Use of postbiotics for treating or preventing disruptions of the gut-brain axis

Abstract

Provided herein are postbiotic compositions prepared using fermentation and herbal substrate compositions for the treatment or prevention of the disruption of the gut-brain axis. Such postbiotic compositions can be used to treat or prevent neurological diseases or disorders, such as synucleinopathies, including but not limited to Parkinson's disease.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 632,374 filed April 10, 2024, the contents of which are incorporated herein by reference in their entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on March 28, 2025, is named 084487-000101 WOPT SL.xml and is 150,869 bytes in size. FIELD

[0003] The present disclosure is broadly concerned with postbiotic compositions and methods of using them to prevent or treat disruptions of the gut-brain axis. BACKGROUND

[0004] Body systems beyond the nervous system are impacted in neurological disease. Among these, gastrointestinal (GI) health and the role of the gut microbiome is a component of nervous system disorders, including in synucleinopathies such as Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). As Gl abnormalities are common in PD and can precede the manifestation of the movement disorder, the GI system can contribute to PD pathogenesis. Significant perturbation of the gut microbial community has been consistently reported in PD patients compared to healthy individuals. However, whether this contributes to the disease process in PD or is a consequence of the disease remains unknown. There is need for therapeutics for synucleinopathies, and for diseases or disorders related to disruptions of the gut-brain axis. SUMMARY

[0005] Examples are provided herein to enhance understanding of the present disclosure.

[0006] In one aspect, described herein is a method of treating or preventing a disease or disorder associated with a disruption in the gut-brain axis, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

[0007] In one aspect, described herein is a method of treating or preventing a neurological disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

[0008] In one aspect, described herein is a method of treating or preventing a synucleinopathy, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

[0009] In some embodiments of any of the aspects, the disease or disorder is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

[0010] In some embodiments of any of the aspects, the disease or disorder is Parkinson’s disease.

[0011] In some embodiments of any of the aspects, the disease or disorder is REM Sleep Behavior Disorder.

[0012] In some embodiments of any of the aspects, administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., Faecalibacterium, Akkermansia, and / or Ruminococcus); decreased abundance of pathogenic or non-beneficial microbiome species (e.g., Scardovia, Escherichia-Shigella, and / or Streptococcus)', decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa), interleukin-1 P (IL-ip), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life.

[0013] In some embodiments of any of the aspects, the postbiotic comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species. (0014] In some embodiments of any of the aspects, the postbiotic comprises the products of fermentation of herbal material comprising ashwagandha root and elderberry, with at least one Bifidobacterium species and at least one Lactobacillus species.

[0015] In some embodiments of any of the aspects, the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms; (b) preparing a fermentation substrate composition; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and (e) lyophilizing or spray-drying the fermented inoculate composition to obtain the postbiotic composition.

[0016] In some embodiments of any of the aspects, the fermentation substrate composition comprises: herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0017] In some embodiments of any of the aspects, the fermentation substrate composition comprises: herbal material comprising ashwagandha root and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0018] In some embodiments of any of the aspects, the fermentation substrate composition further comprises one or more of glucose, sucrose, fructose, honey, and molasses.

[0019] In some embodiments of any of the aspects, the herbal material further comprises an herb of the Astragalus family and / or a legume of the Lens orientalis or Lens culinaris family.

[0020] In some embodiments of any of the aspects, the herbal material further comprises Astragalus membranaceus root and / or and red lentil.

[0021] In some embodiments of any of the aspects, the fermentation substrate comprises: about 2% by weight to about 10% by weight ashwagandha; about 2% by weight to about 10% by weight elderberry; about 2% by weight to about 10% by weight Astragalus membranaceus root; about 0.5% by weight to about 3% by weight red lentil; about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses; and / or about 70% by weight to about 95% by weight water.

[0022] In some embodiments of any of the aspects, the predetermined amount of time is about 24 hours to about 10 days.

[0023] In some embodiments of any of the aspects, the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0024] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, B. longum, and any combination thereof. (0025] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0026] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108 CFU / mL to about 1x1012 CFU / mL.

[0027] In some embodiments of any of the aspects, administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition.

[0028] In one aspect, described herein is a method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.

[0029] In one aspect, described herein is a method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms comprising B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei; (b) preparing a fermentation substrate composition comprising herbal material comprising ashwagandha root and elderberry in combination with liquid water sufficient to suspend or submerge the herbal material; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and (e) lyophilizing or spray-drying the fermented inoculate composition to obtain the postbiotic composition. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to describe the manner in which the advantages and features of the disclosure can be obtained, reference is made to embodiments thereof which are illustrated in the appended drawings. Understanding that these drawings depict only exemplary embodiments of the disclosure and are not therefore to be considered limiting of its scope, the principles herein are described and explained with additional specificity and detail through the use of the accompanying drawings.

[0031] Fig. 1 is a schematic showing an exemplary study design for treatment of Parkinson’s disease. DETAILED DESCRIPTION

[0032] The present disclosure provides methods for using postbiotic compositions with advantageous metabolite and secondary metabolite and organic acid levels and profiles to treat or prevent the disruption of the gut-brain axis. As used herein, the term “gut-brain axis” refers to the gut-produced or modulated hormones, gut bacterial metabolites, etc. that influence fiinction of the central and / or peripheral nervous system (e.g., neurons, glial cells, and the like). Postbiotics comprise primary and secondary metabolic products, molecular cues that can be membrane-bound or dissolved, secreted products created by probiotic microorganisms, and / or components of microbial substrates converted or not by microbial activity that influence the gut microbiome and its host.

[0033] According to at least one aspect of the present disclosure, the presently disclosed postbiotic compositions are effective in treating or preventing a neurological disease or disorder. In some aspects, the postbiotic compositions can be used to treat or prevent a synucleinopathy, which is a group of neurodegenerative disorders in which the protein alpha-synuclein accumulates abnormally to fonn inclusions in the cell bodies or axons of neurons or oligodendrocytes and is associated with multisystem neurodegeneration.

[0034] Non-limiting examples of diseases or disorders associated with synucleinopathy include movement disorders, parkinsonism (Parkinson's disease, pantothenate kinase-associated neurodegeneration), dementia (Parkinson's disease dementia, dementia with Lewy body), and autonomic dysfunction (pure autonomic failure, multiple system atrophy). In some embodiments, the subject to be treated has or is diagnosed with a disease or disorder selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA). In some embodiments, the subject to be treated has or is diagnosed with REM Sleep Behavior Disorder, which is characterized by complex motor enactment of dreams and is a potential prodromal marker of Parkinson's disease (PD).

[0035] The presently disclosed gut microbiome protecting postbiotic compositions can be prepared according to a process that uses fermentation. In particular, the presently disclosed compositions provide probiotics combined with fermented herbal substrates, and compounds from microbial activity that protects, stimulates and stabilizes a healthy gut ecosystem, thereby protecting the gut-brain axis. It has been surprisingly discovered that the fermentation provides postbiotic compositions with metabolite profiles that can be used to treat or prevent disruption of the gut-brain axis. In particular, the fermentation results in postbiotic compositions with elevated advantageous metabolites, such as 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, organic acids such as citric acid, succinic acid, lactic acid, glycerol and acetic acid, as well as indole organic acids, and vitamin C.

[0036] As used herein, the term “postbiotic” or “postbiotics” is defined as the metabolites in, the secondary metabolites of, and the secretions, membrane proteins, intra- and / or extra- cellular components of a microbial community.

[0037] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition. In some embodiments of any of the aspects, the fermentation substrate is or comprises an herbal substrate composition or herbal material. In some embodiments of any of the aspects, the substrate composition or herbal material comprises at least one of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus, and a legume of the Lens orientalis or Lens culinaris family. The substrate composition also comprises liquid water, e.g., sufficient to suspend or submerge the plant substrate material.

[0038] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising at least one of an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus, and a legume of the Lens orientalis or Lens culinaris family, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0039] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0040] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0041] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0042] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material.

[0043] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least two of the following: B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0044] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with at least two of the following: B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or £. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0045] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0046] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal material comprising ashwagandha root and elderberry, in combination with B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, and liquid water sufficient to suspend or submerge the herbal material.

[0047] In some embodiments of any of the aspects, the herbal material is provided as a dried powder prior to combination with water. In some embodiments of any of the aspects, the dried powder comprises dried powder of a juice.

[0048] In some embodiments of any of the aspects, the herb of the Astragalus family is Astragalus membranaceus. In some embodiments of any of the aspects, the herb of the Astragalus family is Astragalus membranaceus root. In some embodiments of any of the aspects, the herb is provided as a dried powder.

[0049] In some embodiments of any of the aspects, the herb of the Solanaceae or nightshade family is ashwagandha root. In some embodiments of any of the aspects, the herb is provided as a dried powder.

[0050] In some embodiments of any of the aspects, the berry of the Sambucus L. genus is elderberry. In some embodiments of any of the aspects, the berry is provided as a dried powder.

[0051] In some embodiment of any of the aspects s, the legume of the Lens orientalis or Lens culinaris family is a lentil. In some embodiments of any of the aspects, the legume is red lentil. In some embodiments of any of the aspects, the legume is provided as a dried powder.

[0052] In some embodiments of any of the aspects, the fermentation substrate comprises at least an herb of the Astragalus family and an herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, an herb of the Solanaceae or nightshade family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Astragalus family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha root and elderberry (e.g., elderberry juice). In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate comprises a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, an herb of the Astragalus family, an herb of the Solanaceae or nightshade family, a berry of the Sambucus L. genus and a legume of the Lens orientalis or Lens culinaris family. [0053) In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and Ashwagandha. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises elderberry and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, ashwagandha and elderberry. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, ashwagandha and red lentil. In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus, elderberry and red lentil.

[0054] In some embodiments of any of the aspects, the fermentation substrate further comprises one or more of glucose, sucrose, fructose, honey, and molasses. In some embodiments of any of the aspects, the fermentation substrate further comprises glucose, sucrose, fructose, honey, or molasses.

[0055] The pH of the fermentation substrate can vary, and can change over the course of fermentation. In some embodiments of any of the aspects, the pH of the fermentation substrate is from about 5.0 to about 8.0. In some embodiments of any of the aspects, the pH of the fermentation is from about 5.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 8.0, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0 or about 7.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g., during the fermentation). In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 4.2 (e.g., end of fermentation). In some embodiments of any of the aspects, the pH of the end product of the fermentation process (e.g., a postbiotic composition) is from 5.0 to 8.0.

[0056] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising at least one herbal material selected from Astragalus membranaceus root, ashwagandha, elderberry and red lentil, in combination with liquid water sufficient to suspend or submerge the herbal material.

[0057] In some embodiments of any of the aspects, the fermentation substrate composition further comprises glucose, sucrose, fructose, honey, or molasses. In some embodiments of any of the aspects, the fermentation substrate composition further comprises a source of fermentable sugar, e.g., glucose, sucrose, fructose, malt extract, molasses, honey, or other fermentable sugar.

[0058] In some embodiments of any of the aspects, the herbal material is provided as a dried powder prior to combination with water.

[0059] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and Ashwagandha.

[0060] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and elderberry.

[0061] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root and red lentil.

[0062] In some embodiments of any of the aspects, the fermentation substrate comprises ashwagandha and elderberry.

[0063] In some embodiments of any of the aspects, the fermentation substrate comprises elderberry and red lentil.

[0064] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha and elderberry.

[0065] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha and red lentil. (0066] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, elderberry and red lentil.

[0067] In some embodiments of any of the aspects, the fermentation substrate comprises Astragalus membranaceus root, ashwagandha, elderberry and red lentil.

[0068] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight herb of the Astragalus family. In some embodiments of any of the aspects, the substrate composition comprises from about 2.5% by weight to about 5% by weight herb of the Astragalus family.

[0069] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight Astragalus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight Astragalus.

[0070] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight herb of the Solanaceae or nightshade family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight herb of the Solanaceae or nightshade family.

[0071] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight ashwagandha. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight ashwagandha.

[0072] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight berry of the Sambucus L. genus. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight berry of the Sambucus L. genus.

[0073] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight elderberry. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight elderberry.

[0074] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses.

[0075] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 2.5% by weight to about 5% by weight glucose, sucrose, fructose, honey, or molasses.

[0076] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 3% by weight legume of the Lens orientalis or Lens culinaris family. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 1.5% by weight legume of the Lens orientalis or Lens culinaris family.

[0077] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 3% by weight red lentil. In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 0.5% by weight to about 1.5% by weight red lentil.

[0078] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 70% by weight to about 95% by weight water.

[0079] In some embodiments of any of the aspects, the fermentation substrate composition comprises from about 80% by weight to about 90% by weight water.

[0080] In some embodiments of any of the aspects, the fermentation substrate composition comprises: from about 2.5% by weight to about 5% by weight Astragalus', from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; from about 0.5% by weight to about 1.5% by weight red lentil; and from about 80% by weight to about 90% by weight water.

[0081] In some embodiments of any of the aspects, the fermentation substrate composition comprises: from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; from about 0.5% by weight to about 1.5% by weight red lentil; and from about 80% by weight to about 90% by weight water.

[0082] In some embodiments of any of the aspects, the substrate composition comprises: from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; and from about 80% by weight to about 90% by weight water.

[0083] In some embodiments of any of the aspects, the substrate composition comprises: from about 2.5% by weight to about 5% by weight Astragalus; from about 2.5% by weight to about 5% by weight ashwagandha; from about 2.5% by weight to about 5% by weight elderberry; from about 2.5% by weight to about 5% by weight sucrose or molasses; and from about 80% by weight to about 90% by weight water.

[0084] In some embodiments of any of the aspects, the fermentation substrate further comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0085] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. infantis, B. longum. and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infantis (B. infantis).

[0086] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0087] In some embodiments of any of the aspects, the fermentation substrates comprise at least 2 (e.g., at least 3. at least 4, at least 5, or 6) of the following: B. lactis. B. infantis, B. breve. L. paracasei. L. rhamnosus. and / or L. casei. In some embodiments of any of the aspects, the fermentation substrates comprise at least 2 (e.g., at least 3, at least 4, at least 5, or 6) of the following: B. lactis, B. longum, B. breve, L. paracasei, L. rhamnosus, and / or L. casei.

[0088] In one aspect, described herein is a postbiotic composition, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms; (b) preparing a fermentation substrate composition as described herein, e.g., an herbal fermentation substrate composition as described herein; (c) inoculating the fennentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition and; (e) lyophilizing or spray-drying the fermented inoculate composition to obtain the postbiotic composition.

[0089] In some embodiments of any of the aspects, the postbiotic composition further comprises a carrier. In some embodiments of any of the aspects, the carrier is resistant starch or maltodextrin.

[0090] In some embodiments of any of the aspects described herein, the predetermined amount of time for fermentation is from about 24 hours to about 10 days. In some embodiments of any of the aspects, the predetermined amount of time is from about 24 hours to about 8 days, about 24 hours to about 7 days, about 24 hours to about 6 days, about 24 hours to about 5 days, about 24 hours to about 4 days, about 24 hours to about 72 hours, about 24 hours to about 48 hours, about 24 hours to about 36 horns, about 36 hours to about 8 days, about 36 hours to about 7 days, about 36 hours to about 6 days, about 36 hours to about 5 days, about 36 hours to about 4 days, about 36 hours to about 72 hours, about 36 hours to about 48 hours, about 48 hours to about 8 days, about 48 hours to about 7 days, about 48 hours to about 6 days, about 48 hours to about 5 days, about 48 hours to about 4 days, about 48 hours to about 72 hours, about 72 hours to about 8 days, about 72 hours to about 7 days, about 72 hours to about 6 days, about 72 hours to about 5 days, or about 72 hours to about 4 days. In some embodiments of any of the aspects, the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0091] In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. infantis, B. longum, and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infantis (B. infantis).

[0092] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0093] It is contemplated that in some embodiments of any of the aspects, other immune-supportive bacteria can be used, alone or in combination with species described herein, to ferment substrates as described herein to provide postbiotic compositions as described herein. Examples are provided, for example, in Schluter et al.. Nature 588: 303-307 (2020). the contents of which are incorporated herein by reference in their entirety.

[0094] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108 CFU / mL to about IxlO12 CFU / mL. In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 109 CFU / mL to about lx 1011 CFU / mL.

[0095] In some embodiments of any of the aspects, the culture of microorganisms further comprises de Man, Rogosa & Sharpe (MRS) broth. In some embodiments or any of the aspects, the fermentation substrate or culture of microorganisms does not include MRS broth. In some embodiments or any of the aspects, the fermentation substrate or culture of microorganisms does not include any animal product.

[0096] In some embodiments of any of the aspects, fermenting the inoculate composition comprises sealing the inoculate composition in a fermentation vat under substantially anaerobic conditions.

[0097] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 40°C. In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 37°C.

[0098] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained < 1.5%.

[0099] In some embodiments of any of the aspects, the inoculate composition is maintained at a pH from about 5.0 to about 8.0. In some embodiments, the pH of the fermentation is maintained from about 5.0 to about 7.5. In some embodiments, the pH of the fermentation is maintained from about 5.0 to about 7.5, about 5.0 to about 7.0. about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5. about 6.2 to about 7.0. about 6.2 to about 6.8. about 6.2 to about 6.6. about 6.2 to about 6.4. about 6.4 to about 8.0. about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8. about 6.4 to about 6.6. about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0 or about 7.0 to about 7.5. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g., during the fermentation). In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 4.2 (e g., end of fermentation). In some embodiments of any of the aspects, the pH of the end product of the fermentation process (e.g.. a postbiotic composition) is from 5.0 to 8.0.

[00100] In some embodiments of any of tire aspects, the final bacteria content post fermentation is about 1.0 x 108 to about 1 x 1011 colony-forming units per milliliter (cfu / ml) of living bacteria. In some embodiments of any of the aspects, the final bacteria content post fermentation is about 1.0 x 109 to about 1 x 1010 cfu / ml. In some embodiments of any of the aspects, the final bacteria content post fermentation is about 1.0 x 106 to about 1.5 x 109 cfu / ml.

[00101] In some embodiments of any of the aspects, the bacterial content after drying (e.g., spray drying or freeze drying) is about 1 x 10s active-fluorescent units per gram (afu / g; e.g.. using flow cytometry) to about 2 x 109 afu / g of bacterial cells, e.g., living or non-living. In some embodiments of any of the aspects, the bacterial content after drying is about 1 x 108 afu / g to about 1.5 x 109 afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 1 x 1()8 afu / g to about 1 x 1 ()9 afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108 afu / g to about 2 x 109 afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108 afu / g to about 1.5 x 109 afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108 afu / g to about 1 x 109 afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108 afu / g to about 8.8 x 108 afu / g. In some embodiments of any of the aspects, the bacterial content after drying is about 5 x 108 afu / g to about 8.5 x 108 afu / g. In some embodiments of any of the aspects, the bacterial content after dry ing is about 5 x 108 afu / g to about 8.2 x 108 afu / g. In some embodiments of any of die aspects, the bacterial content after dry ing is about 5 x 108 afu / g to about 8.0 x 108 afu / g.

[00102] In some embodiments of any of the aspects, the postbiotic composition after dry ing (e.g., spray drying or freeze dry ing) comprises non-viable or non-living bacteria. In some embodiments of any of the aspects, the postbiotic composition after drying (e g., spray drying or freeze drying) comprises a low level of viable or living bacteria. In embodiments where the postbiotic composition is administered to an immunocompromised subject, it is beneficial for the composition to comprise a low level of viable or living bacteria. In embodiments where the postbiotic composition is administered to a non-immunocompromised subject, the composition can comprise viable or non-viable bacteria.

[00103] In some embodiments of any of the aspects, the bacterial content after spray drying is about 0 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is greater than 0 efu / g of living or viable bacteria. In some embodiments of any of tire aspects, the bacterial content after spray drying is less than 100,000 efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 10' efu / g of living or viable bacteria. In some embodiments of any of the aspects, the bacterial content after spray drying is less than 101 efu / g, less than 102 efu / g, less than 103 efu / g. less than 104 efu / g, less than 105 efu / g. less than 1()6 efu / g, or less than 107 efu / g of living or viable bacteria.

[00104] In some embodiments of any of the aspects, the bacterial content after freeze drying is at most about 1010 efu / g. In some embodiments of any of the aspects, the bacterial content after freeze drying is less than 101 efu / g, less than 102 efu / g, less than 103 efu / g. less than 104 efu / g, less than 105 efu / g, less than 106 efu / g. or less than 107 efu / g.

[00105] In some embodiments of any of the aspects, the viability7 of the bacteria in the postbiotic composition after drying (e.g., spray drying or freeze drying) is at most 10%. In some embodiments of any of the aspects, the viability of the bacteria in the postbiotic composition after dry ing (e.g., spray drying or freeze drying) is at most 0.01%. at most 0.02%, at most 0.03%. at most 0.04%, at most 0.05%, at most 0.06%. at most 0.07%, at most 0.08%, at most 0.09%, at most 0.1%. at most 0.2%, at most 0.3%, at most 0.4%, at most 0.5%, at most 0.6%, at most 0.7%, at most 0.8%, at most 0.9%, at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%. at most 8%, at most 9%, or at most 10%.

[00106] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from Table 2.

[00107] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, an indole organic acid or any combination thereof.

[00108] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, lutcolin, N-[(2S)-2-hydroxypropanoyl]-L-lcucinc, and any combination thereof. The postbiotic composition can also include organic acids produced by the fermentation, including, for example, citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[00109] In some embodiments of any of the aspects, the postbiotic composition comprises each of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin and N-[(2S)-2-hydroxypropanoyl]-L-leucine and an indole organic acid.

[00110] In some embodiments of any of the aspects, the postbiotic composition comprises one or more organic acids produced by the fermentation, selected from citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[00111] In some embodiments of any of the aspects, the postbiotic composition comprises each of citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[00112] Exemplary amounts in the final fermentation broth include 0.5 to 3.0 g / L citric acid. 0.02 to 0.9 g / L succinic acid, 2.0 to 20 g / L lactic acid, 0.1 to 2.5 g / L glycerol, and 1.0 to 20 g / L acetic acid. An exemplary organic acid profile for tire final fermentation broth includes 1.18 g / L citric acid, 0.1 g / L succinic acid, 14.69 g / L lactic acid, 0.55 g / L glycerol, and 7.73 g / L acetic acid. See also an example of organic acid content over fermentation time in Table 1.

[00113] Table 1: Organic Acid Content Concentration (g / L) Time (hr) Citric Acid Succinic Acid Lactic Acid Glycerol Acetic Acid 0 2.839 0.236 0.769 0.119 0.029 49 2.55 0.601 6.207 n.d. 3.801 96 2.493 0.73 12.611 n.d. 5.716

[00114] In some embodiments of any of the aspects, the postbiotic composition comprises one or more components selected from 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and indole organic acids. In some embodiments of any of the aspects, the indole organic acids comprise indole-3-acetate and / or indole-3-lactate.

[00115] In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from Table 2. Hundreds of metabolites exhibited a significant increase in concentration in the postbiotic product. In these increased metabolite categories, the average increase was calculated at 5.6 fold. In some embodiments of any of the aspects, the postbiotic composition comprises at least one metabolite selected from: 3-Hydroxybutyric acid, 6-Methoxysalicylic acid, trans-caffeic acid, Phloroglucinol carboxylic acid, 1, 6. 8-trimethyl-allantoate, Vitamin C, wedelolactone, 9, 10-Dihydroxystearic acid. Isorhamnetin, Pseudopurpurin, Quercetin, Luteolin, 2-Ethylglutaric acid, and Phloionolic acid (see e.g., Table 2).

[00116] Table 2: Non-limiting examples of metabolites in the postbiotic composition. Metabolite Enriched in fermentation %-age increase Description 3- Hydroxybutyric acid 4.0 68% • increases brain-derived neurotrophic factor (BDNF) • clinical relevance in the treatment of depression, anxiety, and cognitive impairment 6-Methoxysalicylic acid 4.0 68% • role as a bacterial metabolite • discovered to have highest cox-1 inhibitory compounds, thus anti-inflammatory • See e.g.. Periwal et al 2022, PLoS Comp Biol (PMID: 35468126) trans-caffeic acid 5.0 85% • bioavailable plant organic compound Phloroglucinol carboxylic acid 5.0 85% • metabolite of the microbiota from quercetin conversion • See e.g.. Kawabata et al. 2019 Molecules (PMID: 30669635) 1,6,8-trimethyl-allantoate 10.0 170% involved in direct interactions of gut microbiome and host See e.g., Gao et al. 2014 Biomed Res Int (PMID: 25126572) Vitamin C 15.0 254% wedelolactone 18.0 305% • a plant-derived natural product • increased bioavailability • anti-inflammatory • antioxidant • anticancer • antiosteoporosis 9,10-Dihydroxystearic acid 21.0 356% • natural product • decreased in intensity over time during high fat diet • See e.g., Curtasu et al 2020 Metabolites (PMC7697781) Isorhamnetin 22.0 373% • major active substance of Puhuang, a traditional herb medicine widely used in clinical practice • quercetin is a katabolic product of Isorhamnetin Pseudopurpurin 25.0 424% • improves bone geometry • selectively exhibits tumor inhibitory potential • Humbare 2022 Antioxidants (PMID: 35624869) Quercetin 32.0 542% • suppresses pro-inflammatory cytokines, such as interleukin (IL)-17, tumor necrosis factor alpha, and IL-6 • promotes the production of IL-10 • alleviates Citrobacter rodentium-mAncQA colitis • Sec c.g., Lin ct al 2019 Frontiers Microbiology (PMID: 31156598) Luteolin 34.0 576% • Anti-inflammatory • benefits on nonalcoholic fatty liver disease • reduces blood lipids • reduce intestinal permeability • See e.g., Sun et al. 2019 Bioorg Chern (PMID: 33991837) 2-Ethylglutaric acid 49.0 830% • fatty acid Phloionolic acid 63.0 1067% • natural product • increased bioavailability

[00117] In some embodiments of any of the aspects, the postbiotic composition comprises a metabolite profile exhibiting elevated levels of one or more metabolites selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin. N-[(2S)-2-hydroxypropanoyl]-L-leucine, indole organic acid(s). and any combination thereof.

[00118] In some embodiments of any of the aspects, the postbiotic composition comprises nucleic acid including sequences selected from: B. lactis, B. breve. B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei.

[00119] In some embodiments of any of the aspects, the postbiotic composition comprises at least a portion of the 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus. L. casei, and / or L. paracasei. In some embodiments of any of the aspects, the postbiotic composition comprises the V4 and / or V5 region of the 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments, the V4 and / or V5 region is about 250 base pairs long. In some embodiments of any of the aspects, the postbiotic composition comprises nucleic acid, including nucleic acid molecules that can hybridize with primer sequences (e.g., 16S primer) sequences selected from SEQ ID NOs: 1-13 or nucleic acid complementary to at least one of SEQ ID NOs: 1-13: B. lactis: TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1), B. breve: CCGGATGCTCCATCACAC (SEQ ID NO: 2), B. breve: ACAAAGTGCCTTGCTCCCT (SEQ ID NO: 3). B. infantis: TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4), B. infantis: GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5). L. plantarum-. GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6), L. plantarum-. TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7), L. acidophilus-. CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8). L. acidophilus-. ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9), L. rhamnosus: GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10), J., rhamnosus-. CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11), L. paracasei: CAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12), or L. paracasei'. GCCAATCACCGCATTAATCG (SEQ ID NO: 13). In some embodiments, the primer(s) hybridizes specifically under stringent conditions to a DNA fragment having the nucleotide sequence (e.g., at least a portion of the 16S rRNA gene sequence). As herein used, the term “stringent conditions” means hybridization will occur only if there is at least 95% identity in nucleotide sequences. In another embodiment, hybridization under “stringent conditions” occurs when there is at least 97% identity between the sequences.

[00120] In one aspect, described herein is a postbiotic composition comprising 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone. luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine and an indole organic acid.

[00121] In some embodiments of any of the aspects, the postbiotic composition further comprises bacteria of the genera Bifidobacterium and Lactobacillus.

[00122] In some embodiments of any of the aspects, the postbiotic composition further comprises an rRNA (e.g., 16S RNA) having a nucleic acid sequence at least 90% identical to one of SEQ ID NO: 14-16 (B. lactis), SEQ ID NO: 17-20 (B. breve), SEQ ID NO: 21-26 (B. infantis), SEQ ID NO: 27-32 (L. plantarum), SEQ ID NO: 33-39 (L. acidophilus), SEQ ID NO: 40-44 (L. rhamnosus). SEQ ID NO: 45-48 (L. paracasei). or SEQ ID NO: 49-52 (L. casei).

[00123] In some embodiments of any of the aspects, the postbiotic composition further comprises one or more organic acids selected from citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[00124] In some embodiments of any of the aspects, the postbiotic composition comprises each of citric acid, succinic acid, lactic acid, glycerol and acetic acid.

[00125] In one aspect, described herein is an oral postbiotic formulation, the formulation comprising a composition as described herein (e.g., a postbiotic composition). In one aspect, described herein is a composition for oral delivery, the composition comprising a postbiotic composition as described herein, formulated for oral delivery.

[00126] In some embodiments of any of the aspects, the oral postbiotic formulation is formulated as a tablet, pill, capsule, or microcapsule.

[00127] In some embodiments of any of the aspects, the oral postbiotic formulation is formulated for buccal, sublabial, or sublingual administration.

[00128] In some embodiments of any of the aspects, the oral postbiotic formulation is a liquid suspension. In some embodiments of any of the aspects, the formulation comprises a liquid suspension.

[00129] In one aspect, described herein is a pharmaceutical composition comprising a composition as described herein (e.g., a postbiotic composition) and a pharmaceutically acceptable carrier.

[00130] In one aspect, described herein is a method of preparing a postbiotic composition, the method comprising: (a) preparing a culture of microorganisms; (b) preparing a fermentation substrate composition as described herein, e.g., an herbal fermentation substrate; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; and (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition.

[00131] In some embodiments of any of the aspects, the predetermined amount of time is from about 24 hours to about 10 days, or a period therebetween as described herein above.

[00132] In some embodiments of any of the aspects, the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[00133] In some embodiments of any of die aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. In some embodiments of any of the aspects, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, B. longum, and any combination thereof. In some embodiments of any of the aspects, the B. longum is B. longum subspecies infantis (B. infantis).

[00134] In some embodiments of any of the aspects, the Lactobacillus is selected from the group consisting of L. plantarum. L. acidophilus, L. rhamnosus, L. paracasei. L. casei, and any combination thereof.

[00135] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108 CFU / mL to about 1x1012 CFU / mL.

[00136] In some embodiments of any of the aspects, the culture of microorganisms comprises a microorganism concentration from about 1.0 x 109 CFU / mL to about IxlO11 CFU / mL.

[00137] In some embodiments of any of the aspects, fermenting the inoculate composition comprises sealing the inoculate composition in a fermentation vat under substantially anaerobic conditions.

[00138] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 40°C.

[00139] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises incubating the inoculate composition at a temperature from about 33°C to about 37°C.

[00140] In some embodiments of any of the aspects, fermenting the inoculate composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained < 1.5%.

[00141] In some embodiments of any of the aspects, the pH of the fermentation is maintained in the range of about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4,, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 7.5, about 6.8 to about 7.0, or about 7.0 to about 7.5. In some embodiments of any of the aspects, the inoculate composition is maintained at a pH from about 6.0 to about 6.8. In some embodiments of any of the aspects, the pH of the fermentation is from about 3.5 to 6.7 (e.g., during the fermentation). In some embodiments of any of die aspects, the pH of the fermentation is from about 3.5 to 4.2 (e.g., end of fermentation). In some embodiments of any of the aspects, the pH of die end product of the fermentation process (e.g., a postbiotic composition) is from 5.0 to 8.0.

[00142] In some embodiments of any of the aspects, the method further comprises lyophilizing the fermented inoculate composition to obtain the postbiotic composition. In some embodiments of any of the aspects, the method further comprises spray-drying the fermented inoculate composition to obtain the postbiotic composition.

[00143] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition for oral delivery.

[00144] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition as a tablet, pill, capsule, or microcapsule.

[00145] In some embodiments of any of the aspects, the method further comprises formulating the postbiotic composition in a liquid suspension.

[00146] In one aspect, described herein is a pharmaceutical composition comprising a composition (e.g., a postbiotic composition) prepared by a method as described herein, and a pharmaceutically acceptable carrier.

[00147] In some embodiments of any of the aspects, administering to the subject comprises oral administration in the form of a tablet, pill, capsule, or microcapsule.

[00148] In some embodiments of any of tire aspects, administering to the subject comprises buccal, sublabial, or sublingual administration.

[00149] In some embodiments of any of tire aspects, administering to the subject comprises oral administration in the form of a liquid suspension.

[00150] According to at least one aspect of the present disclosure, a method of preparing a postbiotic composition is provided. The method can include preparing a culture of microorganisms and herbal fermentation substrate composition as described herein, e.g., an herbal fermentation substrate as described herein, followed by inoculating the herbal substrate composition with the culture of microorganisms to generate an inoculate composition. The method can also include fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition. The fermented inoculate composition can be lyophilized to obtain the postbiotic composition.

[00151] In some embodiments, the postbiotic composition can further comprise a carrier, e.g., a carrier suitable for spray drying and / or freeze drying (also referred to as lyophilization). In some embodiments, the carrier is resistant starch (e.g.. digestion resistant starch). In some embodiments, the carrier comprises maltodextrin. In some embodiments, the carrier comprises resistant maltodextrin (e.g., FIBERSOL). In some embodiments, the carrier comprises at least one prebiotic fiber co-drying agent. The term “excipient'’ can be used interchangeably with “carrier.”

[00152] The predetermined amount of time can be as described herein above. In at least some instances, the culture of microorganisms comprises at least one microorganism selected from the group consisting of Bifidobacterium and Lactobacillus. In some cases, the culture of microorganisms comprises Bifidobacterium. In some cases, the culture of microorganisms comprises Lactobacillus. The Bifidobacterium can be selected, for example, from the group consisting of B. lactis (also referred to as B. animalis subsp. lactis), B. breve, B. infantis, and any combination thereof. The Lactobacillus can be selected, for example, from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[00153] In at least some aspects, the culture of microorganisms can comprise a microorganism concentration from about 1.0 x 108 CFU / mL to about lx 1012 CFU / mL, or from about 1.0 x 109 CFU / mL to about IxlO11 CFU / mL. or from about 1.0 x 109 CFU / mL to about IxlO10 CFU / mL, or from about 1.0 x 108 CFU / mL to about IxlO11 CFU / mL. In some embodiments, the postbiotic compositions described herein are prepared by spray-drying. In some embodiments, the bacterial content after spray drying is about 0 efu / g. In some embodiments, the postbiotic compositions described herein are prepared by freeze-drying. In some embodiments, the bacterial content after freeze drying is at most about 1010 efu / g. The fermentation substrate composition can be as described herein above.

[00154] In some embodiments, the postbiotic composition comprises nucleic acid including sequences from the plant and / or bacterial species described herein. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. Such nucleic acids can include DNA or RNA indicative of any one of these bacterial species. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following plant genera or species: the Astragalus family, the Solanaceae or nightshade family, the Sambucus L. genus, and / or the Lens orientalis or Lens culinaris family. In some embodiments, the postbiotic composition comprises nucleic acid including sequences selected from any of the following plant genera or species: Astragalus membranaceus, Astragalus complanatus, ashwagandha (species Withania somnifera. family Solanaceae), elderberry (species Sambucus nigra) and / or red lentil (species lens culinaris or L. culinaris subsp. orientalis). Such nucleic acids can include DNA or RNA indicative of any one of these plant genera or species.

[00155] In some embodiments, the plant is an Astragalus species, e.g., Astragalus membranaceus or Astragalus complanatus (see e.g., Accession number NC 065024.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NOs: 5354 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 53-54 or a fragment thereof.

[00156] SEQ ID NO: 53 Astragalus complanatus 18S Accession number NC065024.1.

[00157] SEQ ID NO: 54 KY316029.1 Astragalus membranaceus.

[00158] In some embodiments, the plant is an Withania species, e.g., Withania somnifera (see e.g., Accession number NC_047245.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NO: 54-58 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical one of SEQ ID NO: 54-58 or a fragment thereof.

[00159] SEQ ID NO: 55 Withania 18S. Accession number NC_047245.1.

[00160] SEQ ID NO: 56 Withania 18S. Accession number NC_047245.1.

[00161] SEQ ID NO: 57 Withania 18S. Accession number NC_047245.1.

[00162] SEQ ID NO: 58 Withania 18S. Accession number NC_047245.1.

[00163] SEQ ID NO: 59 Withania 18S. Accession number NC_047245.1.

[00164] In some embodiments, the postbiotic composition comprises at least one compound produced by any of the following plant genera or species: the Astragalus family, the Solanaceae or nightshade family, the Sambucus L. genus, and / or the Lens orientalis or Lens culinaris family. In some embodiments, the postbiotic composition comprises Withanolides (e g., Withaferin A): the Withanolides can be produced by ashwaganda root. In some embodiments, the postbiotic composition comprises at least one of the following compounds, that can be produced by elderberry: Anthocyanins (e.g., cyanidin-3-glucoside: e.g., measured using a pH-Differential method): Anthocyanins (e.g., cyanidm-3-glucoside; e.g., measured using HPLC); Polyphenols (e.g., catechin; e.g.. measured using Folin-Ciocalteu reagent); and / or Polyphenols (e.g., expressed as gallic acid equivalent; e.g., measured using Folin-Ciocalteu reagent).

[00165] In some embodiments, the microorganism is Bifidobacterium lactis (also referred to as Bifidobacterium animalis subsp. lactis), e.g., strain DSM 10140 (see e.g.. NCBI Reference Sequence: NC_012815.1 for an exemplary B. lactis genome sequence). In some embodiments, the microorganism is B. lactis strain BLC1- (Centro sperimentale del Latte (CSL) / SACCO). In some embodiments, the microorganism is B. lactis strain PBP1418518. In some embodiments, a nucleic acid primer for 16S sequencing of B. lactis comprises TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 14-16 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 14-16 or a fragment thereof.

[00166] In some embodiments, the microorganism is Bifidobacterium breve, e.g., strain ATCC 15700 (see e.g., RefSeq: NZCP006712.1 for an exemplar}7 B. breve genome sequence). In some embodiments, the microorganism is B. breve strain Bbr8 (CSL / SACCO). In some embodiments, the microorganism is B. breve strain PBP2741300. In some embodiments, a nucleic acid primer for 16S sequencing of B. breve comprises CCGGATGCTCCATCACAC (SEQ ID NO: 2) or ACAAAGTGCCTTGCTCCCT (SEQ ID NO: 3). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 17-20 or a nucleic acid sequence that is at least 80%. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 17-20 or a fragment thereof. For further non-limiting examples of 16S rRNA-gene-targeted Bifidobacteria-specific primers, see e.g., Matsuki et al., Appl Environ Microbiol. 2004 Jan; 70(1): 167-173 (see e.g., Table 1 of Matsuki 2004). the contents of which are incorporated herein by reference in their entirety.

[00167] In some embodiments, the microorganism is Bifidobacterium infantis (also referred to as Bifidobacterium longum subsp. infantis) e.g., strain ATCC 15697 (see e.g., RefSeq: NC_015052.1 for an exemplary B. infantis genome sequence). In some embodiments, the microorganism is B. infantis strain SP 37 (CSL / SACCO). In some embodiments, the microorganism is B. infantis strain PBP234451. In some embodiments, a nucleic acid primer for 16S sequencing of B. infantis comprises TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4) or GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 21-26 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 21-26 or a fragment thereof.

[00168] In some embodiments, the microorganism is Lactobacillus plantarum (also referred to as Lactiplantibacillus plantarum), e.g., strain Korean Agricultural Culture Collection (KACC) 11451 (see e.g., RefSeq: NZ CP030105.1 for an exemplar}’ L. plantarum genome sequence). In some embodiments, a nucleic acid primer for sequencing of L. plantarum comprises GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6) or TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 27-32 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 27-32 or a fragment thereof. For further non-limiting examples of 16S rRNA-gene-targeted Lactobacillus-specific primers, see e.g., Kim et al.. BMC Microbiology volume 20, Article number: 96 (2020) (see e.g., Table 1 of Kim 2020). the contents of which are incorporated herein by reference in their entirety.

[00169] In some embodiments, the microorganism is Lactobacillus acidophilus, e.g.. strain KACC 12419 (see e.g., RefSeq: NC 021181.2 for an exemplary L. acidophilus genome sequence). In some embodiments, a nucleic acid primer for 16S-23S region sequencing of L. acidophilus comprises CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8) or ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9) In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 33-39 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 33-39 or a fragment thereof.

[00170] In some embodiments, the microorganism is Lactobacillus rhamnosus (also referred to as Lacticaseibacillus rhamnosus). e.g., strain Korean Collection for Type Cultures (KCTC) 3237 (see e.g., RefSeq: NZCP086326.1. NZ LR134331.1, or ASM284801vl for an exemplary L. rhamnosus genome sequence). In some embodiments, the microorganism is L. rhamnosus strain CRL1505 (CSL / SACCO). In some embodiments, the microorganism is L. rhamnosus strain PBP4542118. In some embodiments, a nucleic acid primer for 16S-23S region sequencing of L. rhamnosus comprises GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10) or CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11) In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 40-43 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 40-43 or a fragment thereof.

[00171] In some embodiments, the microorganism is Lactobacillus paracasei (also referred to as Lacticaseibacillusparacasei), e.g., strain KACC 12361 (see e.g., RefSeq: NC_014334.2 for an exemplary’ L. paracasei genome sequence). In some embodiments, the microorganism is L. paracasei strain IMC502 (CSL / SACCO). In some embodiments, the microorganism is L. paracasei strain PBP5197148. In some embodiments, a nucleic acid primer for sequencing of L. paracasei comprises CAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12) or GCCAATCACCGCATTAATCG (SEQ ID NO: 13). In some embodiments, the microorganism comprises a nucleic acid sequence (e.g.. 16S sequence) comprising one of SEQ ID NO: 45-48 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 45-48

[00172] In some embodiments, the microorganism is Lactobacillus easel, e.g., strain BGP 93 (CSL / SACCO) (see e g., RefSeq: NZAP012544.1 or CP017065 for exemplary L. easel genome sequences; see e.g., Kang et al.. Front Immunol. 2017; 8: 413, the contents of which are incorporated herein by reference in their entirety ). In some embodiments, the microorganism is L. casei strain PBP4157051. In some embodiments, the microorganism is L. casei strain DSM 20011, JCM 1134, ATCC 393, or LC5.In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., 16S sequence) comprising one of SEQ ID NO: 49-52 or a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NO: 49-52

[00173] In some embodiments of any of die aspects, the bacterial strain is selected from Table 3. While specific strains of bacteria are named herein, other strains of these species are contemplated to perform in a similar manner. As a non-limiting example, to determine whether any given strain of a species is effective, the strain can be substituted for another strain of the same species in the fermentation process of the fermentation substrate composition to prepare the postbiotic composition. The postbiotic composition prepared using the substituted strain can be tested for efficacy compared to the postbiotic composition prepared using the original strain. Non-limiting examples of tests for efficacy include cell or animal models or human clinical testing of diseases and disorders such as dysbiosis; a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA).

[00174] Table 3: Exemplary Bacterial Strains (sequence GENBANK accession number and location of gene of interest, e.g., rRNA genes, 16S, 23S, 5S) Bifidobacterium animalis (Bifidobacterium animalis subsp. lactis) NHMR02000002.447733-450831 CP0075 22.17745 81 -1777619 CP003039.1862400-1865487 NHMR02000002.456838-459936 CP007755.1854987-1858079 CP002915.1770950-1774006 NHMR02000002.3 57105-360203 GQ340908.1-511 CP003 941.1894164-1897251 JG YM01000004.99960-102996 CP022724.426063-429157 CP002915.1867126-1870182 ABOT01000014.1-2831 GQ340904.1-481 CP003039.1871099-1874186 PHUS01000023.178-932 GQ340905.1-530 CP009045.1862414-1865509 AHGW01000005.465993-469070 CP001853.463423-466479 CP001892.1867944-1871070 AHGW01000005.171115-174192 CP015407.798614-801712 CP003497.1471384-1474509 PESQ01000015.402-3312 CP003497.1871201-1874327 CP003498.1471389-1474515 PESQ01000044.176-943 CP003498.1871423-1874549 CP001892.1771715-1774841 PHUS01000019.2351-4620 CP031703.292508-295603 CP003497.1766264-17693 90 PESQO1000016.2351 -4620 CP004053.1766069-1769153 CP003498.1766484-1769610 QDIR01000003.165853-168948 CPOO1606.1471265-14743 91 CP002567.1484779-1487856 QDIV01000030.239-3334 CP001853.168853-171909 CPOO1515.1871313-1874439 QDIPO1000008.4098-7193 CP007522.14713 27-1474424 CP004053.1471267-14743 51 QDIK01000002.90881-93976 CPO 15407.1251722-1254820 CP001892.1476835-1479961 CBUQO10000001.199-3 287 CP003039.1766112-1769199 CP007522.1879511-1882543 CBUQO10000003.88687-91877 CP007522.1870805-1873900 CP007522.1765921-1769016 QDIUO1000009.2351 -5446 CP007755.1863694-1866786 CP031703.301218-304313 CBWX010000074.246-3332 CP003 941.1794711 -1797800 CPO 17098.1876987-1880082 QDIO01000050.2336-5431 CP003497.1862491-1865617 CP002915.1875836-1878891 A WFQ01000007.2552-5646 CP003498.1862713-1865839 CP009045.1471213 -14743 08 QDINO1000004.165858-168953 CP022724.34874-37967 CPO 17098.1868277-1871372 MLZL01000021.2277-5365 CP001853.559666-562722 CP009045.1871124-1874219 QDIZ01000011.2345-5440 CP003941.1885457-1888543 CP017098.1771957-1775051 AWFM01000016.239-3334 CP001515.1471333-1474459 CP017098.1476864-1479959 QDIZ01000052.1-359 CPOO 1606.1766146-1769272 CP022724.434771-437864 A WFP01000017.240-3334 CPOO1213.902284-905348 CP010433.1891255-1894380 QDILO1000005.165858-168953 CP002567.1856200-1859280 CP022724.329746-332839 A WFL01000014.239-3334 CP015407.889242-892341 CPO 10433.1476837-1479963 QDIT01000009.239-3334 CP001892.1876654-1879780 CP028460.1764167-1766624 AWFN01000009.252-3349 CP001213.1080287-10833 50 CP010433.1882545-1885671 AWFO01000013.3194-6288 CP001606.1862373-1865501 CPO10433.1876767-1879938 NIGRO 1000004.165695-168757 CP002567.1764176-1767254 CP028460.1856191-1858647 CP001853.568367-571423 CP001515.1766374-1769500 CPO 10433.1868040-1871166 A WFK01000023.2268-5362 CP001606.1871087-1874213 CP031154.1476721-1479816 CPO15407.789509-792607 CP003039.1471229-1474316 CP031703.692417-695511 NIGQ01000005.165695-168757 CP002915.1476216-1479272 CP010433.1771720-1774845 FTRP01000009.342-3322 CP004053.1862387-1865471 CP031154.1771603-1774697 CP00405 3.1871094-1874178 CP003941.1493276-1496365 CP028460.1484769-1487229 QSUF01000014.3937-7032 CP002567.1864911-1867986 CP028460.1864899-1867356 FTRE01000009.342-3322 CPOO 1515.1862603-1865729 CP031703.397539-400632 QSSU01000013.5254-8349 CP009045.1766093-1769188 CP031154.1867923-1871018 Bifidobacterium breve PKGQO1000008.2197-5277 ACCG02000014.1-1799 CP010413.2274068-2277141 JG YRO1000006.88316-91378 BCXQ01000015.45340-48402 CP006714.2222715-2225775 NAPZO1000021.449-2485 BCXOO1000053.1982-5044 CP021387.1477845-1480905 MWVR01000023.1-1394 BCXXO1000043.1786-4849 CP021388.2276729-2279790 AVQEO1000009.123432-126512 BCXP01000010.8139-11201 CP021393.2276773-2279833 NAQG01000032.537-3600 BCXNO1000046.6481-9543 CP021553.2369819-2372879 AVQA01000016.2002-5083 BCXS01000057.141-3098 CP006711.1481840-1484903 AVQB01000011.1889-4970 QDIS01000011.267-3347 CP006715.1558123-1561185 NAQI01000022.2323-5385 BCXXO1000023.121613-124571 CP006715.2247131-2250193 BCXMO1000027.261696-264759 BCXP01000010.1891-4953 CP006716.1553646-1556709 BCXS01000055.149-3211 BCXL01000101.2196-5259 CP010413.552370-555443 AVQDO1000023.1896-4976 FNFWO1000004.174218-177270 CP006716.2194146-2197209 MWVRO1000020.1-1747 A WUG01000001.567561-570622 CP006716.2200394-2203457 MWVRO1000021.1-1173 AWFR01000017.262-3342 CP019596.1613108-1616188 AF V VO 1000031.2196-5256 AWFTO1000016.1989-5067 CP023192.1533021-1536082 AFXX01000047.2198-5261 BCXL01000027.260918-263876 CP023195.1533048-1536109 MWVRO 1000024.442-1217 A WFS01000022.81-3161 CP023197.1533046-1536107 AVQCO1000028.1785-4865 AWFU01000011.270-3350 CP021385.2197977-2201037 JDUD01000016.2023-5085 AWSX01000035.280-3342 CP021392.2298990-2302051 BCXX01000044.124990-128053 AWFV01000032.137-3217 CP006713.2272548-2275608 BCXL01000099.373-3331 FNFW01000022.6643-9695 CP021553.1696481-1699541 BCXTO1000047.1981-5043 LFII01000018.29-1478 CP021556.2310591-2313651 BCXQO1000006.2096-5158 CP006712.2192941 -2196001 CP021555.2195706-2198766 BCXMO 1000015.23265-26223 ATCB01000001.1-3062 CP021559.1635063-1638123 BCXNO1000054.47799-50861 NIGSO1000008.116386-119425 CP006713.1590347-1593407 BCXW01000037.1900-4963 NJOG01000035.1-1163 CP021385.1533136-1536195 BCXS01000053.1786-4848 FTRLO1000008.1892-4954 CP0213 92.1609244-1612305 BCXU01000019.382-3339 PNHM01000012.2778-5858 CP021387.2160069-2163129 BCXM01000024.373-3331 LRPPO 1000035.1-1152 CP0213 88.2282979-228603 9 BCXLO1000068.6717-9780 BBAOO1000074.2191-5245 CP021393.2283024-2286085 BCXSO1000009.274-33 36 LFIT01000019.1-1669 CP021554.1588698-1591756 BCXPO1000019.12059-15016 NJO AO 100003 5.1-3074 CP021384.1556548-1559608 BCXM01000025.373-3331 NJOG01000036.263-1157 CP021389.2419632-2422693 BCXR01000051.221-3283 ATCB01000003.457-3519 CP021389.1749967-1753028 BCXTO 1000057.145412-148369 CP021555.2201953-2205013 CP021394.2317813-2320873 BCXT01000059.2153-5215 CP021559.2380434-2383492 CP021386.1505976-1509035 BCX VO 1000028.1895-4957 FTRK01000007.382-3340 CP021392.2305241-2308302 BCXQO 1000006.8346-11408 CPOOO3O3.1610117-1613177 CP010413.2267833-2270906 BCXN01000037.1428-4385 CP023198.2328111-2331171 CP023198.1646572-1649632 MWVR01000018.205053-205443 GQ340900.1-906 CP021386.2225223-2228283 BCXM01000024.6618-9576 NJOF01000022.13-1230 CP021386.2231459-2234518 BCXOO1000043.127349-130306 NJOBO100003 3.1-604 CP023194.2197821-2200881 BCXPO 1000024.135929-138886 NJODO1000026.1-2142 CP0213 90.2293765-2296825 BCXU01000018.382-3339 CP002743.683712-686759 CP021557.2185059-2188120 BCXV01000029.1895-4957 AP012324.1556553-1559613 CP021384.2174804-2177862 BCXR01000050.377-3334 ATCB01000002.688345-691407 CP021389.2425880-2428941 BCXO01000054.374-3331 ATCB01000002.1-3062 CP023192.2197852-2200913 BCXLO 1000100.6614-9572 AP012324.2174820-2177874 CP021390.1610175-1613235 BCXU01000041.48330-51392 NJOB01000035.1-1819 CP021557.1556372-1559430 BCXWO1000036.1900-4963 CP000303.2315331-2318391 CP021391.2314226-2317286 BCXQO 1000007.2096-5158 CP002743.2232959-2236013 CP021552.2328108-2331168 BCXL01000100.373-3331 CP021555.1592874-1595934 CP021558.2507190-2510251 BCXV01000028.8130-11192 CP021556.1664886-1667946 CP021391.2307975-2311036 BCXOO1000051.1982-5044 CP023195.2197984-2201045 CP021552.1646573-1649633 BCXQ01000009.383-3340 CP023197.2197883-2200944 CP021558.2500114-2503175 BCXOO 100005 5.3 74-3 3 31 CP006714.1506536-1509596 CP0213 91.1667860-1670921 BCXP01000011.373-3330 CP002743.2226712-2229765 CP021558.1782121-1785182 BCXUO1000018.6626-9583 CP019596.2323125-2326205 CP023196.1533054-1536114 BCXW01000038.383-3341 CP019596.2329373-2332453 CP023196.2197930-2200991 BCXOO 100005 3.8219-11281 CP021387.2166302-2169362 CP023199.2386695-2389754 BCXS01000056.149-3211 CP0213 94.1627964-1631024 CP021390.2302560-2305620 BCXT01000048.382-3339 CP021554.2216991-2220051 CP021557.2191312-2194373 MNLA01000015.343-2254 CP006712.1505194-1508255 CP023199.1635080-1638139 BCXR01000046.1634-4591 CP006711.2148819-2151882 CP023194.1532997-1536055 BCXVO1000039.127171-130233 CP021388.1573876-1576936 CP023199.2380446-2383504 PNHM01000011.6787-9867 CP021393.1566630-1569691 CP023193.2197778-2200839 BCXP01000013.373-3330 CP021553.2363571-2366631 CP023193.1533043-1536104 A WUF01000002.3 3 46-6408 CP021556.2316841-2319901 Bifidobacterium Ionium infantis CCWT01000056.14-3060 NAQJO100002 3.2566-5629 LN824140.1109875-1112929 CCWS01000051.14-3060 BCYF01000104.332-3393 AP010890.2121545-2124610 CCWN01000056.14-3060 CC WP01000060.6461 -9510 APO 10889.2757707-2760771 BCYG01000058.1-1181 BCYG01000043.56936-58116 AP010889.962798-965862 BCYF01000055.67-3051 BCYG01000038.1-1181 AP010890.2290976-2294041 JNWB01000028.2168-5223 BCYG01000026.1-1307 LN824140.1661400-1664451 CCWR01000050.14-3060 BCYG01000031.1-1181 LN824140.1858333-1861387 CCWQ01000054.189-3238 UAQL01000033.607-3670 CP010411.1734220-1737284 CCWR01000050.6175-9224 BCYG01000032.375-3337 LN824140.1852153-1855204 ABQQO1000041.2175-523 5 BCYG01000030.1-1179 AP010889.2539588-2542652 CCWU01000050.6175-9224 BCYF01000054.143-3206 AP010890.2299614-2302679 .1DTT01000098.92-3053 BC YFO1000087.106436-109489 AP010889.2751543-2754607 CCWU01000050.14-3060 UAQLO 1000014.719245-722308 CP001095.2755591-2758448 CCWP01000060.297-3346 MOAF01000031.39089-42139 CP001095.963165-966022 UAQLO1000032.205924-207042 GQ340901.1-895 CP001095.2761755-2764612 CCWO01000067.6427-9476 CP001095.2539820-2542677 CP010411.657870-660934 CCWO01000067.263-3312 AP010890.1577985-1581050 CP010411.454596-457660 Lactobacillus acidophilus UGNR01000002.1-2298 MNPO01000001.413502-416405 AB09263 3.206-665 UGNR01000002.916171 -919076 MNPO01000002.354985-357888 AB092642.216-672 UGNRO1000002.924101 -927006 CBLR010000038.101-3004 KC161273.1-427 UGNR01000002.520355-523260 CBLPO10000007.101-3004 CP000033.415728-418779 UGNRO 1000001.62722-65627 NXEYO1OOOO33.151-1480 RBHY01000021.96-3006 UGNRO1000001.1-2299 CBLP010000014.64525-67428 CP00003 3.1627955-1631003 UYIX01000011.1546621-1549539 CBLT010000017.1006-3909 JN368427.1-745 UYIX01000009.1089868-1092786 NXE YO1000006.152872-155782 AB092631.209-696 UYIXO1000009.346942-349860 CBLTO10000012.64463-67366 AJ620360.1-2891 UYIXO1000011.7253 94-728312 CBLSO10000044.189-3092 MG752953.1-1244 UYIX01000011.238841-241759 CBLT010000003.101-3004 A YUB01000062.293-3081 BDHM01000014.293-3081 CBLQ010000055.1-2779 CP005926.415727-418808 LWSH01000065.1-1873 NXEY01000032.1-1509 CPOOOO33.1630739-1632556 LWSH01000069.1-836 CBLTO 10000019.101 -3004 AB092630.209-696 QAHLO1000020.187-3097 AF182726.210-661 CP020620.1281087-1283997 QAHQ01000047.1-843 AZCS01000022.101-3004 CP017062.1627228-1630138 QAHQ01000051.1-353 ACHNO1000040.101-3004 CP005926.1627499-1630579 QAHR01000025.96-3006 BALR01000023.292-3078 CP017062.436000-438910 QAHQ01000052.1-531 CP005926.60960-64040 CP017062.415780-418690 QAHMO1000023.96-3006 JRUT01000009.96-3006 CP005926.435948-439028 QAHSO1000020.187-3097 NIGU01000015.195-3091 CP017062.61020-63930 QAHQ01000049.1-664 A YUB01000055.880-3700 CP020620.70406-73316 QAZY01000020.187-3097 AB092634.225-709 CP020620.1706056-1708966 QAHT01000020.187-3097 CPOOOO33.435949-438999 CP010432.416090-418995 Q AI INO1000020.187-3097 CP020620.90625-93535 CP010432.61327-64232 QAHPO1000018.187-3097 A YUA01000140.1-1685 CP010432.436310-439215 QAHQ01000048.1-807 CPOOOO33.60957-64007 CP022449.729894-732804 QAHQ01000059.1-309 AB092632.210-684 CP010432.1628306-1631211 BCVR01000014.293-3081 AJ438156.210-689 CP022449.375134-378044 QAHO01000020.187-3097 AB092620.209-697 CP022449.1942103 -1945013 QAZXO1000020.187-3097 KC161284.1-671 CP022449.750111-753021 CBLPO10000002.101-3004 Lactobacillus casei LCUNO 1000026.1-2441 MODS01000034.2128-5047 MODT01000028.5-2924 LDE JO 1000075.1-702 MODS01000025.157-3076 AY221481.1-556 JPKN02000019.29079-31998 KC161274.1-786 AJ542550.1-353 LDEJO1000078.1-702 FM177140.1986676-1989475 AFI 82729.225-685 LCUNO 1000018.1-3 82 JXNVO1000061.128-3043 KC161276.1-856 AFYS01000097.827-1232 FM177140.260644-263559 AY221474.1-556 QAZD01000125.336-1720 AJ542555.1-352 AP012544.651131-654050 LNQD01000056.793-3592 KC161263.1-715 AP012544.2478882-2481801 JPKN02000021.33624-36543 KC161264.1-718 AJ542561.1-340 AFYS01000105.580-931 KC161265.1-688 AP012544.711187-714106 AFYK01000008.2720-5637 AY221471.1-556 HE970764.1984824-1987739 LDEJ01000001.1-1400 FM177140.2639820-2642619 AF098107.1-1287 QAZE01000108.20-2939 LS991421.1772971-1775770 CPO17065.274780-277699 AFYMO1OOO133.1-424 AY221480.1-556 LS991421.749481-752396 LDEJO 1000068.1-851 AP012544.211890-214809 APO 12544.1785700-1788619 JPKN02000001.159860-162779 AY221472.1-556 HE970764.908184-911099 QAZD01000113.41-2875 AY221482.1-556 AB092640.223-705 AFYSOl 000021.20527-23444 FM177140.909841-912756 AY221478.1-556 AFYK01000016.1-372 BD107104.2-2751 HE970764.260608-263523 LTDPO1000051.11022-13937 AY112676.1-557 HE970764.886510-889425 AFYM01000079.20977-23894 KC161277.1-735 CP006690.780180-783097 AFYSOl 000042.55792-56280 AY221475.1-556 CP017065.778359-781278 FXZN01000024.423-3222 AY221479.1-556 LS991421.2481497-2484296 MPOP01000089.2059-4978 AJ542556.1-351 AY112675.1-560 FM177140.888163-891078 AB109025.226-704 CP017065.2602394-2605313 JUPZ01000178.35-2950 LS991421.298439-301354 CP017065.1873810-1876729 JUQW01000199.64-2863 AY221476.1-556 CP006690.278340-281257 B AL S01000124.22-2821 KC161266.1-713 CP006690.799547-802464 AZOE01000162.18-1091 LS991421.769905-772820 CP006690.1836273-1839190 AWZQ01000366.2-1315 HE970764.2636323-2639238 CP017065.801255-804174 MODT01000024.157-3076 AY221473.1-556 CP006690.2469049-2471967 AZCOO 1000094.128-3043 AY221477.1-556 Lactobacillus paracasei JYBDO1000071.128-3043 ANLE01000030.125-3044 CPO13921.2761902-2764821 QVHW01000051.5-2924 ANKB01000105.125-3044 CP001084.796507-799422 AQPP01000001.260865-263770 ANMI01000270.24-2941 CP013921.515170-518089 AQPPO1000006.252371 -255276 ANJT01000005.1-1546 CP017261.1492633-1495552 PKQ.T01000048.125-3044 ANKI01000149.5-2924 CP002616.260642-263557 AQPP01000009.605644-608559 ANK V01000065.111 -2909 CP014985.1600926-1603844 AQPP01000009.600587-603502 ANKY01000105.128-3044 CP025582.1986706-1989608 AQPP01000016.62953-65868 ANLG01000694.230-3149 CP0023 91.27673 0-279645 RCFI01000003.1690584-1693503 ANMN01000001.128-3043 CP001084.1782359-1785274 PKQJ01000093.1-396 ANKH01000527.5-2924 CP002618.2630785-2633584 AFYOO 1000009.1-382 ANJY01000202.5-2924 CP016355.2612922-2615840 AF YQO1000091.13157-13586 ANKD01000024.5-2924 CP025582.273208-276122 MWVE01000057.125-3044 BAYO01000006.111-2910 CP002391.795807-798722 AFYP01000020.875-3792 ANMN01000130.126-3043 CP001084.777140-780055 AFYL01000005.8980-11897 AN JV01000255.125-3044 CP001084.2434661-2437576 NOKL01000002.2119828-2122743 QMJF01000007.337-3256 CP002391.1862810-1865725 AF YTO1000013.7069-7489 ANMK01000201.126-3043 AP018392.1988835-1991740 AF YLO1000041.968-1425 ANJX01000426.239-3158 CP013921.2072431 -2075350 AFYT01000046.53948-54418 MKFZ01000076.1572-4482 CP002618.257941-260856 AF YQO 1000010.1-511 ANJZ01000001.125-3043 CP017261.2666438-2669357 AFYU01000103.226-3143 ANKJO 1000077.5-2924 CP005486.1966610-1969527 NOKL01000002.2792646-2795561 ANKF01000177.5-2924 CP001084.278212-281127 NOKL01000002.1414872-1417671 JVDQ01000084.128-3043 CP002616.2599898-2602697 NOKL01000002.741022-743821 CP014985.978915-981834 CP002618.880145-883060 NOKL01000002.2773205-2776120 QMJVO1000112.125-3044 CP017716.799676-802595 BAGT01000081.il 1-2910 JVUBO1000142.64-2863 CP002616.1947764-1950563 AFYOO 1000056.1-342 ANKK01000016.125-3044 APO 183 92.2671098-2673 897 AFYN01000039.173625-174028 ANMH01000131.6-2923 CP029686.647565-650484 AFYP01000028.159237-159700 ANKV01000091.6-2922 CP017716.2497923-2500842 AFYR01000129.582-954 JVNIO1000042.422-3221 CP002391.2500295-2503210 AFYP01000004.1-440 JVUA01000226.344-3217 CP013921.1586454-1589373 AFYP01000018.168852-169235 QMJW01000133.234-3153 CP013921.1564702-1567621 AF YNO1000040.7582-10499 CP005486.2687409-2690326 CP032637.1657331-1660250 ARNV02000013.382265-385064 CP017716.819117-822036 CP017261.403745-406664 AFYTO1000014.1-476 AJ542563.1-370 CP017261.426901-429820 AFYR01000012.73045-75962 J VNI01000043.420-3219 CP016355.290838-293756 RCFIO1000003.2202534-2205453 NCSO01000009.730-3645 CP016355.953173-956092 AFYO01000023.46683-49600 JVUA01000259.1854-4727 CP029686.2614715-2617632 AFYQ01000064.46893-49810 NCSN01000021.102454-105371 CP016355.1970977-1973896 ARNV02000003.606215-609130 NC SPO1000023.172796-175713 CP012148.2629309-2632226 ANKW01000115.123-2922 JVDQO1000102.490-3289 CP016355.972537-975456 ANKY01000144.128-3029 QMJP01000122.904-3 823 CP007122.112736-115655 BDIT01000061.128-3041 JVDQ01000020.2062-4977 CP007122.2436073-2438992 ANKM01000146.5-2924 JVNI01000059.il 1-2910 CP005486.935230-938147 ARNV02000010.48774-51573 AP012541.799669-802588 CP005486.274272-277189 MWVD01000103.124-3043 AP012541.2608884-2611803 CP007122.1978957-1981876 AFYQ01000065.1-456 CP000423.2501036-2503550 CP012148.909974-912891 AFYT01000008.879-3796 MKF YO 1000031.3 29-3 03 3 CP007122.1957007-1959926 NIGW01000035.14-2923 AB109028.224-694 CP007122.939212-942131 ARNV02000001.261345-264260 AP012541.258903-261822 CP025582.2608203-2611002 ARNV02000003.584537-587452 CP000423.1825733-1828247 CP026097.905657-908572 LGIYO1000002.2462 87-249206 AB109026.225-712 CP012148.1974186-1977103 QXET01000145.1-779 MKG AO 1000043.86-3001 CP025582.905987-908902 AUYM01000009.125-3044 AP012541.819244-822163 CP026097.19863 97-1989301 QXET01000132.1-1015 AY221470.1-556 CP029686.628199-631117 NXETO1000001.1486-4275 CP025582.886623-889538 CP012148.269317-272234 NXES01000001.1009-3928 MO AGO 1000022.1900-4819 CP012148.890533-893450 QXET01000102.5-2924 CP002616.890255-893170 CP026097.886295-889208 ANLFO1000280.5-2924 CPO14985.998357-1001276 CP012187.245662-248581 ANKLO1000407.125-3044 MBTZ01000129.5-2924 CP032637.1051199-1054118 AZGH01000016.20261-23176 AF182724.225-685 CP026097.273209-276124 QRBHO1000041.215-3130 CP029686.1925852-1928771 CP012187.2465034-2467953 ANJSO1000169.7-2926 CP032637.3010302-3013221 CP012187.1808296-1811214 AN JU01000123.125-3044 AYYJ01000181.135-2934 CP012187.768777-771696 BAYN01000045.il 1-2910 CP017261.2119204-2122123 CP029686.1209017-1211935 NDXH01000075.1-1400 CP005486.954596-957513 CP026097.2607764-2610563 ANML01000168.126-3043 CP017716.285086-288005 CPO 12187.744041 -746960 AP012541.1879414-1882333 CP000423.261698-264212 CP029546.2488232-2491151 QXET01000222.1-329 CPO 17716.1837722-1840641 CP032637.2366308-2369227 ANKC01000028.125-3044 CP000423.825967-828481 CP029536.598172-600969 ANJWO1000490.5-2924 CP002391.776440-779355 CP029536.1920349-1923263 ANKW01000201.18-2935 CP000423.847717-850231 CP029546.743643-746562 ANKA01000137.125-3044 CPO14985.2314829-2317748 CP032637.1031834-1034753 ANMM01000074.6-2923 AP018392.948523-951438 CP029536.2946091-2948890 ANMJO1000090.126-3043 CP002618.901823-904738 CP029546.1822428-1825347 ANJT01000004.1-590 CP014985.2975376-2978295 CP029536.1941358-1944271 ANKEO1000660.5-2924 CP002618.1978650-1981449 CP029546.763009-765928 ACGY01000021.6-1348 CP002616.911933-914848 CP029536.1304492-1307407 ANMH01000061.111-2910 AP018392.929083-931997 CP029546.249849-252768 ANKG01000193.1-2871 AP018392.289327-292242 Lactobacillus plantarum JSUWO1000107.1916-4834 MKDV0100003 9.140-3058 CP017374.2849941-2852863 JSUX01000107.203-3009 QMJU01000098.188-3110 CP017406.1550753-1553559 QBKX01000050.290-3096 QMJRO1000080.100-3022 CP018209.2494073-2496991 QBKWO1000066.290-3096 AB092636.211-684 CP017406.2263106-2266014 JMEL01000116.1985-4901 KC161272.1-681 CP014780.2471956-2474878 MJHI01000068.309-3115 LKLZ01000013.1-1152 CP017954.584052-586974 MJ AMO 1000014.49646- 52452 MKEB01000094.2021-4939 CP021997.681976-684898 MJHJO1000047.80-2 998 MKDZ01000034.329-3247 CP019348.831360-834285 MJHKO1000031.202-3008 CP018324.181357-184279 CP018209.1662658-1665464 MJHGO1000067.1937-4855 MKEG01000037.1916-4834 CPO 19722.489693-492615 MJHD01000007.284-3090 LKHZ01000001.823379-826299 CP016071.1529433-1532355 MJHH01000017.1844-4762 MKDY01000030.360-3166 CP022294.2914570-2917492 MCOL01000001.2093797-2096717 QMJE01000030.17-2939 CP023771.484016-486938 LZXZ01000028.1-591 MKDH01000022.1810-4728 CP017954.1430807-1433729 LZXZ01000020.332445-333232 MKDK01000036.1925-4843 CP004406.1983506-1986425 MJHCO1000023.290-3096 FMBQ01000065.1925-4843 CP017954.2027576-2030498 LZXZ01000019.691030-691392 AGRIO 1000003.162285-165204 CP005942.2764119-2767037 AVF J02000024.24040-26961 JHWAO1000027.1404250-1407168 CP011769.1835336-1838258 A VFIO1000045.1886-4808 LUWG01000131.189-3109 CP022373.995554-998476 LZXZ01000014.1-1215 MEG Y01000029.77620-80426 CP017066.2021423-2024345 AVFI01000113.33084-33501 MEG Y01000065.140-3012 CP004406.2408034-2410953 LDEL01000022.1-1764 LUWX01000124.189-3109 CP004082.1359287-1362205 NKCZ01000027.189-3109 LUWY01000010.189-3109 CP016071.683251-686173 NQNQ01000042.2046-4968 LUX JO 1000104.189-3109 CP020816.1134208-1137125 LWKN01000138.137-3059 LUI IN01000063.1-579 CP032460.1609394-1612316 AVFJ02000001.133133-136055 LUXG01000072.189-3109 CP032648.2656491-2659413 OKQT01000093.191-3107 LUXB01000078.145-3065 CP017363.1109529-1112451 PEGWO1OOOO35.13-2935 CPO 13149.1942992-1945914 CP017374.478745-481667 OKQP01000080.191-3107 LUXF01000016.189-3109 CP006033.1076904-1079823 LMVD01000097.31-2951 LUHN01000077.1-373 CP012650.2306881-2309803 OKQV01000099.191-3107 MEG Y01000071.103-2909 CPO 18209.127503 8-1277844 MCOL01000001.511668-514588 F J VLO 1000032.22170-24976 CP017066.1153446-1156368 QAHFO1000047.1-53 8 CP019348.1848495-1851417 CP021086.1489538-1492343 LDELOl 000024.1-546 AB092638.212-683 CP018324.1034746-1037668 LDEM01000002.712273-715070 LKHZ01000002.1132871-1135751 CP004082.733183-736101 LNCPO1000005.802632-805554 AL93 5263.2015 966-2018885 CP011769.2322414-2325336 AVAQ01000039.121-3043 LKCO01000035.137-3059 CP025586.1489914-1492832 MCOE01000001.2575115-2578035 LUWF01000065.189-3109 CP025988.2500260-2503178 LDELO1000006.153080-153991 LUWU01000015.189-3109 CP017363.503808-506730 LNCP01000004.361-3283 FMBS01000207.370-3176 CP017066.501182-504103 LNCP01000006.1-1923 LKHZ01000002.693042-695962 CP006033.515910-518829 AVFJ02000055.9211-12133 JXAX01000030.17-2939 CP018209.811321-814127 MCOL01000001.1218531-1221451 AGRI01000001.299538-302457 CP012650.691990-694912 QAHH01000017.188-3110 LUWN01000024.163-3083 CP018324.1318125-1321047 JPSU01000012.586575-589483 LUXN01000006.3565-6485 CP019722.1096963-1099885 QAZQ01000017.188-3110 LUXE01000014.138-3058 CP021932.2526653-2529575 JZSBO1000005.47847-50765 MKDX01000039.213-3135 CP023728.2491914-2494836 QAZS01000019.137-3059 MKEE01000035.139-3057 CP020816.2014188-2016994 NQNI01000043.1-570 MKED01000017.139-3057 CP004406.2858596-2861515 NKRH01000025.2095-5017 JHWA01000003.78378-81183 CPO 19722.1951442-1954364 MCOL01000001.3037459-3040379 LUWI101000063.73-2993 CP021086.2105663-2108571 JPSU01000004.1-2746 MH624119.1-2922 CP019722.2436175-2439097 QOSF01000003.1913-4834 MH624121.1-3706 CP020861.1106044-1108966 NQNE01000028.1-636 CPO13149.2887265-2890187 CP012122.1453299-1456218 LDELOl 000025.1-547 LUXI01000015.189-3109 CP020861.481509-484431 QAHG01000032.188-3110 LUWQ01000054.189-3109 CP012650.1181538-1184460 FKLQO1000016.1-1699 LUWL01000007.31-2951 CP012343.1670520-1673442 FKLQO1000030.313 927-316733 LUXK01000044.189-3109 CP022294.1104008-1106930 AXDQ01000020.32253-35171 LUSM01000042.1-303 CP018324.2530093-2533015 NQNE01000011.420262-420613 LUHNO1000018.1-564 CP021528.2697152-2700072 NQNE01000022.1-2191 AL93 5263.2941803-2944722 CP010528.2511370-2514292 LJDC01000068.1-401 MEGY01000013.140-3058 CP020816.489843-492761 NQNI01000031.1-1892 AGRI01000003.807476-810395 CP010528.503295-506217 AXDQ01000052.58-2976 AGRIO 1000010.177928-180847 CP025586.189392-192198 JZ SBO1000011.165 97-19403 LUWP01000028.189-3109 CP021501.499232-502152 JZSB01000015.111505-114311 LUXD01000007.189-3109 CP021932.2061104-2064026 QAHF01000044.135-2429 PZPN01000092.188-3110 CP022294.1961784-1964706 QAZOO1000030.188-3110 CP013753.1412228-1415150 CP022373.2575987-2578909 Q AI IF01000052.1-346 AB092637.212-701 CP021086.64413 8-647056 QAHE01000024.188-3110 LUWW01000030.189-3109 CP018324.1750277-1753199 JPSU01000005.136384-139302 LUXM01000017.1-1120 CP020093.2911279-2914085 NQNI01000042.188-571 KC109451.1-680 CP009236.491411-494329 LJDC01000054.1-401 CP010528.1171257-1174179 CP021997.1145185-1148107 LJDCO1000069.1-401 LUXL01000034.157471-160391 CP020093.1976877-1979683 QAZP01000028.188-3110 JQAWO1000005.102-3020 CP020564.1058404-1061324 LJDC01000047.1-583 CP022373.3027547-3030469 CP009236.2000194-2003112 JZSB01000002.109373-112291 LUXCO1000022.189-3109 CP021086.146212-149130 QAZR01000025.188-3110 NJPU01000011.189-3109 CP022294.483653-486575 PEGOO100003 9.462- 3 3 84 LUXHO1000090.189-3109 CP025412.2415175-2418097 PEBE01000031.13-2935 LUWSO1000007.189-3109 CP025590.204603-207520 JPSU01000011.22866-25672 LRUO01000038.137-3059 CP025988.1738374-1741292 AXDQ01000131.12090-14998 MEG Y01000047.68816-71622 CP023174.1290913-1293835 AXDQ01000092.4233-7039 .TOJT01000024.163-3083 CP021997.2635585-2638507 PEGJ01000041.188-3110 PZQK01000072.19-2941 CP020861.1975117-197803 9 PEGS01000042.13-2935 BD107240.10-2929 CP020861.2901831-2904753 AXDQ01000112.10152-12958 CP023174.1837024-1839946 CP023174.3135290-3138212 AWTS01000185.360-3166 LKLZO1000003.848448-851368 CP021932.2992051-2994973 FKLQ01000028.4324-5920 MKDT01000006.1808-4726 CP020093.2418751 -2421557 PEGI01000034.13-2935 MKDW01000021.100-3022 CP020564.472107-475027 AZEJO1OOOO33.2184-5102 MKFX01000021.202-3008 CP009236.1108333-1111251 FWXC01000001.2016129-2018935 MKDU01000042.1798-4716 CP020861.2461072-2463994 NQNI01000030.188-3110 MKD SO 1000022.1782-4700 CP020564.2812013-2814933 PEGM01000040.13-2935 KC109452.339-746 CP020816.2494527-2497333 JZSB01000012.280041-282847 AF182722.211-673 CP021501.2470413-2473333 PEGP01000039.13-2935 LUXA01000024.138-3058 CP011769.1012672-1015594 LJDC01000037.1-401 LUWJ01000006.189-3109 CP021501.1144241-1147161 LJDCO1000067.1-401 CP001617.1156864-1159783 CP020093.508572-511490 LTCDO1000061.188-3110 KC161282.1-696 CP020564.2358971-2361891 FKLQ01000036.22437-25243 ASJE01000130.134-3056 CP009236.2916554-2919472 LJDCO 1000046.1-401 AGRIO1000006.626817-629736 CP021086.2878419-2881337 AXZV01000022.141-3060 CP013149.2425011 -2427933 CP020816.2944084-2946890 LJDCO 1000041.1-401 CP001617.2857559-2860478 CP026743.575947-578869 LGIM01000013.1-1425 MKDQ01000018.352-3158 CP023490.491639-494561 AUTE01000080.1-2786 MKDA01000064.193-3115 CP023772.2911687-2914609 PVNNO1000013.1889-4811 MKGF01000047.329-3011 CP021501.1995703-1998623 LYUK01000015.138-3058 AL935263.504868-507787 CP012122.2910937-2913859 PEGK01000037.462-3384 AL93 5263.1171166-1174085 CP021528.2056693-2059613 LSST01000060.188-3110 LUWO01000069.158-3078 CP023771.1922576-1925500 PEGU01000018.13-2935 LUWC01000011.158-3078 CP012343.2953735-2956657 PEGT01000015.39-2961 LUWT01000036.158-3078 CP011769.2706012-2708934 LSND01000049.157-3079 LUHN01000007.7531-8747 CP029349.700760-703682 PEKIO1000076.1-1169 LUWI01000010.475931 -478851 CP021528.1179917-1182837 LJDC01000044.1-739 LUXM0100003 3.144637-147557 CP022373.185104-188026 PEGQ01000039.188-3109 LUWK01000023.158-3078 CP021932.1159757-1162679 LJDCO 1000045.1-518 LUWEO100003 9.189-3109 CP020093.1121054-1123972 LTAUO1000018.145-3065 LUWA01000055.189-3109 CP020564.1910968-1913888 LGIM01000057.119246-119563 LUWR01000004.189-3109 CP009236.2475624-2478542 PEGL01000040.462-3384 LUWB01000047.189-3109 CP024413.1156032-1158954 PEGV01000039.13-2935 CP015126.1987114-1990036 CP021528.753056-755976 LJDCO 1000040.1-401 MH624120.1-2923 CP023771.1061616-1064538 PEGN01000039.188-3110 KC109453.278-729 CP021932.495932-498854 LGIM01000097.29-1557 CP015308.1444435-1447351 CP031318.1088389-1091311 LJDC01000038.1-647 CP026743.2395587-2398509 CP030105.2088451-2091257 QPFUO1000001.491374-494292 AJ542548.1-372 CP025991.3089010-3091933 LEKW01000011.1-2530 CP027349.2886932-2889854 CPO 12650.1576752-1579674 LEAY01000026.il 9-2925 LUXL01000024.407613-408089 CP021501.2905677-2908597 LEBCO 1000047.292-3098 CP013749.1037125-1040047 CP021528.323436-326356 OMOP01000095.191-3107 CP015966.1370391-1373313 CP025586.2419805-2422723 FMBR01000251.1918-4836 CP032460.1180052-1182974 CP023728.1163334-1166256 QXEU01000095.211-2586 CP032648.2194216-2197138 CP032464.1828348-1831270 PEGR01000033.13-2935 CP005942.1024850-1027768 CP023490.2032035-2034957 QPFU01000001.1130322-1133240 CP017379.1061283-1064205 CP023728.2014932-2017854 QPQR01000030.130-3052 LUWZ01000043.189-3109 CP023490.978448-981370 UASUO1000001.1419270-1422188 LUXOO1000021.123964-126884 CP025586.789343-792251 FWXC01000001.2941972-2944778 CP017354.1109529-1112451 CPO 12122.486867-489785 MPLC01000037.1821-4739 CP017379.2850605-2853527 CP032460.2769097-2772019 JIBX01000032.1-1528 CP013149.497314-500236 CP030105.1656595-1659401 RDEYO1000027.1-1387 CP001617.486614-489533 CP026743.1941605-1944526 LBDFO1000013.69812-71946 CPO13753.1863 827-1866749 CP012343.350331-353253 LEAX01000031.290-3096 CP013753.2423757-2426679 CP023771.23 97631-2400553 QPFU01000001.2521782-2524588 CP002222.1985590-1988509 CP012122.935301-938221 LEBW01000018.290-3096 CPO 19348.347087-349996 CP025586.1941081-1943999 AZFR01000081.140-3058 CP015857.9170-12092 CP025988.3106246-3109163 UASUO 1000001.136855-139773 CP015126.1175289-1178211 CP023490.1352508-1355430 QPFU01000001.2025563-2028369 AP018405.2374309-2377227 CP030881.13130-16048 FWXC01000001.1171238-1174156 CP015308.878893-881809 CP025412.483014-485936 LBHSO1000001.1464239-1467161 CP016270.1645484-1648403 CP012343.1193796-1196718 LUWD01000048.145-3065 CP019348.1983926-1986848 CP023728.499203-502125 LUWM01000009.189-3109 CP013749.1488688-1491610 CP023771.2850950-2853872 LEBG01000062.141-3059 CP015966.2807600-2810522 CP031702.1540052-1542974 LEBI01000020.137-3055 CP013749.2048618-2051540 CP024413.1982715-1985637 JIBX01000030.1-1390 CP001617.1982443-1985362 CP023772.2430472-2433394 QPQSO100003 5.72-2994 CP016270.296501-299421 CP032464.489126-492048 QPFU01000001.2960573-2963379 CP022373.1727914-1730836 CP023772.1534443-1537365 LEBV01000020.290-3096 CP004082.2718978-2721896 CP023772.846859-849781 QXEU01000111.1-626 CP013749.2899745-2902667 CP032648.298397-301319 LE AW01000020.141 -2947 CP023174.440810-443732 CP024413.2407246-2410168 LEBR01000050.290-3096 CP013753.565741-568663 CP025412.1078359-1081281 CBZWO10000062.1-2686 CP013753.3274883-3277805 CP025988.806243-809161 UASUO 1000001.2114123-2117040 CP010528.2039478-2042400 CP028977.1125250-1128172 FZSL01000111.140-3012 CP017354.2434261-2437183 CP025590.1738648-1741454 LEBS01000082.174-2980 APO 18405.193 7444-19403 62 CP025412.1934213-1937135 LEBJ01000078.290-3096 CP023728.2946002-2948924 CP025988.1277788-1280706 LEBD01000049.116-2922 APO 18405.1164682-11675 90 CP023490.2623071-2625993 FWXC01000001.2499027-2501833 CP012122.2267052-2269973 CP012650.2883876-2886798 UASUO1000001.590086-593004 CP018209.3136103-3139021 CP023772.17382-20304 LEBT01000061.290-3096 CP023174.2288594-2291516 CP025590.2654460-2657266 NDXC01000084.337-3255 CPO 15126.2467241 -2470163 CP025590.2205535-2208341 UASU01000006.211435-214353 CP012343.2114963-2117885 CP030881.2358764-2361672 CPO13149.1077123-1080045 CPO 173 54.2877400-28803 22 CP031318.2824376-2827298 FWXC01000001.504932-507850 AP018405.500919-503725 CP025991.1073770-1076692 LBHSO1000001.824378-827300 CP015308.2212592-2215508 CP029349.2063132-2066054 LEBA01000066.137-3055 CP005942.4663 86-469304 CP025991.2629573-2632495 AWOY01000006.143-3065 CP017379.483692-486614 CP025991.1816263-1819185 BALV01000030.141-3056 CP017406.3105955-3108873 CP028977.498885-501807 LQHDO1OOOO32.1914-4834 CP011769.453540-456462 CP031771.497317-500235 LEBH01000028.290-3096 CP025412.2854281-2857203 CP032642.1204573-1207495 LEBBO1000046.141-3059 CP017954.2758565-2761487 CP032751.2880765-2883687 LEAZO1000050.182-2988 CP015966.53197-56119 CP031702.2822785-2825707 RDE YO1000026.135-1671 CP002222.2465929-2468848 CP032460.344843-347765 LEAV01000040.290-3096 CP015966.2039576-2042498 CP032648.1735653-1738575 LEBF01000021.290-3096 CP026743.1475989-1478911 CP032359.486897-489819 LOMII01000102.188-3110 CP002222.2915487-2918406 CP032464.3190742-3193664 LEBN01000034.140-3058 CP002222.489648-492567 CPO3O1O5.2534104-2536910 LBHSO 1000002.465880-468802 CP016270.1158827-1161743 CP025590.896368-899286 LEBEO1000053.174-2980 CP026743.3210296-3213218 CP025991.214649-217571 LEBL01000038.290-3096 CP017066.2930737-2933659 CP028977.2028846-2031768 LEBU01000057.240-3046 CP016071.2437340-2440262 CP031318.2339638-2342560 LQHBO1000014.189-3109 CP002222.1134012-1136931 CP031771.1077126-1080044 LQHCO1000054.1914-4834 CP017379.1922234-1925156 CP032642.560683-563605 LEBP01000039.141-3059 CP015857.489172-492094 CP032751.2440379-2443301 LEBMO1000047.290-3096 CP015126.487442-490364 CP029349.1308030-1310952 LBDE01001655.1-1805 CP017363.2388813-2391735 CP028977.2453702-2456624 LBDF01000010.75118-76053 CP017374.1970620-1973542 CPO3O1O5.766317-769235 CP013749.190621-193543 CP017354.1940712-1943634 CP032460.2034535-2037457 APHPO1000043.1844-4766 CP017406.312260-315178 CPO31318.481107-484029 LEBK01000059.290-3096 CP006033.2352904-2355823 CP028977.2887998-2890920 JHWAO1000027.149669-152577 CP019722.2932318-2935240 CP030881.1726312-1729118 NIGV01000012.52132-55044 CPO 16270.2076717-2079637 CP027349.1164485-1167407 PYBS01000026.157-3079 CP014780.494235-497157 CP031702.19278-22200 MKDF01000048.245-3051 CP015308.15426-18342 CP032464.973864-976786 CPOO1617.2406988-2409907 CP015857.1350320-1353242 CP032642.2018330-2021252 LEBQ01000040.141-3059 APO 18405.2860023-2862941 CP032464.2435634-2438556 MKEC01000050.1-2779 CP004082.3178845-3181763 CP027349.1980550-1983472 LEBO01000047.141-3059 CP016071.82305-85227 CP027349.2451406-2454328 QMJN01000080.113-3035 CP016270.2834980-2837899 CP030881.901800-904718 QMJS01000121.137-3059 CP017954.117313-120235 CP032359.2267101-2270023 CPO 15126.2914445-2917367 CPO 14780.1182256-1185178 CP032466.1809877-1812799 CP015308.2682366-2685282 CP021997.1955773-1958695 CP029349.3044017-3046939 MKEHO1000004.141 -2947 CP017066.2483457-2486379 CP029349.2559280-2562202 MAXE01000020.42-1400 CP014780.2038329-2041251 CP030881.466256-469174 NIGLO1000004.510-1897 CP031702.2369418-2372340 CP031702.843836-846758 .1HWA01000027.908102-911020 CP004406.486846-489765 CP032642.2536334-2539256 NTGH01000033.140-3058 CP017363.1895262-1898184 CP032642.2984777-2987699 MKEFO1000074.140-3058 CP017374.1131181-1134103 CP027349.481487-484409 MKDB01000028.221-3143 CP006033.1881510-1884429 CP032359.1453344-1456266 CP015966.515451-518373 CP005942.1876469-1879387 CP032466.1202604-1205526 MQNK01000090.109232-112150 CP015857.1940902-1943824 CP032359.935339-938261 JH WA01000015.24420-2723 0 CP032648.967605-970526 CP032466.348126-351048 LUWV01000029.158-3078 CP021997.250345-253267 CPO3O1O5.144269-147187 CP004082.2256665-2259583 CP010528.2935198-2938120 CP031771.2887268-2890176 MKDP01000062.1992-4910 CP004406.1156980-1159899 CP032466.3061124-3064046 OMOOO1000100.191 -3107 CP017363.2831953-2834875 CP032751.511351-514273 LKLZ01000009.476405-476816 CP017374.2420080-2423002 CP031318.1843490-1846412 MQNL01000032.18742-21660 CP005942.2350602-2353520 CP031771.1943094-1945900 CP017354.503806-506728 CP017406.731946-734864 CP032751.1881129-1884051 CP017379.2397287-2400209 CP006033.2779990-2782909 CP031771.2425113-2427919 NIGG01000040.236-3042 CP022294.2455107-2458029 CP032751.1082317-1085239 AJ542557.1-354 CP015857.2712063-2714985 CP032359.2910991-2913913 AL93 5263.2498866-2501785 CPO14780.2918979-2921901 CP032466.2564976-2567898 MAMT01000045.73-1110 CPO16071.1966374-1969296 Lactobacillus rhamnosus NBVL01000096.1-359 QAZK01000028.11-2930 AY608417.359-956 NB VLO1000020.3 95947-396305 MLKA01000027.125-3044 AMQX01000036.126-3043 NB VLO1000038.107249-110168 MLKC01000014.1-1442 AP011548.1920458-1923378 JYCS01000046.125-3044 NXEW01000052.657-1051 JQ952565.1-1064 JMSI01000014.11-2731 QFFR01000017.4-2923 EF030190.1-2449 MJHBO1000049.1907-4822 JVIZ01000304.304-3103 AFI 82730.226-686 LPNUO1000052.112922-115720 JUIS01000013.231-3150 LP124489.309541-312456 PKQF01000030.4-2923 JUMO01000136.1-2498 EU184020.1849-4770 JNNV01000002.195931 -198850 NXEXO1000013.1003 9-12705 AP011548.2560406-2563325 LPNW01000032.45107-47906 MLKC01000050.1-1080 KJ522771.175-600 JTITO1OOOO33.125-3044 QFFQ01000030.4-2923 LFNB01000054.125-3044 JTDC01000070.125-3044 JWIIC01000055.125-3044 JQ952566.1-1064 LWBT01000053.4-2923 NXEZ01000022.45151-48071 FM179322.309541-312456 AEYM01001955.1-336 NXEV01000050.667-3586 FM179323.1892336-1895251 MSTBO1000010.9-2926 JUIL01000003.232-3151 EF030191.1-2449 JDFQ01000059.128-3043 JUPA01000135.128-3043 CP017063.780881-783800 LPNW01000054.297-3212 JUIP01000001.125-3044 CP016823.26583-29501 LPNW01000062.48132-50931 NXEU01000011.44449-47667 LT220504.1453029-1455828 JTIL01000084.1-383 LAZEO1000069.42871 -45790 A YTRO1000044.116-2915 JTIX01000003.125-3044 NXEZO1000009.1-457 A YTQO1000062.167-2 966 JTIV01000001.233-3152 JUII01000288.9-2928 LP124490.308565-311480 JTIH01000044.125-3044 JUPX01000234.110-2909 FM179322.825034-827949 JNNV01000008.54289-57208 MLKC01000062.1-396 FM179323.2545004-2547919 JTHY01000064.il-2930 MLJZ01000022.1-2901 FM179322.845075-847990 PKJX01000001.973678-976597 MLKB01000036.125-3044 CP005484.752982-755899 PKQF01000104.1-365 AZCQO1000032.110-2909 LP124489.1926158-1928958 JDFR01000053.122-2921 JUIN01000677.125-3044 CP006804.1311020-1313939 JDRW01000070.128-3043 UWPA01000065.110-2909 AY608413.572-1169 PESP01000015.125-2349 CBZU010000002.5-2920 LP124489.825034-827949 JTI AO 1000278.2-2921 JUIR01000596.11-2930 LP124490.2560513-2563312 JTIM01000029.36124-36688 JUKV01000156.235-3034 KJ522769.279-800 JTIG01000044.11-2930 JUIO01000001.4-2923 CP020464.2278682-2281601 JTIU01000003.227-3146 .TUI JO 1000273.9-2928 KJ522768.236-686 LPNT01000058.78246-79836 JUON01000132.128-3043 AY608412.572-1169 LPNV01000046.509128-512042 JUIH01000144.100-3019 AY608416.359-956 LPNT01000028.16075-17665 OGTX02000322.7-2894 FM179322.1926053-1928969 AVFG02000084.81319-84238 JUIM01000001.125-3044 CP021426.1067790-1070709 JTIC01000068.9-2928 JUIK01000542.125-3044 CPO16823.490071 -492987 JTIP01000108.11-2930 BALT01000056.14-2929 FM179322.2565342-2568257 LPNTO1000027.1-1700 P YRN01000027.227-3146 CP016823.1567720-1570639 JTIR01000061.125-3044 JUTB01000139.394-3309 CP005484.1799561 -1802478 JTHS01000058.232-3151 JUIQ01000003.125-3044 CP017063.760852-763771 JPZB01 000061.125-3044 ACTZ01000149.128-3043 CP006804.2596532-2599451 QAHA01000029.11-2930 JULF01000298.425-3340 CP005484.2468527-2471444 MWVF01000026.11-2930 LT220504.1966955-1969754 CP006804.2616571-2619490 QAZJ01000027.1-2709 JVPR01000263.122-2921 LP124489.845075-847990 JTHZ01000001.9-2928 JUWG01000102.110-2909 LT220504.331530-334445 AB WJ01000062.125-3044 JUTS01000152.466-3265 CP003094.2464960-2467873 JTIE01000095.11-2914 JVIZO1000305.13 985-16900 CP016823.470038-472957 JTHW01000071.125-3043 MAGA01000079.1-1047 CP017063.1800293-1803212 JTHT01000106.1-2919 MAGA01000089.1-436 CP003094.1817448-1820361 JTIW01000098.9-2928 CP017063.2467680-2470599 CPO 14201.1042874-1045793 JNNV01000022.16023-16476 CP005484.279215-282132 CP014201.1702655-1705574 JTHQ01000082.125-3044 AMQW01000040.7-2924 CP005484.773131-776048 JUWQ01000124.110-2909 CP006804.643619-646539 CPO 16823.2207573-2210490 QQWF01000027.2051-4970 AGKC01000001.982077-983797 CP014201.3038292-3041211 LPNT01000036.112574-114165 JVLT01000015.110-2909 CP006804.2123604-2126523 JUMP01000134.110-2909 JVPR01000164.304-3103 CP020464.1249824-1252743 JTIL01000088.1-383 MAGA01000092.1-434 CP021426.2460816-2463736 JTHX01000042.4-2923 FM179323.819584-822499 CP022109.2562767-2565566 JTIMO1000073.1-565 .1X665051.229-677 CP014201.3018254-3021173 QAZHO1000027.125-3044 MAGA01000077.1-2097 CP005485.298950-301867 QAGZO1000031.11-2239 JVJAO1000908.1-2515 CP014201.2535397-2538316 JTIK01000344.125-3044 JVQV01000050.128-3043 CP022109.815101-818016 QAZI01000051.125-3044 ATBI01000022.12-2927 CP005485.813907-816824 QAZJO1000036.1-338 ATBI01000006.245094-247893 CP014645.615844-618763 QQWF01000763.1-527 AP011548.822600-825519 CPO17063.270244-273163 QAHB01000026.1685-4604 J VIZ01000389.122-2921 CP003094.822938-825853 AFZY01000013.1-2623 AGKC01000009.1-1444 CP019305.835125-838040 JTIL01000075.9-2545 LP124490.842643-845558 CP022109.835125-838040 QAGY01000026.125-3044 JVPRO1000194.1927-4842 CP003094.802914-805829 JTIF01000010.125-3044 JVLT01000016.128-3043 CP005485.833931-836848 MSTC01000071.125-3043 AY608414.359-956 CP005485.2563350-2566267 JNNV01000004.1-770 FM179323.291567-294482 CP005485.1893930-1896847 JTHU01000144.100-3019 LT220504.1432902-1435807 CP019305.815101-818016 QAGZ01000041.1-376 LT220504.2686837-2689752 CP003094.291743-294658 JTH VO 1000013.1-2918 AP011548.842641-845560 CP019305.1893891-1896690 JTIB01000063.125-3044 AP011548.308563-311482 CP020016.346162-349081 JTII01000049.9-2928 LP124489.2565447-2568246 CP019305.2562756-2565555 QAGW01000012.11-2930 CP021426.553754-556673 CP021426.1820994-1823913 PESP01000017.4-693 A YTPO1000043.128-3043 CP021426.533713-536632 JTIOO1000001.64-2983 LP124490.822602-825517 CP020464.2298825-2301744 JTIN01000086.137-3056 JVDP01000077.2140-5055 CP020464.2772592-2775511 JTID01000072.10-2929 AY608415.359-956 CP022109.298952-301867 QAGZ0100003 8.1-569 FM179323.839608-842523 CP020464.581711-584630 JTHR01000069.124-3 043 AB092641.224-693 CP019305.298952-301867 JTIS01000001.9-2928 EFNA01000055.125-3044 CP022109.1893898-1896697 JTIQ01000061.233-3152 ATBI01000013.62458-65257 CP031290.2565346-2568265 JTIM01000061.125-2479 PZQM01000035.277-3196 CP031290.309538-312457 JTIJ01000045.9-2928 ATBI01000015.292-3098 CP031290.825034-827953 QAGX01000013.11-2930 JVCX01000010.2140-5055 CP031290.845075-847994 AFYD01000005.110-1639 LP124490.1920565-1923365 CP031290.1926057-1928977 NXE WO 1000004.73 847-76759 ATBI01000019.12-2927 Exemplary B. lactis sequences

[00175] SEQ ID NO: 14, B. lactis rRNA. 1538 nucleotides (nt).

[00176] SEQ ID NO: 15, B. lactis. Accession Number: CP001853.168853.171909 Bifidobacterium; Bifidobacterium animalis subsp. lactis. rRNA Sequence.

[00177] SEQ ID NO: 16, B. lactis. Accession Number: CP001892.1476835.1479961 Bifidobacterium; Bifidobacterium animalis subsp. lactis. rRNA Sequence. Exemplary B. breve sequences

[00178] SEQ ID NO: 17, B. breve rRNA sequence, 1531 nt (see e.g.. NCBI Reference Numbers B7017_RS06345 or B7017_RS09250, rRNA ribosomal RNA, Bifidobacterium breve JCM 7017, NCBI Gene IDs: 56564913 or 56565465).

[00179] SEQ ID NO: 18, B. breve, Accession Number: BCXW01000037.1900.4963 Bifidobacterium; Bifidobacterium breve. rRNA Sequence.

[00180] SEQ ID NO: 19, B. breve. Accession Number: CP021558.1782121.1785182 Bifidobacterium; Bifidobacterium breve. rRNA Sequence.

[00181] SEQ ID NO: 20, B. breve. Accession Number: CP021388.2282979.2286039 Bifidobacterium; Bifidobacterium breve. rRNA Sequence. Exemplary B. infantis sequences

[00182] SEQ ID NO: 21, B. infantis rRNA sequence, 1526 nt (see e.g.. NCBI Gene ID: 66505550).

[00183] SEQ ID NO: 22, B. infantis, Accession Number: AP010889.2757707.2760771 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[00184] SEQ ID NO: 23, B. infantis, Accession Number: AP010889.2751543.2754607 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[00185] SEQ ID NO: 24, B. infantis, Accession Number: CP001095.2539820.2542677 Bifidobacterium; Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222 = DSM 20088. rRNA Sequence.

[00186] SEQ ID NO: 25, B. infantis, Accession Number: BCYG01000038.1.1181 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence.

[00187] SEQ ID NO: 26, B. infantis, Accession Number: BCYF01000054.143.3206 Bifidobacterium; Bifidobacterium longum subsp. infantis. rRNA Sequence. Exemplary L. plantarum sequences

[00188] SEQ ID NO: 27, L. plantarum rRNA sequence. 1474 nt (see e.g., Lactobacillus plantarum strain NRRL B-14768 16S ribosomal RNA, partial sequence, NCBI Reference Sequence: NR 042394.1).

[00189] SEQ ID NO: 28, L. plantarum. Accession Number: CP026743.575947.578869 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[00190] SEQ ID NO: 29, L. plantarum. Accession Number: CP020816.489843.492761 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[00191] SEQ ID NO: 30, L. plantarum, Accession Number: CP025412.483014.485936 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[00192] SEQ ID NO: 31, L. plantarum, Accession Number: CP029349.2063132.2066054 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence.

[00193] SEQ ID NO: 32, L. plantarum, Accession Number: LUXF01000016.189.3109 Lactiplantibacillus; Lactobacillus plantarum. rRNA Sequence. Exemplary L. acidophilus sequences

[00194] SEQ ID NO: 33, L. acidophilus rRNA sequence, 1564 nt (see e.g., NCBI Reference Number LA14 RS08025 16S ribosomal RNA Lactobacillus acidophilus La-14, NCBI Gene ID: 56943192).

[00195] SEQ ID NO: 34, L. acidophilus, Accession Number: CP000033.60957.64007 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[00196] SEQ ID NO: 35, L. acidophilus, Accession Number: CP010432.436310.439215 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[00197] SEQ ID NO: 36, L. acidophilus, Accession Number: LWSH01000065.1.1873 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[00198] SEQ ID NO: 37, L. acidophilus, Accession Number: CBLR010000038.101.3004 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[00199] SEQ ID NO: 38, L. acidophilus, Accession Number: KC161284.1.671 Lactobacillus; Lactobacillus acidophilus. rRNA Sequence.

[00200] SEQ ID NO: 39, L. acidophilus, Accession Number: NXEYO1000033.151.1480 Salmonella; Lactobacillus acidophilus. rRNA Sequence. Exemplary L. rhamnosus sequences

[00201] SEQ ID NO: 40, L. rhamnosus rRNA sequence, 1521 nt (sec c.g., Lactobacillus rhamnosus strain JCM 1136 16S ribosomal RNA, partial sequence NCBI Reference Sequence: NR_043408.1).

[00202] SEQ ID NO: 41, L. rhamnosus, Accession Number: JUPX01000234.110.2909 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.

[00203] SEQ ID NO: 42, L. rhamnosus, Accession Number: JTIN01000086.137.3056 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.

[00204] SEQ ID NO: 43, L. rhamnosus, Accession Number: CP014201.1702655.1705574 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence.

[00205] SEQ ID NO: 44, L. rhamnosus, Accession Number: AFYD01000005.110.1639 Lacticaseibacillus; Lactobacillus rhamnosus. rRNA Sequence. Exemplary L. paracasei sequences

[00206] SEQ ID NO: 45, L. paracasei rRNA sequence, 1522 nt (see e.g.. Lactobacillus paracasei strain R094 16S ribosomal RNA gene, partial sequence, NCBI Reference Sequence: NR 025880.1.

[00207] SEQ ID NO: 46, L. paracasei, Accession Number: CP002391.1862810.1865725 Lacticaseibacillus; Lactobacillus paracasei. rRNA Sequence.

[00208] SEQ ID NO: 47, J,, paracasei, Accession Number: CP016355.2612922.2615840 Lacticaseibacillus; Lactobacillus paracasei. rRNA Sequence.

[00209] SEQ ID NO: 48, L. paracasei, Accession Number: ANKB01000105.125.3044 Lacticaseibacillus; Lactobacillus paracasei. rRNA Sequence. Exemplary L. casei sequences

[00210] SEQ ID NO: 49, L. casei rRNA, Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 16S ribosomal RNA, partial sequence, 1517 nucleotides (nt).

[00211] SEQ ID NO: 50, L. casei, Accession Number: AB092640.223.705 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[00212] SEQ ID NO: 51, L. casei. Accession Number: AY221478.1.556 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[00213] SEQ ID NO: 52, L. casei. Accession Number: FM177140.909841.912756 Lacticaseibacillus; Lactobacillus casei. rRNA Sequence.

[00214] It has been surprisingly discovered that postbiotic compositions prepared according to the presently disclosed methods have unique metabolite profiles and advantageous properties. In at least some instances, the presently disclosed postbiotic compositions have a metabolite profile exhibiting elevated levels or one or more advantageous metabolites selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, organic acids including citric acid, succinic acid, lactic acid, glycerol and acetic acid, as well as indole organic acids, vitamin C, and any combination thereof.

[00215] According to another aspect of the present disclosure, oral postbiotic formulations comprising the presently disclosed postbiotic compositions are provided. The oral postbiotic formulations can be formulated as a tablet, pill, capsule, or microcapsule. In other instances, the oral postbiotic formulation can be formulated for buccal, sublabial, or sublingual administration. In still other instances, the oral postbiotic formulation can be a liquid suspension. The oral postbiotic formulations can be useful for the modulation, treatment or prevention of disruption of the gut-brain axis. The oral postbiotic formulations can also be useful for the treatment or prevention of a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA). Definitions

[00216] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[00217] As used herein, the term “dysbiosis” (also referred to as “dysbacteriosis” or “disruption of gut microbiota”) refers to a disruption to tire microbiota homeostasis caused by an imbalance in the microflora, changes in their functional composition and metabolic activities, or a shift in their local distribution. It is a term for a microbial imbalance or maladaptation on or inside the body, such as an impaired microbiota. For example, a part of the human microbiota, such as the skin flora, gut flora, or vaginal flora, can become deranged, with normally dominating species underrepresented and normally outcompeted or contained species increasing to fill the void. Dysbiosis is most commonly reported as a condition in the gastrointestinal tract, but applies to other niches as well.

[00218] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce.” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%. at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%. at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%. at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%. at least about 99% , or more. As used herein, “reduction” or “inhibition” docs not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal, e.g., for an individual without a given disorder.

[00219] The terms “increased”, “increase", “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount, fn some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%. or at least about 50%. or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an “increase” is a statistically significant increase in such level.

[00220] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g.. dog, fox, wolf, avian species, e.g.. chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g.. a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.

[00221] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of dysbiosis; a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA). A subject can be male or female.

[00222] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (eg. dysbiosis; a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA)) or one or more complications related to such a condition, and optionally, have already undergone treatment for dysbiosis or the one or more complications related to dysbiosis. Alternatively, a subject can also be one who has not been previously diagnosed as having dysbiosis or one or more complications related to dysbiosis. For example, a subject can be one who exhibits one or more risk factors for dysbiosis or one or more complications related to dysbiosis or a subject who docs not exhibit risk factors. In some embodiments of any of the aspects, the subject is immunocompromised.

[00223] A “subject in need’’ of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.

[00224] A variant amino acid or DNA sequence can be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%. or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).

[00225] A variant amino acid sequence can be at least 50%, at least 60%, at least 70%. at least 80%, at least 90%. at least 91%, at least 92%. at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99%. or more, similar to a native or reference sequence. As used herein, “similarity” refers to an identical amino acid or a conservatively substituted amino acid, as described herein. Accordingly, the percentage of “sequence similarity” is the percentage of amino acids which is either identical or conservatively changed; e.g., “sequence similarity” = (% sequence identity)+(% conservative changes). It should be understood that a sequence that has a specified percent similarity to a reference sequence necessarily encompasses a sequence with the same specified percent identity to that reference sequence. The skilled person will be aware of various computer programs, using different mathematical algorithms, that are available to determine the identity or similarity between two sequences. For instance, use can be made of a computer program employing the Needleman and Wunsch algorithm (Needleman et al. (1970)); the GAP program in the Accelrys GCG software package (Accelerys Inc., San Diego U.S.A.); the algorithm of E. Meyers and W. Miller (Meyers et al. (1989)) which has been incorporated into the ALIGN program (version 2.0); or more preferably the BLAST (Basic Local Alignment Tool using default parameters); see e.g.. US Patent 10.023.890. the content of which is incorporated by reference herein in its entirety.

[00226] In some embodiments, sequencing comprises 16S rRNA gene sequencing, which can also be referred to as “ 16S ribosomal RNA sequencing”, “ 16S rDNA sequencing” or “16s rRNA sequencing”. Sequencing of the 16S rRNA gene can be used for genetic studies as it is highly conserved between different species of bacteria, but it is not present in eukaryotic species. In addition to highly conserved regions, the 16S rRNA gene also comprises nine hypervariable regions (V1-V9) that vary by species. 16S rRNA gene sequencing typically comprises using a plurality of universal primers that bind to conserved regions of the 16S rRNA gene, PCR amplifying the bacterial 16S rRNA gene regions (including hypervariable regions), and sequencing the amplified 16S rRNA genes with a next-generation sequencing technology as described herein (see also e.g., US Patents 5,654.418; 6,344,316; and 8,889,358; and US Patent Application Numbers US 2013 / 0157265 and US 2018 / 0195111, which are incorporated by reference in their entireties).

[00227] As used herein, the terms "treat,” "treatment," "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g. dysbiosis that includes a disruption of the gut-brain axis; a neurological disease or disorder; a synucleinopathy; Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and / or multiple system atrophy (MSA). The tenn “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with dysbiosis drat includes a disruption of the gut-brain axis. Treatment is generally “effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of. progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[00228] As used herein, the term “pharmaceutical composition” refers to the active agent in combination with a pharmaceutically acceptable carrier e.g. a carrier commonly used in the pharmaceutical industry. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be an artificial or engineered carrier, e.g., a carrier that the active ingredient would not be found to occur in or within nature.

[00229] As used herein, the term "administering," refers to the placement of a compound as disclosed herein into a subject by a method or route which results in at least partial delivery of the agent at a desired site. Pharmaceutical compositions comprising the compounds disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject. In some embodiments, administration comprises physical human activity, e.g., an injection, act of ingestion, an act of application, and / or manipulation of a delivery device or machine. Such activity can be performed, e.g., by a medical professional and / or the subject being treated. In some embodiments, administration can be one or more doses and / or treatments daily over a period of weeks or months. Examples of dosing and / or treatment schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. In some embodiments, administration can be 1 capsule or 2 capsules a day. In some embodiments, administration can be up to 2 capsules a day, twice a day.

[00230] As used herein, “contacting" refers to any suitable means for delivering, or exposing, an agent to at least one cell. Exemplary delivery methods include, but are not limited to, direct delivery to cell culture medium, transfection, transduction, perfusion, injection, or other delivery method known to one skilled in the art. In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and / or decanting; and / or manipulation of a delivery device or machine.

[00231] In some embodiments of any of the aspects, the cells (e.g., bacterial cells) can be maintained in culture. As used herein, “maintaining” refers to continuing the viability of a cell or population of cells. A maintained population of cells will have at least a subpopulation of metabolically active cells.

[00232] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2SD) or greater difference.

[00233] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.

[00234] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.

[00235] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[00236] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[00237] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherw ise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "c.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[00238] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of tire group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[00239] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in cell biology, immunology, and molecular biology can be found in The Merck Manual of Diagnosis and Therapy. 20th Edition, published by Merck Sharp & Dohme Corp.. 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat. Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons. 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.). John Wiley and Sons, Inc.. 2005; and Current Protocols in Immunology' (CPI) (John E. Coligan, ADA M Kruisbeek. David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[00240] Other terms are defined herein within the description of the various aspects of the invention.

[00241] All patents and other publications; including literature references, issued patents, published patent applications, and co-pcnding patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[00242] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for. the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[00243] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[00244] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs: 1. A method of treating or preventing a disease or disorder associated with a disruption in the gutbrain axis, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition. 2. A method of treating or preventing a neurological disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition. 3. A method of treating or preventing a synucleinopathy, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition. 4. The method of any one of paragraphs 1-3, wherein the disease or disorder is selected from the group consisting of: Parkinson's disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA). 5. The method of any one of paragraphs 1-4, wherein the disease or disorder is Parkinson’s disease. 6. The method of any one of paragraphs 1-5, wherein the disease or disorder is REM Sleep Behavior Disorder. 7. The method of any one of paragraphs 1-6. wherein administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., Faecalibacterium, Akkertnansia. and / or Ruminococcus)', decreased abundance of pathogenic or non-beneficial microbiome species (e.g., Scardovia, Escherichia-Shigella, and / or Streptococcus)', decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g., tumor necrosis factor-alpha (TNFa), interleukin-ip (IL-1P), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life. 8. The method of any one of paragraphs 1-7, wherein the postbiotic comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species. 9. The method of any one of paragraphs 1-8. wherein the postbiotic comprises the products of fermentation of herbal material comprising ashwagandha root and elderberry, with at least one Bifidobacterium species and at least one Lactobacillus species. 10. The method of any one of paragraphs 9, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms; (b) preparing a fermentation substrate composition; (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and (e) lyophilizing or spray-drying tire fermented inoculate composition to obtain the postbiotic composition. 11. The method of paragraph 10, wherein the fermentation substrate composition comprises: herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material. 12. The method of paragraph 10 or 11, wherein the fermentation substrate composition comprises: herbal material comprising ashwagandha root and elderberry. in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and liquid water sufficient to suspend or submerge the herbal material. 13. The method of any one of paragraphs 10-12, wherein the fermentation substrate composition further comprises one or more of glucose, sucrose, fructose, honey, and molasses. 14. The method of any one of paragraphs 8-13, wherein the herbal material further comprises an herb of the Astragalus family and / or a legume of the Lens orientalis or Lens culinaris family. 15. The method of any one of paragraphs 8-14, wherein the herbal material further comprises Astragalus membranaceus root and / or and red lentil. 16. The fermentation substrate of any one of paragraphs 10-15. wherein the fermentation substrate comprises: about 2% by weight to about 10% by weight ashwagandha; about 2% by weight to about 10% by weight elderberry; about 2% by weight to about 10% by weight Astragalus membranaceus root; about 0.5% by weight to about 3% by weight red lentil; about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses; and / or about 70% by weight to about 95% by weight water. 17. The method of any one of paragraphs 10-16, wherein the predetermined amount of time is about 24 hours to about 10 days. 18. The method of any one of paragraphs 10-17. wherein the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species. 19. The method of any one of paragraphs 8, 9. 11, 12, or 18, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, B. longum, and any combination thereof. 20. The method of any one of paragraphs 8, 9, 11, 12, or 18, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof. 21. The method of any one of paragraphs 10-20, wherein the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108 CFU / mL to about IxlO12 CFU / mL. 22. The method of any one of paragraphs 1-21, wherein administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition. 23. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy. wherein the postbiotic composition comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species. 24. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising: (a) preparing a culture of microorganisms comprising B. lactis, B. infantis. B. breve, L. paracasei, L. rhamnosus. and / or L. casei; (b) preparing a fermentation substrate composition comprising herbal material comprising ashwagandha root and elderberry in combination with liquid water sufficient to suspend or submerge the herbal material: (c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition; (d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and (e) lyophilizing or spray-drying the fermented inoculate composition to obtain the postbiotic composition.

[00245] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting. EXAMPLES Example 1 - Preparation of Bifidobacterium Cultures

[00246] A IL flask was washed with soap and rinsed with hot water and sanitized. 500mL of MRS broth was prepared and stirred without autoclaving. The 500 mL aliquot of MRS broth was inoculated with Bifidobacterium culture powder comprising B. laclis, B. breve, and B. infanlis such that a target concentration of 1.00E+10 CFU / mL was achieved. Example 2 - Preparation of Lactobacillus Cultures

[00247] A IL flask was washed with soap and rinsed with hot water and sanitized. 500mL of MRS broth was prepared and stirred without autoclaving. The 500 mL aliquot of MRS broth was inoculated with Lactobacillus culture powder comprising L. plantarum, L. acidophilus, L. rhamnosus, and L. paracasei such that a target concentration of 1.00E+10 CFU / mL was achieved. Example 3 - Preparation of Herbal Substrate Composition

[00248] A blender was w ashed with soap, rinsed wdth hot water, and sanitized. The herbal substrate components listed in Table 4 were introduced into a blender and blended until smooth. The pH of the of herbal substrate composition w as adjusted to 6.5 with IM NaOH.

[00249] Table 4 - Exemplary Herbal Substrate Components Component Weight (kg) Weight (% by wt) Astragalus (powder) 5.83 3.5% Ashwagandha (powder) 5.83 3.5% Elderberry (powder) 5.83 3.5% Molasses 5.83 3.5% Red Lentil 1.67 1.0% Filtered Water 142 85.0% Total 167 100.0% Total Dry- Weight 25 Total Wet Weight 167

[00250] An alternative formulation can comprise the components shown in Table 5 below. In some embodiments, up to two capsules a day are administered, twice a day.

[00251] Table 5: Exemplary Components of Fermentation Substrate Component Nominal Quantity in a Capsule Function Ashwagandha root (Withania somnifera) extract 400 mg of fermented plant material combined with a total dead cell count in final product of >U10"' AFU / g and < 200 CFU / g Active Ingredient: Co-fermented herb Elderberry fruit (Sambucus nigra) powder Active Ingredient: Co-fermented herb Bifidobacterium animalis subspecies lactis Active Ingredient: Bacteria (heat killed after fermentation in final DP) Bifidobacterium breve Bifidobacterium longum Lactobacillus casei Lactobacillus paracasei Lactobacillus rhamnosus

[00252] An alternative formulation can comprise the following: ashwagandha powder, 3.5% by weight; elderberry' powder, 3.5% by weight; sucrose, 3.5% by weight, admixed with water. The term “ Withania Somnifera Extract” can be used interchangeably with “ashwagandha” or “ashwagandha powder.” In some embodiments of any of the aspects, the elderberry’ powder comprises ElderberryJuice Extract. In some embodiments, the formulation can comprise the following: Withania Somnifera Extract, 3.5% by weight; Elderberry- Juice Extract, 3.5% by weight; sucrose, 3.5% by weight, admixed with water. Example 4 - Fermentation Process to Prepare Postbiotic Composition

[00253] One example of fermentation to produce a postbiotic composition is described below. A fermentation vat was washed with soap, rinsed with hot water, and sanitized. The herbal substrate composition was transferred to the fermentation vat. The vat containing the herbal substrate composition was inoculated by pipette with the Bifidobacterium cultures from Example 1 (the starter concentration was 3.00E+10 CFU / mL for Bifidobacterium) and with the Lactobacillus culture from Example 2 (the starter concentration was 4.00E+10 CFU / mL for Lactobacillus). The target concentration was 2.00E+06 CFU / mL. During fermentation, the fennentation vat was sealed and purged with nitrogen gas (99.99% purity) so that an oxygen concentration of < 1% was achieved. The fermentation vat was incubated at 37°C. The pH of the fermentation volume was adjusted to 6.5 with IM NaOH, as needed. On day 5, the fermented composition was lyophilized to produce the postbiotic composition.

[00254] For more information about production of the postbiotic compositions described herein, see e.g., international publication WO2023137418A2, the contents of which are incorporated herein by reference in their entirety. Example 5 - Evaluation of the effects ofpostbiotic products on Parkinson’s Disease markers

[00255] Described herein is use of microbiome modulation methodology in PD patients to study its effect on disease pathogenesis and clinical symptoms, which would answer the scientific question of whether the microbiome differences in PD are cause or consequence of the disease. The former conclusion can lead to a target for therapeutic intervention. Altering the gut microbiome by fecal microbiome transplant to a more ‘‘healthy” state can improve disease measures in animal models and human subjects. Described herein is administration of postbiotics, an approach for altering the gut microbial community, to modify the gut microbiome in PD patients to promote a microbial composition that is more associated with health, to measure the alleviation of gastrointestinal (GI) symptoms associated with PD, and to ultimately delay or prevent PD progression.

[00256] Altering the microbiome with live bacteria using fecal microbiota transplants or probiotics has been explored in PD (see e.g., Xue et al. Medicine (Baltimore) 2020, 99(35): e22035; DuPont et al. Front Neurol 2023, 14: 1104759), though these approaches pose potential safety concerns or have reported conflicting data on efficacy. Postbiotics are an alternative to therapeutics with live bacteria. Postbiotics is an umbrella term that encompasses complex mixtures of metabolites produced by bacteria, such as during fermentation, as well as cell wall and other dead cell components. Consumption of postbiotics can alter the microbial community by providing an environment that favors the colonization of beneficial species. The manufacturing process of postbiotic compositions can impact the final metabolite composition and thereby influence the gut microbiota. Described herein is use of a formulation (e.g., a postbiotic composition as described herein) that results from a fennentation process by indicated species of Lactobacillus and Bifidobacterium, major taxa present during infant microbiome assembly. Without wishing to be bound by theory, it is hypothesized that the metabolites of these species, their products of secondary metabolism and signaling molecules support or elicit competitive responses within resident members of the commensal adult microbiome that have evolved to ecologically succeed early colonizers of the gut microbiome and increases their resilience to external perturbations. This formulation has been shown to improve GI microbial diversity following treatment with oral antibiotics (see e.g., WO2023137418A2).

[00257] Described herein is testing of the role of the gut microbiome in synucleinopathies using the disease modifying therapy of postbiotics. Prodromal synucleinopathy subjects (e.g., n=10 including those with REM Sleep Behavior Disorder [RBD], which is characterized by complex motor enactment of dreams and is a potential prodromal marker of Parkinson's disease (PD)). Parkinson’s Disease (PD) (n=10). and control (n=10) subjects) consume a postbiotic composition as described herein; the postbiotic’s effect on their gut microbiome is measured by longitudinal assessment of fecal microbial composition, systemic markers of inflammation (circulating immune cells), measures of GI and autonomic function, and / or clinical measures of PD. Without wishing to be bound by theory, it is hypothesized that the postbiotic composition can modify the GI microbial composition in ways consistent with the hypothesized ecological progression from pathological to normal and this can attenuate synuclein abnormalities detected in the gut, alter immune system function, and improve autonomic symptoms including constipation. The sample size and duration of the study of 8 weeks are based on a previous postbiotic study showing restoration of 2 fold microbiome diversity during antibiotic treatment with n=32 sample size (see e.g., WO2023137418A2).

[00258] This study can provide information on the effect of the postbiotic composition in a synucleinopathy cohort. Disease modification can also be assessed using PD-relevant clinical parameters. Postbiotic compositions as described herein can also be used to treat or prevent other synucleinopathies such as DLB as well as pure autonomic failure (PAF) and MSA. Postbiotic compositions as described herein can be used to modulate central neurological pathogenesis and symptoms consequent to measurable peripheral changes and can be broadly relevant to treating or preventing many other neurological disorders.

[00259] Table 6: Study design, Subjects: (n=10 each, n=30 total) Prodromal CNS synucleinopathies Control (n=10) RBD (n=10) PD (n=10)

[00260] Table 6: Outcome measures. *These invasive procedures will be optional for this phase of the study. Baseline 8 weeks 6 months microbiome composition X X X Stool synuclein (Syn) Seed Amplification Assay (SAA) Immune profile X X X *Colon biopsy for Syn SAA X X *Skin biopsy for Syn SAA X X ^cerebrospinal fluid (CSF) for Syn SAA X X cytokine levels, peripheral blood mononuclear cell (PBMC) assay X X X GI Rome criteria Bristol stool scale X X X sleep behavior disorder questionnaire (RBDQ) X X X Autonomic SCales for Outcomes in PArkinson’s disease (SCOPA) X X X PD features Unified Parkinson’s Disease Rating Scale - MOVEMENT DISORDER SOCIETY (UPDRS-MDS) X X X Cognitive Montreal Cognitive Assessment (MoCA) X X X Depression Anxiety scale X X X | Quality of life (QoL)|x|x|x|

[00261] It is contemplated herein that administration of the postbiotic composition to a PD subject or to a RBD subject will be associated with at least one of the following outcomes, as compared to a negative control such as a subject receiving a placebo, a subject not receiving die postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., populations of beneficial microbes associated with immune system support; e g., Faecalibacterium, Akkermansia, and / or Ruminococcus; see e.g., Fig. 8A of WO2023137418A2); decreased abundance of pathogenic or non-beneficial microbiome species (e.g., Scardovia. Escherichia-Shigella, and / or Streptococcus', see e.g.. Fig. 8A of WO2023137418A2); decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut, skin, and / or CSF); decreased inflammatory cytokines (e.g.. tumor necrosis factor-alpha (TNFa), interleukin-ip (IL-ip), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g.. tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality of life. References:

[00262] 1. Wallen ZD, Demirkan A. Twa G, et al. Metagenomics of Parkinson's disease implicates the gut microbiome in multiple disease mechanisms. Nat Commun 2022; 13(1 ):6958.

[00263] 2. Boktor IC. Sharon G, Verhagen Metinan LA, et al. Integrated Multi-Cohort Analysis of the Parkinson's Disease Gut Metagenome. Mov Disord 2023.

[00264] 3. Toh TS, Chong CW, Lim SY, et al. Gut microbiome in Parkinson's disease: New insights from meta-analysis. Parkinsonism Relat Disord 2021;94:1-9.

[00265] 4. Shen T, Yue Y, He T, et al. The Association Between the Gut Microbiota and Parkinson's Disease, a Meta-Analysis. Front Aging Neurosci 2021;13:636545.

[00266] 5. Xue LJ, Yang XZ, Tong Q, et al. Fecal microbiota transplantation therapy for Parkinson's disease: A preliminary’ study. Medicine (Baltimore) 2020;99(35):c22035.

[00267] 6. DuPont HL, Suescun J, Jiang ZD, et al. Fecal microbiota transplantation in Parkinson's disease-A randomized repeat-dose, placebo-controlled clinical pilot study. Front Neurol 2023;14:1104759.

[00268] 7. Salminen S, Collado MC, Endo A, et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat Rev Gastroenterol Hepatol 2021;18(9):649-667.

[00269] 8. Mosca A, Abreu YAAT, Gwee KA, et al. The clinical evidence for postbiotics as microbial therapeutics. Gut Microbes 2022;14(l):2117508.

[00270] 9. Wastvk HC. Fragiadakis GK, Perelman D, et al. Gut-microbiota-targeted diets modulate human immune status. Cell 2021:184(16):4137-4153 e4114.

[00271] 10. Zhou X, Qi W, Hong T, et al. Exopolysaccharides from Lactobacillus plantarum NCU116 Regulate Intestinal Barrier Function via STAT3 Signaling Pathway. J Agric Food Chem 2018;66(37):9719-9727.

[00272] 11. Schaffrath A. Schleyken S, Seger A, et al. Patients with isolated REM-sleep behavior disorder have elevated levels of alpha-synuclein aggregates in stool. NPJ Parkinsons Dis 2023;9(l):14.

[00273] 12. Houser MC, Chang J, Factor SA, et al. Stool Immune Profiles Evince Gastrointestinal Inflammation in Parkinson's Disease. Mov Disord 2018;33(5):793-804.

[00274] 13. Fenyi A, Leclair-Visonneau L, Clairembault T, et al. Detection of alpha-synuclein aggregates in gastrointestinal biopsies by protein misfolding cyclic amplification. Neurobiol Dis 2019;129:38-43.

[00275] 14. Martinez-Valbuena I, Visanji NP, Olszcwska DA, et al. Combining Skin alpha Synuclein Real-Time Quaking-Induced Conversion and Circulating Neurofilament Light Chain to Distinguish Multiple System Atrophy and Parkinson's Disease. Mov Disord 2022;37(3):648-650.

[00276] 15. Kuzkina A, Panzer C, Seger A, et al. Dermal Real-Time Quaking-Induced Conversion Is a Sensitive Marker to Confinn Isolated Rapid Eye Movement Sleep Behavior Disorder as an Early alpha-Synucleinopathy. Mov Disord 2023.

[00277] 16. Russo MJ, Orru CD, Concha-Marambio L. et al. High diagnostic performance of independent alpha-synuclein seed amplification assays for detection of early Parkinson's disease. Acta Neuropathol Commun 2021;9(l):179.

Claims

1. A method of treating or preventing a disease or disorder associated with a disruption in the gutbrain axis, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

2. A method of treating or preventing a neurological disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

3. A method of treating or preventing a synucleinopathy. the method comprising administering to a subject in need thereof an effective amount of a postbiotic composition.

4. The method of any one of claims 1-3, wherein the disease or disorder is selected from the group consisting of: Parkinson’s disease (PD); REM Sleep Behavior Disorder; dementia with Lewy bodies (DLB); pure autonomic failure (PAF); and multiple system atrophy (MSA).

5. The method of any one of claims 1-4. wherein the disease or disorder is Parkinson’s disease.

6. The method of any one of claims 1-5, wherein the disease or disorder is REM Sleep Behavior Disorder.

7. The method of any one of claims 1-6, wherein administering the postbiotic composition is associated with at least one of the following outcomes, as compared to a negative control such as a subject not receiving the postbiotic composition or the treated subject prior to being administered the postbiotic composition: higher diversity in microbiome; higher abundance of beneficial microbiome species (e.g., Eaecalibacterium, Akkermansia. and / or Ruminococcus)', decreased abundance of pathogenic or non-beneficial microbiome species (e.g.. Scardovia, Escherichia-Shigella, and / or Streptococcus^ decreased alpha-synuclein accumulates or inclusions (e.g., in samples from the stool, colon, gut. skin, and / or CSF); decreased inflammatory cytokines (e.g.. tumor necrosis factor-alpha (TNFa), interleukin-ip (IL-1 P), and / or interleukin-6 (IL-6)); decreased immune activation; decreased constipation; decreased stool hardness; decreased bowel movement frequency; decreased incidence or severity of sleep behavior disorders; decreased incidence or severity of Parkinson’s symptoms (e.g., tremor in hands, arms, legs, jaw, or head; muscle stiffness; slowness of movement; impaired balance and coordination); increased cognitive function; decreased depression; decreased anxiety; and / or increased quality oflife.

8. The method of any one of claims 1-7. wherein the postbiotic comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family and aberry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.

9. The method of any one of claims 1-8, wherein the postbiotic comprises the products of fermentation of herbal material comprising ashwagandha root and elderberry, with at least one Bifidobacterium species and at least one Lactobacillus species.

10. The method of any one of claims 9. wherein the postbiotic composition is prepared according to a process comprising:(a) preparing a culture of microorganisms;(b) preparing a fermentation substrate composition;(c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition;(d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and(e) lyophilizing or spray-dry ing tire fermented inoculate composition to obtain the postbiotic composition.

11. The method of claim 10, wherein the fermentation substrate composition comprises:herbal material comprising an herb of the Solanaceae or nightshade family and a berry of the Sambucus L. genus,in combination with at least one Bifidobacterium species and at least one Lactobacillus species, andliquid water sufficient to suspend or submerge the herbal material.

12. The method of claim 10 or 11, wherein the fermentation substrate composition comprises: herbal material comprising ashwagandha root and elderberry, in combination with at least one Bifidobacterium species and at least one Lactobacillus species, andliquid water sufficient to suspend or submerge the herbal material.

13. The method of any one of claims 10-12, wherein the fermentation substrate composition further comprises one or more of glucose, sucrose, fructose, honey, and molasses.

14. The method of any one of claims 8-13, wherein the herbal material further comprises an herb of the Astragalus family and / or a legume of the Lens orientalis or Lens culinaris family.

15. The method of any one of claims 8-14, wherein the herbal material further comprises Astragalus membranaceus root and / or and red lentil.

16. The fermentation substrate of any one of claims 10-15, wherein the fermentation substrate comprises:about 2% by weight to about 10% by weight ashwagandha:about 2% by weight to about 10% by weight elderberry;about 2% by weight to about 10% by weight Astragalus membranaceus root;about 0.5% by weight to about 3% by weight red lentil;about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses; and / orabout 70% by weight to about 95% by weight water.

17. The method of any one of claims 10-16, wherein the predetermined amount of time is about 24 hours to about 10 days.

18. The method of any one of claims 10-17, wherein the culture of microorganisms comprises at least one Bifidobacterium species and at least one Lactobacillus species.

19. The method of any one of claims 8, 9, 11, 12, or 18, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve. B. infantis, B. longum, and any combination thereof.

20. The method of any one of claims 8. 9, 11. 12, or 18, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei. and any combination thereof.

21. The method of any one of claims 10-20, wherein the culture of microorganisms comprises a microorganism concentration from about 1.0 x 108 CFU / mL to about IxlO12 CFU / mL.

22. The method of any one of claims 1-21, wherein administering the postbiotic composition in combination with a synucleinopathy treatment is associated with an improvement in intestinal mucositis, as compared to a negative control such as a subject not receiving the composition or the treated subject prior to being administered the composition.

23. A method of treating a synucleinopathy, tire method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy. wherein the postbiotic composition comprises the products of fermentation of herbal material comprising an herb of the Solanaceae or nightshade family anda berry of the Sambucus L. genus, with at least one Bifidobacterium species and at least one Lactobacillus species.

24. A method of treating a synucleinopathy, the method comprising administering an effective amount of a postbiotic composition to a subject in need thereof, wherein the administering is effective to treat the synucleinopathy, wherein the postbiotic composition is prepared according to a process comprising:(a) preparing a culture of microorganisms comprising B. lactis, B. infantis. B. breve, L. paracasei, L. rhamnosus, and / or L. casei;(b) preparing a fermentation substrate composition comprising herbal material comprising ashwagandha root and elderberry in combination with liquid water sufficient to suspend or submerge the herbal material;(c) inoculating the fermentation substrate composition with the culture of microorganisms to generate an inoculate composition;(d) fermenting the inoculate composition for a predetermined amount of time to generate a fermented inoculate composition; and(e) lyophilizing or spray -drying the fermented inoculate composition to obtain the postbiotic composition.

Images