Compositions for p65 inhibition and methods of use thereof

Abstract

The disclosure provides compositions comprising a peptide-polynucleotide complex, wherein the peptide comprises an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the amino acid sequence ofSEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194; or to anyone of the amino acid sequences of SEQ ID Nos: 195 to 219 and wherein the polynucleotide is a small interfering RNA (siRNA) targeting human p65 mRNA. The disclosure further provides methods of using the peptide-polynucleotide complexes disclosed herein.

Description

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0001] The contents of the electronic sequence listing (AURS_01100US_SeqListST26.xml; Date of Creation: April 30, 2025) are herein incorporated by reference in its entirety. BACKGROUND

[0002] The protein p65, also known as nuclear factor NF-kappa-B p65 subunit or RELA (REL-associated protein) is a transcription factor. It is involved in NF-kappa-B dimerization, nuclear translocation, and activation. p65, along with the other NF-kappa-B subunits - NF-kappa-B 1, NF-kappa-B2, c-Rel, and RelB - forms a variety of homodimers and heterodimers to regulate gene expression downstream of signaling by cytokines, bacterial and viral molecules, growth factors, and stress stimuli.

[0003] Activation of p65 has been observed in multiple types of cancer as well as in many inflammatory diseases and its function has been implicated in the pathogenesis of these diseases. For instance, in cancer cells, NF-kappa-B is thought to regulate apoptosis, regulation of cell proliferation, promotion of angiogenesis and stimulation of metastasis. NF-kappa-B is also a pivotal mediator of inflammatory responses.

[0004] There is a need in the art for improved therapeutics for the treatment of cancer and inflammatory diseases that effectively target p65 expression and / or function and that can be delivered specifically to cancer cells, cells affected by inflammation or inflammatory cells. SUMMARY

[0005] The disclosure provides compositions comprising a peptide-polynucleotide complex, wherein the peptide comprises an amino acid sequence with at least about 80% identity, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194; and wherein the polynucleotide is a small interfering RNA (siRNA) targeting human p65 mRNA. In embodiments, the peptide is non-lytic, non-cytotoxic, and capable of affecting the release of the polynucleotide from an endosome of a cell. In embodiments, the peptide comprises a cationic region and one or more histidine residues located adjacent to the cationic region. In embodiments, the peptide comprises an amino acid sequence with at least about 95% identity to the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194. In embodiments, the peptide comprises the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194.

[0006] In embodiments, the siRNA comprises a sense strand and an antisense strand. In embodiments, the sense strand comprises a number of nucleotides in the range of about 16 bases to about 24 bases. In embodiments, the antisense strand comprises a number of nucleotides in the range of about 16 bases to about 24 bases. In embodiments, the sense strand comprises, or consists of, 19 bases. In embodiments, the antisense strand comprises, or consists of, 21 bases. In embodiments, the sense strand and / or the antisense strand comprise one or more chemical modifications. In embodiments, the sense strand and / or the antisense strand comprise one or more chemical modifications selected from the group consisting of 2’-methoxy (2’-OMe), 2’-fluoro (2’-F), 2’-O-methoxyethyl (2’-O-MOE), 5’-vinylphosphonate, phosphorothioate (PTO), locked nucleic acid (LNA), unlocked nucleic acid (UNA), glycol nucleic acid (GNA), and deoxyribonucleic acid (DNA).

[0007] In embodiments, the sense strand comprises: PTO at positions 1 and 2; 2’-F at positions 3, 7-9, 12, and 17; and 2’-OMe at positions 1, 2, 4-6, 10, 11, 13-16, 18, and 19. In embodiments, the antisense strand comprises: PTO at positions 1, 2, 19, and 20; 2’-F at positions 2 and 14; and 2’-OMe at positions 1, 3-13, and 15-21. In embodiments, the last nucleotide of the sense strand is adenine (A). In embodiments, the first nucleotide of the antisense strand is uracil (U). In embodiments, the sense strand comprises, or consists of, one of the sense strand nucleic acid sequences listed in Table 1, and wherein the antisense strand comprises, or consists of, one of the antisense strand nucleic acid sequences listed in Table 1, or wherein the sense strand comprises, or consists of, one of the sense strand nucleic acid sequences listed in Table 2, and wherein the antisense strand comprises, or consists of, one of the antisense strand nucleic acid sequences listed in Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleic acid sequence of any one of SEQ ID Nos: 1 to 95. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleic acid sequence of any one of SEQ ID Nos: 96-190.

[0008] In embodiments, the sense strand comprises a nucleic acid sequence with at least 90% identity to the nucleic acid sequence of SEQ ID NO: 65. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 90% identity to the nucleic acid sequence of SEQ ID NO: 160. In embodiments, the sense strand comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 65; and wherein the antisense strand comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 160.

[0009] In embodiments, the molar ratio of peptide to polynucleotide is about 2:1 to about 3500:1. In embodiments, the molar ratio of peptide to polynucleotide is about 5:1 to about 200:1. In embodiments, the molar ratio of peptide to polynucleotide is about 100:1. In embodiments, the molar ratio of peptide to polynucleotide is about 5:1. In embodiments, the charge ratio of peptide to polynucleotide is about 6:1 to about 18:1. In embodiments, the charge ratio of peptide to polynucleotide is about 12:1. In embodiments, the peptide-polynucleotide complex is a nanoparticle with a diameter of about 10 nm to about 300 nm. In embodiments, the peptide-polynucleotide complex is coated with albumin and / or hyaluronic acid. In embodiments, the composition comprises a pharmaceutically acceptable carrier.

[0010] The disclosure provides methods of delivering a polynucleotide into a cell, comprising contacting the cell with any one of the compositions disclosed herein. In embodiments, the polynucleotide is delivered into the cytoplasm of the cell. In embodiments, the contacting of the cell is performed in vitro, ex vivo or in vivo. In embodiments, the cell is a cancer cell. In embodiments, the cell is a cell affected by inflammation. In embodiments, the cell is an inflammatory cell, such as, for example, a mast cell, an eosinophil, a neutrophil, a basophil, a macrophage, a dendritic cell, a monocyte or a lymphocyte. In embodiments, the cell is a chondrocyte.

[0011] The disclosure provides methods of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of any one of the compositions disclosed herein. In embodiments, the subject has a cancer, an autoimmune disease, an inflammation-related disease, inflammatory airway disease, rheumatoid arthritis, osteoarthritis, atherosclerosis, inflammatory bowel disease, systemic lupus erythematosus, type I diabetes, chronic obstructive pulmonary disease, asthma, or multiple sclerosis. In embodiments, the subject has a cancer. In embodiments, the cancer is a blood cancer or a solid tumor cancer. In embodiments, the subject is a human subject. BRIEF DESCRIPTION OF THE FIGURES

[0012] FIG. 1 shows the exemplary modification pattern of the siRNAs disclosed herein. 2’-methoxy is referred to as 2’-OMe and is depicted using striped boxes, 2’-fluoro is referred to as 2’-F and is depicted using gray boxes, and phosphorothioate is referred to as PTO and is indicated by arrows. The number of the nucleotides is indicated on the top of the sense strand and on the bottom of the antisense strand.

[0013] FIGs. 2A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 2B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48469K1 on the X-axis. FIG. 2C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48475K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 2B and 2C.

[0014] FIGs. 3A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 3B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48480K1 on the X-axis. FIG. 3C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48481K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 3B and 3C.

[0015] FIGs. 4A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 4B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48482K1 on the X-axis. FIG. 4C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48497K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 4B and 4C.

[0016] FIGs. 5A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 5B shows a dose response curve with the relative % levels of remaining p65 mRNA expression -4- in A431 cells on the Y-axis and the concentration of XD-48498K1 on the X-axis. FIG. 5C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48506K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 5B and 5C.

[0017] FIGs. 6A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 6B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48507K1 on the X-axis. FIG. 6C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48509K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 6B and 6C.

[0018] FIGs. 7A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 7B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48510K1 on the X-axis. FIG. 7C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48511K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 7B and 7C.

[0019] FIGs. 8A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 8B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48515K1 on the X-axis. FIG. 8C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48516K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 8B and 8C.

[0020] FIGs. 9A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 9B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48517K1 on the X-axis. FIG. 9C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in -5- A431 cells on the Y-axis and the concentration of XD-48518K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 9B and 9C.

[0021] FIGs. 10 A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 10B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48523K1 on the X-axis. FIG. 10C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48525K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 10B and 10C.

[0022] FIGs. 11A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 11B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48526K1 on the X-axis. FIG. 11C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48530K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 1 IB and 1 IC.

[0023] FIGs. 12A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 12B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48533K1 on the X-axis. FIG. 12C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48544K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 12B and 12C.

[0024] FIGs. 13A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in A431 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 13B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48558K1 on the X-axis. FIG. 13C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in A431 cells on the Y-axis and the concentration of XD-48562K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 13B and 13C.

[0025] FIGs. 14A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 14B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells on the Y-axis and the concentration of XD-48469K1 on the X-axis. FIG. 14C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells on the Y-axis and the concentration of XD-48525K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 14B and 14C.

[0026] FIGs. 15A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNAs at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 15B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells on the Y-axis and the concentration of XD-48526K1 on the X-axis. FIG. 15C shows a dose response curve with the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells on the Y-axis and the concentration of XD-48530K1 on the X-axis. IC50 is indicated by the dotted line in FIGs. 15B and 15C.

[0027] FIGs. 16A shows a bar graph showing the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells (on the Y axis) resulting from treatment of the cells with the indicated siRNA at concentrations ranging from 0.002 nM to 50 nM (on the X axis) for 24 hours. FIG. 16B shows a dose response curve with the relative % levels of remaining p65 mRNA expression in McA-RH7777 cells on the Y-axis and the concentration of XD-48533K1 on the X-axis. IC50 is indicated by the dotted line in FIG. 16B.

[0028] FIG. 17 shows a bar graph showing the “fold change” (on the Y axis) of p65 expression in PANC-1 cells 72hrs post siRNA transfection resulting from treatment of the cells with siRNA at a dose of lOOnM. Results are shown for untransfected cells (white) and transfected cells based on distinct molar ratios of the peptide:siRNA (“NP ratio”: 1:100 (black); 1:50 (dark grey); 1:20 (lighter grey); and 1:5 (light grey)). The results are normalized based on untransfected cells (1.0 fold change).

[0029] FIG. 18 shows a bar graph showing the “fold change” (on the Y axis) of p65 expression in PANC-1 cells 72hrs post siRNA transfection resulting from treatment of the cells with siRNA at a dose of 200nM. Results are shown for untransfected cells (white) and transfected cells based on distinct NP ratios (1:100 (black); 1:50 (dark grey); and 1:5 (light grey)). The results are normalized based on untransfected cells (1.0 fold change). The loss of p65 expression is also presented as % expression loss over expression in untransfected cells. -7- |0030| FIG. 19 shows a bar graph showing the “fold change” (on the Y axis) of p65 expression in PANC-1 cells 72hrs post siRNA transfection resulting from treatment of the cells with siRNA at a dose of 200nM. Results are shown (left hand, “Plate 1”) for HSA-coated particles (versus uncoated) and (right hand, “Plate 2”) for HA-coated particles (versus uncoated): Untransfected cells (white) and transfected cells based on distinct NP ratios and for coated and uncoated particles (1:100, uncoated (black); 1:100, coated (chess-like pattern); 1:5, uncoated (light grey); and 1:5 coated (light grey, patterned). The results are normalized based on untransfected cells (1.0 fold change). The loss of p65 expression is also presented as % expression loss over expression in untransfected cells.

[0031] FIG. 20A shows a bar graph showing the “fold change” (on the Y axis) of p65 expression in PANC-1 cells 72hrs post siRNA transfection resulting from treatment of the cells with siRNA at a dose of 200nM. Results are shown (left hand, “Plate 1”) for HSA-coated particles (versus uncoated) and (right hand, “Plate 2”) for HA-coated particles (versus uncoated): Untransfected cells (white) and transfected cells based on distinct NP ratios and for coated and uncoated particles (1:100, uncoated (black); 1:100, coated (chess-like pattern); 1:5, uncoated (light grey); and 1:5 coated (light grey, patterned). The results are normalized based on untransfected cells (1.0 fold change). The loss of p65 expression is also presented as % expression loss over expression in untransfected cells. Fig. 20B shows a bar graph showing the “fold change” (on the Y axis) of p65 expression in PANC-1 cells 72hrs post siRNA transfection resulting from treatment of the cells with siRNA at a dose of 200nM. Results are shown for HA-coated particles (versus uncoated): Untransfected cells (white) and transfected cells for coated and uncoated particles (1:100, uncoated (black); 1 TOO, HA-coated (chess-like pattern). The results are normalized based on untransfected cells (1.0 fold change). The loss of p65 expression is also presented as % expression loss over expression in untransfected cells.

[0032] FIG. 21 shows a bar graph showing the “fold change” (on the Y axis) of p65 expression in PANC-1 cells 24, 48 and 72hrs post siRNA transfection resulting from treatment of the cells with siRNA at a dose of 200nM. Results are shown for untransfected cells (white) and transfected cells based on distinct NP ratios and for coated (HSA- and HA coated) and uncoated particles: NP 1:5, HSA-coated (peptide:HSA molar ratio of 1:5) (light grey, patterned); 1:100, uncoated (black); and 1:100, HA-coated (peptide:HA molar ratio of 1:200) (grey, chess-like pattern)). The results are normalized based on untransfected cells (1.0 fold change). The loss of p65 expression is also presented as % expression loss over expression in untransfected cells. DETAILED DESCRIPTION

[0033] Following long-standing patent law convention, the terms “a”, “an”, and “the” refer to “one or more” when used in this application, including the claims.

[0034] Also as used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0035] In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. The term “about”, when immediately preceding a number or numeral, means that the number or numeral ranges plus or minus 10%.

[0036] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, such as a mammal. The mammal may be, for example, a mouse, a rat, a rabbit, a cat, a dog, a pig, a sheep, a horse, a non-human primate (e.g., cynomolgus monkey, chimpanzee), or a human. A subject’s tissues, cells, or derivatives thereof, obtained in vivo or cultured in vitro are also encompassed. A human subject may be an adult, a teenager, a child (2 years to 14 years of age), an infant (1 month to 24 months), or a neonate (up to 1 month). In embodiments, the adults are seniors about 65 years or older, or about 60 years or older. In some embodiments, the subject is a pregnant woman or a woman intending to become pregnant.

[0037] As used herein, “treatment” or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and / or a prophylactic benefit. Therapeutic benefit refers to any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. The term “treating” in one embodiment, includes: (1) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in the patient that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; (2) inhibiting the state, disorder or condition (e.g., arresting, reducing or delaying the development of the disease, or a relapse thereof in case of maintenance treatment, of at least one clinical or subclinical symptom thereof); (3) relieving the condition (for example, by causing regression, or reducing the severity of the state, disorder or condition or at least one of its clinical or subclinical symptoms).

[0038] The term “effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to achieve an outcome, for example, to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like.

[0039] The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymer.

[0040] The terms “homologous,” “identical,” or percent “identity” in relation to two or more peptides, refers to two or more sequences or subsequences that have a specified percentage of amino acid residues that are the same (i.e., about 60% identity, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or by manual alignment and visual inspection (see, e.g., NCB1 web site www.ncbi.nlm.nih.gov / BLAST / or the like). The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions, as well as naturally occurring, e.g., polymorphic or allelic variants, and man-made variants. The algorithms can account for gaps and the like.

[0041] The terms “isolated,” “purified,” or “biologically pure” refer to material that is substantially or essentially free from components that normally accompany it as found in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. A protein or nucleic acid that is the predominant species present in a preparation is substantially purified. The term “purified” in embodiments denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For instance, it means that the nucleic acid or protein is at least 85% pure, at least 95% pure, and most at least 99% pure. “Purify” or “purification” in embodiments means removing at least one contaminant from the composition to be purified. In this sense, purification does not require that the purified compound be homogenous, e.g., 100% pure.

[0042] The term “target sequence” refers to a sequence of nucleotides found within the mRNA of a target gene (e.g., the p65 gene). Such a sequence of nucleotides is complementary to the anti-sense strand of an siRNA disclosed herein. A. Peptide-Polynucleotide Complex

[0043] The disclosure provides compositions for p65 inhibition comprising a peptidepolynucleotide complex. In embodiments, the polynucleotide is a small interfering RNA (siRNA) targeting human p65 mRNA. In embodiments, the peptide-polynucleotide complexes disclosed herein are capable of efficient transfection of the polynucleotide associated with the peptide into the cytoplasm of a cell. Peptide

[0044] In embodiments, the peptide-polynucleotide complexes disclosed herein comprise a peptide. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein is derived from melittin and modified to attenuate its cytotoxicity while maintaining its propensity for interacting with membrane bilayers. Furthermore, the peptide is substantially non-lytic and non-cytotoxic to cells.

[0045] In embodiments, a peptide-polynucleotide complex disclosed herein comprises a peptide that (1) has a function substantially similar to a peptide with an amino acid sequence of SEQ ID NO: 192 (VLTTGLPALISWIRRRHRRHC), SEQ ID NO: 193 (VLTTGLPALISWIRRRHRRHG), or SEQ ID NO:     194 (VLTTGLPALISWIKRKRQHRWRRRR), and (2) has an amino acid sequence with similarity or identity to the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194. As used herein, the phrase “functions substantially similar to a peptide comprising SEQ ID NO: 192, 193, or 194” refers to a substantially non-lytic and / or non-cytotoxic peptide that is capable of affecting the release of the polynucleotide from an endosome. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein is non-lytic. The term “non-lytic” means that the lipid bilayer of a cell typically is not compromised upon contact with the peptide. The integrity of the lipid bilayer may be assessed by the improper entry or exit of cellular or extracellular components into a cell. For example, cellular proteins and / or organelles may leak out of a cell with a compromised lipid bilayer. Alternatively, extracellular components (z.e., those that normally do not enter via gap junctions, for example) may enter a cell with a compromised lipid bilayer. It should be noted, however, that the peptide may penetrate the lipid bilayer of a cell and enter the interior of the cell, but in doing so the integrity of the lipid bilayer is not affected. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein is substantially non-cytotoxic. The term “non-cytotoxic” indicates that the cell typically is not killed upon contact with the peptide. Typically, a peptide of the peptide-polynucleotide complexes disclosed herein decreases cell viability by no more than about 10%, no more than about 7%, no more than about 5%, or no more than about 3%. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein is non-lytic and non-cytotoxic.

[0046] A peptide of the peptide-polynucleotide complexes disclosed herein is capable of associating with a polynucleotide. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises at least one cationic region that interacts with a polynucleotide. As used herein, a “cationic region” has 2 or more contiguous, basic amino acids.

[0047] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein possesses an endosomolytic capacity, which allows it to affect the release of a polynucleotide from an endosome and into the cytoplasm of a cell. As used herein, the term “endosomolytic” describes substances that initiate or facilitate the lysis of endosomes. The endosomolytic capacity of a peptide of the peptide-polynucleotide complexes disclosed herein obviates the need for additional endosomolytic agents, such as chloroquine, fusogenic peptides, inactivated adenoviruses and polyethyleneimine, for releasing transfected polynucleotides from endosomes for delivery into the cytoplasm of a cell. Such known endosomolytic agents have negative effects on cells and may increase cytotoxicity during transfection.

[0048] Without being bound by a theory, it is thought that the protonation of histidine residues of a peptide of the peptide-polynucleotide complexes disclosed herein promotes disassembly of the peptide-polynucleotide complex, which releases the peptide to permeabilize the endosomal membrane for polynucleotide release. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises one or more histidine residues located adjacent to or within at least one cationic region of the peptide. By way of a non-limiting example, if a peptide of the peptide-polynucleotide complexes disclosed herein comprises three cationic regions, the peptide may have at least one histidine adjacent to or within the first cationic region of the peptide, at least one histidine adjacent to or within the second cationic region of the peptide, at least one histidine adjacent to or within the third cationic region of the peptide, at least one histidine adjacent to or within each of the first and second cationic region of the peptide, at least one histidine adjacent to or within each of the first and third cationic region of the peptide, at least one histidine adjacent to or within each of the second and third cationic region of the peptide, or at least one histidine adjacent to or within each of the first, -12- second and third cationic region of the peptide. A histidine residue adjacent to a cationic region may be positioned before or after the cationic region. In embodiments, a histidine residue adjacent to a cationic region is immediately adjacent to the region. In embodiments, a histidine residue adjacent to a cationic region is not immediately adjacent to the region. For example, the histidine residue may be within about 2, 3, 4 or 5 positions from the cationic region. In embodiments, a histidine residue is within a cationic region.

[0049] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises SEQ ID NO: 192. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein consists of SEQ ID NO: 192. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein is a variant of SEQ ID NO: 192, wherein the variant comprises at least 10 contiguous amino acids of SEQ ID NO: 192 and functions substantially similar to a peptide comprising SEQ ID NO: 192. For instance, a peptide of the peptide-polynucleotide complexes disclosed herein may encompass at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous amino acids of SEQ ID NO: 192.

[0050] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises an amino acid sequence that has at least 80% identity to SEQ ID NO: 192, wherein the peptide is non-lytic and is capable of affecting the release of a polynucleotide from an endosome of a cell. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises an amino acid sequence that has at least about 80% identity to SEQ ID NO: 192 (for instance, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100%, including all values and subranges that lie therebetween), wherein the peptide is non-lytic and is capable of affecting the release of a polynucleotide from an endosome of a cell. The peptide comprising an amino acid sequence that has at least 80% identity to SEQ ID NO: 192, can have about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 192.

[0051] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprising an amino acid sequence that has at least 80% identity to SEQ ID NO: 192 may comprise one or more amino acids that have been conservatively substituted. For instance, one, two, three, four, five, six, seven, eight, nine, ten or more than ten amino acids may be conservatively substituted.

[0052] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises SEQ ID NO: 193. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein consists of SEQ ID NO: 193. In embodiments, a peptide of the -13- peptide-polynucleotide complexes disclosed herein is a variant of SEQ ID NO: 193, wherein the variant comprises at least 10 contiguous amino acids of SEQ ID NO: 193 and functions substantially similar to a peptide comprising SEQ ID NO: 193, For instance, a peptide of the peptide-polynucleotide complexes disclosed herein may encompass at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous amino acids of SEQ ID NO: 193.

[0053] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises an amino acid sequence that has at least 80% identity to SEQ ID NO: 193, wherein the peptide is non-lytic and is capable of affecting the release of a polynucleotide from an endosome of a cell. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises an amino acid sequence that has at least about 80% identity to SEQ ID NO: 193 (for instance, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100%, including all values and subranges that lie therebetween), wherein the peptide is non-lytic and is capable of affecting the release of a polynucleotide from an endosome of a cell. The peptide comprising an amino acid sequence that has at least 80% identity to SEQ ID NO: 193, can have about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 193.

[0054] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprising an amino acid sequence that has at least 80% identity to SEQ ID NO: 193 may comprise one or more amino acids that have been conservatively substituted. For instance, one, two, three, four, five, six, seven, eight, nine, or more than nine amino acids may be conservatively substituted.

[0055] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises SEQ ID NO: 194. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein consists of SEQ ID NO: 194. In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein is a variant of SEQ ID NO: 194, wherein the variant comprises at least 10 contiguous amino acids of SEQ ID NO: 194 and functions substantially similar to a peptide comprising SEQ ID NO: 194. For instance, a peptide of the peptide-polynucleotide complexes disclosed herein may encompass at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 contiguous amino acids of SEQ ID NO: 194.

[0056] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises an amino acid sequence that has at least 80% identity to SEQ ID NO: 194, wherein the peptide is non-lytic and is capable of affecting the release of a polynucleotide from an endosome of a cell. In embodiments, a peptide of the peptide-polynucleotide complexes -14- disclosed herein comprises an amino acid sequence that has at least about 80% identity to SEQ ID NO: 194 (for instance, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100%, including all values and subranges that lie therebetween), wherein the peptide is non-lytic and is capable of affecting the release of a polynucleotide from an endosome of a cell. The peptide comprising an amino acid sequence that has at least 80% identity to SEQ ID NO: 194, can have about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100% identity to the amino acid sequence of SEQ ID NO: 194.

[0057] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprising an amino acid sequence that has at least 80% identity to SEQ ID NO: 194 may comprise one or more amino acids that have been conservatively substituted. For instance, one, two, three, four, five, six, seven, eight, nine, or more than nine amino acids may be conservatively substituted.

[0058] In embodiments, a peptide of the peptide polynucleotide complexes disclosed herein may be modified at the N-terminus and / or C-terminus. The modification may be a fatty acid modification, an acetylation and / or an amidation. In particular, the peptide may be modified at the C- terminus by an amidation (“amide”).

[0059] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein comprises an amino acid sequence that has at least about 80% identity to any one of SEQ ID NOs: 195 to 219, including peptides Rn with 8<n<16 (for instance, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% or 100% with any one of these sequences. The sequences according to SEQ ID NOs: 195 to 219 are shown in the below table A: Peptide name Amino acid sequence SEQ ID NO: Mellitin GIGAVLKVLTTGLPALISWIKRKRQQ 195 Peptide 5C VLTTGLPALISWIKRKRQQC 196 Peptide 5RWR VLTTGLPALISWIKRKRQQRWRRRR 197 Peptide 5RH VLTTGLPALISWIRRRHRRC 198 Peptide 5RH-AA VAKVLTTGAPALISWIRRRHRRC 199 Peptide 5RH-LL VLKVLTTLAPALISWIRRRHRRC 200 TAT47.57 YGRKKRRQRRR 201 Penetratin RQIKIWFQNRRMKWKK 202 Transportan GWTLNSAGYLLGKINLKALAALAKKIL 203 TP10 AGYLLGKINLKALAALAKKIL 204 Rns-RVG RRRRRRRRRRVG 205 Ro RRRRRRRRR 206 R15 RRRRRRRRRRRRRRR 207 Dermaseptin S4 ALWMTLLKKVLKAAAKAALNAVLVGANA 208 MPG GALFLGFLGAAGSTMGAWSQPKKKRKV 209 MPGanls GALFLGFLGAAGSTMGAWSQPKSKRKV 210 MPG8 pAFLGWLGAWGTMGWSPKKKRK 211 MPGa GALFLAFLAAALSLMGLWSQPKKKRKV 212 CADY GLWRALWRLLRSLWRLLWRA 213 Arg8 RRRRRRRR 214 TAT GRKKRRQRRRPQ 215 LMWP VSRRRRRRGGRRRR 216 STR-Arg8 STRRRRRRRRR 217 RALA WEARLARALARALARHLARALARALRACEA 218 Pep-1 KETWWETWWTEWSQPKKKRKV 219

[0060] A peptide of the peptide-polynucleotide complexes disclosed herein may be produced using a variety of techniques known in the art. The peptides may be isolated using standard techniques, may be synthesized using standard techniques, or may be purchased or obtained from a depository.

[0061] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein contains a C-terminal thiol in the form of a cysteine residue. In embodiment, when a peptide of the peptide-polynucleotide complexes disclosed herein contains a C-terminal thiol in the form of a cysteine residue, a peptide of the peptide-polynucleotide complexes disclosed herein may be able to form a disulfide bond with another free thiol group, for example, with a free thiol group from the same or different peptide. A skilled artisan can readily determine whether dimer formation does or does not improve the delivery of plasmid DNA. Without wishing to be bound by theory, dimer formation may improve the delivery of plasmid DNA for certain peptides disclosed herein due to improved DNA condensation. Dimerization may be induced by incubation of free peptide in 20% DMSO for 24-72 hours, or by other methods known in other art. As a non-limiting example, free thiols may be quantified by colorimetric assays using Ellman's Reagent.

[0062] In embodiments, a peptide of the peptide-polynucleotide complexes disclosed herein may be labeled. Non-limiting examples of suitable labels include fluorescent labels, chemiluminescent labels, radioactive labels, colorimetric labels, and resonance labels. Methods of labeling peptides are well known in the art.

[0063] In embodiments, a peptide may be bound to a cargo complex. As used herein, the term “cargo complex” may refer to any molecule or agent that may be carried by or bound to the peptide other than a polynucleotide disclosed herein. Stated another way, a peptide of the peptide-polynucleotide complexes disclosed herein may be bound to a cargo complex in addition to a polynucleotide disclosed herein. For instance, a cargo complex may be an imaging cargo, a therapeutic cargo, a cytotoxic cargo, or a targeting cargo.

[0064] Non-limiting examples of imaging cargo molecules and agents may include any molecule, agent, or material having a detectable physical or chemical property. Such imaging cargos have been well-developed in the field of fluorescent imaging, magnetic resonance imaging, positron emission tomography, Raman imaging, optical coherence tomography, photoacoustic imaging, Fourier transform infrared imaging, or immunoassays and, in general, most any label useful in such methods may be applied to the present invention. For a review of various labeling or signal producing systems that may be used, see U.S. Pat. No. 4,391,904, incorporated herein by reference in its entirety.

[0065] Non-limiting examples of therapeutic cargo may include any substance that has a biological activity, such as pharmacological agents. Such therapeutic cargo may include analgesics, antipyretics, antiasthmatics, antibiotics, antidepressants, antidiabetics, antifungal agents, antihypertensive agents, anti-inflammatories including non-steroidal and steroidal, antineoplastics, antianxiety agents, immunosuppressive agents, anti migraine agents, sedatives, hypnotics, antianginal agents, antipsychotic agents, antimanic agents, antiarrhythmics, antiarthritic agents, antigout agents, anticoagulants, thrombolytic agents, antifibrinolytic agents, hemorheologic agents, antiplatelet agents, anticonvulsants, antiparkinson agents, antihistamines, anti-restenosis agents, antipruritics, agents useful for calcium regulation, antibacterial agents, antiviral agents, antimicrobials, anti-infectives, bronchodilators, steroidal compounds and hormones, and combinations thereof. Alternatively, a cargo complex may be in the form of components of molecular complexes or pharmacologically acceptable salts.

[0066] Cytotoxic cargo refers to a molecule or agent that is detrimental to (e.g, kills or damages) a cell. Examples may include anti-microtubule drugs such as the taxols (paclitaxel, docetaxel) and vinca alkaloids (vincristine, vinblastine). For instance, examples may include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin didne, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.

[0067] A targeting cargo may be any molecule or agent that directs a peptide-polynucleotide complex disclosed herein to a cell. A targeting cargo may be directed to a eukaryotic target cell or a prokaryotic target cell. Non-limiting examples of targeting agents may include an antibody or an antibody fragment, a receptor ligand, a small molecule, a peptide, a polypeptide, a lipid, a carbohydrate, a nucleic acid, a siRNA, a shRNA, an antisense RNA, a dendrimer, a microbubble, or an aptamer.

[0068] The means by which a cargo complex is bound to a peptide of the peptidepolynucleotide complexes disclosed herein can and will vary depending on the embodiment. A cargo complex may be bound to a peptide of the peptide-polynucleotide complexes disclosed herein by any means known in the art, including covalently or non-covalently.

[0069] Further details on the peptides of the the peptide-polynucleotide complexes disclosed herein are provided in U.S. Patent No. 9987371, U.S. Patent No. 10758627, and U.S. Patent No. 11529388, the contents of each of which is incorporated herein by reference in their entireties for all purposes. Polynucleotide

[0070] In embodiments, the peptide-polynucleotide complexes disclosed herein comprise a polynucleotide. The polynucleotide may be single stranded, double stranded, or a combination thereof. In embodiments, the polynucleotide is double stranded. In embodiments, the polynucleotide is single stranded. In embodiments, the polynucleotide is a combination of single stranded and double stranded.

[0071] In embodiments, the polynucleotide is a ribonucleic acid (RNA), a deoxyribonucleic acid (DNA), or a combination of RNA and DNA. Additionally, the polynucleotide may comprise modified nucleic acid bases, such as modified DNA bases or modified RNA bases. Modifications may occur at, but are not restricted to, the sugar 2’ position, the C-5 position of pyrimidines, and the 8-position of purines. Examples of suitable modified DNA or RNA bases include 2’-fluoro nucleotides, 2’-amino nucleotides, 5’-aminoallyl-2’-fluoro nucleotides and phosphorothioate nucleotides (monothiophosphate and dithiophosphate). In embodiments, the polynucleotide comprises a nucleotide mimic. Examples of nucleotide mimics include locked nucleic acids (LNA), peptide nucleic acids (PNA), and phosphorodiamidate morpholino oligomers (PMO).

[0072] In embodiments, the polynucleotide of the peptide-polynucleotide complexes disclosed herein comprises RNA. Non-limiting examples of RNA sequences may include mRNA capable of encoding a protein, and non-coding RNA such as tRNA, rRNA, snoRNAs, microRNAs, siRNAs, saRNA, piRNAs and the long noncoding RNA (IncRNA). In -18- embodiments, the polynucleotide is an mRNA molecule. The mRNA molecule may be 5’ capped, polyadenylated, or capped and polyadenylated. In embodiments, the mRNA molecule comprises one or more internal ribosomal entry sites (IRES) for translation of an internal open reading frame of the mRNA.

[0073] In embodiments, the polynucleotide comprises non-coding RNA capable of regulating or inhibiting the expression of a nucleic acid sequence expressed in a cell. Nonlimiting examples of non-coding RNA capable of regulating or inhibiting the expression of a nucleic acid sequence expressed in a cell include microRNAs (also known as miRNAs), siRNAs, piRNAs and IncRNAs. In general, transfection of a cell with a non-coding RNA capable of regulating or inhibiting the expression of a nucleic acid sequence may lead to cleavage of the nucleic acid sequence, enhance, prevent, or disrupt translation of the nucleic acid sequence into a protein, or regulate the transcription of a nucleic acid sequence.

[0074] In embodiments, a polynucleotide disclosed herein comprises a non-coding RNA capable of disrupting expression of a nucleic acid sequence expressed in a cell. As used herein, “disrupting expression of a nucleic acid sequence” may be used to describe any decrease in the expression level of a nucleic acid sequence (such as, an mRNA), or a protein translated from the nucleic acid sequence, when compared to a level of expression of the nucleic acid sequence in a cell that was not treated with a peptide-polynucleotide complex disclosed herein. In embodiments, the polynucleotide comprises a short interfering RNA (siRNA).

[0075] In embodiments, a siRNA comprises a double-stranded RNA molecule that ranges from about 15 to about 29 nucleotides in length. In embodiments, the siRNA is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length. In embodiments, the siRNA is about 16 to about 18, about 17 to about 19, about 21 to about 23, about 24 to about 27, or about 27 to about 29 nucleotides in length. In embodiments, the siRNA is about 21 nucleotides in length. A siRNA may optionally further comprise one or two single-stranded overhangs, e.g., a 5 ’ overhang on one or both ends, a 3 ’ overhang on one or both ends, or a combination thereof. The siRNA may be formed from two RNA molecules that hybridize together or, alternatively, may be generated from a short hairpin RNA (shRNA). In embodiments, the two strands of the siRNA may be completely complementary, such that no mismatches or bulges exist in the duplex formed between the two sequences. In embodiments, the two strands of the siRNA may be substantially complementary, such that one or more mismatches and / or bulges may exist in the duplex formed between the two sequences. In embodiments, one or both of the 5’ ends of the siRNA may have a phosphate group, while in embodiments one or both of the 5’ ends lack a phosphate group. In embodiments, one or both of the 3’ ends of the siRNA may have a hydroxyl group, while in embodiments one or both of the 5’ ends lack a hydroxyl group.

[0076] One strand of the siRNA, which is referred to as the “antisense strand” or “guide strand,” includes a portion that hybridizes with a target transcript. A target transcript refers to a nucleic acid sequence (such as, an mRNA), the expression of which is targeted for disruption by the siRNA. In embodiments, the antisense strand of the siRNA is completely complementary with a region of the target transcript, i.e., it hybridizes to the target transcript without a single mismatch or bulge over a target region. In embodiments, the target region is between about 15 and about 29 nucleotides in length. In embodiments, the target region is at least 16 nucleotides in length. In embodiments, the target region is about 18-20 nucleotides in length. In embodiments, the antisense strand is substantially complementary to the target region, i.e., one or more mismatches and / or bulges may exist in the duplex formed by the antisense strand and the target transcript. In embodiments, siRNAs are targeted to exonic sequences of the target transcript. Those of skill in the art are familiar with programs, algorithms, and / or commercial services that design siRNAs for target transcripts. Non-limiting examples are the Rosetta siRNA Design Algorithm (Rosetta Inpharmatics, North Seattle, Wash.), MISSION® siRNA (Sigma-Aldrich, St. Louis, Mo.) and siGENOME siRNA (Thermo Scientific). The siRNA may be enzymatically synthesized in vitro using methods well known to those of skill in the art. Alternatively, the siRNA may be chemically synthesized using oligonucleotide synthesis techniques that are well known in the art.

[0077] In embodiments, the polynucleotide comprises a non-coding RNA capable of disrupting the expression of a nucleic acid sequence encoding human p65 / RELA. In embodiments, the non-coding RNA is siRNA.

[0078] Exemplary siRNAs compatible with the polypeptide-polynucleotide complexes disclosed herein are listed in Table 1 below. Table 1: siRNA sequences disclosed herein Sense Sequence 5'—>3' SEQ ID NO Antisense Sequence 5'-->3' SE ID NO AUGUGGAGAUCAUUGAGCA 220 UGCUCAAUGAUCUCCACAUAG 315 CUACAAGUGCGAGGGGCGA 221 UCGCCCCUCGCACUUGUAGCG 316 UACAAGUGCGAGGGGCGCA 222 UGCGCCCCUCGCACUUGUAGC 317 AGUGCGAGGGGCGCUCCGA 223 UCGGAGCGCCCCUCGCACUUG 318 GUGCGAGGGGCGCUCCGCA 224 UGCGGAGCGCCCCUCGCACUU 319 CUCCGCGGGCAGCAUCCCA 225 UGGGAUGCUGCCCGCGGAGCG 320 GCAGCAUCCCAGGCGAGAA 226 UUCUCGCCUGGGAUGCUGCCC 321 CAGCAUCCCAGGCGAGAGA 227 UCUCUCGCCUGGGAUGCUGCC 322 CAUCCCAGGCGAGAGGAGA 228 UCUCCUCUCGCCUGGGAUGCU 323 AUCCCAGGCGAGAGGAGCA 229 UGCUCCUCUCGCCUGGGAUGC 324 GGCGAGAGGAGCACAGAUA 230 UAUCUGUGCUCCUCUCGCCUG 325 GCGAGAGGAGCACAGAUAA 231 UUAUCUGUGCUCCUCUCGCCU 326 AGAGGAGCACAGAUACCAA 232 UUGGUAUCUGUGCUCCUCUCG 327 AGCACAGAUACCACCAAGA 233 UCUUGGUGGUAUCUGUGCUCC 328 GACCCACCCCACCAUCAAA 234 UUUGAUGGUGGGGUGGGUCUU 329 AGAUCAAUGGCUACACAGA 235 UCUGUGUAGCCAUUGAUCUUG 330 AUCAAUGGCUACACAGGAA 236 UUCCUGUGUAGCCAUUGAUCU 331 UCAAUGGCUACACAGGACA 237 UGUCCUGUGUAGCCAUUGAUC 332 CACAGGACCAGGGACAGUA 238 UACUGUCCCUGGUCCUGUGUA 333 AGCUUGUAGGAAAGGACUA 239 UAGUCCUUUCCUACAAGCUCG 334 CUUGUAGGAAAGGACUGCA 240 UGCAGUCCUUUCCUACAAGCU 335 UGUAGGAAAGGACUGCCGA 241 UCGGCAGUCCUUUCCUACAAG 336 GUAGGAAAGGACUGCCGGA 242 UCCGGCAGUCCUUUCCUACAA 337 GAAAGGACUGCCGGGAUGA 243 UCAUCCCGGCAGUCCUUUCCU 338 AAAGGACUGCCGGGAUGGA 244 UCCAUCCCGGCAGUCCUUUCC 339 GGACUGCCGGGAUGGCUUA 245 UAAGCCAUCCCGGCAGUCCUU 340 GCCGGGAUGGCUUCUAUGA 246 UCAUAGAAGCCAUCCCGGCAG 341 UUCUAUGAGGCUGAGCUCA 247 UGAGCUCAGCCUCAUAGAAGC 342 UCUAUGAGGCUGAGCUCUA 248 UAGAGCUCAGCCUCAUAGAAG 343 CUAUGAGGCUGAGCUCUGA 249 UCAGAGCUCAGCCUCAUAGAA 344 UGAGCUCUGCCCGGACCGA 250 UCGGUCCGGGCAGAGCUCAGC 345 GAGCUCUGCCCGGACCGCA 251 UGCGGUCCGGGCAGAGCUCAG 346 AGCUCUGCCCGGACCGCUA 252 UAGCGGUCCGGGCAGAGCUCA 347 CUGCCCGGACCGCUGCAUA 253 UAUGCAGCGGUCCGGGCAGAG 348 UGCCCGGACCGCUGCAUCA 254 UGAUGCAGCGGUCCGGGCAGA 349 GCCCGGACCGCUGCAUCCA 255 UGGAUGCAGCGGUCCGGGCAG 350 CCCGGACCGCUGCAUCCAA 256 UUGGAUGCAGCGGUCCGGGCA 351 CCGGACCGCUGCAUCCACA 257 UGUGGAUGCAGCGGUCCGGGC 352 CGACCUGAAUGCUGUGCGA 258 UCGCACAGCAUUCAGGUCGUA 353 GACCUGAAUGCUGUGCGGA 259 UCCGCACAGCAUUCAGGUCGU 354 CCUGAAUGCUGUGCGGCUA 260 UAGCCGCACAGCAUUCAGGUC 355 CUGAAUGCUGUGCGGCUCA 261 UGAGCCGCACAGCAUUCAGGU 356 UGAAUGCUGUGCGGCUCUA 262 UAGAGCCGCACAGCAUUCAGG 357 GAAUGCUGUGCGGCUCUGA 263 UCAGAGCCGCACAGCAUUCAG 358 GCGGCUCUGCUUCCAGGUA 264 UACCUGGAAGCAGAGCCGCAC 359 GGACAUAUGAGACCUUCAA 265 UUGAAGGUCUCAUAUGUCCUU 360 GACAUAUGAGACCUUCAAA 266 UUUGAAGGUCUCAUAUGUCCU 361 AGAAGAGUCCUUUCAGCGA 267 UCGCUGAAAGGACUCUUCUUC 362 GAAGAGUCCUUUCAGCGGA 268 UCCGCUGAAAGGACUCUUCUU 363 AAGAGUCCUUUCAGCGGAA 269 UUCCGCUGAAAGGACUCUUCU 364 AGAGUCCUUUCAGCGGACA 270 UGUCCGCUGAAAGGACUCUUC 365 GAGUCCUUUCAGCGGACCA 271 UGGUCCGCUGAAAGGACUCUU 366 AGUCCUUUCAGCGGACCCA 272 UGGGUCCGCUGAAAGGACUCU 367 UCCUUUCAGCGGACCCACA 273 UGUGGGUCCGCUGAAAGGACU 368 ACGCAUUGCUGUGCCUUCA 274 UGAAGGCACAGCAAUGCGUCG 369 AUUGCUGUGCCUUCCCGCA 275 UGCGGGAAGGCACAGCAAUGC 370 GACUUCUCCUCCAUUGCGA 276 UCGCAAUGGAGGAGAAGUCUU 371 ACUUCUCCUCCAUUGCGGA 277 UCCGCAAUGGAGGAGAAGUCU 372 UUCUCCUCCAUUGCGGACA 278 UGUCCGCAAUGGAGGAGAAGU 373 UCCUCCAUUGCGGACAUGA 279 UCAUGUCCGCAAUGGAGGAGA 374 UCCAUUGCGGACAUGGACA 280 UGUCCAUGUCCGCAAUGGAGG 375 CCAUUGCGGACAUGGACUA 281 UAGUCCAUGUCCGCAAUGGAG 376 CAUUGCGGACAUGGACUUA 282 UAAGUCCAUGUCCGCAAUGGA 377 AUUGCGGACAUGGACUUCA 283 UGAAGUCCAUGUCCGCAAUGG 378 UUGCGGACAUGGACUUCUA 284 UAGAAGUCCAUGUCCGCAAUG 379 UGCGGACAUGGACUUCUCA 285 UGAGAAGUCCAUGUCCGCAAU 380 AGUCAGAUCAGCUCCUAAA 286 UUUAGGAGCUGAUCUGACUCA 381 GUCAGAUCAGCUCCUAAGA 287 UCUUAGGAGCUGAUCUGACUC 382 UCAGAUCAGCUCCUAAGGA 288 UCCUUAGGAGCUGAUCUGACU 383 CAGAUCAGCUCCUAAGGGA 289 UCCCUUAGGAGCUGAUCUGAC 384 CAGGGGAUUGAAGCCCUCA 290 UGAGGGCUUCAAUCCCCUGCA 385 AGGGGAUUGAAGCCCUCCA 291 UGGAGGGCUUCAAUCCCCUGC 386 AAGCACUUACGGAUUCUGA 292 UCAGAAUCCGUAAGUGCUUUU 387 AGCACUUACGGAUUCUGGA 293 UCCAGAAUCCGUAAGUGCUUU 388 GCACUUACGGAUUCUGGUA 294 UACCAGAAUCCGUAAGUGCUU 389 CACUUACGGAUUCUGGUGA 295 UCACCAGAAUCCGUAAGUGCU 390 CUUACGGAUUCUGGUGGGA 296 UCCCACCAGAAUCCGUAAGUG 391 UUACGGAUUCUGGUGGGGA 297 UCCCCACCAGAAUCCGUAAGU 392 UACGGAUUCUGGUGGGGUA 298 UACCCCACCAGAAUCCGUAAG 393 ACGGAUUCUGGUGGGGUGA 299 UCACCCCACCAGAAUCCGUAA 394 GGAUUCUGGUGGGGUGUGA 300 UCACACCCCACCAGAAUCCGU 395 UUCUGGUGGGGUGUGUUCA 301 UGAACACACCCCACCAGAAUC 396 UCUGGUGGGGUGUGUUCCA 302 UGGAACACACCCCACCAGAAU 397 GGUGCUUAAGCAGAAGCAA 303 UUGCUUCUGCUUAAGCACCUC 398 UUAACUUCUCUGGAAAGGA 304 UCCUUUCCAGAGAAGUUAAUG 399 AGCUGGGGAAACUCAAACA 305 UGUUUGAGUUUCCCCAGCUCC 400 CCCUGUCCUGAUGGUCAGA 306 UCUGACCAUCAGGACAGGGGA 401 CUGAUGGUCAGCUCCCUUA 307 UAAGGGAGCUGACCAUCAGGA 402 UGAUGGUCAGCUCCCUUCA 308 UGAAGGGAGCUGACCAUCAGG 403 UAUCAAGUGUCUUCCAUCA 309 UGAUGGAAGACACUUGAUAAG 404 CAAGUGUCUUCCAUCAUGA 310 UCAUGAUGGAAGACACUUGAU 405 AAGUGUCUUCCAUCAUGGA 311 UCCAUGAUGGAAGACACUUGA 406 CCAGUCAGGAGGCAUAGUA 312 UACUAUGCCUCCUGACUGGAG 407 CAGUCAGGAGGCAUAGUUA 313 UAACUAUGCCUCCUGACUGGA 408 AGUCAGGAGGCAUAGUUUA 314 UAAACUAUGCCUCCUGACUGG 409

[0079] In embodiments, the siRNAs disclosed herein are modified. In embodiments, the modifications are selected from the group consisting of 2’-methoxy (2’-OMe), 2’-fluoro (2’-F), 2’-O-methoxyethyl (2’-O-MOE), 5’-vinylphosphonate, phosphorothioate (PTO), locked nucleic acid (LNA), locked nucleic acid (UNA), glycol nucleic acid (GNA), and DNA.

[0080] In embodiments, the modifications of the sense strand comprise PTO at positions 1 and / or 2. In embodiments, the modifications of the sense strand comprise 2’-F at one or more positions of 3, 7-9, 12, and 17. In embodiments, the modifications of the sense strand comprise 2’-OMe at one or more positions of 1, 2, 4-6, 10, 11, 13-16, 18, and 19. In embodiments, the modifications of the antisense strand comprise PTO at one or more positions of 1, 2, 19, and 20. In embodiments, the modifications of the antisense strand comprise 2’-F at positions 2 and / or 14. In embodiments, the modifications of the antisense strand comprise 2’-OMe at any position of 1, 3-13, and 15-21.

[0081] In embodiments, the last nucleotide of the sense strand is adenine (A). In embodiments, the first nucleotide of the antisense strand is uracil (U). In embodiments, the last nucleotide of the sense strand is uracil (U). In embodiments, the first nucleotide of the antisense strand is adenine (A). In embodiments, the last nucleotide of the sense strand is cytosine (C). In embodiments, the first nucleotide of the antisense strand is guanine (G). In embodiments, the last nucleotide of the sense strand is guanine (G). In embodiments, the first nucleotide of the antisense strand is cytosine (C).

[0082] Exemplary modified siRNAs compatible with the polypeptide-polynucloetide complexes disclosed herein are shown in Table 2 below. Table 2; Modified siRNAs disclosed herein

[0083] In the sequences in Table 2 below, “n” denotes 2'O-methyl RNA, “Nf ’ denotes 2'-fluoro RNA, and “s” denotes phosphorothioate. siRNA ID Sense SEQ ID NO: Sense Sequence 5'-->3' Antisense SEQ ID NO: Antisense Sequence 5'-->3' XD-48469K1 1 asusGfuggAfGfAfucAfuugaGfca 96 usGfscucaaugaucuCfcacausasg XD-48470K1 2 csusAfcaaGfUfGfcgAfggggCfga 97 usCfsgccccucgcacUfuguagscsg XD-48471K1 3 usasCfaagUfGfCfgaGfgggcGfca 98 usGfscgccccucgcaCfiiuguasgsc XD-48472K1 4 asgsUfgcgAfGfGfggCfgcucCfga 99 usCfsggagcgccccuCfgcacususg XD-48473K1 5 gsusGfcgaGfGfGfgcGfcuccGfca 100 usGfscggagcgccccUfcgcacsusu XD-48474K1 6 csusCfcgcGfGfGfcaGfcaucCfca 101 usGfsggaugcugcccGfcggagscsg XD-48475K1 7 gscsAfgcaUfCfCfcaGfgcgaGfaa 102 usUfscucgccugggaUfgcugcscsc XD-48476K1 8 csasGfcauCfCfCfagGfcgagAfga 103 usCfsucucgccugggAfugcugscsc XD-48477K1 9 csasUfcccAfGfGfcgAfgaggAfga 104 usCfsuccucucgccuGfggaugscsu XD-48478K1 10 asusCfccaGfGfCfgaGfaggaGfca 105 usGfscuccucucgccll fgggausgsc XD-48479K1 11 gsgsCfgagAfGfGfagCfacagAfua 106 usAfsucugugcuccuCfucgccsusg XD-48480K1 12 gscsGfagaGfGfAfgcAfcagaU faa 107 usUfsaucugugcuccUfcucgcscsu XD-48481K1 13 asgsAfggaGfCfAfcaGfauacCfaa 108 usUfsgguaucugugcUfccucuscsg XD-48482K1 14 asgsCfacaGfAfUfacCfaccaAfga 109 usCfsuuggugguaucUfgugcuscsc XD-48483Klxa 15 gsasCfccaCfCfCfcaCfcaucAfaa 110 usUfsugaugguggggUfgggucsusu XD-48484K1 16 asgsAfucaAfUfGfgcUfacacAfga 111 usCfsuguguagccauUfgaucususg XD-48485K1 17 asusCfaauGfGfCfuaCfacagGfaa 112 usUfsccuguguagccAfuugauscsu XD-48486K1 18 uscsAfaugGfCfU fac AfcaggAfca 113 usGfsuccuguguagcCfauugasusc XD-48487K1 19 csasCfaggAfCfCfagGfgacaGfua 114 us Afsc ugucccugguCfcugugsusa XD-48488K1 20 asgsCfuugUfAfGfgaAfaggaCfua 115 usAfsguccuuuccuaCfaagcuscsg XD-48489K1 21 csusUfguaGfGfAfaaGfgacuGfca 116 usGfscaguccuuuccUfacaagscsu XD-48490K1 22 usgsUfaggAfAfAfggAfcugcCfga 117 usCfsggcaguccuuuCfcuacasasg XD-48491K1 23 gsusAfggaAfAfGfgaCfugccGfga 118 usCfscggcaguccuuUfccuacsasa XD-48492K1 24 gsas Afagg AfCfU fgcCfgggaU fga 119 usCfsaucccggcaguCfcuuucscsu XD-48493K1 25 asasAfggaCfUfGfccGfggauGfga 120 usCfscaucccggcagUfccuuuscsc XD-48494K1 26 gsgsAfcugCfCfGfggAfuggcUfua 121 usAfsagccaucccggCfaguccsusu XD-48495K1 27 gscsCfggg AfUfGfgcU fucuaU fga 122 usCfsauagaagccauCfccggcsasg XD-48496K1 28 ususCfuauGfAfGfgcUfgagcUfca 123 usGfsagcucagccucAfuagaasgsc XD-48497K1 29 uscsUfaugAfGfGfcuGfagcuCfua 124 usAfsgagcucagccuCfauagasasg XD-48498K1 30 csusAfugaGfGfCfugAfgcucUfga 125 usCfsagagcucagccUfcauagsasa XD-48499K1 31 usgsAfgcuCfUfGfccCfggacCfga 126 usCfsgguccgggcagAfgcucasgsc XD-48500K1 32 gsasGfcucU fGfCfccGfgaccGfca 127 usGfscgguccgggcaGfagcucsasg XD-48501K1 33 asgsCfucuGfCfCfcgGfaccgCfua 128 usAfsgcgguccgggcAfgagcuscsa XD-48502K1 34 csusGfcccGfGfAfccGfcugcAfua 129 usAfsugcagcgguccGfggcagsasg XD-48503K1 35 usgsCfccgGfAfCfcgCfugcaUfca 130 usGfsaugcagcggucCfgggcasgsa XD-48504K1 36 gscsCfcggAfCfCfgcUfgcauCfca 131 usGfsgaugcagcgguCfcgggcsasg XD-48505K1 37 cscsCfggaCfCfGfcuGfcaucCfaa 132 usUfsggaugcagcggU fccgggscsa XD-48506K1 38 cscsGfgacCfGfCfugCfauccAfca 133 usGfsuggaugcagcgGfuccggsgsc XD-48507K1 39 csgsAfccuGfAfAfugCfugugCfga 134 usCfsgcacagcauucAfggucgsusa XD-48508K1 40 gsasCfcugAfAfUfgcUfgugcGfga 135 usCfscgcacagcauuCfaggucsgsu XD-48509K1 41 cscsU fgaaU fGfCfugU fgcggCfua 136 us AfsgccgcacagcaU fucaggsusc XD-48510K1 42 csusGfaauGfCfUfguGfcggcUfca 137 usGfsagccgcacagcAfuucagsgsu XD-48511K1 43 usgsAfaugCfUfGfugCfggcuCfua 138 usAfsgagccgcacagCfauucasgsg XD-48512K1 44 gsasAfugcUfGfUfgcGfgcucUfga 139 usCfsagagccgcacaGfcauucsasg XD-48513K1 45 gscsG fgcuCfU fG fcuU fccagGfua 140 usAfsccuggaagcagAfgccgcsasc XD-48514K1 46 gsgs AfcauAfU fGfagAfccuuCfaa 141 usUfsgaaggucucauAfuguccsusu XD-48515K1 47 gsasCfauaUfGfAfgaCfcuucAfaa 142 usUfsugaaggucucaUfaugucscsu XD-48516K1 48 asgs AfagaGfUfCfcuU fucagCfga 143 usCfsgcugaaaggacU fcuucususc XD-48517K1 49 gsas AfgagU fCfCfuuU fcagcGfga 144 usCfscgcugaaaggaCfucuucsusu XD-48518K1 50 asasGfaguCfCfUfuuCfagcgGfaa 145 usU fsccgcugaaagg Afcuc uuscsu XD-48519K1 51 asgsAfgucCfUfUfucAfgcggAfca 146 usGfsuccgcugaaagGfacucususc XD-48520K1 52 gsasGfuccUfUfUfcaGfcggaCfca 147 usGfsguccgcugaaaGfgacucsusu XD-48521K1 53 asgsUfccuUfUfCfagCfggacCfca 148 usGfsgguccgcugaaAfggacuscsu XD-48522K1 54 uscsCfuuuCfAfGfcgGfacccAfca 149 usGfsuggguccgcugAfaaggascsu XD-48523K1 55 ascsGfcauU fGfCfugU fgccuU fca 150 usGfsaaggcacagcaAfugcguscsg XD-48524K1 56 asusUfgcuGfUfGfccUfiicccGfca 151 usGfscgggaaggcacAfgcaausgsc XD-48525K1 57 gsasCfuucUfCfCfucCfauugCfga 152 usCfsgcaauggaggaGfaagucsusu XD-48526K1 58 ascsUfucuCfCfUfccAfuugcGfga 153 usCfscgcaauggaggAfgaaguscsu XD-48527K1 59 ususCfuccUfCfCfauUfgcggAfca 154 usG fsuccgcaauggaGfgagaasgsu XD-48528K1 60 uscsCfucc AfUfU fgcGfgacaU fga 155 usCfsauguccgcaauGfgaggasgsa XD-48529K1 61 uscsCfauuGfCfGfgaCfauggAfca 156 usGfsuccauguccgcAfauggasgsg XD-48530K1 62 cscsAfuugCfGfGfacAfuggaCfua 157 usAfsguccauguccgCfaauggsasg XD-48531K1 63 csasUfugcGfGfAfcaUfggacUfua 158 usAfsaguccauguccGfcaaugsgsa XD-48532K1 64 asusUfgcgGfAfCfauGfgacuUfca 159 usGfsaaguccaugucCfgcaausgsg XD-48533K1 65 ususGfcggAfCfAfiigGfacuuCfua 160 usAfsgaaguccauguCfcgcaasusg XD-48534K1 66 usgsCfggaCfAfUfggAfcuucUfca 161 usGfsagaaguccaugUfccgcasasu XD-48535K1 67 asgsU fcag AfU fCfagCfuccu Afaa 162 usUfsuaggagcugauCfugacuscsa XD-48536K1 68 gsusCfagaU fCfAfgcU fccua Afga 163 usCfsuuaggagcugaUfcugacsusc XD-48537K1 69 uscsAfgauCfAfGfcuCfcuaaGfga 164 usCfscuuaggagcugAfucugascsu XD-48538K1 70 csasGfaucAfGfCfiicCfuaagGfga 165 usCfsccuuaggagcuGfaucugsasc XD-48539K1 71 csasGfgggAfUfU fgaAfgcccU fca 166 usGfsagggcuucaauCfcccugscsa XD-48540K1 72 asgsGfggaUfUfGfaaGfcccuCfca 167 usGfsgagggcuucaaUfccccusgsc XD-48541K1 73 asasGfcacUfU fAfcgGfauucU fga 168 usCfsagaauccguaaGfugcuususu XD-48542K1 74 asgsCfacuUfAfCfggAfuucuGfga 169 usCfscagaauccguaAfgugcususu XD-48543K1 75 gscsAfcuuAfCfGfgaUfucugGfua 170 usAfsccagaauccguAfagugcsusu XD-48544K1 76 csasCfuuaCfGfGfauUfcuggUfga 171 usCfsaccagaauccgUfaagugscsu XD-48545Klxa 77 csusUfacgGfAfUfucUfggugGfga 172 usCfsccaccagaaucCfguaagsusg XD-48546Klxa 78 ususAfcggAfUfUfcuGfguggGfga 173 usCfscccaccagaauCfcguaasgsu XD-48547K1 79 usasCfggaUfUfCfugGfugggGfua 174 us AfsccccaccagaaU fccguasasg XD-48548Klxa 80 ascsGfgauU fCfU fggU fggggUfga 175 usCfsaccccaccagaAfuccgusasa XD-48549K1 81 gsgsAfuucUfGfGfugGfggugUfga 176 usCfsacaccccaccaGfaauccsgsu XD-48550Klxa 82 ususCfuggUfGfGfggUfguguUfca 177 usGfsaacacaccccaCfcagaasusc XD-48551Klxa 83 uscsUfgguGfGfGfguGfuguuCfca 178 usGfsgaacacaccccAfccagasasu XD-48553K1 84 gsgsUfgcuUfAfAfgcAfgaagCfaa 179 usU fsgcuucugcuua Afgcaccsusc XD-48554K1 85 ususAfacuUfCfUfcuGfgaaaGfga 180 usCfscuuuccagagaAfguuaasusg XD-48555K1 86 asgsCfuggGfGfAfaaCfucaaAfca 181 usGfsuuugaguuuccCfcagcuscsc XD-48556K1 87 cscsCfuguCfCfUfgaUfggucAfga 182 usCfsugaccaucaggAfcagggsgsa XD-48557K1 88 csusGfaugGfUfCfagCfucccUfua 183 usAfsagggagcugacCfaucagsgsa XD-48558K1 89 usgs AfuggU fCfAfgcU fcccuUfca 184 usGfsaagggagcugaCfcaucasgsg XD-48559K1 90 usasUfcaaGfUfGfucUfuccaUfca 185 usGfsauggaagacacUfugauasasg XD-48560K1 91 csas AfgugU fCfUfucCfaucaUfga 186 usCfsaugauggaagaCfacuugsasu XD-48561K1 92 asasGfuguCfUfUfccAfucauGfga 187 usCfscaugauggaagAfcacuusgsa XD-48562K1 93 cscsAfgucAfGfGfagGfcauaGfua 188 usAfscuaugccuccuGfacuggsasg XD-48563K1 94 csasGfucaGfGfAfggCfauagUfua 189 us AfsacuaugccuccU fgacugsgsa XD-48564K1 95 asgsUfcagGfAfGfgcAfuaguUfua 190 usAfsaacuaugccucCfugacusgsg

[0084] In embodiments, the sense strand comprises a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of any one of the sense strands listed in Table 1 or Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with at least 85% identity to the nucleic acid sequence of any one of the sense strands listed in Table 2 or Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with at least 90% identity to the nucleic acid sequence of any one of the sense strands listed in Table 1 or Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with at least 95% identity to the nucleic acid sequence of any one of the sense strands listed in Table 1 or Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with at least 98% identity to the nucleic acid sequence of any one of the sense strands listed in Table 1 or Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with at least 99% identity to the nucleic acid sequence of any one of the sense strands listed in Table 1 or Table 2. In embodiments, the sense strand comprises a nucleic acid sequence with 100% identity to the nucleic acid sequence of any one of the sense strands listed in Table 1 or Table 2.

[0085] In embodiments, the antisense strand comprises a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 85% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 90% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 95% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 98% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2. In embodiments, the antisense strand comprises a nucleic acid sequence with at least 99% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2. In embodiments, the antisense strand comprises a nucleic acid sequence with 100% identity to the nucleic acid sequence of any one of the antisense strands listed in Table 1 or Table 2.

[0086] In embodiments, the polynucleotide is a combination of RNA and DNA. In embodiments, the polynucleotide comprises DNA. When the polynucleotide is DNA, the polynucleotide may comprise an expression cassette. As used herein, an “expression cassette” is a nucleic acid construct comprising a nucleic acid sequence encoding an RNA, a protein or a peptide operably linked to a promoter. In embodiments, the nucleic acid construct further -26- comprises additional regulatory sequences. A non-limiting example of an additional regulatory sequence includes a transcription termination sequence. Other regulatory sequences are known in the art. As used herein, the term promoter may mean a synthetic or naturally-derived molecule capable of conferring or activating expression of a target nucleic acid sequence in a cell. The promoter may be a promoter normally associated with a DNA polynucleotide of the the peptide-polynucleotide complexes disclosed herein or may be a heterologous promoter. A heterologous promoter may be derived from such sources as viruses, bacteria, fungi, plants, insects, and animals. The promoter may regulate the expression of a DNA sequence constitutively or differentially with respect to the cell, the tissue or organ in which expression occurs. In embodiments, the promoter may regulate expression with respect to developmental stage, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents or activators (i.e., an inducible promoter). Non-limiting representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, HSP70 basal promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, a promoter comprising the tetracycline response element (TRE) nucleic acid sequence, and the CMV IE promoter.

[0087] In embodiments, a DNA polynucleotide of the the peptide-polynucleotide complexes disclosed herein is incorporated into a vector. One of skill in the art would be able to construct a vector through standard recombinant techniques (see, for example, Sambrook et al., 2001 and Ausubel et al., 1996, both incorporated herein by reference in their entireties for all purposes). Vectors include but are not limited to plasmids, cosmids, transposable elements, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs), such as retroviral vectors (e.g., derived from Moloney murine leukemia virus vectors (MoMLV), MSCV, SFFV, MPSV, SNV etc.), lentiviral vectors (e.g., derived from HIV-1, HIV-2, SIV, BIV, FIV etc.), adenoviral (Ad) vectors including replication competent, replication deficient and gutless forms thereof, adeno-associated viral (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papilloma virus vectors, Epstein-Barr virus, herpes virus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, murine mammary tumor virus vectors, and Rous sarcoma virus vectors.

[0088] In embodiments, the promoters utilized to direct in vivo expression of the one or more siRNA or shRNA transcription units are promoters for RNA polymerase III (Pol III). Certain Pol III promoters, such as U6 or Hl promoters, do not require cis-acting regulatory elements within the transcribed region, and thus, are in embodiments. In embodiments, promoters for -27- Pol II may be used to drive expression of the one or more siRNA or shRNA transcription units. In embodiments, tissue-specific, cell-specific, or inducible Pol II promoters may be used.

[0089] A construct that provides a template for the synthesis of siRNA or shRNA may be produced using standard recombinant DNA methods and inserted into any of a wide variety of different vectors suitable for expression in eukaryotic cells. Guidance may be found in Current Protocols in Molecular Biology (Ausubel et al., John Wiley & Sons, New York, 2003) or Molecular Cloning: A Laboratory Manual (Sambrook & Russell, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 3rd edition, 2001). Those of skill in the art also appreciate that vectors may comprise additional regulatory sequences (e.g., termination sequence, translational control sequence, etc.), as well as selectable marker sequences. DNA plasmids are known in the art, including those based on pBR322, PUC, and so forth. Since many expression vectors already contain a suitable promoter or promoters, it may only be necessary to insert the nucleic acid sequence that encodes the RNAi agent of interest at an appropriate location with respect to the promoter(s). Viral vectors may also be used to provide intracellular expression of RNAi agents. Suitable viral vectors include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated virus vectors, herpes virus vectors, and so forth. In embodiments, the RNAi expression vector is a shRNA lentiviral-based vector or lentiviral particle, such as that provided in MISSION® TRC shRNA products (Sigma-Aldrich).

[0090] Nucleic acid sequences disclosed herein may be obtained using a variety of different techniques known in the art. The nucleic acid sequences, as well as homologous sequences, may be isolated using standard techniques, may be synthesized using standard techniques, or may be purchased or obtained from a depository. Once the nucleic acid sequence is obtained, it may be amplified for use in a variety of applications, using methods known in the art. Polypeptide-Polyn ucleotide Complex

[0091] In embodiments, the polypeptide disclosed herein and the polynucleotide disclosed herein associate to form a complex. As used herein, the term “associate” may refer to the interaction of a peptide and a polynucleotide through non-covalent bonds, or to the covalent bonding of a peptide and a polynucleotide. In embodiments, a polypeptide and a polynucleotide disclosed herein associate through non-covalent bonds such as a hydrogen bond, an ionic bond, a bond based on Van der Waals, a hydrophobic bond, or electrostatic interactions. For instance, a peptide of the peptide-polynucleotide complexes disclosed herein may have an overall net positive charge, which may allow the peptide to associate with a polynucleotide disclosed herein through electrostatic interactions to form a complex disclosed herein.

[0092] The ratio of peptide to polynucleotide at which a peptide of the peptidepolynucleotide complexes disclosed herein associates with a polynucleotide disclosed herein can and will vary depending on the peptide, the polynucleotide composition, or the size of the polynucleotide, and may be determined experimentally. In essence, a suitable molar ratio of a peptide of the peptide-polynucleotide complexes disclosed herein to a polynucleotide of the peptide-polynucleotide complexes disclosed herein may be a molar ratio wherein the peptide completely complexes the polynucleotide, while minimizing exposure of a subject (who is administered the peptide-polynucleotide complexes disclosed herein) to the peptide.

[0093] In embodiments, the ratio is the molar ratio. In embodiments, the molar ratio is about 2:1 to about 3500:1. In embodiments, the molar ratio of peptide to polynucleotide is about 4:1 to about 1000:1. In embodiments, the molar ratio of peptide to polynucleotide is about 10:1 to about 500:1. In embodiments, the molar ratio of peptide to polynucleotide is about 5:1 to about 200:1. In embodiments, the molar ratio of peptide to polynucleotide is about 50:1 to about 200:1. In embodiments, the molar ratio of peptide to polynucleotide is about 100:1. In embodiments, the molar ratio of peptide to polynucleotide is about 5:1.

[0094] In embodiments, the ratio is the charge ratio. As used herein, the “charge ratio” is the ratio of positively-chargeable polymer amine groups to negatively-charged nucleic acid phosphate groups. In embodiments, the charge ratio of peptide to polynucleotide is about 6:1 to about 18:1. In embodiments, the charge ratio of peptide to polynucleotide is about 6:1. In embodiments, the charge ratio of peptide to polynucleotide is about 7:1. In embodiments, the charge ratio of peptide to polynucleotide is about 8:1. In embodiments, the charge ratio of peptide to polynucleotide is about 9:1. In embodiments, the charge ratio of peptide to polynucleotide is about 10:1. In embodiments, the charge ratio of peptide to polynucleotide is about 11:1. In embodiments, the charge ratio of peptide to polynucleotide is about 12:1. In embodiments, the charge ratio of peptide to polynucleotide is about 13:1. In embodiments, the charge ratio of peptide to polynucleotide is about 14:1. In embodiments, the charge ratio of peptide to polynucleotide is about 15:1. In embodiments, the charge ratio of peptide to polynucleotide is about 16:1. In embodiments, the charge ratio of peptide to polynucleotide is about 17:1. In embodiments, the charge ratio of peptide to polynucleotide is about 18:1.

[0095] Methods of determining the ratio wherein the peptide is capable of completely complexing the polynucleotide are known in the art and may include gel retardation assays. Methods of determining a molar ratio wherein exposure of a subject to the peptide is minimized are known in the art and may include cytotoxicity measurements using increasing doses of the polypeptide.

[0096] In embodiments, the peptide-polynucleotide complexes disclosed herein may be about 10 nm to about 500 nm in diameter. In embodiments, the diameter of the peptidepolynucleotide complex is about 10 nm to about 300 nm. In embodiments, the diameter of the peptide-polynucleotide complex is at least about 10 nm. In embodiments, the diameter of the peptide-polynucleotide complex is at most about 300 nm. In embodiments, the diameter of the peptide-polynucleotide complex is about 10 nm to about 50 nm, about 10 nm to about 100 nm, about 10 nm to about 150 nm, about 10 nm to about 200 nm, about 10 nm to about 250 nm, about 10 nm to about 300 nm, about 50 nm to about 100 nm, about 50 nm to about 150 nm, about 50 nm to about 200 nm, about 50 nm to about 250 nm, about 50 nm to about 300 nm, about 100 nm to about 150 nm, about 100 nm to about 200 nm, about 100 nm to about 250 nm, about 100 nm to about 300 nm, about 150 nm to about 200 nm, about 150 nm to about 250 nm, about 150 nm to about 300 nm, about 200 nm to about 250 nm, about 200 nm to about 300 nm, or about 250 nm to about 300 nm. In embodiments, the diameter of the peptide-polynucleotide complex is about 10 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, or about 300 nm.

[0097] In embodiments, the peptide-polynucleotide complex is a nanoparticle with a diameter of about 10 nm to about 500 nm. In embodiments, the nanoparticles disclosed herein may be further modified to enhance stability of the nanoparticle. For instance, a nanoparticle disclosed herein may be coated with albumin and / or hyaluronic acid to enhance stability. In embodiments, the nanoparticles disclosed herein coated with albumin may be about 5 to about 90 nm or more in diameter.

[0098] Particle size and / or charge may be assessed using methods known in the art. Nonlimiting examples of methods of measuring the size of a particle may include dynamic light scattering, light scattering, multi-angle light scattering, field-flow fractionation systems, laser diffraction, electrozone (electric sensing zone), light obscuration—also referred to as photozone and single particle optical sensing (SPOS), sieve analysis, aerodynamic measurements, air permeability diameter, sedimentation, nanoparticle tracking analysis, electron microspcopy, atomic force microscopy, small-angle X ray scattering, flow cytometry, measuring the zeta potential of the particle, analytical ultracentrifugation or combinations thereof. In embodiments, particle size is assessed by dynamic light scattering. In embodiments, particle charge is assessed by measuring the zeta potential of the particle. In embodiments, particle size and / or charge is assessed by dynamic light scattering or by measuring the zeta potential of the particle.

[0099] In embodiments, the nanoparticles disclosed herein may have a zeta potential of about -15 to about 20 mV, about 0 mV or more. For instance, the nanoparticle may have a zeta potential of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 mV or more. In embodiments, the nanoparticle has a zeta potential of about 1, about 2, about 3, about 4, or about 5 mV. In embodiments, the nanoparticle has a zeta potential of about 10, 11, 12, 13, or about 14 mV. In embodiments, the nanoparticle has a zeta potential of about 11, about 12, about 13, about 14, or about 15 mV. In embodiments, the nanoparticle has a zeta potential of about 1, about 2, about 3, about 4, or about 5 mV. In embodiments, the nanoparticle has a zeta potential of about 10, about 11, 12, about 13, or about 14 mV. In embodiments, the nanoparticle has a zeta potential of about 3.72 mV. In embodiments, the nanoparticle has a zeta potential of about 12 mV. In embodiments, the nanoparticle has a zeta potential of about 13.1 mV.

[00100] In embodiments, the peptide-polynucleotide complexes disclosed herein are capable of efficient release of the polynucleotide into the cytoplasm of a cell. In embodiments, the peptide-polynucleotide complex may also be capable of protecting the polynucleotide from degradation upon administration in a subject. In embodiments, the peptide-polynucleotide nanoparticle disclosed herein may remain stable in the presence of serum. In embodiments, the nanoparticle may remain stable in the presence of serum for about 10, 20, 30, 40, 50, 60 minutes, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 hours, about 1, 2, 3, 4, 5, 6, 7 days or longer. In embodiments, the nanoparticle may remain stable in the presence of about 5, 10, 15, 25, 50, 100, 150, 200, or about 300 pg / ml or more human serum albumin. Stability of the nanoparticle may be determined by measuring the ability of a nanoparticle to maintain the activity of a polynucleotide of the peptide-polynucleotide complex of the nanoparticle, or by measuring changes in the size of a nanoparticle over time.

[00101] Methods of preparing the peptide-polynucleotide complexes disclosed herein generally comprise contacting a peptide of the peptide-polynucleotide complexes disclosed herein with a polynucleotide disclosed herein to form the peptide-polynucleotide complex. Typically, a peptide and a polynucleotide are contacted by incubating under conditions suitable for a peptide-polynucleotide complex disclosed herein to form. Exemplary conditions suitable for a peptide-polynucleotide complex disclosed herein to form are described in the examples. Typically, such conditions may comprise a temperature of about 30°C to about 40°C, and incubation times of between about 20 sec to about 60 min or more. Suitable temperatures may also be lower than about 30°C. For example, incubation may occur on ice. One skilled in the -31- art will appreciate that the length and temperature of incubation can and will vary depending on the peptide and the polynucleotide and may be determined experimentally.

[00102] In embodiments, the peptide-polynucleotide nanoparticle disclosed herein may be further modified to enhance stability of the nanoparticle. For instance, a peptide-polynucleotide complex disclosed herein may be crosslinked to enhance the stability of nanoparticles. One of ordinary skill in the art would recognize that a suitable cross-linker can and will vary depending on the composition of the nanoparticle and the antibody or antibody fragment. In embodiments, the peptide-polynucleotide nanoparticle disclosed herein may be chemically crosslinked using chemical crosslinkers such as glutaraldehyde, bis-carboxylic acid spacers, bis-carboxylic acidactive esters, using a bis-linker amine / acid by carbodiimide coupling protocol, or using a click chemistry protocol, carbodiimde-coupling chemistry, acylation, active ester coupling, or alkylation.

[00103] In embodiments, the peptide-polynucleotide nanoparticle disclosed herein may be coated with a compound capable of enhancing the stability of nanoparticles. Methods of modifying a nanoparticle to enhance stability are known in the art. Further details are provided in Nicolas et al., 2013 Acta Biomater. 9:4754-4762, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[00104] As used herein, the term “coating” may refer to the interaction of a peptide-polynucleotide complex disclosed herein with a compound through non-covalent bonds, or to the covalent bonding of a peptide-polynucleotide complex disclosed herein with a compound. In embodiments, a peptide-polynucleotide complex disclosed herein and a coating compound associate through non-covalent bonds such as a hydrogen bond, an ionic bond, a bond based on Van der Waals, a hydrophobic bond, or electrostatic interactions. For instance, a peptide-polynucleotide complex disclosed herein may have an overall net positive charge, and a coating compound may have an overall negative charge which may allow the peptide-polynucleotide complex and compound to associate through electrostatic interactions to form a complex disclosed herein.

[00105] Non-limiting examples of compounds that may be used to coat a nanoparticle to enhance stability of the nanoparticle include polymeric compounds, such as proteins, peptides, or polysaccharides. Further Examples of such compounds are albumin, in particular human serum albumin, hyaluronic acid, fatty acids such as oleic acid, polyethylene glycol, polysaccharides such as chitosan, heparin or heparans and other glycosaminoglycans, or other published coating materials known to those skilled in the art. In embodiments, stability of a peptide-polynucleotide complex disclosed herein may be enhanced by coating nanoparticles -32- with a fatty acid. In embodiments, the stability of a peptide-polynucleotide complex disclosed herein may be enhanced by coating nanoparticles with a polysaccharide, such as hyaluronic acid.

[00106] In embodiments, stability of the peptide-polynucleotide nanoparticle disclosed herein may be enhanced by coating nanoparticles with albumin, in particular human serum albumin. Albumins are negatively charged globular proteins commonly found in blood serum. Without being bound by a theory, it is thought that coating nanoparticles disclosed herein with albumin may enhance stability of nanoparticles by preventing flocculation. In embodiments, the albumins that may be used to coat a nanoparticle comprising a peptide-polynucleotide complex disclosed herein are serum albumins, and may include bovine serum albumin and human serum albumin. In exemplary embodiments, stability of a nanoparticle comprising a peptide-polynucleotide complex disclosed herein may be enhanced by coating nanoparticles with human serum albumin or hyaluronic acid.

[00107] In essence, a nanoparticle is coated with albumin by incubating the nanoparticle with a solution comprising albumin. Nanoparticles may be incubated in a solution comprising about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8, 4.0, 4.2, 4.4, 4.6, 4.8, 5.0 mg / ml or more albumin. In embodiments, nanoparticles comprising a peptide-polynucleotide complex disclosed herein may be incubated in a solution comprising about 0.1. 0.3, 0.5, 0.7, or 0.9 mg / ml albumin. In embodiments, nanoparticles comprising a peptide-polynucleotide complex disclosed herein may be incubated in a solution comprising about 1.0, 1.2, 1.4, 1.6, or 1.8 mg / ml albumin. In embodiments, nanoparticles comprising a peptide-polynucleotide complex disclosed herein may be incubated in a solution comprising about 2.0, 2.2, 2.4, 2.6, or 2.8 mg / ml albumin. In embodiments, nanoparticles comprising a peptide-polynucleotide complex disclosed herein may be incubated in a solution comprising about 3.0, 3.2, 3.4, 3.6, or 3.8 mg / ml albumin. In additional embodiments, nanoparticles comprising a peptide-polynucleotide complex disclosed herein may be incubated in a solution comprising about 4.0, 4.2, 4.4, 4.6, 4.8, or 5.0 mg / ml albumin. In embodiments, nanoparticles comprising a peptide-polynucleotide complex disclosed herein may be incubated in a solution comprising about 4.0 mg / ml albumin.

[00108] In embodiments, the peptide-polynucleotide complexes disclosed herein may be incubated with albumin for about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or about 60 minutes or more to coat the peptide-polynucleotide complex. In embodiments, a particle comprising a peptide-polynucleotide complex disclosed herein is incubated with albumin for about 5, 10, 15, or about 20 minutes. In embodiments, a particle comprising a peptide--33- polynucleotide complex disclosed herein is incubated with albumin for about 20, 25, 30, or about 35 minutes. In embodiments, a particle comprising a peptide-polynucleotide complex disclosed herein is incubated with albumin for about 35, 40, 45, or about 50 minutes. In embodiments, a particle comprising a peptide-polynucleotide complex disclosed herein is incubated with albumin for about 50, 55, or about 60 minutes or more. In embodiments, a particle comprising a peptide-polynucleotide complex disclosed herein is incubated with albumin for about 25, 30, or about 35 minutes.

[00109] In embodiments, the peptide-polynucleotide complex disclosed herein may be incubated with hyaluronic acid for about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or about 60 minutes or more to allow the hyaluronic acid coat the peptide-polynucleotide complex or integrate into the peptide-polynucleotide complex. In embodiments, a peptide-polynucleotide complex disclosed herein may be incubated with hyaluronic acid for about 1, 2, 3, 4, 5, 10, 12, 18, or 24 hours or more, to allow the hyaluronic acid coat the peptide-polynucleotide complex or integrate into the peptide-polynucleotide complex. In embodiments, a peptide-polynucleotide complex disclosed herein may be incubated with hyaluronic acid for about 45 minutes. Shorter times could be used in embodiments, for example, when using flow processes or microfluidic devices. B. Cells

[00110] In embodiments, a peptide-polynucleotide complex disclosed herein is capable transfecting the polynucleotide into the cytoplasm of a cell. In embodiments, a cell is a prokaryotic cell. In embodiments, a cell is a eukaryotic cell. The cell may be in vitro, in vivo (such as, in a subject), in situ, or ex vivo. The cell may be a single cell or may be part of a tissue or an organ.

[00111] In embodiments, a peptide-polynucleotide complex disclosed herein may be administered to a cell in vitro by incubating a cell in the presence of a peptide-polynucleotide complex disclosed herein under conditions suitable for transfection of a polynucleotide of a peptide-polynucleotide complex. Conditions suitable for transfection of a polynucleotide in a peptide-polynucleotide complex disclosed herein may be as described in the examples. One skilled in the art will appreciate that the length of incubation can and will vary depending on the peptide-polynucleotide complex, and the cells. Typically, such conditions may comprise incubation times of between about ten minutes and 24 hours, transfection conditions may comprise incubation times of between about 15 minutes and 3 hours.

[00112] A peptide-polynucleotide complex disclosed herein may be administered to a cell in vivo (such as, in a subject) by administering to a subject a composition (such as, a pharmaceutical composition) comprising a peptide-polynucleotide complex disclosed herein. C. Compositions

[00113] In embodiments, a peptide-polynucleotide complex disclosed herein may be incorporated into a composition. In embodiments, the composition is a pharmaceutical composition suitable for administration to a subject. A pharmaceutical composition disclosed herein may be used to disrupt the expression of one or more nucleic acid sequences normally expressed in a cell. For instance, a pharmaceutical composition disclosed herein may be used to disrupt the expression of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid sequences normally expressed in a cell. In embodiments, the disrupted expression leads to measurable and beneficial effects for the subject administered the composition (i.e., significant efficacy). In embodiments, the disrupted expression leads to treatment of a disease or a disorder.

[00114] In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of one nucleic acid sequence normally expressed in a cell. In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of a nucleic acid sequence encoding p65 / RELA, such as the human p65 / RELA protein. In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of a nucleic acid sequence encoding STAT3. In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of a nucleic acid sequence encoding JNK2. In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of a nucleic acid sequence encoding the pl00 / p52 subunit of the canonical NFkB signaling pathway.

[00115] In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of two nucleic acid sequences normally expressed in a cell. In embodiments, a pharmaceutical composition disclosed herein is used to disrupt the expression of a nucleic acid sequence encoding the p65 subunit of the canonical NFkB signaling pathway, and a nucleic acid sequence encoding the pl00 / p52 subunit of the canonical NFkB signaling pathway.

[00116] When a pharmaceutical composition disclosed herein is used to disrupt the expression of more than one nucleic acid sequence normally expressed in a cell, a pharmaceutical composition may be formulated using a mixture of more than one peptide-polynucleotide complex, wherein each complex comprises a polynucleotide capable of disrupting the expression of a different nucleic acid sequence normally expressed in a cell. In embodiments, more than one polynucleotide may be used for generating a mixture of peptide- polynucleotide complexes, wherein each polynucleotide is capable of disrupting the expression of a different nucleic acid sequence normally expressed in a cell.

[00117] A pharmaceutical composition disclosed herein may also comprise one or more nontoxic pharmaceutically acceptable carriers, adjuvants, excipients, and vehicles as desired. As used herein, the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with nanoparticles disclosed herein, use thereof in the compositions is contemplated. Supplementary active compounds may also be incorporated into the compositions.

[00118] A pharmaceutical composition disclosed herein may be formulated to be compatible with its intended route of administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, polysorbates, poloxamers or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride, glucose or dextrose. The pH may be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[00119] Oral compositions generally may include an inert diluent or an edible carrier. Oral compositions may be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions may also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents and / or adjuvant materials may be included as part of the composition. The tablets, pills, capsules, troches, and the like, may contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent -36- such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

[00120] In embodiments, a pharmaceutical composition disclosed herein is formulated to be compatible with parenteral administration. For instance, pharmaceutical compositions suitable for injectable use may include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, balanced salt solution, bacteriostatic water, Cremophor EL (BASF; Parsippany, N.J.), or phosphate buffered saline (PBS). In exemplary embodiments, a pharmaceutical composition disclosed herein is formulated with phosphate buffered saline (PBS).

[00121] In embodiments, the composition is sterile and fluid to the extent that allows easy syringeability. In embodiments, the composition is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it may include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[00122] Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation are vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[00123] Systemic administration may also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and may include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration may be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. The compounds may also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[00124] In embodiments, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, chitosans, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[00125] Additional formulations of pharmaceutical compositions may be in, for example, Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (1975), and Liberman, H. A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y. (1980). Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton Pa., 16Ed ISBN: 0-912734-04-3, latest edition, incorporated herein by reference in its entirety, provides a compendium of formulation techniques as are generally known to practitioners.

[00126] One of skill in the art will recognize that the concentration of a peptidepolynucleotide complex disclosed herein in a pharmaceutical composition can and will vary depending in part on the route of administration, the subject, and the reason for the administration, and may be determined experimentally. Methods of experimentally determining the concentration of an active agent such as nanoparticles disclosed herein in a pharmaceutical composition are known in the art. In general, a pharmaceutical composition may be formulated to comprise about 0.1 nM to about 50 pM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. For example, a pharmaceutical composition may be formulated to comprise about 0.1 nM, 0.2 nM, 0.3 nM, 0.4 nM, 0.5 nM, 0.6 nM, 0.7 nM, 0.8 nM, 0.9 nM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 11 nM, 12 nM, -38- 13 nM, 14 nM, 15 nM, 16 nM, 17 nM, 18 nM, 19 nM, 20 nM, 21 nM, 22 nM, 23 nM, 24 nM, 25 nM, 26 nM, 27 nM, 28 nM, 29 nM, 30 nM, 31 nM, 32 nM, 33 nM, 34 nM, 35 nM, 36 nM, 37 nM, 38 nM, 39 nM, 40 nM, 41 nM, 42 nM, 43 nM, 44 nM, 45 nM, 46 nM, 47 nM, 48 nM, 49 nM, 50 nM, 51 nM, 52 nM, 53 nM, 54 nM, 55 nM, 56 nM, 57 nM, 58 nM, 59 nM, 60 nM, 61 nM, 62 nM, 63 nM, 64 nM, 65 nM, 66 nM, 67 nM, 68 nM, 69 nM, 70 nM, 71 nM, 72 nM, 73 nM, 74 nM, 75 nM, 76 nM, 77 nM, 78 nM, 79 nM, 80 nM, 81 nM, 82 nM, 83 nM, 84 nM, 85 nM, 86 nM, 87 nM, 88 nM, 89 nM, 90 nM, 91 nM, 92 nM, 93 nM, 94 nM, 95 nM, 96 nM, 97 nM, 98 nM, 99 nM, 100 nM, 101 nM, 102 nM, 103 nM, 104 nM, 105 nM, 106 nM, 107 nM, 108 nM, 109 nM, 110 nM, 111 nM, 112 nM, 113 nM, 114 nM, 115 nM, 116 nM, 117 nM, 118 nM, 119nM, 120 nM, 121 nM, 122 nM, 123 nM, 124 nM, 125 nM, 126 nM, 127 nM, 128 nM, 129 nM, 130 nM, 131 nM, 132 nM, 133 nM, 134 nM, 135 nM, 136 nM, 137 nM, 138 nM, 139 nM, 140 nM, 141 nM, 142 nM, 143 nM, 144 nM, 145 nM, 146 nM, 147 nM, 148 nM, 149 nM, 150 nM, 151 nM, 152 nM, 153 nM, 154 nM, 155 nM, 156 nM, 157 nM, 158 nM, 159 nM, 160 nM, 161 nM, 162 nM, 163 nM, 164 nM, 165 nM, 166 nM, 167 nM, 168 nM, 169 nM, 170 nM, 171 nM, 172 nM, 173 nM, 174 nM, 175 nM, 176 nM, 177 nM, 178 nM, 179 nM, 180 nM, 181 nM, 182 nM, 183 nM, 184 nM, 185 nM, 186 nM, 187 nM, 188 nM, 189 nM, 190 nM, 191 nM, 192 nM, 193 nM, 194 nM, 195 nM, 196 nM, 197 nM, 198 nM, 199 nM, 200 nM, 201 nM, 202 nM, 203 nM, 204 nM, 205 nM, 206 nM, 207 nM, 208 nM, 209 nM, 210 nM, 211 nM, 212 nM, 213 nM, 214 nM, 215 nM, 216 nM, 217 nM, 218 nM, 219 nM, 220 nM, 221 nM, 222 nM, 223 nM, 224 nM, 225 nM, 226 nM, 227 nM, 228 nM, 229 nM, 230 nM, 231 nM, 232 nM, 233 nM, 234 nM, 235 nM, 236 nM, 237 nM, 238 nM, 239 nM, 241 nM, 242 nM, 243 nM, 244 nM, 245 nM, 246 nM, 247 nM, 248 nM, 249 nM, 251 nM, 252 nM, 253 nM, 254 nM, 255 nM, 256 nM, 257 nM, 258 nM, 259 nM, 261 nM, 262 nM, 263 nM, 264 nM, 265 nM, 266 nM, 267 nM, 268 nM, 269 nM, 271 nM, 272 nM, 273 nM, 274 nM, 275 nM, 276 nM, 277 nM, 278 nM, 279 nM, 281 nM, 282 nM, 283 nM, 284 nM, 285 nM, 286 nM, 287 nM, 288 nM, 289 nM, 291 nM, 292 nM, 293 nM, 294 nM, 295 nM, 296 nM, 297 nM, 298 nM, 299 nM, 300 nM, 301 nM, 302 nM, 303 nM, 304 nM, 305 nM, 306 nM, 307 nM, 308 nM, 309 nM, 310 nM, 311 nM, 312 nM, 313 nM, 314 nM, 315 nM, 316 nM, 317 nM, 318 nM, 319 nM, 320 nM, 321 nM, 322 nM, 323 nM, 324 nM, 325 nM, 326 nM, 327 nM, 328 nM, 329 nM, 330 nM, 331 nM, 332 nM, 333 nM, 334 nM, 335 nM, 336 nM, 337 nM, 338 nM, 339 nM, 340 nM, 341 nM, 342 nM, 343 nM, 344 nM, 345 nM, 346 nM, 347 nM, 348 nM, 349 nM, 350 nM, 351 nM, 352 nM, 353 nM, 354 nM, 355 nM, 356 nM, 357 nM, 358 nM, 359 nM, 360 nM, 361 nM, 362 nM, 363 nM, 364 nM, 365 nM, 366 nM, 367 nM, 368 nM, 369 nM, 370 nM, 371 nM, 372 nM, 373 nM, 374 nM, 375 nM, 376 nM, 377 nM, 378 nM, 379 nM, 380 nM, 381 nM, 382 nM, 383 nM, 384 nM, 385 nM, 386 -39- nM, 387 nM, 388 nM, 389 nM, 390 nM, 391 nM, 392 nM, 393 nM, 394 nM, 395 nM, 396 nM, 397 nM, 398 nM, 399 nM, 400 nM, 401 nM, 402 nM, 403 nM, 404 nM, 405 nM, 406 nM, 407 nM, 408 nM, 409 nM, 410 nM, 411 nM, 412 nM, 413 nM, 414 nM, 415 nM, 416 nM, 417 nM, 418 nM, 419 nM, 420 nM, 421 nM, 422 nM, 423 nM, 424 nM, 425 nM, 426 nM, 427 nM, 428 nM, 429 nM, 430 nM, 431 nM, 432 nM, 433 nM, 434 nM, 435 nM, 436 nM, 437 nM, 438 nM, 439 nM, 440 nM, 441 nM, 442 nM, 443 nM, 444 nM, 445 nM, 446 nM, 447 nM, 448 nM, 449 nM, 450 nM, 451 nM, 452 nM, 453 nM, 454 nM, 455 nM, 456 nM, 457 nM, 458 nM, 459 nM, 460 nM, 461 nM, 462 nM, 463 nM, 464 nM, 465 nM, 466 nM, 467 nM, 468 nM, 469 nM, 470 nM, 471 nM, 472 nM, 473 nM, 474 nM, 475 nM, 476 nM, 477 nM, 478 nM, 479 nM, 480 nM, 481 nM, 482 nM, 483 nM, 484 nM, 485 nM, 486 nM, 487 nM, 488 nM, 489 nM, 490 nM, 491 nM, 492 nM, 493 nM, 494 nM, 495 nM, 496 nM, 497 nM, 498 nM, 499 nM, 500 nM, 501 nM, 502 nM, 503 nM, 504 nM, 505 nM, 506 nM, 507 nM, 508 nM, 509 nM, 510 nM, 511 nM, 512 nM, 513 nM, 514 nM, 515 nM, 516 nM, 517 nM, 518 nM, 519 nM, 520 nM, 521 nM, 522 nM, 523 nM, 524 nM, 525 nM, 526 nM, 527 nM, 528 nM, 529 nM, 530 nM, 531 nM, 532 nM, 533 nM, 534 nM, 535 nM, 536 nM, 537 nM, 538 nM, 539 nM, 540 nM, 541 nM, 542 nM, 543 nM, 544 nM, 545 nM, 546 nM, 547 nM, 548 nM, 549 nM, 550 nM, 551 nM, 552 nM, 553 nM, 554 nM, 555 nM, 556 nM, 557 nM, 558 nM, 559 nM, 560 nM, 561 nM, 562 nM, 563 nM, 564 nM, 565 nM, 566 nM, 567 nM, 568 nM, 569 nM, 570 nM, 571 nM, 572 nM, 573 nM, 574 nM, 575 nM, 576 nM, 577 nM, 578 nM, 579 nM, 580 nM, 581 nM, 582 nM, 583 nM, 584 nM, 585 nM, 586 nM, 587 nM, 588 nM, 589 nM, 590 nM, 591 nM, 592 nM, 593 nM, 594 nM, 595 nM, 596 nM, 597 nM, 598 nM, 599 nM, 600 nM, 601 nM, 602 nM, 603 nM, 604 nM, 605 nM, 606 nM, 607 nM, 608 nM, 609 nM, 610 nM, 611 nM, 612 nM, 613 nM, 614 nM, 615 nM, 616 nM, 617 nM, 618 nM, 619 nM, 620 nM, 621 nM, 622 nM, 623 nM, 624 nM, 625 nM, 626 nM, 627 nM, 628 nM, 629 nM, 630 nM, 631 nM, 632 nM, 633 nM, 634 nM, 635 nM, 636 nM, 637 nM, 638 nM, 639 nM, 640 nM, 641 nM, 642 nM, 643 nM, 644 nM, 645 nM, 646 nM, 647 nM, 648 nM, 649 nM, 650 nM, 651 nM, 652 nM, 653 nM, 654 nM, 655 nM, 656 nM, 657 nM, 658 nM, 659 nM, 660 nM, 661 nM, 662 nM, 663 nM, 664 nM, 665 nM, 666 nM, 667 nM, 668 nM, 669 nM, 670 nM, 671 nM, 672 nM, 673 nM, 674 nM, 675 nM, 676 nM, 677 nM, 678 nM, 679 nM, 680 nM, 681 nM, 682 nM, 683 nM, 684 nM, 685 nM, 686 nM, 687 nM, 688 nM, 689 nM, 690 nM, 691 nM, 692 nM, 693 nM, 694 nM, 695 nM, 696 nM, 697 nM, 698 nM, 699 nM, 700 nM, 701 nM, 702 nM, 703 nM, 704 nM, 705 nM, 706 nM, 707 nM, 708 nM, 709 nM, 710 nM, 711 nM, 712 nM, 713 nM, 714 nM, 715 nM, 716 nM, 717 nM, 718 nM, 719 nM, 720 nM, 721 nM, 722 nM, 723 nM, 724 nM, 725 nM, 726 nM, 727 nM, 728 nM, 729 nM, 730 nM, 731 nM, 732 nM, 733 nM, 734 nM, 735 nM, 736 nM, 737 nM, 738 nM, 739 nM, 740 nM, 741 nM, 742 nM, 743 -40- nM, 744 nM, 745 nM, 746 nM, 747 nM, 748 nM, 749 nM, 750 nM, 751 nM, 752 nM, 753 nM, 754 nM, 755 nM, 756 nM, 757 nM, 758 nM, 759 nM, 760 nM, 761 nM, 762 nM, 763 nM, 764 nM, 765 nM, 766 nM, 767 nM, 768 nM, 769 nM, 770 nM, 771 nM, 772 nM, 773 nM, 774 nM, 775 nM, 776 nM, 777 nM, 778 nM, 779 nM, 780 nM, 781 nM, 782 nM, 783 nM, 784 nM, 785 nM, 786 nM, 787 nM, 788 nM, 789 nM, 790 nM, 791 nM, 792 nM, 793 nM, 794 nM, 795 nM, 796 nM, 797 nM, 798 nM, 799 nM, 800 nM, 801 nM, 802 nM, 803 nM, 804 nM, 805 nM, 806 nM, 807 nM, 808 nM, 809 nM, 810 nM, 811 nM, 812 nM, 813 nM, 814 nM, 815 nM, 816 nM, 817 nM, 818 nM, 819 nM, 820 nM, 821 nM, 822 nM, 823 nM, 824 nM, 825 nM, 826 nM, 827 nM, 828 nM, 829 nM, 830 nM, 831 nM, 832 nM, 833 nM, 834 nM, 835 nM, 836 nM, 837 nM, 838 nM, 839 nM, 840 nM, 841 nM, 842 nM, 843 nM, 844 nM, 845 nM, 846 nM, 847 nM, 848 nM, 849 nM, 850 nM, 851 nM, 852 nM, 853 nM, 854 nM, 855 nM, 856 nM, 857 nM, 858 nM, 859 nM, 860 nM, 861 nM, 862 nM, 863 nM, 864 nM, 865 nM, 866 nM, 867 nM, 868 nM, 869 nM, 870 nM, 871 nM, 872 nM, 873 nM, 874 nM, 875 nM, 876 nM, 877 nM, 878 nM, 879 nM, 880 nM, 881 nM, 882 nM, 883 nM, 884 nM, 885 nM, 886 nM, 887 nM, 888 nM, 889 nM, 890 nM, 891 nM, 892 nM, 893 nM, 894 nM, 895 nM, 896 nM, 897 nM, 898 nM, 899 nM, 900 nM, 901 nM, 902 nM, 903 nM, 904 nM, 905 nM, 906 nM, 907 nM, 908 nM, 909 nM, 910 nM, 911 nM, 912 nM, 913 nM, 914 nM, 915 nM, 916 nM, 917 nM, 918 nM, 919 nM, 920 nM, 921 nM, 922 nM, 923 nM, 924 nM, 925 nM, 926 nM, 927 nM, 928 nM, 929 nM, 930 nM, 931 nM, 932 nM, 933 nM, 934 nM, 935 nM, 936 nM, 937 nM, 938 nM, 939 nM, 940 nM, 941 nM, 942 nM, 943 nM, 944 nM, 945 nM, 946 nM, 947 nM, 948 nM, 949 nM, 950 nM, 951 nM, 952 nM, 953 nM, 954 nM, 955 nM, 956 nM, 957 nM, 958 nM, 959 nM, 960 nM, 961 nM, 962 nM, 963 nM, 964 nM, 965 nM, 966 nM, 967 nM, 968 nM, 969 nM, 970 nM, 971 nM, 972 nM, 973 nM, 974 nM, 975 nM, 976 nM, 977 nM, 978 nM, 979 nM, 980 nM, 981 nM, 982 nM, 983 nM, 984 nM, 985 nM, 986 nM, 987 nM, 988 nM, 989 nM, 990 nM, 991 nM, 992 nM, 993 nM, 994 nM, 995 nM, 996 nM, 997 nM, 998 nM, 999 nM, 1 pM, 2 pM, 3 ^iM, 4 pM, 5 pM, 6 pM, 7 pM, 8 pM, 9 pM, 10 pM, 11 pM, 12 pM, 13 pM, 14 pM, 15 pM, 16 pM, 17 pM, 18 pM, 19 pM, 20 pM, 21 pM, 22 pM, 23 pM, 24 pM, 25 pM, 26 pM, 27 pM, 28 pM, 29 pM, 30 pM, 31 pM, 32 pM, 33 pM, 34 pM, 35 pM, 36 pM, 37 pM, 38 pM, 39 pM, 40 pM, 41 pM, 42 pM, 43 pM, 44 pM, 45 pM, 46 pM, 47 pM, 48 pM, 49 pM, or about 50 pM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 0.1 nM to about 1.0 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 1 nM to about 10 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may -41- be formulated to comprise about 1 nM to about 100 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 1 nM to about 200 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 1 nM to about 50 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 10 nM to about 100 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 10 nM to about 200 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 50 nM to about 100 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 50 nM to about 200 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 100 nM to about 200 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 150 nM to about 200 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 200 nM to about 100 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 500 nM to about 1000 nM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition may be formulated to comprise about 1 uM to about 50 pM of a polynucleotide in a peptidepolynucleotide complex disclosed herein. A concentration of peptide in a peptidepolynucleotide complex disclosed herein may be calculated based on the desired concentration of polynucleotide and the ratio of peptide to polynucleotide in the peptide-polynucleotide complex disclosed herein.

[00127] A pharmaceutical composition may also be formulated to comprise about 30,40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or about 700 pg / ml or more of a peptide-polynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition is formulated to comprise 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or about 100 pg / ml of a peptide-polynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition is formulated to comprise 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or about 300 -42- pg / ml of a peptide-polynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition is formulated to comprise 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or about 500 pg / ml of a peptidepolynucleotide complex disclosed herein. In embodiments, a pharmaceutical composition is formulated to comprise 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, or about 700 pg / ml or more of a peptide-polynucleotide complex disclosed herein. D. Methods of Use

[00128] The disclosure provides methods of using the peptide-polynucleotide complexes disclosed herein. In embodiments, the disclosure provides methods for using a peptide-polynucleotide complex disclosed herein to transfect the polynucleotide into the cytoplasm of a cell. In embodiments, the cell is in vitro. In embodiments, the cell is in vivo (such as, in a subject). The disclosure also provides methods for using a peptide-polynucleotide complex disclosed herein to transfect the polynucleotide into the cytoplasm of a cell in a subject in need thereof. In embodiments, the methods disclosed herein comprises contacting a cell with a peptide-polynucleotide complex disclosed herein under conditions suitable for transfection of a polynucleotide. In embodiments, the methods disclosed herein comprise administering a pharmaceutical composition comprising a peptide-polynucleotide complex disclosed herein to a subject in need thereof.

[00129] In embodiments, the disclosure provides methods for treating a condition in a subject. In embodiments, the methods for treating a condition in a subject disclosed herein comprise administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a peptide-polynucleotide complex disclosed herein. A peptide-polynucleotide complex disclosed herein is capable of efficiently transfecting, or delivering, the polynucleotide of the peptide-polynucleotide complex into a cell of the subject.

[00130] In embodiments, a polynucleotide disclosed herein comprises non-coding RNA capable of regulating or inhibiting expression of a nucleic acid sequence expressed in a cell. By efficiently transfecting a polynucleotide capable of regulating or inhibiting expression of a nucleic acid sequence expressed in a cell, a method disclosed herein may be used to treat any condition that can be treated by regulating or inhibiting the expression of a nucleic acid sequence normally expressed in a cell. In embodiments, the disclosure provides methods of administering a peptide-polynucleotide complex disclosed herein to a subject to treat an NFkB-mediated condition in the subject. In embodiments, the disclosure provides methods of administering to a subject a peptide-polynucleotide complex disclosed herein to treat a condition associated with overexpression or aberrant expression of p65 in the subject. In embodiments, the disclosure provides methods of administering to a subject a peptidepolynucleotide complex disclosed herein to treat a condition associated with STAT3 dysregulation in the subject. In embodiments, the disclosure provides methods of administering to a subject a peptide-polynucleotide complex disclosed herein to treat a condition associated with JNK2 dysregulation in the subject. E. Administration to a Subject in Need Thereof

[00131] In embodiments, the disclosure provides methods of administering a therapeutically effective amount of a pharmaceutical composition disclosed herein to a subject in need thereof. As used herein, the phrase “a subject in need thereof’ refers to a subject in need of preventative or therapeutic treatment. A subject may be a rodent, a human, a livestock animal, a companion animal, or a zoological animal. In one embodiment, a subject may be a rodent, e.g., a mouse, a rat, a guinea pig, etc. In another embodiment, a subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas and alpacas. In still another embodiment, a subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, a subject may be a zoological animal. As used herein, a “zoological animal” refers to an animal that may be found in a zoo. Such animals may include non-human primates, large cats, wolves, and bears. In embodiments, a subject is a mouse. In embodiments, a subject is a human.

[00132] As described herein, a pharmaceutical composition disclosed herein is formulated to be compatible with its intended route of administration. Suitable routes of administration include parenteral, oral, pulmonary, transdermal, transmucosal, and rectal administration. The term parenteral, as used herein, includes subcutaneous, intravenous, intramuscular, intrathecal, or intrasternal injection, or infusion techniques. Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g, sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and / or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain). In some embodiments, the administration is by injection into the central nervous system. The most suitable route in any given case will depend on the nature and severity of the condition being treated and / or prevented and on the nature of the composition that is being used. In embodiments, a pharmaceutical composition disclosed herein is administered by injection.

[00133] One of skill in the art will recognize that the amount and concentration of the composition administered to a subject will depend in part on the subject and the reason for the administration. Methods for determining optimal amounts are known in the art. In general, the concentration of a peptide-polynucleotide complex disclosed herein in a pharmaceutical composition may be as described herein.

[00134] Compositions disclosed herein are typically administered to a subject in need thereof in an amount sufficient to provide a benefit to the subject. This amount is defined as a “therapeutically effective amount.” A therapeutically effective amount may be determined by the efficacy or potency of the particular composition, the disorder being treated, the duration or frequency of administration, the method of administration, and the size and condition of the subject, including that subject's particular treatment response. A therapeutically effective amount may be determined using methods known in the art, and may be determined experimentally, derived from therapeutically effective amounts determined in model animals such as the mouse, or a combination thereof. Additionally, the route of administration may be considered when determining the therapeutically effective amount. In determining therapeutically effective amounts, one skilled in the art may also consider the existence, nature, and extent of any adverse effects that accompany the administration of a particular compound in a particular subject.

[00135] When a pharmaceutical composition disclosed herein is administered to a subject by injection, a composition may be administered to the subject in a bolus in an amount of about 0.1 mg / kg to about 100 mg / kg or more. In embodiments, a pharmaceutical composition disclosed herein is administered to a subject in an amount of about 0.1 mg / kg to about 5 mg / kg. In embodiments, a pharmaceutical composition disclosed herein is administered to a subject in an amount of about 5 mg / kg to about 15 mg / kg. In embodiments, a pharmaceutical composition disclosed herein is administered to a subject in an amount of about 15 mg / kg to about 30 mg / kg. In embodiments, a pharmaceutical composition disclosed herein is administered to a subject in an amount of about 30 mg / kg to about 45 mg / kg. In additional embodiments, a pharmaceutical composition disclosed herein is administered to a subject in an amount of about 45 mg / kg to about 100 mg / kg or more. In embodiments, a composition is administered to the subject in a bolus in an amount of about 0.5 to about 1.5 mg / kg.

[00136] A composition may also be administered by injecting more than one bolus into the subject over a period of time. For instance, a composition may be administered by injecting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more boluses into the subject. In embodiments, a composition is administered by injecting 1, 2, 3, 4, or 5 boluses into the subject. In embodiments, a composition is administered by injecting 5, 6, 7, 8, 9, 10 or more boluses into the subject. In embodiments, a composition is administered by injecting 2, 3, or 4 boluses into the subject. The boluses may be injected about every 1, 2, 3,4, 5, 6, 7, 8, 9,10,11, or about every 12 hours, or they may be injected about every 1, 2, 3, 4, 5, 6, or about every 7 days. In embodiments, boluses may be injected about every day. F. Treatment Methods

[00137] The disclosure provides methods of treating a subject in need thereof, comprising administering a therapeutically effective amount of a pharmaceutical composition disclosed herein to a subject in need thereof.

[00138] The disclosure provides methods of treating and / or delaying the onset of a NF-kappa-B-associated disease in a subject, comprising administering to the subject a therapeutically effective amount of the compositions disclosed herein. As used herein, a “NF-kappa-B-associated disease” is a disease which is correlated with, or caused by, genetic changes (for example, one or more deletions, insertions, duplications and / or substitutions) to the gene encoding one or more of the NF-kappa-B subunits (that is, p65, NF-kappa-Bl, NF-kappa-B2, c-Rel, and RelB) as compared to the corresponding counterpart wild type NF-kappa-B subunit gene, and / or alterations to the expression and / or function of one or more of the NF-kappa-B subunits, as compared to the corresponding counterpart wild type NF-kappa-B subunit. In embodiments, the NF-kappa-B-associated disease is a cancer, an autoimmune disease, an inflammation-related disease, inflammatory airway disease, rheumatoid arthritis, atherosclerosis, inflammatory bowel disease, systemic lupus erythematosus, type I diabetes, chronic obstructive pulmonary disease, asthma, or multiple sclerosis.

[00139] In embodiments, the methods disclosed herein comprise treating and / or delaying the onset of a p65-associated disease in a subject, comprising administering to the subject a therapeutically effective amount of the compositions disclosed herein. As used herein, a “p65-associated disease” is a disease which is correlated with, or caused by, genetic changes (for example, one or more deletions, insertions, duplications and / or substitutions) to the gene encoding p65 as compared to the corresponding counterpart wild type p65 subunit gene, and / or alterations to the expression and / or function of p65, as compared to the corresponding counterpart wild type p65 subunit. In embodiments, the p65-associated disease is a cancer, an autoimmune disease, an inflammation-related disease, inflammatory airway disease, rheumatoid arthritis, osteoarthritis, atherosclerosis, inflammatory bowel disease, systemic lupus erythematosus, type I diabetes, chronic obstructive pulmonary disease, asthma, or multiple sclerosis.

[00140] In embodiments, the subject has a disease or a disorder, such as, for example, a cancer. In embodiments, the disclosure provides methods of treating a neoplasm or cancer. The neoplasm may be malignant or benign, the cancer may be primary or metastatic; the neoplasm or cancer may be early stage or late stage. The cancer may be a blood cancer or a solid tumor cancer. A cancer or a neoplasm may be treated by delivering a nucleic acid sequence to a cancer tumor in a subject. The cancer or neoplasm may be treated by slowing cancer cell growth, killing cancer cells or reducing the spreading of cancer cells to generate metastases. In embodiments, the cancer cell expresses p65 or a mutated version of p65.

[00141] In embodiments, the methods comprise delivering a composition or a polynucleotide of the nanoparticles disclosed herein to a cancer cell in a subject in vivo. In embodiments, the methods comprise treating a cancer or a neoplasm by delivering a polynucleotide of the nanoparticles disclosed herein to cells of the tumor microenvironment or to other cells in the surroundings of a tumor. Non-limiting examples of neoplasms or cancers that may be treated with a method disclosed herein may include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytomas (childhood cerebellar or cerebral), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brainstem glioma, brain tumors (cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic gliomas), breast cancer, bronchial adenomas / carcinoids, Burkitt lymphoma, carcinoid tumors (childhood, gastrointestinal), carcinoma of unknown primary, central nervous system lymphoma (primary), cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma in the Ewing family of tumors, extracranial germ cell tumor (childhood), extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancers (intraocular melanoma, retinoblastoma), gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, germ cell tumors (childhood extracranial, extragonadal, ovarian), gestational -47- trophoblastic tumor, gliomas (adult, childhood brain stem, childhood cerebral astrocytoma, childhood visual pathway and hypothalamic), gastric carcinoid, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma (childhood), intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer (renal cell cancer), laryngeal cancer, leukemias (acute lymphoblastic, acute myeloid, chronic lymphocytic, chronic myelogenous, hairy cell), lip and oral cavity cancer, liver cancer (primary), lung cancers (non-small cell, small cell), lymphomas (AIDS-related, Burkitt, cutaneous T-cell, Hodgkin, non-Hodgkin, primary central nervous system), macroglobulinemia (Waldenstrom), malignant fibrous histiocytoma of bone / osteosarcoma, medulloblastoma (childhood), melanoma, intraocular melanoma, Merkel cell carcinoma, mesotheliomas (adult malignant, childhood), metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome (childhood), multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic / myeloproliferative diseases, myelogenous leukemia (chronic), myeloid leukemias (adult acute, childhood acute), multiple myeloma, myeloproliferative disorders (chronic), nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer (surface epithelial-stromal tumor), ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, pancreatic cancer (islet cell), paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma and supratentorial primitive neuroectodermal tumors (childhood), pituitary adenoma, plasma cell neoplasia, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), renal pelvis and ureter transitional cell cancer, retinoblastoma, rhabdomyosarcoma (childhood), salivary gland cancer, sarcoma (Ewing family of tumors, Kaposi, soft tissue, uterine), Sezary syndrome, skin cancers (nonmelanoma, melanoma), skin carcinoma (Merkel cell), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer with occult primary (metastatic), stomach cancer, supratentorial primitive neuroectodermal tumor (childhood), T-cell lymphoma (cutaneous), T-cell leukemia and lymphoma, testicular cancer, throat cancer, thymoma (childhood), thymoma and thymic carcinoma, thyroid cancer, thyroid cancer (childhood), transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor (gestational), unknown primary site (adult, childhood), ureter and renal pelvis transitional cell -48- cancer, urethral cancer, uterine cancer (endometrial), uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma (childhood), vulvar cancer, Waldenstrom macroglobulinemia, and Wilms tumor (childhood). In embodiments, a method disclosed herein is used to treat T-cell leukemia and lymphoma. In an exemplary embodiment, a method disclosed herein is used to treat Human T-Lymphotropic Virus-1 (HTLV-1) induced adult T-cell leukemia / lymphoma (ATLL).

[00142] In embodiments, the subject has a disease or a disorder, such as, for example, an inflammatory disease. In embodiments, the disclosure provides methods of treating an inflammatory disease. Thus, the disclosure provides methods of treating and / or delaying the onset of an inflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of any one or more of the compositions disclosed herein.

[00143] In embodiments, the methods comprise delivering a polynucleotide of the nanoparticles disclosed herein to an inflammatory cell in a subject in vivo. In embodiments, the cell is an inflammatory cell, such as, for example, a mast cell, an eosinophil, a neutrophil, a basophil, a macrophage, a monocyte or a lymphocyte. In embodiments, the methods comprise delivering a polynucleotide of the nanoparticles disclosed herein to a cell affected by inflammation in a subject in vivo. In embodiments, the methods comprise treating an inflammatory disease in a subject by administering a polynucleotide of the nanoparticles disclosed herein to the subject. In embodiments, the inflammatory cell expresses p65 or a mutated version of p65.

[00144] Non-limiting examples of inflammatory diseases include autoimmune diseases (e.g. rheumatoid arthritis, psoriatic arthris, gouty arthritis, lupus, psoriasis, ankylosing spondylitis), cardiovascular diseases (e.g. high blood pressure, heart disease), gastrointestinal diseases (e.g., inflammatory bowel disease, Crohn’s disease, ulcerative colitis), lung disease (e.g., chronic obstructive pulmonary disease (COPD), asthma), mental illness (e.g., depression, anxiety), metabolic illness (e.g., Type 2 diabetes mellitus, Type 1 diabetes mellitus), neurodegenerative disease (e.g., Parkinson’s disease, Alzheimer’s disease), fatty liver disease, endometriosis, allergy, and cancer.

[00145] Other examples of inflammatory diseases include Encephalitis, Myelitis, Meningitis, Arachnoiditis, Neuritis, Dacryoadenitis, Scleritis, Episcleritis, Keratitis, Retinitis, Chorioretinitis, Blepharitis, Conjunctivitis, Uveitis, Otitis externa, Otitis media, Labyrinthitis, Mastoiditis, Carditis, Endocarditis, Myocarditis, Pericarditis, Vasculitis, Arteritis, Phlebitis, Capillaritis, Sinusitis, Rhinitis, Pharyngitis, Laryngitis, Tracheitis, Bronchitis, Bronchiolitis, Pneumonitis, Pleuritis, Mediastinitis, Stomatitis, Gingivitis, Gingivostomatitis, Glossitis, -49- Tonsillitis, Sialadenitis / Parotitis, Cheilitis, Pulpitis, Gnathitis, Esophagitis, Gastritis, Gastroenteritis, Enteritis, Colitis, Enterocolitis, Duodenitis, Ileitis, Caecitis, Appendicitis, Proctitis, Hepatitis, Ascending cholangitis, Cholecystitis, Pancreatitis, Peritonitis, Dermatitis, Folliculitis, Cellulitis, Hidradenitis, Arthritis, Dermatomyositis, Myositis, Synovitis / Tenosynovitis, Bursitis, Enthesitis, Fasciitis, Capsulitis, Epicondylitis, Tendinitis, Panniculitis, Osteochondritis: Osteitis / Osteomyelitis, Spondylitis, Periostitis, Chondritis, Urinary system, Nephritis, Glomerulonephritis, Pyelonephritis, Ureteritis, Cystitis, Urethritis, Oophoritis, Salpingitis, Endometritis, Parametritis, Cervicitis, Vaginitis, Vulvitis, Mastitis, Orchitis, Epididymitis, Prostatitis, Seminal vesiculitis, Balanitis, Posthitis, Balanoposthitis, Chorioamnionitis, Funisitis, Omphalitis, Insulitis, Hypophysitis, Thyroiditis, Parathyroiditis, Adrenalitis, Lymphangitis, and Lymphadenitis.

[00146] In embodiments, the methods comprise delivering a polynucleotide of a peptidepolynucleotide complex disclosed herein to a cancer cell in vitro. For instance, a polynucleotide of a peptide-polynucleotide complex disclosed herein may be delivered to a cancer cell line in vitro. A cancer cell may be a cancer cell line cultured in vitro. In embodiments, a cancer cell line may be a primary cell line that is not yet described. Methods of preparing a primary cancer cell line utilize standard techniques known to individuals skilled in the art. In other alternatives, a cancer cell line may be an established cancer cell line. A cancer cell line may be adherent or non-adherent, or a cell line may be grown under conditions that encourage adherent, nonadherent or organotypic growth using standard techniques known to individuals skilled in the art. A cancer cell line may be contact inhibited or non-contact inhibited.

[00147] In embodiments, the cancer cell line may be an established human cell line derived from a tumor. Non-limiting examples of cancer cell lines derived from a tumor include the osteosarcoma cell lines 143B, CAL-72, G-292, HOS, KHOS, MG-63, Saos-2, and U-2 OS; the prostate cancer cell lines DU145, PC3 and Lncap; the breast cancer cell lines MCF-7, MDA-MB-438 and T47D; the myeloid leukemia cell line THP-1, the glioblastoma cell line U87; the neuroblastoma cell line SHSY5Y; the bone cancer cell line Saos-2; the colon cancer cell lines WiDr, COLO 320DM, HT29, DLD-1, COLO 205, COLO 201, HCT-15, SW620, LoVo, SW403, SW403, SW1116, SW1463, SW837, SW948, SW1417, GPC-16, HCT-8, HCT 116, NCI-H716,NCI-H747,NCI-HSO8, NCI-H498, COLO 320HSR, SNU-C2A, LS 180,LS 174T, MOLT-4, LS513, LS1034, LS411N, Hs 675.T, CO 88BV59-1, Co88BV59H21-2, Co88BV59H21-2V67-66, 1116-NS-19-9, TA 99, AS 33, TS 106, Caco-2, HT-29, SK-CO-1, SNU-C2B and SW480; the non-small cell lung cancer (NSCLC) cell lines H358, H2122, H441, H727, SK-Lu-1, H2009, the melanoma cell line B16-F10, the macrophage cell line RAW264.7, -50- the F8 cell line, and the pancreatic carcinoma cell lines Panel, PANC 10.05, CAP AN-1, CAP AN-2, PSN1, MIA-PaCa2. In an exemplary embodiment, a peptide-polynucleotide complex disclosed herein may be administered to a F8 cell line. In embodiments, a peptidepolynucleotide complex disclosed herein may be administered to a B16-F10 cell line.

[00148] In embodiments, the nanoparticles or compositions disclosed herein are used for specific delivery to tumors. Without being bound by a theory, it is thought that the leaky vasculature of tumors allows for the extravasation of the nanoparticles disclosed herein due to its physicochemical characteristics. The coating of the nanoparticles disclosed herein with albumin enriches the local concentration of the nanoparticles through binding to the receptors pg60 and / or SPARC. These receptors are upregulated in certain tumors. Coating the nanoparticle with hyaluronic acid can have the same effect on other tumor types through the CD44 receptor. Thus, the nanoparticles may be coated by serum albumin, in particular human serum albumin. Alternatively, hyaluronic acid, preferably hyaluronic acid of a molecular weight of ...), may be used for coating such that the nanoparticles have a hyaluronic acid coating.

[00149] In embodiments, the methods comprise delivering a polynucleotide of a peptidepolynucleotide complex disclosed herein to an inflammatory cell or a cell affected by inflammation in vitro. In embodiments, the nanoparticles or compositions disclosed herein are used for specific delivery to sites of inflammation. Without being bound by a theory, it is thought that the leaky vasculature induced by inflammation allows for the extravasation of the nanoparticles disclosed herein due to its physicochemical characteristics. The coating of the nanoparticles disclosed herein with albumin enriches the local concentration of the nanoparticles through binding to the receptors pg60 and / or SPARC. These receptors are upregulated in response to inflammation. Coating the nanoparticle with hyaluronic acid can have the same effect on other inflammation sites through the CD44 receptor. G. Kits

[00150] The disclosure provides kits comprising: a first composition comprising a peptide of the peptide-polynucleotide complexes disclosed herein, and optionally a second composition comprising a polynucleotide. Alternatively, a polynucleotide of interest may be provided by a user of the kit. By following directions provided by the kit, a user of the kit may mix the composition comprising a peptide of the peptide-polynucleotide complexes disclosed herein and a composition comprising a polynucleotide to form a peptide-polynucleotide complex. The directions of the kit may include instructions to mix the peptide and polynucleotide at a suitable ratio. The kit may also include suitable buffers, water, cross-linking reagents or albumin. EXAMPLES

[00151] It is to be understood that the description above as well as the examples that follow are intended to illustrate, and not limit, the scope of the invention. Example 1: Identification of siRNAs Targeting p65

[00152] A bioinformatics approach was used to identify potential siRNAs targeting human p65 / RELA mRNA (Gene ID: 5970), assuming a canonical siRNA structure. Positions 2-18 (5’ -3’) of the sense and antisense strand were used for the specificity calculations, and positions 1-19 (5’-3’) of the antisense strand were used for cross-reactivity and human SNP analysis. The following parameters were assessed: (i) species cross-reactivity for human, cynomolgus monkey, rhesus monkey, mouseand rat: analysis based on a canonical siRNA design using 19 bases and 17 bases (without considering positions 1 and 19) for cross-reactivity, including full match as well as single mismatch analysis, (ii) predicted specificity in human, rhesus monkey, cynomolgus monkey, mouseand rat: analysis of sense and antisense strand separately, (iii) identicalness of siRNA seed region and seed region of known miRNAs, (iv) analysis of human SNP database (NCBI-DB-SNP) to identify siRNAs targeting regions with known SNPs; information will include positions of SNPs within the target sequence as well as minor allele frequency (MAF) in case data are available, (v) siRNA activity prediction based on canonical siRNA design. Further details on the bioinformatics procedure are as follows.

[00153] All possible siRNAs were created from human p65 / RELA mRNA sequence (NM_021975.4). siRNA off-target genes were predicted for human, rhesus monkey, cynomolgus monkey, mouse and rat. A specificity score was assigned to each siRNA strand. siRNA strands were analyzed for presence of human, rhesus monkey, dog, pig, mouse, rat and rabbit miRNA seed regions. Specificity categories were assigned to siRNAs (combined specificity score + miRNA seed analysis). siRNA cross reactivity was calculated: for transcript variants and different species, for 19-mers and 17-mers (nucleotides 2-18 of 19mer) and for 19mers and 17mers with a single mismatch. Human SNPs were mapped to siRNA target sites in p65 / RELA transcript NM_021975.4. siRNA activity was predicted and a score was assigned to each siRNA.

[00154] 95 siRNAs were selected for further analysis. The sense and antisense sequences of each of the siRNAs are shown in Table 1 above.

[00155] These siRNA sequences were further modified. The modification pattern is shown in FIG. 1. The modified sequences are shown in Table 2 above. Example 2: In vitro Inhibition of p65 mRNA by identified siRNAs

[00156] The 95 siRNA sequences listed in Table 2 were synthetized and tested in A431 human skin epithelial carcinoma cells. The results are shown in Table 3 below. Table 3: Two Dose Analysis in A431 cells A431 cells 10 nM final sample 0.5 nM final sample concentration 10 nM final sample concentration 0.5 nM final sample concentration Name of siRNA sequence 5'-->3' sequence 5'—>3' Mean Value (MV) p65 / GAPD H Standard Deviation (SD) p65 / GAPD H MV p65 / GAPD H SD p65 / GAPD H MV GAPD H SD GAPD H MV GAPD H SD GAPD H XD-48469K1 asusGfuggAfGfAfucAfuuga Gfca usGfscucaaugaucuCfcacaus asg 16.1 2.0 48.8 0.6 77.7 16.0 95.0 5.9 XD-48470K1 csusAfcaaGfUfGfcgAfgggg Cfga usCfsgccccucgcacUfuguags csg 88.3 7.8 92.4 3.6 79.8 13.5 99.5 8.4 XD-48471K1 usasCfaagUfGfCfgaGfgggc Gfca usGfscgccccucgcaCfuuguas gsc 92.5 8.2 92.8 3.6 73.4 11.9 94.0 11.7 XD-48472K1 asgsUfgcgAfGfGfggCfgcuc Cfga usCfsggagcgccccuCfgcacus usg 93.1 6.8 90.8 5.7 79.2 14.4 92.0 13.5 XD-48473K1 gsusGfcgaGfGfGfgcGfcucc Gfca usGfscggagcgccccUfcgcacs usu 88.9 2.8 88.3 7.1 64.8 12.6 90.5 14.5 XD-48474K1 csusCfcgcGfGfGfcaGfcaucC fca usGfsggaugcugcccGfcggags csg 90.9 4.2 93.0 8.7 73.8 13.7 88.0 13.6 XD-48475K1 gscs AfgcaU fCfC fcaG fgcgaG faa usUfscucgccugggaUfgcugcs CSC 34.6 3.7 80.3 1.5 78.7 17.5 88.3 14.4 XD-48476K1 csasGfcauCfCfCfagGfcgagA fga usCfsucucgccugggAfugcugs CSC 85.4 5.9 93.2 5.5 70.7 15.4 86.9 12.0 XD-48477K1 csasUfcccAfGfGfcgAfgagg Afga usCfsuccucucgccuGfggaugs csu 88.0 5.3 88.8 4.3 86.8 15.2 85.7 10.6 XD-48478K1 asusCfccaGfGfCfgaGfaggaG fca usGfscuccucucgccUfgggaus gsc 85.9 2.9 88.1 4.7 93.3 7.8 85.0 7.7 XD-48479K1 gsgsCfgagAfGfGfagCfacag Afua usAfsucugugcuccuCfucgccs usg 48.1 0.4 87.6 2.6 93.0 6.0 95.0 5.9 XD- 48480K1 gscsGfagaGfGfAfgcAfcaga Ufaa usUfsaucugugcuccUfcucgcs csu 36.1 1.0 59.0 4.3 93.1 10.0 99.5 8.4 XD-48481K1 asgsAfggaGfCfAfcaGfauacC faa usUfsgguaucugugcUfccucus csg 10.8 0.9 23.0 1.9 87.5 6.9 94.0 11.7 \NO 2025 / 229137                                     PCT / EP2025 / 061992 XD-48482K1 asgsCfacaGfAfUfacCfaccaA fga usCfsuuggugguaucUfgugcu scsc 30.4 3.3 69.7 4.1 85.7 11.2 92.0 13.5 XD-48483K1 xa gsasCfccaCfCfCfcaCfcaucAf aa usU fsugaugguggggU fggguc SUSU 72.5 5.8 89.8 3.2 81.1 13.8 90.5 14.5 XD-48484K1 asgsAfucaAfUfGfgcUfacacA fga usCfsuguguagccauU fgaucus usg 93.8 7.3 89.8 4.8 81.7 11.0 88.0 13.6 XD-48485K1 asusCfaauGfGfCfuaCfacagG faa usUfsccuguguagccAfuugaus esu 39.8 1.3 85.0 4.4 84.1 8.8 88.3 14.4 XD-48486K1 uses AfaugGfCfUfac Afcagg Afca usGfsuccuguguagcCfauugas use 71.0 4.9 89.8 4.7 83.5 4.5 86.9 12.0 XD-48487K1 csasCfaggAfCfCfagGfgacaG fua usAfscugucccugguCfcugugs usa 90.9 5.0 89.5 5.1 88.9 7.7 85.7 10.6 XD-48488K1 asgsCfuugUfAfGfgaAfagga Cfua usAfsguccuuuccuaCfaagcus esg 69.1 5.2 88.9 3.0 89.5 9.5 85.0 7.7 XD-48489K1 csusUfguaGfGfAfaaGfgacu Gfea usGfscaguccuuuccUfacaags esu 40.1 5.3 79.3 2.5 92.9 8.0 97.8 5.7 XD-48490K1 usgsUfaggAfAfAfggAfeuge Cfga usCfsggcaguccuuuCfcuacas asg 87.0 7.2 92.4 4.3 102.4 4.4 95.6 4.7 XD-48491K1 gsusAfggaAfAfGfgaCfugcc Gfga usCfscggcaguccuuUfccuacs asa 82.4 2.3 87.7 9.4 93.3 10.2 97.9 6.6 XD-48492K1 gsas AfaggAfCfUfgcCfggga Ufga usCfsaucccggcaguCfcuuucs esu 105.7 11.2 100.5 9.9 87.2 5.9 92.8 3.9 XD-48493K1 asasAfggaCfUfGfccGfggau Gfga usCfscaucccggcagUfccuuus CSC 116.0 11.2 92.7 3.9 91.5 3.5 88.9 6.6 XD-48494K1 gsgsAfcugCfCfGfggAfuggc Ufua usAfsagccaucccggCfaguccs usu 73.1 25.5 90.4 2.5 85.2 13.8 86.7 5.6 XD-48495K1 gscsCfgggAfUfGfgcUfucua Ufga usCfsauagaagccauCfccggcs asg 86.6 4.5 109.3 16.1 91.6 5.1 89.7 4.8 XD-48496K1 ususCfuauGfAfGfgcUfgagc Ufea usGfsagcucagccucAfuagaas gsc 103.2 5.1 113.8 30.6 95.4 4.6 69.2 39.7 XD-48497K1 uscsUfaugAfGfGfcuGfagcu Cfua usAfsgagcucagccuCfauagas asg 18.7 2.0 70.9 14.0 96.1 3.3 92.6 10.0 XD-48498K1 csusAfugaGfGfCfugAfgcuc Ufga usCfsagagcucagccUfcauags asa 12.2 3.7 44.2 1.9 98.7 3.8 93.8 12.8 XD-48499K1 usgsAfgcuCfUfGfccCfggacC fga usCfsgguccgggcagAfgcucas gsc 97.9 7.1 96.7 8.6 98.9 4.0 99.9 5.1 WO 2025 / 229137                                   PCT / EP2025 / 061992 XD-48500K1 gsasGfcucUfGfCfccGfgaccG fca usGfscgguccgggcaGfagcucs asg 109.2 12.2 96.4 6.3 96.9 4.9 96.8 1.9 XD-48501K1 asgsCfucuG fCfCfcgGfaccgC fua usAfsgcgguccgggcAfgagcus csa 48.2 3.8 98.6 13.6 94.2 5.0 86.7 7.5 XD-48502K1 csusGfcccGfGfAfccGfcugcA fua usAfsugcagcgguccGfggcags asg 82.4 2.1 107.4 8.3 101.6 6.2 84.6 10.1 XD-48503K1 usgsCfccgGfAfCfcgCfugcaU fca usGfsaugcagcggucCfgggcas gsa 93.5 7.9 106.5 15.0 97.7 4.1 91.0 11.8 XD-48504K1 gscsCfcggAfCfCfgcUfgcauC fca usGfsgaugcagcgguCfcgggcs asg 86.6 9.3 100.1 4.5 100.9 6.8 87.8 7.1 XD-48505K1 cscsCfggaCfCfGfcuGfcaucC faa usUfsggaugcagcggU fccgggs csa 38.6 6.1 110.1 14.6 96.5 6.8 82.2 5.1 XD-48506K1 cscsGfgacCfGfCfugCfauccA fca usG fsuggaugcagcgG fuccggs gsc 23.7 2.0 87.1 7.6 99.6 5.5 88.7 15.2 XD-48507K1 csgsAfccuGfAfAfugCfugug Cfga usCfsgcacagcauucAfggucgs usa 11.7 1.2 47.0 6.8 93.6 7.8 75.3 4.3 XD-48508K1 gsasCfcugAfAfUfgcUfgugc Gfga usCfscgcacagcauuCfaggucs gsu 81.8 12.1 119.1 19.4 93.0 7.1 85.2 11.1 XD-48509K1 cscsU fgaaU fGfCfugU fgcgg Cfua usAfsgccgcacagcaUfucaggs use 14.2 2.0 35.8 5.9 92.4 6.1 90.8 4.5 XD-48510K1 csusGfaauGfCfUfguGfcggc Ufca usGfsagccgcacagcAfuucags gsu 25.3 8.4 35.6 24.1 91.3 12.8 90.3 7.4 XD- 48511K1 usgsAfaugCfUfGfugCfggcu Cfua usAfsgagccgcacagCfauucas gsg 15.1 2.5 43.3 12.5 87.4 11.4 88.4 11.8 XD-48512K1 gsasAfugcUfGfUfgcGfgcuc Ufga usCfsagagccgcacaGfcauucs asg 88.9 4.1 122.5 26.9 93.0 6.6 88.5 11.6 XD-48513K1 gscsGfgcuCfUfGfcuUfccag Gfua usAfsccuggaagcagAfgccgcs asc 67.1 7.0 81.9 31.1 89.7 11.3 85.7 15.1 XD-48514K1 gsgsAfcauAfU fGfagAfccuu Cfaa usUfsgaaggucucauAfuguccs usu 44.8 5.1 136.4 4.7 99.7 3.9 88.0 12.4 XD-48515K1 gsasCfauaUfGfAfgaCfcuucA faa usUfsugaaggucucaUfaugucs esu 26.4 7.7 63.9 7.8 89.5 11.0 91.5 7.1 XD-48516K1 asgsAfagaGfUfCfcuUfucagC fga usCfsgcugaaaggacUfcuucus use 14.5 6.2 67.6 15.4 97.8 6.6 93.0 6.3 XD-48517K1 gsas AfgagU fCfCfuuU fcagc Gfga usCfscgcugaaaggaCfucuucs usu 21.5 3.5 75.8 7.9 92.2 8.0 97.2 3.6 XD-48518K1 asasGfaguCfCfU fuuCfagcgG faa usUfsccgcugaaaggAfcucuus esu 14.5 1.0 43.4 3.6 101.1 5.0 104.0 5.4 \NO 2025 / 229137                                     PCT / EP2025 / 061992 XD-48519K1 asgs AfgucCfUfU fuc Afgcgg Afca usGfsuccgcugaaagGfacucus use 50.0 6.0 88.8 13.1 97.7 6.0 94.3 5.8 XD-48520K1 gsasGfuccUfUfUfcaGfcggaC fca usGfsguccgcugaaaGfgacucs usu 103.6 10.5 122.8 18.0 91.8 9.9 80.6 4.2 XD-48521 KI asgsUfccuU fU fCfagCfggacC fca usGfsgguccgcugaaAfggacus esu 112.4 10.7 124.4 17.4 83.9 6.6 82.5 7.2 XD-48522K1 uscsCfuuuCfAfGfcgGfacccA fca usGfsuggguccgcugAfaaggas esu 72.1 11.4 125.9 24.3 89.3 7.1 73.8 33.0 XD-48523K1 ascsGfcauUfGfCfugUfgccu Ufca usGfsaaggcacagcaAfugcgus esg 15.5 1.1 41.5 17.0 93.1 3.4 86.1 6.6 XD-48524K1 asusUfgcuGfUfGfccUfuccc Gfca usGfscgggaaggcacAfgcaaus gsc 106.6 11.0 94.1 19.1 82.6 6.3 86.5 7.0 XD-48525K1 gsasCfuucUfCfCfucCfauugC fga usCfsgcaauggaggaGfaagucs usu 29.3 2.2 116.9 21.4 90.3 4.7 78.3 8.2 XD-48526K1 ascsUfucuCfCfUfccAfuugcG fga usCfscgcaauggaggAfgaagus esu 28.4 5.7 66.9 16.9 88.6 9.4 88.8 10.9 XD-48527K1 ususCfuccUfCfCfauUfgcgg Afca usGfsuccgcaauggaGfgagaas gsu 96.4 12.9 107.6 7.1 91.1 6.1 74.6 33.1 XD-48528K1 uscsCfuccAfUfUfgcGfgacaU fga usCfsauguccgcaauGfgaggas gsa 99.3 4.4 96.4 6.5 94.4 4.3 97.8 2.7 XD-48529K1 uscsCfauuGfCfGfgaCfaugg Afca usGfsuccauguccgcAfauggas gsg 65.8 9.4 98.3 8.8 99.2 3.6 97.0 7.5 XD-48530K1 cscsAfuugCfGfGfacAfugga Cfua usAfsguccauguccgCfaauggs asg 24.0 7.5 84.7 10.8 91.0 9.9 95.0 8.5 XD-48531K1 csasU fugcG fGfAfcaU fggac Ufua usAfsaguccauguccGfcaaugs gsa 95.0 6.5 118.4 19.3 88.8 9.1 96.1 10.5 XD-48532K1 asusUfgcgGfAfCfauGfgacu Ufca usGfsaaguccaugucCfgcaaus gsg 96.4 16.0 128.1 9.5 91.3 9.6 95.8 11.4 XD-48533K1 ususGfcggAfCfAfugGfacuu Cfua usAfsgaaguccauguCfcgcaas usg 14.4 2.4 56.0 13.9 75.0 41.1 98.6 16.3 XD-48534K1 usgsCfggaCfAfUfggAfcuuc Ufca usGfsagaaguccaugUfccgcas asu 62.2 19.9 119.0 21.4 85.0 12.4 101.3 19.8 XD-48535K1 asgsUfcagAfUfCfagCfuccuA faa usUfsuaggagcugauCfugacus csa 63.9 22.4 106.6 25.1 89.7 13.1 94.1 15.2 XD-48536K1 gsusCfagaUfCfAfgcUfccuaA fga usCfsuuaggagcugaUfcugacs use 81.8 14.6 106.6 6.0 86.5 8.9 100.5 4.4 XD-48537K1 uscsAfgauCfAfGfcuCfcuaaG fga usCfscuuaggagcugAfucugas esu 103.5 20.6 102.8 6.8 88.6 11.0 96.6 9.8 WO 2025 / 229137                                   PCT / EP2025 / 061992 XD-48538K1 csasGfaucAfGfCfucCfuaagG fga usCfsccuuaggagcuGfaucugs asc 99.0 31.5 99.1 8.1 92.6 9.8 96.3 16.3 XD-48539K1 csasGfgggAfU fU fgaAfgccc Ufca usGfsagggcuucaauCfcccugs csa 44.7 3.3 78.4 1.7 99.0 5.8 99.9 3.5 XD-48540K1 asgsGfggaUfUfGfaaGfcccuC fca usGfsgagggcuucaaUfccccus gsc 70.4 15.5 111.1 8.5 85.4 8.3 91.2 3.3 XD-48541K1 asasGfcacUfUfAfcgGfauucU fga usCfsagaauccguaaGfugcuus usu 54.8 14.4 113.7 11.6 82.9 14.2 83.3 4.0 XD-48542K1 asgsCfacuUfAfCfggAfuucu Gfga usCfscagaauccguaAfgugcus usu 41.4 5.0 119.9 12.2 85.3 6.1 90.1 14.0 XD-48543K1 gscsAfcuuAfCfGfgaUfucug Gfua usAfsccagaauccguAfagugcs usu 47.4 7.6 96.8 14.1 82.3 8.0 90.6 13.3 XD-48544K1 csasCfuuaCfGfGfauUfcugg Ufga usCfsaccagaauccgUfaagugs csu 34.1 5.4 83.9 13.6 81.9 8.8 96.8 6.7 XD-48545K1 xa csusUfacgGfAfUfucUfggug Gfga usCfsccaccagaaucCfguaags usg 67.6 10.9 111.4 9.5 85.7 9.3 91.1 5.8 XD-48546K1 xa ususAfcggAfUfUfcuGfgugg Gfga usCfscccaccagaauCfcguaas gsu 92.1 12.3 121.6 20.2 86.2 6.1 94.0 6.9 XD-48547K1 usasCfggaUfUfCfugGfuggg Gfua us AfsccccaccagaaU fccguas asg 74.3 7.3 85.0 24.2 89.3 5.8 90.5 18.8 XD-48548K1 xa ascsGfgauUfCfUfggUfgggg Ufga usCfsaccccaccagaAfuccgus asa 110.2 7.0 108.0 23.1 89.8 1.5 96.0 13.9 XD-48549K1 gsgsAfuucUfGfGfugGfggug Ufga usCfsacaccccaccaGfaauccsg SU 64.7 11.0 97.0 12.1 95.7 10.0 90.5 8.0 XD-48550K1 xa ususCfuggU fGfGfggU fgugu Ufca usGfsaacacaccccaCfcagaasu sc 53.5 9.2 119.6 12.1 95.7 5.4 86.0 8.7 XD-48551K1 xa uscsUfgguGfGfGfguGfuguu Cfca usGfsgaacacaccccAfccagasa SU 50.9 11.1 99.6 14.5 89.2 12.1 89.3 9.5 XD-48553K1 gsgsU fgcuU fAfAfgc Afgaag Cfaa usUfsgcuucugcuuaAfgcaccs use 60.0 11.5 108.8 26.9 93.3 7.5 88.5 12.4 XD-48554K1 ususAfacuUfCfUfcuGfgaaa Gfga usCfscuuuccagagaAfguuaas usg 74.9 19.7 101.1 20.0 89.7 13.4 92.3 13.3 \NO 2025 / 229137                                     PCT / EP2025 / 061992 XD-48555K1 asgsCfuggGfGfAfaaCfucaaA fca usGfsuuugaguuuccCfcagcus CSC 65.8 XD-48556K1 cscsCfuguCfCfUfgaUfgguc Afga usCfsugaccaucaggAfcagggs gsa 66.0 XD-48557K1 csusGfaugGfUfCfagCfucccU fua usAfsagggagcugacCfaucags gsa 82.9 XD-48558K1 usgsAfuggUfCfAfgcUfcccu Ufca usGfsaagggagcugaCfcaucas gsg 27.9 XD-48559K1 usasUfcaaGfU fGfucU fuccaU fca usGfsauggaagacacUfugauas asg 43.0 XD-48560K1 csasAfgugUfCfUfucCfaucaU fga usCfsaugauggaagaCfacuugs asu 62.2 XD-48561K1 asasGfuguCfUfU fee Afucau Gfga usCfscaugauggaagAfcacuus gsa 42.4 XD- 48562K1 cscsAfgucAfGfGfagGfcaua Gfua usAfscuaugccuccuGfacuggs asg 37.5 XD-48563K1 csasGfucaGfGfAfggCfauag Ufua us AfsacuaugccuccU fgacugs gsa 56.0 XD-48564K1 asgsUfcagGfAfGfgcAfuagu Ufua usAfsaacuaugccucCfugacus gsg 122.6 5.5 103.5 18.6 82.2 4.2 86.3 10.7 15.6 110.3 12.6 90.0 9.6 82.5 8.2 21.4 113.6 18.0 91.6 8.3 85.5 8.2 5.4 61.1 11.5 92.7 10.4 93.3 8.5 7.6 92.2 11.8 94.3 6.6 90.1 7.3 12.0 96.9 15.1 85.8 8.5 85.8 5.5 2.7 108.1 5.4 91.1 8.6 62.1 21.7 6.0 66.3 4.9 85.4 10.0 72.0 2.3 8.4 121.1 23.6 90.9 7.7 72.9 3.9 7.3 154.8 43.0 91.2 7.4 77.2 10.3 WO 2025 / 229137                                   PCT / EP2025 / 061992

[00157] Of the siRNAs listed in Table 3, 24 siRNAs that resulted in the highest p65 mRNA inhibtion were selected, and dose response curves were generated at a wide range of siRNA concentrations to assess p65 silencing in A431 human skin epithelial carcinoma cells. A431 cells were transfected using RNAiMAX via reverse transfection and Quantigene branched DNA assay was used to measure p65 mRNA levels 24 hours after treatment with siRNA. Human GAPDH mRNA was used for normalization and the following mRNAs were used as controls: human AHSA1, human FVII and F-luc. Further details on the materials and methods are provided in Example 3.

[00158] The results of the dose response (IC50s and percentage inhibition) are listed in

[00159] Table 44 below. Table 4: IC50 Values from Dose Response Experiments ID Human A431 cells Rat cells IC50 [nM| Max inhib [%1 IC50 |nM] Max inhib [%1 XD-48507K1 0.02 90.58 XD-48523K1 0.04 88.60 XD-48509K1 0.07 89.58 XD-48533K1 0.08 88.98 1.4 84.8 XD-48481K1 0.08 89.57 XD-48511K1 0.15 87.53 XD-48498K1 0.26 89.40 XD-48518K1 0.32 87.96 XD-48515K1 0.33 81.23 XD-48510K1 0.34 83.76 XD-48469K1 0.56 86.61 18 61.1 XD-48516K1 0.60 89.44 XD-48497K1 0.68 89.94 XD-48517K1 0.84 87.87 XD-48526K1 0.84 83.07 5.9 72.4 XD-48506K1 0.86 84.02 XD-48480K1 0.89 68.92 XD-48544K1 0.91 78.44 XD-48482K1 1.08 71.40 XD-48530K1 1.31 84.71 9.8 62.7 XD-48525K1 1.46 83.38 4.9 70.7 XD-48562K1 1.51 63.78 XD-48475K1 3.51 70.47 XD-48558K1 8.14 54.01

[00160] The dose-response curves for these siRNAs in A431 cells are shown in FIGs. 2A-2C, 3A-3C, 4A-4C, 5A-5C, 6A-6C, 7A-7C, 8A-8C, 9A-9C, 10A-10C, 11A-11C, 12A-12C, and 13A-13C.

[00161] Furthermore, for 5 selected siRNAs, dose response curves were generated at a wide range of siRNA concentrations to assess rnp65 silencing in McA-RH7777 rat liver epithelial cells. McA-RH7777 cells were transfected using RNAiMAX via reverse transfection and Quantigene branched DNA assay was used to measure rnp65 mRNA levels 24 hours after treatment with siRNA. rnGAPDH mRNA was used for normalization and the following mRNAs were used as controls: human AHSA1, human FVII and F-luc. The results of the dose response (IC50s and percentage inhibition) are listed in

[00162] Table 44 above. The dose-response curves for these siRNAs in McA-RH7777 cells are shown in FIGs. 14A-14C, 15A-15C and 16A-16B. Example 3: Material and Methods In vitro knock-down analysis of p65 foliowins transfection of different siRNAs

[00163] Experimental details: knock-down analysis in A431 cells Cell Line A431 (Human skin epithelial carcinoma) Transfection agent RNAiMAX, reverse transfection Target gene hsp65 Controls hsAHSAl / hsFVII / F-luc Normalization gene hsGAPDH Assay Quantigene branched DNA Time point for knock down analysis 24h

[00164] Experimental details: knock-down analysis in McA-RH7777 cells Cell Line McA-RH7777 (Rat liver epithelial cells) Transfection agent RNAiMAX, reverse transfection Target gene mp65 Controls hsAHSAl / hsFVII / F-luc Normalization gene rnGAPDH Assay Quantigene branched DNA Time point for knock down analysis 24h

[00165] Cells were transfected with increasing concentrations of p65 siRNAs (0.00002 nM -50 nM) using RNAiMax transfection agent (Invitrogene) following the manufacturer’s instructions. 24h after transfection p65 knock down was analysed using a Quantigene® branched DNA assay. Reagents for cell culture and transfection Item Supplier Cat# L-15 Medium Gibco 11415-064 McCoy’s 5a Medium Gibco 12330-031 MEM Hyclone SH30024.01 FBS Gibco 10099-141 Trypsin 0.25% EDTA Gibco 25200-072 NEAA Gibco 11140-050 siRNA Axolabs N / A Lipofectamine RNAiMAX Invitrogen 13778150 Reagents for RT-PCR Reagent Vendor Cat No. RNeasy Mini Kit Qiagen 74106 RNase-Free DNase Set TIANGEN RT411 High Capacity cDNA Reverse Transcriptase Kit ABI 4374966 TaqMan Universal PCR Master Mix ABI 4304437 Equipment 1) Applied Biosystems Inc. (ABI), fast PCR system 7900H, 384 well format Equipment ID: BEPCR0030 2) Data analysis software: ABI SDS2.4 3) Nanodrop™ 2000 spectrophotometer Equipment ID: BENOP0020 4) Qiagen Tissue lyserll Equipment ID: BETIS0010 Resuspension of siRNA a) Briefly centrifuge the screw cap vial at low speed (maximum 4000 x g) to ensure that all material is collected at the bottom of the vial or well before opening. b) Carefully remove the screw cap. c) Add nuclease-free water to achieve the stocking concentration lOOpM. d) Let the vial or plate stand for a few minutes at ambient temperature. e) Gently pipette up and down 5 times to resuspend. f) Repeat steps d and e. g) Aliquot the resuspended siRNA into multiple tubes or plates to limit the number of freezethaw cycles. Store at -80°C. h) Note: siRNA solution was on ice when preparing transfection reaction. Cell seeding and TO plate readins a) Plate cells in 96-well plates at a pre-determined density in 90pL culture medium 24 hours before transfection (Day 0). Cells should reach 30-50% confluency on the next day. b) Take plate TO group (Day 1), and add lOpL culture medium to each well for TO reading. c) Add lOOpL CellTiter-Glo Reagent to each well. d) Mix contents for 20mins on an orbital shaker to facilitate cell lysis. e) Allow the plate to incubate at room temperature for lOmins to stabilize luminescent signal. (Note: Uneven luminescent signal within standard plates can be caused by temperature gradients, uneven seeding of cells, and edge effects in multiwall plates.) f) Place Backseal black sticker to the bottom of each plate. g) Record luminescence using EnVision Multilabel Reader. siRNA transfection a) On the day of transfection (Day 1), refresh the culture medium with 90pL culture medium. b) Transfect cells with siRNA at a range of final concentration in triplicate. Prepare siRNA-lipid complex as shown below: Diluted siRNA Opti-MEM Medium (pL) 5 siRNA (pL) 0.1 Diluted Lipofectamine Opti-MEM Medium (pL) 5 Lipofectamine RNAiMAX Reagent (pL) 0.3 c) Add 5pL diluted siRNA to 5pL diluted Lipofectamine and incubate the mix for 5mins at RT. Add the siRNA-lipid complexes dropwise to each well and mix gently by rocking the plate back and forth. Incubate the cells for a specific time before cell viability assay (see Appendix). Refreshe the culture medium after 24hrs of incubation if required. d) To evaluate cell viability, add lOOpL CellTiter-Glo Reagent to each well. Mix the contents for 20mins on an orbital shaker to facilitate cell lysis. Incubate the plate at RT for lOmins to stabilize luminescent signals. Place a Backseal black sticker to the bottom of each plate and measure the luminescence data using an EnVision Multi Label Reader. qPCR sample collection a) Plate cells in 6-well plates at a pre-determined density in 2.25mL culture medium 24 hours before transfection (Day 0). Cells should reach 30-50% confluency on the next day. b) On the day of transfection (Day 1), refresh the culture medium with 2.25mL growth medium. c) Transfect cells with siRNA at a range of final concentration (see Appendix). Prepare siRNA-lipid complex as shown below: Diluted siRNA Opti-MEM Medium (pL) 125 siRNA (pL) 2.5 Diluted Lipofectamine Opti-MEM Medium (pL) 125 Lipofectamine RNAiMAX Reagent (pL) 7.5 d) Add 125pL diluted siRNA to 125 pL diluted Lipofectamine and incubate the mix for 5mins at RT. Add the siRNA-lipid complexes dropwise to each well and mix gently by rocking the plate back and forth. Incubate the cells for a specific time before harvested. Refresh the culture medium after 24hrs of incubation if required. e) Remove the culture medium and freeze the transfected cells in liquid nitrogen and store the cells at -80 °C. Total / LV.l extraction 1) Place a stainless-steel bead (5 mm mean diameter) and 350 pL Buffer RLT into a 2 mL microcentrifuge tube containing cell. Place the tubes in the TissueLyser adapter set and operate the TissueLyser for 5 min at 20 Hz. Proceed with RNA extraction. 2) Add 1 volume of 70% ethanol to the lysate and mix well by pipetting. Do not centrifuge. Proceed immediately to step 3. 3) Transfer up to 700 pL of the sample, including any precipitate, to a RNeasy Mini spin column placed in a 2 mL collection tube (supplied). Close the lid, and centrifuge for 15 s at >8000 x g. Discard the flow-through. Transfer the remaining lysate to the same tube and repeat the step 3. 4) Add 350 pL Buffer RW1 to the RNeasy column. Close lid, centrifuge for 15 s at 8000 x g. Discard the flow-through. 5) Add 10 pL DNase I stock solution to 70 pL Buffer RDD. Mix by gently inverting the tube, and centrifuge briefly. 6) Add the DNase I incubation mix (80 pL) directly to the RNeasy column membrane, and place the tubes on the bench top (20-30□) for 15 min. 7) Add 350 pL Buffer RW1 to the RNeasy column. Close the lid, centrifuge for 15s at 8000 x g. Discard the flow-through. 8) Add 500 pL Buffer RPE to the spin column. Close the lid gently, and centrifuge for 2 min at 8000 x g to wash the spin column membrane. Discard the flow-through. 9) Add 500 jj.L Buffer RPE to the spin column. Close the lid gently, and centrifuge for 2 min at 8000 x g to wash the spin column membrane. 10) Place the RNeasy spin column in a new 1.5 mL collection tube (supplied). Add 30-50 pL RNase-free water directly to the center of the spin column membrane. Close the lid gently, and centrifuge for 1 min at full speed to elute the RNA. RNA quantification Total RNA quantification by Nanodrop™ 2000 spectrophotometer. cDNA synthesis (Reverse Transcription, RT) 1) Set up the RT reaction as follows: Reagent Volume 10x RT Buffer Mix 2 pL 25 x dNTP Mix 0.8 pL 10x RT Random Primers 2 pL RNase inhibitor 1 pL 50U / pL MultiScribe Reverse Transcriptase 1 pL RNA 2000 ng Nuclease / RNase free Water To 20 pL 2) RT reaction conditions: Temperature Time 25°C 10 min 37°C 120 min 85°C 5 min 4°C Forever 3) To achieve highest yield of cDNA, 20 pL RT reactions were performed with up to 2 pg total RNA. cDNA samples were stored at -20°C or used for Real-Time PCR immediately. Real-7zme PCR Reaction (TaqMan Method) 1) Prepare the Real-Time PCR as follows: Reagent Volume TaqMan 2x Universal PCR MasterMix 5 pL Probe 0.5 pL RNase-free Water 2.5 pL cDNA 2 pL Total 10 pL 2) Procedure of Real-Time PCR Temperature Time Cycle 50°C 5 min 1 cycle 95°C 10 min 1 cycle 95°C 15 sec 45 cycles 60°C 1 min 3) ddH2O was used as a no template control (NTC). RNA sample was used as a no reverse transcription control (No RT). Each sample had three technical replicates. Example 4: In vitro knock-down analysis of p65 following transfection of different formulations of p65 siRNA A series of experiments was carried testing various formulations of modified siRNA and their knock-out potential.by testing their inhibitory potential. The modifications of the p65 directed modified siRNA tested are the following: (i) “NF” (“Af, Gf, Uf, Cf’): 2’-fluoro modified nucleotides; (ii) “n” (“a, g, u, c”): 2'-O-methyl modified nucleotides; and (iii) “s”: phosphorthioate backbone modifications in between adjacent nucleotides: The siRNA sequences are: Sense strand: ususGfcggAfCfAfugGfacuuCfua (SEQ ID NO: 65) Anti-sense strand: usAfsgaaguccauguCfcgcaasusg (SEQ ID NO: 160) In experimental set-up A PANC-1 cells were transfected with modified p65 siRNA (SEQ ID NOs: 65 / 160) at an siRNA concentration of 100 nM and based on different peptide concentrations (PEP-C concentrations). The “NP ratios” (referring to the molar ratio of PEP-C concentration to siRNA concentration) were 1:100, 1:50, 1:20, and 1:5 (corresponding to ascending PEP-C concentrations). Cell culturing, preparation of the formulation(s) and transfection were carried out as follows: On day 1, PANC-1 cells were seeded in a 6-well plate (250 000 cells / well) in DMEM complete medium + FBS 10% (volume per well = 2 mL). On day 2, the formulation(s) was / were prepared by incubating a mixture of the siRNA and the peptide (“PEP-C”, also designated as “p5RHH” (see Hou, K. K., Pan, H., Ratner, L., Schlesinger, P. H. & Wickline, S. A. Mechanisms of Nanoparticle Mediated siRNA Transfection by Melittin-Derived Peptides. ACS nano 7,   8605-8615); VLTTGLPALISWIRRRHRRHC; SEQ ID NO: 192) for 40 min at 37°C without shaking to provide nanoparticle complexes (siRNA concentration in the formulation = 2 uM (2000 nM)). Just before transfection on day 2, the medium of the cells was replaced with fresh complete DMEM + 10% FBS (total volume 1.8 mL / well). Thereafter, the solution containing the nanoparticle complexes was added to the cells (200 uL (according to set-up A diluted by 50% as compared to set-ups B, C, D, and E) formulation / well (final siRNA concentration I well =100 nM)). After 72 hours of exposure of the cells to the nanoparticles under the conditions described above, p65 expression was assessed with RT-qPCR. The results are shown in Fig. 17. For all NP ratios, significant reduction of p65 expression was observed with an optimum reduction level of about -60% (dark grey bar) at an NP ratio of 1:50 as compared to p65 expression in untransfected cells. In experimental set-up B, the experimental design was the same as in set-up A. According to set-up B, an siRNA concentration of 200 nM (the solution containing the nanoparticle complexes was added to the cells (200 uL (as compared to set-up A not diluted) formulation / well (final siRNA concentration / well = 200 nM)) and different PEP-C concentrations (various NP ratios (1:100, 1:50, and 1:5) were used. The experimental design on day 1 and day 2 as described for set-up A was applied with the only exception that the nanoparticle complex containing solution was undiluted and resulted in an siRNA concentration of 200 nM. Reduction of p65 expression was measured as in set-up A with RT-qPCR, in comparison to untransfected cells. The results are shown in Fig. 18. As in experimental set-up A, significant levels of p65 expression of between 50 and 70 (compared to the expression in untransfected cells) was observed with an optimum for NP 1:100 formulated siRNA (black bar; -66.5%). In experimental set-up C, the experimental design was the same as in set-up B. According to set-up C, an siRNA concentration of 200 nM and different PEP-C concentrations (NP ratios of 1:100 and 1:5) with or without HSA (human serum albumin) or HA (hyaluronic acid) coating were used. After incubation of the mixture of siRNA and PEP-C to provide the nanoparticle complexes, the coating material was added to the particles and incubated at room temperature for ten minutes (for preparing the coated complexes) before transfection. According to the experimental design of “Plate 1”, the PEP-C:HSA molar ratio was 1:6.9 (NP l:100)and 1:1.54 (NP 1:5); according to “Plate 2”, the PEP-C:HA molar ratio was 1:140 (NP 1:100) and 1:991 (for PEP-RNA 1:5). Reduction of p65 expression was measured as in set-up A or B with RT-qPCR, in comparison to untransfected cells. The results are shown in Fig. 19. “Plate 1” (left) represents HSA coated nanoparticles vs. uncoated nanoparticles; “Plate 2” (right) represents HA coated nanoparticles vs. uncoated nanoparticles. Irrespective of the type of coating (HSA or HA), all formulations showed significant reduction of p65 expression. The optimum results in terms of p65 expression reduction for coated particles were observed at an NP ratio of 1:5 (HSA coated particles; -44%) and at an NP ratio of 1:100 (HA coated particles; -59%) as compared to the p65 expression of untransfected cells. In a further experimental set-up D, the experimental design was the same as in set-up B or C. According to set-up D, an siRNA concentration of 200 nM and different PEP-C concentrations (NP ratios of 1:100 and 1:5) with or without HSA (human serum albumin) or HA (hyaluronic acid) coating were used. Coating was carried out as described for set-up C. Reduction of p65 expression was measured as in set-up A; B or C with RT-qPCR, in comparison to untransfected cells. The results are shown in Fig. 20A and Fig. 20B. In Figure 20A, “Plate 1” (left) represents HSA coated nanoparticles vs. uncoated nanoparticles; “Plate 2” (right) represents HA coated nanoparticles vs. uncoated nanoparticles. According to the experimental design of “Plate 1”, the PEP-C:HSA molar ratio was 1:5; according to “Plate 2”, the PEP-C:HA molar ratio was 1:70. Irrespective of the type of coating (HSA or HA), all formulations showed significant reduction of p65 expression. The optimum results in terms of p65 expression reduction for coated particles were observed at an NP ratio of 1:5 (HSA coated particles; -54.2%) and at an NP ratio of 1:100 (HA coated particles; -34%) as compared to the p65 expression of untransfected cells. In Figure 20B (“Plate 3”), the results of p65 expression for HA coated nanoparticles are shown as in Figure 20A (right) at an NP ratio of 1:100 with a PEP-C: HA molar ratio of 1:50 (instead of 1:70). HA coated particles showed a p65 expression reduction of -30.6% as compared to the p65 expression in untransfected cells. In further experimental set-up E, the experimental design was the same as in set-up B, C or D. According to set-up E, an siRNA concentration of 200 nM and different PEP-C concentrations (NP ratios of 1:100 and 1:5) with or without HSA (human serum albumin) or HA (hyaluronic acid) coating at different time points (24hrs, 48hrs and 72hrs after transfection). The PEP-C:HSA molar ratio was 1:5 and the PEP-C:HA molar ratio was 1:200. Reduction of p65 expression was measured with RT-qPCR as in set-up A, B; C or D, in comparison with untransfected cells. By that experimental design, the kinetics of p65 expression reduction was studied. The results are shown in Fig. 21. Irrespective of the type of coating (HSA or HA) or the NP ratios (molar concentration ratios of PEP-C and siRNA) applied, all formulations showed significant reduction of p65 expression. The level of p65 expression was overall stable in the course of the observation period.

[00166] It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the present description.

[00167] Various publications, articles and patents are cited or described in the background and throughout the specification; each of these references is herein incorporated by reference in its entirety. The incorporated patents include, but are not limited to, US Patent No. 9,987,371, US Patent No. 10,758,627, and US Patent No. 11,529,388. Discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is for the purpose of providing context for the invention. Such discussion is not an admission that any or all of these matters form part of the prior art with respect to any inventions disclosed or claimed.

Claims

1. A composition comprising a peptide-polynucleotide complex,wherein the peptide comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194, or to anyone of the amino acid sequences of SEQ ID Nos: 195 to 219; andwherein the polynucleotide is a small interfering RNA (siRNA) targeting human p65 mRNA.

2. The composition of claim 1, wherein the peptide is non-lytic, non-cytotoxic, and capable of affecting the release of the polynucleotide from an endosome of a cell.

3. The composition of claim 1 or 2, wherein the peptide comprises a cationic region and one or more histidine residues located adjacent to the cationic region.

4. The composition of any one of claims 1 to 3, wherein the peptide comprises an amino acid sequence with at least about 95% identity to the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194.

5. The composition of any one of claims 1 to 4, wherein the peptide comprises the amino acid sequence of SEQ ID NO: 192, SEQ ID NO: 193, or SEQ ID NO: 194.

6. The composition of any one of claims 1 to 5, wherein the siRNA comprises a sense strand and an antisense strand.

7. The composition of claim 6, wherein the sense strand comprises a number of nucleotidesin the range of about 16 bases to about 24 bases.

8. The composition of claim 6 or 7, wherein the antisense strand comprises a number of nucleotides in the range of about 16 bases to about 24 bases.

9. The composition of any one of claims 6 to 8, wherein the sense strand comprises, or consists of, 19 bases.

10. The composition of any one of claims 6 to 9, wherein the antisense strand comprises, or consists of, 21 bases.

11. The composition of any one of claims 6 to 10, wherein the sense strand and / or the antisense strand comprise one or more chemical modifications.

12. The composition of claim 11, wherein the sense strand and / or the antisense strand comprise one or more chemical modifications selected from the group consisting of 2’-methoxy (2’-OMe), 2’-fluoro (2’-F), 2’-O-methoxyethyl (2’-O-MOE), 5’-vinylphosphonate, phosphorothioate (PTO), locked nucleic acid (LNA), unlocked nucleic acid (UNA), glycol nucleic acid (GNA), and deoxyribonucleic acid (DNA).

13. The composition of claim 11 or 12, wherein the sense strand comprises:1) PTO at positions 1 and 2;2)     2’-F at positions 3, 7-9, 12, and 17; and3) 2’-OMe at positions 1, 2, 4-6, 10, 11, 13-16, 18, and 19.

14. The composition of any one of claims 11 to 13, wherein the antisense strand comprises: 1) PTO at positions 1,2, 19, and 20;2)     2’-F at positions 2 and 14; and3) 2’-OMe at positions 1, 3-13, and 15-21.

15. The composition of any one of claims 6 to 14, wherein the last nucleotide of the sense strand is adenine (A).

16. The composition of any one of claims 6 to 15, wherein the first nucleotide of the antisense strand is uracil (U).

17. The composition of any one of claims 6 to 16,(i) wherein the sense strand comprises a nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to one of the sense strand nucleic acid sequences listed in Table 1, and wherein the antisense strand comprises a nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to one of the antisense strand nucleic acid sequences listed in Table 1, or(ii) wherein the sense strand comprises a nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to one of the sense strand nucleic acid sequences listed in Table 2, and wherein the antisense strand comprises a nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to one of the antisense strand nucleic acid sequences listed in Table 2.

18. The composition of any one of claims 6 to 17, wherein the sense strand comprises a nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to the nucleic acid sequence of any one of SEQ ID Nos: 1 to 95.

19. The composition of any one of claims 6 to 18, wherein the antisense strand comprises a nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity to the nucleic acid sequence of any one of SEQ ID Nos: 96 to 190.

20. The composition of any one of claims 6 to 19, wherein the sense strand comprises a nucleic acid sequence with at least about 90% identity to the nucleic acid sequence of SEQ ID NO: 65.

21. The composition of any one of claims 6 to 20, wherein the antisense strand comprises a nucleic acid sequence with at least about 90% identity to the nucleic acid sequence of SEQ ID NO: 160.

22. The composition of any one of claims 6 to 21, wherein the sense strand comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 65; and wherein the antisense strand comprises, or consists of, the nucleic acid sequence of SEQ ID NO: 160.

23. The composition of any one of claims 1 to 22, wherein the molar ratio of peptide to polynucleotide is about 2:1 to about 3500:1.

24. The composition of claim 23, wherein the molar ratio of peptide to polynucleotide is about 5:1 to about 200:1.

25. The composition of claim 23, wherein the molar ratio of peptide to polynucleotide is about 100:1.

26. The composition of claim 23, wherein the molar ratio of peptide to polynucleotide is about 5:1.

27. The composition of any one of claims 1 to 26, wherein the charge ratio of peptide to polynucleotide is about 6:1 to about 18:1.

28. The composition of claim 27, wherein the charge ratio of peptide to polynucleotide is about 12:1.

29. The composition of any one of claims 1 to 28, wherein the peptide-polynucleotide complex is a nanoparticle with a diameter of about 10 nm to about 300 nm.

30. The composition of any one of claims 1 to 29, wherein the peptide-polynucleotide complex is coated with albumin and / or hyaluronic acid.

31. The composition of any one of claims 1 to 30, wherein the composition comprises a pharmaceutically acceptable carrier.

32. A method of delivering a polynucleotide into a cell, comprising contacting the cell with the composition of any one of claims 1 to 31.

33. The method of claim 32, wherein the polynucleotide is delivered into the cytoplasm of the cell.

34. The method of claim 32 or claim 33, wherein the contacting of the cell is performed in vitro, ex vivo or in vivo.

35. The method of any one of claims 32 to 34, wherein the cell is a cancer cell.

36. The method of any one of claims 32 to 34, wherein the cell is a cell affected byinflammation.

37. A method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the composition of any one of claims 1 to 31.

38. The method of claim 37, wherein the subject has a cancer, an autoimmune disease, an inflammation-related disease, inflammatory airway disease, rheumatoid arthritis, osteoarthritis, atherosclerosis, inflammatory bowel disease, systemic lupus erythematosus, type I diabetes, chronic obstructive pulmonary disease, asthma, or multiple sclerosis.

39. The method of claim 37 or claim 38, wherein the subject has a cancer.

40. The method of claim 39, wherein the cancer is a blood cancer or a solid tumor cancer.

41. The method of claim 37 or claim 38, wherein the subject has an inflammation-relateddisease.

42. The method of claim 41, wherein the inflammation-related disease is rheumatoid arthritis, psoriatic arthris, gouty arthritis, lupus, psoriasis, ankylosing spondylitis, high blood pressure, heart disease, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, chronic obstructive pulmonary disease (COPD), asthma, depression, anxiety, Type 2 diabetes mellitus, Type 1 diabetes mellitus, fatty liver disease, endometriosis, or allergy.

43. The method of any one of claims 37 to 42, wherein the subject is a human subject.

Images