Method for separating oligonucleotides

Abstract

The technology described herein relates generally to methods for purifying longer double-stranded and single-stranded oligonucleotides from shorter complementary or partially complementary oligonucleotide fragments.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119 of U.S. Provisional Application No. 63 / 641,046 filed May 1, 2024, the contents of which are incorporated herein by reference in their entireties. TECHNICAL FIELD

[0002] The instant application contains a Sequence Listing which has been filed electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 24,2025, is named “ALN-522_ST_26.xml” and is 53,248 bytes in size. TECHNICAL FIELD

[0003] The technology described herein relates generally to methods for purifying longer double stranded and single-stranded oligonucleotides from shorter complementary or partially complementary oligonucleotide fragments. BACKGROUND

[0004] Typical syntheses of siRNA duplexes involve the solid phase syntheses of both sequences followed by their independent purifications, and the purified single strands are then annealed to form the duplex of interest (see, for example, Zhang, Q.; Lv, H.; Wang, L.; et. al. Int J Mol Sci. 2016, 17, 2134). However, there remains a need in the art for methods for purifying siRNA duplexes. The present disclosure addresses this need. SUMMARY

[0005] In one aspect provided herein is a method for separating shorter complementary or partially complementary oligonucleotide fragments from longer double-stranded or single-stranded oligonucleotides to obtain a longer double-stranded or single-stranded oligonucleotide product. The method comprises filtering a solution (also referred to as an initial solution, a feed solution or solution to be filtered herein), in the presence of one or more destabilizing agents to generate a purified longer double-stranded or single-stranded oligonucleotide product. The initial solution comprises the shorter complementary or partially complementary oligonucleotide fragments and the longer double-stranded or single-stranded oligonucleotides. It is noted that filtering can be continuous filtration or batch filtration.

[0006] In some embodiments, the initial solution is filtered by tangential flow filtration (TFF). For example, the filtration is ultrafiltration (UF).

[0007] In some embodiments of any one of the aspects described herein, the initial solution comprises a destabilizing agent. In some non-limiting examples, the destabilizing agent can be a salt or a free acid form thereof. For example, the destabilizing agent can be a salt. In some embodiments, the destabilizing agent is a salt comprising an ion selected from the group consisting of Li+, Na+, K+, Mg2*, Ca2*, Sr2*, Ti4*, Zr4+, Mn2*, Fe2*, Co2*, Ni2*, Cu2*, Ag2+, Zn2*, Cd2*, Al2*, Tl*, Zn2*, Ce3*, Rb*, Cs*, NH4*, N(alkyl)4+ (where each R is independently Ci-Cealkyl, such as methyl, ethyl, propyl, butyl, and tributyl methyl), guanidinium, 1-aminoguanidinium, Br, F, F’, CF, NO3 , ClO-f, SCN’, HCOs', COs2', H2PO4", HPO42', HSO4', formate, acetate, citrate, oxalate, trichloroacetate, dichloroacetate, chloroacetate, trifluoroacetate, p-toluene sulfonate, methyl sulfonate, trifluoromethyl sulfonate, and any combinations thereof. In some embodiments, the destabilizing agent is a carbonate (CO32), phosphate (PO43 ), citrate, or acetate (CH3CO2) salt. For example, the destabilizing agent is sodium carbonate (Na2CO3), potassium carbonate (K2CO3), sodium citrate (HOC(COONa)(CH2COONa)2), sodium citrate monobasic (HOC(COONa)(CH2COOH)2), sodium phosphate dibasic (Na2HPO4)or sodium phosphate tribasic (Na3PO4), or a combination of sodium phosphate dibasic and sodium phosphate tribasic. In some embodiments, the destabilizing agent is a free acid form of a salt.

[0008] In some embodiments, the destabilizing agent is a solvent. For example, the destabilizing agent is an organic solvent. Some exemplary solvents for the destabilizing agent include, but are not limited to, methanol, ethanol, propanol, DMSO, DMF, acetamide, acetone, urea, thiourea, HMPA, and the like. In some embodiments, the destabilizing agent is DMF, urea, or ethanol.

[0009] It is noted two or more destabilizing agents can be used together. In other words, the initial solution comprises two (e.g., 3,4, 5 or more) different destabilizing agents.

[0010] Without wishing to be bound by a theory, an appropriate amount / concentration of destabilizing agents is used to reduce the melting temperature of shorter complementary or partially complementary oligonucleotides. In other words, the destabilizing agent is present in an amount sufficient to lower the Tm of the shorter complementary or partially complementary oligonucleotides. For example, the agent is present in the initial solution in an amount sufficient to preferentially denature the shorter complementary or partially complementary oligonucleotides without substantially denaturing the longer double-stranded oligonucleotides. For clarity, melting temperature of shorter complementary or partially complementary oligonucleotides refers to the melting temperature of a double-stranded oligonucleotide formed when the shorter complementary or partially complementary oligonucleotides are hybridized with a fully complementary strand or to one another (i.e., all doublestranded moieties in solution that are not the longer double-stranded oligonucleotide).

[0011] The amount of the destabilizing agent in the initial solution can be from about 0.01M to about 12 M or the maximum concentration of the relevant agent in the solution. For example, the destabilizing agent can be present in the initial solution at a concentration of from about 0.03 M to about 10 M. In some embodiments, the initial solution comprises the destabilizing agent at a concentration from about 0.04 M to about 1 M. For example, the initial solution comprises the destabilizing agent at a concentration from about 0.1 M to about 0.5 M, e.g., from about 0.2 M to about 0.3 M. In some embodiments, the destabilizing agent can be present in the initial solution at a concentration of from about from about 2 M to about 10M, e.g., from about 3 M to about 9 M, from about 4 M to about 8 M, or from about 5 M to about 7 M.

[0012] In some embodiments, the destabilizing agent can be present in the initial solution in an amount from about 5% to about 75% (v / v or w / v). For example, the initial solution comprises the destabilizing agent in an amount from about 10% to about 50% (v / v or w / v), e.g., from about 15% to about 45%. In some embodiments, the destabilizing agent can be present in the initial solution in an amount from about 20% to about 40% (v / v or w / v).

[0013] As one of skill in the art will appreciate, the filtering step can be carried out at ambient temperature (e.g., room temperature) or at a temperature higher or lower than ambient temperature. Thus, the step of filtering the initial solution can be at a temperature from about 15°C to about 60°C. In some embodiments, the step of filtering the initial solution is at a temperature from about 15°C to about 35°C. For example, the step of filtering the initial solution is at an ambient temperature, e.g., a temperature from about 15°C to about 25°C. In some other embodiments, the step of filtering the initial solution is carried out an elevated temperature, e.g., a temperature higher than 30°C.

[0014] The pH of the initial solution can range from about 5 to about 13 or about 5 to 11. In some embodiments, the initial solution has a pH of from about 6 to about 12 or about 6 to 11. In some embodiments, the initial solution has a pH from about 3 to about 11. In some embodiments, the initial solution has a pH lower than 7, from about 3 to about 6.5, from about 3.5 to about 6, from about 4 to about 5, or about 4.5. For example, the initial solution has a pH from about 10 to about 11. In some embodiments of any one of the aspects described herein, the initial solution is filtered under high pH, i.e., the initial solution has a pH higher than 7. For example, the initial solution has a pH of about 7.5 or higher. In some embodiments, the initial solution has a pH of from about 8 to about 13, e.g., from about 8.5 to about 12.5, about 9 to about 12, or about 9.5 to about 11.5. In one particular embodiment, where a carbonate (e.g., sodium carbonate) is the destabilizing agent, then the initial solution has a pH less than 11, such as about 7 to 11, or about 8 to 11, or 9 to 11, or 10 to 11; or 7 to 10.8 or 8 to 10.8 or 9 to 10.8 or 9.5 to 10.8; or 7 to 10.5 or 8 to 10.5 or 9 to 10.5 or 9.5 to 10.5.The initial solution can be filtered at a constant a transmembrane pressure (TMP) or the TMP can be changed during the filtering step. In some embodiments, the initial solution is filtered at a TMP of from about 0.01 to about 50 pounds per square inch (psi). For example, the initial solution is filtered at a TMP of from about 5 to about 30 psi. In some embodiments, the initial solution is filtered at a TMP of from about 15 to about 25 psi.

[0015] After purification, the resulting longer double-stranded or single-stranded oligonucleotide product is at least 80% pure. For example, the purity of the resulting longer double-stranded or singlestranded oligonucleotide product is at least about 80%, e.g., at least about 85% or more, based on total nucleic acid content of the purified product. Stated in another way, the purified longer double-stranded or single-stranded oligonucleotide product obtained from the filtering step comprises at least 85% or more of the longer double-stranded or single-stranded oligonucleotide, based on the total nucleic acid content of product. For example, the longer double-stranded or single-stranded oligonucleotide product is present at a level of at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more in the purified product, e.g., in the purified solution, based on total nucleic acid content of the purified product, e.g., in the purified solution. In other words, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more of the total nucleic acid content the purified product, e.g., in the purified solution is the longer double-stranded or single-stranded oligonucleotide product The purity can be determined by methods commonly known to the skilled person, such as size-exclusion chromatograph (SEC), high-performance liquid chromatography (HPLC), mass spectrometry (MS), liquid chromatography-MS (LC-MS), HPLC-MS or capillary electrophoresis mass spectrometry (CEMS), e.g. by analytical HPLC. For example, the purity can be determined by an analytical HPLC method described in the Examples section herein, and calculated by percentage of the total integration (area%) of a UV chromatogram, without adjustment for absorbance differences among analytes.

[0016] Without wishing to be bound by a theory, the methods described herein lead to high recovery of the longer double-stranded and single-stranded oligonucleotide. In some embodiments, at least 80%, e.g., e.g., at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85% or more of the longer double-stranded or single-stranded oligonucleotides from the initial solution can be recovered after the filtering step. In other words, an amount of the longer doublestranded or single-stranded oligonucleotide product obtained from the filtering step is at least about 80%, e.g., at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85% or more of the amount of same present in the initial solution.

[0017] After purification, the resulting purified product comprises a lower amount of the shorter complementary or partially complementary oligonucleotide fragments. For example, the resulting purified product comprises the shorter double-stranded or single-stranded oligonucleotide fragments in an amount of about 15%, e.g., about 13%, about 12%, about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 2%, about 1%, about 0.75%, about 0.5% or less of the total nucleic acid content of purified product. In some embodiments, the purified product is substantially free of the shorter complementary or partially complementary oligonucleotides.

[0018] Generally, about 80%, e.g., about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about %, about 1% or less of the shorter complementary or partially complementary oligonucleotide fragments from the initial solution is recovered in the purified product after the filtering step. In other words, an amount of shorter complementary or partially complementary oligonucleotide fragment in the purified product is about 80%, e.g., about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less of the amount of same present in the initial solution.

[0019] Toal amount of the nucleic acids, i.e., total of longer double-stranded and single-stranded oligonucleotides and shorter complementary or partially complementary oligonucleotide fragments in the initial solution can be at least about 0.1 mg / mL. For example, the total nucleic acid amount in the initial solution can be at least about 0.5mg / mL, about 1 mg / mL, about 1.5mg / mL, about 2mg / mL, about 2.5mg / mL, about 5mg / mL, about 7.5mg / mL, about lOmg / mL, about 15mg / mL, about 20mg / mL, about 25 mg / mL, about 30mg / mL, about 35mg / mL, about 40mg / mL, about 45mg / mL, about 50mg / mL, about 55mg / mL, about 60mg / mL, about 65mg / mL, about 70mg / mL, about 75mg / mL, about 80mg / mL, about 85mg / mL, about 90mg / mL, about 95mg / mL, about lOOmg / mL or more.

[0020] In some embodiments, the longer double-stranded or single-stranded oligonucleotides present in the initial solution are obtained by ligation of shorter complementary or partially complementary oligonucleotide fragments. For example, the longer double-stranded or single-stranded oligonucleotides present in the initial solution are obtained by enzymatic ligation of shorter complementary or partially complementary oligonucleotide fragments, e.g., using an RNA or DNA ligase, e.g., using an RNA or DNA ligase. Generally, the shorter complementary or partially complementary oligonucleotide fragments are independently 3 to 12 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, such as 4,5,6,7,8,9 or 10) nucleotides in length. In some embodiments, the shorter complementary or partially complementary oligonucleotide fragments are independently about half the length of the one or both strands of the longer double-stranded oligonucleotide. It is noted that the shorter complementary or partially complementary oligonucleotide fragments used in the ligation can be prepared using chemical (e.g., solid phase or solution phase) synthesis, or enzymatic synthesis.

[0021] It is noted that the purified product be collected in the retentate or the permeate from the filtering step. In some embodiments, the longer double-stranded or single-stranded oligonucleotide product is retained in the retentate. Accordingly, in some embodiments, a filter / membrane with a molecular weight cut-off (MWCO) of lower than a molecular weight of the longer double-stranded or single-stranded oligonucleotide product is used in the filtering step. For example, the initial solution is filtered through a filter having MWCO at least 10, e.g., at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25 or more lower than a molecular weight of the longer the longer double-stranded or single-stranded oligonucleotide product. In some embodiments, the initial solution is filtered through a through a filter having a molecular weight cut off lOkDa or less. For example, the initial solution is filered through a membrane with a MWCO of from about 5 kDa to about 10 kDa. In some embodiments, the initial solution is filtered using a membrane having a MWCO of 10 kDa.

[0022] It is noted that different manufacturers may use different methods or molecules to define the MWCO of their membranes. Thus, a filter having a MWCO of 10 kDa from one manufacturer may not have the same retention as a filter from a different manufacturer. On method for characterization of MWCO of a filter is by using dextran standards where the filter is challenged with a mixture of dextran markers (ranging from 100 to 4,000,000 Da) in a stirred cell (< 10 kD at 4 bar, > 10 kD at 1 bar) with a crossflow of 0.8 m / s). The retentate is analyzed via Gel Permeation Chromatography (GPC, 0.05 M potassium phosphate buffer eluent, flow rate of 1 mL / min, column temperature of 30 °C) to determine the different sizes and amount of dextran in the samples. The MWCO is the value of the molecular weight of the dextran standard that is at least 90% retained by the filter.

[0023] In some embodiments, the longer double-stranded or single-stranded oligonucleotide product is in the permeate. Thus, in some embodiments, a filter / membrane with a molecular weight cut off (MWCO) of higher than a molecular weight of the longer double-stranded or single-stranded oligonucleotide product is used in the filtering step. For example, the initial solution is filtered through a filter having MWCO at least 10, e.g., at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25 or more higher than a molecular weight of the longer doublestranded or single-stranded oligonucleotide product. In some embodiments, the initial solution is filtered through a through a filter having a molecular weight cut off about 30 kDa.

[0024] In some embodiments, a filter of suitable MWCO is selected so that at least 90%, e.g., 91%, 92%, 93%, 94%, 95% or more of the longer double-stranded oligonucleotide product from the initial solution is retained and, at least 90% e.g., 91%, 92%, 93%, 94%, 95% or more of the individual single strands are rejected.

[0025] In some embodiments, the initial solution comprises or is a reaction mixture from a ligation reaction to prepare the longer the longer double-stranded or single-stranded oligonucleotides. It is noted that the reaction mixture can be processed to remove one or more ligation reagents / components present in the reaction mixture prior to the step of filtering the solution. For example, the reaction mixture can be filtered to remove one or more ligation reagents / components present in the reaction mixture.

[0026] The longer single-stranded oligonucleotides can be from about 15 to about 200 nucleotides in length, e.g., from about 15 to about 50 nucleotides in length. In some embodiments, longer singlestranded oligonucleotides are 15, 16, 17,28, 19, 20,21,22,23,24, 25, 26,27,28,29 or 30 nucleotides in length. For example, the longer single-stranded oligonucleotides can be 19,20,21,22,23,24 or 25 nucleotides in length. In some embodiments, single-stranded oligonucleotides are 19, 20,21,22 or 23 nucleotides in length.

[0027] It is noted that that the longer single-stranded oligonucleotides are at least 3, e.g., 4, 5,6,7, 8, 9, 10 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotide fragments. For example, the longer single-stranded oligonucleotides are 3, 4, 5, 6, 7, 8 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotide fragments.

[0028] The longer double-stranded oligonucleotide product comprises a first strand and a second strand substantially complementary to the first strand. Generally, each of the first and second strand is independently from about 15 to about 30 nucleotides. For example, each of the first and second strand is independently 15, 16,17,28, 19,20,21,22,23,24,25,26,27,28,29 or 30 nucleotides in length. In some embodiments, each of the first and second strand is independently 18,19,20,21,22,23,24 or 25 nucleotides) in length. For example, each of the first and second strand is independently 18, 19, 21, 22,22,23 or 24 nucleotides in length.

[0029] The first strand and the second strand of the longer double-stranded oligonucleotides are substantially complementary to each other and hybridize to each other to form a duplex region of from about 15 base-pairs to about 30 base-pairs. For example, the first and second strand hybridize to each other to form a duplex region of 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 base-pairs. In some embodiments, the first and second strand hybridize to each other to form a duplex region of 18, 19,21, 22, or 23 base-pairs. For example, the first and second strand hybridize to each other to form a duplex region of 18,19,21 or 22 base-pairs.

[0030] In some embodiments, one strand of the longer double-stranded oligonucleotide product is shorter than the other strand. For example, one strand of the longer double-stranded oligonucleotide product is 1,2,3, 4 or 5 nucleotides shorter than the other strand. In some embodiments, one strand of the longer double-stranded oligonucleotide product is 1,2 or 3 nucleotides shorter than the other strand. For example, one strand of the longer double-stranded oligonucleotide product is no more than 1 or 2 nucleotides shorter than the other strand.

[0031] It is noted that at least one of the first or second strand of the longer double-stranded oligonucleotide product is at least 3, e.g., 4, 5,6, 7, 8, 9,10 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotides. For example, at least one of the first or second strand of the longer double-stranded oligonucleotide product is at least 4, 5, 6, 7, 8 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotides.

[0032] Generally, the longer double-stranded oligonucleotides comprise at least 2, e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide base-pairs than the short complementary or partially complementary oligonucleotides. For example, the longer double-stranded oligonucleotides comprise 2,3,4, 5, 6,7, 8 or more nucleotide base-pairs than the short complementary or partially complementary oligonucleotides. In some embodiments, the longer double-stranded oligonucleotides comprise 3,4, 5 or more nucleotide base-pairs than the short complementary or partially complementary oligonucleotides.

[0033] In some embodiments, one or both of the first and second strands of the longer doublestranded oligonucleotide product comprise a one- or two-nucleotide overhang on its respective 5’-end or 3’-end. For example, only one of the first or second strand has a 1 one- or two-nucleotide overhang on its 5’-end or 3’-end. In some embodiments, only one of the first or second strand has a two-nucleotide overhang on its 3’-end.

[0034] In some embodiments of any one of the aspects described herein, the longer doublestranded oligonucleotide is capable of inducing RNA interference. For example, the longer doublestranded oligonucleotide is a therapeutic siRNA.

[0035] It is noted that the longer double-stranded or single-stranded oligonucleotides can be unmodified, partially, or completely modified RNA or DNA oligonucleotide. For example, the longer double-stranded or single-stranded oligonucleotides can be unmodified, partially, or completely modified RNA. In some embodiments, the longer double-stranded or single-stranded oligonucleotides are partially, or completely modified RNA or DNA. Stated in another way, the longer double-stranded or single-stranded oligonucleotides comprises at least one nucleic acid modification. Exemplary nucleic acid modifications include, but are not limited to, nucleobase modifications, sugar modifications, intemucleotide linkage modifications, conjugates (e.g., ligands), and any combinations thereof.

[0036] The longer double-stranded or single-stranded oligonucleotide can comprise at least one, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified ribose sugars. In some embodiments, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1, 2, 3,4, 5, 6, 7, 8, 9,10 or more 2’-OMe nucleotides. In some embodiments, the longer double-stranded or singlestranded oligonucleotide product comprises at least one, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-F nucleotides. In some embodiments, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1,2, 3,4, 5, 6,7, 8, 9,10 or more) 2’-H nucleotides.

[0037] In some embodiments, the longer the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more thermally destabilizing modification of the duplex. Some exemplary thermally destabilizing modification of the duplex include, but are not limited to, abasic modifications; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2’-deoxy (i.e., 2’-H) modification, acyclic nucleotide (e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA)), threose nucleic acid (TNA), a nucleotide linked by through its 2’-position (i.e., by its 2’-OH group to 5’-position of the subsequent nucleotide (a 2’-5’ RNA modification)); a Hyp-spacer modification; modified intemucleotide linkages that decrease the thermal stability of dsNA duplexes; nucleobases with impaired W-C H-bonding to complementary base on the opposite strand; universal nucleobases, or a-nucleotides. In some embodiments, the thermally destabilizing modification is GNA, e.g., S-isomer GNA.

[0038] In some embodiments, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1,2,3,4,5,6,7,8,9,10 or more thermally stabilizing modification of the duplex. Exemplary thermally stabilizing modifications include, but are not limited to, 2’-fluoro nucleotides, bridged nucleic acid (e.g., locked nucleic acid, LNA), and cyclohexene nucleic acid.

[0039] In some embodiments, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more lipohilic modifications, e.g., nucleotide modified with a lipophilic group.

[0040] In some embodiments, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more non-natural or modified nucleobases.

[0041] In some embodiments, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1,2,3,4,5,6,7,8,9,10 or more modified intemucleoside linkages. For example, the longer double-stranded or single-stranded oligonucleotide product comprises at least one, e.g., 1,2, 3,4, 5, 6,7, 8, 9,10 or more phosphorothioate modified intemucleoside linkages.

[0042] In some embodiments, the longer double-stranded or single-stranded oligonucleotide is conjugated with a ligand. It is noted that the ligand can be at the 3’-end, 5’-end, or at an internal position. In certain embodiments, the ligand is at the 3 ’-end of a strand, e.g., at the 3 ’-end of the sense strand. In other embodiments, the ligand is at the 5’-end of a strand, e.g., at the 5’-end of the sense strand. In yet other embodiments, the ligand is at an internal position on a strand, e.g., at the 2’-position of a nucleotide within the sense strand. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0044] FIG. 1 depicts the general reaction scheme for formation of AD-64958.

[0045] FIG. 2 depicts AD-64958 and Example Impurity Duplexes with Corresponding G-C Content.

[0046] FIG. 3 depicts difference in equilibrium constants differentiating oligonucleotide duplexes. TniFLP= the Tm of the FLP duplex, Tmi= The Tm of the impurity or intermediate duplexes.

[0047] FIG. 4 depicts duplex purification through differentiating Tm.

[0048] FIG. 5 depicts Tm Data for AD-64958 at varying concentrations of oligonucleotide and NaiCOj.

[0049] FIG. 6 depicts Relative Tm of AD-64958 and intermediate duplexes in 0.125 M NaiCCh.

[0050] FIG. 7 depicts initial test results with lOkD regenerated cellulose membrane with water.

[0051] FIG. 8 depicts initial test results with lOkD regenerated cellulose membrane with 0.5 M and 1 M NaCl.

[0052] FIG. 9 depicts comparison of UF purity results at different temperatures.

[0053] FIG. 10 depicts using 0.1 M and 0.25 M sodium carbonate (NaiCCh) at ambient temperature, initial solution-6 mg / ml. DETAILED DESCRIPTION

[0054] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0055] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose. Method

[0056] In one aspect, provided herein is a method for separating shorter complementary or partially complementary oligonucleotide fragments from longer double-stranded or single-stranded oligonucleotides to obtain a longer double-stranded or single-stranded oligonucleotide product. The method comprises filtering a solution (i.e., initial solution) under conditions that preferentially denature the shorter complementary or partially complementary oligonucleotide fragments without substantially denaturing the longer double-stranded or single-stranded oligonucleotides to generate a purified longer double-stranded or single-stranded oligonucleotide product.

[0057] For example, the method comprises filtering the initial solution through a membrane / filter under conditions that preferentially denature that preferentially denature the shorter complementary or partially complementary oligonucleotide fragments without substantially denaturing the longer doublestranded or single-stranded oligonucleotides to generate a purified longer double-stranded or singlestranded oligonucleotide product. The purified longer double-stranded or single-stranded oligonucleotide product can be collected, e.g., by flushing the purified product from the filter; thereby obtaining a solution comprising the purified longer double-stranded or single-stranded oligonucleotide product. The solution comprising the purified product is also referred to as the purified solution herein. Purity of the product

[0058] As used herein, the term “purifying”, “purification” or “purify” means that a desired longer double-stranded or single-stranded oligonucleotide product in a sample, e.g., a initial solution (such as a reaction mixture, or a permeate or retentate from a filtration such as from filtration of a reaction mixture) is separated from undesired components, such as shorter complementary or partially complementary oligonucleotide fragments that may be present in the sample.

[0059] Generally, the purify of the longer double-stranded or single-stranded oligonucleotide product, e.g., in the purified solution is at least about 80%, e.g., at least about 85% or more, based on total nucleic acid content of the purified product, e.g., in the purified solution. Stated in another way, at least about 80%, e.g., at least about 85% or more of the total nucleic acid content in purified product, e.g., in the purified solution is the longer double-stranded or single-stranded oligonucleotide product. For example, the longer double-stranded or single-stranded oligonucleotide product is present at a level of at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more in the purified product, e.g., in the purified solution, based on total nucleic acid content of the purified product, e.g., in the purified solution. In other words, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more of the total nucleic acid content the purified product, e.g., in the purified solution is the longer double-stranded or single-stranded oligonucleotide product. As discussed herein, the purify can be determined by methods commonly known to the skilled person, e.g. by analytical HPLC. For example, the purify can be determined by an analytical HPLC method described in the Examples section herein.

[0060] The purified longer double-stranded or single-stranded oligonucleotide product, e.g., the purified solution is substantially free of shorter complementary or partially complementary oligonucleotide fragments. As used herein, the phrase “substantially free of shorter complementary or partially complementary oligonucleotide fragments” means a state in which relatively little or none of the shorter complementary or partially complementary oligonucleotide fragments are present. For example, the shorter complementary or partially complementary oligonucleotide fragments are present at a level of less than about 15%, about 14%, about 13%, about 12%, about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, about 0.5% or less, based on total nucleic acid content of purified product Stated in another way, less than about 15%, about 14%, about 13%, about 12%, about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, about 0.5% or less of the total nucleic acid content in the purified product, e.g., in the purified solution is the shorter complementary or partially complementary oligonucleotide fragments.

[0061] In some embodiments, the amount of the shorter complementary or partially complementary oligonucleotide fragments in purified product is at least about 75% or more lower than the amount in the initial solution. For example, the amount of shorter complementary or partially complementary oligonucleotide fragments in the purified product is at least about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or more lower than the amount in the initial solution.

[0062] The total nucleic acid amount in the initial solution can be at least about 0.1 mg / ml or more. For example, the total nucleic acid content in the initial solution can be at least about 0.5 mg / mL, about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 5 mg / mL, about 7.5 mg / mL, about 10 mg / mL, about 15 mg / mL, about 20 mg / mL, about 25 mg / mL, about 30 mg / mL, about 35 mg / mL, about 40 mg / mL, about 45 mg / mL, about 50 mg / mL, about 55 mg / mL, about 60 mg / mL, about 65 mg / mL, about 70 mg / mL, about 75 mg / mL, about 80 mg / mL, about 85 mg / mL, about 90 mg / mL, about 95 mg / mL, or more. In some embodiments, the total nucleic acid concentration in the initial solution is at least about 100 mg / mL, about 125 mg / mL, about 130 mg / mL, about 135 mg / mL, about 140 mg / mL, about 145 mg / mL, about 150 mg / mL, about 155 mg / mL, about 160 mg / mL, about 165 mg / mL, about 170 mg / mL, about 175 mg / mL, about 180 mg / mL, about 185 mg / mL, about 190 mg / mL, 195 mg / mL, about 200 mg / mL, about 225 mg / mL, about 230 mg / mL, about 235 mg / mL, about 240 mg / mL, about 245 mg / mL, about 250 mg / mL, about 255 mg / mL, about 260 mg / mL, about 265 mg / mL, about 270 mg / mL, about 275 mg / mL, about 280 mg / mL, about 285 mg / mL, about 290 mg / mL, 295 mg / mL, about 300 mg / mL or up to the solubility limit for the nucleic acid.

[0063] Using the method described herein, at least about 80%, e.g., at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85% or more of the longer doublestranded or single-stranded oligonucleotides from the initial solution can be recovered in the purified product. For example, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, or more of the longer double-stranded or single-stranded oligonucleotides from the initial solution can be recovered in the purified product.

[0064] In some embodiments, at least about 80%, e.g., at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85% or more of the longer double-stranded or singlestranded oligonucleotides from the initial solution can be recovered and the purity of the recovered the longer double-stranded or single-stranded oligonucleotides is at least about 80%, e.g., at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85% or more, based on total nucleic acid content of the purified product. Destabilizing agent

[0065] In some embodiments, the initial solution further comprises a destabilizing agent. For example, the method comprises a step of adding a destabilizing agent to the initial solution prior to the step of filtering. As used herein the term “destabilizing agent” refers to molecules, compounds or compositions that destabilize a duplex formed between two complementary oligonucleotides and effectively lower the temperature (Tm) of the duplex. A destabilizing agent includes a substance that disrupts a macromolecular structure by interfering with intermolecular or intramolecular ionic or hydrogen bonds, hydrophobic interactions, and / or van der Waals interactions. In other words, a destabilizing agent is a substance that disrupts the structure of, or denatures, biological materials or macromolecules, such as nucleic acids and proteins.

[0066] In some embodiments, the destabilizing agent is a salt. Some exemplary salts include, but are not limited to, salts comprising an ion selected from COs2', HCCh', HiPCV, HPCV', Li+, Na+, K+, Mg2*, Ca2*, Sr2*, Ti4*, Zr4+, Mn2*, Fe2*, Co2*, Ni2*, Cu2*, Ag2+, Zn2*, Cd2*, Al2*, Tl*, Zn2*, Ce3*, Rb*, Cs*, NH4*, N(alkyl)4* (where each R is independently Ci-Cealkyl, such as methyl, ethyl, propyl, butyl, and combinations thereof, such as tributyl methyl), guanidinium, 1-aminoguanidinium, Br, F, F’, CF, NO3 , CIO4-, SCN’, HSCV, formate, acetate, citrate, oxalate, trichloroacetate, dichloroacetate, chloroacetate, trifluoroacetate, p-toluene sulfonate, methyl sulfonate, trifluoromethyl sulfonate.

[0067] In some embodiments, the destabilizing agent is a carbonate, phosphate or acetate salt. For example, the destabilizing agent is lithium carbonate, sodium carbonate, potassium carbonate, or cesium carbonate, or a mixture thereof. In some embodiments, the destabilizing agent is sodium carbonate. In some embodiments, the destabilizing agent is potassium carbonate. In some embodiments, the destabilizing agent is a mixture of sodium carbonate and potassium carbonate.

[0068] In other examples, the destabilizing agent is a phosphate or acetate salt. For example, the destabilizing agent is sodium phosphate.

[0069] In some embodiments, the destabilizing agent is a solvent. For example, the destabilizing agent is an organic solvent. Some exemplary solvents for the destabilizing agent include, but are not limited to, formamide, dimethylacetamide (DMA), methanol, ethanol, propanol, DMSO, DMF, acetamide, acetone, HMPA, and the like.

[0070] In some embodiments, the destabilizing agent is a neutral molecule capable of participating in hydrogen bonding, such as urea or thiourea.

[0071] In some embodiments the destabilizing agent is selected from Table A below. Table A: Exemplary destabilizing agents DMF and its derivatives 0 A R? Rf N' 4 R. = H, Me. Et, nPr, iPr R<. = H, Me, Et, nPr. iPr Rj = H, Me, Et, nPr, SPf Pyrrolidone and its derivatives f RR X. / R « H. Ms, El, RPt, iP? Alcohols R-OH R = Me, Et, CF3-CH2, nPr, iPr, nBu, iBu Acids O R^OH R= H, CH3, CF3, CCI3, CHCI2, CH2CI, Et, nPr, iPr, nBu, iBu, Phenyl Phosphoric acid and its derivatives 0 R3O^V°R1 OR2 R1= R2= R3= H R1=R2=H; R3= Na, Mg, Ca any other metal ion R1=H; R2= R3= Na, Mg, Ca any other metal ion Oxalic acid and its salts 0 V” R= H, Na, Mg, Ca, any other metal ion Citric acid and its salts R2°v 0 0  \ OR1 R3oA^Ao R1 = R2 = R3= H R1= R2 = H; R3= Na, Mg, Ca, anyother metal ion R1= H; R2 = R3= Na, Mg, Ca, any other metal ion R1= R2 = R3= Na, Mg, Ca, any other metal ion Urea and its derivatives 0 r4-n4r' 63 &2 R1= H, Me, Et, nPr, iPr, nBu, iBu R2= H, Me, Et, nPr, iPr, nBu, iBu R3= H, Me, Et, nPr, iPr, nBu, iBu R4= H, Me, Et, nPr, iPr, nBu, iBu

[0072] Generally, the initial solution comprises the destabilizing agent in an amount sufficient to preferentially denature the shorter complementary or partially complementary oligonucleotide fragments without substantially denaturing the longer double-stranded or single-stranded oligonucleotides. For example, the initial solution comprises the destabilizing agent in an amount such that at least 50% of the shorter complementary or partially complementary oligonucleotide fragments is denatured while about 10% or less of the full-length double-stranded nucleic acid is denatured. For example, the initial solution comprises the destabilizing agent in an amount such that at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%%, at least 90%, at least 95% or more of the shorter complementary or partially complementary oligonucleotide fragments is denatured while about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2% or less of the longer double-stranded or single-stranded oligonucleotides are denatured.

[0073] In some embodiments, the initial solution comprises the destabilizing agent at a concentration of about 0.04 M, 0.05 M, about 0.1M, about 0.25 M, about 0.5 M, about 0.75 M, about 1 M, about 1.25 M, about 1.5 M, about 1.75 M, about 2 M, about 2.25 M, about 2.5 M, about 2.75 M, about 2 M, about 3.25 M, about 3.5 M, about 3.75 M, about 4 M, about 4.25 M, about 4.5 M, about 4.75 M, about 5 M, about 5.25 M, about 5.5 M, about 5.75 M, about 6 M, about 6.25 M, about 6.5 M, about 6.75 M, about 7 M, about 7.25 M, about 7.5 M, about 7.75 M, about 8 M, about 8.25 M, about 8.5 M, about 8.75 M, about 9 M, about 9.25 M, about 9.5 M, about 9.75 M, about 10 M, about 10.25 M, about 10.5 M, about 10.75 M, about 11 M, about 11.25 M, about 11.5 M, or about 11.75 M. For example, the destabilizing agent can be present in the initial solution at a concentration of about 0.1M, about 0.25 M, about 0.5 M, about 0.75 M, about 1 M, about 1.25 M, about 1.5 M, about 1.75 M, about 2 M, about 2.25 M, about 2.5 M, about 2.75 M, about 2 M, about 3.25 M, about 3.5 M, about 3.75 M, about 4 M, about 4.25 M, about 4.5 M, about 4.75 M, about 5 M, about 5.25 M, about 5.5 M, about 5.75 M, about 6 M, about 6.25 M, about 6.5 M, about 6.75 M, about 7 M, about 7.25 M, about 7.5 M, about 7.75 M, or about 8 M.

[0074] When the destabilizing agent is a solvent, it can be present in the initial solution in an amount from about 5% to about 75% (v / v or w / v). For example, the initial solution comprises the destabilizing agent in an amount from about 10% to about 50% (v / v or w / v), e.g., from about 15% to about 45%. In some embodiments, the destabilizing agent can be present in the initial solution in an amount from about 20% to about 40% (v / v or w / v). For example, the initial solution comprises the destabilizing agent in an amount of about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, or about 70%.

[0075] In some embodiments, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of a double-stranded nucleic acid is at least about 5°C lower than a melting temperature of the same double-stranded nucleic acid in absence of the destabilizing agent (e.g., in water, a buffer (a phosphate-buffered saline) or the initial solution) under same conditions. For example, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of a double-stranded nucleic acid is at least about 5.5°C (e.g., about 6°C, about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C, about 10.5°C, about 11°C, about 11.5°C, about 12°C, about 12.5°C, about 13°C, about 13.5°C, about 14°C, about 14.5°C, about 15°C, about 15.5°C, about 16°C, about 16.5°C, about 17°C, about 17.5°C, about 18°C, about 18.5°C, about 19°C, about 19.5°C, about 20°C or more) lower than a melting temperature of the same doublestranded nucleic acid in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions.

[0076] In some embodiments, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the longer double-stranded or single-stranded oligonucleotides is at least about 5°C lower than a melting temperature of the longer double-stranded or single-stranded oligonucleotides in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions. For example, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the longer double-stranded or single-stranded oligonucleotides is at least about 5.5°C (e.g., about 6°C, about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C, about 10.5°C, about 11°C, about 11.5°C, about 12°C, about 12.5°C, about 13°C, about 13.5°C, about 14°C, about 14.5°C, about 15°C, about 15.5°C, about 16°C, about 16.5°C, about 17°C, about 17.5°C, about 18°C, about 18.5°C, about 19°C, about 19.5°C, about 20°C or more) lower than a melting temperature of the longer double-stranded or single-stranded oligonucleotides in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions.

[0077] In some embodiments, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments is at least about 5°C lower than a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions. For example, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments is at least about 5.5°C (e.g., about 6°C, about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C, about 10.5°C, about 11°C, about 11.5°C, about 12°C, about 12.5°C, about 13°C, about 13.5°C, about 14°C, about 14.5°C, about 15°C, about 15.5°C, about 16°C, about 16.5°C, about 17°C, about 17.5°C, about 18°C, about 18.5°C, about 19°C, about 19.5°C, about 20°C or more) lower than a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions.

[0078] In some embodiments, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments is at least about 5°C lower than a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions. For example, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments is at least about 6°C (e.g., about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C, about 10.5°C, about 11°C, about 11.5°C, about 12°C, about 12.5°C, about 13°C, about 13.5°C, about 14°C, about 14.5°C, about 15°C, about 15.5°C, about 16°C, about 16.5°C, about 17°C, about 17.5°C, about 18°C, about 18.5°C, about 19°C, about 19.5°C, about 20°C or more) lower than a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions.

[0079] In some embodiments, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments is at least about 2.5°C lower than a melting temperature of the longer doublestranded or single-stranded oligonucleotides in absence of the destabilizing agent (e.g., in water, a buffer, such as PBS, or the initial solution) under same conditions. For example, the initial solution comprises the destabilizing agent in an amount such that a melting temperature of the shorter complementary or partially complementary oligonucleotide fragments is at least about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, about 6°C, about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C, about 10.5°C, about 11°C, about 11.5°C, about 12°C, about 12.5°C, about 13°C, about 13.5°C, about 14°C, about 14.5°C, about 15°C, about 15.5°C, about 16°C, about 16.5°C, about 17°C, about 17.5°C, about 18°C, about 18.5°C, about 19°C, about 19.5°C, about 20°C or more) lower than a melting temperature of the longer double-stranded or singlestranded oligonucleotides under same conditions.

[0080] In some embodiments, initial solution comprises the destabilizing agent in a concentration from about 0.025 M to about 5 M. For example, the destabilizing agent is present in a concentration from about 0.03M to about 4M, or from about 0.04M to about 3M, or from about 0.05 to about 2, or from about 0.025 M to about 1.5M, or from about 0.1 M to about 1.5M, or from about 0.25 M to about 1.5M, or from about 0.5M to about 1.5M, or from about 0.75M to about 1.25M, or about 1.0 M) in the solution.

[0081] In some embodiments, the destabilizing agent is present in a concentration of at least about 0.025M. For example, the initial solution comprises the destabilizing agent in a concentration of at least about 0.05M, about 0.1M, about 0.125M, about 0.25M, about 0.5M, about 0.75M, about IM, about 1.25M, about 1.5M, about 1.75M, about 2M, about 2.25M, about 2.5M, about 2.75M, about 3M, about 3.25M, about 3.5M, about 3.75M, about 4M, about 4.25M, about 4.5M, about 4.75M, about 5M or more. Filtration

[0082] A variety of filtering architectures can be utilized, such as hollow fiber, spiral wound, and flat plate. Some exemplary filtration systems, methods, and parameters amenable to the method described herein are described, for example, in Ultrafiltration for Bioprocessing. Development and Implementation of Robust Processing (Herb Lutz, ed., Woodhead Publishing, Waltham, MA, 2015) content of which is incorporated by reference in its entirety.

[0083] A membrane / filter utilized in the method described herein can include a plurality of pores. Pores can have a regular, uniform shape such as a cylindrical or a rectangular profile, and the like, or can have an irregular profile. The pores can have a nanoscale and may not be capable of dimensional measurement. One of skill in the art is well aware that pore size determines the nominal molecular weight limits (NMWL), also referred to as the molecular weight cut off (MWCO) for a particular filter. Thus, the pore size can be measured based on filtration performance, e.g., based on what molecular weight particles will and / or will not pass through the filter.

[0084] The term “molecular weight cut-off” or “MWCO” refers to the lowest molecular weight (in Daltons) of a molecule in which at least 90% of the molecule is prevented from passing through the membrane / filter. Membranes / filters with a MWCO of between about 5 kDa to about 30 kDa, e.g., from about 5 kDa to about 25 kDa, or from about 5 kDa to about 20 kDa, or from about 5 kDa to about 15 kDa can be employed in the method described herein.

[0085] Generally, the shorter complementary or partially complementary oligonucleotide fragments are separated from the longer double-stranded or single-stranded oligonucleotides using a membrane with a molecular weight cut off of lower than a molecular weight of the longer doublestranded or single-stranded oligonucleotides. Accordingly, in some embodiments, the initial solution is filtered using a membrane having a MWCO of 10 kDa or lower. For example, the shorter complementary or partially complementary oligonucleotide fragments are separated from the longer double-stranded or single-stranded oligonucleotides using a membrane with a MWCO of from about 5 kDa to about 10 kDa. In some embodiments, the initial solution is filtered using a membrane having a MWCO of 20 kDa, e.g., 25 kDa, 30 kDa or higher. For example, the initial solution is filtered using a membrane having a MWCO of 30 kDa.

[0086] In some embodiments, the filtration is tangential flow filtration (TFF). Tangential flow filtration (also known as crossflow filtration) is a type of filtration wherein the material to be filtered is passed tangentially across a filter rather than through it. Generally, the filter is positioned laterally to the initial solution flow direction. In TFF, permeate passes through the filter, while the retentate passes along the filter. It is important to note that the desired material, e.g., the longer double-stranded or single-stranded oligonucleotides can be in the retentate or the permeate. Thus, either the retentate or the permeate is collected downstream depending on which one contains the desired product. In some embodiments, the desired product is contained in the retentate in TFF. In some other embodiments, the desired product is contained in the permeate in TFF. The principles, theory, and devices used for TFF are described, for example, in Michaels et al., “Tangential Flow Filtration” in Separations Technology, Pharmaceutical and Biotechnology Applications (W. P. Olson, ed., CRC Press, Boca Raton, FL, 2020), content of which is incorporated by reference in its entirety.

[0087] One or more filtration process, e.g., TFF process variables, such as temperature, transmembrane pressure, membrane loading, number of volumetric exchanges, flow rate of the initial solution, flow rate or flux of the permeate can be adjusted as needed.

[0088] The transmembrane pressure is the force that drives fluid through the filter, carrying with it permeable molecules, i.e., the pressure difference between initial and permeate streams. Generally, the transmembrane pressure is from about 0.5 to about 100 pounds per square inch (psi). For example, the TMP is from about 1 to about 90 psi, or from about 5 psi to about 75 psi, or from about 10 psi to about 50, of from about 5 psi to about 25 psi. In some embodiments, the TMP is about 5 psi, about 10 psi, about 15 psi, about 20 psi, about 25 psi, about 30 psi, about 35 psi, about 40 psi, about 45 psi, about 50 psi, about 55 psi, about 60 psi, about 65 psi, about 70 psi, about 75 psi, about 80 psi, about 85 psi, about 90 psi, about 95 psi, or about 100 psi. For example, the TMP is from about 0.01 to about 50 psi., e.g., from about 5 to 30 psi, or from about 15 to 25 psi.

[0089] It is noted that a filtration step can be carried out at a constant TMP or the TMP can be changed during the filtration process. Accordingly, in some embodiments, the filtration process is at a constant TMP. In some other embodiments, the method comprises increasing the TMP from a first TMP to a second TMP during a filtering step. The second TMP can be at least about lOpsi or higher than the first transmembrane pressure. For example, the second TMP can be about 10.5 psi, about 1 Ipsi, about 11.5psi, about 12psi, about 12.5psi, about 13psi, about 13.5psi, about 14psi, about 14.5psi, about 15psi, about 15.5psi, about 16psi, about 16.5psi, about 17psi, about 17.5psi, about 18psi, about 18.5psi, about 19psi, about 19.5psi, about 20psi, about 20.5 psi, about 2 Ipsi, about 21.5psi, about 22psi, about 22.5psi, about 23psi, about 23.5psi, about 24psi, about 24.5psi, about 25psi, about 25.5psi, about 26psi, about 26.5psi, about 27psi, about 27.5psi, about 28psi, about 28.5psi, about 29psi, about 29.5psi, about 30psi,about 30.5 psi, about 3 Ipsi, about 31.5psi, about 32psi, about 32.5psi, about 33psi, about 33.5psi, about 34psi, about 34.5psi, about 35psi, about 35.5psi, about 36psi, about 36.5psi, about 37psi, about 37.5psi, about 38psi, about 38.5psi, about 39psi, about 39.5psi, about 40psi or more higher than the first TMP.

[0090] In some other embodiments, the method comprises decreasing the TMP from a first TMP to a second TMP during a filtering step. The second TMP can be at least about lOpsi or lower than the first transmembrane pressure. For example, the second TMP can be about 10.5 psi, about 1 Ipsi, about 11.5psi, about 12psi, about 12.5psi, about 13psi, about 13.5psi, about 14psi, about 14.5psi, about 15psi, about 15.5psi, about 16psi, about 16.5psi, about 17psi, about 17.5psi, about 18psi, about 18.5psi, about 19psi, about 19.5psi, about 20psi, about 20.5 psi, about 21psi, about 21,5psi, about 22psi, about 22.5psi, about 23psi, about 23.5psi, about 24psi, about 24.5psi, about 25psi, about 25.5psi, about 26psi, about 26.5psi, about 27psi, about 27.5psi, about 28psi, about 28.5psi, about 29psi, about 29.5psi, about 30psi,about 30.5 psi, about 3 Ipsi, about 31.5psi, about 32psi, about 32.5psi, about 33psi, about 33.5psi, about 34psi, about 34.5psi, about 35psi, about 35.5psi, about 36psi, about 36.5psi, about 37psi, about 37.5psi, about 38psi, about 38.5psi, about 39psi, about 39.5psi, about 40psi or more lower than the first TMP.

[0091] When filtering is at two different TMPs, the transmembrane pressure can be changed in one step or over time. In some embodiments, the transmembrane pressure is changed over a period of time or number of volumetric exchanges. For example, the transmembrane pressure from a first transmembrane pressure to a second transmembrane pressure is changed over a period of at least about 30 mins, e.g., about 45 mins, about 1 hour, about 1.25 hours, about 1.5 hours, about 1.75 hours, about 2 hours, about 2.25 hours, about 2.5 hours, about 2.75 hours, about 3 hours, about 3.25 hours, about 3.5 hours, about 3.75 hours, about 4 hours, about 4.25 hours, about 4.5 hours, about 4.75 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours or longer. In some embodiments, when the transmembrane pressure is changed over the number of volumetric exchanges, the change can be over the course of 20 exchanges, or 10 exchanges, or 5 exchanges, or 5-20, or 5-10, or 10-20 exchanges. For example, change over the course of 5 exchange can mean that following 5 exchanges at a first pressure, the pressure is changed for the next set of exchanges.

[0092] A filtration step can be carried out an ambient temperature or a temperature higher or lower than the ambient temperature. Accordingly, in some embodiments, a filtering step can be carried out at an ambient temperature. For example, a filtration can be carried out at room temperature, such as a temperature from about 15°C to about 30°C. In some other embodiments, the step of filtering the initial solution is carried out an elevated temperature, e.g., a temperature higher than 30°C.

[0093] A filtration step can be carried out at a constant temperature, or the temperature can be changed during the filtration process. Accordingly, in some embodiments, the filtration process is at a constant temperature. For example, the filtration process is at an ambient temperature (e.g., from about 15°C to about 30°C, such as about 15°C, about 16°C, about 17°C, about 18°C, about 19°C, about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about, 28°C, about 29°C, or about 30°C, about. In another nonlimiting example, the filtration process is at an elevated temperature, e.g., at a temperature higher than 30°C. For example, the filtration step is at a temperate of about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, about 40°C, about 41°C, about 42°C, about 43°C, about 44°C, about 45°C, about 46°C, about 47°C, about 48°C, about 48°C, about 50°C, about 51°C, about 52°C, about 53°C, about 54°C, about 55°C, about 56°C, about 57°C, about 58°C, about 59°C, about 60°C, or higher. In some embodiments, the filtration step is at a temperature for about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, about 40°C, about 41°C, about 42°C, about 43°C, about 44°C, or about 45°C.

[0094] Generally, the filtering of the initial solution is at a temperature higher than the Tm of the shorter complementary or partially complementary oligonucleotides. On the other hand, the filtering temperature is lower than the Tm of the longer double-stranded or single-stranded oligonucleotides. Stated in another way, the filtering temperature is higher than the Tm of the shorter complementary or partially complementary oligonucleotides but lower than the Tm of the longer double-stranded or singlestranded oligonucleotides. For example, the filtering temperature is at least 2.5°C, e.g., about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, about 6°C, about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C or more higher than the Tm of the shorter complementary or partially complementary oligonucleotides, e.g., as measured in the initial solution. In some embodiments, the filtering temperature is at least 2.5°C, e.g., about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, about 6°C, about 6.5°C, about 7°C, about 7.5°C, about 8°C, about 8.5°C, about 9°C, about 9.5°C, about 10°C or more lower than the Tm of the longer double-stranded or single-stranded oligonucleotides, e.g., as measured in the initial solution.

[0095] For clarity, melting temperature of longer single-stranded oligonucleotides refers to the melting temperature of a double-stranded oligonucleotide formed when the longer single-stranded oligonucleotides are hybridized with a fully complementary strand or with a complementary strand that is shorter (e.g., by at least 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides) than the longer single-stranded oligonucleotide but longer (e.g., by at least 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides) than the shorter complementary or partially complementary oligonucleotides.

[0096] In some embodiments, the method comprises increasing the temperature from a first temperature to a second temperature during a filtering step. The second temperature can be at least about 5°C or higher than the first temperature. For example, the second temperature can be at least about 6°C, about 7°C, about 8°C, about 9°C, about 10°C, about 11 °C, about 12°C, about 13°C, about 14°C, about 15°C, about 16°C, about 17°C, about 18°C, about 19°C, about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, or higher than the first temperature.

[0097] In some other embodiments, the method comprises decreasing the temperature from a first temperature to a second temperature during a filtering step. The second temperature can be at least about 5°C or more lower than the first temperature. For example, the second temperature can be at least about 6°C, about 7°C, about 8°C, about 9°C, about 10°C, about 11 °C, about 12°C, about 13°C, about 14°C, about 15°C, about 16°C, about 17°C, about 18°C, about 19°C, about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, or more lower than the first temperature.

[0098] When filtering is at two different temperatures, the temperature can be changed in one step or over time. In some embodiments, the temperature is changed over a period of time. For example, the temperature from a first temperature to a second temperature is changed over a period of at least about 30 mins, e.g., about 45 mins, about 1 hour, about 1.25 hours, about 1.5 hours, about 1.75 hours, about 2 hours, about 2.25 hours, about 2.5 hours, about 2.75 hours, about 3 hours, about 3.25 hours, about 3.5 hours, about 3.75 hours, about 4 hours, about 4.25 hours, about 4.5 hours, about 4.75 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours or longer.

[0099] The initial rate (also known as the crossflow velocity) is the rate of the solution flow through the initial channel and across the filter. The initial rate determines the force that sweeps away molecules that may otherwise clog or foul the filter and thereby restrict filtrate flow. In some embodiments, the initial rate is between about 0.1 and about 200 L / minute / m2. For example, the initial rate is between about 0.5 and about 175 L / minute / m2, between about 1 and about 150 L / minute / m2, between about 1.5 and about 125 L / minute / m2, between about 2 and about 100 L / minute / m2, between about 2.5 and about 75 L / minute / m2, or between about 3 and about 50 L / minute / m2. In some embodiments, the filtration is performed at a initial rate of about 1 L / minute / m2, about 2 L / minute / m2, about 3 L / minute / m2, about 4 L / minute / m2, about 5 L / minute / m2, about 6 L / minute / m2, about 7 L / minute / m2, about 8 L / minute / m2, about 9 L / minute / m2, about 10 L / minute / m2, about 15 L / minute / m2, about 20 L / minute / m2, about 25 L / minute / m2, about 30 L / minute / m2, about 35 L / minute / m2, about 40 L / minute / m2, about 45 L / minute / m2, about 50 L / minute / m2, 55 about L / minute / m2, 60 about L / minute / m2, about 65 L / minute / m2, about 70 L / minute / m2, about 75 L / minute / m2, about 80 L / minute / m2, about 85 L / minute / m2, about 90 L / minute / m2, about 95 L / minute / m2, or about 100 L / minute / m2.

[00100] The flow rate of the permeate, i.e., the permeate flow rate is the rate at which the permeate is removed from the system. For a constant initial rate, increasing permeate flow rates can increase the pressure across the filter, leading to enhanced filtration rates while also potentially increasing the risk of filter clogging or fouling. In some embodiments, the permeate flow rate is between about 0.01 and about 100 L / minute / m2. For example, the permeate flow rate is between about 0.02 and about 75 L / minute / m2, between about 0.03 and about 50 L / minute / m2, between about 0.04 and about 25 L / minute / m2, between about 0.05 and about 20 L / minute / m2, between about 0.075 and about 75 L / minute / m2, or between about 0.1 and about 15 L / minute / m2.

[00101] Generally, the initial solution is filtered at a pH of from about 5 to 13, i.e., the initial solution has a pH of from about 5 to 13. In some embodiments, the initial solution has a pH from about 6 to 12. For example, the initial solution has a pH of about 5, about 5.25, about 5.5, about 5.75, about 6, about 6.25, about 6.5, about 6.75, about 7, about 7.25, about 7.5, about 7.75, about 8, about 8.25, about 8.5, about 8.75, about 9, about 9.25, about 9.5, about 9.75, about 10, about 10.25, about 10.5, about 10.75, about 11, about 11.25, about 11.5, about 11.75, about 12, about 12.25, about 12.5, about 12.75, or about 13. In some embodiments, the initial solution has a pH of from about 6 to about 12. For example, the initial solution has a pH of from about 10 to about 11.

[00102] Without wishing to be bound by a theory, pH influence of the stability of double-stranded oligonucleotides. Alkaline pHs promote duplex dissociation and therefore inhibit hybridization, i.e., high pH acts as a destabilizing agent. Thus, in some embodiments of any one of the aspects described herein, the initial solution is filtered under high pH, i.e., the initial solution has a pH higher than 7. For example, the initial solution has a pH about 7.5 or higher., e.g. a pH of from about 8 to about 13, from about 9 to about 12, or from about 10 to about 12.

[00103] In some embodiments, TFF is ultrafiltration. In some embodiments, TFF is diafiltration.

[00104] It is noted that filtration can be continuous filtration. As used herein, the term "continuous filtration" means that a specific amount or volume of solution to be filtered is continuously passed through the membrane filter before the filtered product is delivered to the next step.

[00105] In some embodiments, filtration can be batch filtration. As used herein, the term "batch filtration" means that a specific amount or volume of the solution to be filtered is passed through a membrane filter with one batch to achieve a filtration process before the filtered product is delivered to the next step.

[00106] In some embodiments, the filtering process is a dead-end filtration. In dead-end filtration, the pore-containing filter is at an end of a container and fluid is pressed against the filter, e.g., by gravity or other pressure source.

[00107] The method described herein can be implemented on industrial scale and can include system(s) adapted, configured, and / or programmed to periodically take steps to delay or prevent fouling of the membrane / filter. For example, the system can backwash the filter by periodically inverting the transmembrane pressure, providing alternating tangential flow, cleaning-in-place with detergents, reactive agents, and / or alkalis, and periodically closing or reducing flow from the permeate outlet. Postprocessing the purified product

[00108] The method can further comprise a step of removing the destabilizing agent from the purified product. This can be accomplished, for example, by buffer exchange. Thus, in some embodiments, the method further comprises a step of buffer exchange to remove the destabilizing agent from the purified product. Methods for performing a buffer exchange are well known in the art and available to one of skill in the art. Exemplary buffer exchange methods include, but are not limited to, dialysis, desalting column chromatography, and filtration (e.g., diafiltration and ultrafiltration).

[00109] It is noted that buffer exchange can be carried out at the same filtration as used for filtering the initial solution. For example, after separating the shorter complementary or partially complementary oligonucleotides from the longer double-stranded or single-stranded oligonucleotide, the initial solution can be replaced with a buffer lacking the destabilizing agent. Thus, in some embodiments, the method further comprises, prior to flushing the purified product from the filter, a step of buffer exchange to remove the destabilizing agent.

[00110] In some embodiments, the method comprises flushing the retentate from the filter to obtain a solution comprising the purified longer double-stranded or single-stranded oligonucleotide product and performing a buffer exchange with the solution comprising the purified product. In some other embodiments, the method comprises flushing the permeate from the filter to obtain a solution comprising purified longer double-stranded or single-stranded oligonucleotide product and performing a buffer exchange with the solution comprising the purified product.

[00111] In some embodiments, the step of buffer exchange comprises TFF. For example, the step of buffer exchange is by diafiltration. In another non-limiting example, the step of buffer exchange is by ultrafiltration.

[00112] In some embodiments, the method comprises a step of concentrating or lyophilizing the purified product. Methods for concentrating or lyophilizing are well known in the art and available to one of skill in the art. Preprocessing the initial solution

[00113] In some embodiments, the initial solution comprises or is a reaction mixture from a ligation reaction to prepare the longer the longer double-stranded or single-stranded oligonucleotides, and the method comprises a step of removing one or more ligation reagents / components present in the reaction mixture prior to the step of filtering the solution. For example, the reaction mixture can be filtered to remove one or more ligation reagents / components present in the reaction mixture to obtain the initial solution prior to filtration. Stated in another way, the method comprises filtering a reaction mixture to obtain the initial solution, and then filtering the initial solution to obtain the longer double-stranded or single-stranded oligonucleotide product. It is noted that the initial solution can be a permeate or retentate from the filtering of the reaction mixture. In some embodiments, the initial solution is a permeate from the filtering of the reaction mixture.

[00114] In some embodiments, the step of filtering the reaction mixture comprises TFF. For example, the step of filtering the reaction mixture comprises diafiltration.

[00115] It is noted that the reaction mixture can be filtered at a constant a transmembrane pressure or the TMP can be changed during the filtering step. In some embodiments, the step of filtering the reaction mixture is at a constant TMP. In some other embodiments, the step of filtering the reaction mixture comprises filtering the reaction mixture at a first transmembrane pressure followed by at a second transmembrane pressure. For example, the method comprises, filtering the reaction mixture at a first transmembrane pressure followed by at a second transmembrane pressure, and wherein the second transmembrane pressure is higher than the first transmembrane pressure, and In some embodiments, the second TMP is at least about lOpsi (e.g., about 10.5 psi, about 1 Ipsi, about 11.5psi, about 12psi, about 12.5psi, about 13psi, about 13.5psi, about 14psi, about 14.5psi, about 15psi, about 15.5psi, about 16psi, about 16.5psi, about 17psi, about 17.5psi, about 18psi, about 18.5psi, about 19psi, about 19.5psi, about 20psi, about 20.5 psi, about 2 Ipsi, about 21,5psi, about 22psi, about 22.5psi, about 23psi, about 23.5psi, about 24psi, about 24.5psi, about 25psi, about 25.5psi, about 26psi, about 26.5psi, about 27psi, about 27.5psi, about 28psi, about 28.5psi, about 29psi, about 29.5psi, about 30psi,about 30.5 psi, about 3 Ipsi, about 31.5psi, about 32psi, about 32.5psi, about 33psi, about 33.5psi, about 34psi, about 34.5psi, about 35psi, about 35.5psi, about 36psi, about 36.5psi, about 37psi, about 37.5psi, about 38psi, about 38.5psi, about 39psi, about 39.5psi, about 40psi or more) higher than the first transmembrane pressure. It is noted the transmembrane pressure can be changed in one step or over time. In some embodiments, the transmembrane pressure is changed over a period of time. For example, the transmembrane pressure is increased from the first transmembrane pressure to the second transmembrane pressure over a period of at least about 30 mins, e.g., about 45 mins, about 1 hour, about 1.25 hours, about 1.5 hours, about 1.75 hours, about 2 hours, about 2.25 hours, about 2.5 hours, about 2.75 hours, about 3 hours, about 3.25 hours, about 3.5 hours, about 3.75 hours, about 4 hours, about 4.25 hours, about 4.5 hours, about 4.75 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours or longer.

[00116] The reaction mixture can be filtered at a constant temperature, or the temperature can be changed during the filtering step. In some embodiments, the step of filtering the reaction mixture is at a constant temperature. For example, the step of filtering the reaction mixture is at an ambient temperature (e.g., from about 15°C to about 30°C, such as about 15°C, about 16°C, about 17°C, about 18°C, about 19°C, about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about, 28°C, about 29°C, or about 30°C, about. In some embodiments, the step of filtering the reaction mixture is at an elevated temperature, e.g., at a temperature higher than 30°C. For example, the reaction mixture is filtered at a temperate of about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, about 40°C, about 41°C, about 42°C, about 43°C, about 44°C, about 45°C, about 46°C, about 47°C, about 48°C, about 48°C, about 50°C, about 51°C, about 52°C, about 53°C, about 54°C, about 55°C, about 56°C, about 57°C, about 58°C, about 59°C, about 60°C, or higher. In some embodiments, the step of filtering the reaction mixture is at a temperature for about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, about 40°C, about 41°C, about 42°C, about 43°C, about 44°C, or about 43°C, about 44°C.

[00117] In some embodiments, said step of filtering the reaction mixture comprises ultrafiltering the reaction mixture at a first temperature followed by at a second temperature. For example, the step of filtering the reaction mixture comprises ultrafiltering the reaction mixture at a first temperature followed by at a second temperature, wherein the second temperature is higher than the first temperature. Generally, the the second temperature is at least about 5°C (e.g., about 6°C, about 7°C, about 8°C, about 9°C, about10°C,about 11 °C, about12°C, about13°C, about14°C, about15°C,about 16°C, about 17°C, about 18°C, about 19°C, about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, or more) higher than the first temperature. It is noted the temperature can be changed in one step or over time. In some embodiments, the temperature is changed over a period of time. For example, the temperature is increased from the first temperature to the second temperature over a period of at least about 30 mins, e.g., about 45 mins, about 1 hour, about 1.25 hours, about 1.5 hours, about 1.75 hours, about 2 hours, about 2.25 hours, about 2.5 hours, about 2.75 hours, about 3 hours, about 3.25 hours, about 3.5 hours, about 3.75 hours, about 4 hours, about 4.25 hours, about 4.5 hours, about 4.75 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours or longer.

[00118] Generally, the reaction mixture comprises the longer double-stranded or single-stranded oligonucleotides and the reaction mixture is filtered through a filter / membrane having a MWCO higher than the mw of the longer double-stranded or single-stranded oligonucleotides. For example, the reaction mixture is filtered through a filter / membrane having a MWCO of 30kDa. Nucleic acids

[00119] Embodiments of the various aspects described herein include double-stranded oligonucleotides, also referred to as double-stranded nucleic acids or dsNA herein. Generally, the dsNA comprises a first oligonucleotide strand and a second oligonucleotide strand, substantially complementary to the first strand. As used herein, the term "oligonucleotide", means a polymer of nucleotide residues, which can be deoxyribonucleotides (wherein the resulting oligonucleotide is DNA), ribonucleotides (wherein the resulting oligonucleotide is RNA), modified nucleotides, or a mixture thereof.

[00120] As used herein, the term “substantially complementary”, with respect to a nucleotide sequence in relation to a reference nucleotide sequence means a nucleotide sequence having a percentage of identity between the substantially complementary nucleotide sequence and the exact complementary sequence of said reference of at least at least 80%. e.g., at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% (i.e., exactly complementary). Preferably identity is assessed over a length of at least 15, e.g., at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides.

[00121] The skilled person is well aware that double-stranded RNAs comprising a duplex structure of between 19 and 24, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA interference (RNAi). However, others have found that shorter or longer double-stranded oligonucleotides can be effective as well. Accordingly, in some embodiments, a longer double-stranded oligonucleotide described herein is capable of inducing RNA interference. Stated another way, the longer double-stranded oligonucleotides comprising a duplex structure of between 19 and 24, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA interference described herein can mediate RNA interference. As used herein, the phrase “mediates RNAi” refers to the ability to inhibit or reduce the expression of a target nucleic acid, e.g., a target RNA such as a mRNA in a sequence specific manner.

[00122] In some embodiments, the dsNA comprises a sense strand (also referred to as passenger strand herein) and an antisense strand (also referred to as guide strand herein). Stated another way, one strand of the dsNA is a sense strand and the other strand of the dsNA is an antisense strand.

[00123] As used herein, the term “antisense strand” refers to a polynucleotide that is substantially or 100% (e.g., exactly) complementary to a target nucleic acid of interest. An antisense strand may comprise a polynucleotide that is RNA, DNA or chimeric RNA / DNA. For example, an antisense strand can be complementary, in whole or in part, to target nucleic acid of interest, such as a messenger RNA, an RNA sequence that is not mRNA (e.g., microRNA, piwiRNA, tRNA, rRNA and hnRNA) or a sequence of DNA that is either coding or non-coding.

[00124] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[00125] Each strand of the dsNA independently can range from 15-30, e.g., 17-25 nucleotides in length. For example, each strand of the dsNA independently can be between 17-24 nucleotides in length, 17-23 nucleotides in length, between 17-22 nucleotides in length, 17-21 nucleotides in length, between 17-20 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. In some embodiments, each strand is independently

[00126] For example, each of the first and second strand is independently 15,16,17,28,19,20,21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. For, example, each of the first and second strand is independently 18,19,21,22,23,24, or 25 nucleotides in length. In some embodiments, each strand is independently 19, 20, 21, 22 or 23 nucleotides in length. In some embodiments, one strand (e.g., the sense strand) is 18, 19, 20, 21 or 22 nucleotides in length and the other strand (e.g., the antisense strand) is 21,22,23,24 or 25 nucleotides in length.

[00127] The two strands of the dsNA molecule are complementary to each other and can hybridize to each other to form a double-stranded or duplex region. Accordingly, the dsNA molecule has a doublestranded or duplex region. The duplex region (double-stranded region) can be 17-25 nucleotide base pairs in length. For example, the dsNA can have a duplex region of 17-24 nucleotide pairs in length. In some embodiments, the dsNA has a duplex region of 18, 19,20,21,22,22,23,24, or 25 nucleotide base pairs in length. In some embodiments, the dsNA has a duplex region of 19,20,21 or 22 nucleotide base pairs in length.

[00128] The dsNA molecule can have one or more overhang regions (i.e., single-stranded region) and / or capping groups of dsNA molecule at the 3’-end, or 5’-end or both ends of a strand. Without limitations, the overhang can be 1-3 nucleotides, e.g., 1, 2 or 3 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the sequence being targeted or it can be complementary to the sequence being targeted or can be other sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers. Without limitations the overhang can be present at the 3’-end of only one of the strands or both strands.

[00129] In some embodiments, the dsNA molecule comprises a single overhang. For example, the dsNA molecule has a single overhang and the overhang is no more than one, two or three nucleotides in length. Preferably, the overhang is no more than 2 nucleotides in length. In some embodiments, the overhang is present at the 3’-end of a strand (e.g., the antisense strand). In some embodiments, the dsRA comprises a two-nucleotide overhang at the 3’-end of a strand (e.g., the antisense strand). For example, the overhang is present at the 3’-end of the antisense strand. For example, the antisense comprises a 1 or 2 nucleotide overhang at its 3’-end.

[00130] The dsNA can also have a blunt end. For example, one end of the dsNA is a blunt end and the other end has an overhang. Without limitations, the blunt end can be located at the 5’-end of the antisense strand (or the 3’-end of the sense strand) or vice versa. Generally, the antisense strand of the dsNA has a nucleotide overhang at the 3’-end, and the 5’-end is blunt. While not bound by theory, the asymmetric blunt end at the 5’-end of the antisense strand and 3’-end overhang of the antisense strand favor the guide strand loading into RISC process. In some embodiments, the dsNA has a 2-nucleotide overhang on the 3’-end of the antisense strand and a blunt end at the 5’-end of the antisense strand.

[00131] In some other embodiments, the dsNA molecule has two blunt ends, i.e., at both ends of the dsNA. For example, the two strands of the dsNA are of the same length.

[00132] In some embodiments, the antisense strand is of length 18 to 25 nucleotides. In some embodiments, the antisense strand is 21-25, 19-25, 19-21 or 21-23 nucleotides in length. In some particular embodiments, the antisense strand is 23 nucleotides in length.

[00133] Similar to the antisense strand, the sense strand can be, in some embodiments, 18-25 nucleotides in length. In some embodiments, the sense strand is 21-25, 19-25, 19-21 or 21-23 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length.

[00134] In some embodiments, sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length. Longer double-stranded oligonucleotides

[00135] Embodiments of the various aspects described herein include longer double-stranded oligonucleotides. The longer double-stranded oligonucleotides are also referred to as longer dsNA (longer-dsNA) herein. In the longer-dsNA molecules, the two strands of the dsNA can be of equal length or unequal length. When the strands are of unequal lengths, one strand can be longer than the other strand by 1,2, 3, 4, or 5 nucleotides. Stated another way, when the strands of a longer-dsNA are of unequal length, their lengths differ by no more than 1,2,3,4 or 5 nucleotides. Preferably, the lengths of the strands of a longer-dsNA differ by no more than 1, 2, or 3 nucleotides. In some embodiments, the lengths of two strands of a longer-dsNA differ by no more than 1 or 2 nucleotides. In some embodiments, the antisense strand is longer, e.g., by 1 or 2 nucleotides than the sense strand.

[00136] The longer-dsNA molecule can have two blunt ends; a blunt end at one end and an overhang at the end, where the overhang is 1,2 or 3 nucleotides in length; or an overhang at each end, where each overhang is independently 1, 2 or 3 nucleotides in length. Accordingly, in some embodiments of any one of the aspects described herein, the longer-dsNA comprises a blunt end at one end and a 1, 2 or 3 nucleotide overhang at the other end. For example, the longer-dsNA a blunt end at 5’-end of the antisense strand and a 1, 2 or 3, preferably 1 or 2, nucleotide overhang at the 3’-end of the antisense strand.

[00137] In some embodiments, at least one strand (e.g., only one strand or both strands) of longer-dsNA is at least 3 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotides. For example, one or both strands of the longer-dsNA independently are 4, 5, 6, 7, 8, 9, 10 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotides. In some embodiments, the sense strand is at least 3 (e.g., 4, 5, 6, 7, 8, 9, 10 or more) nucleotides longer than the shorter complementary or partially complementary oligonucleotides. In some embodiments, the antisense strand is at least 3 (e.g., 4, 5, 6, 7, 8, 9, 10 or more) nucleotides longer than the shorter complementary or partially complementary oligonucleotides. In some embodiments, both the sense and antisense strand are independently at least 3 (e.g., 4, 5, 6, 7, 8, 9, 10 or more) nucleotides longer than the shorter complementary or partially complementary oligonucleotides. Longer single-stranded oligonucleotides

[00138] Embodiments of the various aspects described herein include longer single-stranded oligonucleotides, also referred to as longer single-stranded nucleic acids or longer-ssNA herein. The longer single-stranded oligonucleotides can be from about 15 to about 200 nucleotides in length. For example, the longer single-stranded oligonucleotides can be from about 15 to about 50 nucleotides in length. In some embodiments, longer single-stranded oligonucleotides are 15, 16, 17, 28, 19, 20,21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, the longer single-stranded oligonucleotides are 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. For example, single-stranded oligonucleotides are 19,20,21,22 or 23 nucleotides in length.

[00139] Generally, the longer single-stranded oligonucleotides are at least 3 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotide fragments. For example, the longer single-stranded oligonucleotides are 4, 5, 6, 7, 8, 9,10 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotide fragments. In some embodiments, the longer single-stranded oligonucleotides are 11, 12, 13, 14, 15 or more nucleotides longer than the shorter complementary or partially complementary oligonucleotide fragments. Shorter complementary or partially complementary oligonucleotides

[00140] Embodiments of the various aspects described herein include shorter complementary or partially complementary oligonucleotides. The shorter complementary or partially complementary oligonucleotides can be single-stranded or double-stranded. When the shorter complementary or partially complementary oligonucleotides are double-stranded, they are also referred to as shorter dsNA (shorter-dsNA).

[00141] In the shorter-dsNA molecules, the dsNA molecule comprises at least one overhang of at least 3, e.g., 4, 5, 6, 7 or more) nucleotides. The overhang can be at the 3’-end or the 5’-end of the longer strand. In some embodiments, the shorter-dsNA comprises an overhang at each end, where each overhang is independently at least 3, e.g., 4, 5, 6, 7 or more) nucleotides in length.

[00142] In some embodiments, the shorter-dsRNA comprises a first strand that is the same, e.g., same length as a strand of the longer dsNA and a second strand that is at least 3, e.g., 4, 5,6,7 or more) nucleotides shorter than the first strand. For example, the shorter-dsNA comprises a first strand that is the same as a strand of the longer-dsNA and a second strand is at least 3, e.g., 4, 5, 6, 7 or more) nucleotides shorter than the other strand of the longer-dsNA.

[00143] It is noted that at least one of the first or second strand of the shorter-dsNA is least 3, e.g., 4, 5, 6,7, 8,9,10 or more nucleotides shorter than at least one strand and / or both strands of the longer-dsNA. For example, at least one of the first or second strand of the shorter-dsNA is at least 4, 5, 6,7, 8 or more nucleotides shorter than one or both strands of the longer-dsNA.

[00144] In some embodiments, the longer-dsNA comprises at least 2 or more nucleotide base-pairs compared to a shorter-dsNA. For example, the longer-dsNA comprises 3, 4, 5, 6, 7, 8, 9 10 or more nucleotide base-pairs compared to a shorter-dsNA. In some embodiments, the longer-dsNA comprises 3,4, 5, 6, or 7 more nucleotide base-pairs compared to a shorter-dsNA.

[00145] Without wishing to be bound by a theory, shorter-dsNA molecules have a lower melting temperature compared to the longer-dsNA when measured under same conditions. Accordingly, in some embodiments, the shorter-dsNA has a melting temperature that is at least 4°C lower than the melting temperature of the longer-dsNA under the same conditions. For example, the shorter-dsNA has a melting temperature that is at least 5°C, 6°C, 7°C, 8°C, 9°C, 10°C or more lower than the melting temperature of the longer-dsNA under the same conditions.

[00146] The molecular weight of the shorter-dsNA is lower than the mw of the longer-dsNA. For example, the shorter-dsNA has a molecular weight that is at least 900 Da lower than the mw of the longer-dsNA. In some embodiments, the mw of the longer-dsNAis at least 1,200 Da, 1,500 Da, 1,800 Da, 2,100 Da or more higher than the mw of a shorter-dsNA. Nucleic acid modifications

[00147] The longer double-stranded and single-stranded oligonucleotides described herein can comprise one or more nucleic acid modifications. Exemplary nucleic acid modifications include, but are not limited to, nucleobase modifications, sugar modifications, inter-sugar linkage modifications, conjugates (e.g., ligands), and any combinations thereof. It is noted that a nucleic acid modifications) can be present in any position of longer double-stranded and single-stranded oligonucleotides. Further, when the modified molecule is a dsNA, a nucleic acid modification(s) can be present in only one strand or both strands of a dsNA. In some embodiments, only the antisense strand comprises at least one, e.g., two, three, four, five or more nucleic acid modifications. In some embodiments, only the sense strand comprises at least one, e.g., two, three, four, five or more nucleic acid modifications. In some embodiments, both strands independently comprise at least one, e.g., two, three, four, five or more nucleic acid modifications.

[00148] Embodiments of the various aspects described herein recite specific position(s) on a strand, counting from an end of a strand. When the strand is single stranded, e.g., a longer-stranded oligonucleotide, the counting of the position is from the first nucleotide at the specified end. When the strand is part of a double-stranded molecule, e.g., a longer double-stranded oligonucleotide, the counting of the position can be from the first nucleotide at the specified end of the strand, or the first base-paired nucleotide in the strand at the specified end. Preferably, counting of the position is from the first nucleotide at the specified end of the strand. Thermally destabilizing modifications

[00149] In some embodiments of any one of the aspects described herein, longer double-stranded and single-stranded oligonucleotides described herein comprise a thermally destabilizing modification. By a “thermally destabilizing modification” is meant modification that result in a dsNA having a lower overall melting temperature (Tm), preferably a Tm with one, two, three or four degrees lower, than the Tm of the dsNA without having such a modification. Exemplary thermally destabilizing modifications are described herein below, and can include, but are not limited to, abasic modifications; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2’-deoxy (i.e., 2’-H) modification, acyclic nucleotide (e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA)), threose nucleic acid (TNA), a nucleotide linked by through its 2’-position (i.e., by its 2’-OH group to 5’-position of the subsequent nucleotide (a 2’-5’ RNA modification)); a Hyp-spacer modification; modified intemucleotide linkages that decrease the thermal stability of dsNA duplexes; or nucleobases with impaired W-C H-bonding to complementary base on the opposite strand.

[00150] In some embodiments, the longer-dsNA and / or the longer-ssNA comprises at least one, e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more independently selected thermally destabilizing modifications. The thermally destabilizing modification can be present at any position of the longer-dsNA or longer-ssNA. Further, the thermally destabilizing modifications all can be present in one strand or both strands of the dsNA. In some embodiments, only the antisense strand comprises at least one, e.g., two, three, four or more thermally destabilizing modifications. In some embodiments, only the sense strand comprises at least one, e.g., two, three, four or more thermally destabilizing modifications. In some embodiments, both the sense and the antisense strands comprise at least one, e.g., two, three, four or more thermally destabilizing modifications.

[00151] The thermally destabilizing modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the thermally destabilizing modification can occur on every nucleotide on the sense strand and / or antisense strand; each thermally destabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand and antisense strand both comprise thermally destabilizing modifications in an alternating pattern. The alternating pattern of the thermally destabilizing modifications on the sense strand can be the same or different from the antisense strand, and the alternating pattern of the thermally destabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the thermally destabilizing modifications on the antisense strand.

[00152] In some embodiments, thermally destabilizing modification is located at position 2,3,4, 5, 6, 7, 8 or 9, or preferably at position 4, 5, 6, 7, or 8, counting from the 5’-end of the antisense strand. In some embodiments, the thermally destabilizing modification is located at position 2,3,4,5 or 9 from the 5’-end of the antisense strand. In some other embodiments, the thermally destabilizing modification is located at position 6,7 or 8 from the 5’-end of the antisense strand. In some particular embodiments, the thermally destabilizing modification is located at position 7 from the 5’-end of the antisense strand.

[00153] In some embodiments, only the antisense strand comprises a thermally destabilizing modification. For example, only the antisense strand comprises a thermally destabilizing modification and said thermally destabilizing modification is located at position 4, 5, 6, 7, or 8, counting from the 5’-end of the antisense strand, preferably the thermally destabilizing modification is located at position 5, 6, 7, or 8; more preferably the thermally destabilizing modification is located at position 6, 7, or 8. In some embodiments, only the antisense strand comprises a thermally destabilizing modification and the thermally destabilizing modification is located at position 7 of the antisense strand, counting from the 5’-end of the antisense strand.

[00154] Similar to the antisense strand, a thermally destabilizing modification can be located at one of position 2, 3, 4, 5, 6, 7, 8 or 9, or preferably at position 4, 5, 6, 7, or 8, counting from the 5’-end of the longer-ssNA. In some embodiments, the thermally destabilizing modification is located at position 2, 3, 4, 5 or 9 from the 5’-end of the longer-ssNA. In some other embodiments, the thermally destabilizing modification is located at position 6, 7 or 8 from the 5’-end of the longer-ssNA. In some particular embodiments, the thermally destabilizing modification is located at position 7 from the 5’-end of the longer-ssNA. Thermally stabilizing modifications

[00155] In some embodiments, longer double-stranded and single-stranded oligonucleotides described herein can comprise a thermally destabilizing modification. By a “thermally stabilizing modification” is meant modification that result in a dsNA having a higher overall melting temperature (Tm), preferably a Tm with one, two, three or four degrees higher, than the Tm of the dsNA without having such a modification. Exemplary thermally destabilizing modifications are described herein below, and can include, but are not limited to, 2’-fluoro nucleotides (2’-F modifications), bridged nucleic acid (BNA), e.g., locked nucleic acid (LNA), and cyclohexene nucleic acid (CeNA). In some preferred embodiments, the thermally stabilizing modification is a 2’-fluoro nucleotide. Exemplary, thermally stabilizing modification are described herein below. Additional exemplary abasic nucleotides, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications are described in detail in WO 2011 / 133876 and WO2019222479, contents of both of which are incorporated herein by reference in their entireties.

[00156] In some embodiments, longer double-stranded and single-stranded oligonucleotides described herein can comprise at least two, e.g., three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or more the thermally stabilizing (e.g., 2’-F) modifications. Without limitations, the thermally stabilizing (e.g., 2’-F) modifications all can be present in one strand or both strands of a dsNA. In some embodiments, the sense strand comprises at least one, e.g., two, three, four or more thermally stabilizing (e.g., 2’-F) modifications. In some embodiments, the antisense strand comprises at least one, e.g., two, three, four or more thermally stabilizing (e.g., 2’-F) modifications. In some embodiments, both the sense and the antisense strands comprise at least one, e.g., two, three, four or more thermally stabilizing (e.g., 2’-F) modifications. The thermally stabilizing (e.g., 2’-F) modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the thermally stabilizing (e.g., 2’-F) modification can occur on every nucleotide on the sense strand and / or antisense strand; each thermally stabilizing (e.g., 2’-F) modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand and antisense strand both comprise thermally stabilizing (e.g., 2’-F) modifications in an alternating pattern. The alternating pattern of the thermally stabilizing (e.g., 2’-F) modifications on the sense strand can be the same or different from the antisense strand, and the alternating pattern of the thermally stabilizing (e.g., 2’-F) modifications on the sense strand can have a shift relative to the alternating pattern of the thermally stabilizing (e.g., 2’-F) modifications on the antisense strand.

[00157] In some embodiments, the sense strand of the longer-dsNA comprises at least one, e.g., two, three, four, five, six, seven, eight, nine, ten or more thermally stabilizing (e.g., 2’-F) modifications. In some embodiments, the sense strand comprises two, three, four, or five thermally stabilizing (e.g., 2’-F) modifications. For example, the sense strand comprises three or four thermally stabilizing (e.g., 2’-F) modifications. Without limitations, a thermally stabilizing (e.g., 2’-F) modification in the sense strand can be present at any positions. In some embodiments, the sense strand comprises at least three thermally stabilizing (e.g., 2’-F) modifications. For example, the sense comprises thermally stabilizing (e.g., 2’-F) modification at least at positions 7,10 and 11, counting from the 5’-end of the sense strand. In some other embodiments, the sense strand comprises at least four thermally stabilizing (e.g., 2’-F) modifications. For example, the sense comprises thermally stabilizing (e.g., 2’-F) modification at least at positions 7, 9,10 and 11, counting from the 5’-end of the sense strand.

[00158] In some embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at positions opposite or complimentary to positions 11,12 and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some other embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at positions opposite or complimentary to positions 11,12,13 and 15 of the antisense strand, counting from the 5 ’ -end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four thermally stabilizing (e.g., 2’-F) modification.

[00159] In some embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 7, 9, and 11, counting from the 5’-end of the sense strand, and the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,14 and 16, counting from the 5’-end of the antisense strand. In some other embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 7, 9, and 11 from the 5’-end, counting from the 5’-end of the sense strand, and the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,6, 9,14 and 16, counting from the 5’-end of the antisense strand. In yet some other embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 7,9, and 11, counting from the 5’-end of the sense strand, and the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 6, 8, 9, 14 and 16, counting from the 5’-end of the antisense strand.

[00160] In some embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 7,9,10, and 11, counting from the 5’-end of the sense strand, and the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,14 and 16, counting from the 5’-end of the antisense strand. In some other embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 7, 9,10, and 11, counting from the 5’-end of the sense strand, and the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,6,9,14 and 16, counting from the 5 ’ -end of the antisense strand. In yet some other embodiments, the sense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 7,9,10, and 11, counting from the 5’-end of the sense strand, and the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 6, 8, 9, 14 and 16, counting from the 5’-end of the antisense strand.

[00161] In some embodiments, the sense strand does not comprise a thermally stabilizing (e.g., 2’-F) modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

[00162] The antisense strand of the dsNA molecule can comprise at least one, e.g., two, three, four, five, six, seven, eight, nine, ten or more thermally stabilizing (e.g., 2’-F) modifications. In some embodiments, the antisense strand comprises two, three, four, five or six thermally stabilizing (e.g., 2’-F) modifications. Without limitations, a thermally stabilizing (e.g., 2’-F) modification in the antisense strand can be present at any position. In some embodiments, the antisense strand comprises at least three thermally stabilizing (e.g., 2’-F) modifications. For example, the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 14 and 16, counting from the 5’-end of the antisense strand. In some other embodiments, the antisense comprises at least four thermally stabilizing (e.g., 2’-F) modifications. For example, the antisense comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,6,14 and 16, counting from the 5’-end of the antisense strand. In some further embodiments, the antisense strand comprises at least five thermally stabilizing (e.g., 2’-F) modifications. For example, the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 6, 9, 14 and 16, counting from the 5’-end of the antisense strand. In still some further embodiments, the antisense strand comprises at least six thermally stabilizing (e.g., 2’-F) modifications. For example, the antisense strand comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,6, 8,9,14 and 16, counting from the 5’-end of the antisense strand.

[00163] In some embodiments, the antisense strand comprises at least one thermally stabilizing (e.g., 2’-F) modification adjacent to a stabilizing destabilizing modification. For example, the thermally stabilizing (e.g., 2’-F) modification can be the nucleotide at the 5’-end or the 3’-end of the thermally destabilizing modification, i.e., at position -1 or +1 from the position of the thermally destabilizing modification. In some embodiments, the antisense strand comprises a thermally stabilizing (e.g., 2’-F) modification at each of the 5’-end and the 3’-end of the thermally destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification.

[00164] In some embodiments, the antisense strand comprises at least two stabilizing modifications at the 3’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.

[00165] In some embodiments, the sense strand does not comprise a thermally stabilizing (e.g., 2’-F) modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

[00166] In some embodiments, the longer-ssNA comprises at least one, e.g., two, three, four, five, six, seven, eight, nine, ten or more thermally stabilizing (e.g., 2’-F) modifications. In some embodiments, the longer-ssNA comprises two, three, four, or five thermally stabilizing (e.g., 2’-F) modifications. For example, the longer-ssNA comprises three or four thermally stabilizing (e.g., 2’-F) modifications. Without limitations, a thermally stabilizing (e.g., 2’-F) modification in the longer-ssNA can be present at any positions. In some embodiments, the longer-ssNA comprises at least three thermally stabilizing (e.g., 2’-F) modifications. For example, the longer-ssNA thermally stabilizing (e.g., 2’-F) modification at least at positions 7,10 and 11, counting from the 5’-endof the longer-ssNA. In another non-limiting example, the longer-ssNA comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2,14 and 16, counting from the 5’-end of longer-ssNA.

[00167] In some other embodiments, the longer-ssNA comprises at least four thermally stabilizing (e.g., 2’-F) modifications. For example, the longer-ssNA comprises thermally stabilizing (e.g., 2’-F) modification at least at positions 7, 9, 10 and 11, counting from the 5’-end of the longer-ssNA. In another non-limiting example, the longer-ssNA comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 6, 14 and 16, counting from the 5’-end of

[00168] In some further embodiments, the longer-ssNA comprises at least five thermally stabilizing (e.g., 2’-F) modifications. For example, the longer-ssNA comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 6, 9, 14 and 16, counting from the 5’-end of the longer-ssNA. In still some further embodiments, the longer-ssNA comprises at least six thermally stabilizing (e.g., 2’-F) modifications. For example, the longer-ssNA comprises thermally stabilizing (e.g., 2’-F) modifications at least at positions 2, 6, 8, 9,14 and 16, counting from the 5’-end of the longer-ssNA.

[00169] In some embodiments, the longer-ssNA comprises at least one thermally stabilizing (e.g., 2’-F) modification adjacent to a thermally destabilizing modification. For example, the thermally stabilizing (e.g., 2’-F) modification can be the nucleotide at the 5’-end or the 3’-end of the stabilizing destabilizing modification, i.e., at position -1 or +1 from the position of the stabilizing destabilizing modification. In some embodiments, the longer-ssNA comprises a thermally stabilizing (e.g., 2’-F) modification at each of the 5’-end and the 3’-end of the thermally destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification. In some embodiments, the longer-ssNA comprises at least two stabilizing modifications at the 3’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification. 2’-OMe nucleotides

[00170] In some embodiments, the longer double-stranded and single-stranded oligonucleotides described herein can comprise at least one, e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more 2’-OMe nucleotides. Without limitations, the 2’-OMe nucleotides all can be present in one strand or both strands of a dsNA. In some embodiments, both the sense and the antisense strands comprise at least one 2’-OMe nucleotide. The 2’-OMe modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the 2’-OMe modification can occur on every nucleotide on the sense strand and / or antisense strand; each 2’-OMe modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand and antisense strand both comprise 2’-OMe modifications in an alternating pattern. The alternating pattern of the 2’-OMe modifications on the sense strand can be the same or different from the antisense strand, and the alternating pattern of the 2’-OMe modifications on the sense strand can have a shift relative to the alternating pattern of the 2’-OMe modifications on the antisense strand.

[00171] The antisense strand of the dsNA molecule can comprise at least one, e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen or more 2’-OMe modifications. Without limitations, a 2’-OMe modification in the antisense strand can be present at any position. In some embodiments, each nucleotide, except for any other specified modification (e.g., thermally destabilizing modification(s), thermally stabilizing modification(s), and / or 2’-deoxy (2’-H) modification(s)) of the antisense strand is independently a 2’-O-methyl nucleotide.

[00172] Like the antisense strand, the sense strand of the dsNA molecule can comprise at least one, e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or more 2’-OMe modifications. Without limitations, a 2’-OMe modification in the sense strand can be present at any positions. In some embodiments, each nucleotide, except for any other specified modification (e.g., thermally stabilizing modification(s), lipophilic modification(s), inverted nucleotide(s), thermally destabilizing modification(s), and / or 2’-deoxy (2’-H) modification(s)) of the sense strand is independently a 2’-O-methyl nucleotide. 2’-deoxy (2’-H) nucleotides

[00173] In some embodiments, the longer double-stranded and single-stranded oligonucleotides described herein can comprise a 2’-deoxy, i.e., 2’-H nucleotides. For example, the longer doublestranded and single-stranded oligonucleotides described herein can comprise at least one (e.g., 1, 2, 3, 4, 5 or more) 2’-deoxy nucleotides.

[00174] A 2’-deoxy nucleotide can be present in any position of the sense or antisense strand. Further, 2’-deoxy nucleotides all can be present in one strand or both strands of the dsNA.

[00175] In some embodiments, sense strand comprises 1, 2, 3, 4, 5 or more 2’-deoxy nucleotides. For example, the sense strand comprises a 2’-deoxy nucleotide at any one of positions 7, 9 and 11, counting from the 5’-end of the sense strand. In some embodiments, the sense strand comprises a 2’-deoxy nucleotide at least at position 9, counting from the 5’-end of the strand. For example, the sense strand comprises a 2’-deoxy nucleotide at least at positions 7 and 9, counting from the 5’-end of the strand. In another non-limiting example, the sense strand comprises a 2’-deoxy nucleotide at least at positions 9 and 11, counting from the 5’-end of the strand.

[00176] In some embodiments, antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more 2’-deoxy nucleotides. For example, the antisense strand comprises a 2’-deoxy nucleotide at any one of positions 2, 5, 7, 12, 14 and 16, counting from the 5’-end of the antisense strand. In some embodiments, the antisense strand comprises a 2’-deoxy nucleotide at least at position 5, counting from the 5’-end of the strand. For example, the antisense strand comprises a 2’-deoxy nucleotide at least at positions 2, 5 and 9, counting from the 5’-end of the strand. In another non-limiting example, the antisense strand comprises a 2’-deoxy nucleotide at least at positions 2, 5, 7, and 12, counting from the 5’-end of the strand. In another non-limiting example, the antisense strand comprises a 2’-deoxy nucleotide at least at positions 2, 5,7, 12, 14, and 16, counting from the 5’-end of the strand.

[00177] A longer single-stranded oligonucleotide described herein can comprise 1, 2, 3, 4, 5, 6, 7, 8 or more 2’-deoxy nucleotides. For example, the ssNA comprises a 2’-deoxy nucleotide at any one of positions 2, 5, 7,9,11,12,14 and 16, counting from the 5’-end of the ssNA. In some embodiments, the ssNA comprises a 2’-deoxy nucleotide at any one of positions 7,9 and 11, counting from the 5 ’-end of the ssNA. In some embodiments, the ssNA comprises a 2’-deoxy nucleotide at least at position 9, counting from the 5’-end of the ssNA. For example, the ssNA comprises a 2’-deoxy nucleotide at least at positions 7 and 9, counting from the 5’-end of the ssNA. In another non-limiting example, the ssNA comprises a 2’-deoxy nucleotide at least at positions 9 and 11, counting from the 5’-end of the ssNA. In some embodiments, the ssNA comprises a 2’-deoxy nucleotide at any one of positions 2, 5,7, 12, 14 and 16, counting from the 5’-end of the ssNA. In some embodiments, the ssNA comprises a 2’-deoxy nucleotide at least at position 5, counting from the 5’-end of the ssNA. For example, the ssNA comprises a 2’-deoxy nucleotide at least at positions 2, 5 and 9, counting from the 5’-end of the ssNA. In another non-limiting example, the ssNA comprises a 2’-deoxy nucleotide at least at positions 2, 5,7, and 12, counting from the 5’-end of the ssNA. In another non-limiting example, the ssNA comprises a 2’-deoxy nucleotide at least at positions 2, 5, 7, 12, 14, and 16, counting from the 5’-end of the ssNA. Lipophilic modifications

[00178] In some embodiments, the longer double-stranded and single-stranded oligonucleotides described herein can comprise a lipophilic modification. For example, the longer double-stranded and single-stranded oligonucleotides described herein can comprise at least one (e.g., 1,2, 3, 4, 5 or more) lipophilic modifications. Exemplary lipophilic modifications include nucleotides modified with a lipophilic group, e.g., nucleotides comprising a lipophilic group (e.g., an C10-C30 alkyl, or a C10-C30 alkenyl group, such as a Ci6 alkyl, a Ci6 alkenyl, a Cis alkyl, a Cis alkenyl, a C2oalkyl, a C20 alkenyl, a C22 alkyl, a C22 alkenyl, a C24 alkyl, a C24 alkenyl; C15 alkyl, a C15 alkenyl, a C17 alkyl, a C17 alkenyl, a Cigalkyl, a C19 alkenyl, a C21 alkyl, a C21 alkenyl, a C23 alkyl, or a C23 alkenyl) at their 2’-position. Some exemplary lipophilic nucleotides include, but are not limited to, 2’-O-hexadecyl-modified nucleotide (Nhd), 2’-O-docosanyl-modified nucleotide (Nda), 2’-O-(omega-hydroxy-hexadecyl)-modified nucleotide (NhdOH), and 2’-O-(omega-hydroxy-docosanyl)-modified nucleotide (NdaOH).

[00179] A lipophilic modification can be present in any position of the sense or antisense strand. Further, lipophilic modifications all can be present in one strand or both strands of a dsNA. In some embodiments, only the sense strand comprises a lipophilic modification. For example, the sense strand comprises a lipophilic modification at any one of positions 1,2,3,4, 5,6,7, 8, 13,14,15,16, 17 or 18, counting from the 5’-end of the sense strand. In some embodiments, the sense strand comprises a lipophilic modification at any one of positions 4, 5, 6, 7, 8, 13, 14, 15, 16, 17 or 18, counting from the 5’-end of the sense strand.

[00180] In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl, 2’-fluoro, 2’-deoxy, LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-allyl, or 2’-C-allyl, 2’-deoxy, or. The strands can contain more than one modification. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. It is to be understood that these modifications are in addition to any other specified modification (e.g., at least one thermally destabilizing modification of the duplex present in the antisense strand) of dsNA molecule.

[00181] In some embodiments, at least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2’-deoxy, 2’-O-methyl or 2’-fluoro modifications, thermally destabilizing modifications. In some embodiments, the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2’-O-methyl or 2’-deoxy. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl nucleotide, 2’-deoxy nucleotide, 2'-deoxy-2’-fluoro nucleotide, 2’-O-N-methylacetamido (2’-O-NMA) nucleotide, a 2’-O-dimethylaminoethoxyethyl (2’-O-DMAEOE) nucleotide, 2’-O-aminopropyl (2’-O-AP) nucleotide, or 2’-ara-F nucleotide. For example, each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl nucleotide, 2’-deoxy nucleotide or 2'-deoxy-2’-fluoro nucleotide. Again, it is to be understood that these modifications are in addition to any thermally destabilizing modification of the duplex present in the antisense strand.

[00182] In some embodiments, the antisense strand comprises at least one thermally destabilizing modification, and the remaining nucleotides are independently a 2’-O-methyl nucleotide, 2’-deoxy nucleotide, 2'-deoxy-2’-fluoro nucleotide, 2’-O-N-methylacetamido (2’-0-NMA) nucleotide, a 2’-O-dimethylaminoethoxyethyl (2’-O-DMAEOE) nucleotide, 2’-O-aminopropyl (2’-O-AP) nucleotide, or 2’-ara-F nucleotide. For example, the antisense strand comprises a thermally destabilizing modification and the remaining nucleotides are independently a 2’-O-methyl nucleotide, 2’-deoxy nucleotide, 2'-deoxy-2’-fluoro nucleotide. In some embodiments, the antisense strand comprises: (i) a thermally destabilizing modification at position 5, 6,7, or 8, counting from the 5’-end of the antisense strand; (ii) at least two, e.g., 3,4,5 or 6 2’-fluoro nucleotides; and (iii) the remaining nucleotides are independently a 2’-O-methyl nucleotide or 2’-deoxy nucleotide.

[00183] In some embodiments, each nucleotide of the sense strand is independently 2’-O-methyl nucleotide, 2’-deoxy nucleotide, 2'-deoxy-2’-fluoro (2’-F) nucleotide, 2’-O-N-methylacetamido (2’-O-NMA) nucleotide, a 2’-O-dimethylaminoethoxyethyl (2’-O-DMAEOE) nucleotide, 2’-O-aminopropyl (2’-O-AP) nucleotide, or 2’-ara-F nucleotide. For example, each nucleotide of the sense strand is independently 2’-O-methyl nucleotide, 2’-deoxy nucleotide, 2'-deoxy-2’-fluoro nucleotide. In some embodiments, the sense strand comprises at least two, e.g., 3, 4, 5 or 6 2’-fluoro nucleotides, and the remaining nucleotides are independently a 2’-O-methyl nucleotide or 2’-deoxy nucleotide.

[00184] In some embodiments, at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand of a dsNA can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex. In some embodiments, the nucleotide at the 1 position within the duplex region from the 5’- end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’- end of the antisense strand is an A:U base pair. It is noted that either the sense strand or the antisense strand can comprise the adenosine (A) nucleotide. Modified internucleotide linkages

[00185] The longer double-stranded and single-stranded oligonucleotides described herein can comprise at least one, e.g., two, three, four, five, six, seven, eight, nine, ten or more modified intemucleoside linkages. As used herein, “intemucleoside linkage” refers to a covalent linkage between adjacent nucleosides. Exemplary modified intemucleoside linkage include, but are not limited to, phosphodiesters, phosphorothioates (R, S, or racemic), phosphorodithioates, methylenemethylimino (MMI, 3'-CH2-N(CH3)-O-5'), phosphotriesters, alkylphosphonates (e.g., methylphosphonates), phosphoramidates methylenemethylimino (—CH2-N(CH3)-O—CH2-), thiodiester (—O—C(O)—S—), thionocarbamate (—O—C(O)(NH)—S—), siloxane (—O—Si(H)2-0— and dialkylsiloxane), N,N-dimethylhydrazine (—CH2-N(CH3)-N(CH3)-), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5')), hydroxylamino, siloxane (dialkylsiloxane), carboxamide, carbonate, carboxymethyl, carbamate, carboxylate ester, thioether, ethylene oxide linker, sulfide, sulfonate, sulfonamide, sulfonate ester, thioformacetal (3'-S-CH2-O-5'), formacetal (3 '-O-CH2-O-5'), oxime, methyleneimino, methykenecarbonylamino,            methylenehydrazo,            methylenedimethylhydrazo, methyleneoxymethylimino, ethers (C3’-O-C5’), thioethers (C3’-S-C5’), thioacetamido (C3’-N(H)-C(=O)-CH2-S-C5’, C3’-O-P(O)-O-SS-C5’), C3’-CH2-NH-NH-C5’, 3'-NHP(O)(OCH3)-O-5', 3’-NHP(O)(OCH3)-O-5’), 2’->5’ intemucleoside linkages, 2’->3’ intemucleoside linkages, 3’->3’ intemucleoside linkages, and 5’->5’ intemucleoside linkages, optionally the modified intemucleoside linkage is phosphorothioate, methylphosphonate, imidophosphoramidate (imidp) or MMI, more preferably the modified intemucleoside linkage is phosphorothioate (PS). In some embodimentrs, the modified intemucleoside linkage is a small molecule linker.

[00186] A modified intemucleotide linkage can occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand. For instance, the intemucleotide linkage modification can occur on every nucleotide on the sense strand and / or antisense strand; each intemucleotide linkage modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both intemucleotide linkage modifications in an alternating pattern. The alternating pattern of the intemucleotide linkage modification on the sense strand can be the same or different from the antisense strand, and the alternating pattern of the intemucleotide linkage modification on the sense strand can have a shift relative to the alternating pattern of the intemucleotide linkage modification on the antisense strand.

[00187] In some embodiments, the dsNA molecule comprises the modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage(s) in the overhang region. For example, the overhang region comprises two nucleotides having modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage between the two nucleotides. Intemucleotide linkage modifications can also be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides can be linked through modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage, and optionally, there can be additional modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. Preferably, these terminal three nucleotides can be at the 3’-end of the antisense strand.

[00188] With respect to position of an intemucleotide linkage, the indicated position refers to the intemucleotide linkage that links the nucleotide at said position with the nucleotide one position down stream from said position. In other word, an intemucleotide linkage at position N means it is between nucleotides N and N+l. Thus, an intemucleotide linkage at position 1, counting from the 5 ’-end, means the linker is between the first and second nucleotides, counting from the 5’-end.

[00189] In some embodiments, the sense strand comprises one to five (e.g., 1,2,3,4 or 5) modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkages within position 1-5, counting from the 5’-end of the sense strand, and one to five (e.g., 1, 2, 3, 4 or 5) modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkages within position 1-5, counting from the 5’-end of the sense strand. For example, the sense strand comprises a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, counting from the 5’-end of the sense strand, and sense strand further comprises a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, counting from the 3’-end of the sense strand.

[00190] In some embodiments, the antisense strand comprises one to five (e.g., 1, 2, 3, 4 or 5) modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkages within position 1-5, counting from the 5’-end of the antisense strand, and one to five (e.g., 1,2, 3,4 or 5) modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkages within position 1-5, counting from the 5’-end of the antisense strand. For example, the antisense strand comprises a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, counting from the 5 ’-end of the antisense strand, and the antisense strand further comprises a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, counting from the 3’-end of the antisense strand.

[00191] In some embodiments, the sense strand comprises a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage at positions 1 and 2 counting from the 5’-end of the sense strand, a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage at positions 1 and 2, counting from the 3’-end of the sense strand; and the antisense strand comprises a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage at positions 1 and 2 counting from the 5 ’-end of the antisense strand, a modified intemucleoside (e.g., phosphorothioate or methylphosphonate intemucleotide) linkage at positions 1 and 2, counting from the 3’-end of the antisense strand. Overhang modifications

[00192] The nucleotides in the overhang region of the dsNA molecule can each independently be a modified or unmodified nucleotide including, but not limited to 2’-sugar modified, such as, 2’-Fluoro, 2’-O-methyl, thymidine (T), 2’-O-methoxyethyl-5-methyluridine, 2’-O-methoxyethyladenosine, 2’-O-methoxyethyl-5-methylcytidine, GNA (glycol nucleic acid), SNA (serinol nucleic acid), TNA (threose nucleic acid),, and any combinations thereof. For example, TT (or UU) can be an overhang sequence for either end on either strand. The 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the dsNA molecule can be phosphorylated. In some embodiments, the overhang region contains two nucleotides having a phosphorothioate intemucleotide linkage between the two nucleotides, where the two nucleotides in the overhang region can be the same or different. 5 ’-modifications

[00193] The 5’-end of the longer single-stranded product or a strand of the longer double-stranded product can be modified. Exemplary modifications for the 5’-end include, but are not limited to a phosphate or phosphoryl analog at the 5’-end, a 5’-morpholino nucleotide (e.g., a nucleotide where the 5’-OH group is replaced with a morpholino group), a 5’-dimethylamino nucleotide (e.g., a nucleotide where the 5’-OH group is replaced with a dimthylamino group, a 5’-deoxy nucleotide, an inverted nucleotide (i.e., a nucleotide linked via a 5’->5’ linkage to the rest of the strand), an inverted abasic nucleotide (e.g., an abasic nucleotide linked by a 5’->5’ linkage), or an inverted abasic locked nucleic acid modification (i.e., an LNA lacking a nucleobase and linked by a 5’->5’ linkage) at the 5’-end.

[00194] In some embodiments, the antisense strand of the dsNA comprises at its 5 ’-end a phosphate or phosphate mimic. Phosphate mimics include those groups that, while similar in molecular structure and properties to a phosphate, are not susceptible to the hydrolytic action of phosphatases under physiological condition, such as phosphonic acid (-P(O)(OH)2) or phosphonate (-P(O)(OH)(OR), where R is a Ci-4alkyl group, such as methyl or ethyl) containing groups, which contain a carbon-phosphorus bond instead of an oxygen-phosphorus bond of phosphate.

[00195] In some embodiments, the antisense strand of the dsNA comprises a 5’-phosphate or 5’-phosphate mimic, such as VP is Vinyl-phosphonate (e.g., 5’-(E)-vinylphosphonate), 5'-cyclopropylphosphonate (5'-CP), 4’-O-methylphosphonate (4’-OMP), or 4’-O-methylphosphonate methyl ester (4’-OMPMe). In some embodiments, the antisense strand comprises Vinyl-phosphonate (e.g., 5’-(E)-vinylphosphonate), 5'-cyclopropylphosphonate, 4’-O-methylphosphonate, or 4’-O-methylphosphonate methyl ester, and a nucleoside at position N-l that reduces or inhibits activity of siRNA relative to a siRNA having the same antisense strand sequence but unmodified N-l position and a nucleoside at position N-l that reduces or inhibits activity of siRNA relative to a siRNA having the same antisense strand sequence but unmodified N-l position.

[00196] In some embodiments, the sense strand of the dsNA comprises a 5’-morpholino nucleotide, a 5’-dimethylamino nucleotide, a 5’-deoxy nucleotide, an inverted nucleotide, an inverted abasic nucleotide, or an inverted abasic locked nucleic acid modification at the 5’-end. For example, the sense strand comprises an inverted nucleotide, an inverted abasic nucleotide, or an inverted abasic locked nucleic acid modification at the 5’-end.

[00197] In some embodiments, the sense strand of the dsNA comprises a an inverted nucleotide, an inverted abasic nucleotide, or an inverted abasic locked nucleic acid modification at the 3’-end.

[00198] In some embodiments, the sense strand comprises a ligand at its 3’-end. Ligands

[00199] In some embodiments, the longer double-stranded and single-stranded oligonucleotide can comprise a ligand. Without wishing to be bound by a theory, a ligand can modify one or more properties of the attached molecule (e.g., the dsNA described herein) including but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake (cell targeting), endosomolytic, charge and clearance.

[00200] In some embodiments, the ligand is a targeting ligand. As used herein the term “targeting ligand” refers to any molecule that provides an enhanced affinity for a selected target, e.g., a cell, cell type, tissue, organ, region of the body, or a compartment, e.g., a cellular, tissue or organ compartment. Some exemplary targeting ligands include, but are not limited to, antibodies, antigens, folates, receptor ligands, carbohydrates, aptamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. Carbohydrate based targeting ligands include, but are not limited to, D-galactose, multivalent galactose, N-acetyl-D-galactosamine (GalNAc), multivalent GalNAc, e.g. GalNAc2 and GalNAc3; D-mannose, multivalent mannose, multivalent lactose, N-acetyl-gulucosamine, multivalent fucose, glycosylated polyaminoacids and lectins. The term multivalent indicates that more than one monosaccharide unit is present. Such monosaccharide subunits can be linked to each other through glycosidic linkages or linked to a scaffold molecule.

[00201] In some embodiments, the ligand is an asialoglycoprotein receptor (ASGPR) ligand. By an ASGPR ligand is meant a ligand that binds the ASGPR. In some embodiments, the ASGPR ligand comprises one or more (e.g., 1,2,3 or more) GalNAc or GalNAc derivatives attached through a bivalent or trivalent branched linker. An exemplary ASGPR ligand is: ,or a loop forming oligonucleotide where 3 or 4 consecutive nucleosides are modified with GalNAc containing ligands; such as, for example, the loop containing oligonucleotide, -R = GCAGCC[G*][A*][A*][A*]GGCUGC (SEQ ID NO: 6), where each capital letter is optionally modified with 2’F or 2’0Me (such as gcagcc[G*][A*][A*][A*]ggcugc (SEQ ID NO: 7), where each lowercase is substituted at the 2’-0 position with methyl (i.e., a 2’0Me mod)) and each G* and A* is substituted at the 2’-0 position with

[00202] Exemplary carbohydrate-based targeting ligands are also described in US Patent No. 5,994,517 and US Patent No. 6,906,182, and PCT Application No. PCT / US2022 / 047102, contents of each of which are incorporated herein by reference in their entireties. Exemplary folate and folate analogs targeting ligands are described in U.S. Pat. Nos. 2,816,110; 5,552,545; 6,335,434 and 7,128,893, contents of which are herein incorporated in their entireties by reference.

[00203] It is noted that when two or more ligands are present, the ligands can all have same properties, all have different properties, or some ligands have the same properties while others have different properties. In a preferred embodiment, all the ligands have different properties.

[00204] It is noted that a ligand can be linked at any position of either strands of the dsNA or at any position of the dsNA. For example, the ligand can be at the 5’-end, 3’-end or at an internal position of a strand.

[00205] In some embodiments, the sense strand comprises the ligand, i.e., the ligand is conjugated to the sense strand. For example, the ligand is conjugated to the 3' end of the sense strand. Exemplary sense strands

[00206] In some embodiments, the sense strand of the dsNA has one of the following modification patterns: Table B: Exemplary sense strand motifs # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 3’-mod SI. n n n n n n Nf n Nf Nf Nf n n n n n n n n n n S2. n n n n n n n n Nf Nf Nf n n n n n n n n n n S3. Nf n Nf n Nf n Nf n Nf Nf Nf n Nf n Nf n Nf n Nf n Nf S4. Nf n Nf n Nf n Nf n Nf Nf Nf n Nf n n n Nf n Nf n Nf S5. n n n n n n n n dN n dN n n n n n n n n n n S6. n n n n n n Nf n Nf Nf dN n n n n n n n n n n S7. n n n n n n Nf n Nf n Nf n n n n n n n n n n S8. n n n n n Nf n Nf Nf Nf n n n n n n n n n n S9. n n n n n n n Nf Nf Nf n n n n n n n n n n S10. n Nf n Nf n Nf n Nf Nf Nf n Nf n Nf n Nf n Nf n Nf Sil. n Nf n Nf n Nf n Nf Nf Nf n Nf n n n Nf n Nf n Nf S12. n n n n n n n dN n dN n n n n n n n n n n S13. n n n n n Nf n Nf Nf dN n n n n n n n n n n S14. n n n n n Nf n Nf n Nf n n n n n n n n n n S15. n n n n Nf n Nf Nf Nf n n n n n n n n n n S16. n n n n n n Nf Nf Nf n n n n n n n n n n S17. Nf n Nf n Nf n Nf Nf Nf n Nf n Nf n Nf n Nf n Nf S18. Nf n Nf n Nf n Nf Nf Nf n Nf n n n Nf n Nf n Nf S19. n n n n n n dN n dN n n n n n n n n n n S20. n n n n Nf n Nf Nf dN n n n n n n n n n n S21. n n n n Nf n Nf n Nf n n n n n n n n n n S22. n n n Nf n Nf Nf Nf n n n n n n n n n n S23. n n n n n Nf Nf Nf n n n n n n n n n n S24. n Nf n Nf n Nf Nf Nf n Nf n Nf n Nf n Nf n Nf S25. n Nf n Nf n Nf Nf Nf n Nf n n n Nf n Nf n Nf S26. n n n n n dN n dN n n n n n n n n n n S27. n n n Nf n Nf Nf dN n n n n n n n n n n S28. n n n Nf n Nf n Nf n n n n n n n n n n S29. n n Nf n Nf Nf Nf n n n n n n n n n n S30. n n n n Nf Nf Nf n n n n n n n n n n S31. Nf n Nf n Nf Nf Nf n Nf n Nf n Nf n Nf n Nf WO 2025 / 231081                                   PCT / US2025 / 027003 # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 3’-mod S32. Nf n Nf n Nf Nf Nf n Nf n n n Nf n Nf n Nf S33. n n n n dN n dN n n n n n n n n n n S34. n n Nf n Nf Nf dN n n n n n n n n n n S35. n n Nf n Nf n Nf n n n n n n n n n n WO 2025 / 231081                                   PCT / US2025 / 027003 wherein n is a 2’-O-methyl-nucleotide; (dN) is a 2’-deoxy-nucleotide; Nf is a 2’-fluoro-modified nucleotide (e.g., 2’-deoxy-2’-fluoro modified nucleotide); and the sense strand optionally comprises either: (a) a 3’-terminal or 5’-terminal modification selected from: (i) 5’-(Ll)- attached to the 5’-terminal nucleotide (e.g., through the 5’-0 of the terminal nucleoside), optionally via a divalent linking group, such as a phosphodiester or phosphorothioate linkage; (ii) -(L2)-3', attached to the 3’-terminal nucleotide (e.g., through the 3’-0 of the terminal nucleoside), optionally via a divalent linking group, such as a phosphodiester or phosphorothioate linkage; (iii) 5’-(Ll)(I)- attached to the 5’-terminal nucleotide (5’-5’), optionally via a divalent linking group, such as a phosphodiester or phosphorothioate linkage; or (iv) -(I)(L2)-3', attached to the 3’-terminal nucleotide (3’-3’), optionally via a divalent linking group, such as a phosphodiester or phosphorothioate linkage; wherein each (I) is an inverted nucleotide (e.g., an inverted abasic nucleotide, such as an inverted abasic ribonucleotide, such as an inverted abasic deoxyribonucleotide); (LI) and (L2) are independently hydrogen or a group comprising a ligand (L), wherein the ligand is selected from: (i) a lipophilic group; examples include a group comprising an C10-C30 alkyl, or a C10-C30 alkenyl group, e.g., a Ci6 alkyl, a Ci6 alkenyl, a Ci8 alkyl, a Ci8 alkenyl, a C2oalkyl, a C20 alkenyl, a C22 alkyl, a C22 alkenyl, a C24 alkyl, a C24 alkenyl; C15 alkyl, a C15 alkenyl, a C17 alkyl, a C17 alkenyl, a Cisalkyl, a Cis alkenyl, a C21 alkyl, a C21 alkenyl, a C23 alkyl, or a C23 alkenyl group; examples include, but are not limited to, a hexadecyl group, a docosanyl group, an omega-hydroxy-hexadecyl group, and an omega-hydroxy-docosanyl group; or (ii) a receptor targeting ligand, such as a group comprising an ASGPR ligand; or (iii) a precursor functional group, where the precursor functional group is suitable for post-synthetic functionalization with a ligand (e.g. as described in (i) or (ii)) containing or conjugated to a complementary reactive functional group; examples of precursor functional groups include, but are not limited to, amino, carboxy, primary amido (-QOjNTL), N-succinamido, azido (-N3), mercapto (-SH), active esters (e.g., an N-hydroxysuccinimde ester (NHS ester) or a pentafluorophenyl ester), 1,2,4,5-tetrazinyl (e.g., 3-methyl-l,2,4,5-tetrazinyl, 3-(pyridin-2-yl)-1,2,4,5-tetrazinyl, or 3-(pyrimidin-2-yl)-l,2,4,5-tetrazinyl-); cyclooctynyl (e.g., bicyclo[6.1.0]nonynyl (BCN) or dibenzocyclooctynyl (DBCO)), transcyclooctenyl, 2-methylsulfonylpyrimidinyl, 4-vinylpyridinyl, and protected forms thereof; or (b) a nucleotide comprising a ligand modification, as described above, that replaces the nucleotide decribed above; examples of lipophile modified nucleotides include, (Nhd) - 2’-O-hexadecyl-modified nucleotide; (Nda) - a 2’-O-docosanyl-modified nucleotide; (NhdOH) - 2’-O-(omega-hydroxy-hexadecyl)-modified nucleotide); or (NdaOH) - a 2’-O-(omega-hydroxy-docosanyl)-modified nucleotide.

[00207] In each of the preceding sense strands, each of the nucleotides are connected in series (i.e., in a 3’->5’ manner) via optionally modified intemucleotide linkages. For example, each of the nucleotides are connected by phosphodiester or phosphorothioate intemucleotide linkages.

[00208] In certain embodiments, the nucleotides at position 1 and 2 are connected by a phosphorothioate intemucleotide linkage; the nucleotides at position 2 and 3 are connected by a phosphorothioate intemucleotide linkage; and the remaining nucleotides are connected in via phosphodiester linkage s, counting from the 5’-end of the oligonucleotide.

[00209] In certain embodiments, the nucleotides at position 1 and 2 are connected by a phosphorothioate intemucleotide linkage; the nucleotides at position 2 and 3 are connected by a phosphorothioate intemucleotide linkage; the nucleotides at position 3 and 4 are connected by a phosphorothioate intemucleotide linkage; and the remaining nucleotides are connected in via phosphodiester linkages, counting from the 5’-end of the oligonucleotide.

[00210] In certain embodiments, where the nucleotide in m nucleotides in length, the nucleotides at positions m-1 and m are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide. That is, for a nucleotide in 23 nucleotides in length, the nucleotides at positions 22 and 23 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide; and for a nucleotide in 21 nucleotides in length, the nucleotides at positions 20 and 21 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide.

[00211] In certain embodiments, where the nucleotide in m nucleotides in length, the nucleotides at positions m-2 and m-1 are connected by a phosphorothioate intemucleotide linkage, and the nucleotides at positions m-1 and m are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide. That is, for a nucleotide in 23 nucleotides in length, the nucleotides at positions 21 and 22 are connected by a phosphorothioate intemucleotide linkage; and positions 22 and 23 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide; and for a nucleotide in 21 nucleotides in length, the nucleotides at positions 20 and 21 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide.

[00212] In other embodiments, each (inv) attached to a 5’-terminal nucleotide is connected via a phosphorothioate linkage (5’-5’).

[00213] In other embodiments, each (inv) attached to a 3’-terminal nucleotide is connected via a phosphorothioate linkage (3’-3’).

[00214] In certain other embodiments, each (inv) attached to a 5’-terminal nucleotide is connected via a phosphorothioate linkage (5’-5’), and each (inv) attached to a 3’-terminal nucleotide is connected via a phosphorothioate linkage (3’-3’).

[00215] in certain embodiments, the sense strand is according to any one of S1-S35 wherein the nucleotide at any one of positions 4-8 or 13-18 counting from the 5’-end of the strand, is replaced with a nucleotide that is substituted with an (L) group.

[00216] For example, in certain embodiments, the sense strand of the dsNA has one of the following modification patterns: Cl w Table C: Additional exemplary sense strand motifs # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 3’-mod S36. Nfs ns Nf n Nf n Nf n Nf Nf Nf n Nf n Nf n Nf n Nf(s) n(s) Nf(s) (L2) S37. Nfs ns Nf n Nf n Nf n Nf Nf Nf n Nf n n n Nf n Nf(s) n(s) Nf(s) (L2) S38. ns ns n n n n n n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (L2) S39. ns ns n n n n Nf n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (L2) S40. ns ns n n n n Nf n Nf n dN n n n n n n n n(s) n(s) n(s) (L2) S41. ns ns n n n n n n dN n dN n n n n n n n n(s) n(s) n(s) (L2) S42. ns ns n n n n Nf n dN n dN n n n n n n n n(s) n(s) n(s) (L2) S43. (L)s ns n n n n Nf n Nf Nf Nf n n n n n n n ns ns n S44. ns (L)s n n n n Nf n Nf Nf Nf n n n n n n n ns ns n S45. ns ns (L) n n n Nf n Nf Nf Nf n n n n n n n ns ns n S46. ns ns n (L) n n Nf n Nf Nf Nf n n n n n n n ns ns n S47. ns ns n n (L) n Nf n Nf Nf Nf n n n n n n n ns ns n S48. ns ns n n n (L) Nf n Nf Nf Nf n n n n n n n ns ns n S49. ns ns n n n n Nf (L) Nf Nf Nf n n n n n n n ns ns n S50. ns ns n n n n Nf n Nf Nf Nf n (L) n n n n n ns ns n S51. ns ns n n n n Nf n Nf Nf Nf n n (L) n n n n ns ns n S52. ns ns n n n n Nf n Nf Nf Nf n n n (L) n n n ns ns n S53. ns ns n n n n Nf n Nf Nf Nf n n n n (L) n n ns ns n S54. ns ns n n n n Nf n Nf Nf Nf n n n n n (L) n ns ns n S55. ns ns n n n n Nf n Nf Nf Nf n n n n n n (L) ns ns n S56. (L)s ns n n n n n n Nf Nf Nf n n n n n n n ns ns n S57. ns (L)s n n n n n n Nf Nf Nf n n n n n n n ns ns n S58. ns ns (L) n n n n n Nf Nf Nf n n n n n n n ns ns n S59. ns ns n (L) n n n n Nf Nf Nf n n n n n n n ns ns n S60. ns ns n n (L) n n n Nf Nf Nf n n n n n n n ns ns n S61. ns ns n n n (L) n n Nf Nf Nf n n n n n n n ns ns n S62. ns ns n n n n (L) n Nf Nf Nf n n n n n n n ns ns n S63. ns ns n n n n n (L) Nf Nf Nf n n n n n n n ns ns n S64. ns ns n n n n n n Nf Nf Nf n (L) n n n n n ns ns n S65. ns ns n n n n n n Nf Nf Nf n n (L) n n n n ns ns n S66. ns ns n n n n n n Nf Nf Nf n n n (L) n n n ns ns n WO 2025 / 231081                                   PCT / US2025 / 027003 WO 2025 / 231081                                   PCT / US2025 / 027003 u SU SU (t) u u u u u u JN JN JN u JN u u u u ’66S u SU SU u (t) u u u u u JN JN JN u JN u u u u ’86S u SU SU u u (t) u u u u JN JN JN u JN u u u u ’46S u SU SU u u u (t) u u u JN JN JN u JN u u u u 96S u SU SU u u u u (1) u u JN JN JN u JN u u u u S6S u SU SU u u u u u (t) u JN JN JN u JN u u u u •1z6S u SU SU u u u u u u u JN JN JN (1) JN u u u u T6S u SU SU u u u u u u u JN JN JN u JN (1) u u u 76S u SU SU u u u u u u u JN JN JN u JN u (t) u u T6S u SU SU u u u u u u u JN JN JN u JN u u (t) u 06S u SU SU u u u u u u u JN JN JN u JN u u u (1) ’68S u SU SU u u u u u u u JN JN JN u JN u u u u ’88S u SU SU u u u u u u u JN JN JN u JN u u u u ’48S (IT) (s)u (s)u (s)u u u u u u u u NP u NP u JN u u u u ’98S (IT) (s)u (s)u (s)u u u u u u u u NP u NP u u u u u u ’S8S (IT) (s)u (s)u (s)u u u u u u u u NP u JN u JN u u u u ’IzSS (IT) (s)u (s)u (s)u u u u u u u u JN JN JN u JN u u u u T8S (IT) (s)u (s)u (s)u u u u u u u u JN JN JN u u u u u u T8S (IT) (s)jN (s)u (s)jN u JN u u u JN u JN JN JN u JN u JN u JN ’T8S (IT) (s)jN (s)u (s)jN u JN u JN u JN u JN JN JN u JN u JN u JN ’08S (I) (s)u u u u u u u u u u NP u JN u JN u u u u u u (s)(r)(n) ’64S (I) (s> u u u u u u u u u NP u NP u JN u u u u u u (s)(f)(lT) ’84S (I) (s> u u u u u u u u u NP u NP u u u u u u u u (s)(f)(lT) ’44S (I) (s> u u u u u u u JN u JN u JN u u u u u u u u (s)(f)(lT) ’94S UT)(f) (s> u u u u u u u u u JN JN JN u JN u u u u u u (S)(l) ’S4S (I) (s)u (s)u (s)u u u u u u u u JN JN JN u JN u u u u u u (s)(r)(n) >4S UT)(f) (s> (s)u (s)u u u u u u u u JN JN JN u JN u u u u u u (s)(f)(lT) T4S (ZT)(f) (s> (s> (s)u u u u u u u u JN JN JN u u u u u u u u (8)(1) T4S (I) (s> (s> (s)u u u u u u u u JN JN JN u u u u u u u u (s)(f)(n) ’T4S (ZT)(f) (s)u (s)u (s)u u u u u u u u JN JN JN u u u u u u u u (s)(f)(n) ’04S u SU SU (t) u u u u u u JN JN JN u u u u u u SU SU ’69S u SU SU u (1) u u u u u JN JN JN u u u u u u SU SU ’89S u SU SU u u (t) u u u u JN JN JN u u u u u u SU SU ’49S POUI-t£ II 01 61 81 41 91 SI SI II II 01 6 8 4 9 s t £ I I poui-tg # # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 3’-mod S100. n n n n n n Nf Nf Nf n n n n n n n ns ns n S101. n n n n n n Nf Nf Nf n n n n n n n ns ns n S102. (L) n n n n n Nf Nf Nf n n n n n n n ns ns n S103. n (L) n n n n Nf Nf Nf n n n n n n n ns ns n S104. n n (L) n n n Nf Nf Nf n n n n n n n ns ns n S105. n n n (L) n n Nf Nf Nf n n n n n n n ns ns n S106. n n n n (L) n Nf Nf Nf n n n n n n n ns ns n S107. n n n n n (L) Nf Nf Nf n n n n n n n ns ns n S108. n n n n n n Nf Nf Nf n (L) n n n n n ns ns n S109. n n n n n n Nf Nf Nf n n (L) n n n n ns ns n S110. n n n n n n Nf Nf Nf n n n (L) n n n ns ns n Sill. n n n n n n Nf Nf Nf n n n n (L) n n ns ns n S112. n n n n n n Nf Nf Nf n n n n n (L) n ns ns n S113. n n n n n n Nf Nf Nf n n n n n n (L) ns ns n S114. n n n n n n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (J)(L2) S115. n n n n n n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (I) S116. n n n n n n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (J)(L2) S117. n n n n Nf n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (J)(L2) S118. n n n n Nf n Nf Nf Nf n n n n n n n n(s) n(s) n(s) (I) S119. n n n n Nf n Nf Nf Nf n n n n n n n n n n(s) (J)(L2) S120. n n n n n n Nf n Nf n Nf n n n n n n n n(s) (I) S121. n n n n n n dN n dN n n n n n n n n n n(s) (I) S122. n n n n Nf n dN n dN n n n n n n n n n n(s) (I) S123. n n n n Nf n Nf n dN n n n n n n n n n n(s) (I) WO 2025 / 231081                                   PCT / US2025 / 027003 wherein n is a 2’-O-methyl-modified nucleotide; (dN) is a 2’-deoxy-nucleotide; Nf is a 2’-fluoro-modified nucleotide; (L) is a ligand-modified nucleotide, e.g., comprising a lipophilic group (e.g., Ci6 or C22 modification), a cell-receptor targeting ligand, such as an Asialoglycoprotein receptortargeting (ASGPR) ligand, an integrin-receptor targeting ligand, or a lipoprotein receptortargeting ligand; and s is a phosphorothioate intemucleotide linkage, (s) is a phosphorothioate or a phosphodiester intemucleotide linkage (e.g., in certain embodiments, each (s) is a phosphorothioate); each (J) is independently an optional linking group (such as an inverted nucleotide (I) (e.g., an inverted abasic nucleotide, such as an inverted abasic ribonucleotide, such as an inverted abasic deoxyribonucleotide)); (LI) and (L2) are independently hydrogen or a group comprising a ligand, and the sense strand optionally comprises a 5’-morpholino nucleotide, a 5’-dimethylamino nucleotide, a 5’-deoxy nucleotide, an inverted nucleotide, an inverted abasic nucleotide, or an inverted abasic locked nucleic acid modification at the 5’-end.

[00217] In some embodiments, the antisense strand of the dsNA has one of the following modification patterns: Table D: Exemplary antisense strand motifs # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod ASI Z n dN n n dN n dN n n n n dN n Nf n n n n n n n n n AS2 Z n dN n n dN n dN n n n n dN n dN n dN n n n n n n n AS3 Z n Nf n n n Nf n n n n n n n Nf n Nf n n n n n n n AS4 Z n Nf n n n Nf n n Nf n n n n Nf n Nf n n n n n n n AS5 Z n Nf n n n Nf n Nf Nf n n n n Nf n Nf n n n n n n n AS6 Z n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n AS7 Z n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n n n AS8 Z n Nf n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf n Nf n AS9 Z n Nf n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf n n n AS10 Z n Nf n Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf n Nf n ASH Z n Nf n Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf n n n AS12 Z n Nf n Nf n n n n n n n Nf n Nf n Nf n Nf n Nf n Nf n AS13 Z n Nf n Nf n n n n n n n Nf n Nf n Nf n n n n n n n ASM Z n dN n n dN n dN n n n n dN n Nf n n n n n n n ASI 5 Z n dN n n dN n dN n n n n dN n dN n dN n n n n n AS16 Z n Nf n n n Nf n n n n n n n Nf n Nf n n n n n AS17 Z n Nf n n n Nf n n Nf n n n n Nf n Nf n n n n n ASI 8 Z n Nf n n n Nf n Nf Nf n n n n Nf n Nf n n n n n AS19 Z n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n AS20 Z n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n AS21 Z n Nf n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf n AS22 Z n Nf n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf n AS23 Z n Nf n Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf n AS24 Z n Nf n Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf n AS25 Z n Nf n Nf n n n n n n n Nf n Nf n Nf n Nf n Nf n AS26 z n Nf n Nf n n n n n n n Nf n Nf n Nf n n n n n AS27 z n dN n n dN n dN n n n n dN n Nf n n n n n AS28 z n dN n n dN n dN n n n n dN n dN n dN n n n AS29 z n Nf n n n Nf n n n n n n n Nf n Nf n n n AS30 z n Nf n n n Nf n n Nf n n n n Nf n Nf n n n AS31 z n Nf n n n Nf n Nf Nf n n n n Nf n Nf n n n WO 2025 / 231081                                   PCT / US2025 / 027003 Cl 00 # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod AS32 Z n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n AS33 Z n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n AS34 Z n Nf n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n AS35 Z n Nf n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n AS36 Z n Nf n Nf n Nf n Nf n n n n n Nf n Nf n Nf n AS37 Z n Nf n Nf n Nf n Nf n n n n n Nf n Nf n Nf n AS38 Z n Nf n Nf n n n n n n n Nf n Nf n Nf n Nf n AS39 Z n Nf n Nf n n n n n n n Nf n Nf n Nf n n n WO 2025 / 231081                                   PCT / US2025 / 027003 wherein: n is a 2’-O-methyl-modified nucleotide; s is a phosphorothioate intemucleotide linkage (3’-5’); (dN) is a 2’-deoxy-nucleotide; Nf is a 2’-fluoro-modified nucleotide; Z is an optional 5’-phosphate or 5’-phosphate mimic, such as VP is Vinyl-phosphonate (e.g., 5’-O (E)-vinylphosphonate,               , where the preceding structure replaces the 4’-CH2OH group on the ribose ring of a 5’-terminal nucleotide), or 5'-cyclopropylphosphonate’(5'-CP) or 4’-O-methylphosphonate (4’-0MP) or 4’-O-methylphosphonate methyl ester (4’-0MPMe), wherein Z replaces the 4’-CH2OH on the terminal nucleotide. O > HO—<^j

[00218] The structure of 5'-CP, as used herein, is               where the broken bond is connected to the 4’-C of the ribose (i.e., the preceding structure replaces the 4’-CH2OH group on the ribose ring of a HO P o •                •                                                              • •     H(5 5’-terminal nucleotide). The structure of4*-OMP, as used herein, is             ' where the broken bond is connected to the 4’-C of the ribose (i.e., the preceding structure replaces the 4’-CH2OH group on the HO ,° o P^O , ribose ring of a 5’-terminal nucleotide).. The structure of 4'-0MPMe, as used herein, is              ' , where the broken bond is connected to the 4’-C of the ribose (i.e., the preceding structure replaces the 4’-CH2OH group on the ribose ring of a 5’-terminal nucleotide).

[00219] In each of the preceding antisense strands, each of the nucleotides are connected in series (i.e., in a 3’->5’ manner) via phosphodiester or phosphorothioate intemucleotide linkages.

[00220] In one embodiment of any one of AS1-AS39, the nucleotide at one of positions 5-8, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G), such as: (Ngn) - a glycol nucleic acid, S-isomer; (N2p) - a 2'-phosphate nucleotide (i.e., a 3’-RNA connected by 3’-5’ and 2’-5’ intemucleotide linkages on the 5’ and 3’ directions, respectively); (Tna) - a threose nucleotide (connected by 3’-3’ and 2’-5’ intemucleotide linkages on the 5’ and 3’ directions, respectively); (MM) a nucleobase mismatch to the sense strand; or (Nul) an unlocked nucleic acid.

[00221] In one embodiment of any one of AS1-AS39, the nucleotide position 5, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G). In one embodiment of any one of AS1-AS39, the nucleotide position 6, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G). In one embodiment of any one of AS1-AS39, the nucleotide position 7, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G). In one embodiment of any one of AS1-AS39, the nucleotide position 8, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G).

[00222] For example, the antisense strand may be selected from any one of AS40 - AS58 as recited in Table E: Table E. # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod AS40 Z n dN n n dN n G n n n n dN n Nf n n n n n n n n n AS41 Z n Nf n n dN n G n n n n n n Nf n Nf n n n n n n n AS42 Z n Nf n n n Nf G n n n n n n Nf n Nf n n n n n n n AS43 Z n Nf n n n Nf G n Nf n n n n Nf n Nf n n n n n n n AS44 Z n Nf n n n Nf G Nf Nf n n n n Nf n Nf n n n n n n n AS45 Z n Nf n Nf n n G n n n n Nf n Nf n Nf n n n n n n n AS46 Z n dN n n dN n G n n n n dN n Nf n n n n n n n AS47 Z n Nf n n dN n G n n n n n n Nf n Nf n n n n n AS48 Z n Nf n n n Nf G n n n n n n Nf n Nf n n n n n AS49 Z n Nf n n n Nf G n Nf n n n n Nf n Nf n n n n n AS50 Z n Nf n n n Nf G Nf Nf n n n n Nf n Nf n n n n n AS51 Z n Nf n Nf n n G n n n n Nf n Nf n Nf n n n n n AS52 Z n dN n n dN n G n n n n dN n Nf n n n n n AS53 Z n Nf n n dN n G n n n n n n Nf n Nf n n n AS54 Z n Nf n n n Nf G n n n n n n Nf n Nf n n n AS55 Z n Nf n n n Nf G n Nf n n n n Nf n Nf n n n AS56 Z n Nf n n n Nf G Nf Nf n n n n Nf n Nf n n n AS57 Z n Nf n Nf n n G n n n n Nf n Nf n Nf n n n WO 2025 / 231081                                   PCT / US2025 / 027003

[00223] In certain embodiments, the nucleotides at position 1 and 2 are connected by a phosphorothioate intemucleotide linkage; the nucleotides at position 2 and 3 are connected by a phosphorothioate intemucleotide linkage; and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide. In certain embodiments, the nucleotides at position 1 and 2 are connected by a phosphorothioate intemucleotide linkage; the nucleotides at position 2 and 3 are connected by a phosphorothioate intemucleotide linkage; the nucleotides at position 3 and 4 are connected by a phosphorothioate intemucleotide linkage; and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide.

[00224] In certain embodiments, where the nucleotide in m nucleotides in length, the nucleotides at positions m-1 and m are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide. That is, for a nucleotide in 23 nucleotides in length, the nucleotides at positions 22 and 23 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide; and for a nucleotide in 21 nucleotides in length, the nucleotides at positions 20 and 21 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide.

[00225] In certain embodiments, where the nucleotide in m nucleotides in length, the nucleotides at positions m-2 and m-1 are connected by a phosphorothioate intemucleotide linkage, and the nucleotides at positions m-1 and m are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide. That is, for a nucleotide in 23 nucleotides in length, the nucleotides at positions 21 and 22 are connected by a phosphorothioate intemucleotide linkage; and positions 22 and 23 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide; and for a nucleotide in 21 nucleotides in length, the nucleotides at positions 20 and 21 are connected by a phosphorothioate intemucleotide linkage, counting from the 5’-end of the oligonucleotide.

[00226] In certain embodiments, where the nucleotide in m nucleotides in length: (a) the nucleotides at position 1 and 2 are connected by a phosphorothioate intemucleotide linkage; (b) the nucleotides at position 2 and 3 are connected by a phosphorothioate intemucleotide linkage; (c) the nucleotides at positions m-2 and m-1 are connected by a phosphorothioate intemucleotide linkage; and (d) the nucleotides at positions m-1 and m are connected by a phosphorothioate intemucleotide linkage, and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide.

[00227] That is, for a nucleotide in 23 nucleotides in length, the nucleotides at positions 1 and 2; 2 and 3; 21 and 22; and 22 and 23 are connected by a phosphorothioate intemucleotide linkage, and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide. And, for a nucleotide in 21 nucleotides in length, the nucleotides at positions 1 and 2; 2 and 3; 19 and 20; and 20 and 21 are connected by a phosphorothioate intemucleotide linkage, and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide.

[00228] In certain embodiments, where the nucleotide in m nucleotides in length: (a) the nucleotides at position 1 and 2 are connected by a phosphorothioate intemucleotide linkage; (b) the nucleotides at position 2 and 3 are connected by a phosphorothioate intemucleotide linkage; (c) the nucleotides at position 3 and 4 are connected by a phosphorothioate intemucleotide linkage; and (d) the nucleotides at positions m-1 and m are connected by a phosphorothioate intemucleotide linkage, and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide.

[00229] That is, for a nucleotide in 23 nucleotides in length, the nucleotides at positions 1 and 2; 2 and 3; 3 and 4; and 22 and 23 are connected by a phosphorothioate intemucleotide linkage, and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide. And, for a nucleotide in 21 nucleotides in length, the nucleotides at positions 1 and 2; 2 and 3; 3 and 4; and 20 and 21 are connected by a phosphorothioate intemucleotide linkage, and the remaining nucleotides are connected in via phosphodiester bonds, counting from the 5’-end of the oligonucleotide.

[00230] For example, in some embodiments, the antisense strand of the dsNA has one of the following modification patterns in Table F: Table F: Additional exemplary antisense motifs # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod AS58 Z ns dNs n n dN n dN n n n n dN n Nf n n n n n n ns ns n AS59 Z ns dNs n n dN n dN n n n n dN n dN n dN n n n n ns ns n AS60 Z ns Nfs n n n Nf n n n n n n n Nf n Nf n n n n ns ns n AS61 Z ns Nfs n n n Nf n n Nf n n n n Nf n Nf n n n n ns ns n AS62 Z ns Nfs n n n Nf n Nf Nf n n n n Nf n Nf n n n n ns ns n AS63 Z ns Nfs n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf ns Nfs n AS64 Z ns Nfs n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf ns ns n AS65 Z ns Nfs n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf ns Nfs n AS66 Z ns Nfs n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf ns ns n AS67 Z ns Nfs n Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf ns Nfs n AS68 Z ns Nfs n Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf ns ns n AS69 Z ns Nfs n Nf n n n n n n n Nf n Nf n Nf n Nf n Nf ns Nfs n AS70 Z ns Nfs n Nf n n n n n n n Nf n Nf n Nf n n n n ns ns n AS71 Z ns dNs n n dN n dN n n n n dN n Nf n n n n ns ns n AS72 Z ns dNs n n dN n dN n n n n dN n dN n dN n n ns ns n AS73 Z ns Nfs n n n Nf n n n n n n n Nf n Nf n n ns ns n AS74 Z ns Nfs n n n Nf n n Nf n n n n Nf n Nf n n ns ns n AS75 Z ns Nfs n n n Nf n Nf Nf n n n n Nf n Nf n n ns ns n AS76 Z ns Nfs n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf ns Nfs n AS77 Z ns Nfs n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf ns Nfs n AS78 Z ns Nfs n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf ns Nfs n AS79 Z ns Nfs n Nf n Nf n Nf n Nf n n n Nf n Nf n Nf ns Nfs n AS80 Z ns Nfs n Nf n Nf n Nf n n n n n Nf n Nf n Nf ns Nfs n AS81 z ns Nfs n Nf n Nf n Nf n n n n n Nf n Nf n Nf ns Nfs n AS82 z ns Nfs n Nf n n n n n n n Nf n Nf n Nf n Nf ns Nfs n AS83 z ns Nfs n Nf n n n n n n n Nf n Nf n Nf n n ns ns n AS84 z ns dNs n n dN n dN n n n n dN n Nf n n ns ns n AS85 z ns dNs n n dN n dN n n n n dN n dN n dN ns ns n WO 2025 / 231081                                   PCT / US2025 / 027003 # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod AS86 Z ns Nfs n n n Nf n n n n n n n Nf n Nf ns ns n AS87 Z ns Nfs n n n Nf n n Nf n n n n Nf n Nf ns ns n AS88 Z ns Nfs n n n Nf n Nf Nf n n n n Nf n Nf ns ns n AS89 Z ns Nfs n Nf n Nf n Nf n Nf n Nf n Nf n Nf ns Nfs n AS90 Z ns Nfs n Nf n Nf n Nf n Nf n Nf n Nf n Nf ns Nfs n AS91 Z ns Nfs n Nf n Nf n Nf n Nf n n n Nf n Nf ns Nfs n AS92 Z ns Nfs n Nf n Nf n Nf n Nf n n n Nf n Nf ns Nfs n AS93 Z ns Nfs n Nf n Nf n Nf n n n n n Nf n Nf ns Nfs n AS94 Z ns Nfs n Nf n Nf n Nf n n n n n Nf n Nf ns Nfs n AS95 Z ns Nfs n Nf n n n n n n n Nf n Nf n Nf ns Nfs n AS96 Z ns Nfs n Nf n n n n n n n Nf n Nf n Nf ns ns n AS97 Z ns dNs ns n dN n dN n n n n dN n Nf n n n n n n n ns n AS98 Z ns dNs ns n dN n dN n n n n dN n dN n dN n n n n n ns n AS99 Z ns Nfs ns n n Nf n n n n n n n Nf n Nf n n n n n ns n AS 100 Z ns Nfs ns n n Nf n n Nf n n n n Nf n Nf n n n n n ns n AS101 Z ns Nfs ns n n Nf n Nf Nf n n n n Nf n Nf n n n n n ns n AS 102 Z ns Nfs ns Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nfs n AS 103 Z ns Nfs ns Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n ns n AS 104 Z ns Nfs ns Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf n Nfs n AS 105 Z ns Nfs ns Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nf n ns n AS 106 Z ns Nfs ns Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf n Nfs n AS 107 Z ns Nfs ns Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nf n ns n AS 108 Z ns Nfs ns Nf n n n n n n n Nf n Nf n Nf n Nf n Nf n Nfs n AS 109 Z ns Nfs ns Nf n n n n n n n Nf n Nf n Nf n n n n n ns n ASI 10 Z ns dNs ns n dN n dN n n n n dN n Nf n n n n n ns n ASI 11 z ns dNs ns n dN n dN n n n n dN n dN n dN n n n ns n ASI 12 z ns Nfs ns n n Nf n n n n n n n Nf n Nf n n n ns n ASI 13 z ns Nfs ns n n Nf n n Nf n n n n Nf n Nf n n n ns n ASI 14 z ns Nfs ns n n Nf n Nf Nf n n n n Nf n Nf n n n ns n ASI 15 z ns Nfs ns Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nfs n ASI 16 z ns Nfs ns Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nfs n ASI 17 z ns Nfs ns Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nfs n WO 2025 / 231081                                   PCT / US2025 / 027003 # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod ASI 18 Z ns Nfs ns Nf n Nf n Nf n Nf n n n Nf n Nf n Nf n Nfs n ASI 19 Z ns Nfs ns Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nfs n AS 120 Z ns Nfs ns Nf n Nf n Nf n n n n n Nf n Nf n Nf n Nfs n AS121 Z ns Nfs ns Nf n n n n n n n Nf n Nf n Nf n Nf n Nfs n AS 122 Z ns Nfs ns Nf n n n n n n n Nf n Nf n Nf n n n ns n AS 123 Z ns dNs ns n dN n dN n n n n dN n Nf n n n ns n AS 124 Z ns dNs ns n dN n dN n n n n dN n dN n dN n ns n AS 125 Z ns Nfs ns n n Nf n n n n n n n Nf n Nf n ns n AS 126 Z ns Nfs ns n n Nf n n Nf n n n n Nf n Nf n ns n AS 127 Z ns Nfs ns n n Nf n Nf Nf n n n n Nf n Nf n ns n AS 128 Z ns Nfs ns Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nfs n AS 129 Z ns Nfs ns Nf n Nf n Nf n Nf n Nf n Nf n Nf n Nfs n AS 130 Z ns Nfs ns Nf n Nf n Nf n Nf n n n Nf n Nf n Nfs n AS131 Z ns Nfs ns Nf n Nf n Nf n Nf n n n Nf n Nf n Nfs n AS 132 Z ns Nfs ns Nf n Nf n Nf n n n n n Nf n Nf n Nfs n AS 133 Z ns Nfs ns Nf n Nf n Nf n n n n n Nf n Nf n Nfs n AS 134 Z ns Nfs ns Nf n n n n n n n Nf n Nf n Nf n Nfs n AS 135 Z ns Nfs ns Nf n n n n n n n Nf n Nf n Nf n ns n WO 2025 / 231081                                   PCT / US2025 / 027003

[00231] In one embodiment of any one of AS58-AS135, the nucleotide at one of positions 5-8, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G), such as: (Ngn) - a glycol nucleic acid, S-isomer; (N2p) - a 2'-phosphate nucleotide (i.e., a 3’-RNA connected by 3’-5’ and 2’-5’ intemucleotide linkages on the 5’ and 3’ directions, respectively); (Tna) - a threose nucleotide (connected by 3’-3’ and 2’-5’ intemucleotide linkages on the 5’ and 3’ directions, respectively); (MM) a nucleobase mismatch to the sense strand; or (Nul) an unlocked nucleic acid.

[00232] In one embodiment of any one of AS58-AS135,, the nucleotide position 5, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G). In one embodiment of any one of AS58-AS135,, the nucleotide position 6, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G). In one embodiment of any one of AS58-AS135,, the nucleotide position 7, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G). In one embodiment of any one of AS58-AS135,, the nucleotide position 8, counting from the 5’-end of the antisense strand is replaced with a thermally destabilizing modification (G).

[00233] For example, the antisense strand may be selected from any one of AS 136 - AS 171 as recited in Table G: o 00 Table G. # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod AS136 Z ns dNs n n dN n G n n n n dN n Nf n n n n n n ns ns n AS137 Z ns Nfs n n dN n G n n n n n n Nf n Nf n n n n ns ns n AS138 Z ns Nfs n n n Nf G n n n n n n Nf n Nf n n n n ns ns n AS139 Z ns Nfs n n n Nf G n Nf n n n n Nf n Nf n n n n ns ns n AS140 Z ns Nfs n n n Nf G Nf Nf n n n n Nf n Nf n n n n ns ns n AS141 Z ns Nfs n Nf n n G n n n n Nf n Nf n Nf n n n n ns ns n AS142 Z ns dNs n n dN n G n n n n dN n Nf n n n n ns ns n AS143 Z ns Nfs n n dN n G n n n n n n Nf n Nf n n ns ns n AS144 Z ns Nfs n n n Nf G n n n n n n Nf n Nf n n ns ns n AS145 Z ns Nfs n n n Nf G n Nf n n n n Nf n Nf n n ns ns n AS146 Z ns Nfs n n n Nf G Nf Nf n n n n Nf n Nf n n ns ns n AS147 Z ns Nfs n Nf n n G n n n n Nf n Nf n Nf n n ns ns n AS148 Z ns dNs n n dN n G n n n n dN n Nf n n ns ns n AS149 Z ns Nfs n n dN n G n n n n n n Nf n Nf ns ns n AS150 Z ns Nfs n n n Nf G n n n n n n Nf n Nf ns ns n AS151 Z ns Nfs n n n Nf G n Nf n n n n Nf n Nf ns ns n AS152 Z ns Nfs n n n Nf G Nf Nf n n n n Nf n Nf ns ns n AS153 Z ns Nfs n Nf n n G n n n n Nf n Nf n Nf ns ns n AS154 Z ns dNs ns n dN n G n n n n dN n Nf n n n n n n n ns n AS155 Z ns Nfs ns n dN n G n n n n n n Nf n Nf n n n n n ns n AS156 Z ns Nfs ns n n Nf G n n n n n n Nf n Nf n n n n n ns n AS157 Z ns Nfs ns n n Nf G n Nf n n n n Nf n Nf n n n n n ns n AS158 Z ns Nfs ns n n Nf G Nf Nf n n n n Nf n Nf n n n n n ns n AS159 Z ns Nfs ns Nf n n G n n n n Nf n Nf n Nf n n n n n ns n AS160 Z ns dNs ns n dN n G n n n n dN n Nf n n n n n ns n AS161 z ns Nfs ns n dN n G n n n n n n Nf n Nf n n n ns n AS162 z ns Nfs ns n n Nf G n n n n n n Nf n Nf n n n ns n AS163 z ns Nfs ns n n Nf G n Nf n n n n Nf n Nf n n n ns n AS164 z ns Nfs ns n n Nf G Nf Nf n n n n Nf n Nf n n n ns n WO 2025 / 231081                                   PCT / US2025 / 027003 # 5’-mod 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3’-mod AS165 Z ns Nfs ns Nf n n G n n n n Nf n Nf n Nf n n n ns n AS166 Z ns dNs ns n dN n G n n n n dN n Nf n n n ns n AS167 Z ns Nfs ns n dN n G n n n n n n Nf n Nf n ns n AS168 Z ns Nfs ns n n Nf G n n n n n n Nf n Nf n ns n AS169 Z ns Nfs ns n n Nf G n Nf n n n n Nf n Nf n ns n AS170 Z ns Nfs ns n n Nf G Nf Nf n n n n Nf n Nf n ns n AS171 Z ns Nfs ns Nf n n G n n n n Nf n Nf n Nf n ns n WO 2025 / 231081                                   PCT / US2025 / 027003

[00234] In a further embodiment of each of the preceding exemplary sense and antisense strands, each of sense strand SI through SI23 can be hybridized or duplexed with any one of antisense strands ASI through AS 171. In other words, the longer double-stranded oligonucleotide product described herein comprises any one of the sense strands SI through S123hybridized / duplexed with any one of the antisense strands ASI through AS 171. In certain embodiments, the sense strand is selected from an embodiment having 21 nucleotides and the antisense strand is selected from an embodiment having 23 nucleotides. In certain embodiments, the sense strand is selected from an embodiment having 21 nucleotides and the antisense strand is selected from an embodiment having 21 nucleotides. In certain embodiments, the sense strand is selected from an embodiment having 19 nucleotides and the antisense strand is selected from an embodiment having 21 nucleotides. In certain embodiments, the sense strand is selected from an embodiment having 19 nucleotides and the antisense strand is selected from an embodiment having 19 nucleotides.

[00235] In some embodiments, the longer single-stranded oligonucleotide described herein is any one of the sense strands SI through S123 or any one of the antisense strands ASI through AS 171. Synthesis of longer dsNA and ssNA

[00236] In some embodiments, the longer double-stranded and single-stranded oligonucleotides described herein are synthesized by joining together shorter complementary or partially complementary oligonucleotide fragments. The shorter complementary or partially complementary oligonucleotide fragments used to prepare the longer double-stranded and single-stranded oligonucleotides fragments are also referred to as blockmers herein.

[00237] An exemplary method of preparing the linger product is shown in Figure 1. Generally, the method comprises providing a pool of shorter complementary or partially complementary oligonucleotide fragments (blockmers), allowing the fragments (blockmers) to anneal, and joining or ligating the annealed fragments (blockmers) to produce the longer product. It is noted that all the needed blockmers can be annealed and ligated at the same time, or a subset of blockmers is annealed and ligated first followed by annealing and ligation of additional blockmers, and repeating this until the desired longer product is obtained.

[00238] Generally, the blockmers used for the synthesis of larger product are independently 3 to 20 nucleotides in length. For example, the blockmers independently are 5 to 16 nucleotides in length. In some embodiments, the blockmers independently are 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the blockmers independently are 6, 7, 8, 9, 11, 12, 14 or 15 nucleotides in length. For example, the blockmers independently are 7, 8, 14 or 15 nucleotides in length. In another non limiting example, the blockmers independently are 7, 8, 9, or 12 nucleotides in length. In yet another non limiting example, the blockmers independently are 6, 7, 8, or 10 nucleotides in length.

[00239] In some embodiment there are three blockmers: a first 5' blockmer that is 7 nucleotides, a second 5’ blockmer that is 8 nucleotides long, a first 3’ blockmer that is 14 nucleotides lining and second 3’-blockmer that is 15 nucleotides long, which when ligated together form a double-stranded oligonucleotide where one strand is 21 nucleotides in length and the other strand is 23 nucleotides in length and complementary to the first strand. In this embodiment, the first strand comprises the first 5’ blockmer linked to the first 3 ’ blockmer, and the second strand comprises the second 5’ blockmer linked to the second 3’ blockmer.

[00240] In some other embodiments, there are five blockmers: a first 5’ blockmer that is 9 nucleotide long, a second 5’ blockmer that is 8 nucleotides long, a first 3’ blockmer that is 12 nucleotides long, a second 3’ blockmer that is 8 nucleotides long, and a central blockmer that is 7 nucleotides long, , which when ligated together form a double-stranded oligonucleotide where one strand is 21 nucleotides in length and the other strand is 23 nucleotides in length and complementary to the first strand. In this embodiment, the first strand comprises the first 5’ blockmer linked to the first 3’ blockmer, and the second strand comprises the second 5’ blockmer linked to central blockmer linked to the second 3’ blockmer.

[00241] In yet other embodiments, there are six blockmers: a first 5 ’ blockmer that is 8 nucleotide long, a second 5 ’ blockmer that is 10 nucleotides long, a first 3 ’ blockmer that is 7 nucleotides long, a second 3 ’ blockmer that is 6 nucleotides long, a first central blockmer that is 6 nucleotides long, and a second central blockmer that is 7 nucleotides long, which when ligated together form a double-stranded oligonucleotide where one strand is 21 nucleotides in length and the other strand is 23 nucleotides in length and complementary to the first strand. In this embodiment, the first strand comprises the first 5’ blockmer linked to the first central blockmer linked to the first 3’ blockmer, and the second strand comprises the second 5’ blockmer linked to second central blockmer linked to the second 3 ’ blockmer.

[00242] The blockmers can be joined together enzymatically or chemically. In some embodiments, blockmers are joined together enzymatically, i.e., enzymatic ligation. As used herein, the term “enzymatic ligation” means that the link between two adjacent blockmers, i.e., between the 3’-end of a first blockmer and 5’-end of a blockmer that is adjacent to the first blockmer is formed enzymatically. Stated in another way, 3 ’-end of a first blockmer is enzymatically linked to the 5’-end of a second fragment.

[00243] Enzymatic ligation uses ligases. As used herein, the term "ligase" refers to an enzyme used to covalently join together two nucleic acid strands, e.g. by formation of a phosphodiester bond between the 3' end a first strand with the 5' end of the same or another strand. Generally, a ligase catalyzes the formation of a phosphodiester bond between adjacent 3' hydroxyl and 5' phosphoryl termini of oligonucleotides. Exemplary ligases include, but are not limited to, ATP-dependent double-stranded polynucleotide ligase, NAD+-dependent double-stranded DNA or RNA ligase and single-stranded polynucleotide ligases. ATP-dependent ligase is described in the Enzyme Class EC 6.5.1.1, NAD+-dependent ligase in Enzyme Class EC 6.5.1.2, and RNA ligase in Enzyme Class EC 6.5.1.3 as defined by the International Union of Biochemistry and Molecular Biology. In some embodiments, ligase is a DNA ligase. In some other embodiments, the ligase is RNA ligase.

[00244] Where a blockmer does not comprise a 5’-phosphate group, such may be provided prior to ligation by treatment with a suitable kinase, such as T4 Polynucleotide Kinase, (T4 PNK) to introduce the 5' phosphate.

[00245] In some embodiments, the ligase used in the ligation reaction is a thermostable ligase. As used herein, a “thermostable ligase” is a ligase that is active at elevated temperatures, i.e. above ambient temperature, i.e. above 37°C. A thermostable ligase can be active at a temperature, for example, between from about 40°C to about 90° C, e.g., between from about 40°C to about 65°C.

[00246] Exemplary enzymatic ligation methods for preparing the longer double-stranded oligonucleotides are described, for example, in Paul S., et al., ACS Chern. Biol. (2003), vol. 18(10), pp. 2183-2187, content of which is incorporated by reference in its entirety.

[00247] In some embodiments, blockmers can be joined together chemically, i.e., chemical ligation. As used herein, the term “chemical ligation” means that the link between two adjacent blockmers, i.e., between the 3’-end of a first blockmer and 5’-end of a blockmer that is adjacent to the first blockmer is formed without the use of a ligase. Generally, chemical ligation uses chemical ligation reagents. Exemplary chemical ligation agents include, but are not limited to, activating, condensing, and reducing agents, such as carbodiimide, cyanogen bromide (BrCN), N-cyanoimidazole, imidazole, 1-methylimidazole / carbodiimide / cystamine, and dithiothreitol (DTT). Chemical ligation reagents can also include click chemistry and light, e.g., ultraviolet light. Reagents and methods for chemical ligation of oligonucleotides are well known and available to one of skill in the art. See, for example, U.S. Pat. No. 5,476,930 Kanaya and Yanagawa, Biochemistry 25:7423-30 (1986); Chu and Orgel, Nucleic Acids Res. 16:3671-91 (1988); Sokolova et al., FEBS Letters 232:153-55 (1988); Ashley and Kushlan, Biochemistry 30:2927-33 (1991); Luebke and Dervan, Nucleic Acids Res. 20:3005-09 (1992); Purmal et al., Nucleic Acids Res. 20:3713-19 (1992); Gryaznov and Letsinger, Nucleic Acid Res. 21:1403-08 (1993); Gryaznov et al., Nucleic Acid Res. 22:2366-69 (1994); Sievers and von Kiedrowski, Nature 369:221-24 (1994); Wang and Kool, Nucleic Acids Res. 22:2326-33 (1994); Naylor and Gilham, Biochemistry 5:2722-28 (1966); Liu and Taylor, Nucleic Acids Res. 26:3300-04 (1999); and Xu et al., Nucleic Acid Res., 27:875-81 (1999), contents of all which are incorporated herein by reference in their entireties.

[00248] Various aspects of the technology described herein can also be defined according to any of the following numbered embodiments:

[00249] Embodiment 1 : A method for separating shorter complementary or partially complementary oligonucleotides from a longer double-stranded or single-stranded oligonucleotide, the method comprises: filtering a initial solution comprising the shorter complementary or partially complementary oligonucleotides and the longer double-stranded or single-stranded oligonucleotide, to generate a purified longer double-stranded or single-stranded oligonucleotide product, and wherein the initial solution further comprises a destabilizing agent.

[00250] Embodiment 2: The method of claim 1, wherein the initial solution comprises the destabilizing agent in an amount sufficient to lower the melting temperature (Tm) of short complementary or partially complementary oligonucleotides.

[00251] Embodiment 3: The method of claim 1 or 2, wherein the initial solution comprises the destabilizing agent in an amount sufficient to preferentially denature the short complementary or partially complementary oligonucleotides without substantially denaturing the longer double stranded product.

[00252] Embodiment 4: The method of any one of claim 1-3, wherein the initial solution comprises the destabilizing agent in an amount from about 0.04 M to about 12 M.

[00253] Embodiment 5: The method of any one of claim 1-4, wherein the initial solution comprises the destabilizing agent in an amount from about 0.1 M to about 0.5 M or from about 2 M to about 8 M.

[00254] Embodiment 6: The method of any one of claim 1-3, wherein the initial solution comprises the destabilizing agent in an amount from about 0.2 M to about 0.3 M or from about 5 M to about 7 M.

[00255] Embodiment 7: The method of any one of claims 1-3, wherein the initial solution comprises the destabilizing agent in an amount from about 5% to about 75% (w / v or v / v).

[00256] Embodiment 8: The method of claim 8, the initial solution comprises the destabilizing agent in an amount from about 10% to about 50% (w / v or v / v).

[00257] Embodiment 9: The method of claim 8, the initial solution comprises the destabilizing agent in an amount from about 20 % to about 40% (w / v or v / v).

[00258] Embodiment 10: The method of any one of claims 1-9, wherein the destabilizing agent is a salt, or a free acid form thereof.

[00259] Embodiment 11: The method of any one of claims 1-9, wherein the destabilizing agent is a solvent, e.g., an organic solvent or other small molecule.

[00260] Embodiment 12: The method of any one of claims 1 -11, wherein the initial solution comprises at least two different destabilizing agents.

[00261] Embodiment 13: The method of any one of claims 1-12, wherein the filtration is performed at a temperature greater than 15°C.

[00262] Embodiment 14: The method of any one of claims 1-12, wherein the filtration is performed at a temperature from about 15°C to about 60°C.

[00263] Embodiment 15: The method of claim 14, wherein the filtration is performed at a temperature from about 15°C to about 35°C.

[00264] Embodiment 16: The method of claim 14 or 15, wherein the filtration is performed at a temperature from about 15°C to about 25°C.

[00265] Embodiment 17: The method of any one of claims 14-16, wherein the filtration is performed at room temperature.

[00266] Embodiment 18: The method of any one of claims 1-17, wherein the filtration is performed at a pH above 7 (e.g., between 7 and 11).

[00267] Embodiment 19: The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 3 to about 11.

[00268] Embodiment 20: The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 3.5 to about 6.

[00269] Embodiment 21: The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 4 to about 5.

[00270] Embodiment 22: The method of any one of claims 1-17, wherein the filtration is performed at a pH below 7

[00271] Embodiment 23: The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 5 to about 13.

[00272] Embodiment 24: The method of claim 23, wherein the filtration is performed at a pH of from about 6 to about 12.

[00273] Embodiment 24: The method of claim 23 or 24, wherein the filtration is performed at a pH of from about 10 to about 11.

[00274] Embodiment 25: The method of any one of claims 1-25, wherein the filtration is performed at an elevated temperature and a pH above 7.

[00275] Embodiment 26: The method of any one of claims 1-26, wherein the filtration is tangential flow filtration.

[00276] Embodiment 27: The method of any one of claims 1-27, wherein the longer double-stranded or single-stranded oligonucleotide product is obtained by ligation of short complementary or partially complementary oligonucleotide fragments.

[00277] Embodiment 28: The method of claim 28, wherein the short complementary or partially complementary oligonucleotide fragments are obtained by chemical solid phase or solution phase synthesis, or enzymatic synthesis.

[00278] Embodiment 29: The method of claim 28 or 29, wherein the short complementary or partially complementary oligonucleotide fragments are independently 3 to 12 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, such as 4, 5, 6, 7, 9, 9 or 10) nucleotides in length.

[00279] Embodiment 30: The method of claims 28-30, wherein the longer double-stranded or singlestranded oligonucleotide product is obtained by enzymatic ligation or chemical ligation.

[00280] Embodiment 31: The method of claim 31, wherein the enzymatic ligation is using an RNA or DNA ligase.

[00281] Embodiment 32: The method of any one of claims 1-32, wherein the longer double-stranded or single-stranded oligonucleotide product is unmodified, partially, or completely modified RNA or DNA oligonucleotide.

[00282] Embodiment 33: The method of any one of claims 1-33, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one nucleic acid modification.

[00283] Embodiment 34: The method of any one of claims 1-34, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one nucleic acid modification selected from the group consisting of nucleobase modifications, sugar modifications, intemucleotide linkage modifications, conjugates (e.g., ligands), and any combinations thereof.

[00284] Embodiment 35: The method of any one of claims 1-35, wherein the longer double-stranded or single-stranded oligonucleotide product is conjugated with a ligand.

[00285] Embodiment 36: The method of any one of claims 1-36, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-OMe nucleotide.

[00286] Embodiment 37: The method of any one of claims 1-37, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-F nucleotide.

[00287] Embodiment 38: The method of any one of claims 1-38, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-H nucleotide.

[00288] Embodiment 39: The method of any one of claims 1-39, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) thermally destabilizing modification of the duplex.

[00289] Embodiment 40: The method of any one of claims 1-40, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) lipophilic modifications, e.g., a nucleotide modified with one lipophilic group.

[00290] Embodiment 41: The method of any one of claims 1-41, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) non-natural or modified nucleobase.

[00291] Embodiment 42: The method of any one of claims 1-42, the longer double-stranded or singlestranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) modified intemucleoside linkage (e.g. phosphorothioates or a small molecule linker).

[00292] Embodiment 43: The method of any one of claims 1-43, wherein the product is the longer single-stranded oligonucleotide.

[00293] Embodiment 44: The method of claim 44, wherein the single-stranded oligonucleotide product is from about 15 to about 200 nucleotides in length, e.g., from about 15 to about 50 nucleotides in length, such as 15, 16, 17,28,19,20,21,22,23,24,25,26,27,28,29 or 30 nucleotides in length, optionally 19, 20, 21,22, 23, 24 or 25 nucleotides, preferably 19, 20, 21, 22 or 23 nucleotides in length.

[00294] Embodiment 45: The method of any one of claims 1-45, wherein the single-stranded oligonucleotide product is at least 3 (e.g., 4,5,6,7,8,9,10 or more, such as 4,5,6,7,8 or more) nucleotides longer than the short complementary or partially complementary oligonucleotide fragments.

[00295] Embodiment 46: The method of any one of claims 1-43, wherein the product is a doublestranded oligonucleotide.

[00296] Embodiment 47: The method of claim 47, wherein the double-stranded oligonucleotide product comprises a first strand and a second strand substantially complementary to the first strand, and wherein at least one of the first or second strand of the double-stranded oligonucleotide product is at least 3 (e.g., 4, 5, 6, 7, 8, 9, 10 or more, such as 4, 5, 6, 7, 8 or more) nucleotides longer than the short complementary or partially complementary oligonucleotides.

[00297] Embodiment 48: The method of claim 47 or 48, wherein the double-stranded oligonucleotide product comprises at least 2 (e.g., 3,4, 5, 6, 7, 8, 9, 10 or more, such as 2, 3,4, 5 or more) nucleotide basepairs than the short complementary or partially complementary oligonucleotides.

[00298] Embodiment 50: The method of any one of claims 47-49, wherein the double-stranded oligonucleotide product comprises a first strand and a second strand substantially complementary to the first strand, wherein each of the first and second strand is independently from about 15 to about 30 nucleotides (e.g., 15, 16, 17, 28, 19, 20,21,22, 23, 24,25, 26,27,28, 29 or 30 nucleotides, such as 19, 20, 21, 22, 23, 24 or 25 nucleotides) in length, and wherein the first and second strand hybridize to each other to form a duplex region of from about 15 base-pairs to about 30 base-pairs (e.g., a duplex region of 15, 16, 17, 18,19,20,21, 22, 23,24,25,26, 27,27,28,29 or 30 base-pairs, such as a duplex region of 18, 19,20, 21, 22, 23 or 24 base-pairs).

[00299] Embodiment 51: The method of any one of claims 47-50, wherein the one or both of the first and second strand have a 1-2 nucleotide overhang on its respective 5’-end or 3’-end.

[00300] Embodiment 52: The method of claim 50, wherein only one of the first or second strand has a two-nucleotide overhang on its 5’-end or 3’-end.

[00301] Embodiment 53: The method of claim 52, wherein only one of the first or second strand has a two-nucleotide overhang on its 3’-end.

[00302] Embodiment 54: The method of any one of claims 1-53, wherein the double-stranded oligonucleotide product is capable of inducing RNA interference.

[00303] Embodiment 55: The method of claim 54, wherein the product is a therapeutic siRNA.

[00304] Embodiment 56: The method of any one of claims 1-55, wherein the initial solution is a reaction mixture from a ligation reaction mixture.

[00305] Embodiment 57: The method of claim 56, wherein the method further comprises a step of processing the reaction mixture to remove one or more ligation reagents / components present in the reaction mixture prior to the step of filtering the initial solution.

[00306] Embodiment 58: The method of any one of claims 1-57, wherein a total nucleic acid concentration in the initial solution is at least about 0.1 mg / ml (e.g., about 0.5mg / ml, about Img / ml, about 1.5mg / mL, about 2mg / mL, about 2.5mg / mL, about 5mg / mL, about 7.5mg / mL, about lOmg / mL, about 15mg / mL, about 20mg / mL, about 25 mg / mL, about 30mg / mL, about 35mg / mL, about 40mg / mL, about 45mg / mL, about 50mg / mL, about 55mg / mL, about 60mg / mL, about 65mg / mL, about 70mg / mL, about 75mg / mL, about 80mg / mL, about 85mg / mL, about 90mg / mL, about 95mg / mL, about lOOmg / mL or more).

[00307] Embodiment 59: The method of any one of claims 1-58, wherein the method further comprises a step of removing the destabilizing agent from the purified product.

[00308] Embodiment 60: The method of any one of claims 1-59, wherein the method further comprises a step of lyophilizing the purified product.

[00309] Embodiment 61: The method of any one of claims 1-60, wherein the purified product is in a retentate from the filtering step.

[00310] Embodiment 62: The method of any one of claims 1-60, wherein the purified product is in a permeate from the filtering step.

[00311] Embodiment 63: The method of any one of claims 1-62, wherein the filtering is continuous filtering.

[00312] Embodiment 64: The method of any one of claims 1-63, wherein the filtering is batch filtering.

[00313] Embodiment 65: The method of any one of claims 1-64, wherein the destabilizing agent comprises sodium carbonate, sodium citrate, DMF, urea, or potassium carbonate. Some selected definitions

[00314] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected herein. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[00315] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood to one of ordinary skill in the art to which this invention pertains. Although any known methods, devices, and materials may be used in the practice or testing of the invention, the methods, devices, and materials in this regard are described herein. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054,978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735,9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[00316] Further, the practice of the present invention can employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook et al., 1989); “Oligonucleotide Synthesis” (M. J. Gait, ed., 1984); “Animal Cell Culture” (R. I. Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Current Protocols in Molecular Biology” (F. M. Ausubel et al., eds., 1987, and periodic updates); “PCR: The Polymerase Chain Reaction”, (Mullis et al., ed., 1994); “A Practical Guide to Molecular Cloning” (Perbal Bernard V., 1988); “Phage Display: A Laboratory Manual” (Barbas et al., 2001).

[00317] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[00318] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±10%. In some embodiments of the various aspects described herein, the term “about” when used in connection with percentages can mean ±5%. The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[00319] As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective components) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.

[00320] The term “consisting of’ refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[00321] As used herein the term “consisting essentially of’ refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[00322] The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[00323] The abbreviation, “e.g.” is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.”

[00324] As used herein, the terms “siRNA”, and “iRNA agent” are used interchangeably to refer to agents that can mediate silencing of a target RNA, e.g., mRNA, e.g., a transcript of a gene that encodes a protein. For convenience, such mRNA is also referred to herein as mRNA to be silenced. Such a gene is also referred to as a target gene. In general, the RNA to be silenced is an endogenous gene, exogenous gene or a pathogen gene. In addition, RNAs other than mRNA, e.g., tRNAs, and viral RNAs, can also be targeted.

[00325] As used herein, the phrase “mediates RNAi” refers to the ability to silence, in a sequence specific manner, a target gene, e.g., mRNA. While not wishing to be bound by theory, it is believed that silencing uses the RNAi machinery or process and a guide RNA, e.g., antisense strand of a dsRNA, where the antisense strand is 21 to 23 nucleotides in length.

[00326] By “specifically hybridizable” and "complementary" is meant that a nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. In reference to the nucleic molecules of the present invention, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al, 1987, CSH Symp. Quant. Biol. LII pp.123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA 83:9373-9377; Turner et al., 1987, JACS 109:3783-3785). A percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5,6, 7, 8, 9,10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Perfectly complementary" or 100% complementarity means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Less than perfect complementarity refers to the situation in which some, but not all, nucleoside units of two strands can hydrogen bond with each other. “Substantial complementarity” refers to polynucleotide strands exhibiting 90% or greater complementarity, excluding regions of the polynucleotide strands, such as overhangs, that are selected so as to be noncomplementary. Specific binding requires a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to nontarget sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed. The non-target sequences typically differ by at least 5 nucleotides.

[00327] As used herein, the term “annealing” means the hybridization of complementary oligonucleotides in a sequence specific manner. “Conditions to allow for annealing” will depend on the Tm of the hybridized complementary oligonucleotides and will be readily apparent to a person skilled in the art. For example, the temperature for annealing may be below the Tmof the hybridized oligonucleotides. Alternatively, the temperature for annealing may be close to the Tm of the hybridized oligonucleotides, e.g. + / -1, 2 or 3°C The temperature for annealing is, in general, not higher than 10°C above the Tmof the hybridized oligonucleotides.

[00328] As used herein, the term “denaturing” in relation to a double stranded oligonucleotide is used to mean that the complementary strands are no longer annealed.

[00329] As used herein, a “terminal region” of a strand refers to positions 1-4, e.g., positions 1, 2, 3, and 4, counting from the nearest end of the strand. For example, a 5’-terminal region refers to positions 14, e.g., positions 1, 2, 3 and 4 counting from the 5’-endofthe strand. Similarly, a 3’-terminal region refers to positions 1-4, e.g., positions 1, 2, 3 and 4 counting from the 3’-end of the strand.

[00330] For example, a 5’-terminal region for the antisense strand is positions 1, 2, 3 and 4 counting from the 5’-end of the antisense strand. A preferred 5’-terminal region for the antisense strand is positions 1, 2 and 3 counting from the 5’-end of the antisense strand. A 3’-terminal region for the antisense strand can be positions 1, 2, 3, and 4 counting from the 3’-end of the strand. A preferred 3’-terminal region for the antisense strand is positions 1, 2 and 3 counting from the 3’-end of the antisense strand.

[00331] Similarly, a 5’-terminal region for the sense strand is positions 1, 2, 3 and 4 counting from the 5’-end of the sense strand. A preferred 5’-terminal region for the sense strand is positions 1, 2 and 3 counting from the 5’-end of the sense strand. A 3’-terminal region for the sense strand can be positions 1, 2, 3, and 4 counting from the 3’-end of the strand. A preferred 3’-terminal region for the sense strand is positions 1, 2 and 3 counting from the 3’-end of the sense strand.

[00332] As used herein, a “central region” of a strand refers to positions 5-17, e.g., positions 6-16, positions 6-15, positions 6-14, positions 6-13, positions 6-12, positions 7-15, positions 7-14, positions 713, positions, 7-12, positions 8-16, positions 8-15, positions 8-14, positions 8-13, positions 8-12, positions 9-16, positions 9-15, positions 9-14, positions 9-13, positions 9-12, positions 10-16, positions 10-15, positions 10-14, positions 10-13 or positions 10-12, counting from the 5’-end of the strand. For example, the central region of a strand means positions 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 of the strand. A preferred central region for the sense strand is positions 6, 7, 8, 9, 10, 11, 12, 13, and 14, counting from the 5’-end of the sense strand. A more preferred central region for the sense strand is positions 7, 8, 9, 10, 11, 12 and 13, counting from the 5’-end of the sense strand. A preferred central region for the antisense strand is positions 9, 10, 11, 12, 13, 14, 15 16 and 17, counting from 5’-end of the antisense strand. A more preferred central region for the antisense strand is positions 10, 11, 12, 13, 14, 15 and 16, counting from 5’-end of the antisense strand.

[00333] The term “statistically significant” or “significantly” refers to statistical significance and generally means a two standard deviation (2SD) or greater difference. B A SO ^' °y

[00334] A glycolic nucleic acid (GNA) is           , wherein B is a modified or unmodified nucleobase, and * is R, S, or racemic.

[00335] The term “acyclic nucleotide” refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g., CT-C2’, C2’-C3’, C3’-C4’, C4’-O4’, or Cl’-O4’) is absent and / or at least one of ribose carbons or oxygen (e.g., Cl’, C2’, C3’, C4’ or 04’) are independently or in combination absent from the nucleotide. In some embodiments, the acyclic nucleotide modified or unmodified nucleobase, R1 and R2 independently are H, halogen, OR3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar.

[00336] Unlocked nucleic acid (UNA) modification encompasses monomers with bonds between Cl’-C4’ being removed (i.e. the covalent carbon-oxygen-carbon bond between the Cl’ and C4’ carbons). In another example, the C2’-C3 ’ bond (i.e. the covalent carbon-carbon bond between the C2 ’ and C3 ’ carbons) of the sugar is removed (see Mikhailov et. al., Tetrahedron Letters, 26 (17): 2059 (1985); and Fluiter et al., Mol. Biosyst., 10: 1039 (2009), which are hereby incorporated by reference in their entirety). The acyclic nucleotide can be linked via 2’-5’ or 3’-5’ linkage. In some embodiments, UNA has the structure: , where B is a modified or unmodified nucleobase; R, R’, R”, R’” and R”” are independently H, OH, CH3, CH2CH3, O-alkyl, NH2, NHMe or NMe2; and each * is independently R, S, or racemic. In some embodiments, the UNA modification is where B is a modified or unmodified nucleobase and R is H, OH or O-alkyl.

[00337] Modified unlocked nucleic acid (ynUNA) modification include, but are not limited to the following: I! k 'NG Mod $ {GNA-q Mod 3 Mod 4 (GNA-IsoGJ Mod 5 (V mUNA} Mods "'s,  „ BiW § >0^ S 5 .-. OH Mod 7 wherein Base is a modified or unmodified nucleobase, and * is R, S, or racemic.

[00338] In some embodiments, the UNA modification is selected from the group consisting of: 5’-(S)-Me-UNA 5'-(R)-IV!e-UNA 3'-(R)-Nle-4’-(S}-hydroxylmethyi-UNA 4’-(P)-0Me-UNA Y95                   Y97 Y102 Y101

[00339] The term “abasic modification” refers to a nucleotide or analog thereof that does not have a nucleobase. Some exemplary abasic modifications include, but are not limited to, the following: wherein R is H, Me, Et or OMe; R’ is H, Me, Et or OMe; R” is H, Me, Et or OMe; and * represents either R, S or racemic.

[00340] In some embodiments the thermally destabilizing modification is selected from the group consisting of: Mod A (GNA) Mod B (2'-OMe Abasic Spacer) ModC (3'-OMe) Mod D (5'-Me) Mod E (Hyp-spacer) X = OMe, F Mod F           Mod G (SNA)            (hGNA) Mod H           Mod I         Mod J (hhGNA)         (mGNA)         (TNA) °y Mod K (h'GNA) wherein B is a modified or unmodified nucleobase, and * is R, S, or racemic.

[00341] As used herein, the 2’-5’ RNA is where Base is a modified or unmodifed nucleobase.

[00342] As used herein TNA is a nucleotide comprising a threose sugar instead of a ribose sugar, where its 3 ’ -position is linked to the 3 ’ -positoon of the nucleotide upstream of it, and its 2 ’ -psotion is linked to the 5 ’ -positoon of the nucleotide downstream of it. TNA has the structure modifications include, but are not limited to, the following: . Some exemplary TNA

[00343] As used herein, a Hyp-spacer modification comprises a hydroxyprolinol monomer, e.g., R s, where R is H or a modified or unmodified nucleobase.

[00344] Additional exemplary sugar modifications include, but are not limited to the following: ’b o k           9 I and 1     , where B is a modified or unmodified nucleobase, and R is H or Ci-Cealkyl (e.g., methyl or ethyl),

[00345] Exemplary, nucleotides with impaired W-C H-bonding to complementary base on opposing strand include, but are not limited to, nucleotides comprising a nucleobase independently selected from the following:

[00346] Exemplary non-canonical bases with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand, include, but are not limited to, inosine, nebularine, 2-aminopurine, 2,4-difluorotoluene, 5-nitroindole, 3-nitropyrrole, 4-fluoro-6-methylbenimidazole and 4-methylbenzimidazole. / \

[00347] Exemplary a-nucleotides include, but are not limited to,                     , B is a modified or unmodified nucleobase, and R is H, OH, OCH3, F, NHz, NHMe, NMe2 or O-alkyl.

[00348] Exemplary phosphate modifications known to decrease the thermal stability of dsNA duplexes compared to natural phosphodiester linkages include, but are not limited to, the following: III   II  I III   II  I I     I      I         II       I <5        6         6              d       d          d O^-SH O=^-CH3 O=^-CH2-COOH O^-R O^F^-NH-R O^-O-R d      d       d            d      d         d I     I      I         II       I R = alkyl where the alkyl for the R group can be a Ci-Cealkyl. Specific alkyls for the R group include, but are not limited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.

[00349] As used herein, the term “bridged nucleic acid” includes, but is not limited to, nucleotides that comprise a five-membered or six-membered bridged structure with a fixed 3'-endo confirmation, also known as the north confirmation. The bridged structure connects the 2'-arbon (e.g., 2’-oxygen) of the ribose sugar to the 4' carbon of the ribose sugar. Various different bridge structures are possible containing carbon, oxygen, nitrogen, and hydrogen atoms.

[00350] In some embodiments, the BNA is locked nucleic acid (LNA). As used herein, the term "locked nucleic acid" (LNA) generally refers to a class of BNAs, where the ribose ring is "locked" with a methylene bridge connecting the 2' oxygen of the ribose sugar to the 4' carbon of the ribose sugar.

[00351] It should be understood that this disclosure is not limited to the particular methodology, protocols, and reagents, etc., provided herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure, which is defined solely by the claims. The invention is further illustrated by the following example, which should not be construed as further limiting.

[00352] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[00353] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[00354] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure. EXAMPLES

[00355] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting. Example 1: Separation of Oligonucleotide Duplexes Based on Differences in Melting Temperature

[00356] As can be seen from Figure 1 the synthesis approach using enzymatic ligation as applied to AD-64958, or the direct synthesis of a duplex rather than single strands, involves the building up of a target siRNA through the use of small “blockmers” which anneal and ligate to form intermediate duplexes. The full-length product (FLP) or target duplex results after successive annealing and ligation of all blockmers. In developing a purification technique for the resulting duplex, two points were kept in mind: 1) Most of the resulting impurities of interest were either blockmers or intermediates; 2) These impurities exist as duplexes with either a full-length single strand or another impurity. Table El Duplex Id Strand Oligo Seq Translated Seq AD-64958 sense asascaguGfuUICfUfugcucuauaaL96 (SEQ ID NO: 1) AACAGUGUUCUUGCUCUAUAA (SEQ ID NO: 2) antisense usUfsauaGfagcaagaAfcAfcuguususu (SEQ ID NO: 3) UUAUAGAGCAAGAACACUGUUUU (SEQ ID NO: 4) Blockmers Sense: asascaguGfu (3.1) P-UfCfUfugc (3.2)) P-ucuauaaL96 (3.3) Antisense: P-uguususu (3.4) P-agaAfcAfc (3.5) usUfsauaGfagca (3.6) (SEQ ID NO: 5)

[00357] A survey of known purification methods for oligonucleotide duplexes was conducted, however, limited information on non-denaturing methods has been reported in the literature. Direct purification of oligonucleotide duplexes has been achieved via anion exchange chromatography (see, for example, Noll, B.; Seiffert, S.; Hertel, F.; et. al. Nucleic Acid Ther 2011, 21, 383-93 and Ogawa, H.; Okubo, T.; Nonaka, Y.; et. al. Journal of Chromatography A, 2023, 1691, 463808). Additionally, non-denaturing methods for reverse phase, hydrophobic interaction, and size exclusion chromatography have been reported (see, for example, Noll, B.; Seiffert, S.; Vomlocher, H.; Roehl, I. Journal of Chromatography A, 2011, 1218, 5609, Huang, X. Xu, H. Qiu et al. Journal of Chromatography A 2021, 1648,462184, and Shimoyama, A.; Fujisaka, A.; Obika, S. J. Pharm. Biomed. Anal., 2017, 136, 55-65, respectively). However, all of these methods involve chromatography, which was dismissed as a viable technique for scale-up because of their limitations in scale, their time-consuming nature to run and for the analysis of fractions and mock pools, and cost constraints. Instead, we focused on the identity of FLP and impurities in solution and decided to peruse other methods of separation based on size.

[00358] As can been seen in Figure 2, the predominate impurity duplexes do not vary significantly from the FLP, however, the individual components (i.e., the single strands) do. As an example, the single strands comprising the FLP duplex are each roughly half the total molecular weight. In considering this difference we postulated that it should be possible to separate an individual single strand from a duplex based on size difference, utilizing ultrafiltration (UF) with a suitable molecular weight cutoff (MWCO).

[00359] To develop this into viable purification technique, a thorough understanding of the reaction kinetics involved was needed. First it was necessary to differentiate oligonucleotide duplexes based on difference in melting temperature (Tm), or the temperature where the duple and single strands exist in a 1:1 ratio (see Figure 3).

[00360] The factors influencing Tm (number of base pairs, G-C content, oligonucleotide concentration, salt concentration, and the presence and concentration of destabilizing agents) are well understood in simple systems (see, for example, Maskos, U.; Southern, E. Nucleic Acids Research 1992,20, 1675 and Schreiber-Gosch, S.; Edwards, R. J. Chern. Educ. 2009, 86, 644), however complex systems containing more than one type of duplex like those described herein are less well understood. If a significant enough difference in Tm between duplexes of different lengths can be realized and differentiated by either addition of heat or a destabilizing agent, then a system based on separation by Tm would be possible (See Figure 4) Melting Temperature (Tm)

[00361] Before the potential purification techniques were examined, a thorough understanding of the conditions effecting the melting transition was needed The initial study focused on AD-64958. An initial study utilizing differential scanning calorimetry (DSC) focused on FLP duplex along with intermediate duplexes in water at varying concentrations to generate a base line curve (see Table 1). From this data a clear relationship between oligonucleotide concentration (see, for example, Ozel, A.; Srivannavit, O.; Rouillard, J.; Gulari, E. Biotechnol Prog. 2012, 28, 556) and Tm can be seen, as well as a relationship between the number of G-C base pairs in the intermediate duplexes and their relative Tm. Table 1:______Tm of AD-64958 and Intermediate Duplexes in Water Duplex Tm (°C) at 30 mg / mL Tm (°C) at 20 mg / mL Tm (°C) at 15 mg / mL Tm (°C) at 5 mg / mL Tm (°C) at 1 mg / mL AD-64958 72.2 71.0 68.1 55.9 N / A AS:3.2-3.3 65.2a N / A 56.4b 44.5 35.8 SS:3.4-3.5 70.2a N / A 61.9b 50.2 40.1 a. Measured concentration 25 mg / mL b. Measured concentration 12 mg / mL All the data points with N / A signify either the concentration was too low to give Tm curve or previous Tm data point was close to room temperature, not needing any further investigation

[00362] While encouraging it was clear that the transition temperatures, at concentrations useful for development of a purification method, may be too high to be practical and they would not be compatible with ultrafiltration where membranes typically have a maximum working temperature of 50 - 55 °C. To this end, various methods of modulating Tm through the use of destabilizing agents were explored.

[00363] Various destabilizing agents were then tested at concentrations relevant to manufacturing to determine effect on Tm by DSC (see Table 2). These reagents included sodium iodide, sodium bromide, sodium citrate dibasic, sodium carbonate (NazCOa) and potassium carbonate (K2CO3). A few negative controls known to increase melting transition were also included, including sodium chloride. Table 2: Tm of AD-64958 Under Various Conditions Reagent Tm (°C) at 15 mg / ml of duplex Water 67.6 Sodium lodide(lM) 95.5 Sodium Bromide(lM) 95.2 Sodium Carbonate(lM) 31.5 Sodium citrate dibasic (IM) 95.5 Potassium carbonate(lM) 25.1 All the data points with N / A signify either the concentration was too low to give Tm curve or previous Tm data point was close to room temperature, not needing any further investigation

[00364] From these results it became clear that sodium carbonate stood out as a potentially useful as an agent to modulate Tm. The study expanded to determine effect of concentration of both the reagent and how that translates with different concentrations of the duplex (see Table 3 and Figure 5. Table 3: Tm of AD-64958 with Varying Concentrations of NazCOs Sodium Na2COs Tm (°C) at 20 mg / mL Tm (°C) at 15 mg / mL Tm (°C) at 5 mg / mL 0.125 59.1 53.1 40.0 0.25 50.2 45.5 33.9 0.5 42.0 38.2 27.1 Data fields with N / A either signify the Tm curve at given concentration was too low to give a signal or the Tm at previous data point was close to room temperature, not needing any further investigation.

[00365] Data was also collected for the intermediate duplexes so the Tm of the FLP duplex could be compared to those of impurities (see Table 4, Table 5, and Table 6).

[00366] For a given intermediate, the lower the concentration of the sample, the lower molar strength of sodium carbonate is required, for Tm values to be close to room temperature. Table 4:______Tm of intermediate Duplexes at 12 mg / mL with Varying Concentrations of NazCOs Duplex Intermediate Tm (°C) in 0.5M Na2COs Tm (°C) in 0.25M Na2CO3 Tm (°C) in 0.125M Na2CO3 Antisense: 3.2-3.3 28.4 34.8 41.4 Sense: 3.4-3.5 24.7 32.8 41.0 Table 5:______Tm of intermediate Duplexes at 5 mg / mL with Varying Concentrations of NazCOs Duplex Intermediate Tm (°C) at 0.5M Na2CO3 Tm (°C) at 0.25M Na2CO3 Tm (°C) at 0.125M Na2CO3 Antisense: 3.2-3.3 18.7 24.1 30.6 Sense: 3.4-3.5 15.5 22.8 30.8 Table 6:______Tm of intermediate Duplexes at mg / mL with Varying Concentrations of NazCOs Duplex Intermediate Tm (°C) at 0.5M Na2CO3 Tm (°C) at 0.25M Na2CO3 Tm (°C) at 0.125M Na2CO3 Antisense: 3.2-3.3 N / A 14.4 17.8 Sense:3.4-3.5 N / A 14.0 18.7 Data was not collected for some intermediates at higher concentration of sodium carbonate since the Tm values are closer to room temperature and well within the study range, not needing any further investigation.

[00367] As can be seen in Figure 6, the measured Tm of the intermediate duplexes is lower than that the FLP duplex for a given set of conditions. An additional consideration for future experimental design was the expected relative difference in concentrations between FLP duplex and intermediate duplexes, and a noted difference in Tm related to concentration was observed. Ultrafiltration Studies

[00368] In addition to understanding conditions that impact the melting of siRNA duplexes, a mechanism to remove single strands once that had become denatured was needed. For this aspect of the purification, that ultrafiltration was determined to work best, in that several membranes are commercially available with a range of MWCOs, and screening could be easily accomplished using with a model system or initial post-synthetic material. Model System

[00369] Preliminary studies in water at room temperature demonstrated that complete breakthrough of AD-64958 duplex through a 30 kD regenerated cellulous membrane could be achieved while it was retained with one that had a 10 kD MWCO. With that in mind a model system of AD-64958 which had spiked blockmers and ultrafiltered against water to determine purifiability of the various impurities. As can be seen in Figure 7, and increase in %FLP from 48% to 61.2% was achieved, and all of the blockmers were greatly reduced. Moreover, with increase in TMP from 20 psi to 30 psi resulted in additional purging of these impurities. Importantly, incorporation of NaCl, which increases Tm, at both 0.5 and 1 M concentrations resulted in decreased final purity and retention of blockmers (see Figure 8). Experiments with Initial Solutions from Enzymatic Ligation

[00370] With a baseline understanding of the ability to purge blockmers and intermediates by ultrafiltration in hand, initial samples prepared from enzymatic ligation (see Figure 1) was next examined.

[00371] Based on the key learnings from the model system, additional UF experiments were conducted to further understand the impact of temperature and Na2CO3 concentration in conjunction with a gradual increase in TMP on the purifiability of impurity duplexes and recovery of FLP. Additionally, membrane pore size was investigated focusing on 10 and 30 kD MWCOs.

[00372] Initial studies focused on varying temperature (ambient temperature and 35 °C) in conjunction with a 30 kD MWCO membrane, as dual filtration (to remove large molecules such as the enzymes) and purification based of selective melting and purging of impurity duplexes. These were followed up with studies performed using the 10 kD membrane in conjunction with sodium carbonate (0.1 - 0.5 M) as a destabilizing agent. For these studies, trans membrane pressure (TMP) was gradually increased from 10 psi to 50 psi, and each TMP permeate was collected separately. Temperature

[00373] The theory behind using 30 kD membrane was that the FLP duplex would initially be retained while impurity duplexes denatured (as they have lower Tm than FLP duplex) into single strands and flow into the permeate, and the rate of oligonucleotides flowing into the permeate could be controlled by controlling the TMP. As the TMP was then increased, the FLP duplex could then pass through the membrane as an intact duplex.

[00374] In experiments conducted at ambient temperature, the purity of FLP duplex was increased from 48% to 66% as shown in Figure 9. The small molecules that came from the reagents of ligation reaction were mostly removed andblockmers were greatly reduced. As expected, the intermediates (3.2-3.3 and 3.4 and 3.5) along with other impurities closely related to the FLP duplex were unchanged. This result further reiterates that denaturing of impurity duplexes is necessary for their removal. Evidently, the Tm of impurity duplexes is higher than the ambient temperature for the potential concentrations that could present in the initial ligation solution (see Table 1). The major portion of purity bump came from the reduction of small molecules of reagents. It was noted that substantial amount of duplex was left in the retentate along with proteins and other large molecules including lipopolysaccharides.

[00375] The effect of increasing temperature was next examined in the hope of reducing impurity duplexes by denaturing them to single strands at high temperature. Accordingly, 35 °C experiment was conducted. In the 35 °C experiment the purity of FLP duplex was increased from 48% to 68%. The blockmers were mostly removed and the intermediates (3.2-3.3 and 3.4-3.5) were greatly reduced. As shown in Table 3, Tm of impurity duplexes is lower than 40 °C at any given concentration. The FLP duplex purity comparison at different temperatures can be seen in Figure 9. Moreover, only traces of duplex left in the retentate compared to ambient temperature experiment, which further indicated that higher temperature is required to obtain good flux of the duplex through the membrane. NazCCh Concentrations

[00376] As shown in Table 2, various destabilizing agents were screened to modulate Tm, and sodium carbonate (0.05 M - 1 M) reduced Tm of FLP duplex and Impurity duplexes substantially. Moreover, Tm of impurity duplexes is lower than Tm of FLP duplex at any of their given concentration in the studied concentration range of sodium carbonate (see Table 3, Table 4, Table 5, and Table 6). Therefore, different concentrations of initial enzymatic ligation mixture and concentrations of sodium carbonate (NazCCh) were examined at ambient temperature using the 10 kD membrane.

[00377] Based on the initial screening results, it was known that the smaller pore size of 10 kD membrane, relative to the 30 kD membrane, would retain the FLP duplex, and that intermediates and other impurities could flow into the permeate. The goal was to achieve differential melting of impurity duplexes over FLP duplex in the presence of NazCCh solution and increase purity by having the corresponding single strands flow into the permeate. As shown in Figure 10, using both 0.1 M and 0.25 M NazCCh the purity of FLP duplex from 48% to ~65% was achieved using initial solution of concentration 6 mg / mL respectively. The small molecules came from the reagents of ligation reaction and blockmers were mostly removed, and the intermediates (3.2-3.3 and 3.4-3.5) and other impurities were greatly reduced. Whereas with 0.5 M Na2COs experiment, loss of FLP duplex into permeate was observed. This might be due to the higher concentration of Na2CO3 denatured FLP duplex into singles strands, and passed through membrane into permeate. In fact, this result is in good agreement with the Tm data as shown in Table 3.

[00378] In conclusion an increase in FLP duplex purity from 45-48% to 65-70% is achieved with initial ligation reaction mixture that contains FLP duplex, different impurity duplexes, enzymes / proteins and small molecules, using UF diafiltration with either heat (warm water) or destabilizing agent (Na2CO3). The gradual increase in TMP apparently plays an important role in achieving the desired purity of FLP duplex while using the larger MWCO membrane. It is important to note that the selection of MWCO membrane determines whether FLP duplex remains in the retentate or passes into the permeate under these conditions. Example 2: Screening of Destabilizing Agents General procedure for acquiring Tm data:

[00379] The melting temperature (Tm) of a given sample was calculated by Differential Scanning calorimetry (DSC) using a MicroCai PEAQ-DSC Automated instrument. Temperature gradient was run between 4-110°C. The thermogram generated was used to calculate the Tm (highest peak of the curve) and onset Tm (temperature at 2% peak height) for a given sample.

[00380] The reagents listed in Table 7 were utilized to generate the melting temperature (Tm) and melting onset temperature (Tm, onset) of a TTR-targeting full-length duplex. In addition, Tm data was also collected in water for baseline and saline (sodium chloride 0.9%) as a positive control respectively. It is documented in the literature that saline promotes the ordering and stabilization of duplexes that results in an increase in melting temperature (Tm) and melting onset temperature. Duplex concentration was 40 mg / mL. Table 7: Melting temperature of TTR-targeting duplex using various reagents Reagent name Concentration (M) Tm (°C) Onset Tm (°C) Water 75.9 53.3 Saline (0.9%) 0.154 88.8 75.5 Sodium carbonate 0.025 67.5 30.7 Potassium carbonate 0.025 67.0 29.4 Guanidine carbonate 0.025 67.4 29.5 Cesium carbonate 0.025 67.0 28.6 Ammonium carbonate 0.025 79.8 59.5 Sodium Citrate monobasic 0.5 71.2 50.4 Sodium Citrate dibasic 0.5 97.4 78.8 Sodium Phosphate monobasic 0.5 92.5 75.7 Sodium Phosphate dibasic 0.5 89.1 72.6 Sodium Phosphate tribasic 0.5 n / a n / a 0.25 n / a n / a 0.025 74.7 45.4 Sodium Iodide 1 99.7 80.6 Sodium Bromide 1 99.5 81.3 Urea 3 63.7 39.0 6 57.6 33.6 Sodium acetate 1 100.0 81.9 Sodium trichloroacetate 1 95.6 86.9 Sodium chloroacetate 1 96.8 88.3 Sodium p-toluene sulfonate 1 94.5 82.4 Sodium methane sulfonate 1 n / a n / a Sodium oxalate 1 93.4 78.5 Ammonium acetate 1 98.3 79.8 Sodium Thiocyanate 1 98.5 78.7 Guanidine Thiocyanate 1 86.5 68.3 Methanol 15%(v / v) 74.4 58.4 30%(v / v) 73.7 53.4 Ethanol 15%(v / v) 73.7 53.8 30%(v / v) 75.3 53.6 Sodium Phosphate (di / tri basic) pH 12 0.2 n / a n / a 0.02 74.0 48.1 Propanol 30%(v / v) 78.9 64.9 DMSO 30%(v / v) 70.5 50.9 DMF 30%(v / v) 68.6 54.6 Guanidine HC1 1 89.2 71.7 Sodium Formate 1 100.4 82.7 Sodium metasilicate 1 n / a n / a

[00381] As can be seen in Table 7, certain reagents act as stabilizing agents and raise the Tm, while certain reagents act as destabilizing agents and lower the Tm. Based on the data, a concentration of destabilizing agent was chosen at which the target duplex melting onset temperature (Tm,onset) is slightly higher than ambient temperature to perform purification by ultrafiltration, so that impurity duplexes that are present in the crude duplex solution will denature into their corresponding fragments (to be removed by ultrafiltration), without substantially denaturing the target full-length duplex. Example 3: Purification of Various Duplex Sequences

[00382] Six destabilizing agents were selected to perform the ultrafiltration process of crude duplex for five different target sequences, to assess their effectiveness in achieving both high purity and maximum recovery of the target full-length duplex. General Ultrafiltration procedure:

[00383] The multi-channel Sartorius AMBR Crossflow system was used to conduct the Ultrafiltration Purification with the selected destabilizing agents. The method parameters include injection of crude duplex, 20 diafiltration volumes of reagent across a commercially available 10 kDa MWCO membrane, 10 final diafiltration volumes of water for desalting, and harvesting step. The harvested samples were measured by UV-Vis spectrophotometry via plate at 260nm. Harvest samples were then prepped to same concentration in water for denaturing IPRP LC-analysis (Agilent 1290 Infinity UHPLC System) for duplex purity. Fulllength duplex purity is calculated from the sum of the sense and antisense strands area percentage under peak vis OpenLab CDS ChemStation. Table 8: Purification of TTR-targeting duplex using various destabilizing agents Reagent name Concentration (M) Duplex Purity (%) Before UF After UF DMF 30% (v / v) 60.26 91.94 Urea 3 60.26 90.80 Ethanol 15% (v / v) 60.26 90.59 Sodium Phosphate (di / tri basic) pH 12 0.025 60.26 91.02 Sodium Carbonate 0.025 60.26 91.5 Sodium Citrate monobasic 0.55 60.26 93.32 Water (baseline) 60.26 80.30

[00384] Table 8 shows that three destabilizing agents 30% DMF, 0.025M Na2CO3, and 0.5M citric acid mono basic demonstrated high level of impurities purging and high recovery of full-length duplex (~95%), and significantly enhanced the full-length duplex purity, elevating it from an initial ~60% to around >90% after Ultrafiltration process. Among these three destabilizing agents, 0.55M Sodium Citrate monobasic afforded the highest purity of the full-length duplex 93.3% with >95% full-length duplex recovery.

[00385] Furthermore, 0.025M NajCCb was utilized to purify large-scale crude batches of the TTR-targeting duplex through the ultrafiltration process. This purification method effectively removed impurities, resulting in a substantial increase in full-length duplex purity, shown in Table 9. Table 9: Large-scale purification of TTR-targeting duplex Experiment Reagent name Concentration (M) Duplex Purity (%) Before UF After UF 50g batch Sodium Carbonate 0.05 68.05 88.6 500g batch Sodium Carbonate 0.025 64.22 86.0 500g batch Sodium Carbonate 0.025 73.28 91.6

[00386] Tables 10,12,14, and 16 show melting temperatures for full-length duplexes with different sequences targeting different genes. Tables 11,13,15, and 17 show the results of ultrafiltration of each crude duplex mixture. Overall full-length duplex recovery in each case was about 95% or higher. Table 10: Tm data of GRB14-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Tm (°C) Onset Tm (°C) DMF 30% (v / v) 66.9 43.6 Urea 3 63.4 41.6 Ethanol 15% (v / v) 70.9 50.2 Sodium Phosphate (di / tri basic) pH 12 0.025 68.2 28.6 Sodium Carbonate 0.1 51.7 24.4 Sodium Citrate monobasic 0.55 73.7 56.4 Water (baseline) 71.59 50.24 Table 11: Purification of GRB14-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Duplex Purity (%) Before UF After UF DMF 30% (v / v) 57.79 90.63 Urea 3 57.79 80.42 Ethanol 15% (v / v) 57.79 80.71 Sodium Phosphate (di / tri basic) pH 12 0.025 57.79 69.19 Sodium Carbonate 0.025 57.79 81.38 Sodium Citrate monobasic 0.55 57.79 83.04 Water (baseline) 57.79 72.00 Table 12: Tm data of PLG-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Tm (°C) Onset Tm (°C) DMF 30% (v / v) 75.9 54.9 Urea 6 65.7 47.9 Ethanol 15% (v / v) 80 59.6 Sodium Phosphate (di / tri basic) pH 12 0.025 78.3 29 Sodium Carbonate 0.2 50.4 25.3 Sodium Citrate monobasic 0.55 80.8 61.5 Water (baseline) 79.4 60.4 Table 13: Purification of PLG-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Duplex Purity (%) Before UF After UF DMF 30% (v / v) 60.14 82.80 Urea 6 60.14 78.29 Ethanol 15% (v / v) 60.14 72.49 Sodium Phosphate (di / tri basic) pH 12 0.025 60.14 71.02 Sodium Carbonate 0.035 60.14 86.01 Sodium Citrate monobasic 0.55 60.14 86.43 Water (baseline) 60.14 68.78 Table 14: Tm data of COVI-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Tm (°C) Onset Tm (°C) DMF 30% (v / v) 65.6 41.9 Urea 3 59.1 39.2 Ethanol 15% (v / v) 68.7 47.9 Sodium Phosphate (di / tri basic) pH 12 0.025 67 29.9 Sodium Carbonate 0.1 49.3 26.6 Sodium Citrate monobasic 0.55 64.7 46.3 Water (baseline) 67.7 45.5 Table 15: Purification of COVl-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Duplex Purity (%) Before UF After UF DMF 30% (v / v) 58.04 85.07 Urea 3 58.04 85.88 Ethanol 15% (v / v) 58.04 80.03 Sodium Phosphate (di / tri basic) pH 12 0.025 58.04 73.81 Sodium Carbonate 0.025 58.04 79.94 Sodium Citrate monobasic 0.55 58.04 87.29 Water (baseline) 58.04 81.48 Table 16: Tm data of SLC02-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Tmi(°C) Tm2 (°C) Onset Tm (°C) DMF 30% (v / v) 51.5 79.9 36.6 Urea 3 Ethanol 15% (v / v) 62.8 85 47.8 Sodium Phosphate (di / tri basic) pH 12 0.05 16.9 59.8 7.8 Sodium Carbonate 0.25 23.3 52 13.2 Sodium Citrate monobasic 0.55 48.5 84.6 32.8 Water (baseline) 69.7 85.6 50.4 Table 17: Purification of SLC02-targeting duplex using selected destabilizing agents Reagent name Concentration (M) Duplex Purity (%) Before UF After UF DMF 30% (v / v) 58.81 87.22 Urea 3 58.81 88.14 Ethanol 15% (v / v) 58.81 76.88 Sodium Phosphate (di / tri basic) pH 12 0.025 58.81 73.17 Sodium Carbonate 0.025 58.81 84.44 Sodium Citrate monobasic 0.55 58.81 75.58 Water (baseline) 58.81 83.04

[00387] In Examples 2 and 3, sample concentration for Tm measurement was 40 mg / mL for the TTR-targeting duplex, 30 mg / mL for the SLC02-targeting, COV1-targeting or PLG-targeting duplex, and 25mg / mL for the GRB-targeting duplx. Sample concentration for the UF purification was 40mg / mL for the TTR-targeting duplex, and 30 mg / mL for the SLC02-targeting, COV1-targeting, PLG-targeting or GRB-targeting duplex. All duplexes for the Tm and UF studies comprised a 21-mer sense strand and a 23-mer antisense strand. The chemical modifications to strands included one or more of 2'-OMe, 2'-F, 2'-H (DNA), GNA, phosphorothioate linkages, conjugated GalNAc, conjugated C-16, and 5’-vinylphosphonate. The TTR-targeting duplex was synthesized by enzymatic ligation. All other other duplexes were prepared by solid phase synthesis. For TTR, impurities ("unreacted blockmers") were spiked in as representative of a “poor ligation reaction” and to ensure a response was seen. Representative impurities of a ligation reaction, i.e., unreacted blockments were added to the duplexes prepared by solid phase synthesis. The spiked blockmers usually form shorter duplexes with excess single strands, single strand impurities and other complementary blockmers present in the solution mixture. Quantities of each blockmer added to each duplex for UF screening are summarized in Table 18. Table 18: Material ID strand mg TTR duplex 17500 9-mer sense 3000 9-mer antisense 3000 Total TTR 23500 COV1 duplex 5000 13-mer sense 1200 18-mer antisense 50 15-mer antisense 50 13-mer antisense 1400 Total COV1 7700 GRB14 duplex 5000 13-mer sense 50 18-mer antisense 155 15-mer antisense 750 13-mer antisense 1300 Total GRB14 7255 PLG duplex 5000 13-mer sense 62 18-mer antisense 60 15-mer antisense 700 13-mer antisense 1150 Total PLG 6972 SLC02 duplex 5000 13-mer sense 50 18-mer antisense 50 15-mer antisense 1100 13-mer antisense 1400 Total SLC02 7600 Conclusion

[00388] In conclusion described herein is a novel purification method of siRNA that involves the kinetic resolution of duplexes based on differences in Tm and the mechanical removal of single strands. The removal single strands, resulting from the melting of the duplexes, are removed by ultrafiltration which takes advantage of the size difference between duplex and single strand. Table 18: Abbreviations used in sequences Af 2 ’ -deoxy-2 ’ -fluoroadeno sine-3 ’ -phosphate Afs 2 ’ -deoxy-2 ’ -fluoroadeno sine-3 ’ -phosphorothioate Cf 2 ’ -deoxy-2 ’ -fluorocytidine-3 ’ -phosphate Cfs 2 ’ -deoxy-2 ’ -fluorocytidine-3 ’ -phosphorothioate Gf 2 ’ -deoxy-2 ’ -fluoroguanosine-3 ’ -phosphate Gfs 2 ’ -deoxy-2 ’ -fluoroguanosine-3 ’ -phosphorothioate Uf 2 ’ -deoxy-2 ’ -fluorouridine-3 ’ -phosphate Ufs 2 ’ -deoxy-2 ’ -fluorouridine -3 ’ -phosphorothioate a 2'-O-methyladenosine-3 ’ -phosphate as 2'-O-methyladenosine-3 ’ - phosphorothioate c 2'-O-methylcytidine-3 ’ -phosphate cs 2'-O-methylcytidine-3 ’ - phosphorothioate g 2'-O-methylguanosine-3 ’ -phosphate gs 2'-O-methylguanosine-3 ’- phosphorothioate t 2 ’ -O-methyl-5-methyluridine-3 ’ -phosphate ts 2 ’ -O-methyl-5-methyluridine-3 ’ -phosphorothioate u 2'-O-methyluridine-3 ’ -phosphate US 2'-O-methyluridine-3 ’ -phosphorothioate s Phosphorothioate linkage - indicates modification of 3’-phosphate for 3’-phosphorothioate on the preceding nucleotide L96 (2S,4R)-1 -[29-[[2-(acetylamino)-2-deoxy-P-D-galactopyranosyl]oxy]-14,14-bis[[3-[[3-[[5-[[2-(acetylamino)-2-deoxy-P-D-galactopyranosyl]oxy]-l-oxopentyl]amino]propyl]amino]-3-oxopropoxy]methyl]-l,12,19,25-tetraoxo-16-oxa-13,20,24-triazanonacos-1 -yl]-4-hydroxy-2-hydroxymethylpyrrolidine HO z0H H        H hoY^-V0^^^ AcHM              n           r                        HQr wn OH                                             ~l                                    / A (-. V-Vil           H     H         1 H                    t HO ^---7--^0                           " N AeHN             o          o      o^ o H 0^-----7----^0.-.^^        ...... N.-.-. AcHN                 H       H * 3’-terminal nucleotides are 3’-OH unless conjugated to (L) or otherwise indicated

[00389] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

Claims

1. A method for separating shorter complementary or partially complementary oligonucleotides froma longer double-stranded or single-stranded oligonucleotide, the method comprises:filtering a initial solution comprising the shorter complementary or partially complementary oligonucleotides and the longer double-stranded or single-stranded oligonucleotide, to generate a purified longer double-stranded or single-stranded oligonucleotide product,wherein the initial solution further comprises a destabilizing agent.

2. The method of claim 1, wherein the initial solution comprises the destabilizing agent in an amount sufficient to lower the melting temperature (Tm) of short complementary or partially complementary oligonucleotides.

3. The method of claim 1 or 2, wherein the initial solution comprises the destabilizing agent in an amount sufficient to preferentially denature the short complementary or partially complementary oligonucleotides without substantially denaturing the longer double stranded product.

4. The method of any one of claim 1-3, wherein the initial solution comprises the destabilizing agent in an amount from about 0.04 M to about 12 M.

5. The method of any one of claim 1-4, wherein the initial solution comprises the destabilizing agent in an amount from about 0.1 M to about 0.5 M or from about 2 M to about 8 M.

6. The method of any one of claim 1-3, wherein the initial solution comprises the destabilizing agent in an amount from about 0.2 M to about 0.3 M or from about 5 M to about 7 M.

7. The method of any one of claims 1-3, wherein the initial solution comprises the destabilizing agentin an amount from about 5% to about 75% (w / v or v / v).

8. The method of claim 8, the initial solution comprises the destabilizing agent in an amount from about 10% to about 50% (w / v or v / v).

9. The method of claim 8, the initial solution comprises the destabilizing agent in an amount from about 20 % to about 40% (w / v or v / v).

10. The method of any one of claims 1-9, wherein the destabilizing agent is a salt, or a free acid form thereof.

11. The method of any one of claims 1-9, wherein the destabilizing agent is a solvent, e.g., an organic solvent or other small molecule.

12. The method of any one of claims 1-11, wherein the initial solution comprises at least two differentdestabilizing agents.

13. The method of any one of claims 1-12, wherein the filtration is performed at a temperature greaterthan 15°C.

14. The method of any one of claims 1-12, wherein the filtration is performed at a temperature from about 15°C to about 60°C.

15. The method of claim 14, wherein the filtration is performed at a temperature from about 15°C to about 35°C.

16. The method of claim Mor 15, wherein the filtration is performed at a temperature from about 15°C to about 25°C.

17. The method of any one of claims 14-16, wherein the filtration is performed at room temperature.

18. The method of any one of claims 1-17, wherein the filtration is performed at a pH above 7 (e.g.,between 7 and 11).

19. The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 3to about 11.

20. The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 3.5 to about 6.

21. The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 4to about 5.

22. The method of any one of claims 1-17, wherein the filtration is performed at a pH below 723.    The method of any one of claims 1-17, wherein the filtration is performed at a pH of from about 5to about 13.

24. The method of claim 23, wherein the filtration is performed at a pH of from about 6 to about 12.

25. The method of claim 23 or 24, wherein the filtration is performed at a pH of from about 10 to about11.

26. The method of any one of claims 1-25, wherein the filtration is performed at an elevated temperature and a pH above 7.

27. The method of any one of claims 1-26, wherein the filtration is tangential flow filtration.

28. The method of any one of claims 1-27, wherein the longer double-stranded or single-stranded oligonucleotide product is obtained by ligation of short complementary or partially complementary oligonucleotide fragments.

29. The method of claim 28, wherein the short complementary or partially complementary oligonucleotide fragments are obtained by chemical solid phase or solution phase synthesis, or enzymatic synthesis.

30. The method of claim 28 or 29, wherein the short complementary or partially complementary oligonucleotide fragments are independently 3 to 12 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, such as 4, 5, 6, 7, 9, 9 or 10) nucleotides in length.

31. The method of claims 28-30, wherein the longer double-stranded or single-stranded oligonucleotideproduct is obtained by enzymatic ligation or chemical ligation.

32. The method of claim 31, wherein the enzymatic ligation is using an RNA or DNA ligase.

33. The method of any one of claims 1-32, wherein the longer double-stranded or single-strandedoligonucleotide product is unmodified, partially, or completely modified RNA or DNA oligonucleotide.

34. The method of any one of claims 1-33, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one nucleic acid modification.

35. The method of any one of claims 1-34, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one nucleic acid modification selected from the group consisting of nucleobase modifications, sugar modifications, intemucleotide linkage modifications, conjugates (e.g., ligands), and any combinations thereof.

36. The method of any one of claims 1-35, wherein the longer double-stranded or single-stranded oligonucleotide product is conjugated with a ligand.

37. The method of any one of claims 1-36, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-0Me nucleotide.

38. The method of any one of claims 1-37, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-F nucleotide.

39. The method of any one of claims 1-38, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2’-H nucleotide.

40. The method of any one of claims 1-39, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) thermally destabilizing modification of the duplex.

41. The method of any one of claims 1-40, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) lipophilic modifications, e.g., a nucleotide modified with one lipophilic group.

42. The method of any one of claims 1-41, wherein the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1,2, 3,4, 5,6,7, 8, 9,10 or more) non-natural or modified nucleobase.

43. The method of any one of claims 1-42, the longer double-stranded or single-stranded oligonucleotide product comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) modified intemucleoside linkage (e.g. phosphorothioates or a small molecule linker).

44. The method of any one of claims 1-43, wherein the product is the longer single-stranded oligonucleotide.

45. The method of claim 44, wherein the single-stranded oligonucleotide product is from about 15 to about 200 nucleotides in length, e.g., from about 15 to about 50 nucleotides in length, such as 15,16, 17, 28, 19, 20,21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, optionally 19, 20, 21, 22, 23, 24 or 25 nucleotides, preferably 19, 20, 21, 22 or 23 nucleotides in length.

46. The method of any one of claims 1-45, wherein the single-stranded oligonucleotide product is at least 3 (e.g., 4, 5, 6, 7, 8, 9, 10 or more, such as 4, 5, 6, 7, 8 or more) nucleotides longer than the short complementary or partially complementary oligonucleotide fragments.

47. The method of any one of claims 1-43, wherein the product is a double-stranded oligonucleotide.

48. The method of claim 47, wherein the double-stranded oligonucleotide product comprises a firststrand and a second strand substantially complementary to the first strand, and wherein at least one of the first or second strand of the double-stranded oligonucleotide product is at least 3 (e.g., 4, 5, 6,7, 8,9,10 or more, such as 4, 5, 6,7, 8 or more) nucleotides longer than the short complementary or partially complementary oligonucleotides.

49. The method of claim 47 or 48, wherein the double-stranded oligonucleotide product comprises at least 2 (e.g., 3,4, 5, 6,7, 8,9, 10 or more, such as 2, 3,4, 5 or more) nucleotide base-pairs than the short complementary or partially complementary oligonucleotides.

50. The method of any one of claims 47-49, wherein the double-stranded oligonucleotide product comprises a first strand and a second strand substantially complementary to the first strand, wherein each of the first and second strand is independently from about 15 to about 30 nucleotides (e.g., 15, 16, 17, 28, 19, 20,21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, such as 19, 20, 21, 22, 23, 24 or 25 nucleotides) in length, and wherein the first and second strand hybridize to each other to form a duplex region of from about 15 base-pairs to about 30 base-pairs (e.g., a duplex region of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 27, 28, 29 or 30 base-pairs, such as a duplex region of 18, 19,20,21, 22, 23 or 24 base-pairs).

51. The method of any one of claims 47-50, wherein the one or both of the first and second strand havea 1-2 nucleotide overhang on its respective 5’-end or 3’-end.

52. The method of claim 51, wherein only one of the first or second strand has a two-nucleotide overhang on its 5’-end or 3’-end.

53. The method of claim 52, wherein only one of the first or second strand has a two-nucleotide overhang on its 3’-end.

54. The method of any one of claims 1-53, wherein the double-stranded oligonucleotide product is capable of inducing RNA interference.

55. The method of claim 54, wherein the product is a therapeutic siRNA.

56. The method of any one of claims 1-55, wherein the initial solution is a reaction mixture from aligation reaction mixture.

57. The method of claim 56, wherein the method further comprises a step of processing the reaction mixture to remove one or more ligation reagents / components present in the reaction mixture prior to the step of filtering the initial solution.

58. The method of any one of claims 1-57, wherein a total nucleic acid concentration in the initial solution is at least about 0.1 mg / ml (e.g., about 0.5mg / ml, about Img / ml, about 1.5mg / mL, about 2mg / mL, about 2.5mg / mL, about 5mg / mL, about 7.5mg / mL, about lOmg / mL, about 15mg / mL, about 20mg / mL, about 25 mg / mL, about 30mg / mL, about 35mg / mL, about 40mg / mL, about 45mg / mL, about 50mg / mL, about 55mg / mL, about 60mg / mL, about 65mg / mL, about 70mg / mL, about 75mg / mL, about 80mg / mL, about 85mg / mL, about 90mg / mL, about 95mg / mL, about lOOmg / mL or more).

59. The method of any one of claims 1-58, wherein the method further comprises a step of removing the destabilizing agent from the purified product.

60. The method of any one of claims 1-59, wherein the method further comprises a step of lyophilizing the purified product.

61. The method of any one of claims 1-60, wherein the purified product is in a retentate from the filtering step.

62. The method of any one of claims 1-60, wherein the purified product is in a permeate from the filtering step.

63. The method of any one of claims 1-62, wherein the filtering is continuous filtering.

64. The method of any one of claims 1-63, wherein the filtering is batch filtering.

65. The method of any one of claims 1-64, wherein the destabilizing agent comprises sodium carbonate, sodium citrate, DMF, urea, or potassium carbonate.

Images