 g) and methanol (20 mL), a 4 M hydrogen chloride ethyl acetate solution (50 mL) was added at room temperature, and the mixture was stirred overnight. The solvent was distilled off under reduced pressure, and the precipitate that had deposited was collected by filtration, washed with ethyl acetate, and then dried to obtain the title compound (4.5 g). MS (m / z): 204.2 [M+H]+

[0130] [Step 3] Production of 5-[(1-propylpiperidin-4-yl)oxy]pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg), N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), 1-bromopropane (385 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. The title compound (300 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 246.2 [M+H]+

[0131] [Step 4]      Production of 3-{5-[(1-propylpiperidin-4- yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[(1-propylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (300 mg) obtained in Step 3 of Example 15 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (260 mg) was obtained. MS (m / z): 305.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.50 (br, 1H), 7.96 (d, 1H), 7.71 (dd, 1H), 5.05-4.77 (m, 1H), 3.63-2.95 (m, 6H), 2.33-1.95 (m, 4H), 1.79-1.67 (m, 2H), 0.92 (t, 3H)

[0132] Example 16 3-(5-{[1=(cyclopropylmethyl)piperidin=42 yl]oxv}pyridm-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1]     Production of 5-{[1-(cyclopropylmethyl)piperidin-4- yl]oxy}pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), (bromomethyl)cyclopropane (422 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. The title compound (300 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 258.2 [M+H]+

[0133] [Step 2] Production of 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using        5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridine-2- carbonitrile (300 mg) obtained in Step 1 of Example 16 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (310 mg) was obtained. MS (m / z): 317.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.43 (d, 1H), 7.89 (d, 1H), 7.64 (dd, 1H), 4.80-4.70 (m, 1H), 3.20-3.05 (m, 2H), 2.94-2.80 (m, 2H), 2.70-2.60 (m, 2H), 2.20-2.05 (m, 2H), 1.94-1.80 (m, 2H), 1.04-0.92 (m, 1H), 0.600.48 (m, 2H), 0.28-0.15 (m, 2H)

[0134] Example 17 3-{5-[(1-propylpiperidin-4-yl)methoxy]pyridin-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), and diisopropylethylamine (0.37 mL), 1-bromopropane (0.12 mL) was added sequentially at room temperature, and the mixture was stirred at 80 °C for 4 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (42 mg). MS (m / z): 319.1 [M+H]+

[0135] Example     18 3-{5-[2-(2,3-dihydro-1H-isoindol-2- yl)ethoxy]pyridin-2-yl}-4,5-dihydro21,2,4-oxadiazol-5-one hydrochloride [Step 1]       Production of   5-[2-(2,3-dihydro-1H-isoindol-2- yl)ethoxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 2- (2,3-dihydro-1H-isoindol-2-yl)ethan-1-ol (122 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (112 mg) was obtained. MS (m / z): 266.2 [M+H]+

[0136] [Step 2] Production of 3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using           5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridine-2- carbonitrile (112 mg) obtained in Step 1 of Example 18 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (76 mg) was obtained. MS (m / z): 325.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 8: 8.52 (d, 1H), 8.03 (d, 1H), 7.65 (dd, 1H), 7.45-7.38 (m, 4H), 4.60 (t, 2H), 3.99 (t, 2H), 3.29 (s, 4H) Elemental analysis value (as Ci7Hi6N4O3^HCb0.2H2O) Calculated (%) C: 56.03, H: 4.81, N: 15.38 Found (%) C: 56.01, H: 4.64, N: 15.44

[0137] Example 19 3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2- yl)ethoxy]pyridin-2-yl}-4,5-dihydro21,2,4-oxadiazol-5-one hydrochloride [Step 1]     Production of 5-[2-(1,2,3,4-tetrahydroisoquinolin-2- yl)ethoxy]pyridine-2-carbonitrile By a method in accordance with Step 1 of Example 1, using 2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethan-1-ol (174 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (164 mg) was obtained. MS (m / z): 280.2 [M+H]+

[0138] [Step 2] Production of 3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using      5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridine-2- carbonitrile (162 mg) obtained in Step 1 of Example 19 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (30 mg) was obtained. MS (m / z): 339.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 8: 8.42 (d, 1H), 7.95 (d, 1H), 7.56 (dd, 1H), 7.18-7.05 (m, 4H), 4.42 (t, 2H), 3.94 (s, 2H), 3.18 (t, 2H), 3.10-3.04 (m, 2H), 3.04-2.96 (m, 2H)

[0139] Example 20 ethyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridm-3-yl]oxy}methyl)piperidme-1 -carboxylate To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.57 mL), and diisopropylethylamine (0.24 mL), ethyl carbonochloridate (0.027 mL) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. The mixture was diluted with water, 2 M hydrochloric acid was added, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (83 mg). MS (m / z): 349.2 [M+H]+ Elemental analysis value (as C16H20N4O5) Calculated (%) C: 55.17, H: 5.79, N: 16.08 Found (%) C: 55.07, H: 5.82, N: 16.07

[0140] Example 21 3-(5-J3[4=(2-fluorophenyl)piperazin-12 yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production      of      5-{3-[4-(2-fluorophenyl)piperazin-1- yl]propoxy}pyridine-2-carbonitrile To a mixture of 3-[4-(2-fluorophenyl)piperazin-1-yl]propan-1-ol (351 mg) and N,N-dimethylformamide (3 mL), sodium hydride (60%, dispersed in liquid paraffin, 59 mg) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 5-Fluoropyridine-2-carbonitrile (120 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution, and the title compound (270 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 341.1 [M+H]+

[0141] [Step 2] Production      of      5-{3-[4-(2-fluorophenyl)piperazin-1- yl]propoxy}-N'-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (480 mg) and dimethyl sulfoxide (5 mL), KOtBu (712 mg) was added sequentially at room temperature, and the mixture was stirred for 10 minutes. 5-{3-[4-(2-Fluorophenyl)piperazin-1-yl]propoxy}pyridine-2-carbonitrile (270 mg) was added, and the mixture was stirred at room temperature for 4 hours. Water was added to the reaction solution, and the title compound (160 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 374.2 [M+H]+

[0142] [Step 3] Production     of     3-(5-{3-[4-(2-fluorophenyl)piperazin-1- yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}-N'-hydroxypyridine-2-carboximidamide    (160 mg), tetrahydrofuran (5 mL), and DBU (0.096 mL), CDI (104 mg) was added at room temperature, and the mixture was stirred for 5 hours. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (75 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 400.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.39 (d, 1H), 7.88 (d, 1H), 7.57 (dd, 1H), 7.15-6.92 (m, 4H), 4.20 (t, 2H), 3.05-2.98 (m, 4H), 2.60-2.56 (m, 4H), 2.55-2.48 (m, 2H), 1.99-1.92 (m, 2H)

[0143] Example 22 3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of    5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridine-2- carbonitrile By a method in accordance with Step 1 of Example 1, using 2-(4-phenylpiperazin-1-yl)ethan-1-ol (50 mg) instead of (1-ethylpiperidin-4-yl)methanol, the title compound (62 mg) was obtained. MS (m / z): 309.2 [M+H]+

[0144] [Step 2] Production of 3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridine-2-carbonitrile (62 mg) obtained in Step 1 of Example 22 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (45 mg) was obtained. MS (m / z): 368.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.43 (d, 1H), 7.91 (d 1H), 7.61 (dd, 1H), 7.23-7.16 (m, 2H), 6.96-6.91 (m, 2H), 6.78-6.74 (m, 1H), 4.31 (t, 2H), 4.20-4.00 (br, 1H), 3.16-3.12 (m, 4H), 2.80 (t, 2H), 2.68-2.92 (m, 4H)

[0145] Example 23  3-{5-[3-(piperidm-1-yl)propoxy]pyrimidm-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate [Step 1] Production of 5-[3-(piperidin-1-yl)propoxy]pyrimidine-2-carbonitrile To a mixture of 3-(piperidin-1-yl)propan-1-ol (175 mg) and N,N-dimethylformamide (1.6 mL), sodium hydride (60%, dispersed in liquid paraffin, 49 mg) was added under ice cooling, and the mixture was stirred for 15 minutes. 5-Fluoropyrimidine-2-carbonitrile (100 mg) was added, and the mixture was stirred under ice cooling for 2 hours. Water was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel column chromatography to obtain the title compound (69 mg). MS (m / z): 247.1 [M+H]+

[0146] [Step 2]     Production of  N-hydroxy-5-[3-(piperidin-1- yl)propoxy]pyrimidine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (97 mg) and ethanol (1.4 mL), a 2 M aqueous sodium hydroxide solution (0.7 mL) was added, and the mixture was stirred at room temperature for 10 minutes. 5-[3-(Piperidin-1-yl)propoxy]pyrimidine-2-carbonitrile (69 mg) was added to the reaction solution, and the mixture was stirred for 4 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (58 mg). MS (m / z): 280.1 [M+H]+

[0147] [Step 3]         Production of 3-{5-[3-(piperidin-1- yl)propoxy]pyrimidin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one      4- methylbenzene-1-sulfonate To     a    mixture     of N-hydroxy-5-[3-(piperidin-1- yl)propoxy]pyrimidine-2-carboximidamide (58 mg), tetrahydrofuran (1 mL), and DBU (0.046 mL), CDI (51 mg) was added at room temperature, and the mixture was stirred for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (316 mg) was added dropwise to the reaction solution to make it acidic. The title compound (39 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 306.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.64 (s, 2H), 7.69 (d, 2H), 7.22 (d, 2H), 4.35 (t, 2H), 3.80-3.50 (m, 2H), 3.40-3.26 (m, 2H), 3.10-2.80 (m, 2H), 2.42-2.26 (m, 5H), 2.10-1.40 (m, 6H)

[0148] Example 24  3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 6-[3-(piperidin-1-yl)propoxy]pyridazine-3-carbonitrile To a mixture of 3-(piperidin-1-yl)propan-1-ol (770 mg) and N,N-dimethylformamide (5 mL), sodium hydride (60%, dispersed in liquid paraffin, 215 mg) was added, and the mixture was stirred at room temperature for 30 minutes. 6-Chloropyridazine-3-carbonitrile (500 mg) was added, and the mixture was stirred at room temperature overnight. Water was added to the reaction solution under ice cooling, and the title compound (300 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 247.2 [M+H]+

[0149] [Step 2]     Production of N-hydroxy-6-[3-(piperidin-1- yl)propoxy]pyridazine-3-carboximidamide To a mixture of hydroxylamine hydrochloride (510 mg) and ethanol (5 mL), a 2 M aqueous sodium hydroxide solution (3.04 mL) was added, and the mixture was stirred at room temperature for 30 minutes. 6-[3-(Piperidin-1-yl)propoxy]pyridazine-3-carbonitrile (300 mg) was added to the reaction solution, and the mixture was stirred overnight. Water was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (227 mg). MS (m / z): 280.2 [M+H]+

[0150] [Step 3]         Production of    3-{6-[3-(piperidin-1- yl)propoxy]pyridazin-3-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To     a    mixture     of    N-hydroxy-6-[3-(piperidin-1- yl)propoxy]pyridazine-3-carboximidamide (227 mg), tetrahydrofuran (5 mL), and DBU (0.182 mL), CDI (198 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (125 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 306.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.13 (d, 1H), 7.43 (d, 1H), 4.62 (t, 2H), 3.58-3.25 (m, 4H), 3.20 (t, 2H), 2.32-2.22 (m, 2H), 1.86-1.25 (m, 6H) Elemental analysis value (as C14H19N5O3^HCb0.1H2O) Calculated (%) C: 48.94, H: 5.93, N: 20.38 Found (%) C: 48.84, H: 6.08, N: 20.39

[0151] Example 25 3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step        1]                Production        of       5-({3-[(tert- butyldimethylsilyl)oxy]propyl}sulfanyl)pyridine-2-carbonitrile To a mixture of 3-sulfanylpropan-1-ol (1  g), N,N- dimethylformamide (5 mL), and sodium carbonate (2.3 g), 5- fluoropyridine-2-carbonitrile (1.5 g) was added, and the mixture was heated and stirred at 50 °C for 3 hours. The reaction solution was returned to room temperature, imidazole (2.24 g) and tert butyl(chloro)dimethylsilane (2.13 g) were added, and the mixture was stirred overnight. The title compound (800 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 309.2 [M+H]+

[0152] [Step     2]           Production     of     3-[5-({3-[(tert- butyldimethylsilyl)oxy]propyl}sulfanyl)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one By a method in accordance with Step 2 and Step 3 of Example 7, using 5-({3-[(tert-butyldimethylsilyl)oxy]propyl}sulfanyl)pyridine-2-carbonitrile (800 mg) obtained in Step 1 of Example 25 instead of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile, the title compound (950 mg) was obtained. MS (m / z): 368.1 [M+H]+

[0153] [Step      3]             Production      of      3-{5-[(3- hydroxypropyl)sulfanyl]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To                                                 3-[5-({3-[(tert- butyldimethylsilyl)oxy]propyl}sulfanyl)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (950 mg), a 4 M hydrogen chloride ethyl acetate solution (6.46 mL) was added, and the mixture was stirred at room temperature for 1 hour. The precipitate that had deposited was collected by filtration and dried to obtain the title compound (700 mg). MS (m / z): 252.1 [M+H]+

[0154] [Step 4] Production of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]sulfanyl}propyl       4-methylbenzene-1- sulfonate To a mixture of 3-{5-[(3-hydroxypropyl)sulfanyl]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one (200 mg) and pyridine (3 mL), 4-methylbenzene-1-sulfonyl chloride (256 mg) was added, and the mixture was stirred for 1 hour. Hexane was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (280 mg). MS (m / z): 408.2 [M+H]+

[0155] [Step 5]         Production of    3-(5-{[3-(piperidin-1- yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]sulfanyl}propyl 4-methylbenzene-1-sulfonate (80 mg), N,N-dimethylformamide (0.5 mL), and sodium iodide (88 mg), piperidine (50 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. Hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (35 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 321.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 8: 8.61 (s, 1H), 7.94-7.82 (m, 2H), 7.47 (d, 2H), 7.11 (d, 2H), 3.20-2.92 (m, 6H), 2.28 (s, 3H), 2.00-1.88 (m, 4H), 1.72-1.42 (m, 6H)

[0156] Example 26 3-(5-{[3-(pyrrolidin-1-yl)propyl]sulfanyl}pyridin- 2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]sulfanyl}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 4 of Example 25, sodium iodide (88 mg), diisopropylethylamine (0.1 mL), and N,N-dimethylformamide (0.5 mL), pyrrolidine (42 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (187 mg) was added dropwise to the reaction solution to make it acidic. The title compound (15 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 307.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.66 (d, 1H), 7.98 (dd, 1H), 7.89 (d, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 3.40-3.15 (m, 8H), 2.28 (s, 3H), 1.991.84 (m, 6H)

[0157] Example 27  3-(5-{r3-(azepan-1-yl)propyl]sulfanyl}pyridin-2- yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Example 26, using azepane (58 mg) instead of pyrrolidine, the title compound (73 mg) was obtained. MS (m / z): 335.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.47 (s, 1H), 7.72-7.64 (m, 2H), 3.15-2.95 (m, 8H), 1.95-1.85 (m, 2H), 1.75-1.45 (m, 8H)

[0158] Example 28 phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1 -carboxylate [Step 1] Production of phenyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (5 mL), and diisopropylethylamine (1.08 mL), phenyl carbonochloridate (380 mg) was added, and the mixture was stirred at room temperature for 1 hour. The title compound (400 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 324.0 [M+H]+

[0159] [Step 2] Production of phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate By a method in accordance with Step 2 and Step 3 of Example 1, using phenyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate (400 mg) obtained in Step 1 of Example 28 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (370 mg) was obtained. MS (m / z): 383.0 [M+H]+ Elemental analysis value (as C19H18N4O5) Calculated (%) C: 59.68, H: 4.75, N: 14.65 Found (%) C: 59.64, H: 4.58, N: 14.70

[0160] Example 29 ethyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridm-3-yl]oxy}piperidme-1 -carboxylate [Step 1] Production of ethyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (5 mL), and diisopropylethylamine (1.08 mL), ethyl carbonochloridate (340 mg) was added, and the mixture was stirred at room temperature for 1 hour. The title compound (400 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 276.0 [M+H]+

[0161] [Step 2] Production of ethyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate By a method in accordance with Step 2 and Step 3 of Example 1, using ethyl 4-[(6-cyanopyridin-3-yl)oxy]piperidine-1-carboxylate (400 mg) obtained in Step 1 of Example 29 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (180 mg) was obtained. MS (m / z): 335.0 [M+H]+ Elemental analysis value (as C15H18N4O5) Calculated (%) C: 53.89, H: 5.43, N: 16.76 Found (%) C: 53.81, H: 5.37, N: 16.71

[0162] Example 30 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[(1-ethylpiperidin-4-yl)oxy]pyridine-2-carbonitrile To a mixture of 1-ethylpiperidin-4-ol (206 mg) and N,N-dimethylformamide (3 mL), sodium hydride (60%, dispersed in liquid paraffin, 64 mg) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 5-Fluoropyridine-2-carbonitrile (130 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution, and the title compound (240 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 232.2 [M+H]+

[0163] [Step 2] Production of  5-[(1-ethylpiperidin-4-yl)oxy]-N'-hydroxypyridine-2- carboximidamide To a mixture of hydroxylamine hydrochloride (577 mg) and dimethyl sulfoxide (5 mL), KOtBu (931 mg) was added sequentially at room temperature, and the mixture was stirred for 10 minutes. 5-[(1-Ethylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (240 mg) was added, and the mixture was stirred at room temperature for 4 hours. Water was added to the reaction solution, and the title compound (260 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 265.1 [M+H]+

[0164] [Step 3] Production of 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of    5-[(1-ethylpiperidin-4-yl)oxy]-N'- hydroxypyridine-2-carboximidamide (260 mg), tetrahydrofuran (5 mL), and DBU (0.22 mL), CDI (239 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (160 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 291.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.44 (d, 1H), 7.91 (d, 1H), 7.65 (dd, 1H), 4.80-4.74 (m, 1H), 4.25-3.85 (m, 2H), 3.60-3.00 (m, 2H), 2.88-2.74 (m, 3H), 2.16-2.07 (m, 2H), 1.92-1.82 (m, 2H), 1.15 (t, 3H) Elemental analysis value (as Ci4Hi8N4O3’HCl) Calculated (%) C: 51.46, H: 5.86, N: 17.15 Found (%) C: 51.45, H: 6.19, N: 17.21

[0165] Example 31   3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[(1-butylpiperidin-4-yl)oxy]pyridine-2- carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), 1-bromobutane (429 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. The title compound (190 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 260.1 [M+H]+

[0166] [Step 2]       Production of 3-{5-[(1-butylpiperidin-4- yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[(1-butylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (190 mg) obtained in Step 1 of Example 31 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (220 mg) was obtained. MS (m / z): 319.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.49 (d, 1H), 7.96 (d, 1H), 7.72 (dd, 1H), 5.10-4.70 (br, 1H), 3.65-3.20 (m, 4H), 3.05 (t, 2H), 2.30-2.18 (m, 2H), 2.14-1.95 (m, 2H), 1.74-1.65 (m, 2H), 1.31 (dt, 2H), 0.92 (t, 3H) Elemental analysis value (as Ci6H22N4OyHCMH2O) Calculated (%) C: 51.54, H: 6.76, N: 15.03 Found (%) C: 51.24, H: 7.00, N: 14.97

[0167] Example 32  3-{5-r(1-pentylpiperidm-4-yl)oxy]pyridm-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-[(1-pentylpiperidin-4-yl)oxy]pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (400 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.86 mL), 1-bromopentane (504 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. The title compound (300 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 274.2 [M+H]+

[0168] [Step 2] Production of 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using 5-[(1-pentylpiperidin-4-yl)oxy]pyridine-2-carbonitrile (300 mg) obtained in Step 1 of Example 32 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (280 mg) was obtained. MS (m / z): 333.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 10.50 (br, 1H), 8.50 (d, 1H), 7.96 (d, 1H), 7.72 (dd, 1H), 5.02-4.98 (br, 1H), 4.85-4.73 (m, 1H), 3.60-3.32 (m, 4H), 3.18-2.97 (m, 4H), 2.34-1.92 (m, 2H), 1.76-1.65 (m, 2H), 1.38-1.24 (m, 4H), 0.89 (t, 3H) Elemental analysis value (as C17H24N4OyHCb0.3H2O) Calculated (%) C: 54.56, H: 6.89, N: 14.97 Found (%) C: 54.51, H: 6.97, N: 15.02

[0169] Example 33 3-(5-{[1=(cyclobutylmethyl)piperidin-42 yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1]     Production of 5-{[1-(cyclobutylmethyl)piperidin-4- yl]oxy}pyridine-2-carbonitrile To a mixture of 5-(piperidin-4-yloxy)pyridine-2-carbonitrile hydrochloride (500 mg) obtained in Step 2 of Example 15, N,N-dimethylformamide (1 mL), and diisopropylethylamine (1.08 mL), (bromomethyl)cyclobutane (466 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. The title compound (113 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 272.1 [M+H]+

[0170] [Step 2] Production of 3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 1, using         5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridine-2- carbonitrile (113 mg) obtained in Step 1 of Example 33 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (90 mg) was obtained. MS (m / z): 331.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.49 (d, 1H), 7.96 (d, 1H), 7.71 (dd, 1H), 5.10-4.70 (br, 1H), 3.62-3.20 (m, 4H), 3.14 (d, 2H), 2.86-2.72 (m, 1H), 2.30-1.55 (m, 11H) Elemental analysis value (as C17H22N4OyHCb0.5H2O) Calculated (%) C: 54.33, H: 6.44, N: 14.91 Found (%) C: 53.99, H: 6.45, N: 14.90

[0171] Example 34 3-(5-{[1=(propan-2-yl)piperidin-4= yl]methoxy}pyridin-2-yl)-4J5-dihydro-1J2J4-oxadiazol-5-one [Step 1]       Production of 5-{[1-(propan-2-yl)piperidin-4- yl]methoxy}pyridine-2-carbonitrile To a mixture of [1-(propan-2-yl)piperidin-4-yl]methanol (386 mg) and N,N-dimethylformamide (3 mL), sodium hydride (60%, dispersed in liquid paraffin, 98 mg) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 5-Fluoropyridine-2-carbonitrile (200 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution, and the title compound (300 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 260.1 [M+H]+

[0172] [Step 2]     Production of N'-hydroxy-5-{[1-(propan-2- yl)piperidin-4-yl]methoxy}pyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (460 mg) and dimethyl sulfoxide (5 mL), KOtBu (649 mg) was added sequentially at room temperature, and the mixture was stirred for 10 minutes. 5-{[1-(Propan-2-yl)piperidin-4-yl]methoxy}pyridine-2-carbonitrile (300 mg) was added, and the mixture was stirred at room temperature for 4 hours. Water was added to the reaction solution, and the title compound (280 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 293.2 [M+H]+

[0173] [Step 3] Production of 3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of N'-hydroxy-5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridine-2-carboximidamide (280 mg), tetrahydrofuran (5 mL), and DBU (0.172 mL), CDI (202 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (250 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.33 (d, 1H), 7.82 (d, 1H), 7.49 (dd, 1H), 4.15-4.00 (br, 1H), 4.00 (d, 2H), 3.30-3.00 (m, 4H), 2.70-2.55 (m, 2H), 2.00-1.85 (m, 3H), 1.51-1.41 (m, 2H), 1.12 (d, 6H) Elemental analysis value (as Ci6H22N4Oy0.3H2O) Calculated (%) C: 59.35, H: 7.04, N: 17.30 Found (%) C: 59.11, H: 7.10, N: 17.27

[0174] Example 35  3-{5-|~(1-butylpiperidm-4-yl)methoxy]pyridin-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.37 mL), 1-bromobutane (0.138 mL) was added sequentially at room temperature, and the mixture was heated and stirred at 80 °C for 4 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (13 mg). MS (m / z): 333.1 [M+H]+

[0175] Example 36 3-(5-{£1=(cyclopropylmethyl)piperidin=4= yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14 and N,N-dimethylformamide (1 mL), (bromomethyl)cyclopropane (290 mg), tetrabutylammonium iodide (232 mg), and a 10 M aqueous sodium hydroxide solution (0.13 mL) were added, and the mixture was heated and stirred at 80 °C for 3 hours. Hydrochloric acid was added dropwise to make it acidic. The title compound (30 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 331.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.40 (d, 1H), 7.89 (d, 1H), 7.57 (dd, 1H), 4.04 (d, 2H), 3.45 (d, 1H), 2.85-2.75 (m, 3H), 2.10-1.85 (m, 3H), 1.65 (dd, 2H), 1.25 (dd, 2H), 1.10-1.00 (m, 1H), 0.64-0.55 (m, 2H), 0.350.27 (m, 2H)

[0176] Example 37 3-{5-[(1-benzylpiperidin-4-yl)methoxy]pyridin-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (30 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.43 mL), water (0.43 mL), and diisopropylethylamine (0.074 mL), bromomethylbenzene (15 mg) was added, and the mixture was stirred at room temperature for 2 hours. The title compound (7 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 367.3 [M+H]+

[0177] Example 38    3-[5-({1-[(2-ethylphenyl)methyl]piperidin-4- yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.372 mL), 1-(bromomethyl)-2-ethylbenzene (90 mg) was added, and the mixture was stirred at room temperature overnight. The title compound (67 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 395.1 [M+H]+

[0178] Example 39 3-{5-[(1-{[2- (trifluoromethyl)phenyl]methyl}piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.372 mL), 1-(bromomethyl)-2-(trifluoromethyl)benzene (108 mg) was added, and the mixture was stirred at room temperature overnight. The title compound (102 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 435.0 [M+H]+

[0179] Example 40    3-[5-({1-[(3-fluorophenyl)methyl]piperidin-4- yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (2.15 mL), water (2.15 mL), and diisopropylethylamine (0.37 mL), 1-(bromomethyl)-3-fluorobenzene (85 mg) was added, and the mixture was stirred at room temperature for 2 hours. The title compound (22 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 385.0 [M+H]+

[0180] Example 41 3-[5-({1-[(3-bromophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (120 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (1.72 mL), water (1.72 mL), and diisopropylethylamine (0.30 mL), 1-bromo-3-(bromomethyl)benzene (90 mg) was added, and the mixture was stirred at room temperature for 2 hours. The title compound (24 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 445.2 [M+H]+

[0181] Example 42  3-{5-[(1-acetylpiperidin-4-yl)methoxy]pyridin-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (1 mL), acetic acid (25 mg), and diisopropylethylamine (0.27 mL), HATU (146 mg) was added, and the mixture was stirred at room temperature for 45 minutes. The title compound (59 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.2 [M+H]+

[0182] Example 43 3-{5-£(1-propanoylpiperidin-42 yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (150 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (1 mL), propionic acid (46 mg), and diisopropylethylamine (0.40 mL), HATU (219 mg) was added, and the mixture was stirred at room temperature for 45 minutes. The title compound (99 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 333.2 [M+H]+

[0183] Example 44 methyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3 -yl)pyridin-3-yl]oxy}methyl)piperidine-1 -carboxylate To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.57 mL), and diisopropylethylamine (0.24 mL), methyl carbonochloridate (0.022 mL) was added, and the mixture was stirred at room temperature for 1 hour. Hydrochloric acid was added, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (61 mg). MS (m / z): 335.2 [M+H]+ Elemental analysis value (as C15H18N4O5) Calculated (%) C: 53.89, H: 5.43, N: 16.76 Found (%) C: 53.88, H: 5.38, N: 16.82

[0184] Example 45 propan-2-yl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate To a mixture of 3-{5-[(piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Step 4 of Example 14, N,N-dimethylformamide (0.57 mL), and diisopropylethylamine (0.24 mL), propan-2-yl carbonochloridate (0.039 mL) was added sequentially at room temperature, and the mixture was stirred for 15 minutes. 2 M hydrochloric acid was added, the mixture was diluted with water, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (69 mg). MS (m / z): 363.3 [M+H]+ Elemental analysis value (as C17H22N4O5) Calculated (%) C: 56.35, H: 6.12, N: 15.46 Found (%) C: 56.13, H: 6.28, N: 15.31

[0185] Example 46     methyl  4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4- oxadiazol-3-yl)pyridm-3-yl]oxy}ethyl)piperazme-1-carboxylate [Step 1]      Production of methyl 4-{2-[(6-cyanopyridin-3- yl)oxy]ethyl}piperazine-1-carboxylate To a mixture of 5-[2-(piperazin-1-yl)ethoxy]pyridine-2-carbonitrile dihydrochloride (220 mg) obtained in Step 2 of Example 6, dichloromethane (2.4 mL), and diisopropylethylamine (0.62 mL), methyl carbonochloridate (0.067 mL) was added, and the mixture was stirred for 2 hours. Saturated aqueous sodium hydrogen carbonate solution was added to the reaction solution, and the title compound (194 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 291.2 [M+H]+

[0186] [Step 2] Production of methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate By a method in accordance with Step 2 and Step 3 of Example 1, using methyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (194 mg) obtained in Step 1 of Example 46 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (128 mg) was obtained. MS (m / z): 350.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.45 (d, 1H), 7.93 (d, 1H), 7.63 (dd, 1H), 4.28 (t, 2H), 3.58 (s, 3H), 3.40-3.25 (m, 8H), 2.79 (t, 2H) Elemental analysis value (as C15H19N5O5^ 1H2O) Calculated (%) C: 49.04, H: 5.76, N: 19.06 Found (%) C: 49.45, H: 5.64, N: 19.30

[0187] Example 47 ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate [Step 1] Production of tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate By a method in accordance with Step 2 and Step 3 of Example 1, using tert-butyl 4-{2-[(6-cyanopyridin-3-yl)oxy]ethyl}piperazine-1-carboxylate (3.73 g) obtained in Step 1 of Example 6 instead of 5-[(1-ethylpiperidin-4-yl)methoxy]pyridine-2-carbonitrile, the title compound (3.3 g) was obtained. MS (m / z): 392.1 [M+H]+

[0188] [Step 2] Production of 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (3.3 g), methanol (40 mL), THF (11 mL), and a 4 M hydrogen chloride dioxane solution (22 mL) were added sequentially at room temperature, and the mixture was stirred overnight. The solvent was distilled off under reduced pressure to obtain the title compound (2.95 g). MS (m / z): 292.2 [M+H]+

[0189] [Step 3] Production of ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate To a mixture of 3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (100 mg), N,N-dimethylformamide (0.55 mL), and diisopropylethylamine (0.24 mL), ethyl carbonochloridate (0.026 mL) was added dropwise under ice cooling, and the mixture was stirred at room temperature for 1 hour. Hydrochloric acid was added dropwise to make it acidic. The title compound (64 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 364.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) S: 8.40 (d, 1H), 7.95 (d, 1H), 7.53 (dd, 1H), 4.30 (t, 2H), 4.12 (q, 2H), 3.58-3.45 (m, 4H), 2.90 (t, 2H), 2.652.55 (m, 4H), 1.25 (t, 3H) Elemental analysis value (as C16H21N5O5) Calculated (%) C: 52.89, H: 5.83, N: 19.27 Found (%) C: 52.85, H: 5.89, N: 19.30

[0190] Example 48     propyl  4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4- oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazme-1 -carboxylate By a method in accordance with Step 3 of Example 47, using propyl carbonochloridate (0.031 mL) instead of ethyl carbonochloridate, the title compound (84 mg) was obtained. MS (m / z): 378.2 [M+H]+

[0191] Example 49 propan-2-yl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1 -carboxylate By a method in accordance with Step 3 of Example 47, using propan-2-yl carbonochloridate (0.038 mL) instead of ethyl carbonochloridate, the title compound (61 mg) was obtained. MS (m / z): 378.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) S: 8.40 (d, 1H), 7.95 (d, 1H), 7.53 (dd, 1H), 4.90-4.80 (m, 1H), 4.30 (t, 2H), 3.55-3.45 (m, 4H), 3.35-3.26 (m, 1H), 2.90 (t, 2H), 2.65-2.55 (m, 4H), 1.24 (d, 6H) Elemental analysis value (as C17H23N5O5) Calculated (%) C: 54.10, H: 6.14, N: 18.56 Found (%) C: 53.70, H: 6.13, N: 18.47

[0192] Example 50     benzyl  4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4- oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1 -carboxylate By a method in accordance with Step 3 of Example 47, using benzyl carbonochloridate (0.039 mL) instead of ethyl carbonochloridate, the title compound (44 mg) was obtained. MS (m / z): 426.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.44 (d, 1H), 7.92 (d, 1H), 7.62 (dd, 1H), 7.40-7.28 (m, 5H), 5.07 (s, 2H), 4.27 (t, 2H), 3.45-3.33 (m, 4H), 2.78 (t, 2H), 2.55-2.45 (m, 4H) Elemental analysis value (as C21H23N5O5^0.5H2O) Calculated (%) C: 58.06, H: 5.57, N: 16.12 Found (%) C: 57.88, H: 5.49, N: 15.86

[0193] Example 51  3-{5-|~3-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of hydroxylamine hydrochloride (4.43 g) and ethanol (50 mL), a 2 M aqueous sodium hydroxide solution (28.4 mL) was added, and the mixture was stirred at room temperature for 10 minutes. 5-Fluoropyridine-2-carbonitrile (4.95 g) was added to the reaction solution, and the mixture was stirred at room temperature overnight. Water was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain a crude product (6.2 g). To this crude product, tetrahydrofuran (50 mL), DBU (8.9 mL), and CDI (9.7 g) were added at room temperature, and the mixture was stirred for 5 hours. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The precipitate that had deposited was collected by filtration and dried to obtain the title compound (6.3 g). MS (m / z): 182.1 [M+H]+

[0194] [Step 2] Production of 3-[5-(3-hydroxypropoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (7  g), propane-1,3-diol (8.82  g), and 1- methylpyrrolidin-2-one (70 mL), KOtBu (8.67 g) was added, and the mixture was heated and stirred at 60 °C for 3 hours. Hydrochloric acid was added to the reaction solution under ice cooling to neutralize it, and the title compound (3.5 g) was obtained by purification by silica gel column chromatography. MS (m / z): 238.1 [M+H]+

[0195] [Step 3] Production of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate To a mixture of 3-[5-(3-hydroxypropoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one (3.0  g), pyridine (3.07 mL), and dichloromethane (100 mL), 4-methylbenzenesulfonyl 4-methylbenzene-1-sulfonate (6.19 g) was added under ice cooling, and the mixture was stirred at room temperature for 3 hours. Saturated aqueous ammonium chloride solution was added to the reaction solution under ice cooling, and the mixture was diluted with ethyl acetate, washed with water and saturated brine, and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel column chromatography to obtain the title compound (1.9 g). MS (m / z): 392.1 [M+H]+

[0196] [Step 4] Production of 3-{5-[4-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) and N,N-dimethylformamide (1 mL), azepane (61 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. Hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (35 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.32 (d, 1H), 7.79 (d, 1H), 7.46 (dd, 1H), 4.15 (t, 2H), 3.00-2.88 (m, 4H), 2.04-1.94 (m, 2H), 1.75-1.52 (m, 10H)

[0197] Example 52   3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate [Step 1] Production of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 51, using ethane-1,2-diol (3.4 g) instead of propane-1,3-diol, the title compound (1.02 g) was obtained. MS (m / z): 378.3 [M+H]+

[0198] [Step 2] Production of 3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (30 mg), N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.041 mL), azepane (16 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (121 mg) was added dropwise to the reaction solution to make it acidic. The title compound (27 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 305.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.44 (br, 1H), 7.92 (br, 1H), 7.68 (d 2H), 7.54 (d, 1H), 7.21 (d, 2H), 4.51 (t, 2H), 3.68 (t, 2H), 3.50-3.45 (m, 4H), 2.35 (s, 3H), 1.98-1.91 (m, 4H), 1.77-1.72 (m, 4H)

[0199] Example 53 3-{5-[2-(4-methoxypiperidm-1-yl)ethoxy]pyridm- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (45 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.062 mL), and N,N-dimethylformamide (0.5 mL), 4-methoxypiperidine (41 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (181 mg) was added dropwise to make it neutral. The title compound (10 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 321.1 [M+H]+

[0200] Example 54 3-{5-[2-(3-methoxypiperidin-1-yl)ethoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 52, N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.069 mL), 3-methoxypiperidine (31 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. Hydrochloric acid was added to the reaction solution to make it neutral. The title compound (6 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 321.1 [M+H]+ [0201 ] Example 55 3-[5-(2-{7-azaspiro[4.5]decan-7- yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.069 mL), and N,N-dimethylformamide (0.2 mL), 7-azaspiro[4.5]decane (37 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (101 mg) was added dropwise to make it neutral. The title compound (23 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 345.1 [M+H]+

[0202] Example 56 3-[5-(2-{9-oxa-2-azaspiro[5.5]undecan-2- yl}ethoxy)pyridin-2-yl]-4J5-dihydro-1J2J4-oxadiazol-52one To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (45 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.062 mL), and N,N-dimethylformamide (0.5 mL), 9-oxa-2-azaspiro[5.5]undecane (56 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (181 mg) was added dropwise to make it neutral. The title compound (12 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 361.2 [M+H]+

[0203] Example 57 tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate To a mixture of 2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl 4-methylbenzene-1-sulfonate (200 mg) obtained in Step 1 of Example 52, diisopropylethylamine (0.275 mL), and N,N-dimethylformamide (5.3 mL), tert-butyl piperazine-1-carboxylate (197 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. The mixture was allowed to cool to room temperature, and acetic acid (0.46 mL) was added dropwise to make it neutral. The title compound (25 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 390.2 [M-H]-

[0204] Example 58  3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of tert-butyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate (19 mg) obtained in Example 57 and tetrahydrofuran (0.5 mL), a 4 M hydrochloric acid dioxane solution (0.24 mL) was added, and the mixture was stirred overnight. After concentration, 4 M hydrochloric acid (1.15 mL) was added dropwise to the reaction solution, and the mixture was stirred overnight. 12 M hydrochloric acid (0.15 mL) was added dropwise to the reaction solution, and the mixture was stirred for 8 hours. The reaction solution was concentrated, and the obtained residue was washed with diethyl ether and then dried to obtain the title compound (4 mg). MS (m / z): 292.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 8: 8.52 (d, 1H), 8.01 (d, 1H), 7.64 (dd, 1H), 4.62 (t, 2H), 3.86-3.60 (m, 10H)

[0205] Example 59 3-{5-|~2-hydroxy-3-(piperidin-1 - yl)propoxy]pyridin-2-yl}-4,5j:dihydro21,2,4-oxadiazol-5-one hydrochloride [Step 1]        Production of 5-[2-hydroxy-3-(piperidin-1- yl)propoxy]pyridine-2-carbonitrile To a mixture of 5-hydroxypyridine-2-carbonitrile (100 mg), 2-(chloromethyl)oxirane (154 mg), and acetonitrile (1.5 mL), potassium carbonate (345 mg) was added sequentially at room temperature, and the mixture was heated and stirred at 70 °C for 5 hours. The insoluble matter was filtered off and concentrated. Water (1 mL) and piperidine (212 mg) were added, and the mixture was stirred at room temperature for 3 hours. The title compound (90 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 262.3 [M+H]+

[0206] [Step 2] Production of 3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 7, using 5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile (74 mg) obtained in Step 1 of Example 59 instead of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile, the title compound (25 mg) was obtained. MS (m / z): 321.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.35 (d, 1H), 7.83 (d, 1H), 7.52 (dd, 1H), 4.16-3.97 (m, 3H), 2.60-2.40 (m, 6H), 1.70-1.35 (m, 6H)

[0207] Example 60 3-{5-[3-(4-hydroxypiperidm-1-yl)propoxy]pyridm-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1] Production of 5-(3-hydroxypropoxy)pyridine-2-carbonitrile To a mixture of propane-1,3-diol (5.6 g) and N,N-dimethylformamide (5 mL), sodium hydride (60%, dispersed in liquid paraffin, 983 mg) was added, and the mixture was stirred at room temperature for 15 minutes. 5-Fluoropyridine-2-carbonitrile (3 g) was added, and the mixture was stirred overnight. Water was added to the reaction solution under ice cooling, and the title compound (1.8 g) was obtained by purification by silica gel column chromatography. MS (m / z): 179.2 [M+H]+

[0208] [Step 2] Production of 3-[(6-cyanopyridin-3-yl)oxy]propyl 4-methylbenzene-1-sulfonate To a mixture of 5-(3-hydroxypropoxy)pyridine-2-carbonitrile (400 mg) and pyridine (1 mL), 4-methylbenzene-1-sulfonyl chloride (642 mg) was added, and the mixture was stirred at room temperature for 1 hour. Hexane was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (690 mg). MS (m / z): 333.2 [M+H]+

[0209] [Step 3]      Production of   5-[3-(4-hydroxypiperidin-1- yl)propoxy]pyridine-2-carbonitrile To a mixture of 3-[(6-cyanopyridin-3-yl)oxy]propyl 4-methylbenzene-1-sulfonate (186 mg), N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.291 mL), piperidin-4-ol (170 mg) was added, and the mixture was heated and stirred at 80 °C for 2 hours. The title compound (98 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 262.3 (M+H)+

[0210] [Step 4] Production of 3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 2 and Step 3 of Example 7, using 5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridine-2-carbonitrile (98 mg) obtained in Step 3 of Example 60 instead of 5-[3-(piperidin-1-yl)propoxy]pyridine-2-carbonitrile, the title compound (25 mg) was obtained. MS (m / z): 321.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 8: 8.34 (d, 1H), 7.84 (d, 1H), 7.50 (dd, 1H), 4.69 (br, 1H), 4.17 (t, 2H), 3.60-3.45 (m, 1H), 2.98-2.86 (m, 2H), 2.72-2.62 (m, 2H), 2.35-2.45 (m, 2H), 2.20-1.85 (m, 2H), 1.84-1.54 (m, 2H), 1.54-1.50 (m, 2H) [0211 ] Example6U215-[3-(3-hydroxypiperidin-1-yl)propoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Example 60, using piperidin-3-ol (170 mg) instead of piperidin-4-ol, the title compound (15 mg) was obtained. MS (m / z): 321.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 9.59 (br, 1H), 8.38 (d, 1H), 7.88 (d, 1H), 7.55 (dd, 1H), 4.76 (br, 1H), 4.17 (t, 2H), 3.60-3.40 (m, 2H), 2.952.88 (m, 1H), 2.80-2.72 (m, 1H), 2.70-2.55 (m, 2H), 2.00-1.88 (m, 2H), 1.80-1.38 (m, 4H)

[0212] Example 62   3-{5-[3-(morpholin-4-yl)propoxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Example 60, using morpholine (380 mg) instead of piperidin-4-ol, the title compound (35 mg) was obtained. MS (m / z): 307.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.42 (d, 1H), 7.92 (d, 1H), 7.59 (dd, 1H), 4.19 (t, 2H), 3.62-3.56 (m, 4H), 2.47 (t, 2H), 2.43-2.36 (m, 4H), 1.93 (dt, 2H) Elemental analysis value (as C14H18N4OyHCl) Calculated (%) C: 49.06, H: 5.59, N: 16.35 Found (%) C: 49.38, H: 5.76, N: 16.55

[0213] Example    63 32{5-[3-(L2J3J6delTahydro^ yl)propoxy]pyridin-2-yl}-4,52dihydro-1J2J4-oxadiazol=52one hydrochloride By a method in accordance with Example 60, using 1,2,3,6-tetrahydropyridine (140 mg) instead of piperidin-4-ol, the title compound (55 mg) was obtained. MS (m / z): 303.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.39 (d, 1H), 7.88 (d, 1H), 7.56 (dd, 1H), 5.77-5.64 (m, 2H), 4.19 (t, 2H), 3.07-3.02 (m, 2H), 2.69-2.58 (m, 4H), 2.16-2.09 (m, 2H), 2.03-1.93 (m, 2H)

[0214] Example 64 3- [5-(3-{1,4-dioxa- 8-azaspiro [4.5]decan-8- yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Example 60, using 1,4-dioxa-8-azaspiro[4.5]decane (600 mg) instead of piperidin-4-ol, the title compound (13 mg) was obtained. MS (m / z): 363.3 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.33 (br, 1H), 7.85 (br, 1H), 7.45 (br, 1H), 4.25-4.14 (m, 2H), 4.00-3.94 (m, 4H), 3.25-2.85 (m, 6H), 2.30-2.08 (m, 2H), 1.90-1.80 (m, 4H)

[0215] Example 65   1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3- yl)pyridin-3 -yl]oxy }propyl)piperidin-4-one 4-methylbenzene-1 - sulfonate To a mixture of 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride (100 mg) obtained in Example 64 and water (5 mL), 4-methylbenzene-1-sulfonic acid hydrate (95 mg) was added, and the mixture was stirred at room temperature overnight. The residue obtained by concentration was purified by silica gel column chromatography to obtain the title compound (70 mg). MS (m / z): 319.0 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 8: 8.39 (br, 1H), 7.93 (d, 1H), 7.69 (d, 2H), 7.51 (d, 1H), 7.23 (d, 2H), 4.95-4.85 (m, 2H), 4.24 (t, 2H), 3.443.20 (m, 6H), 2.36 (s, 3H), 2.34-2.22 (m, 2H), 2.10-1.92 (m, 2H)

[0216] Example 66 3-{5-[3-(3-fluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (100 mg) obtained in Step 3 of Example 51, potassium carbonate (177 mg), and N,N-dimethylformamide (1 mL), 3-fluoropiperidine hydrochloride (107 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (243 mg) was added dropwise to the reaction solution to make it neutral. The title compound (29 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 323.0 [M+H]+

[0217] Example 67 3-{5-[3-(4-methylpiperidin-1-yl)propoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and sodium iodide (92 mg), 4-methylpiperidine (61 mg) was added, and the mixture was heated and stirred at 80 °C overnight. 2 M hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (12 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.34 (d, 1H), 7.84 (d, 1H), 7.51 (dd, 2H), 7.19-7.02 (m, 3H), 4.16 (t, 2H), 3.03 (d, 2H), 2.66 (t, 2H), 2.21 (t, 2H), 2.02-1.92 (m, 2H), 1.64 (d, 2H), 1.48-1.34 (m, 1H), 1.27-1.13 (m, 2H), 0.89 (d, 3H)

[0218] Example 68 3-{5-I3-(4-methoxypiperidin-1- yl)propoxy]pyridin=2-yl}-4,5-dihydro21,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and sodium iodide (92 mg), 4-methoxypiperidine (71 mg) was added, and the mixture was heated and stirred at 80 °C overnight. 2 M hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (12 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 335.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.35 (d, 1H), 7.85 (d, 1H), 7.52 (dd, 1H), 4.16 (t, 2H), 3.22 (s, 3H), 2.85-2.75 (m, 2H), 2.58 (t, 2H), 2.29 (t, 2H), 1.98-1.80 (m, 5H), 1.54-1.44 (m, 2H)

[0219] Example 69_______3-(5-13-I(trans)3,4-dihydroxypiperidin-1- yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one_ hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (15 mg) obtained in Step 3 of Example 51, sodium iodide (11 mg), and N,N-dimethylformamide (0.3 mL), trans-piperidine-3,4-diol (9 mg) was added, and the mixture was heated and stirred at 100 °C for 1 hour. Hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (10 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 337.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.34 (br, 1H), 7.85 (d, 1H), 7.52 (dd, 1H), 4.85-4.65 (m, 2H), 4.15 (t, 2H), 2.50-2.40 (m, 1H), 2.90-2.75 (m, 2H), 2.08-1.70 (m, 6H), 1.44-1.32 (m, 1H)

[0220] Example 70 3-{5-[3-(4,4-difluoropiperidin21- yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51 and N,N-dimethylformamide (1 mL), 4,4-difluoropiperidine (74 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. Hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (25 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 341.0 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.32 (d, 1H), 7.82 (d, 1H), 7.49 (dd, 1H), 4.14 (t, 2H), 2.50-2.42 (m, 6H), 2.00-1.84 (m, 6H) [0221 ] Example 71 3-{5-[3-(42fluoro-4-methylpiperidin2L- yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4- methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (47 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and potassium carbonate (50 mg), 4-fluoro-4-methylpiperidine hydrochloride (56 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added dropwise to the reaction solution to make it acidic. The title compound (14 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 337.3 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.44 (s, 1H), 7.97 (d, 1H), 7.62 (d, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.24 (t, 2H), 3.25-2.94 (m, 6H), 2.29 (s, 3H), 2.20-1.75 (m, 6H), 1.40 (d, 3H)

[0222] Example 72 3-{5-[3-(4-acetvlpiperazin-1-vl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1.3 mL), and diisopropylethylamine (0.066 mL), 1-(piperazin-1-yl)ethan-1-one (33 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (194 mg) was added dropwise to the reaction solution at room temperature to make it acidic. The title compound (9 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 348.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.40 (d, 1H), 7.97 (d, 1H), 7.70 (d, 2H), 7.53 (dd, 1H), 7.23 (d, 2H), 4.27 (t, 2H), 4.00-3.65 (m, 2H), 3.423.18 (m, 8H), 2.36 (s, 3H), 2.34-2.23 (m, 2H), 2.15 (s, 3H)

[0223] Example 73     methyl  4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4- oxadiazol-3 -yl)pyridin-3-yl]oxy}propyl)piperazine-1 -carboxylate [Step 1] Production of tert-butyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1.3 mL), and diisopropylethylamine (0.066 mL), tert-butyl piperazine-1-carboxylate (48 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. 2 M hydrochloric acid was added dropwise to the reaction solution at room temperature to make it acidic. The title compound (10 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 406.2 [M+H]+

[0224] [Step 2] Production of 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of tert-butyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate (10 mg) and tetrahydrofuran (1 mL), a 4 M hydrogen chloride dioxane solution (0.031 mL) was added at room temperature, and the mixture was stirred for 15 hours. A 4 M hydrogen chloride dioxane solution (0.031 mL) and methanol (0.5 mL) were added, and the mixture was heated and stirred at 50 °C for 3 hours. A 4 M hydrogen chloride dioxane solution (0.031 mL) was added, and the mixture was heated and stirred at 50 °C for 2 hours. The solvent was distilled off under reduced pressure, and the precipitate that had deposited was washed with diethyl ether and dried to obtain the title compound (10 mg). MS (m / z): 306.1 [M+H]+

[0225] [Step 3] Production of methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate To a mixture of 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (9 mg), N,N-dimethylformamide (0.48 mL), and diisopropylethylamine (0.02 mL), methyl carbonochloridate (0.0018 mL) was added sequentially at room temperature, and the mixture was stirred for 1 hour. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (36 mg) was added dropwise to the reaction solution to make it acidic. The title compound (3 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 364.3 [M+H]+

[0226] Example 74 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (300 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (7.7 mL), and diisopropylethylamine (0.40 mL), tert-butyl piperazine-1-carboxylate (286 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. Acetic acid (0.66 mL) was added dropwise to the reaction solution to make it neutral. A crude product was obtained by purification by silica gel column chromatography. This crude product was dissolved in tetrahydrofuran (0.94 mL), a 4 M hydrochloric acid dioxane solution (0.59 mL) was added, and the mixture was stirred at room temperature overnight. The reaction solution was concentrated, and the obtained residue was washed with diethyl ether. The title compound (29 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 306.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.23 (d, 2H), 4.22 (t, 2H), 3.25-3.18 (m, 4H), 2.852.60 (m, 6H), 2.36 (s, 3H), 2.10-2.00 (m, 2H)

[0227] Example 75 3-{5-[3-(4-benzylpiperazin-1-yl)propoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate (24 mg) obtained in Example 74, N,N-dimethylformamide (0.25 mL), water (0.25 mL), and diisopropylethylamine (0.043 mL), bromomethylbenzene (9 mg) was added, and the mixture was stirred at room temperature for 3 hours. The mixture was purified by silica gel column chromatography. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (1.6 mg) was added and concentrated to obtain the title compound (9 mg). MS (m / z): 396.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.37 (d, 1H), 7.93 (d, 1H), 7.69 (d, 2H), 7.49 (dd, 1H), 7.45-7.32 (m, 5H), 7.21 (d, 2H), 4.22 (t, 2H), 3.86 (s, 2H), 3.25-2.75 (m, 10H), 2.35 (s, 3H), 2.23-2.14 (m, 2H)

[0228] Example     76 3-|~5-(3-{3-azabicyclo[3.1.0]hexan-3- yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.177 mL), 3-azabicyclo[3.1.0]hexane hydrochloride (73 mg) was added, and the mixture was heated and stirred at 80 °C for 5 hours. 2 M hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (30 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 303.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.37 (d, 1H), 7.88 (d, 1H), 7.54 (dd, 1H), 4.15 (t, 2H), 3.05 (d, 2H), 2.67 (t, 2H), 2.52-2.38 (m, 2H), 1.90 (dt, 2H), 1.42-1.36 (m, 2H), 0.60-0.55 (m, 1H), 0.39-0.32 (m, 1H)

[0229] Example 77 3-[5-(3- {octahydrocyclopenta[ c]pyrrol-2- yl}propoxy)pyridin=2-yl]-4,5j:dihydro21,2,4-oxadiazol-5-one hydrochloride To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and sodium iodide (92 mg), octahydrocyclopenta[c]pyrrole (68 mg) was added, and the mixture was heated and stirred at 80 °C overnight. 2 M hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (12 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 331.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.30 (d, 1H), 7.80 (d, 1H), 7.45 (dd, 1H), 4.16 (t, 2H), 3.0-2.86 (m, 2H), 2.78-2.67 (m, 2H), 2.64-2.54 (m, 2H), 2.40-2.30 (m, 2H), 1.98-1.92 (m, 2H), 1.65-1.34 (m, 6H)

[0230] Example 78 3-[5-(3-{7-azaspiro[4.5]decan-7- yl}propoxy)pyridm-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4- methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (100 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (0.2 mL), and diisopropylethylamine (0.13 mL), 7-azaspiro[4.5]decane (53 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (243 mg) was added dropwise to the reaction solution to make it acidic. The title compound (35 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 359.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.34 (d, 1H), 7.86 (d, 1H), 7.69 (d, 2H), 7.44 (dd, 1H), 7.22 (d, 2H), 4.21 (t, 2H), 3.50-2.29 (m, 6H), 2.35 (s, 3H), 2.35-2.24 (m, 2H), 1.94-1.84 (m, 2H), 1.75-1.45 (m, 10H) [0231 ] Example 79 3-[5-(3-{2-oxa-8-azaspiro[4.5]decan-8- yl}propoxy)pyndin-2-ylJ-4J5-dihydro-12J4-oxadiazol-5-one 4- methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (80 mg) obtained in Step 3 of Example 51, sodium iodide (92 mg), diisopropylethylamine (0.11 mL), and N,N-dimethylformamide (0.5 mL), 2-oxa-8-azaspiro[4.5]decane (87 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4- methylbenzene-1-sulfonic acid hydrate (194 mg) was added to the reaction solution to make it acidic. The title compound (8 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 361.3 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) S: 8.35 (d, 1H), 7.86 (d, 1H), 7.68 (dd, 2H), 7.44 (dd, 1H), 7.22 (d, 2H), 4.22 (t, 2H), 3.88 (t, 2H), 3.59 (s, 2H), 3.38-3.25 (m, 6H), 2.35 (s, 3H), 2.35-2.25 (m, 2H), 1.92-1.82 (m, 6H)

[0232] Example 80 3-[5-(3-{9-oxa=2-azaspiro£5.5Jundecan=2- yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4- methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (47 mg) obtained in Step 3 of Example 51, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.062 mL), 9-oxa-2-azaspiro[5.5]undecane (56 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added dropwise to the reaction solution to make it acidic. The title compound (22 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 375.4 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) S: 8.43 (s, 1H), 7.95 (d, 1H), 7.60 (dd, 1H), 7.49 (d, 2H), 7.09 (d, 2H), 4.25 (t, 2H), 3.35-3.15 (m, 2H), 3.653.48 (m, 6H), 2.28 (s, 3H), 2.25-2.13 (m, 2H), 1.82-1.30 (m, 10H)

[0233] Example 81   1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3- yl)pyridin-3-yl]oxy}propyl)pyridin-1 -ium 4-methylbenzene-1 -sulfonate To a mixture of 3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3- yl)pyridin-3-yl]oxy}propyl 4-methylbenzene-1-sulfonate (170 mg) obtained in Step 3 of Example 51, sodium iodide (130 mg), and N,N-dimethylformamide (0.3 mL), pyridine (0.3 mL) was added, and the mixture was heated and stirred at 100 °C for 1 hour. Hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (40 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 299.2 [M]+ 1H-NMR (400 MHz, DMSO-d6) 8: 9.15 (d, 2H), 8.63 (t, 1H), 8.17 (t, 2H), 8.06 (d, 1H), 7.74 (d, 1H), 7.48 (d, 2H), 7.32 (d, 1H), 7.11 (d, 2H), 4.82 (t, 2H), 4.21 (t, 2H), 2.48-2.42 (m, 2H), 2.29 (s, 3H)

[0234] Example 82 3-{5-[(5-methyl-1,3-oxazol-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (50 mg) obtained in Step 1 of Example 51, (5-methyl-1,3-oxazol-4-yl)methanol (62 mg), and 1-methylpyrrolidin-2-one (0.9 mL), KOtBu (62 mg) was added, and the mixture was heated and stirred at 60 °C for 2 hours and at 80 °C for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (420 mg) was added dropwise to the reaction solution at room temperature to make it acidic. The title compound (2 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 275.1 [M+H]+

[0235] Example 83 3-{5-|~(1,3-thiazol-2-yl)methoxy]pyridm-2-yl}-4,5-dihydro21J2J4-oxadiazol-5-one To a mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4- oxadiazol-5-one (50 mg) obtained in Step 1 of Example 51, (1,3-thiazol-2-yl)methanol (79 mg), and 1-methylpyrrolidin-2-one (0.9 mL), KOtBu (77 mg) was added, and the mixture was heated and stirred at 60 °C for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (420 mg) was added dropwise to the reaction solution at room temperature to make it acidic. The title compound (6 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 277.0 [M+H]+

[0236] Example 84  3-{5-[3-(pyridin-3-yl)propoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one By a method in accordance with Example 83, using 3-(pyridin-3-yl)propan-1-ol (57 mg) instead of (1,3-thiazol-2-yl)methanol, the title compound (7 mg) was obtained. MS (m / z): 299.0 [M+H]+

[0237] Example 85   1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3- yl)pyridin-3-yl]oxy}propyl)piperidin-2-one To a mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (50 mg) obtained in Step 1 of Example 51, 1-(3-hydroxypropyl)piperidin-2-one (87 mg), and 1-methylpyrrolidin-2-one (0.1 mL), KOtBu (62 mg) was added, and the mixture was heated and stirred at 60 °C for 3 hours. Hydrochloric acid was added dropwise to the reaction solution to make it acidic. The title compound (45 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 319.1 [M+H]+

[0238] Example 86 3-{5-[2-methyl-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate By a method in accordance with Example 83, using 2-methyl-3-(piperidin-1-yl)propan-1-ol (87 mg) instead of (1,3-thiazol-2-yl)methanol, the title compound (83 mg) was obtained. MS (m / z): 319.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.44 (d, 1H), 7.98 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.14-4.06 (m, 2H), 3.50-3.26 (m, 2H), 3.24-3.16 (m, 2H), 3.08-3.00 (m, 2H), 2.29 (s, 3H), 1.95-1.22 (m, 7H), 1.11 (d, 3H)

[0239] Example 87 3-{5-|~2-(dimethylamino)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Example 83, using 2-(dimethylamino)ethan-1-ol (37 mg) instead of (1,3-thiazol-2-yl)methanol, the title compound (63 mg) was obtained. MS (m / z): 251.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.48 (d, 1H), 8.00 (d, 1H), 7.67 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.51 (t, 2H), 3.55 (t, 2H), 2.87 (s, 6H), 2.29 (s, 3H)

[0240] Example 88  3-{5-[3-(dimethylammo)propoxy]pyridin-2-yl}- 4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Example 83, using 3-(dimethylamino)propan-1-ol (43 mg) instead of (1,3-thiazol-2-yl)methanol, the title compound (64 mg) was obtained. MS (m / z): 265.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.44 (d, 1H), 7.97 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.24 (t, 2H), 3.23 (t, 2H), 2.82 (s, 6H), 2.29 (s, 3H), 2.18-2.10 (m, 2H) [0241 ] Example 89 3-{5-[4-(dimethylamino)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Example 83, using 4-(dimethylamino)butan-1-ol (49 mg) instead of (1,3-thiazol-2-yl)methanol, the title compound (53 mg) was obtained. MS (m / z): 279.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 9.21 (br, 1H), 8.44 (d, 1H), 7.96 (d, 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.19 (t, 2H), 3.17-3.18 (m, 2H), 2.79 (s, 6H), 2.29 (s, 3H), 1.83-1.73 (m, 4H)

[0242] Example 90 3-{5-[4-(piperidin-1-yl)butoxy]pyridm-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride By a method in accordance with Step 1, Step 2, and Step 3 of Example 7, using 4-(piperidin-1-yl)butan-1-ol (232 mg) instead of 3-(piperidin-1-yl)propan-1-ol, the title compound (112 mg) was obtained. MS (m / z): 319.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.31 (d, 1H), 7.79 (d, 1H), 7.40 (dd, 1H), 4.09 (br, 2H), 2.90-2.65 (m, 6H), 1.85-1.34 (m, 10H)

[0243] Example 91   3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate [Step 1] Production of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 51, using butane-1,4-diol (12 g) instead of propane-1,3-diol, the title compound (4.89 g) was obtained. MS (m / z): 406.1 [M+H]+

[0244] [Step 2] Production of 3-{5-[4-(azepan-1-yl)butoxy]pyridin-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (30 mg), N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.038 mL), azepane (22 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (113 mg) was added dropwise to the reaction solution to make it acidic. The title compound (26 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 333.2 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.43 (d, 1H), 7.95 (d 1H), 7.61 (dd, 1H), 7.47 (d, 2H), 7.11 (d, 2H), 4.22-4.16 (m, 2H), 3.30-3.12 (m, 6H), 2.29 (s, 3H), 1.85-1.72 (m, 8H), 1.66-1.56 (m, 4H)

[0245] Example 92^-{52[4-(pyrrolidin=1-yl)butoxy]pyridin=2-yl}-4i52 dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91 and N,N-dimethylformamide (0.5 mL), pyrrolidine (26 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (164 mg) was added dropwise to the reaction solution to make it acidic. The title compound (35 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 305.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.36 (br, 1H), 7.86 (d, 1H), 7.50-7.42 (m, 3H), 7.12 (d, 2H), 4.11 (br, 2H), 3.30-3.05 (m, 6H), 2.29 (s, 3H), 1.98-1.72 (m, 8H)

[0246] Example 93  3-{5-[4-(3-hydroxypiperidin-1-yl)butoxy]pyridin- 2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.062 mL), piperidin-3-ol (37 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added to the reaction solution to make it acidic. The title compound (1 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 335.1 [M+H]+

[0247] Example 94 3-{5-[4-(morpholin-4-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (1 mL), and diisopropylethylamine (0.062 mL), morpholine (37 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (180 mg) was added dropwise to make it acidic. The title compound (25 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 321.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.22 (d, 2H), 4.19 (t, 2H), 3.95-3.82 (m, 4H), 3.353.17 (m, 6H), 2.36 (s, 3H), 2.00-1.86 (m, 4H)

[0248] Example 95 3-{5-[4-(4-fluoropiperidin-1-yl)butoxy]pyridm-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and potassium carbonate (50 mg), 4-fluoropiperidine hydrochloride (51 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (184 mg) was added dropwise to make it acidic. The title compound (23 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 337.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.38 (d, 1H), 7.96 (d, 1H), 7.70 (d, 2H), 7.52 (dd, 1H), 7.23 (d, 2H), 4.21 (t, 2H), 3.50-3.16 (m, 7H), 2.36 (s, 3H), 2.30-1.86 (m, 8H)

[0249] Example 96 3-{5-[4-(4,4-dimethylpiperidin-1- yl)butoxy]pyridin=2-yl}-4,5-dihydro-1,2J4-oxadiazol-5-one 4- methylbenzene-1 -sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and potassium carbonate (50 mg), 4,4-dimethylpiperidine hydrochloride (54 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (184 mg) was added dropwise to make it acidic. The title compound (16 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 347.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 5: 8.36 (d, 1H), 7.93 (d, 1H), 7.70 (d, 2H), 7.49 (dd, 1H), 7.22 (d, 2H), 4.18 (t, 2H), 3.54-3.00 (m, 6H), 3.402.90 (m, 6H), 2.36 (s, 3H), 2.04-1.85 (m, 4H), 1.74-1.58 (m, 4H), 1.06 (s, 6H)

[0250] Example 97 3-{5-[4-(3-hydroxy-3-methylpiperidin-1- yl)butoxy]pyridin=2-yl}-415-dihydro21J214=oxadiazol-5-one To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-S-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.064 mL), S-methylpiperidin-S-ol (4S mg) was added, and the mixture was heated and stirred at 80 °C for S hours. Hydrochloric acid was added to the reaction solution to make it neutral. The title compound (2S mg) was obtained by purification by silica gel column chromatography. MS (m / z): S49.2 [M+H]+ [0251 ] Example 98 3-[5-(4-{7-azaspiro[4.51decan-7- yl}butoxy)pyridm-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-S-yl)pyridin-S-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.2 mL), and diisopropylethylamine (0.064 mL), 7-azaspiro[4.5]decane (S4 mg) was added, and the mixture was heated and stirred at 80 °C for S hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (94 mg) was added dropwise to make it neutral. The title compound (2S mg) was obtained by purification by silica gel column chromatography. MS (m / z): 373.2 [M+H]+

[0252] Example 99 3-[5-(4-{9-oxa-2-azaspiro[5.5]undecan-2- yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one 4- methylbenzene-1 -sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (49 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (0.5 mL), and diisopropylethylamine (0.063 mL), 9-oxa-2-azaspiro[5.5]undecane (56 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (184 mg) was added dropwise to make it acidic. The title compound (5 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 389.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.36 (br, 1H), 7.91 (br, 1H), 7.70 (d, 2H), 7.46 (dd, 1H), 7.22 (d, 2H), 4.16 (t, 2H), 3.78-3.59 (m, 4H), 3.402.90 (m, 6H), 2.36 (s, 3H), 2.50-1.45 (m, 12H)

[0253] Example 100 methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1 -carboxylate     4- methylbenzene-1 -sulfonate [Step 1] Production of tert-butyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, dimethyl sulfoxide (1 mL), and diisopropylethylamine (0.064 mL), tert-butyl piperazine-1-carboxylate (46 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. 2 M hydrochloric acid was added dropwise to the reaction solution at room temperature to make it acidic. The title compound (13 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 418.3 [M-H]-

[0254] [Step 2] Production of 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of tert-butyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate (13 mg) and tetrahydrofuran (1 mL), a 4 M hydrogen chloride dioxane solution (0.039 mL) was added at room temperature, and the mixture was stirred for 15 hours. A 4 M hydrogen chloride dioxane solution (0.039 mL) and methanol (0.5 mL) were added, and the mixture was heated and stirred at 50 °C for 3 hours. A 4 M hydrogen chloride dioxane solution (0.039 mL) was added, and the mixture was heated and stirred at 50 °C for 2 hours. The solvent was distilled off under reduced pressure, and the precipitate that had deposited was collected by filtration with diethyl ether and dried to obtain the title compound (14 mg). MS (m / z): 320.1 [M+H]+

[0255] [Step 3] Production of methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate 4-methylbenzene-1-sulfonate To a mixture of 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (11 mg), N,N-dimethylformamide (0.31 mL), and diisopropylethylamine (0.026 mL), methyl carbonochloridate (0.0024 mL) was added sequentially at room temperature, and the mixture was stirred for 1 hour. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (47 mg) was added dropwise to the reaction solution to make it acidic. The title compound (2 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 378.1 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.23 (d, 2H), 4.19 (t, 2H), 3.78-3.70 (m, 5H), 3.353.23 (m, 8H), 2.36 (s, 3H), 2.02-1.89 (m, 4H)

[0256] Example 101 3-{5-[4-(4-acetylpiperazm-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (50 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (1.2 mL), and diisopropylethylamine (0.064 mL), 1-(piperazin-1-yl)ethan-1-one (32 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (188 mg) was added dropwise to the reaction solution at room temperature to make it acidic. The title compound (22 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 362.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 6: 8.38 (d, 1H), 7.95 (d, 1H), 7.70 (d, 2H), 7.51 (dd, 1H), 7.23 (d, 2H), 4.21 (t, 2H), 4.00-3.62 (m, 2H), 3.503.18 (m, 8H), 2.36 (s, 3H), 2.15 (s, 3H), 2.06-1.86 (m, 4H)

[0257] Example 102 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5- dihydro-1,2,4-oxadiazol-5-one dihydrochloride To a mixture of 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl 4-methylbenzene-1-sulfonate (200 mg) obtained in Step 1 of Example 91, N,N-dimethylformamide (4.9 mL), and diisopropylethylamine (0.26 mL), tert-butyl piperazine-1-carboxylate (184 mg) was added, and the mixture was heated and stirred at 80 °C for 3 hours. Acetic acid (0.42 mL) was added dropwise to make it neutral. A crude product was obtained by purification by silica gel column chromatography. This crude product was dissolved in THF (0.46 mL), a 4 M hydrochloric acid dioxane solution (0.29 mL) was added, and the mixture was stirred at room temperature overnight. The reaction solution was concentrated, and the obtained residue was washed with diethyl ether. The title compound (28 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 320.2 [M+H]+ 1H-NMR (400 MHz, MeOH-d4) 8: 8.36 (d, 1H), 7.94 (d, 1H), 7.50 (dd, 1H), 4.70-4.50 (m, 2H), 4.17 (t, 2H), 3.20-3.12 (m, 4H), 2.80-2.65 (m, 4H), 2.53 (t, 2H), 1.95-1.82 (m, 2H), 1.75-1.68 (m, 2H)

[0258] Example 103 3-{5-|~4-(4-benzylpiperazm-1-yl)butoxy]pyridm-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one dihydrochloride (21 mg) obtained in Example 102, N,N-dimethylformamide (0.27 mL), water (0.27 mL), and diisopropylethylamine (0.046 mL), bromomethylbenzene (10 mg) was added, and the mixture was stirred at room temperature for 3 hours. The title compound (4 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 410.3 [M+H]+

[0259] Example 104   3-(5-{[5-(piperidm-1-yl)pentyl]oxy}pyridm-2- yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (50 mg) obtained in Step 1 of Example 51, 5-(piperidin-1-yl)pentan-1-ol (118 mg), and 1-methylpyrrolidin-2-one (0.3 mL), KOtBu (77 mg) was added, and the mixture was heated and stirred at 60 °C for 3 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (105 mg) was added dropwise to the reaction solution to make it neutral. The title compound (28 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 333.1 [M+H]+

[0260] Example 105 3-(5-{[2-(3-methoxyphenyl)ethyl]amino}pyridm-2-yl)-4,,5-dihydro-1,2,4-oxadiazol-5-one [Step 1] Production of 5-{[2-(3-methoxyphenyl)ethyl]amino}pyridine-2-carbonitrile To a mixture of 5-fluoropyridine-2-carbonitrile (50 mg), 2-(3-methoxyphenyl)ethan-1-amine (62 mg), and N,N-dimethylformamide (1.4 mL), potassium carbonate (85 mg) was added, and the mixture was heated and stirred at 80 °C for 15 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (89 mg). MS (m / z): 254.1 [M+H]+

[0261] [Step 2]        Production of N-hydroxy-5-{[2-(3- methoxyphenyl)ethyl]amino}pyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (122 mg) and ethanol (1.8 mL), a 2 M aqueous sodium hydroxide solution (0.88 mL) was added, and the mixture was stirred at room temperature for 10 minutes. 5-{[2-(3-Methoxyphenyl)ethyl]amino}pyridine-2-carbonitrile (89 mg) was added to the reaction solution, and the mixture was stirred at room temperature for 15 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (82 mg). MS (m / z): 287.1 [M+H]+

[0262] [Step      3]             Production      of      3-(5-{[2-(3- methoxyphenyl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To       a      mixture       of      N-hydroxy-5-{[2-(3- methoxyphenyl)ethyl]amino}pyridine-2-carboximidamide (82 mg), tetrahydrofuran (1.4 mL), and DBU (0.064 mL), CDI (70 mg) was added at room temperature, and the mixture was stirred for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (436 mg) was added dropwise to the reaction solution to make it acidic. The title compound (81 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 313.0 [M+H]+

[0263] Example 106 3-(5-{[2-(3-fluorophenyl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one By a method in accordance with Step 1, Step 2, and Step 3 of Example 105, using 2-(3-fluorophenyl)ethan-1-amine (57 mg) instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (82 mg) was obtained. MS (m / z): 301.0 [M+H]+

[0264] Example 107 3-(5-{[2-(pyridm-4-yl)ethyl]ammo}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one By a method in accordance with Step 1, Step 2, and Step 3 of Example 105, using 2-(pyridin-4-yl)ethan-1-amine (50 mg) instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (10 mg) was obtained. MS (m / z): 284.1 [M+H]+

[0265] Example 108 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1]        Production of N-hydroxy-5-{[3-(piperidin-1- yl)propyl]amino}pyridine-2-carboximidamide By a method in accordance with Step 1 and Step 2 of Example 105, using 3-(piperidin-1-yl)propan-1-amine (58 mg) instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (55 mg) was obtained. MS (m / z): 278.1 [M+H]+

[0266] [Step 2]        Production of    3-(5-{[3-(piperidin-1- yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of N-hydroxy-5-{[3-(piperidin-1-yl)propyl]amino}pyridine-2-carboximidamide (55 mg), tetrahydrofuran (0.99 mL), and DBU (0.044 mL), CDI (48 mg) was added at room temperature, and the mixture was stirred for 15 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (302 mg) was added dropwise to the reaction solution to make it acidic. The title compound (40 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 304.1 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.07 (d, 1H), 7.70 (d, 1H), 7.47 (d, 2H), 7.13-7.06 (m, 3H), 6.81 (t, 1H), 3.50-3.28 (m, 2H), 3.21 (dd, 2H), 3.13-3.07 (m, 2H), 3.00-2.70 (m, 2H), 2.29 (s, 3H), 1.94-1.18 (m, 8H)

[0267] Example 109 3-(5-{J(1ethylpiperidin=42 yl)methyl]amino } pyridin-2-yl)-4,5 -dihydro-1,2,4-oxadiazol-5 -one [Step     1]          Production     of     5-{[(1-ethylpiperidin-4- yl)methyl]amino}pyridine-2-carbonitrile To a mixture of (1-ethylpiperidin-4-yl)methanamine (140 mg), 5-fluoropyridine-2-carbonitrile (100 mg), and dimethyl sulfoxide (1 mL), potassium carbonate (170 mg) was added sequentially at room temperature, and the mixture was heated and stirred at 120 °C for 3 hours. Water was added to the reaction solution, and the title compound (205 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 245.3 [M+H]+

[0268] [Step 2]       Production of 5-{[(1-ethylpiperidin-4- yl)methyl]amino}-N-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (350 mg) and dimethyl sulfoxide (1 mL), KOtBu (565 mg) was added sequentially at room temperature, and the mixture was stirred for 10 minutes. 5-{[(1-Ethylpiperidin-4-yl)methyl]amino}pyridine-2-carbonitrile (205 mg) was added, and the mixture was stirred overnight. Water was added to the reaction solution, and the precipitate that had deposited was collected by filtration and dried to obtain the title compound (152 mg). MS (m / z): 278.3 [M+H]+

[0269] [Step 3]       Production of   3-(5-{[(1-ethylpiperidin-4- yl)methyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one To a mixture of 5-{[(1-ethylpiperidin-4-yl)methyl]amino}-N-hydroxypyridine-2-carboximidamide (152 mg), tetrahydrofuran (1 mL), and DBU (0.098 mL), CDI (133 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The mixture was purified by silica gel column chromatography. The fraction containing the target product was neutralized with an aqueous solution of potassium carbonate and purified by silica gel column chromatography to obtain the title compound (112 mg). MS (m / z): 304.2 [M+H]+

[0270] Example 110 3-(5-{methyl[3-(piperidin-1- yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride [Step 1]     Production of N-hydroxy-5-{methyl[3-(piperidin-1- yl)propyl]amino}pyridine-2-carboximidamide By a method in accordance with Step 1 and Step 2 of Example 105, using methyl[3-(piperidin-1-yl)propyl]amine (77 mg) instead of 2-(3-methoxyphenyl)ethan-1-amine, the title compound (99 mg) was obtained. MS (m / z): 259.4 [M+H]+

[0271] [Step 2]      Production of  3-(5-{methyl[3-(piperidin-1- yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one hydrochloride To a mixture of N-hydroxy-5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridine-2-carboximidamide (99 mg), tetrahydrofuran (3 mL), and DBU (0.076 mL), CDI (83 mg) was added at room temperature, and the mixture was stirred overnight. Water was added to the reaction solution, and hydrochloric acid was added dropwise to make it acidic. The title compound (80 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 318.4 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 6: 8.10 (d, 1H), 7.67 (d, 1H), 7.18 (dd, 1H), 3.45 (t, 2H), 2.98 (s, 3H), 2.55-2.35 (m, 6H), 1.78-1.66 (m, 2H), 1.62-1.32 (m, 6H)

[0272] Example 111 3-(5-{[2-(dimethylammo)ethyl]ammo}pyridm-2- yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate [Step 1] Production of 5-{[2-(dimethylamino)ethyl]amino}pyridine-2-carbonitrile A mixture of 5-fluoropyridine-2-carbonitrile (50 mg), (2-aminoethyl)dimethylamine (40 mg), 1-methylpyrrolidin-2-one (2.0 mL), and potassium carbonate (85 mg) was heated and stirred at 80 °C for 3 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (66 mg). MS (m / z): 191.3 [M+H]+

[0273] [Step 2] Production of 5-{[2-(dimethylamino)ethyl]amino}-N-hydroxypyridine-2-carboximidamide To a mixture of hydroxylamine hydrochloride (121 mg) and ethanol (1.7 mL), a 2 M aqueous sodium hydroxide solution (0.87 mL) was added sequentially at room temperature, and the mixture was stirred for 10 minutes.         It was added to 5-{[2- (dimethylamino)ethyl]amino}pyridine-2-carbonitrile (66 mg), and the mixture was stirred for 5 hours. The reaction solution was purified by silica gel column chromatography to obtain the title compound (83 mg). MS (m / z): 224.3 [M+H]+

[0274] [Step      3]             Production      of      3-(5-{[2- (dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate To a mixture of 5-{[2-(dimethylamino)ethyl]amino}-N-hydroxypyridine-2-carboximidamide (83 mg), tetrahydrofuran (1.9 mL), and DBU (0.083 mL), CDI (90 mg) was added at room temperature, and the mixture was stirred for 14 hours. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (566 mg) was added dropwise to the reaction solution to make it acidic. The title compound (97 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 250.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.11 (d, 1H), 7.73 (d, 1H), 7.48 (d, 2H), 7.16 (dd, 1H), 7.12 (d, 2H), 6.84 (t, 1H), 3.53 (dt, 2H), 3.25 (t, 2H), 2.83 (s, 6H), 2.29 (s, 3H)

[0275] Example 112 3-(5-{[3-(dimethylammo)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 111, using (3-aminopropyl)dimethylamine (46 mg) instead of (2-aminoethyl)dimethylamine, the title compound (113 mg) was obtained. MS (m / z): 264.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 9.25 (br, 1H), 8.06 (d, 1H), 7.71 (d, 1H), 7.47 (d, 2H), 7.21-7.01 (m, 3H), 6.80 (t, 1H), 3.25-3.17 (m, 2H), 3.13 (t, 2H), 2.79 (s, 6H), 2.29 (s, 3H), 1.90 (tt, 2H)

[0276] Example 113 3-(5-{[4-(dimethylamino)butyl]ammo}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1-sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 111, using (4-aminobutyl)dimethylamine (52 mg) instead of (2-aminoethyl)dimethylamine, the title compound (148 mg) was obtained. MS (m / z): 278.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 9.22 (br, 1H), 8.06 (d, 1H), 7.69 (d, 1H), 7.47 (d, 2H), 7.11 (d, 1H), 7.05 (dd, 1H), 6.78 (t, 1H), 3.20-3.13 (m, 2H), 3.07 (t, 2H), 2.77 (s, 6H), 2.29 (s, 3H), 1.74-1.65 (m, 2H), 1.611.53 (m, 2H)

[0277] Example 114 3-{5-[(1-ethylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 111, using 1-ethylpiperidin-4-amine (58 mg) instead of (2-aminoethyl)dimethylamine, the title compound (79 mg) was obtained. MS (m / z): 290.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.11 (br, 1H), 7.70 (d, 1H), 7.48 (d, 2H), 7.20-7.02 (m, 3H), 6.83 (d, 1H), 3.66 (br, 1H), 3.51 (br, 2H), 3.202.92 (m, 4H), 2.29 (s, 3H), 2.13 (br, 2H), 1.65 (br, 2H), 1.29-1.13 (m, 3H)

[0278] Example 115  3-{5-|~(1-benzylpiperidm-4-yl)amino]pyridm-2- yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 111, using 1-benzylpiperidin-4-amine (86 mg) instead of (2-aminoethyl)dimethylamine, the title compound (109 mg) was obtained. MS (m / z): 352.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) S: 8.13-8.02 (m, 1H), 7.68 (d, 1H), 7.58-7.38 (m, 7H), 7.18-7.06 (m, 3H), 6.80-6.72 (m, 1H), 4.23 (br, 1H), 3.55 (br, 2H), 2.99 (br, 2H), 2.29 (s, 3H), 2.10 (br, 2H), 1.60 (br, 2H)

[0279] Example 116 3-{5-[(1-ethylpiperidin-4- yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 111, using 1-ethyl-N-methylpiperidin-4-amine (64 mg) instead of (2-aminoethyl)dimethylamine, the title compound (13 mg) was obtained. MS (m / z): 304.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) S: 8.29 (d, 1H), 7.75 (d, 1H), 7.46 (d, 2H), 7.35 (dd, 1H), 7.10 (d, 2H), 4.16 (br, 1H), 3.60-3.40 (m, 2H), 3.02 (br, 2H), 2.85 (s, 3H), 2.28 (s, 3H), 2.02-1.89 (m, 2H), 1.88-1.79 (m, 2H), 1.20 (t, 3H)

[0280] Example 117 3-{5-[(1-benzylpiperidin-4- yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Step 1, Step 2, and Step 3 of Example 111, using 1-benzyl-N-methylpiperidin-4-amine (92 mg) instead of (2-aminoethyl)dimethylamine, the title compound (55 mg) was obtained. MS (m / z): 366.4 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) S: 8.31-8.26 (m, 1H), 7.74 (d, 1H), 7.58-7.38 (m, 7H), 7.38-7.33 (m, 1H), 7.11 (d, 2H), 4.15 (br, 1H), 3.583.45 (m, 2H), 3.02 (br, 2H), 2.84 (s, 3H), 2.29 (s, 3H), 1.96 (br, 2H), 1.83 (br, 2H) [0281 ] Example 118    3-(5-{4-I2-(pyrrolidm-1-yl)ethyl]piperidm-1- yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate A mixture of 3-(5-fluoropyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one (30 mg) obtained in Step 1 of Example 51, 4-[2-(pyrrolidin-1-yl)ethyl]piperidine (75 mg), 1-methylpyrrolidin-2-one (1 mL), and diisopropylethylamine (0.072 mL) was stirred at 150 °C for 2 hours under microwave irradiation. An aqueous solution of 4-methylbenzene-1-sulfonic acid hydrate (252 mg) was added dropwise to the reaction solution to make it acidic. The title compound (50 mg) was obtained by purification by silica gel column chromatography. MS (m / z): 344.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) S: 9.37 (br, 1H), 8.39 (d, 1H), 7.75 (d, 1H), 7.47 (d, 2H), 7.44 (d, 1H), 7.11 (d, 2H), 3.99 (d, 2H), 3.52 (br, 2H), 3.18 (t, 2H), 3.01 (br, 2H), 2.87 (t, 2H), 2.29 (s, 3H), 1.92 (br, 4H), 1.76 (d, 2H), 1.65-1.53 (m, 3H), 1.29-1.15 (m, 2H)

[0282] Example^.19^-(5-I4-I2-(dimethylamino)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one 4-methylbenzene-1 -sulfonate By a method in accordance with Example 118, using dimethyl[2-(piperidin-4-yl)ethyl]amine (65 mg) instead of 4-[2-(pyrrolidin-1- yl)ethyl]piperidine, the title compound (60 mg) was obtained. MS (m / z): 318.3 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) 5: 8.39 (d, 1H), 7.75 (d, 1H), 7.47 (d, 2H), 7.44 (d, 1H), 7.11 (d, 2H), 3.98 (d, 2H), 3.10 (t, 2H), 2.87 (t, 2H), 5       2.77 (s, 6H), 2.29 (s, 3H), 1.75 (d, 2H), 1.62-1.49 (m, 3H), 1.31-1.15 (m, 2H)

[0283] The structural formulae of the compounds obtained in Examples 1 to 119 are shown in Table 1. [Table 1] Example Structural formula 1 ¥9 HN ,N N A HCI ¥ 0 2 °¥ N. NH 9 -J 3 °v^ O' / - Q 1 HCI °\ 4 ?¥ N. NH HCI V / N-x^OJ 5 0 Nv NH Vo eV Nx NH nA 6 Y " ^N^s ^Y 0 O NH 7 J HCI °Y o N NH Y n 8 A HCI OjO HCI HCI kb HCI 1 3 o-rWi W z-% p s b 1 4 o N Mh X y d 1 5 0 O—P N x NH O hci 1 6 O N NH ] 0 hci I b- 25 TsOH TsOH HCI N . NH 40 N NH HN N HCI HCI HCI HCI HCI HCI TsOH HCI HN N 68 0 Vo HN xn |l J HCI ,0^ 69 0 V° HN . N X HCI X. N z0H ^"■OH 70 0 V° HN , N N , |l J Ha X X F r 71 9^° V NH X TsOH F 72 0 v° HN TsOH 0 N ~ - TsOH TsOH HCI HCI HN M N NH TsOH TsOH TsOH TsO bL NH TsOH TsOH TsOH H TsOH TsOH TsOH TsOH 0 Nx Nh 1 06 6 HN . F o Nx NH 1 07 M HN \\ fl O 1 08 A TsOH HN -. 0 NH 1 09 0 V 0 HN z A 1 1 0 I HCI N 0 O- NH 111 JI TsOH HI 1 0 L 1 1 2 II TsOH HN^ O 0-^ N x NH 1 1 3 nA 3 TsOH HN. 1 10

[0284] The biological test examples of the compounds obtained in the Examples (test substances) are shown below.

[0285] <Test Example 1 Evaluation of the action of inhibiting the binding between CUG repeat RNA and MBNL protein> 1. Preparation of test substance solution The test substance was prepared to a concentration of 10 mM with dimethyl sulfoxide (DMSO, Nacalai Tesque, 13445-74), and was diluted with DMSO so as to give six concentration points of 10000, 3000, 1000, 300, 100, and 10 pM, respectively. Furthermore, each was diluted 10-fold with RNA Nuclease-Free Water (not DEPC-Treated) (ThermoFisher SCIENTIFIC, AM9937) so as to give concentrations of 1000, 300, 100, 30, 10, and 1 pM, respectively, to prepare test substance solutions.

[0286] 2. Measurement of the action of inhibiting the binding between CUG repeat RNA and MBNL protein The prepared solutions of the test substance at six concentration points were each added at 2 pL / well to a 384-well plate (PerkinElmer, 6008350) so as to give final concentrations of 100000, 30000, 10000, 3000, 1000, and 100 nM, respectively. Furthermore, a buffer containing 40 mM HEPES (Nacalai Tesque, 17547-24), 220 mM KCl (Nacalai Tesque, 28514-75), 20 mM sodium chloride (Nacalai Tesque, 31319-45), 2 mM magnesium chloride hexahydrate (Nacalai Tesque, 20908-65), 4 mM calcium chloride dihydrate (FUJIFILM Wako Pure Chemical, 03619731), 0.2% BSA (Nacalai Tesque, 08587-26), 0.1% Tween (Tokyo Chemical Industry Co., Ltd., T0543-25G), and 10 mM dithiothreitol (Nacalai Tesque, 14112-52), a synthetic RNA having a 12-times repeat sequence of CUG (Sigma) at a final concentration of 5 nM, and MBNL protein at a final concentration of 150 nM were mixed and added at 14 pL / well. After incubation at room temperature for 30 minutes, the donor and acceptor beads of the AlphaScreen Histidine Detection Kit (PerkinElmer, 6760619M) were added at 4 pL / well so as to give a final concentration of 5 pg / mL. After incubation at room temperature for 1.5 hours, the fluorescence intensity was measured with Envision (PerkinElmer) at an excitation wavelength of 680 nm and an absorption wavelength of 520-620 nm. The test was performed in duplicate.

[0287] 3. Analysis of measurement results Taking the maximum inhibition rate of each test substance as 100% and the minimum inhibition rate as 0%, the inhibition rate by the test substance was calculated. The IC50 value (50% inhibitory concentration) of the test substance was calculated by logistic regression analysis. The measurement results for the compounds obtained in the respective Examples are shown in Tables 2 to 4 below.

[0288] [Table 2] Example Inhibition of binding between MBNL protein and CUG repeat, IC50 (pM) Example Inhibition of binding between MBNL protein and CUG repeat, IC50 (pM) 1 4.6 26 9.7 2 4.4 27 2.2 3 4.2 28 3.8 4 3.6 29 6.3 5 3.4 30 4.9 6 5.9 31 6.9 7 4.9 32 5.8 8 4.2 33 6.7 9 3.8 34 4.7 10 3.4 35 4.2 11 5.5 36 5.7 12 2.7 37 5.2 13 9.1 38 6.6 14 8.8 39 10.3 15 5.8 40 5.3 16 4.0 41 6.9 17 4.8 42 4.7 18 3.6 43 7.0 19 3.2 44 6.8 20 7.4 45 7.8 21 8.1 46 4.5 22 5.7 47 6.0 23 19.2 48 9.5 24 62.3 49 6.6 25 4.0 50 8.2 Example Inhibition of binding between MBNL protein and CUG repeat, IC50 (pM) Example Inhibition of binding between MBNL protein and CUG repeat, IC50 (pM) 51 1.9 76 1.6 52 2.3 77 2.6 53 3.3 78 3.9 54 4.9 79 3.2 55 2.3 80 2.6 56 3.3 81 4.3 57 2.2 82 8.0 58 2.9 83 15.4 59 5.1 84 4.2 60 3.3 85 4.6 61 2.6 86 4.1 62 3.2 87 4.5 63 7.1 88 4.0 64 4.3 89 3.4 65 1.5 90 4.9 66 3.9 91 1.6 67 3.6 92 5.8 68 2.8 93 2.9 69 1.6 94 2.7 70 6.0 95 2.1 71 2.6 96 2.0 72 4.3 97 4.7 73 7.3 98 2.8 74 2.8 99 2.8 75 3.5 100 5.0 Example Inhibition of binding between MBNL protein and CUG repeat, IC50 (pM) Example Inhibition of binding between MBNL protein and CUG repeat, IC50 (pM) 101 3.3 111 1.6 102 2.9 112 1.5 103 2.6 113 1.4 104 2.3 114 1.6 105 2.2 115 1.6 106 2.1 116 1.5 107 1.3 117 1.5 108 1.4 118 2.1 109 2.0 119 2.0 110 8.9

[0291] <Test Example 2 Study of in vivo drug efficacy using a myotonic dystrophy type 1 model> 5        1. Preparation of test substance administration solution The test substance was weighed and suspended in 0.5% methylcellulose (Shin-Etsu Chemical) + 99.5% Otsuka distilled water (Otsuka Pharmaceutical Factory) to prepare a test substance administration solution so as to give a concentration of 10 mg / mL. 10

[0292] 2. Preparation of animal model FVB / N-Tg(HSA*LR)20bCath / J (6-week-old male), which is a myotonic dystrophy model animal, was used. The HSALR mouse is a transgenic animal in which a 220-times CTG repeat sequence is incorporated downstream of the hACTA gene, and DM1-like symptoms 15       appear due to the expression of an mRNA containing CUG repeats in skeletal muscle (Non-Patent Literature 7). As a healthy animal, FVB / Njcl (6-week-old male) was used.

[0293] 3. Study of splicing improvement action The test substance administration solution was orally administered twice a day for 4 days, and on the 5th day from the start of administration, the animals were euthanized, and the quadriceps femoris was collected. After total RNA was extracted using Qiazol Reagent (Qiagen, 79306) and Maxwell (registered trademark) RSC simply RNA Tissue Kit (Promega, A1340), cDNA was prepared using SuperScript IV First Strand Synthesis System (Invitrogen, 18091050). Using the cDNA, RT-PCR was performed using the following Clcn1 exon 7a or CACNA1S exon 29 RT primers. The RT-PCR products were electrophoresed using MultiNA (Shimadzu Corporation), the normaltype PCR product and the abnormal-type PCR product were each quantified, and the proportion of the normal type in the RT-PCR products was calculated. <Clcn1 exon 7a RT primer> Fw: TGAAGGAATACCTCACACTCAAGG Rv: CACGGAACACAAAGGCACTG <CACNA1S exon 29 RT primer> Fw: GAGATCCTTGGAATGTGTTTGACTTCCT Rv: GGTTCAGCAGCTTGACCAGTCTCAT

[0294] 4. Analysis of measurement results The splicing improvement rate was calculated from the splicing proportions of the FVB / N-Tg(HSA*LR)20bCath / J vehicle administration group and the FVB / Njcl group (Non-Patent Literature 8). The experimental results are shown in Table 5. Example Dose (mg / kg) CLCN1 exon 7a splicing improvement rate (%) CACNA1S exon 29 splicing improvement rate (%) 7 100 7.1 17.5 11 100 18.3 52.1 12 100 4.8 15.4 15 100 5.6 13.9 16 100 4.0 16.0

Claims

1. A compound represented by general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof,,0p“^N^NHN^X1I IIxyx2 tnAIBiCwherein X1, X2, and X3 are any of the following combinations: (a) X1, X2, and X3 are -CH=;(b) X1 is -N=, X2 is -CH=, and X3 is -CH=; or(c) X1 is -CH=, X2 is -CH=, and X3 is -N=;A represents -O-, -S-, -NR- with R representing a hydrogen atom or a C1 to C3 alkyl group, or a piperidinediyl group;B represents a single bond, a C1 to C5 alkylene group optionally substituted with a hydroxyl group, or -Y1-NY2-Y3- with Y1 and Y3 each independently representing a C1 to C3 alkylene group, and Y2 representing a hydrogen atom or a C1 to C3 alkyl group;C represents a substituted or unsubstituted aryl group, a substituted or unsubstituted nitrogen-containing heterocyclic group, or a dialkylamino group;provided that at least one of B and C contains one or more nitrogen atoms.

2. The compound, or a pharmaceutically acceptable salt thereof, ora solvate thereof according to claim 1, wherein A is -O-.

3. The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to claim 1 or 2, wherein B is a single bond or a C1 to C5 alkylene group.

4. The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of claims 1 to 3, wherein C is a substituted or unsubstituted nitrogen-containing heterocyclic group.

5. The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of claims 1 to 4, wherein C is a substituted or unsubstituted piperidinyl group, a substituted or unsubstituted piperazinyl group, or a substituted or unsubstituted pyrrolidinyl group.

6. The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of claims 1 to 5, wherein C is a nitrogen-containing heterocyclic group substituted with an alkyl group, a benzyl group, or an acyl group, or an unsubstituted nitrogen-containing heterocyclic group.

7. The compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to claim 1, wherein X1, X2, and X3 are (a) a combination in which X1, X2, and X3 are -CH=;A represents -O-;B represents a single bond or a C1 to C5 alkylene group; andC represents a substituted or unsubstituted nitrogen-containing heterocyclic group.

8. A compound selected from the group consisting of the following compounds (1) to (104) and (107) to (119), or a pharmaceutically acceptable salt thereof, or a solvate thereof:(1)   3-{5-[(1-ethylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(2)      3-(5-{[(3R)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(3)       3-(5-{[(3S)-1-ethylpiperidin-3-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(4) 3-{5-[(1-benzylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(5)   3-(5-{2-[benzyl(methyl)amino]ethoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(6)  3-{5-[2-(4-acetylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(7)   3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(8)  3-{5-[3-(pyrrolidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(9)    3-{5-[2-(pyrrolidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(10) 3-{5-[2-(4-benzylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(12)   3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(13)       3-{5-[2-(4-phenoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(14)  3-{5-[(1-cyclopropanecarbonylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(15)      3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(17) 3-{5-[(1-propylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(18)  3-{5-[2-(2,3-dihydro-1H-isoindol-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(19)  3-{5-[2-(1,2,3,4-tetrahydroisoquinolin-2-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(20) ethyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate,(21) 3-(5-{3-[4-(2-fluorophenyl)piperazin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(22)         3-{5-[2-(4-phenylpiperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(23)     3-{5-[3-(piperidin-1-yl)propoxy]pyrimidin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(24)      3-{6-[3-(piperidin-1-yl)propoxy]pyridazin-3-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(25)        3-(5-{[3-(piperidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(26)        3-(5-{[3-(pyrrolidin-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(27) 3-(5-{[3-(azepan-1-yl)propyl]sulfanyl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(28) phenyl 4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate,(29) ethyl  4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}piperidine-1-carboxylate,(30) 3-{5-[(1-ethylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(31) 3-{5-[(1-butylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(32) 3-{5-[(1-pentylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(33)  3-(5-{[1-(cyclobutylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(34)  3-(5-{[1-(propan-2-yl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(35)  3-{5-[(1-butylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(36)   3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]methoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(37) 3-{5-[(1-benzylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(38) 3-[5-({1-[(2-ethylphenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(39)         3-{5-[(1-{[2-(trifluoromethyl)phenyl]methyl}piperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(40) 3-[5-({1-[(3-fluorophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(41)                    3-[5-({1-[(3-bromophenyl)methyl]piperidin-4-yl}methoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(42) 3-{5-[(1-acetylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(43)      3-{5-[(1-propanoylpiperidin-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(44) methyl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate,(45) propan-2-yl 4-({[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}methyl)piperidine-1-carboxylate,(46) methyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(47) ethyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(48) propyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(49) propan-2-yl    4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(50) benzyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(51)    3-{5-[3-(azepan-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(52)     3-{5-[2-(azepan-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(53)       3-{5-[2-(4-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(54)       3-{5-[2-(3-methoxypiperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(55)      3-[5-(2-{7-azaspiro[4.5]decan-7-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(56) 3-[5-(2-{9-oxa-2-azaspiro[5.5]undecan-2-yl}ethoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(57)     tert-butyl     4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(58)   3-{5-[2-(piperazin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(59)     3-{5-[2-hydroxy-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(60)      3-{5-[3-(4-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(61)      3-{5-[3-(3-hydroxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(62) 3-{5-[3-(morpholin-4-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(63)    3-{5-[3-(1,2,3,6-tetrahydropyridin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(64) 3-[5-(3-{1,4-dioxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(65)       1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-4-one,(66)        3-{5-[3-(3-fluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(67)       3-{5-[3-(4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(68)      3-{5-[3-(4-methoxypiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(69)   3-(5-{3-[(trans)3,4-dihydroxypiperidin-1-yl]propoxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(70)    3-{5-[3-(4,4-difluoropiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(71)  3-{5-[3-(4-fluoro-4-methylpiperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(72)        3-{5-[3-(4-acetylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(73) methyl 4-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperazine-1-carboxylate,(74)  3-{5-[3-(piperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(75)       3-{5-[3-(4-benzylpiperazin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(76)    3-[5-(3-{3-azabicyclo[3.1.0]hexan-3-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(77)   3-[5-(3-{octahydrocyclopenta[c]pyrrol-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(78)    3-[5-(3-{7-azaspiro[4.5]decan-7-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(79)  3-[5-(3-{2-oxa-8-azaspiro[4.5]decan-8-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(80)   3-[5-(3-{9-oxa-2-azaspiro[5.5]undecan-2-yl}propoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(81)       1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)pyridin-1-ium 4-methylbenzene-1-sulfonate,(82)      3-{5-[(5-methyl-1,3-oxazol-4-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(83)  3-{5-[(1,3-thiazol-2-yl)methoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(84)    3-{5-[3-(pyridin-3-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(85)       1-(3-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}propyl)piperidin-2-one,(86)      3-{5-[2-methyl-3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(87)  3-{5-[2-(dimethylamino)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(88) 3-{5-[3-(dimethylamino)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(89)  3-{5-[4-(dimethylamino)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(90)   3-{5-[4-(piperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(91)     3-{5-[4-(azepan-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(92)  3-{5-[4-(pyrrolidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(93)       3-{5-[4-(3-hydroxypiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(94)  3-{5-[4-(morpholin-4-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(95) 3-{5-[4-(4-fluoropiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(96)     3-{5-[4-(4,4-dimethylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(97) 3-{5-[4-(3-hydroxy-3-methylpiperidin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(98)      3-[5-(4-{7-azaspiro[4.5]decan-7-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(99) 3-[5-(4-{9-oxa-2-azaspiro[5.5]undecan-2-yl}butoxy)pyridin-2-yl]-4,5-dihydro-1,2,4-oxadiazol-5-one,(100) methyl 4-(4-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}butyl)piperazine-1-carboxylate,(101)        3-{5-[4-(4-acetylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(102)  3-{5-[4-(piperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(103)       3-{5-[4-(4-benzylpiperazin-1-yl)butoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(104)   3-(5-{[5-(piperidin-1-yl)pentyl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(107)   3-(5-{[2-(pyridin-4-yl)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(108) 3-(5-{[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(109)   3-(5-{[(1-ethylpiperidin-4-yl)methyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(110)  3-(5-{methyl[3-(piperidin-1-yl)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(111) 3-(5-{[2-(dimethylamino)ethyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(112)        3-(5-{[3-(dimethylamino)propyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(113) 3-(5-{[4-(dimethylamino)butyl]amino}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one,(114)   3-{5-[(1-ethylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(115)  3-{5-[(1-benzylpiperidin-4-yl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(116)    3-{5-[(1-ethylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(117)  3-{5-[(1-benzylpiperidin-4-yl)(methyl)amino]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(118)    3-(5-{4-[2-(pyrrolidin-1-yl)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one, and(119)   3-(5-{4-[2-(dimethylamino)ethyl]piperidin-1-yl}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one.

9. A compound selected from the group consisting of the following compounds (7), (11), (12), (15), and (16), or a pharmaceutically acceptable salt thereof, or a solvate thereof:(7)   3-{5-[3-(piperidin-1-yl)propoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(11) phenyl 4-(2-{[6-(5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl)pyridin-3-yl]oxy}ethyl)piperazine-1-carboxylate,(12)   3-{5-[2-(piperidin-1-yl)ethoxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one,(15)      3-{5-[(1-propylpiperidin-4-yl)oxy]pyridin-2-yl}-4,5-dihydro-1,2,4-oxadiazol-5-one, and(16) 3-(5-{[1-(cyclopropylmethyl)piperidin-4-yl]oxy}pyridin-2-yl)-4,5-dihydro-1,2,4-oxadiazol-5-one.

10. A pharmaceutical composition comprising, as an active ingredient, the compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of claims 1 to 9.

11. A therapeutic agent for myotonic dystrophy type 1, comprising, as an active ingredient, the compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of claims 1 to 9.

12. 5              Use of the compound, or a pharmaceutically acceptable saltthereof, or a solvate thereof according to any one of claims 1 to 9, for the manufacture of a therapeutic agent for myotonic dystrophy type 1.

13. A binding inhibitor that inhibits the binding between CUG repeat 10      RNA and MBNL protein, comprising, as an active ingredient, thecompound, or a pharmaceutically acceptable salt thereof, or a solvate thereof according to any one of claims 1 to 9.