Engineered meganucleases having specificity for recognition sequences in the dystrophin gene

AU2026223416A1Pending Publication Date: 2026-09-17PRECISION BIOSCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
AU2026223416
Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-08-31
Publication Date
2026-09-17

Smart Images

  • Figure 00000238_0000
    Figure 00000238_0000
  • Figure 00000239_0000
    Figure 00000239_0000
  • Figure 00000240_0000
    Figure 00000240_0000
Patent Text Reader

Abstract

20 26 22 34 16 31 A ug 2 02 6 A B S T R A C T 2 0 2 6 2 2 3 4 1 6 3 1 2 0 2 6 A u g
Need to check novelty before this filing date? Find Prior Art

Description

RELATED APPLICATIONS 5 This is a divisional of Australian Patent Application No. 2021380823, the originally-filed specification of which is incorporated herein by reference in its entirety. FIELD OF THE INVENTION The application relates to the field of engineered meganucleases, molecular biology and recombinant nucleic acid technology. In particular aspects, the invention relates to 0 engineered meganucleases useful for the removal of exons from the dystrophin gene and for the treatment of subjects having Duchenne Muscular Dystrophy. REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS-WEB 15          The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 12, 2021is named P109070054WO00-SEQ-EPG, and is 279,819 bytes in size. 20                  BACKGROUND OF THE INVENTION Duchenne Muscular Dystrophy (DMD) is a rare, X-linked muscle degenerative disorder that affects about 1 in every 3500 boys worldwide. The disease is caused by mutations in the dystrophin gene, which is the largest known gene. The dystrophin gene spans 2.2 Mb of the X chromosome and encodes predominantly a 14-kb transcript derived 25 from 79 exons. The full-length dystrophin protein, as expressed in skeletal muscle, smooth muscle, and cardiomyocytes, is 3685 amino acids and has a molecular weight of 427 kD. The severe Duchenne phenotype is generally associated with the loss of full-length dystrophin protein from skeletal and cardiac muscle, which leads to debilitating muscle degeneration and, ultimately, heart failure. A large number of different dystrophin gene 30 mutations have been described, many of them resulting in either the severe DMD or the milder Becker Muscular Dystrophy. There are several therapeutic strategies being pursued for the treatment of DMD. First, “gene replacement” strategies are an active area of research (Oshima et al. (2009) J. 2026223416   31 Aug 2026 Am. Soc. Gene Ther. 17:73-80; Liu et al. (2005) Mol. Ther. 11:245-56; Lai et al. (2006) Hum Gene Ther. 17:1036-42; Odom et al. (2008) Mol. Ther. 16:1539-45). This approach involves delivering a functional copy of the dystrophin gene to patients using a viral delivery vector, typically adeno-associated virus (AAV). The large size of the dystrophin gene makes it 5 incompatible with the limited carrying capacity of common viral vectors, however. This necessitates the use of a “micro-dystrophin” gene in which most of the repetitive central portion of the gene is removed to leave only the minimally functional protein. It is not clear, however, that expression of “micro-dystrophin” is sufficient for clinical benefit. In addition, this approach suffers from the possibility of random gene integration into the patient genome, 0 which could lead to insertional mutagenesis, and the potential for immune reactions against the delivery vector. A second approach to treating DMD involves the transplantation of healthy muscle precursor cells into patient muscle fibers (Peault et al. (2007) Mol. Ther. 15:867-77; Skuk et al. (2007) Neuromuscul. Disord. 17:38-46). This approach suffers from inefficient migration 15 of the transplanted myoblasts and the potential for immune rejection by the patient. A third approach involves suppression of nonsense mutations using PTC124 (Welch et al. (2007) Nature 447:87-91). This would require lifelong dosing of the drug, however, and the approach is yet to show any significant clinical benefit. A fourth approach for treating DMD is called “Exon Skipping” (Williams et al. 20   (2008) BMC Biotechnol. 8:35; Jearawiriyapaisarn et al. (2008) Mol Ther. 16:1624-29; Yokota et al. (2007) Acta Myol. 26:179-84; van Deutekom et al. (2001) Hum. Mol. Gen. 10:1547-54; Benedetti et al. (2013) FEBS J. 280:4263-80; Rodino-Klapac (2013) Curr Neurol Neurosci Rep. 13:332; Verhaart & Aartsma-Rus (2012) Curr Opin Neurol. 25:58896). In general, the amino (N)- and carboxy (C)-terminal portions of the dystrophin gene are 25 essential for its role as a “scaffold” protein that maintains membrane integrity in muscle fibres, whereas the central “rod domain”, which comprises 24 spectrin-like repeats, is at least partially dispensable. Indeed, the severe Duchenne phenotype is typically associated with mutations in the dystrophin gene that introduce frameshifts and / or premature termination codons, resulting in a truncated form of the dystrophin protein lacking the essential C- 30 terminal domain. Mutations in the central rod domain, including large deletions of whole exons, typically result in the much milder Becker phenotype if they maintain the reading frame such that the C-terminal domain of the protein is intact. DMD is most frequently caused by the deletion of one or more whole exon(s), resulting in reading frame shift. For example, Exon 45 is frequently deleted in Duchenne 2026223416   31 Aug 2026 patients. Because Exon 45 is 176 bp long, which is not divisible by three, deleting the exon shifts Exons 46-79 into the wrong reading frame. The same can be said of Exon 44, which is 148 bp in length. However, if Exons 44 and 45 are deleted, the total size of the deletion is 324 bp, which is divisible by three. Thus, the deletion of both exons does not result in a 5 reading frame shift. Because these exons encode a portion of the non-essential rod domain of the dystrophin protein, deleting them from the protein is expected to result in a mild Becker-like phenotype. Thus, a patient with the Duchenne phenotype due to the deletion of one or more exon(s) can, potentially, be treated by eliminating one or more adjacent exons to restore the reading frame. This is the principle behind “Exon Skipping,” in which modified 0 oligonucleotides are used to block splice acceptor sites in dystrophin pre-mRNA so that one or more specific exons are absent from the processed transcript. The approach has been used to restore dystrophin gene expression in the mdx mouse model by skipping Exon 23, which harbored a disease-inducing nonsense mutation (Mann et al. (2001) Proc. Nat. Acad. Sci. USA 98:42-47). Oligonucleotide analogs that induce skipping of Exon 51 have also shown 15 promise in early human clinical trials (Benedetti et al. (2013) FEBS J. 280:4263-80). The major limitations with this approach are: (1) the exon-skipping process is inefficient, resulting in relatively low levels of functional dystrophin expression; and (2) the exonskipping oligonucleotide has a relatively short half-life so the affect is transient, necessitating repeated and life-long dosing. Thus, while Exon-Skipping approaches have shown some 20 promise in clinical trials, the improvements in disease progression have been minimal and variable. The present disclosure improves upon current Exon-Skipping approaches by correcting gene expression at the level of the genomic DNA rather than pre-mRNA. The invention is a permanent treatment for DMD that involves the excision of specific exons from 25 the dystrophin coding sequence using a pair of engineered, site-specific homing endonucleases, often referred to as meganucleases. By targeting a pair of such endonucleases to sites in the intronic regions flanking exons in the dystrophin gene, it is possible to permanently remove the intervening fragment from the genome. The resulting cell, and its progeny, will express a modified dystrophin in which a portion of the non-essential spectrin 30 repeat domain is removed but the essential N- and C-terminal domains are intact. Homing endonucleases, or meganucleases, are a group of naturally-occurring nucleases that recognize 15-40 base-pair cleavage sites commonly found in the genomes of plants and fungi. They are frequently associated with parasitic DNA elements, such as group 1 self-splicing introns and inteins. They naturally promote homologous recombination or 2026223416   31 Aug 2026 gene insertion at specific locations in the host genome by producing a double-stranded break in the chromosome, which recruits the cellular DNA-repair machinery (Stoddard (2006) Q. Rev. Biophys. 38:49-95). Homing endonucleases are commonly grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family and the HNH family. 5 These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif (see, Chevalier et al. (2001) Nucleic Acids Res. 29:3757-74). The LAGLIDADG homing endonucleases with a single copy of the LAGLIDADG motif form homodimers, whereas members with two copies 0 of the LAGLIDADG motif are found as monomers. I-CreI (SEQ ID NO: 1) is a member of the LAGLIDADG family of homing endonucleases that recognizes and cuts a 22 basepair recognition sequence in the chloroplast chromosome of the algae Chlamydomonas reinhardtii. Genetic selection techniques have been used to modify the wild-type I-CreI cleavage site preference (Sussman et al. (2004) J. 15   Mol. Biol. 342:31-41; Chames et al. (2005) Nucleic Acids Res. 33:e178; Seligman et al. (2002) Nucleic Acids Res. 30:3870-79, Arnould et al. (2006) J. Mol. Biol. 355:443-58). Methods of rationally-designing mono-LAGLIDADG homing endonucleases have been described which are capable of comprehensively redesigning I-CreI and other homing endonucleases to target widely-divergent DNA sites, including sites in mammalian, yeast, 20 plant, bacterial, and viral genomes (WO 2007 / 047859). As first described in WO 2009 / 059195, I-CreI and its engineered derivatives are normally dimeric but can be fused into a single polypeptide using a short peptide linker that joins the C-terminus of a first subunit to the N-terminus of a second subunit (Li et al. (2009) Nucleic Acids Res. 37:1650-62; Grizot et al. (2009) Nucleic Acids Res. 37:5405-19). Thus, a 25 functional “single-chain” meganuclease can be expressed from a single transcript. By delivering genes encoding two different single-chain meganucleases to the same cell, it is possible to simultaneously cut two different sites. This, coupled with the extremely low frequency of off-target cutting observed with engineered meganucleases makes them the preferred endonuclease for the present disclosure. 30 SUMMARY OF THE INVENTION The present disclosure provides engineered meganucleases that bind and cleave recognition sequences in a dystrophin gene (e.g., a human dystrophin gene), as well as compositions comprising such engineered meganucleases and methods of their use. In some 2026223416   31 Aug 2026 embodiments, pairs of engineered meganucleases are used to remove multiple exons from a dystrophin gene by generating a first cleavage site in an intron upstream of a first exon and a second cleavage site in an intron downstream of a second exon. In particular examples described herein, the first cleavage site is generated in the intron 5' upstream of exon 45 of 5 the dystrophin gene, while the second cleavage site is generated in the intron 3' downstream of exon 55. This process allows for excision and removal of exons 45-55 from the dystrophin gene following annealment of the two cleavage sites and repair of the genome. The recognition sequences targeted by the disclosed engineered meganucleases are selected to have identical four basepair center sequences, such that the first and second cleavage sites 0 will have complementary four basepair 3' overhangs that can perfectly ligate to one another (i.e., each basepair of one overhang pairs with its complement on the other overhang). By removing exons 45-55 from a mutant dystrophin gene that lacks one or more of these exons, this approach results in a restoration of the normal (i.e., wild-type) reading frame of the dystrophin gene. Cells so treated will express a shortened modified form of the dystrophin 15 protein in which a portion of the central spectrin repeat domain is absent but the N- and C-terminal domains are intact. This will, in many cases, reduce the severity of the disease. In some cases, it will result in a milder Becker phenotype. Thus, in one aspect, the invention provides an engineered meganuclease that binds and cleaves a recognition sequence in a dystrophin gene, wherein the engineered 20 meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. In some embodiments, the recognition sequence comprises SEQ ID NO: 6. 25         In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 30   77 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 2026223416   31 Aug 2026 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 36-44. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 5 sequence identity to residues 7-153 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 0 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 38, 39, or 149. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit 15 comprises residues 7-153 of any one of SEQ ID NOs: 36-44. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises one or more 20 residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to 25 residue 257 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises a residue corresponding to residue 236 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 36-37. In some embodiments, the HVR2 region comprises a 30 residue corresponding to residue 263 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some 2026223416   31 Aug 2026 embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 3644. In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 5 sequence identity to residues 198-344 of any one of SEQ ID NOs: 36-44. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 36-44. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 36-44. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of 0 any one of SEQ ID NOs: 36, 39, 40, 43, or 44. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 36-38 or 4044. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, 15 the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 36-44. In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 20   97%, 98%, 99% or more sequence identity any one of SEQ ID NOs: 36-44. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 36-44. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in any one of SEQ 25 ID NOs: 60-68. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 60-68. In some embodiments, the recognition sequence comprises SEQ ID NO: 10. In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 30 sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 2026223416   31 Aug 2026 77 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some 5 embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 45-52. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 0 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 45-51. In some 15 embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 45-52. In some such embodiments, the HVR2 region comprises an amino acid sequence 20 having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 25 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises residues corresponding to residues 239, 241, and 264 of any one of SEQ ID NOs: 30   45-52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 250 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 or any one of SEQ ID NOs: 45 or 46. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 45-52 with up to 1, 2026223416   31 Aug 2026 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 45-52. In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 5 sequence identity to residues 198-344 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of 0 SEQ ID NO: 52. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises 15 residues 198-344 of any one of SEQ ID NOs: 45-52. In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 20   97%, 98%, 99% or more sequence identity any one of SEQ ID NOs: 45-52. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 45-52. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in any one of SEQ 25 ID NOs: 69-76. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 69-76. In some embodiments, the recognition sequence comprises SEQ ID NO: 12. In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 30 sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 2026223416   31 Aug 2026 77 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises a residue corresponding to residue 64 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises residues 24-79 of any 5 one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 53-59. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 0 sequence identity to residues 7-153 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 15 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 53-55, 57, or 58. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit 20 comprises residues 7-153 of any one of SEQ ID NOs: 53-59. In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises one or more 25 residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to 30 residue 257 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 53 or SEQ ID NO: 55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 53-55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 255 of SEQ ID NO: 55. In some embodiments, the HVR2 2026223416   31 Aug 2026 region comprises a residue corresponding to residue 263 of any one of SEQ ID NOs: 56-59. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino 5 acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 53-59. In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of any one of SEQ ID NOs: 53-59. In some 0 embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 53-59. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 53-59. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 53 or 55-59. In some embodiments, the second subunit comprises a 15 residue corresponding to residue 330 of any one of SEQ ID NOs: 54-59. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 53-59. 20          In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity any one of SEQ ID NOs: 53-59. In some 25 embodiments, the engineered meganuclease comprises the amino acid sequence of any one of SEQ ID NOs: 53-59. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 77-83. In some embodiments, the engineered meganuclease is encoded by a nucleic 30 sequence set forth in any one of SEQ ID NOs: 77-83. In each of the embodiments above, the engineered meganuclease can comprise a nuclear localization signal. In some embodiments, the nuclear localization signal is at the N-terminus of the engineered meganuclease. In some embodiments, the nuclear localization signal comprises an amino acid sequence having at least 80% or at least 90% sequence 2026223416   31 Aug 2026 identity to SEQ ID NO: 3. In some embodiments, the nuclear localization signal comprises SEQ ID NO: 3. In another aspect, the invention provides a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the 5 polynucleotide is an mRNA. In another aspect, the invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising the polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises 15 an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises an amino acid sequence of SEQ ID NO: 182. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 183. In some 20 embodiments, the AAV9 capsid comprises an amino acid sequence of SEQ ID NO: 183. In some embodiments, the recombinant AAV has an AAV8 capsid. In some embodiments, the nucleic acid sequence comprises a promoter operably linked to the nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, 25 the muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter. In some embodiments, the promoter is capable of expressing an engineered meganuclease described herein in a muscle precursor cell (e.g., a satellite cell or stem cell). 30          In another aspect, the invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some 2026223416   31 Aug 2026 embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 182. In some embodiments, the rh.74 5 capsid comprises an amino acid sequence of SEQ ID NO: 182. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 183. In some embodiments, the AAV9 capsid comprises an amino acid sequence of SEQ ID NO: 183. In some embodiments, the 0 recombinant AAV has an AAV8 capsid. In some embodiments, the polynucleotide comprises a promoter operably linked to the nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 15 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter. In some embodiments, the promoter is capable of expressing an engineered meganuclease described herein in a muscle precursor cell (e.g., a satellite cell or stem cell). In another aspect, the invention provides a lipid nanoparticle composition comprising 20 lipid nanoparticles comprising a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding an engineered meganuclease described herein. In some embodiments, the polynucleotide is an mRNA. In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an engineered meganuclease described herein. 25          In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a polynucleotide described herein. In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a recombinant DNA construct described herein. In another aspect, the invention provides a pharmaceutical composition comprising a 30 pharmaceutically acceptable carrier and a recombinant virus described herein. In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a lipid nanoparticle composition described herein. In another aspect, the invention provides a polynucleotide comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence 2026223416   31 Aug 2026 encoding a second engineered meganuclease, wherein the first engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and wherein the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 10, or wherein the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 1. 15 Table 1. Recognition Sequence of SEQ ID NO: 6 Recognition Sequence of SEQ ID NO: 10 Combination First Meganuclease SEQ ID NO: Second Meganuclease SEQ ID NO: 1 DMD 19-20x.13 36 DMD 35-36x.63 45 2 DMD 19-20x.87 37 DMD 35-36x.63 45 3 DMD 19-20L.249 38 DMD 35-36x.63 45 4 DMD 19-20L.302 39 DMD 35-36x.63 45 5 DMD 19-20L.329 40 DMD 35-36x.63 45 6 DMD 19-20L.374 41 DMD 35-36x.63 45 7 DMD 19-20L.375 42 DMD 35-36x.63 45 8 DMD 19-20L.431 43 DMD 35-36x.63 45 9 DMD 19-20L.458 44 DMD 35-36x.63 45 10 DMD 19-20x.13 36 DMD 35-36x.81 46 11 DMD 19-20x.87 37 DMD 35-36x.81 46 12 DMD 19-20L.249 38 DMD 35-36x.81 46 13 DMD 19-20L.302 39 DMD 35-36x.81 46 14 DMD 19-20L.329 40 DMD 35-36x.81 46 15 DMD 19-20L.374 41 DMD 35-36x.81 46 16 DMD 19-20L.375 42 DMD 35-36x.81 46 17 DMD 19-20L.431 43 DMD 35-36x.81 46 2026223416   31 Aug 2026 Recognition Sequence of SEQ ID NO: 6 Recognition Sequence of SEQ ID NO: 10 Combination First Meganuclease SEQ ID NO: Second Meganuclease SEQ ID NO: 18 DMD 19-20L.458 44 DMD 35-36x.81 46 19 DMD 19-20x.13 36 DMD 35-36L.195 47 20 DMD 19-20x.87 37 DMD 35-36L.195 47 21 DMD 19-20L.249 38 DMD 35-36L.195 47 22 DMD 19-20L.302 39 DMD 35-36L.195 47 23 DMD 19-20L.329 40 DMD 35-36L.195 47 24 DMD 19-20L.374 41 DMD 35-36L.195 47 25 DMD 19-20L.375 42 DMD 35-36L.195 47 26 DMD 19-20L.431 43 DMD 35-36L.195 47 27 DMD 19-20L.458 44 DMD 35-36L.195 47 28 DMD 19-20x.13 36 DMD 35-36L.282 48 29 DMD 19-20x.87 37 DMD 35-36L.282 48 30 DMD 19-20L.249 38 DMD 35-36L.282 48 31 DMD 19-20L.302 39 DMD 35-36L.282 48 32 DMD 19-20L.329 40 DMD 35-36L.282 48 33 DMD 19-20L.374 41 DMD 35-36L.282 48 34 DMD 19-20L.375 42 DMD 35-36L.282 48 35 DMD 19-20L.431 43 DMD 35-36L.282 48 36 DMD 19-20L.458 44 DMD 35-36L.282 48 37 DMD 19-20x.13 36 DMD 35-36L.349 49 38 DMD 19-20x.87 37 DMD 35-36L.349 49 39 DMD 19-20L.249 38 DMD 35-36L.349 49 40 DMD 19-20L.302 39 DMD 35-36L.349 49 41 DMD 19-20L.329 40 DMD 35-36L.349 49 42 DMD 19-20L.374 41 DMD 35-36L.349 49 43 DMD 19-20L.375 42 DMD 35-36L.349 49 44 DMD 19-20L.431 43 DMD 35-36L.349 49 45 DMD 19-20L.458 44 DMD 35-36L.349 49 46 DMD 19-20x.13 36 DMD 35-36L.376 50 47 DMD 19-20x.87 37 DMD 35-36L.376 50 48 DMD 19-20L.249 38 DMD 35-36L.376 50 49 DMD 19-20L.302 39 DMD 35-36L.376 50 50 DMD 19-20L.329 40 DMD 35-36L.376 50 51 DMD 19-20L.374 41 DMD 35-36L.376 50 52 DMD 19-20L.375 42 DMD 35-36L.376 50 53 DMD 19-20L.431 43 DMD 35-36L.376 50 2026223416   31 Aug 2026 Recognition Sequence of SEQ ID NO: 6 Recognition Sequence of SEQ ID NO: 10 Combination First Meganuclease SEQ ID NO: Second Meganuclease SEQ ID NO: 54 DMD 19-20L.458 44 DMD 35-36L.376 50 55 DMD 19-20x.13 36 DMD 35-36L.457 51 56 DMD 19-20x.87 37 DMD 35-36L.457 51 57 DMD 19-20L.249 38 DMD 35-36L.457 51 58 DMD 19-20L.302 39 DMD 35-36L.457 51 59 DMD 19-20L.329 40 DMD 35-36L.457 51 60 DMD 19-20L.374 41 DMD 35-36L.457 51 61 DMD 19-20L.375 42 DMD 35-36L.457 51 62 DMD 19-20L.431 43 DMD 35-36L.457 51 63 DMD 19-20L.458 44 DMD 35-36L.457 51 64 DMD 19-20x.13 36 DMD 35-36L.469 52 65 DMD 19-20x.87 37 DMD 35-36L.469 52 66 DMD 19-20L.249 38 DMD 35-36L.469 52 67 DMD 19-20L.302 39 DMD 35-36L.469 52 68 DMD 19-20L.329 40 DMD 35-36L.469 52 69 DMD 19-20L.374 41 DMD 35-36L.469 52 70 DMD 19-20L.375 42 DMD 35-36L.469 52 71 DMD 19-20L.431 43 DMD 35-36L.469 52 72 DMD 19-20L.458 44 DMD 35-36L.469 52 In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some 5 embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 10   46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second 15 engineered meganuclease is DMD 35-36L.195 (SEQ ID NO: 47), or a variant thereof 2026223416   31 Aug 2026 described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 5   40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. In some embodiments, the first engineered 0 meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. In certain embodiments, the first engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising 15 SEQ ID NO: 6, and the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 2. 20 Table 2. Recognition Sequence of SEQ ID NO: 6 Recognition Sequence of SEQ ID NO: 12 Combination First Meganuclease SEQ ID NO: Second Meganuclease SEQ ID NO: 1 DMD 19-20x.13 36 DMD 37-38x.15 46 2 DMD 19-20x.87 37 DMD 37-38x.15 46 3 DMD 19-20L.249 38 DMD 37-38x.15 46 4 DMD 19-20L.302 39 DMD 37-38x.15 46 5 DMD 19-20L.329 40 DMD 37-38x.15 46 6 DMD 19-20L.374 41 DMD 37-38x.15 46 7 DMD 19-20L.375 42 DMD 37-38x.15 46 8 DMD 19-20L.431 43 DMD 37-38x.15 46 9 DMD 19-20L.458 44 DMD 37-38x.15 46 10 DMD 19-20x.13 36 DMD 37-38x.66 47 11 DMD 19-20x.87 37 DMD 37-38x.66 47 12 DMD 19-20L.249 38 DMD 37-38x.66 47 2026223416   31 Aug 2026 Recognition Sequence of SEQ ID NO: 6 Recognition Sequence of SEQ ID NO: 12 Combination First Meganuclease SEQ ID NO: Second Meganuclease SEQ ID NO: 13 DMD 19-20L.302 39 DMD 37-38x.66 47 14 DMD 19-20L.329 40 DMD 37-38x.66 47 15 DMD 19-20L.374 41 DMD 37-38x.66 47 16 DMD 19-20L.375 42 DMD 37-38x.66 47 17 DMD 19-20L.431 43 DMD 37-38x.66 47 18 DMD 19-20L.458 44 DMD 37-38x.66 47 19 DMD 19-20X.13 36 DMD 37-38x.79 48 20 DMD 19-20x.87 37 DMD 37-38x.79 48 21 DMD 19-20L.249 38 DMD 37-38x.79 48 22 DMD 19-20L.302 39 DMD 37-38x.79 48 23 DMD 19-20L.329 40 DMD 37-38x.79 48 24 DMD 19-20L.374 41 DMD 37-38x.79 48 25 DMD 19-20L.375 42 DMD 37-38x.79 48 26 DMD 19-20L.431 43 DMD 37-38x.79 48 27 DMD 19-20L.458 44 DMD 37-38x.79 48 28 DMD 19-20X.13 36 DMD 37-38L.166 49 29 DMD 19-20x.87 37 DMD 37-38L.166 49 30 DMD 19-20L.249 38 DMD 37-38L.166 49 31 DMD 19-20L.302 39 DMD 37-38L.166 49 32 DMD 19-20L.329 40 DMD 37-38L.166 49 33 DMD 19-20L.374 41 DMD 37-38L.166 49 34 DMD 19-20L.375 42 DMD 37-38L.166 49 35 DMD 19-20L.431 43 DMD 37-38L.166 49 36 DMD 19-20L.458 44 DMD 37-38L.166 49 37 DMD 19-20X.13 36 DMD 37-38L.478 57 38 DMD 19-20x.87 37 DMD 37-38L.478 57 39 DMD 19-20L.249 38 DMD 37-38L.478 57 40 DMD 19-20L.302 39 DMD 37-38L.478 57 41 DMD 19-20L.329 40 DMD 37-38L.478 57 42 DMD 19-20L.374 41 DMD 37-38L.478 57 43 DMD 19-20L.375 42 DMD 37-38L.478 57 44 DMD 19-20L.431 43 DMD 37-38L.478 57 45 DMD 19-20L.458 44 DMD 37-38L.478 57 46 DMD 19-20x.13 36 DMD 37-38L.512 58 47 DMD 19-20x.87 37 DMD 37-38L.512 58 48 DMD 19-20L.249 38 DMD 37-38L.512 58 2026223416   31 Aug 2026 Recognition Sequence of SEQ ID NO: 6 Recognition Sequence of SEQ ID NO: 12 Combination First Meganuclease SEQ ID NO: Second Meganuclease SEQ ID NO: 49 DMD 19-20L.302 39 DMD 37-38L.512 58 50 DMD 19-20L.329 40 DMD 37-38L.512 58 51 DMD 19-20L.374 41 DMD 37-38L.512 58 52 DMD 19-20L.375 42 DMD 37-38L.512 58 53 DMD 19-20L.431 43 DMD 37-38L.512 58 54 DMD 19-20L.458 44 DMD 37-38L.512 58 55 DMD 19-20x.13 36 DMD 37-38L.528 59 56 DMD 19-20x.87 37 DMD 37-38L.528 59 57 DMD 19-20L.249 38 DMD 37-38L.528 59 58 DMD 19-20L.302 39 DMD 37-38L.528 59 59 DMD 19-20L.329 40 DMD 37-38L.528 59 60 DMD 19-20L.374 41 DMD 37-38L.528 59 61 DMD 19-20L.375 42 DMD 37-38L.528 59 62 DMD 19-20L.431 43 DMD 37-38L.528 59 63 DMD 19-20L.458 44 DMD 37-38L.528 59 In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some 5 embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 10   54), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 54), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered 15 meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In some embodiments, the 2026223416   31 Aug 2026 first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38L.166 (SEQ ID NO: 56), or a variant thereof described herein. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the 5 first nucleic acid sequence and the second nucleic acid sequence are separated by an IRES or 2A sequence. In certain embodiments, the 2A sequence is a T2A, P2A, E2A, or F2A sequence. In another aspect, the invention provides a recombinant DNA construct comprising a polynucleotide described herein (i.e., that comprises a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease). In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are separated by an IRES or 2A sequence. In certain embodiments, the 2A sequence is a T2A, P2A, E2A, or F2A sequence. 15          In some embodiments, the polynucleotide comprises a promoter operably linked to the first nucleic acid sequence and the second nucleic acid sequence. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or 20 a SP-905 promoter. In some embodiments, the promoter is capable of expressing a first and second engineered meganuclease described herein in a muscle precursor cell (e.g., a satellite cell or stem cell). In some embodiments, the polynucleotide comprises a first promoter operably linked to the first nucleic acid sequence and a second promoter operably linked to the second nucleic 25 acid sequence. In some embodiments, the first promoter and the second promoter are muscle-specific promoters. In some embodiments, the muscle-specific promoters comprise an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, a SP-905 promoter, or a combination thereof. In some embodiments, the promoters are capable of expressing a 30 first and second engineered meganuclease described herein in a muscle precursor cell (e.g., a satellite cell or stem cell). In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising the polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant 2026223416   31 Aug 2026 AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 5   97%, 98%, 99% or more identity to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises an amino acid sequence of SEQ ID NO: 182. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 183. In some embodiments, the AAV9 capsid comprises an amino acid sequence of SEQ ID NO: 183. In 0 some embodiments, the recombinant AAV has an AAV8 capsid. In another aspect, the invention provides a recombinant virus comprising a polynucleotide described herein (i.e., that comprises a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease). 15          In some embodiments, the polynucleotide comprises a promoter operably linked to the first nucleic acid sequence and the second nucleic acid sequence. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are separated by an IRES or 2A sequence. In certain embodiments, the 2A sequence is a T2A, P2A, E2A, or F2A sequence. 20          In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter. In some embodiments, the promoter is capable of expressing an engineered meganuclease described herein in a muscle precursor 25 cell (e.g., a satellite cell or stem cell). In some embodiments, the polynucleotide comprises a first promoter operably linked to the first nucleic acid sequence and a second promoter operably linked to the second nucleic acid sequence. In some embodiments, the first promoter and the second promoter are muscle-specific promoters. In some embodiments, the muscle-specific promoters comprise 30 an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, a SP-905 promoter, or a combination thereof. In some embodiments, the promoters are capable of expressing an engineered meganuclease described herein in a muscle precursor cell (e.g., a satellite cell or stem cell). In some embodiments, the recombinant virus is a recombinant adenovirus, a 2026223416   31 Aug 2026 recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence 5 having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises an amino acid sequence of SEQ ID NO: 182. In some embodiments, the AAV9 capsid comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 183. In some embodiments, the AAV9 0 capsid comprises an amino acid sequence of SEQ ID NO: 183. In some embodiments, the recombinant AAV has an AAV8 capsid. In another aspect, the invention provides a lipid nanoparticle composition comprising lipid nanoparticles comprising a polynucleotide described herein (i.e., that comprises a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid 15 sequence encoding a second engineered meganuclease). In some embodiments, the polynucleotide is an mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct described herein. In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a polynucleotide described herein (i.e., that 20 comprises a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease). In some embodiments, the polynucleotide comprises an mRNA described herein. In some embodiments, the polynucleotide comprises a recombinant DNA construct described herein. In some embodiments, the pharmaceutical composition comprises a recombinant virus 25 described herein. In some embodiments, the pharmaceutical composition comprises a lipid nanoparticle composition described herein. In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of the genetically modified eukaryotic cell, the method comprising: introducing into a eukaryotic 30 cell a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered meganuclease is expressed in the eukaryotic cell, and wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a 2026223416   31 Aug 2026 muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle, an mRNA, or a recombinant virus (e.g., a 5 recombinant AAV). In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of the genetically modified eukaryotic cell, the method comprising: introducing into a eukaryotic cell an engineered meganuclease described herein, wherein the engineered meganuclease 0 produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. 15          In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into a dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell one or more polynucleotides comprising: a first nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered 20 meganuclease is expressed in the eukaryotic cell; and a second nucleic acid sequence comprising the sequence of interest, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, and wherein the sequence of interest is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises nucleic acid sequences 25 homologous to nucleic acid sequences flanking the cleavage site and the sequence of interest is inserted at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the 30 mammalian cell is a human cell. In some embodiments, the one or more polynucleotides are introduced into the eukaryotic cell by lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAVs). In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into a 2026223416   31 Aug 2026 dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell an engineered meganuclease described herein, and a polynucleotide comprising the sequence of interest, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID 5 NO: 6, and wherein the sequence of interest is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises nucleic acid sequences homologous to nucleic acid sequences flanking the cleavage site and the sequence of interest is inserted at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle 0 cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle, an mRNA, or a recombinant virus (e.g., a recombinant AAV). 15          In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of the genetically modified eukaryotic cell, the method comprising: introducing into a eukaryotic cell a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered meganuclease is expressed in the 20 eukaryotic cell, and wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some 25 embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle, an mRNA, or a recombinant virus (e.g., a recombinant AAV). In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of the 30 genetically modified eukaryotic cell, the method comprising: introducing into a eukaryotic cell an engineered meganuclease described herein, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is 2026223416   31 Aug 2026 a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into a 5 dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell one or more polynucleotides comprising: a first nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered meganuclease is expressed in the eukaryotic cell; and a second nucleic acid sequence comprising the sequence of interest, wherein the engineered meganuclease produces a 0 cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10, and wherein the sequence of interest is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises nucleic acid sequences homologous to nucleic acid sequences flanking the cleavage site and the sequence of interest is inserted at the cleavage site by homologous recombination. In some embodiments, the 15 eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the one or more polynucleotides are introduced into the eukaryotic cell by lipid nanoparticles, mRNA, or recombinant viruses 20   (e.g., recombinant AAVs). In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into a dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell an engineered meganuclease described herein, and a 25 polynucleotide comprising the sequence of interest, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10, and wherein the sequence of interest is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises nucleic acid sequences homologous to nucleic acid sequences flanking the cleavage site and the sequence of interest 30 is inserted at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into 2026223416   31 Aug 2026 the eukaryotic cell by a lipid nanoparticle, an mRNA, or a recombinant virus (e.g., a recombinant AAV). In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of the 5 genetically modified eukaryotic cell, the method comprising: introducing into a eukaryotic cell a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered meganuclease is expressed in the eukaryotic cell, and wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12. In some 0 embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle, an mRNA, or a recombinant 15 virus (e.g., a recombinant AAV). In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of the genetically modified eukaryotic cell, the method comprising: introducing into a eukaryotic cell an engineered meganuclease described herein, wherein the engineered meganuclease 20 produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. 25          In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising an exogenous sequence of interest inserted into a dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell one or more polynucleotides comprising: a first nucleic acid sequence encoding an engineered meganuclease described herein, wherein the engineered 30 meganuclease is expressed in the eukaryotic cell; and a second nucleic acid sequence comprising the sequence of interest, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12, and wherein the sequence of interest is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises nucleic acid sequences 2026223416   31 Aug 2026 homologous to nucleic acid sequences flanking the cleavage site and the sequence of interest is inserted at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or 5 stem cell), a skeletal muscle cell or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the one or more polynucleotides are introduced into the eukaryotic cell by lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAVs). In another aspect, the invention provides a method for producing a genetically 0 modified eukaryotic cell comprising an exogenous sequence of interest inserted into a dystrophin gene of the genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell an engineered meganuclease described herein, and a polynucleotide comprising the sequence of interest, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID 15 NO: 12, and wherein the sequence of interest is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises nucleic acid sequences homologous to nucleic acid sequences flanking the cleavage site and the sequence of interest is inserted at the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle 20 cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle, an mRNA, or a recombinant virus (e.g., a recombinant AAV). 25          In another aspect, the invention provides a method for producing a genetically modified eukaryotic cell comprising a modified dystrophin gene, the method comprising: introducing into a eukaryotic cell one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds and cleaves a 30 recognition sequence in the intron 5' upstream of exon 45, and wherein the second engineered nuclease binds and cleaves a recognition sequence in the intron 3' downstream of exon 55, wherein the first engineered nuclease and the second engineered nuclease are expressed in the eukaryotic cell, wherein the first engineered nuclease produces a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease 2026223416   31 Aug 2026 produces a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein the intervening genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, and wherein the dystrophin gene is annealed to generate 5 the modified dystrophin gene. In some embodiments, the first engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first 0 engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 1. In such embodiments, the first cleavage site and second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered 15 meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof 20 described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 25   19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.195 (SEQ ID NO: 47), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. 30 In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID 2026223416   31 Aug 2026 NO: 49), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. 5          In some embodiments, the first engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 12. In such embodiments, the first cleavage site and second cleavage site have complementary 3' overhangs. In some 0 embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 2. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In 15 some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 20   54), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 54), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered 25 meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof 30 described herein, and the second engineered meganuclease is DMD 37-38L.166 (SEQ ID NO: 56), or a variant thereof described herein. In some embodiments, the complementary overhangs (e.g., 3' overhangs) of the first cleavage site and the second cleavage site are perfectly ligated to one another. 2026223416   31 Aug 2026 In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32 or 34. In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32. In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 34. 5          In some embodiments, a normal reading frame is restored in the modified dystrophin gene is restored as compared to a full-length wild-type dystrophin gene. In some embodiments, the modified dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of a wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises an amino acid 0 sequence set forth in SEQ ID NO: 5. In some embodiments, the method comprises introducing into the eukaryotic cell a first polynucleotide comprising a first nucleic acid sequence encoding the first engineered meganuclease and a second polynucleotide comprising a second nucleic acid sequence encoding the second engineered meganuclease. In some embodiments, the first 15 polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA is an mRNA described herein (i.e., encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some 20 embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct is a recombinant DNA construct described herein (i.e., comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide and the second polynucleotide are introduced into the eukaryotic cell by one or more lipid nanoparticles. In some embodiments, the first polynucleotide is 25 introduced into the eukaryotic cell by a first lipid nanoparticle. In some embodiments, the second polynucleotide is introduced into the eukaryotic cell by a second lipid nanoparticle. In some embodiments, the first polynucleotide is introduced into the eukaryotic cell by a first recombinant virus. In some embodiments, the second polynucleotide is introduced into the eukaryotic cell by a second recombinant virus. In some embodiments, the first recombinant 30 and / or the second recombinant virus are a recombinant virus described herein (i.e., comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the method comprises introducing into the eukaryotic cell a polynucleotide comprising a first nucleic acid sequence encoding the first engineered 2026223416   31 Aug 2026 meganuclease and a second nucleic acid sequence encoding the second engineered meganuclease. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA is an mRNA described herein (i.e., comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some 5 embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is a recombinant DNA construct described herein (i.e., comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a lipid nanoparticle. In some embodiments, the polynucleotide is introduced into the 0 eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is a recombinant virus described herein (i.e., comprising a polynucleotide comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is 15 a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiac muscle cell. In some embodiments, the mammalian cell is a human cell. In another aspect, the invention provides a method for modifying a dystrophin gene in a target cell in a subject, wherein the dystrophin gene is characterized by a mutation that alters the reading frame of the dystrophin gene from wild-type, the method comprising: 20 delivering to the target cell one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds and cleaves a recognition sequence in the intron 5' upstream of exon 45, and wherein the second engineered nuclease binds and cleaves a recognition sequence in the intron 3' downstream of exon 55, 25 wherein the first engineered nuclease and the second engineered nuclease are expressed in the target cell, wherein the first engineered nuclease produces a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease produces a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein 30 the intervening genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene is annealed, and wherein a normal reading frame of the dystrophin gene is restored as compared to a full-length wildtype dystrophin gene. 2026223416   31 Aug 2026 In some embodiments, the first engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 10. In some 5 embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 1. In such embodiments, the first cleavage site and second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second 0 engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), 15 or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered 20 meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.195 (SEQ ID NO: 47), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof 25 described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 30   35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. 2026223416   31 Aug 2026 In some embodiments, the first engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 12. In some 5 embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 2. In such embodiments, the first cleavage site and second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second 0 engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), 15 or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 54), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 54), or a variant thereof described herein. In some embodiments, the first engineered 20 meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In 25 some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38L.166 (SEQ ID NO: 56), or a variant thereof described herein. In some embodiments, the complementary overhangs (e.g., 3' overhangs) of the first cleavage site and the second cleavage site are perfectly ligated to one another. 30          In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32 or 34. In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32. In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 34. 2026223416   31 Aug 2026 In some embodiments, the dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of a wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises an amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the subject is converted to a 5 Becker Muscular Dystrophy phenotype. In some embodiments, the method comprises delivering to the target cell a first polynucleotide comprising a first nucleic acid encoding the first engineered meganuclease and a second polynucleotide comprising a second nucleic acid sequence encoding the second engineered meganuclease. In some embodiments, the first polynucleotide is a first mRNA. 0 In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA is a described herein (i.e., encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct 15 and / or the second recombinant DNA construct is a recombinant DNA construct described herein (i.e., comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide and the second polynucleotide are delivered to the target cells by one or more lipid nanoparticles. In some embodiments, the first polynucleotide is delivered to the target cell by a first lipid 20 nanoparticle. In some embodiments, the second polynucleotide is delivered to the target cell by a second lipid nanoparticle. In some embodiments, the first polynucleotide is delivered to the target cell by a first recombinant virus. In some embodiments, the second polynucleotide is delivered to the target cell by a second recombinant virus. In some embodiments, the first recombinant and / or the second recombinant virus are a recombinant virus described herein 25   (i.e., comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the method comprises delivering to the target cell a polynucleotide comprising a first nucleic acid encoding the first engineered meganuclease and a second nucleic acid sequence encoding the second engineered meganuclease. In some 30 embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA is an mRNA described herein (i.e., comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is a recombinant DNA construct described herein (i.e., comprising first and second nucleic acid 2026223416   31 Aug 2026 sequences each encoding meganucleases described herein). In some embodiments, the polynucleotide is delivered to the target cell by a lipid nanoparticle. In some embodiments, the polynucleotide is delivered to the target cell by a recombinant virus. In some embodiments, the recombinant virus is a recombinant virus described herein (i.e., comprising 5 a polynucleotide comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the subject is a mammal. In some embodiments, the target cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiac muscle cell. In some 0 embodiments, the subject is a human. In another aspect, the invention provides a method for treating DMD in a subject in need thereof, wherein the DMD is characterized by a mutation in a dystrophin gene that alters the reading frame of the dystrophin gene relative to a full-length, wild-type dystrophin gene, the method comprising: administering to the subject an effective amount of one or more 15 polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds and cleaves a recognition sequence in the intron 5' upstream of exon 45, and wherein the second engineered nuclease binds and cleaves a recognition sequence in the intron 3' downstream of exon 55, wherein the one or more polynucleotides 20 are delivered to a target cell in the subject, wherein the first engineered nuclease and the second engineered nuclease are expressed in the target cell, wherein the first engineered nuclease produces a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease produces a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site 25 have complementary overhangs, wherein the intervening genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene is annealed, and wherein a normal reading frame of the dystrophin gene is restored as compared to a full-length wild-type dystrophin gene. In some embodiments, the first engineered nuclease is an engineered meganuclease 30 described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) 2026223416   31 Aug 2026 provided in Table 1. In such embodiments, the first cleavage site and second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof 5 described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 35 0   36x.81 (SEQ ID NO: 46), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, 15 and the second engineered meganuclease is DMD 35-36L.195 (SEQ ID NO: 47), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19 20   20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. In some embodiments, 25 the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof described herein. In some embodiments, the first engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, 30 and the second engineered nuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from the combinations of meganucleases (and variants thereof described herein) provided in Table 2. In such embodiments, the first cleavage site and second cleavage site 2026223416   31 Aug 2026 have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19 5   20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 54), or a variant thereof described herein. In some embodiments, the 0 first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.66 (SEQ ID NO: 54), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant 15 thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof described herein, and the second engineered meganuclease is DMD 37-38x.79 (SEQ ID NO: 55), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second engineered meganuclease is DMD 20   37-38L.166 (SEQ ID NO: 56), or a variant thereof described herein. In some embodiments, the complementary overhangs (e.g., 3' overhangs) of the first cleavage site and the second cleavage site are perfectly ligated to one another. In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32 or 34. In some embodiments, the dystrophin gene comprises a 25 nucleic acid sequence set forth in SEQ ID NO: 32. In some embodiments, the dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 34. In some embodiments, the dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of a wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises an amino acid 30 sequence set forth in SEQ ID NO: 5. In some embodiments, the subject is converted to a Becker Muscular Dystrophy phenotype. In some embodiments, the method comprises administering to the subject a first polynucleotide comprising a first nucleic acid encoding the first engineered meganuclease and a second polynucleotide comprising a second nucleic acid sequence encoding the second 2026223416   31 Aug 2026 engineered meganuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA is a mRNA described herein (i.e., encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide 5 is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct is a recombinant DNA construct described herein (i.e., comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide and the second polynucleotide are administered to the subject by a lipid nanoparticle. In some embodiments, the first polynucleotide is administered to the subject by a first lipid nanoparticle. In some embodiments, the second polynucleotide is administered to the subject by a second lipid nanoparticle. In some embodiments, the first polynucleotide is administered to the subject by a first recombinant virus. In some embodiments, the second 15 polynucleotide is administered to the subject by a second recombinant virus. In some embodiments, the first recombinant and / or the second recombinant virus are a recombinant virus described herein (i.e., comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the method comprises administering to the subject a 20 polynucleotide comprising a first nucleic acid encoding the first engineered meganuclease and a second nucleic acid sequence encoding the second engineered meganuclease. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA is an mRNA described herein (i.e., comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the polynucleotide is a 25 recombinant DNA construct. In some embodiments, the recombinant DNA construct is a recombinant DNA construct described herein (i.e., comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the polynucleotide is administered to the subject by a lipid nanoparticle. In some embodiments, the polynucleotide is administered to the subject by a recombinant virus. In some 30 embodiments, the recombinant virus is a recombinant virus described herein (i.e., comprising a polynucleotide comprising first and second nucleic acid sequences each encoding meganucleases described herein). In some embodiments, the subject is a mammal. In some embodiments, the target cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite 2026223416   31 Aug 2026 cell or stem cell), a skeletal muscle cell, or a cardiac muscle cell. In some embodiments, the subject is a human. In another aspect, the invention provides a polynucleotide comprising a nucleic acid sequence set forth in SEQ ID NO: 32 or SEQ ID NO: 34. In some embodiments, the polynucleotide comprises a nucleic acid sequence set forth in SEQ ID NO: 32. In some embodiments, the polynucleotide is a dystrophin gene in the genome of a cell (e.g., a human muscle cell) that comprises a nucleic acid sequence set forth in SEQ ID NO: 32. In some embodiments, the polynucleotide is a precursor mRNA in a cell (e.g., a human muscle cell) that comprises a nucleic acid sequence set forth in SEQ ID NO: 32. In some embodiments, the polynucleotide comprises a nucleic acid sequence set forth in SEQ ID NO: 34. In some embodiments, the polynucleotide is a dystrophin gene in the genome of a cell (e.g., a human muscle cell) that comprises a nucleic acid sequence set forth in SEQ ID NO: 34. In some embodiments, the polynucleotide is a precursor mRNA in a cell 15   (e.g., a human muscle cell) that comprises a nucleic acid sequence set forth in SEQ ID NO: 34. In another aspect, the invention provides a genetically modified eukaryotic cell comprising in its genome a modified dystrophin gene, wherein the modified dystrophin gene lacks exons 45-55, and wherein the modified dystrophin gene comprises a nucleic acid 20 sequence set forth in SEQ ID NO: 32 or a nucleic acid sequence set forth in SEQ ID NO: 34 positioned within an intron between exon 44 and exon 56. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 32. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 34. In some embodiments, the genetically modified eukaryotic cell is a mammalian cell. 25 In some embodiments, the genetically modified eukaryotic cell is a human cell. In some embodiments, the genetically modified eukaryotic cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or stem cell), a skeletal muscle cell, or a cardiac muscle cell. In another aspect, the invention provides a polypeptide comprising an amino acid 30 sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 5, wherein said polypeptide is a modified dystrophin protein lacking the amino acids encoded by exons 45-55 of the dystrophin gene, and wherein said polypeptide comprises the C-terminal domain of the dystrophin protein. In 2026223416   31 Aug 2026 some embodiments, the polypeptide comprises an amino acid sequence set forth in SEQ ID NO: 5. In another aspect, the invention provides engineered meganucleases described herein, or polynucleotides described herein encoding engineered meganucleases, or cells described 5 herein expressing engineered meganucleases, for use as a medicament. In some embodiments, the medicament is useful for producing a modified dystrophin gene in a subject. In some embodiments, the medicament is useful for the treatment of DMD. In another aspect, the invention provides the use of engineered meganucleases described herein, or polynucleotides disclosed herein encoding engineered meganucleases, or 0 cells described herein expressing engineered meganucleases, in the manufacture of a medicament for treating DMD, for increasing levels of a modified dystrophin protein (i.e., lacking the amino acids encoded by exons 45-55 of the dystrophin gene), or reducing the symptoms associated with DMD. 15                   BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a schematic providing the approximate location of the DMD meganuclease recognition sequences and illustrating the dual meganuclease approach for excising multiple exons from the dystrophin gene. As shown, pairs of engineered meganucleases that bind and cleave either the DMD 19-20 recognition sequence and the DMD 35-36 recognition 20 sequence, or the DMD 19-20 recognition sequence and the DMD 37-38 recognition sequence, result in removal of exons 45-55 from the dystrophin gene. These pairs of recognition sequences are located within introns, have identical four basepair center sequences, and produce cleavage sites having complementary overhangs. Therefore, following the removal of the exons, the gene is ligated at the cleavage sites, which will be 25 within an intron located between exon 44 and exon 56. Following post-transcriptional splicing, this genetic modification results in a dystrophin mRNA having exon 44 in frame with exon 56, which restores the dystrophin gene reading frame and results in a Becker type of dystrophin expression. Also shown is the approximate location where a pair of engineered meganucleases bind and cleave the DMD 19-20 recognition sequence and the DMD 29-30 30 recognition sequence, which results in removal of exon 45 from the dystrophin gene. Figure 2 is a schematic showing exemplary recognition sequences of the disclosure, which include sense and anti-sense sequences for the DMD 19-20 (SEQ ID NOs: 6 and 7), DMD 29-30 (SEQ ID NOs: 8 and 9), DMD 35-36 (SEQ ID NOs: 10 and 11), and DMD 3738 (SEQ ID NOs: 12 and 13) recognition sequences in the human dystrophin gene. Each 2026223416   31 Aug 2026 DMD recognition sequence targeted by engineered meganucleases described herein comprises two recognition half-sites. Each recognition half-site comprises 9 base pairs, separated by a 4 basepair central sequence. For example, the DMD 19-20 recognition sequence has a 5' DMD19 half-site and a 3' DMD20 half-site with a four base pair center 5 sequence GTAT. Figure 3. The engineered meganucleases described herein comprise two subunits, wherein the first subunit comprising the HVR1 region binds to a first recognition half-site (e.g., DMD19) and the second subunit comprising the HVR2 region binds to a second recognition half-site (e.g., DMD20). In embodiments where the engineered meganuclease is 0 a single-chain meganuclease, the first subunit comprising the HVR1 region can be positioned as either the N-terminal or C-terminal subunit. Likewise, the second subunit comprising the HVR2 region can be positioned as either the N-terminal or C-terminal subunit. Figures 4A-4C. Figure 4A provides an alignment of the sequences of DMD 19-20 meganucleases. Figure 4B provides an alignment of the sequences of DMD 35-36 15 engineered meganucleases. Figure 4C provides an alignment of the sequences of DMD 3738 engineered meganucleases. Asterisks indicate conserved residues amongst all aligned nucleases, and a space indicates that at least one amino acid differed amongst the meganucleases. Figure 5 is a schematic of a reporter assay in CHO cells for evaluating engineered 20 meganucleases targeting recognition sequences found in the dystrophin gene. For the engineered meganucleases described herein, a CHO cell line was produced in which a reporter cassette was integrated stably into the genome of the cell. The reporter cassette comprised, in 5' to 3' order: an SV40 Early Promoter; the 5' 2 / 3 of the GFP gene; the recognition sequence for an engineered meganuclease described herein (e.g., the DMD 19-20, 25 DMD 29-30, DMD 35-36, or DMD 37-38 recognition sequences); the recognition sequence for the CHO-23 / 24 meganuclease (WO 2012 / 167192); and the 3' 2 / 3 of the GFP gene. Cells stably transfected with this cassette did not express GFP in the absence of a DNA breakinducing agent. Meganucleases were introduced by transduction of an mRNA encoding each meganuclease. When a DNA break was induced at either of the meganuclease recognition 30 sequences, the duplicated regions of the GFP gene recombined with one another to produce a functional GFP gene. The percentage of GFP-expressing cells could then be determined by flow cytometry as an indirect measure of the frequency of genome cleavage by the meganucleases. 2026223416   31 Aug 2026 Figures 6A-6F. Figures 6A, 6B, and 6G provide the efficiency of engineered DMD 19-20 meganucleases for binding and cleaving the DMD 19-20 recognition sequence expressed in the CHO cell reporter assay. Figure 6C provides the efficiency of engineered DMD 29-30 meganucleases for binding and cleaving the DMD 29-30 recognition sequence 5 expressed in the CHO cell reporter assay. Figure 6D and Figure 6H provide the efficiency of engineered DMD 35-36 meganucleases for binding and cleaving the DMD 35-36 recognition sequence expressed in the CHO cell reporter assay. Figure 6E, Figure 6F, and Figure 6I provide the efficiency of engineered DMD 37-38 meganucleases for binding and cleaving the DMD 37-38 recognition sequence expressed in the CHO cell reporter assay. The relative 0 activity index represents %GFP positive cells for each cell line expressing the test meganuclease normalized to the cell line expressing the CHO-23 / 24 meganuclease accounting for the toxicity of the meganuclease. Figures 7A-7D show bar graphs showing the percentage frequency of insertions and deletions (indel) of the tested meganucleases targeting the indicated recognition sequences at 15 two doses in MRC5 cells. Each meganuclease was tested at three time points (days 2, 5, and 8) following transfection of the meganuclease. Figure 7A provides the percentage of editing with the DMD 19-20 meganucleases. Figure 7B provides the percentage of editing with the DMD 35-36 meganucleases. Figure 7C provides the percentage of editing with the DMD 3738 meganucleases. Figure 7D provides the percentage of editing with the DMD 29-30 20 meganucleases. Figures 8A and 8B provide PCR product and sequencing data for the perfect ligation of the dystrophin gene following cleavage with a pair of engineered meganucleases designed to bind and cleave the DMD 19-20 and DMD 35-36 recognition sequences. Figure 8A is a gel image of the PCR product using primers specific to amplify ligation of the 25 complementary DMD 19-20 and DMD 35-36 recognition sequences. Lane 5 represents the combination of the DMD 19-20x.13 and DMD 35-36x.63 meganucleases. Lane 6 represents the combination of the DMD 19-20x.87 and DMD 35-36x.81 meganucleases. Lane 7 represents the combination of the DMD 19-20x.13 and DMD 35-36x.81 meganucleases. Lane 8 represents the combination of the DMD 19-20x.87 and DMD 35-36x.63 30 meganucleases. Lane M represents a mock control. Figure 8B provides representative sequencing data for perfect ligation of the DMD 19-20 and DMD 35-36 meganuclease recognition sequences following cleavage and excision of the intervening genomic sequence. Figures 9A and 9B provide PCR product and sequencing data for the perfect ligation of the dystrophin gene following cleavage with a pair of engineered meganucleases designed 2026223416   31 Aug 2026 to bind and cleave the DMD 19-20 and DMD 37-38 recognition sequences. Figure 8A is a gel image of the PCR product using primers specific to amplify ligation of the complementary DMD 19-20 and DMD 37-38 recognition sequences. Lane 9 represents the combination of the DMD 19-20x.13 and DMD 37-38x.15 meganucleases. Lane 10 5 represents the combination of the DMD 19-20x.87 and DMD 37-38x.15 meganucleases. Lane 11 represents the combination of the DMD 19-20x.13 and DMD 37-38x.66 meganucleases. Lane 12 represents the combination of the DMD 19-20x.87 and DMD 37-38x.66 meganucleases. Lane 13 represents the combination of the DMD 19-20x.13 and DMD 37-38x.79 meganucleases. Lane 14 represents the combination of the DMD 19-20x.87 0 and DMD 37-38x.79 meganucleases. Lane M represents a mock control. Figure 9B provides a representative sequencing data for perfect ligation of the DMD 19-20 and DMD 37-38 meganuclease recognition sequences following cleavage and excision of the intervening genomic sequence. Figure 10 provides PCR product for the perfect ligation of the dystrophin gene 15 following cleavage with a pair of engineered meganucleases designed to bind and cleave the DMD 19-20 and DMD 29-30 recognition sequences. Shown is a gel image of the PCR product using primers specific to amplify ligation of the complementary DMD 19-20 and DMD 29-30 recognition sequences. Lane 1 represents the combination of the DMD 19-20x.13 and DMD 29-30x.18 meganucleases. Lane 2 represents the combination of the DMD 20   19-20x.87 and DMD 29-30x.40 meganucleases. Lane 3 represents the combination of the DMD 19-20x.13 and DMD 29-30x.40 meganucleases. Lane 4 represents the combination of the DMD 19-20x.87 and DMD 29-30x.18 meganucleases. Lane M represents a mock control. Figure 11 provides a schematic showing the approximate location of the forward and 25 reverse primers and the probe for the reference and perfect ligation primer sets used in the Digital droplet PCR (ddPCR) assay for detecting ligation events following cleavage. The schematic exemplifies the DMD 19-20 and DMD 37-38 ligated recognition sequences. Figures 12A-12C provide bar graphs showing the percentage of deletion of exons 4555, or exon 45 alone, as assessed by ddPCR. Figure 12A provides exon deletion data with 30 the combination of the DMD 19-20x.13 and DMD 35-36x.63 meganucleases, the DMD 19-20x.87 and DMD 35-36x.81 meganucleases, the DMD 19-20x.13 and DMD 35-36x.81 meganucleases, the DMD 19-20x.87 and DMD 35-36x.63 meganucleases, and a mock control. Figure 12B provides exon deletion data with the combination of the DMD 19-20x.13 and DMD 37-38x.15 meganucleases, the DMD 19-20x.87 and DMD 37-38x.15 2026223416   31 Aug 2026 meganucleases, the DMD 19-20x.13 and DMD 37-38x.66 meganucleases, the DMD 19-20x.87 and DMD 37-38x.66 meganucleases, the DMD 19-20x.13 and DMD 37-38x.79 meganucleases, the DMD 19-20x.87 and DMD 37-38x.79 meganucleases, and a mock control. Figure 12C provides exon deletion data for exon 45 alone with the combination of 5 the DMD 19-20x.13 and DMD 29-30x.18 meganucleases, the DMD 19-20x.87 and DMD 29-30x.40 meganucleases, the DMD 19-20x.13 and DMD 29-30x.40 meganucleases, the DMD 19-20x.87 and DMD 29-30x.18 meganucleases, and a mock control. Figure 13 provides a line graph of perfect ligation events assessed by ddPCR with additional different combinations of engineered meganucleases. 0          Figure 14 provides a bar graph showing the percentage of deletion of exons 45-55 as assessed by ddPCR using the pair of DMD 19-20L.249 and DMD 37-38L.166 engineered meganucleases in human skeletal muscle myoblasts (HSMM). The HSMM cells were transfected with either 20 ng, 40 ng, 80 ng, or 160 ng of mRNA encoding each engineered meganuclease. 15          Figure 15 provides a bar graph showing the percentage of perfect ligation assessed by ddPCR using the pair of DMD 19-20L.249 and DMD 37-38L.166 engineered meganucleases in an immortalized myoblast cell line from a patient having DMD (AB1098 cells). The AB1098 cells were transfected with either 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng of mRNA encoding each meganuclease. 20          Figures 16A-16C provide protein expression data following treatment with either 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng of mRNA encoding each of the DMD 19-20L.249 and DMD 37-38L.166 engineered meganucleases, or a mock control, in AB1098 cells. Figure 16A is a graph showing dystrophin protein expression following treatment with the combination of engineered meganucleases or the mock control. Figure 16B provides a gel 25 image of the shortened dystrophin protein band (i.e., lacking the amino acids encoded by exons 45-55) at the correct size. Figure 16C provides the amount of dystrophin protein relative to a reference vinculin gene. Figure 17 provides a bar graph showing RNA splicing of exon 44 to exon 56 in AB1098 cell mRNA following transfection with 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng of 30 mRNA encoding each of the DMD 19-20L.249 and DMD 37-38L.166 engineered meganucleases, or a mock control. Figure 18 provides a bar graph showing the percentage of perfect ligation as assessed by ddPCR using the indicated pairs of engineered meganucleases in HSMM cells. The HSMM cells were transfected with 40 ng of mRNA encoding each engineered meganuclease. 2026223416   31 Aug 2026 Figure 19 provides a schematic of the oligo capture assay utilized to determine off-target effects of an engineered nuclease (e.g., an engineered meganuclease described herein). As shown, the integration cassette or oligo anneals with a double stranded break in the genome that may be due to engineered nuclease cleavage. The DNA is then sheared by 5 sonication, adapters are ligated and PCR amplified followed by sequence analysis to determine location of the double strand break. Figure 20 provides a graph depicting results from an oligo (oligonucleotide) capture assay to identify off-target cutting induced by the DMD 19-20x.13, DMD 19-20L.249, DMD 19-20L.329, DMD 19-20L.374, DMD 19-20L.375, DMD 19-20L.431, and DMD 19-20L.458 meganucleases transfected in HEK 293 cells. The circled dots indicate the on-target site and the non-circled dots indicate off-target sites with the X axis representing the number of sequencing reads for each detected off-target site. The shade of the dot indicates the number of base-pair mismatches between the on target site and each of the detected off-target sites. The closer to the top of the row the dot is located, the lower the number of mismatches. 15          Figure 21 provides a graph depicting results from an oligo capture assay to identify off-target cutting induced by the DMD 35-36x.63, DMD 35-36L.195, DMD 35-36L.364, DMD 35-36L.372, DMD 35-36L.457, and DMD 35-36L.469 meganucleases transfected in HEK 293 cells. The circled dots indicate the on-target site and the non-circled dots indicate off-target sites with the X axis representing the number of sequencing reads for each off- 20 target site. The shade and proximity to the top of the row of the dot indicates the number of base-pair mismatches between the on target site and each of the detected off-target sites. Figure 22 provides a bar graph showing the percentage (%) of total ligation of genomic DNA adjacent to exons 45-55 following cleavage of the DMD 19-20 and DMD 3536 recognition sequences by each of the pairs of indicated engineered DMD 19-20 and DMD 25   35-36 meganucleases. Figure 23A provides a WES protein intensity read out for shortened modified dystrophin protein levels lacking exons 45-55 of the dystrophin gene in AB1098 cells treated with combinations of the DMD 19-20 and DMD 35-36 meganucleases. Lane 1 is the marker control; lane 2 is the heart positive control for dystrophin protein; lane 3 is the blank control; 30 lane 4 is the combination of the DMD 19-20L.374 and DMD 35-36L.376 meganucleases; lane 5 is the combination of the DMD 19-20L.374 and DMD 35-36L.457 meganucleases; lane 6 is the combination of the DMD 19-20L.374 and DMD 35-36L.469 meganucleases; lane 7 is the combination of the DMD 19-20L.375 and DMD 35-36L.376 meganucleases; lane 8 is the combination of the DMD 19-20L.375 and DMD 35-36L.457 meganucleases; 2026223416   31 Aug 2026 lane 9 is the combination of the DMD 19-20L.375 and DMD 35-36L.469 meganucleases; lane 10 is the combination of the DMD 19-20L.431 and DMD 35-36L.376 meganucleases; lane 11 is the combination of the DMD 19-20L.431 and DMD 35-36L.457 meganucleases; lane 12 is the combination of the DMD 19-20L.431 and DMD 35-36L.469 meganucleases; 5 lane 13 is the combination of the DMD 19-20L.458 and DMD 35-36L.376 meganucleases; lane 14 is the combination of the DMD 19-20L.458 and DMD 35-36L.457 meganucleases; lane 15 is the combination of the DMD 19-20L.458 and DMD 35-36L.469 meganucleases; and lane 16 is the mock AB1098 cell line control that lacks expression of dystrophin protein. Figure 23B provides a bar graph showing the shortened modified dystrophin protein levels by 0 WES analysis normalized to the vinculin loading control for each of the pairs of indicated engineered DMD 19-20 and DMD 35-36 meganucleases. Figures 24A-24B. Figure 24A provides a bar graph showing the percentage (%) of total ligation of genomic DNA adjacent to exons 45-55 following cleavage of the DMD 1920 and DMD 37-38 recognition sequences by each of the pairs of indicated engineered DMD 15   19-20 and DMD 37-38 meganucleases. Figure 24B provides a bar graph showing the percentage (%) dystrophin restoration for each of the pairs of indicated engineered DMD 1920 and DMD 37-38 meganucleases compared to an equivalent load of murine quadricep muscle tissue lysate that was based on a standard curve generated from that tissue. Figures 25A-25E provides bar graphs showing the percentage (%) of perfect ligation 20 of genomic DNA adjacent to exons 45-55 in muscle tissues following cleavage of the DMD 19-20 and DMD 37-38 recognition sequences by the pair of DMD 19-20x.13 and DMD 37-38x.15 engineered meganucleases utilizing different muscle-specific promoter combinations. Figure 25A shows the percent perfect ligation in quadricep tissue. Figure 25B shows the percent perfect ligation in heart tissue. Figure 25C shows the percent perfect ligation in 25 diaphragm tissue. Figure 25D shows the percent perfect ligation in soleus tissue. Figure 25E shows the percent perfect ligation in liver tissue. Figures 26A-26E provides bar graphs showing the percentage (%) of total ligation of genomic DNA adjacent to exons 45-55 in muscle tissues following cleavage of the DMD 1920 and DMD 35-36 recognition sequences by the pair of DMD 19-20L.329 and DMD 37 30   38L.219 engineered meganucleases. Figure 26A shows the percent total ligation in quadricep tissue. Figure 26B shows the percent total ligation in heart tissue. Figure 26C shows the percent total ligation in diaphragm tissue. Figure 25D shows the percent total ligation in soleus tissue. Figure 26E shows the percent total ligation in liver tissue. 2026223416   31 Aug 2026 Figures 27A-27E provides bar graphs showing the percentage (%) of total ligation of genomic DNA adjacent to exons 45-55 in muscle tissues following cleavage of the DMD 1920 and DMD 35-36 recognition sequence by the pair of DMD 19-20x.13 and DMD 37-38x.15 engineered meganucleases at two different dosage levels indicated by the total AAV 5 amount (2x1012 or 4x1012). Figure 27A shows the percent total ligation in quadricep tissue. Figure 27B shows the percent total ligation in heart tissue. Figure 27C shows the percent total ligation in diaphragm tissue. Figure 27D shows the percent total ligation in tibialis anterior (TA) tissue. Figure 27E shows the percent total ligation in liver tissue. Figures 28A-28C provides a WES protein intensity read out for shortened modified 0 dystrophin protein levels lacking exons 45-55 of the dystrophin gene after treatment with the DMD 19-20x.13 and DMD 37-38x.15 meganucleases. Lanes 1-6 of Figures 28A-28C represent a standard curve of protein band intensity of full length human dystrophin from a mouse that expresses human dystrophin; lanes 7-8 represent the protein band intensity of shortened modified dystrophin from mice treated with the combination of the DMD 19 15   20x.13 and DMD 37-38x.15 meganucleases at 1x1014 VG / kg; lanes 9-10 represent the protein band intensity of shortened modified dystrophin from mice treated with the combination of the DMD 19-20x.13 and DMD 37-38x.15 meganucleases at 2x1014 VG / kg; lanes 11-12 represent mice treated with PBS and without a meganuclease. Figure 28A represents modified shortened dystrophin levels detected at the indicated dosages in heart tissue; Figure 20   28B represents modified shortened dystrophin levels detected at the indicated dosages in diaphragm tissue; Figure 28C represents modified shortened dystrophin levels detected at the indicated dosages in quadricep tissue. Figure 29 provides a graph showing the percentage (%) of total ligation of genomic DNA adjacent to exons 45-55 in the quadricep, heart, and diaphragm muscle tissues 25 following cleavage of the DMD 19-20 and DMD 35-36 recognitions sequence by the pair of DMD 19-20L.329 and DMD 35-36L.349 engineered meganucleases. Figures 30A-30C provides a WES protein intensity read out for shortened modified dystrophin protein levels lacking exons 45-55 of the dystrophin gene after treatment with the DMD 19-20L.329 and DMD 35-36L.349 meganucleases utilizing different muscle specific 30 promoters. Lane 1 of Figures 30A-30C represent the ladder; lanes 2-6 represent band intensity of full-length human dystrophin from a mouse that expresses human dystrophin; lane 7 represents band intensity of shortened modified dystrophin in mice treated with the combination of the DMD 19-20L.329 and DMD 35-36L.349 meganucleases at 1x1014 VG / kg under the control of the CK8 muscle-specific promoter; lane 8 represents band intensity of 2026223416   31 Aug 2026 shortened modified dystrophin in mice treated with the combination of the DMD 19-20L.329 and DMD 35-36L.349 meganucleases at 1x1014 VG / kg under the control of the MHCK7 muscle-specific promoter; lane 9 represents band intensity of shortened modified dystrophin in mice treated with the combination of the DMD 19-20L.329 and DMD 35-36L.349 5 meganucleases at 1x1014 VG / kg where the DMD 19-20L.329 meganuclease is under the control of the CK8 muscle-specific promoter and the DMD 35-36L.349 meganuclease is under the control of the SPc5-12 muscle specific promoter; lanes 10-11 represent mice treated with PBS. Figure 30A represents modified shortened dystrophin levels detected at the indicated dosages in heart tissue; Figure309B represents modified shortened dystrophin levels 0 detected at the indicated dosages in diaphragm tissue; and Figure 30C represents modified shortened dystrophin levels detected at the indicated dosages in quadricep tissue. Figure 31 provides a bar graph showing the modified shortened dystrophin protein levels by WES analysis normalized to the vinculin loading control for mice treated with the DMD 19-20L.329 and DMD 35-36L.349 meganucleases or PBS in the quadricep (quad), 15 heart, and diaphragm tissue. Figure 32 provides immunohistochemistry imaging of the quadricep (quad), heart, and diaphragm muscle tissue from mice treated with the combination of the DMD 19-20L.329 and DMD 35-36L.349 meganucleases or PBS. Dark staining represents human dystrophin detection, which is only seen in mice treated with the combination of the meganucleases. 20          Figures 33A and 33B provides fluorescent immunohistochemistry imaging of murine quadricep tissue following treatment with either PBS or the DMD 19-20L.329 and DMD 35-36L.349 pair of meganucleases delivered using an AAV9 capsid to hDMDdel52 / mdx (hDMD) mice. Figure 33A provides imaging of Pax7 expression in quadricep tissue from PBS-treated mice. The left panel is a control image that shows any background staining with 25 primary and secondary antibodies that detect meganuclease expression. The middle panel shows cells that express Pax7 indicated by the white arrow heads; and the right panel shows both Pax7 (white arrow heads) and any background staining from antibodies that detect meganuclease expression. Figure 33B provides imaging of meganuclease and Pax7 expression in quadricep tissue from meganuclease treated mice. The left panel provides 30 meganuclease only expressing cells indicated by the white arrow heads with the full arrow indicating a cell that expresses meganuclease protein and Pax7; the middle panel shows cells that express Pax7 only indicated by the white arrowhead or Pax7 and meganuclease protein indicated by the full arrow. The right panel shows cells that express either meganuclease 2026223416   31 Aug 2026 protein or Pax7 indicated by the arrow heads or a cell that expresses both meganuclease protein and Pax7 indicated by the full arrow. Figure 34 provides a schematic of the BaseScope assay used to detect mRNA expression of a modified dystrophin transcript where exons 45-55 of the human dystrophin 5 gene have been deleted following expression of two nucleases. The first nuclease binds and cleaves a recognition sequence located in the intron immediately 5’ of exon 45, and the second nuclease binds and cleaves a recognition sequence located in the intron immediately 3’ of exon 55. As shown the nucleases that bind and cleave recognition sequences located in these introns result in a double strand break that is then repaired by direct religation of the 0 genome. Following transcription and splicing, an mRNA is produced with exon 44 and exon 56 spliced together. A probe designed to recognize this exon 44 to exon 56 junction (denoted as E44-E56 junction) is then used to detect this modified human dystrophin transcript in muscle tissue sections. Figures 35A and 35B provides the BaseScope staining of murine quadricep tissue 15 from hDMDdel52 / mdx (hDMD) mice that were treated with either PBS or the DMD 19-20L.329 and DMD 35-36L.349 pair of meganucleases. Figure 35A shows the BaseScope staining of muscle tissue from PBS treated mice for Pax7 transcript expression and any background staining for the probe used to detect modified human dystrophin transcript expression. Figure 35B shows the BaseScope staining of muscle tissue from mice treated 20 with the DMD 19-20L.329 and DMD 35-36L.349 pair of meganucleases for Pax7 transcript expression and modified human dystrophin transcript expression. Figure 36 provides a WES protein intensity read out for shortened modified dystrophin protein levels lacking exons 45-55 of the dystrophin gene after electroporation of the KM1328 patient cell line that normally lacks dystrophin expression with increasing doses 25 of the DMD 19-20L.329 and DMD 35-36L.349 meganucleases at 20 ng, 80 ng, and 160 ng of mRNA encoding the meganucleases. Lane 1 represents the ladder; lane 2 represents the mock control; lanes 3-5 represents the band intensity of shortened modified dystrophin in cells treated with 20 ng, 80 ng, and 160 ng of meganuclease mRNA; lane 6 represents the band intensity of full length human dystrophin. 30          Figure 37 provides a WES protein intensity read out for shortened modified dystrophin protein levels lacking exons 45-55 of the dystrophin gene after electroporation of the AB1098 patient cell line that normally lacks dystrophin with the DMD 19-20L.329 and DMD 35-36L.349 meganucleases at 80 ng of mRNA encoding the meganucleases. Lane 1 represents the band intensity of full length human dystrophin; lane 2 represents the mock 2026223416   31 Aug 2026 control; lane 3 represents the band intensity of shortened modified dystrophin in cells treated with 80 ng of meganuclease mRNA. Figures 38A-38D provides fluorescent immunohistochemistry imaging of murine quadricep tissue following treatment with either PBS or the DMD 19-20L.329 and DMD 35 5   36L.349 pair of meganucleases delivered using an AAVrH74 capsid to hDMDdel52 / mdx (hDMD) mice. Figure 38A provides imaging of Pax7 expression in quadricep tissue from PBS treated mice. The left panel is a control image that provides any background staining with primary and secondary antibodies that detect meganuclease expression; the star indicates non-specific background detection. The middle panel shows cells that express Pax7 indicated 0 by the white arrowhead; and the right panel shows both Pax7 (white arrowhead) and any background staining from antibodies that detect meganuclease expression indicated by the star. Figure 38B provides imaging of meganuclease and Pax7 expression in quadricep tissue from meganuclease treated mice at a dosage of 1x1014 VG / kg; Figure 38C provides imaging from meganuclease treated mice at a dosage of 3x1013 VG / kg; and Figure 38D provides 15 imaging from meganuclease-treated mice at a dosage of 1x1013 VG / kg. The left panel in Figures 38B-38D provides meganuclease-only expressing cells; the middle panel shows cells that express Pax7; and the right panel in Figures 38B-38D shows cells that express either meganuclease protein or Pax7 or cells that expresses both meganuclease protein and Pax7 indicated by the full arrow. Stars indicate non-specific background staining. 20 BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 sets forth amino acid sequence of the wild-type I-CreI meganuclease from Chlamydomonas reinhardtii. SEQ ID NO: 2 sets forth the amino acid sequence of the LAGLIDADG motif. 25          SEQ ID NO: 3 sets forth the amino acid sequence of a nuclear localization signal. SEQ ID NO: 4 sets forth the amino acid sequence of the wild-type dystrophin protein CCDS48091.1 (Gene ID 1756). SEQ ID NO: 5 sets forth amino acid sequence of the wild-type dystrophin protein CCDS48091.1 (Gene ID 1756) lacking amino acids encoded by exons 45-55. 30          SEQ ID NO: 6 sets forth the nucleic acid sequence of the sense strand of the DMD 19-20 recognition sequence. SEQ ID NO: 7 sets forth the nucleic acid sequence of the antisense strand of the DMD 19-20 recognition sequence. 2026223416   31 Aug 2026 SEQ ID NO: 8 sets forth the nucleic acid sequence of the sense strand of the DMD 29-30 recognition sequence. SEQ ID NO: 9 sets forth the nucleic acid sequence of the antisense strand of the DMD 29-30 recognition sequence. 5          SEQ ID NO: 10 sets forth the nucleic acid sequence of the sense strand of the DMD 35-36 recognition sequence. SEQ ID NO: 11 sets forth the nucleic acid sequence of the antisense strand of the DMD 35-36 recognition sequence. SEQ ID NO: 12 sets forth the nucleic acid sequence of the sense strand of the DMD 0   37-38 recognition sequence. SEQ ID NO: 13 sets forth the nucleic acid sequence of the antisense strand of the DMD 37-38 recognition sequence. SEQ ID NO: 14 sets forth the nucleic acid sequence of the first half-site sense strand of the DMD 19-20 recognition sequence. 15           SEQ ID NO: 15 sets forth the nucleic acid sequence of the first half-site antisense strand of the DMD 19-20 recognition sequence. SEQ ID NO: 16 sets forth the nucleic acid sequence of the first half-site sense strand of the DMD 29-30 recognition sequence. SEQ ID NO: 17 sets forth the nucleic acid sequence of the first half-site antisense 20 strand of the DMD 29-30 recognition sequence. SEQ ID NO: 18 sets forth the nucleic acid sequence of the first half-site sense strand of the DMD 35-36 recognition sequence. SEQ ID NO: 19 sets forth the nucleic acid sequence of the first half-site antisense strand of the DMD 35-36 recognition sequence. 25          SEQ ID NO: 20 sets forth the nucleic acid sequence of the first half-site sense strand of the DMD 37-38 recognition sequence. SEQ ID NO: 21 sets forth the nucleic acid sequence of the first half-site antisense strand of the DMD 37-38 recognition sequence. SEQ ID NO: 22 sets forth the nucleic acid sequence of the second half-site sense 30 strand of the DMD 19-20 recognition sequence. SEQ ID NO: 23 sets forth the nucleic acid sequence of the second half-site antisense strand of the DMD 19-20 recognition sequence. SEQ ID NO: 24 sets forth the nucleic acid sequence of the second half-site sense strand of the DMD 29-30 recognition sequence. 2026223416   31 Aug 2026 SEQ ID NO: 25 sets forth the nucleic acid sequence of the second half-site antisense strand of the DMD 29-30 recognition sequence. SEQ ID NO: 26 sets forth the nucleic acid sequence of the second half-site sense strand of the DMD 35-36 recognition sequence. 5          SEQ ID NO: 27 sets forth the nucleic acid sequence of the second half-site antisense strand of the DMD 35-36 recognition sequence. SEQ ID NO: 28 sets forth the nucleic acid sequence of the second half-site sense strand of the DMD 37-38 recognition sequence. SEQ ID NO: 29 sets forth the nucleic acid sequence of the second half-site antisense 0 strand of the DMD 37-38 recognition sequence. SEQ ID NO: 30 sets forth the nucleic acid sequence of the ligated hybrid DMD 1920 / 29-30 sense strands. SEQ ID NO: 31 sets forth the nucleic acid sequence of the ligated hybrid DMD 1920 / 29-30 sense strands. 15          SEQ ID NO: 32 sets forth the nucleic acid sequence of the ligated hybrid DMD 19 20 / 35-36 sense strands. SEQ ID NO: 33 sets forth the nucleic acid sequence of the ligated hybrid DMD 1920 / 35-36 sense strands. SEQ ID NO: 34 sets forth the nucleic acid sequence of the ligated hybrid DMD 19 20   20 / 37-38 sense strands. SEQ ID NO: 35 sets forth the nucleic acid sequence of the ligated hybrid DMD 1920 / 37-38 sense strands. SEQ ID NO: 36 sets forth the amino acid sequence of the DMD 19-20x.13 engineered meganuclease. 25         SEQ ID NO: 37 sets forth the amino acid sequence of the DMD 19-20x.87 engineered meganuclease. SEQ ID NO: 38 sets forth the amino acid sequence of the DMD 19-20L.249 engineered meganuclease. SEQ ID NO: 39 sets forth the amino acid sequence of the DMD 19-20L.302 30 engineered meganuclease. SEQ ID NO: 40 sets forth the amino acid sequence of the DMD 19-20L.329 engineered meganuclease. SEQ ID NO: 41 sets forth the amino acid sequence of the DMD 19-20L.374 engineered meganuclease. 2026223416   31 Aug 2026 SEQ ID NO: 42 sets forth the amino acid sequence of the DMD 19-20L.375 engineered meganuclease. SEQ ID NO: 43 sets forth the amino acid sequence of the DMD 19-20L.431 engineered meganuclease. 5         SEQ ID NO: 44 sets forth the amino acid sequence of the DMD 19-20L.458 engineered meganuclease. SEQ ID NO: 45 sets forth the amino acid sequence of the DMD 35-36x.63 engineered meganuclease. SEQ ID NO: 46 sets forth the amino acid sequence of the DMD 35-36x.81 engineered 0 meganuclease. SEQ ID NO: 47 sets forth the amino acid sequence of the DMD 35-36L.195 engineered meganuclease. SEQ ID NO: 48 sets forth the amino acid sequence of the DMD35-36L.282 engineered meganuclease. 15         SEQ ID NO: 49 sets forth the amino acid sequence of the DMD35-36L.349 engineered meganuclease. SEQ ID NO: 50 sets forth the amino acid sequence of the DMD 35-36L.376 engineered meganuclease. SEQ ID NO: 51 sets forth the amino acid sequence of the DMD 35-36L.457 20 engineered meganuclease. SEQ ID NO: 52 sets forth the amino acid sequence of the DMD 35-36L.469 engineered meganuclease. SEQ ID NO: 53 sets forth the amino acid sequence of the DMD 37-38x.15 engineered meganuclease. 25         SEQ ID NO: 54 sets forth the amino acid sequence of the DMD 37-38x.66 engineered meganuclease. SEQ ID NO: 55 sets forth the amino acid sequence of the DMD 37-38x.79 engineered meganuclease. SEQ ID NO: 56 sets forth the amino acid sequence of the DMD 37-38L.166 30 engineered meganuclease. SEQ ID NO: 57 sets forth the amino acid sequence of the DMD 37-38L.478 engineered meganuclease. SEQ ID NO: 58 sets forth the amino acid sequence of the DMD 37-38L.512 engineered meganuclease. 2026223416   31 Aug 2026 SEQ ID NO: 59 sets forth the amino acid sequence of the DMD 37-38L.528 engineered meganuclease. SEQ ID NO: 60 sets forth a nucleic acid sequence encoding the DMD 19-20x.13 engineered meganuclease. 5         SEQ ID NO: 61 sets forth a nucleic acid sequence encoding the DMD 19-20x.87 engineered meganuclease. SEQ ID NO: 62 sets forth a nucleic acid sequence encoding the DMD 19-20L.249 engineered meganuclease. SEQ ID NO: 64 sets forth a nucleic acid sequence encoding the DMD 19-20L.302 0 engineered meganuclease. SEQ ID NO: 64 sets forth a nucleic acid sequence encoding the DMD 19-20L.329 engineered meganuclease. SEQ ID NO: 65 sets forth the nucleic acid sequence of the DMD 19-20L.374 engineered meganuclease. 15         SEQ ID NO: 66 sets forth the nucleic acid sequence of the DMD 19-20L.375 engineered meganuclease. SEQ ID NO: 67 sets forth the nucleic acid sequence of the DMD 19-20L.431 engineered meganuclease. SEQ ID NO: 68 sets forth the nucleic acid sequence of the DMD 19-20L.458 20 engineered meganuclease. SEQ ID NO: 69 sets forth a nucleic acid sequence encoding the DMD 35-36x.63 engineered meganuclease. SEQ ID NO: 70 sets forth a nucleic acid sequence encoding the DMD 35-36x.81 engineered meganuclease. 25         SEQ ID NO: 71 sets forth a nucleic acid sequence encoding the DMD 35-36L.195 engineered meganuclease. SEQ ID NO: 72 sets forth a nucleic acid sequence encoding the DMD35-36L.282 engineered meganuclease. SEQ ID NO: 73 sets forth a nucleic acid sequence encoding the DMD35-36L.349 30 engineered meganuclease. SEQ ID NO: 74 sets forth a nucleic acid sequence encoding the DMD35-36L.376 engineered meganuclease. SEQ ID NO: 75 sets forth a nucleic acid sequence encoding the DMD35-36L.457 engineered meganuclease. 2026223416   31 Aug 2026 SEQ ID NO: 76 sets forth a nucleic acid sequence encoding the DMD35-36L.469 engineered meganuclease. SEQ ID NO: 77 sets forth a nucleic acid sequence encoding the DMD 37-38x.15 engineered meganuclease. 5         SEQ ID NO: 78 sets forth a nucleic acid sequence encoding the DMD 37-38x.66 engineered meganuclease. SEQ ID NO: 79 sets forth a nucleic acid sequence encoding the DMD 37-38x.79 engineered meganuclease. SEQ ID NO: 80 sets forth a nucleic acid sequence encoding the DMD 37-38L.166 0 engineered meganuclease. SEQ ID NO: 81 sets forth a nucleic acid sequence encoding the DMD 37-38L.478 engineered meganuclease. SEQ ID NO: 82 sets forth a nucleic acid sequence encoding the DMD 37-38L.512 engineered meganuclease. 15         SEQ ID NO: 83 sets forth a nucleic acid sequence encoding the DMD 37-38L.528 engineered meganuclease. SEQ ID NO: 84 sets forth the amino acid sequence of the DMD 19-20x.13 engineered meganuclease DMD19 binding subunit. SEQ ID NO: 85 sets forth the amino acid sequence of the DMD 19-20x.87 engineered 20 meganuclease DMD19 binding subunit. SEQ ID NO: 86 sets forth the amino acid sequence of the DMD 19-20L.249 engineered meganuclease DMD19 binding subunit. SEQ ID NO: 87 sets forth the amino acid sequence of the DMD 19-20L.302 engineered meganuclease DMD19 binding subunit. 25         SEQ ID NO: 88 sets forth the amino acid sequence of the DMD 19-20L.329 engineered meganuclease DMD19 binding subunit. SEQ ID NO: 89 sets forth the amino acid sequence of the DMD 19-20L.374 engineered meganuclease DMD19 binding subunit. SEQ ID NO: 90 sets forth the amino acid sequence of the DMD 19-20L.375 30 engineered meganuclease DMD19 binding subunit. SEQ ID NO: 91 sets forth the amino acid sequence of the DMD 19-20L.431 engineered meganuclease DMD19 binding subunit. SEQ ID NO: 92 sets forth the amino acid sequence of the DMD 19-20L.458 engineered meganuclease DMD19 binding subunit. 2026223416   31 Aug 2026 SEQ ID NO: 93 sets forth the amino acid sequence of the DMD 35-36x.63 engineered meganuclease DMD35 binding subunit. SEQ ID NO: 94 sets forth the amino acid sequence of the DMD 35-36x.81 engineered meganuclease DMD35 binding subunit. 5         SEQ ID NO: 95 sets forth the amino acid sequence of the DMD 35-36L.195 engineered meganuclease DMD35 binding subunit. SEQ ID NO: 96 sets forth the amino acid sequence of the DMD35-36L.282 engineered meganuclease DMD35 binding subunit. SEQ ID NO: 97 sets forth the amino acid sequence of the DMD35-36L.349 0 engineered meganuclease DMD35 binding subunit. SEQ ID NO: 98 sets forth the amino acid sequence of the DMD35-36L.376 engineered meganuclease DMD35 binding subunit. SEQ ID NO: 99 sets forth the amino acid sequence of the DMD35-36L.457 engineered meganuclease DMD35 binding subunit. 15         SEQ ID NO: 100 sets forth the amino acid sequence of the DMD35-36L.469 engineered meganuclease DMD35 binding subunit. SEQ ID NO: 101 sets forth the amino acid sequence of the DMD 37-38x.15 engineered meganuclease DMD37 binding subunit. SEQ ID NO: 102 sets forth the amino acid sequence of the DMD 37-38x.66 20 engineered meganuclease DMD37 binding subunit. SEQ ID NO: 103 sets forth the amino acid sequence of the DMD 37-38x.79 engineered meganuclease DMD37 binding subunit. SEQ ID NO: 104 sets forth the amino acid sequence of the DMD 37-38L.166 engineered meganuclease DMD37 binding subunit. 25         SEQ ID NO: 105 sets forth the amino acid sequence of the DMD 37-38L.478 engineered meganuclease DMD37 binding subunit. SEQ ID NO: 106 sets forth the amino acid sequence of the DMD 37-38L.512 engineered meganuclease DMD37 binding subunit. SEQ ID NO: 107 sets forth the amino acid sequence of the DMD 37-38L.528 30 engineered meganuclease DMD37 binding subunit. SEQ ID NO: 108 sets forth the amino acid sequence of the DMD 19-20x.13 engineered meganuclease DMD20 binding subunit. SEQ ID NO: 109 sets forth the amino acid sequence of the DMD 19-20x.87 engineered meganuclease DMD20 binding subunit. 2026223416   31 Aug 2026 SEQ ID NO: 110 sets forth the amino acid sequence of the DMD 19-20L.249 engineered meganuclease DMD20 binding subunit. SEQ ID NO: 111 sets forth the amino acid sequence of the DMD 19-20L.302 engineered meganuclease DMD20 binding subunit. 5         SEQ ID NO: 112 sets forth the amino acid sequence of the DMD 19-20L.329 engineered meganuclease DMD20 binding subunit. SEQ ID NO: 113 sets forth the amino acid sequence of the DMD 19-20L.374 engineered meganuclease DMD20 binding subunit. SEQ ID NO: 114 sets forth the amino acid sequence of the DMD 19-20L.375 0 engineered meganuclease DMD20 binding subunit. SEQ ID NO: 115 sets forth the amino acid sequence of the DMD 19-20L.431 engineered meganuclease DMD20 binding subunit. SEQ ID NO: 116 sets forth the amino acid sequence of the DMD 19-20L.458 engineered meganuclease DMD20 binding subunit. 15         SEQ ID NO: 117 sets forth the amino acid sequence of the DMD 35-36x.63 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 118 sets forth the amino acid sequence of the DMD 35-36x.81 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 119 sets forth the amino acid sequence of the DMD 35-36L.195 20 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 120 sets forth the amino acid sequence of the DMD35-36L.282 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 121 sets forth the amino acid sequence of the DMD35-36L.349 engineered meganuclease DMD36 binding subunit. 25         SEQ ID NO: 122 sets forth the amino acid sequence of the DMD35-36L.376 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 123 sets forth the amino acid sequence of the DMD35-36L.457 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 124 sets forth the amino acid sequence of the DMD35-36L.469 30 engineered meganuclease DMD36 binding subunit. SEQ ID NO: 125 sets forth the amino acid sequence of the DMD 37-38x.15 engineered meganuclease DMD38 binding subunit. SEQ ID NO: 126 sets forth the amino acid sequence of the DMD 37-38x.66 engineered meganuclease DMD38 binding subunit. 2026223416   31 Aug 2026 SEQ ID NO: 127 sets forth the amino acid sequence of the DMD 37-38x.79 engineered meganuclease DMD38 binding subunit. SEQ ID NO: 128 sets forth the amino acid sequence of the DMD 37-38L.166 engineered meganuclease DMD38 binding subunit. 5         SEQ ID NO: 129 sets forth the amino acid sequence of the DMD 37-38L.478 engineered meganuclease DMD38 binding subunit. SEQ ID NO: 130 sets forth the amino acid sequence of the DMD 37-38L.512 engineered meganuclease DMD38 binding subunit. SEQ ID NO: 131 sets forth the amino acid sequence of the DMD 37-38L.528 0 engineered meganuclease DMD38 binding subunit. SEQ ID NO: 132 sets forth the amino acid sequence of a linker sequence. SEQ ID NO: 133 sets forth the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 19-20 recognition sequence. SEQ ID NO: 134 sets forth the nucleic acid sequence of a forward PCR primer used 15 in a ddPCR assay for detecting INDELs at the DMD 19-20 recognition sequence. SEQ ID NO: 135 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 19-20 recognition sequence. SEQ ID NO: 136 sets forth the nucleic acid sequence of a probe used as a reference in a ddPCR assay for detecting INDELs. 20          SEQ ID NO: 137 sets forth the nucleic acid sequence of a forward PCR primer used as a reference in a ddPCR assay for detecting INDELs. SEQ ID NO: 138 sets forth the nucleic acid sequence of a forward PCR primer used as a reference in a ddPCR assay for detecting INDELs. SEQ ID NO: 139 sets forth the nucleic acid sequence of a probe used in a ddPCR 25 assay for detecting INDELs at the DMD 37-38 recognition sequence. SEQ ID NO: 140 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 37-38 recognition sequence. SEQ ID NO: 141 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 37-38 recognition sequence. 30          SEQ ID NO: 142 sets forth the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 35-36 recognition sequence. SEQ ID NO: 143 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 35-36 recognition sequence. 2026223416   31 Aug 2026 SEQ ID NO: 144 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 35-36 recognition sequence. SEQ ID NO: 145 sets forth the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 29-30 recognition sequence. 5          SEQ ID NO: 146 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 29-30 recognition sequence. SEQ ID NO: 147 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for detecting INDELs at the DMD 29-30 recognition sequence. SEQ ID NO: 148 sets forth the nucleic acid sequence of a forward PCR primer used 0 in a PCR amplification assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 149 sets forth the nucleic acid sequence of a reverse PCR primer used in a PCR amplification assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 150 sets forth the nucleic acid sequence of a forward PCR primer used 15 in a PCR amplification assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 151 sets forth the nucleic acid sequence of a reverse PCR primer used in a PCR amplification assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 152 sets forth the nucleic acid sequence of a forward PCR primer used 20 in a PCR amplification assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. SEQ ID NO: 153 sets forth the nucleic acid sequence of a reverse PCR primer used in a PCR amplification assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. SEQ ID NO: 154 sets forth the nucleic acid sequence of a forward PCR primer used 25 in a PCR amplification assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. SEQ ID NO: 155 sets forth the nucleic acid sequence of a reverse PCR primer used in a PCR amplification assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. SEQ ID NO: 156 sets forth the nucleic acid sequence of a forward PCR primer used 30 in a PCR amplification assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. SEQ ID NO: 157 sets forth the nucleic acid sequence of a reverse PCR primer used in a PCR amplification assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. 2026223416   31 Aug 2026 SEQ ID NO: 158 sets forth the nucleic acid sequence of a forward PCR primer used in a PCR amplification assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. SEQ ID NO: 159 sets forth the nucleic acid sequence of a reverse PCR primer used in 5 a PCR amplification assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. SEQ ID NO: 160 sets forth the nucleic acid sequence of a probe used in a ddPCR assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. SEQ ID NO: 161 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. 0          SEQ ID NO: 162 sets forth the nucleic acid sequence of a reverse PCR primer used in a ddPCR assay for the DMD 19-20 to DMD 37-38 ligated recognition sequences. SEQ ID NO: 163 sets forth the nucleic acid sequence of a probe used in a ddPCR assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 164 sets forth the nucleic acid sequence of a forward PCR primer used 15 in a ddPCR assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 165 sets forth the nucleic acid sequence of a reverse PCR primer used in a ddPCR assay for the DMD 19-20 to DMD 35-36 ligated recognition sequences. SEQ ID NO: 166 sets forth the nucleic acid sequence of a probe used in a ddPCR assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. 20          SEQ ID NO: 167 sets forth the nucleic acid sequence of a forward PCR primer used in a ddPCR assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. SEQ ID NO: 168 sets forth the nucleic acid sequence of a reverse PCR primer used in a ddPCR assay for the DMD 19-20 to DMD 29-30 ligated recognition sequences. SEQ ID NO: 169 sets forth the nucleic acid sequence of a C5-12 promoter sequence. 25         SEQ ID NO: 170 sets forth the nucleic acid sequence of a murine MCK promoter and enhancer sequence. SEQ ID NO: 171 sets forth the nucleic acid sequence of a human MCK promoter sequence. SEQ ID NO: 172 sets forth the nucleic acid sequence of a wild-type MCK enhancer 30 sequence. SEQ ID NO: 173 sets forth the nucleic acid sequence of a modified MCK enhancer sequence. SEQ ID NO: 174 sets forth the nucleic acid sequence of a spc 5-12 promoter sequence. 2026223416   31 Aug 2026 SEQ ID NO: 175 sets forth the nucleic acid sequence of a MHCK7 promoter sequence. SEQ ID NO: 176 sets forth the nucleic acid sequence of a CK8 promoter sequence. SEQ ID NO: 177 sets forth the nucleic acid sequence of a SK-CRM4 promoter 5 sequence. SEQ ID NO: 178 sets forth the nucleic acid sequence of a SP-301 promoter sequence. SEQ ID NO: 179 sets forth the nucleic acid sequence of a SP-817 promoter sequence. SEQ ID NO: 180 sets forth the nucleic acid sequence of a SP-905 promoter sequence. SEQ ID NO: 181 sets forth the nucleic acid sequence of a Muscle Hybrid promoter 0 sequence. SEQ ID NO: 182 sets forth the amino acid sequence of an rh.74 AAV capsid. SEQ ID NO: 183 sets forth the amino acid sequence of an AAV9 capsid. SEQ ID NO: 184 sets forth the nucleic acid sequence of a forward primer. SEQ ID NO: 185 sets forth the nucleic acid sequence of a reverse primer. 15          SEQ ID NO: 186 sets forth the nucleic acid sequence of a probe. SEQ ID NO: 187 sets forth the nucleic acid sequence of a forward primer. SEQ ID NO: 188 sets forth the nucleic acid sequence of a reverse primer. SEQ ID NO: 189 sets forth the nucleic acid sequence of a probe. 20          SEQ ID NO: 190 sets forth the nucleic acid sequence of a forward primer. SEQ ID NO: 191 sets forth the nucleic acid sequence of a reverse primer. SEQ ID NO: 192 sets forth the nucleic acid sequence of a probe. SEQ ID NO: 193 sets forth the nucleic acid sequence of a reverse primer. 25                DETAILED DESCRIPTION OF THE INVENTION 1.1 References and Definitions The patent and scientific literature referred to herein establishes knowledge that is available to those of skill in the art. The issued US patents, allowed applications, published foreign applications, and references, including GenBank database sequences, which are cited 30 herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. The present disclosure can be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the 2026223416   31 Aug 2026 scope of the invention to those skilled in the art. For example, features illustrated with respect to one embodiment can be incorporated into other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. In addition, numerous variations and additions to the embodiments suggested herein will be 5 apparent to those skilled in the art in light of the present disclosure, which do not depart from the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of 0 describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference herein in their entirety. As used herein, “a,” “an,” or “the” can mean one or more than one. For example, “a” cell can mean a single cell or a multiplicity of cells. 15          As used herein, unless specifically indicated otherwise, the word “or” is used in the inclusive sense of “and / or” and not the exclusive sense of “either / or.” As used herein, the terms “nuclease” and “endonuclease” are used interchangeably to refer to naturally-occurring or engineered enzymes, which cleave a phosphodiester bond within a polynucleotide chain. Engineered nucleases can include, without limitation, 20 engineered meganucleases, zinc finger nucleases, TALENs, compact TALENs, CRISPR system nucleases, and megaTALs. In addition, any engineered nuclease is envisioned that is capable of generating overhangs at its cleavage site. As used herein, the terms “cleave” or “cleavage” refer to the hydrolysis of phosphodiester bonds within the backbone of a recognition sequence within a target sequence 25 that results in a double-stranded break within the target sequence, referred to herein as a “cleavage site”. As used herein, the term “meganuclease” refers to an endonuclease that binds doublestranded DNA at a recognition sequence that is greater than 12 base pairs. In some embodiments, the recognition sequence for a meganuclease of the present disclosure is 22 30 base pairs. A meganuclease can be an endonuclease that is derived from I-CreI (SEQ ID NO: 1), and can refer to an engineered variant of I-CreI that has been modified relative to natural I-CreI with respect to, for example, DNA-binding specificity, DNA cleavage activity, DNA-binding affinity, or dimerization properties. Methods for producing such modified variants of I-CreI are known in the art (e.g., WO 2007 / 047859, incorporated by reference in its entirety). 2026223416   31 Aug 2026 A meganuclease as used herein binds to double-stranded DNA as a heterodimer. A meganuclease may also be a “single-chain meganuclease” in which a pair of DNA-binding domains is joined into a single polypeptide using a peptide linker. The term “homing endonuclease” is synonymous with the term “meganuclease.” Meganucleases of the present 5 disclosure are substantially non-toxic when expressed in the targeted cells as described herein such that cells can be transfected and maintained at 37°C without observing deleterious effects on cell viability or significant reductions in meganuclease cleavage activity when measured using the methods described herein. As used herein, the term “single-chain meganuclease” refers to a polypeptide 0 comprising a pair of nuclease subunits joined by a linker. A single-chain meganuclease has the organization: N-terminal subunit - Linker - C-terminal subunit. The two meganuclease subunits will generally be non-identical in amino acid sequence and will bind non-identical DNA sequences. Thus, single-chain meganucleases typically cleave pseudo-palindromic or non-palindromic recognition sequences. A single-chain meganuclease may be referred to as 15 a “single-chain heterodimer” or “single-chain heterodimeric meganuclease” although it is not, in fact, dimeric. For clarity, unless otherwise specified, the term “meganuclease” can refer to a dimeric or single-chain meganuclease. As used herein, the term “linker” refers to an exogenous peptide sequence used to join two nuclease subunits into a single polypeptide. A linker may have a sequence that is found 20 in natural proteins or may be an artificial sequence that is not found in any natural protein. A linker may be flexible and lacking in secondary structure or may have a propensity to form a specific three-dimensional structure under physiological conditions. A linker can include, without limitation, those encompassed by U.S. Patent Nos. 8,445,251, 9,340,777, 9,434,931, and 10,041,053, each of which is incorporated by reference in its entirety. In some 25 embodiments, a linker may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 132, which sets forth residues 154-195 of any one of SEQ ID NOs: 36-59. As used herein, the terms “recombinant” or “engineered,” with respect to a protein, 30 means having an altered amino acid sequence as a result of the application of genetic engineering techniques to nucleic acids that encode the protein and cells or organisms that express the protein. With respect to a nucleic acid, the term “recombinant” or “engineered” means having an altered nucleic acid sequence as a result of the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR 2026223416   31 Aug 2026 and DNA cloning technologies; transfection, transformation, and other gene transfer technologies; homologous recombination; site-directed mutagenesis; and gene fusion. In accordance with this definition, a protein having an amino acid sequence identical to a naturally-occurring protein, but produced by cloning and expression in a heterologous host, is 5 not considered recombinant or engineered. As used herein, the term “wild-type” refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in the allele population of the same type of gene, wherein a polypeptide encoded by the wild-type allele has its original functions. The term “wild-type” also refers to a polypeptide encoded by a wild-type allele. Wild-type alleles (i.e., 0 polynucleotides) and polypeptides are distinguishable from mutant or variant alleles and polypeptides, which comprise one or more mutations and / or substitutions relative to the wildtype sequence(s). Whereas a wild-type allele or polypeptide can confer a normal phenotype in an organism, a mutant or variant allele or polypeptide can, in some instances, confer an altered phenotype. Wild-type nucleases are distinguishable from recombinant or non- 15 naturally-occurring nucleases. The term “wild-type” can also refer to a cell, an organism, and / or a subject which possesses a wild-type allele of a particular gene, or a cell, an organism, and / or a subject used for comparative purposes. As used herein, the term “genetically modified” refers to a cell or organism in which, or in an ancestor of which, a genomic DNA sequence has been deliberately modified by 20 recombinant technology. As used herein, the term “genetically modified” encompasses the term “transgenic.” As used herein, the term with respect to recombinant proteins, the term “modification” means any insertion, deletion, or substitution of an amino acid residue in the recombinant sequence relative to a reference sequence (e.g., a wild-type or a native 25 sequence). As used herein, the terms “recognition sequence” or “recognition site” refers to a DNA sequence that is bound and cleaved by a nuclease. In the case of a meganuclease, a recognition sequence comprises a pair of inverted, 9 basepair “half-sites,” which are separated by four basepairs. In the case of a single-chain meganuclease, the N-terminal 30 domain of the protein contacts a first half-site and the C-terminal domain of the protein contacts a second half-site. Cleavage by a meganuclease produces four basepair 3' overhangs. “Overhangs,” or “sticky ends” are short, single-stranded DNA segments that can be produced by endonuclease cleavage of a double-stranded DNA sequence. In the case of 2026223416   31 Aug 2026 meganucleases and single-chain meganucleases derived from I-CreI, the overhang comprises bases 10-13 of the 22 basepair recognition sequence. As used herein, the terms “target site” or “target sequence” refers to a region of the chromosomal DNA of a cell comprising a recognition sequence for a nuclease. 5          As used herein, the terms “DNA-binding affinity” or “binding affinity” means the tendency of a nuclease to non-covalently associate with a reference DNA molecule (e.g., a recognition sequence or an arbitrary sequence). Binding affinity is measured by a dissociation constant, Kd. As used herein, a nuclease has “altered” binding affinity if the Kd of the nuclease for a reference recognition sequence is increased or decreased by a 0 statistically significant percent change relative to a reference nuclease. As used herein, the term “specificity” means the ability of a nuclease to bind and cleave double-stranded DNA molecules only at a particular sequence of base pairs referred to as the recognition sequence, or only at a particular set of recognition sequences. The set of recognition sequences will share certain conserved positions or sequence motifs but may be 15 degenerate at one or more positions. A highly-specific nuclease is capable of cleaving only one or a very few recognition sequences. Specificity can be determined by any method known in the art. As used herein, the term “dystrophin gene” refers to the gene associated with National Center for Biotechnology Information (NCBI) gene ID 1756, as well as naturally occurring 20 variants thereof. The term “dystrophin” refers to a polypeptide encoded by the dystrophin gene. The dystrophin isoform expressed in muscle cells and muscle precursor cells is known as the Dp427m dystrophin variant. The amino acid sequence of a full-length, wild type Dp427m dystrophin polypeptide is set forth in SEQ ID NO: 4. NCBI reference numbers NM_004006.3 and NP_003997.2 set forth the dystrophin Dp427m mRNA and polypeptide, 25 respectively. In some embodiments described herein, the dystrophin gene is edited with a pair of engineered meganucleases, resulting in the excision of exons 45-55 and subsequent perfect ligation of the dystrophin gene. Removal of exons 45-55 from the wild-type dystrophin gene can result in a dystrophin polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 5. 30           As used herein, the term “perfect ligation” refers to the ligation (i.e., annealing) of all four bases of a 3' overhang of a first cleavage site with all four bases of a complementary 3' overhang of a second cleavage site in a dystrophin gene following cleavage by a pair of engineered meganucleases of the invention. The recognition sequences targeted by the disclosed engineered meganucleases have identical four basepair center sequences (e.g., 2026223416   31 Aug 2026 GTAT), such that the first and second cleavage sites will have complementary four basepair 3' overhangs. Accordingly, each basepair of the first 3' overhang pairs with its complement basepair on the second 3' overhang, and ligation occurs through a DNA ligase enzyme. Examples of sequences resulting from such perfect ligations are set forth in SEQ ID NO: 32 5   (i.e., perfect ligation of the DMD 19-20 and DMD 35-36 recognition sequences) and SEQ ID NO: 34 (i.e., perfect ligation of the DMD 19-20 and DMD 37-38 recognition sequences). As used herein, the term “Becker Muscular Dystrophy phenotype” refers to a less severe form of muscular dystrophy as compared to DMD. Individuals having Becker Muscular Dystrophy still comprise mutations within the dystrophin gene, but express more 0 functional dystrophin protein in muscle cells (e.g., muscle precursor cells, skeletal muscle cells, and cardiac muscle cells) compared to individuals having DMD, generally leading to a better clinical prognosis. As used herein, the term “homologous recombination” or “HR” refers to the natural, cellular process in which a double-stranded DNA-break is repaired using a homologous DNA 15 sequence as the repair template (see, e.g., Cahill et al. (2006) Front. Biosci. 11:1958-76). The homologous DNA sequence may be an endogenous chromosomal sequence or an exogenous nucleic acid that was delivered to the cell. As used herein, the term “non-homologous end-joining” or “NHEJ” refers to the natural, cellular process in which a double-stranded DNA-break is repaired by the direct 20 joining of two non-homologous DNA segments (see, e.g., Cahill et al. (2006)). DNA repair by non-homologous end-joining is error-prone and frequently results in the untemplated addition or deletion of DNA sequences at the site of repair. In some instances, cleavage at a target recognition sequence results in NHEJ at a target recognition site. Nuclease-induced cleavage of a target site in the coding sequence of a gene followed by DNA repair by non- 25 homologous end joining (NHEJ can introduce mutations into the coding sequence, such as frameshift mutations, that disrupt gene function. Thus, engineered nucleases can be used to effectively knock-out a gene in a population of cells. As used herein, the term “homology arms” or “sequences homologous to sequences flanking a nuclease cleavage site” refer to sequences flanking the 5' and 3' ends of a nucleic 30 acid molecule, which promote insertion of the nucleic acid molecule into a cleavage site generated by a nuclease. In general, homology arms can have a length of at least 50 base pairs, preferably at least 100 base pairs, and up to 2000 base pairs or more, and can have at least 90%, preferably at least 95%, or more, sequence homology to their corresponding 2026223416   31 Aug 2026 sequences in the genome. In some embodiments, the homology arms are about 500 base pairs. As used herein, the term with respect to both amino acid sequences and nucleic acid sequences, the terms “percent identity,” “sequence identity,” “percentage similarity,” 5 “sequence similarity” and the like refer to a measure of the degree of similarity of two sequences based upon an alignment of the sequences that maximizes similarity between aligned amino acid residues or nucleotides, and which is a function of the number of identical or similar residues or nucleotides, the number of total residues or nucleotides, and the presence and length of gaps in the sequence alignment. A variety of algorithms and computer 0 programs are available for determining sequence similarity using standard parameters. As used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ), and are described in, for example, Altschul et al. (1990) J. Mol. Biol. 215:403-10; Gish & States 15   (1993) Nature Genet. 3:266-72; Madden et al. (1996) Meth. Enzymol. 266:131-41; Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402; and Zhang et al. (2000) J. Comput. Biol. 7:203-14. As used herein, percent similarity of two amino acid sequences is the score based upon the following parameters for the BLASTp algorithm: word size=3; gap opening penalty=-11; gap extension penalty=-1; and scoring matrix=BLOSUM62. As used herein, 20 percent similarity of two nucleic acid sequences is the score based upon the following parameters for the BLASTn algorithm: word size=11; gap opening penalty=-5; gap extension penalty=-2; match reward=1; and mismatch penalty=-3. As used herein, the term “corresponding to” with respect to modifications of two proteins or amino acid sequences is used to indicate that a specified modification in the first 25 protein is a substitution of the same amino acid residue as in the modification in the second protein, and that the amino acid position of the modification in the first protein corresponds to or aligns with the amino acid position of the modification in the second protein when the two proteins are subjected to standard sequence alignments (e.g., using the BLASTp program). Thus, the modification of residue “X” to amino acid “A” in the first protein will correspond 30 to the modification of residue “Y” to amino acid “A” in the second protein if residues X and Y correspond to each other in a sequence alignment and despite the fact that X and Y may be different numbers. As used herein, the term “recognition half-site,” “recognition sequence half-site,” or simply “half-site” means a nucleic acid sequence in a double-stranded DNA molecule that is 2026223416   31 Aug 2026 recognized and bound by a monomer of a homodimeric or heterodimeric meganuclease or by one subunit of a single-chain meganuclease or by one subunit of a single-chain meganuclease. As used herein, the term “hypervariable region” refers to a localized sequence within 5 a meganuclease monomer or subunit that comprises amino acids with relatively high variability. A hypervariable region can comprise about 50-60 contiguous residues, about 5357 contiguous residues, or preferably about 56 residues. In some embodiments, the residues of a hypervariable region may correspond to positions 24-79 or positions 215-270 of any one of SEQ ID NOs: 36-59. A hypervariable region can comprise one or more residues that 0 contact DNA bases in a recognition sequence and can be modified to alter base preference of the monomer or subunit. A hypervariable region can also comprise one or more residues that bind to the DNA backbone when the meganuclease associates with a double-stranded DNA recognition sequence. Such residues can be modified to alter the binding affinity of the meganuclease for the DNA backbone and the target recognition sequence. In different 15 embodiments of the invention, a hypervariable region may comprise between 1-20 residues that exhibit variability and can be modified to influence base preference and / or DNA-binding affinity. In particular embodiments, a hypervariable region comprises between about 15-20 residues that exhibit variability and can be modified to influence base preference and / or DNA-binding affinity. In some embodiments, variable residues within a hypervariable 20 region correspond to one or more of positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 36-59. In certain embodiments, variable residues within a hypervariable region can further correspond to residues 48, 50, and 71-73 of any one of SEQ ID NOs: 36-59. In other embodiments, variable residues within a hypervariable region correspond to one or more of positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 25   235, 237, 239, 241, 259, 261, 262, 263, 264, 266, and 268 of any one of SEQ ID NOs: 36-59. In certain embodiments, variable residues within a hypervariable region can further correspond to residues 239, 241, and 263-265 of any one of SEQ ID NOs: 36-59. The terms “increase” in the context of dystrophin protein or mRNA levels refers to any increase in the levels of dystrophin protein or mRNA expression relative to a reference 30 level including an increase of dystrophin protein or mRNA expression of at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or more, when compared to a reference level or control. In some embodiments, an increase in dystrophin protein or mRNA levels refers to an increase in a shortened dystrophin polypeptide or mRNA transcript, for example, missing a portion of the polypeptide encoded 2026223416   31 Aug 2026 by at least one exon (e.g., a portion encoded by exons 45-55) or missing a portion of mRNA corresponding to exons 45-55 compared to the wild-type dystrophin polypeptide or gene. As used herein, the term “reference level” in the context of dystrophin protein or mRNA levels refers to a level of dystrophin protein or mRNA as measured in, for example, a 5 control cell, control cell population or a control subject, at a previous time point in the control cell, the control cell population or the subject undergoing treatment (e.g., a pre-dose baseline level obtained from the control cell, control cell population or subject), or a pre-defined threshold level of dystrophin protein or mRNA (e.g., a threshold level identified through previous experimentation). 0           As used herein, the term “a control” or “a control cell” refers to a cell that provides a reference point for measuring changes in genotype or phenotype of a genetically modified cell. A control cell may comprise, for example: (a) a wild-type cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the genetically modified cell; (b) a cell of the same genotype as the genetically modified cell but which has 15 been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest); or, (c) a cell genetically identical to the genetically modified cell but which is not exposed to conditions or stimuli or further genetic modifications that would induce expression of altered genotype or phenotype. A control subject may comprise, for example: a wild-type subject, i.e., of the same genotype as the starting subject for the genetic 20 alteration which resulted in the genetically modified subject (e.g., a subject having the same mutation in a dystrophin gene), which is not exposed to conditions or stimuli or further genetic modifications that would induce expression of altered genotype or phenotype in the subject. As used herein, the term “recombinant DNA construct,” “recombinant construct,” 25 “expression cassette,” “expression construct,” “chimeric construct,” “construct,” and “recombinant DNA fragment” are used interchangeably herein and are single or doublestranded polynucleotides. A recombinant construct comprises an artificial combination of nucleic acid fragments, including, without limitation, regulatory and coding sequences that are not found together in nature. For example, a recombinant DNA construct may comprise 30 regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source and arranged in a manner different than that found in nature. Such a construct may be used by itself or may be used in conjunction with a vector. 2026223416   31 Aug 2026 As used herein, the term “vector” or “recombinant DNA vector” may be a construct that includes a replication system and sequences that are capable of transcription and translation of a polypeptide-encoding sequence in a given host cell. If a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. Vectors can include, without limitation, plasmid vectors and recombinant AAV vectors, or any other vector known in the art suitable for delivering a gene to a target cell. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleotides or nucleic acid sequences of the invention. In some embodiments, a “vector” also refers to a viral vector. Viral vectors can include, without limitation, retroviral vectors, lentiviral vectors, adenoviral vectors, and AAV. As used herein, the term “operably linked” is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a nucleic acid 15 sequence encoding a nuclease as disclosed herein and a regulatory sequence (e.g., a promoter) is a functional link that allows for expression of the nucleic acid sequence encoding the nuclease. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. 20           As used herein, the terms “treatment” or “treating a subject” refers to the administration of an engineered meganuclease described herein, or a polynucleotide encoding an engineered meganuclease described herein, or a pair of such engineered meganucleases or polynucleotides, to a subject having DMD for the purpose of increasing levels of a dystrophin protein in the subject. In some embodiments, expression of a shortened version (e.g., missing 25 amino acids encoded by multiple exons) of the dystrophin protein is increased. In some embodiments, expression of a version of the dystrophin protein, lacking the amino acids encoded by exons 45-55, is increased. Such treatment, in some embodiments, transitions the DMD phenotype to a Becker Dystrophy phenotype. As used herein, the term “gc / kg” or “gene copies / kilogram” refers to the number of 30 copies of a nucleic acid sequence encoding an engineered meganuclease described herein per weight in kilograms of a subject that is administered a polynucleotide comprising the nucleic acid sequence. As used herein, the term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and / or clinical 2026223416   31 Aug 2026 results. The therapeutically effective amount will vary depending on the formulation or composition used, the disease and its severity and the age, weight, physical condition and responsiveness of the subject to be treated. In specific embodiments, an effective amount of an engineered meganuclease or pair of engineered meganucleases described herein, or 5 polynucleotide or pair of polynucleotides encoding the same, or pharmaceutical compositions disclosed herein, increases the level of expression of a dystrophin protein (e.g., a shortened dystrophin protein lacking the amino acids encoded by exons 45-55) and ameliorates at least one symptom associated with DMD. As used herein, the term “lipid nanoparticle” refers to a lipid composition having a 0 typically spherical structure with an average diameter between 10 and 1000 nm. In some formulations, lipid nanoparticles can comprise at least one cationic lipid, at least one noncationic lipid, and at least one conjugated lipid. Lipid nanoparticles known in the art that are suitable for encapsulating nucleic acids, such as mRNA, are contemplated for use in the invention. 15          As used herein, the recitation of a numerical range for a variable is intended to convey that the present disclosure may be practiced with the variable equal to any of the values within that range. Thus, for a variable which is inherently discrete, the variable can be equal to any integer value within the numerical range, including the end-points of the range. Similarly, for a variable that is inherently continuous, the variable can be equal to any real 20 value within the numerical range, including the end-points of the range. As an example, and without limitation, a variable which is described as having values between 0 and 2 can take the values 0, 1 or 2 if the variable is inherently discrete, and can take the values 0.0, 0.1, 0.01, 0.001, or any other real values =0 and =2 if the variable is inherently continuous. 25   2.1 Principle of the Invention The present disclosure is based, in part, on the hypothesis that certain deletions in the dystrophin gene that give rise to the DMD phenotype can be compensated for by utilizing pairs of endonucleases to strategically delete exons within the dystrophin gene in order to restore a normal reading frame within the gene. The DMD-Leiden Database indicates that 30 most of the mutations that cause DMD are deletions of one or more whole exons that cause a shift in reading frame. In many cases, the reading frame can be restored by eliminating the exon immediately before or after the mutation. As shown in Table 3, 29 different Duchenne-causing mutations, representing ~65% of patients, can be compensated for by deleting a single exon adjacent to the mutation. 2026223416   31 Aug 2026 Table 3. Exon(s) deleted in patient Additional Exon to delete Frequency in DMD-Leiden Database (%) 44, 44-47 43 5 35-43, 45, 45-54 44 8 18-44, 44, 46-47, 46-48, 46 49, 46-51, 46-53 45 13 45 46 7 51, 51-55 50 5 50, 45-50, 48-50, 49-50, 52, 52-63 51 15 51, 53, 53-55 52 3 45-52, 48-52, 49-52, 50-52, 52 53 9 For example, a patient with disease due to the deletion of exon 45, which occurs in 5 approximately 7% of patients, can be treated with a therapeutic that deletes exon 46. A therapeutic capable of deleting exon 51 or exon 45 could be used to treat 15% and 13% of patients, respectively. Notably, greater than 50% of all DMD-related mutations within the dystrophin gene are encompassed by exons 45 through 55. Thus, in particular embodiments of the invention, 10 exons 45 through 55 of the dystrophin gene will be removed in order to restore the normal reading frame of the gene. As disclosed herein, exon removal is achieved by the expression of a pair of engineered meganucleases in muscle cells or muscle precursor cells (e.g., a cardiac muscle cell or a skeletal muscle cell) that generate a pair of cleavage sites in introns upstream of exon 45 and downstream of exon 55, allowing for excision of the intervening 15 genomic region. Following this approach, a genetically modified cell (e.g., a muscle cell in a treated subject) will be able to make an amount of a shortened dystrophin protein from the Beckers phenotype, which is similar to micro-dystrophin approaches, without having to express a micro-dystrophin transgene. This shortened dystrophin may be sufficient to rescue disease permanently, unlike other therapies that require a multi-continuous treatment 20 regimen. 2026223416   31 Aug 2026 Accordingly, it is envisioned that a single treatment will permanently delete exons from a percentage of cells in a subject. In some embodiments, these cells will be myoblasts (i.e., muscle cells) or other muscle precursor cells that are capable of replicating and giving rise to whole muscle fibers that express functional (or semi-functional) dystrophin. If the 5 frequency of exon deletion is low, however, it may be necessary to perform multiple treatments on each patient. 2.2 Meganucleases that Bind and Cleave Recognition Sequences Within a Dystrophin Gene Recognition Sequences It is known in the art that it is possible to use a site-specific nuclease to make a DNA break in the genome of a living cell, and that such a DNA break can result in permanent modification of the genome via mutagenic NHEJ repair or via homologous recombination 15 with a transgenic DNA sequence. NHEJ can produce mutagenesis at the cleavage site, resulting in inactivation of the allele. NHEJ-associated mutagenesis may inactivate an allele via generation of early stop codons, frameshift mutations producing aberrant non-functional proteins, or could trigger mechanisms such as nonsense-mediated mRNA decay. The use of nucleases to induce mutagenesis via NHEJ can be used to target a specific mutation or a 20 sequence present in a wild-type allele. Further, the use of nucleases to induce a double-strand break in a target locus is known to stimulate homologous recombination, particularly of transgenic DNA sequences flanked by sequences that are homologous to the genomic target. In this manner, exogenous polynucleotides can be inserted into a target locus. Such exogenous polynucleotides can encode any sequence or polypeptide of interest. 25          In particular embodiments, engineered meganucleases of the invention have been designed to bind and cleave a DMD 19-20 recognition sequence (SEQ ID NO: 6), a DMD 35-36 recognition sequence (SEQ ID NO: 10), or a DMD 37-38 recognition sequence (SEQ ID NO: 12). Exemplary meganucleases that bind and cleave the DMD 19-20 recognition sequence are provided in SEQ ID NOs: 36-44. Exemplary meganucleases that bind and 30 cleave the DMD 35-36 recognition sequence are provided in SEQ ID NOs: 45-52. Exemplary meganucleases that bind and cleave the DMD 37-38 recognition sequence are provided in SEQ ID NOs: 53-59. The sequence of each recognition sequence, and the four base pair 3' overhang produced when cleaved by an engineered meganuclease described herein, is provided in Table 4 below. 2026223416   31 Aug 2026 Table 4. Engineered Meganuclease Recognition Sequences Recognition Sequence SEQ ID NO: 4 bp 3' Overhang AAGGATTATGTATTACCTCCCG 6 GTAT TAAGATTGGGTATGAGGGATAG 8 GTAT CTACATGGTGTATCTGACTAAG 10 GTAT CTGGCCGAAGTATAGGAATATG 12 GTAT In order to modify the dystrophin gene according to the present disclosure, a pair of 5 engineered meganucleases described herein are utilized together in the same cell. Such pairs of engineered meganucleases were designed to generate a first cleavage site in an intron upstream of exon 45 and a second cleavage site in intron downstream of exon 55, allowing for removal of the intervening genomic sequence. Surprisingly, it was observed that excision of this genomic region from the dystrophin gene, which is greater than 500,000 bp in size, 10 could be accomplished with high efficiency. Moreover, the meganuclease recognition sequences were selected to have complementary four basepair 3' overhangs following cleavage, and it was observed that the dystrophin gene could be repaired at high frequency by a perfect ligation of the 3' overhangs of the two cleavage sites. Such perfectly ligated recognition sequences contemplated herein are provided below in Table 5 below. 15 Table 5. Ligated Recognition Sequences Recognition Sequence Pair Ligated Recognition Sequence SEQ ID NO: Exon(s) Removed DMD 19 / 20 and DMD 29 / 30 AAGGATTATGTATGAGGGATAG 30 45 DMD 19 / 20 and DMD 35 / 36 AAGGATTATGTATCTGACTAAG 32 45-55 DMD 19 / 20 and DMD 37 / 38 AAGGATTATGTATAGGAATATG 34 45-55 These recognition sequences are further selected to be within intronic sequences that are normally spliced out during post transcriptional modification cellular processes. This 20 reduces the likelihood of a mutation being introduced into the dystrophin gene and encoded polypeptide. 2026223416   31 Aug 2026 Exemplary Engineered Meganucleases Engineered meganucleases of the invention comprise a first subunit, comprising a HVR1 region, and a second subunit, comprising a HVR2 region. Further, the first subunit binds to a first recognition half-site in the recognition sequence (e.g., the DMD19 half-site), 5 and the second subunit binds to a second recognition half-site in the recognition sequence (e.g., the DMD20 half-site). In particular embodiments, the meganucleases used to practice the invention are single-chain meganucleases. A single-chain meganuclease comprises an N-terminal subunit and a C-terminal subunit (i.e., the first and second subunits discussed above) joined by a 0 linker peptide. Each of the two subunits recognizes and binds to a half-site of the recognition sequence and the site of DNA cleavage is at the middle of the recognition sequence near the interface of the two subunits. As discussed, DNA strand breaks are offset by four base pairs such that DNA cleavage by a meganuclease generates a pair of four basepair 3' single-strand overhangs. 15          In embodiments where the engineered meganuclease is a single-chain meganuclease, the first and second subunits can be oriented such that the first subunit, which comprises the HVR1 region and binds the first half-site, is positioned as the N-terminal subunit, and the second subunit, which comprises the HVR2 region and binds the second half-site, is positioned as the C-terminal subunit. In alternative embodiments, the first and second 20 subunits can be oriented such that the first subunit, which comprises the HVR1 region and binds the first half-site, is positioned as the C-terminal subunit, and the second subunit, which comprises the HVR2 region and binds the second half-site, is positioned as the N-terminal subunit. Exemplary DMD meganucleases of the invention are provided in SEQ ID NOs: 3625   59, and are summarized below in Tables 6-8. Table 6. Exemplary engineered meganucleases that bind and cleave the DMD 19-20 recognition sequence (SEQ ID NO: 6). Meganuclease AA SEQ ID DMD19 Subunit Residues DMD19 Subunit SEQ ID *DMD19 Subunit % DMD20 Subunit Residues DMD20 Subunit SEQ ID *DMD20 Subunit % DMD 19-20x.13 36 7-153 84 100 198-344 108 100 DMD 19-20x.87 37 7-153 85 92.52 198-344 109 95.24 DMD 19-20L.249 38 7-153 86 91.16 198-344 110 95.92 DMD 19-20L.302 39 7-153 87 90.48 198-344 111 95.24 DMD 19-20L.329 40 7-153 88 91.16 198-344 112 96.6 DMD 19-20L.374 41 7-153 89 91.84 198-344 113 95.92 2026223416   31 Aug 2026 10 DMD 19-20L.375 42 7-153 90 91.84 198-344 114 95.92 DMD 19-20L.431 43 7-153 91 91.16 198-344 115 96.60 DMD 19-20L.458 44 7-153 92 91.84 198-344 116 96.60 “DMD19 Subunit %” and “DMD 20 Subunit %” represent the amino acid sequence identity between the DMD19-binding and DMD20-binding subunit regions of each meganuclease and the DMD19-binding and DMD20-binding subunit regions, respectively, of the DMD 19-20x.13 meganuclease. Table 7. Exemplary engineered meganucleases that bind and cleave the DMD 35-36 recognition sequence (SEQ ID NO: 10). Meganuclease AA SEQ ID DMD35 Subunit Residues DMD35 Subunit SEQ ID *DMD35 Subunit % DMD36 Subunit Residues DMD36 Subunit SEQ ID *DMD36 Subunit % DMD 35-36x.63 45 7-153 93 100 198-344 117 100 DMD 35-36x.81 46 7-153 94 97.96 198-344 118 93.88 DMD 35-36L.195 47 7-153 95 100 198-344 119 93.20 DMD 35-36L.282 48 7-153 96 99.32 198-344 120 93.20 DMD 35-36L.349 49 7-153 97 100 198-344 121 93.20 DMD 35-36L.376 50 7-153 98 100 198-344 122 93.20 DMD 35-36L.457 51 7-153 99 99.32 198-344 123 92.52 DMD 35-36L.469 52 7-153 100 98.64 198-344 124 95.52 “DMD35 Subunit %” and “DMD36 Subunit %” represent the amino acid sequence identity between the DMD35-binding and DMD36-binding subunit regions of each meganuclease and the DMD35-binding and DMD36-binding subunit regions, respectively, of the DMD 35-36x.63 meganuclease. Table 8. Exemplary engineered meganucleases that bind and cleave the DMD 37-38 recognition sequence (SEQ ID NO: 12). Meganuclease AA SEQ ID DMD37 Subunit Residues DMD37 Subunit SEQ ID *DMD37 Subunit % DMD38 Subunit Residues DMD38 Subunit SEQ ID *DMD38 Subunit % DMD 37-38x.15 53 7-153 101 100 198-344 125 100 DMD 37-38x.66 54 7-153 102 98.64 198-344 126 96.60 DMD 37-38x.79 55 7-153 103 99.32 198-344 127 95.24 DMD 37-38.L166 56 7-153 104 91.84 198-344 128 94.56 DMD 37-38L.478 57 7-153 105 91.84 198-344 129 93.88 DMD 37-38L.512 58 7-153 106 91.84 198-344 130 94.56 DMD 37-38L.528 59 7-153 107 90.48 198-344 131 94.56 15 “DMD37 Subunit %” and “DMD38 Subunit %” represent the amino acid sequence identity between the DMD37-binding and DMD38-binding subunit regions of each meganuclease and the DMD37-binding and DMD38-binding subunit regions, respectively, of the DMD 37-38x.15 meganuclease. 2026223416   31 Aug 2026 In certain embodiments of the invention, the engineered meganuclease binds and cleaves a recognition sequence comprising SEQ ID NO: 6 (i.e., the DMD 19-20 recognition sequence) within a dystrophin gene, wherein the engineered meganuclease comprises a first 5 subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a HVR1 region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a HVR2 region. Exemplary DMD 19-20 meganucleases are described below. DMD 19-20x.13 (SEQ ID NO: 36) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises one or more residues corresponding to 15 residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises residues 20   24-79 of SEQ ID NO: 36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 36. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 36. In some embodiments, the first subunit 25 comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 36. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 36. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 36. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 30    14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 36. In 2026223416   31 Aug 2026 some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of 5 SEQ ID NO: 36. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to 0 residue 264 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 36. In some embodiments, the second subunit comprises an amino acid sequence having 15 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 36. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 36. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 36. In some embodiments, the second subunit comprises a 20 residue corresponding to residue 271 of SEQ ID NO: 36. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 36. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises 25 residues 198-344 of SEQ ID NO: 36. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 30 or more sequence identity SEQ ID NO: 36. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 36. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a 2026223416   31 Aug 2026 nucleic acid sequence set forth in SEQ ID NO: 50. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 50. DMD 19-20x.87 (SEQ ID NO: 37) 5         In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 37. In 0 some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 15 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 37. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 37. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 37. In some 20 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 37. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 37. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. 25 In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises one or more residues corresponding to 30 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 37. In some embodiments, the HVR2 2026223416   31 Aug 2026 region comprises a residue corresponding to residue 239 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises residues 5   215-270 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 37. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 0 sequence identity to residues 198-344 of SEQ ID NO: 37. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 37. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 37. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 37. In some embodiments, the second 15 subunit comprises residues 198-344 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 37. In some embodiments, the engineered meganuclease is a single-chain meganuclease 20 comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 37. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 37. In some embodiments, 25 the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 51. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 51. 30 DMD 19-20L.249 (SEQ ID NO: 38) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises one or more residues corresponding to 2026223416   31 Aug 2026 residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to 5 residue 66 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 38. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 0 identity to residues 7-153 of SEQ ID NO: 38. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 38. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 38. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 38. In some embodiments, the first subunit 15 comprises a residue corresponding to residue 80 of SEQ ID NO: 38. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 38. 20         In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of 25 SEQ ID NO: 38. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 38. In some 30 embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 38. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 2026223416   31 Aug 2026 sequence identity to residues 198-344 of SEQ ID NO: 38. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 38. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 38. In some embodiments, the second subunit comprises a 5 residue corresponding to residue 330 of SEQ ID NO: 38. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 38. 0          In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 38. In some embodiments, the engineered 15 meganuclease comprises an amino acid sequence of SEQ ID NO: 38. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 52. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 52. 20 DMD 19-20L.302 (SEQ ID NO: 39) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 39. In 25 some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to 30 residue 66 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 39. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 2026223416   31 Aug 2026 identity to residues 7-153 of SEQ ID NO: 39. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 39. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 39. In some embodiments, the first subunit comprises E, Q, or K at a residue 5 corresponding to residue 80 of SEQ ID NO: 39. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 39. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ 0 ID NO: 39. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises one or more residues corresponding to 15 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 39. In some embodiments, the HVR2 20 region comprises a residue corresponding to residue 236 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 39. 25          In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 39. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 39. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to 30 residue 271 of SEQ ID NO: 39. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 39. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid 2026223416   31 Aug 2026 substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 39. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second 5 subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 39. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 39. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 0   90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NOs: 53. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 53. DMD 19-20L.329 (SEQ ID NO: 40) 15         In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 40. In 20 some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 25 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 40. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 40. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 40. In some 30 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 40. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 40. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 2026223416   31 Aug 2026 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 5 identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of 0 SEQ ID NO: 40. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 15 region comprises residues 215-270 of SEQ ID NO: 40. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 40. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 40. In 20 some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 40. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 40. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 40. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 40 with up to 25    1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 40. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second 30 subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 40. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 40. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 2026223416   31 Aug 2026 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 54. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 54. 5 DMD 19-20L.374 (SEQ ID NO: 41) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 41. In some embodiments, the HVR1 region comprises one or more residues corresponding to 0 residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 41. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 41. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises residues 15   24-79 of SEQ ID NO: 41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 41. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 41. In some embodiments, the first subunit 20 comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 41. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 41. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 41. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 25    14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 41. In 30 some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises Y, R, K, or D at a 2026223416   31 Aug 2026 residue corresponding to residue 257 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 5 region comprises residues 215-270 of SEQ ID NO: 41. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 41. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 41. In 0 some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 41. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 41. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid 15 substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 41. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid 20 sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 41. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 41. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a 25 nucleic acid sequence set forth in SEQ ID NO: 65. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 65. DMD 19-20L.375 (SEQ ID NO: 42) In some embodiments, the HVR1 region comprises an amino acid sequence having at 30 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 2026223416   31 Aug 2026 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 42 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 5 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 42. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 42. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 42. In some 0 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 42. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 42. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 42 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. 15 In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises one or more residues corresponding to 20 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 42. In some embodiments, the HVR2 25 region comprises a residue corresponding to residue 264 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 42 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 42. In some embodiments, the second subunit comprises an amino acid sequence having 30 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 42. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 42. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 42. In some embodiments, the second subunit comprises a 2026223416   31 Aug 2026 residue corresponding to residue 330 of SEQ ID NO: 42. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 42 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ 5 ID NO: 42. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 0 or more sequence identity SEQ ID NO: 42. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 42. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 66. In some embodiments, the engineered 15 meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 66. DMD 19-20L.431 (SEQ ID NO: 43) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 20 identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 43. In some 25 embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 43. In some embodiments, the first subunit comprises an amino acid sequence having at 30 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 43. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 43. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 43. In some embodiments, the first subunit comprises E, Q, or K at a residue 2026223416   31 Aug 2026 corresponding to residue 80 of SEQ ID NO: 43. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 43. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino 5 acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 43. In 0 some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises Y, R, K, or D at a 15 residue corresponding to residue 257 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 43. 20          In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 43. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 43. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to 25 residue 271 of SEQ ID NO: 43. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 43. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 43. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30   29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 43. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid 2026223416   31 Aug 2026 sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 43. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 43. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 5   90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 67. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 67. DMD 19-20L.458 (SEQ ID NO: 44) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 44. In 15 some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 20 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 44. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 44. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 44. In some 25 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 44. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 44. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. 30 In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises one or more residues corresponding to 2026223416   31 Aug 2026 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises Y, R, K, or D at a 5 residue corresponding to residue 257 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 44. 0          In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 44. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 44. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to 15 residue 271 of SEQ ID NO: 44. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 44. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 44. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 20   29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 44. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid 25 sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 44. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 44. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a 30 nucleic acid sequence set forth in SEQ ID NO: 68. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 68. In certain embodiments of the invention, the engineered meganuclease binds and cleaves a recognition sequence comprising SEQ ID NO: 10 (i.e., the DMD 35-36 recognition sequence) within a dystrophin gene, wherein the engineered meganuclease comprises a first 2026223416   31 Aug 2026 subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. Exemplary DMD 35-36 meganucleases 5 are described below. DMD 35-36x.63 (SEQ ID NO: 45) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 0 identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 45. In some 15 embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 45. In some embodiments, the first subunit comprises an amino acid sequence having at 20 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 45. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 45. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 45. In some embodiments, the first subunit comprises E, Q, or K at a residue 25 corresponding to residue 80 of SEQ ID NO: 45. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 45. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ 30 ID NO: 45. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises one or more residues corresponding to 2026223416   31 Aug 2026 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises Y, R, K, or D at a 5 residue corresponding to residue 257 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 250 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises a residue 0 corresponding to residue 263 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 45.In some embodiments, the second subunit comprises an 15 amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 45. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 45. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 45. In some embodiments, the second 20 subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 45. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 45. 25          In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 45. In some embodiments, the engineered 30 meganuclease comprises an amino acid sequence of SEQ ID NO: 45. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 69. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 69. 2026223416   31 Aug 2026 DMD 35-36x.81 (SEQ ID NO: 46) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 5 identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 46. In some 0 embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 46. In some embodiments, the first subunit comprises an amino acid sequence having at 15 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 46. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 46. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 46. In some embodiments, the first subunit comprises E, Q, or K at a residue 20 corresponding to residue 80 of SEQ ID NO: 46. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 46. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ 25 ID NO: 46. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises one or more residues corresponding to 30 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 46. In some embodiments, the HVR2 2026223416   31 Aug 2026 region comprises a residue corresponding to residue 239 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises a residue 5 corresponding to residue 264 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215270 of SEQ ID NO: 46. In some embodiments, the second subunit comprises an amino acid sequence having 0 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 46. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 46. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 46. In some embodiments, the second subunit comprises a 15 residue corresponding to residue 330 of SEQ ID NO: 46. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 46. 20          In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 46. In some embodiments, the engineered 25 meganuclease comprises an amino acid sequence of SEQ ID NO: 46. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ IDNO: 70. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 70. 30 DMD 35-36L.195 (SEQ ID NO: 47) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 47. In 2026223416   31 Aug 2026 some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 47. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 47. In some 5 embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 47. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 47. In some embodiments, the first subunit comprises an amino acid sequence having at 0 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 47. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 47. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 47. In some embodiments, the first subunit comprises E, Q, or K at a residue 15 corresponding to residue 80 of SEQ ID NO: 47. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 47. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ 20 ID NO: 47. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises one or more residues corresponding to 25 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 47. In some embodiments, the HVR2 30 region comprises a residue corresponding to residue 239 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid 2026223416   31 Aug 2026 substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 47. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 5 sequence identity to residues 198-344 of SEQ ID NO: 47. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 47. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 47. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 47. In some embodiments, the second 0 subunit comprises residues 198-344 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 47. In some embodiments, the engineered meganuclease is a single-chain meganuclease 15 comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 47. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 47. In some embodiments, 20 the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 71. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 71. 25 DMD 35-36L.282 (SEQ ID NO: 48) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises one or more residues corresponding to 30 residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises residues 2026223416   31 Aug 2026 24-79 of SEQ ID NO: 48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 48. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 5 identity to residues 7-153 of SEQ ID NO: 48. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 48. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 48. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 48. In some embodiments, the first subunit 0 comprises a residue corresponding to residue 80 of SEQ ID NO: 48. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 48. 15         In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of 20 SEQ ID NO: 48. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 48. In some 25 embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ 30 ID NO: 48. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 48. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 48. In 2026223416   31 Aug 2026 some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 48. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 48. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 5    11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 48. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 48. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 48. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 15   90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 72. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 72. DMD 35-36L.349 (SEQ ID NO: 49) 20         In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 49. In 25 some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 30 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 49. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 49. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 49. In some 2026223416   31 Aug 2026 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 49. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 49. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 49. In some embodiments, 5 the first subunit comprises residues 7-153 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises an amino acid sequence having at 0 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises residues corresponding 15 to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID 20 NO: 49. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 49. 25          In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 49. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 49. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to 30 residue 271 of SEQ ID NO: 49. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 49. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid 2026223416   31 Aug 2026 substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 49. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second 5 subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 49. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 49. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 0   90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 73. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 73. DMD 35-36L.376 (SEQ ID NO: 50) 15         In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 50. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 50. In 20 some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 50. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 50. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 25 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 50. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 50. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 50. In some 30 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 50. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 50. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 50. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 2026223416   31 Aug 2026 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises an amino acid sequence having at 5 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises residues corresponding 0 to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID 15 NO: 50. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 50. 20          In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 50. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 50. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to 25 residue 271 of SEQ ID NO: 50. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 50. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ 30 ID NO: 50. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 2026223416   31 Aug 2026 or more sequence identity SEQ ID NO: 50. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 50. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a 5 nucleic acid sequence set forth in SEQ ID NO: 74. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 74. DMD 35-36L.457 (SEQ ID NO: 51) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 15   28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 51. 20          In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 51. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 51. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID 25 NO: 51. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 51. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 51. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino 30 acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 51. In 2026223416   31 Aug 2026 some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of 5 SEQ ID NO: 51. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises a residue corresponding to 0 residue 264 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 51. In some embodiments, the second subunit comprises an amino acid sequence having 15 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 51. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 51. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 51. In some embodiments, the second subunit comprises a 20 residue corresponding to residue 330 of SEQ ID NO: 51. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 51. 25          In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 51. In some embodiments, the engineered 30 meganuclease comprises an amino acid sequence of SEQ ID NO: 51. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 75. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 75. 2026223416   31 Aug 2026 DMD 35-36L.469 (SEQ ID NO: 52) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 5 identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 52. In some 0 embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 52. In some embodiments, the first subunit comprises an amino acid sequence having at 15 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 52. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 52. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 52. In some embodiments, the first subunit comprises E, Q, or K at a residue 20 corresponding to residue 80 of SEQ ID NO: 52. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises an amino acid sequence having at 25 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises residues corresponding 30 to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID 2026223416   31 Aug 2026 NO: 52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ 5 ID NO: 52. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 52. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 52. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 52. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 52. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 52. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 52 with up to 15    1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 52. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second 20 subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 52. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 52. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 25   90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 76. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence set forth in SEQ ID NO: 76. In certain embodiments of the invention, the engineered meganuclease binds and cleaves a recognition sequence comprising SEQ ID NO: 12 (i.e., the DMD 37-38 recognition 30 sequence) within a dystrophin gene, wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and 2026223416   31 Aug 2026 comprises a second hypervariable (HVR2) region. Exemplary DMD 37-38 meganucleases are described below. DMD 37-38x.15 (SEQ ID NO: 53) 5         In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 53. In 0 some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. 15 In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 53. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 53. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 53. In some 20 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 53. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 53. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 53. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 25    9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 30 identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of 2026223416   31 Aug 2026 SEQ ID NO: 53. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID 5 NO: 53. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 53. 0          In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 53. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 53. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to 15 residue 271 of SEQ ID NO: 53. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 53. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ 20 ID NO: 53. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 25 or more sequence identity SEQ ID NO: 53. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 53. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 77. In some embodiments, the engineered 30 meganuclease is encoded by a nucleic sequence set forth in SEQ ID NO: 77. DMD 37-38x.66 (SEQ ID NO: 54) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 2026223416   31 Aug 2026 identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 5   28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises a residue corresponding to residue 64 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 54 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 0 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 54. In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 54. In some embodiments, the first subunit 15 comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 54. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 54. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 54. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 54. In some embodiments, 20 the first subunit comprises residues 7-153 of SEQ ID NO: 54 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises an amino acid sequence having at 25 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises residues corresponding 30 to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID 2026223416   31 Aug 2026 NO: 54. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 54 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 54. In some embodiments, the second subunit comprises an amino acid sequence having 5 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 54. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 54. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 54. In some embodiments, the second subunit comprises a 0 residue corresponding to residue 330 of SEQ ID NO: 54. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 54 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 54. 15          In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity SEQ ID NO: 54. In some embodiments, the engineered 20 meganuclease comprises the amino acid sequence of SEQ ID NO: 54. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 78. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence set forth in SEQ ID NO: 78. 25 DMD 37-38x.79 (SEQ ID NO: 55) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 55. In 30 some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to 2026223416   31 Aug 2026 residue 66 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 55. In some embodiments, the first subunit comprises an amino acid sequence having at 5 least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 55. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 55. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 55. In some embodiments, the first subunit comprises E, Q, or K at a residue 0 corresponding to residue 80 of SEQ ID NO: 55. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 55. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ 15 ID NO: 55. In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises one or more residues corresponding to 20 residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 55. In some embodiments, the HVR2 25 region comprises a residue corresponding to residue 239 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 255 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 55. In some embodiments, the HVR2 region 30 comprises residues 215-270 of SEQ ID NO: 55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215270 of SEQ ID NO: 55. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more 2026223416   31 Aug 2026 sequence identity to residues 198-344 of SEQ ID NO: 55. In some embodiments, the second subunit comprises G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 55. In some embodiments, the second subunit comprises E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 55. In some embodiments, the second subunit comprises a 5 residue corresponding to residue 271 of SEQ ID NO: 55. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 55. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises 0 residues 198-344 of SEQ ID NO: 55. In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins said first subunit and said second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 15 or more sequence identity SEQ ID NO: 55. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 55. In some embodiments, the engineered meganuclease is encoded by a nucleic sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a nucleic acid sequence set forth in SEQ ID NO: 79. In some embodiments, the engineered 20 meganuclease is encoded by a nucleic sequence set forth in SEQ ID NO: 79. DMD 37-38L.166 (SEQ ID NO: 56) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence 25 identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 56. In some 30 embodiments, the HVR1 region comprises Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 56 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 56. 2026223416   31 Aug 2026 In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 56. In some embodiments, the first subunit comprises G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 56. In some 5 embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 56. In some embodiments, the first subunit comprises E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 56. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 56 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,...

Claims

1. An engineered meganuclease that binds and cleaves a recognition sequence in a dystrophin gene, wherein said engineered meganuclease comprises a first subunit and a second subunit, wherein said first subunit binds to a first recognition half-site of said recognition sequence and comprises a first hypervariable (HVR1) region, and wherein said second subunit binds to a second recognition half-site of said recognition sequence and comprises a second hypervariable (HVR2) region.

2. The engineered meganuclease of claim 1, wherein said recognition sequence comprises SEQ ID NO: 6.

3. The engineered meganuclease of claim 1 or 2, wherein said HVR1 region comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 36-44.

4. The engineered meganuclease of any one of claims 1-3, wherein said HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 36-44.

5. The engineered meganuclease of any one of claims 1-4, wherein said HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 36-44.

6. The engineered meganuclease of any one of claims 1-5, wherein said first subunit comprises an amino acid sequence having at least 80% sequence identity to residues 7-153 of any one of SEQ ID NOs: 36-44.

7. The engineered meganuclease of any one of claims 1-6, wherein said first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 36-44.

8. The engineered meganuclease of any one of claims 1-7, wherein said first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 38, 39, or 43.2026223416   31 Aug 20269. The engineered meganuclease of any one of claims 1-8, wherein said first subunit comprises residues 7-153 of any one of SEQ ID NOs: 36-44.

10. The engineered meganuclease of any one of claims 1-9, wherein said HVR2 region comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 36-44.

11. The engineered meganuclease of any one of claims 1-10, wherein said HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 36-44.

12. The engineered meganuclease of any one of claims 1-11, wherein said HVR2 region comprises a residue corresponding to residue 236 of SEQ ID NO: 3913. The engineered meganuclease of any one of claims 1-12, wherein said HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 37.

14. The engineered meganuclease of any one of claims 1-13, wherein said HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 36-37.

15. The engineered meganuclease of any one of claims 1-14, wherein said HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO: 36.

16. The engineered meganuclease of any one of claims 1-15, wherein said HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 36-44.

17. The engineered meganuclease of any one of claims 1-16, wherein said HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 36-44.

18. The engineered meganuclease of any one of claims 1-17, wherein said second subunit comprises an amino acid sequence having at least 80% sequence identity to residues 198-344 of any one of SEQ ID NOs: 36-44.2026223416   31 Aug 202619. The engineered meganuclease of any one of claims 1-18, wherein said second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 36, 39, 40, 43, or 44.

20. The engineered meganuclease of any one of claims 1-19, wherein said second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 36-38 or 40-44.

21. The engineered meganuclease of any one of claims 1-20, wherein said second subunit comprises residues 198-344 of any one of SEQ ID NOs: 36-44.

22. The engineered meganuclease of any one of claims 1-21, wherein said engineered meganuclease is a single-chain meganuclease comprising a linker, wherein said linker covalently joins said first subunit and said second subunit.

23. The engineered meganuclease of any one of claims 1-22, wherein said engineered meganuclease comprises an amino acid sequence having at least 80% sequence identity any one of SEQ ID NOs: 36-44.

24. The engineered meganuclease of any one of claims 1-23, wherein said engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 3644.

25. The engineered meganuclease of any one of claims 1-24, wherein said engineered meganuclease is encoded by a nucleic sequence having at least 80% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 60-68.

26. The engineered meganuclease of any one of claims 1-25, wherein said engineered meganuclease is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 60-68.

27. The engineered meganuclease of claim 1, wherein said recognition sequence comprises SEQ ID NO: 10.2026223416   31 Aug 202628. The engineered meganuclease of claim 27, wherein said HVR1 region comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 45-52.

29. The engineered meganuclease of claim 27 or 28, wherein said HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 45-52.

30. The engineered meganuclease of any one of claims 27-29, wherein said HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 45-52.

31. The engineered meganuclease of any one of claims 27-30, wherein said first subunit comprises an amino acid sequence having at least 80% sequence identity to residues 7-153 of any one of SEQ ID NOs: 45-52.

32. The engineered meganuclease of any one of claims 27-31, wherein said first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 45-52.

33. The engineered meganuclease of any one of claims 27-32, wherein said first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 45-51.

34. The engineered meganuclease of any one of claims 27-33, wherein said first subunit comprises residues 7-153 of any one of SEQ ID NOs: 45-52.

35. The engineered meganuclease of any one of claims 27-34, wherein said HVR2 region comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 45-52.

36. The engineered meganuclease of any one of claims 27-35, wherein said HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 45-52.2026223416   31 Aug 202637. The engineered meganuclease of any one of claims 27-36, wherein said HVR2 region comprises one or more residues corresponding to residues 239, 241, and 264 of any one of SEQ ID NOs: 45-52.

38. The engineered meganuclease of any one of claims 27-37, wherein said HVR2 region comprises a residue corresponding to residue 250 of SEQ ID NO: 45.

39. The engineered meganuclease of any one of claims 27-38, wherein said HVR2 region comprises a residue corresponding to residue 263 of any one of SEQ ID NOs: 45 or 46.

40. The engineered meganuclease of any one of claims 27-39, wherein said HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 45-52.

41. The engineered meganuclease of any one of claims 27-40, wherein said second subunit comprises an amino acid sequence having at least 80% sequence identity to residues 198-344 of any one of SEQ ID NOs: 45-52.

42. The engineered meganuclease of any one of claims 27-41, wherein said second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 52.

43. The engineered meganuclease of any one of claims 27-42, wherein said second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 45-52.

44. The engineered meganuclease of any one of claims 27-43, wherein said second subunit comprises residues 198-344 of any one of SEQ ID NOs: 45-52.

45. The engineered meganuclease of any one of claims 27-44, wherein said engineered meganuclease is a single-chain meganuclease comprising a linker, wherein said linker covalently joins said first subunit and said second subunit.2026223416   31 Aug 202646. The engineered meganuclease of any one of claims 27-45, wherein said engineered meganuclease comprises an amino acid sequence having at least 80% sequence identity any one of SEQ ID NOs: 45-52.

47. The engineered meganuclease of any one of claims 27-46, wherein said engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 4552.

48. The engineered meganuclease of any one of claims 27-47, wherein said engineered meganuclease is encoded by a nucleic sequence having at least 80% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 69-76.

49. The engineered meganuclease of any one of claims 27-48, wherein said engineered meganuclease is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 69-76.

50. The engineered meganuclease of claim 1, wherein said recognition sequence comprises SEQ ID NO: 12.

51. The engineered meganuclease of claim 50, wherein said HVR1 region comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 53-59.

52. The engineered meganuclease of claim 50 or claim 51, wherein said HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 53-59.

53. The engineered meganuclease of any one of claims 50-52, wherein said HVR1 region comprises a residue corresponding to residue 64 of SEQ ID NO: 54.

54. The engineered meganuclease of any one of claims 50-53, wherein said HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 53-59.2026223416   31 Aug 202655. The engineered meganuclease of any one of claims 50-54, wherein said first subunit comprises an amino acid sequence having at least 80% sequence identity to residues 7-153 of any one of SEQ ID NOs: 53-59.

56. The engineered meganuclease of any one of claims 50-55, wherein said first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 53-59.

57. The engineered meganuclease of any one of claims 50-56, wherein said first subunit comprises a residue corresponding to residue 80 of SEQ ID NOs: 53-55, 57, or 58.

58. The engineered meganuclease of any one of claims 50-57, wherein said first subunit comprises residues 7-153 of any one of SEQ ID NOs: 53-59.

59. The engineered meganuclease of any one of claims 50-58, wherein said HVR2 region comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 53-59.

60. The engineered meganuclease of any one of claims 50-59, wherein said HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 53-59.

61. The engineered meganuclease of any one of claims 50-60, wherein said HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 53 or SEQ ID NO: 55.

62. The engineered meganuclease of any one of claims 50-61, wherein said HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 53-55.

63. The engineered meganuclease of any one of claims 50-62, wherein said HVR2 region comprises a residue corresponding to residue 255 of SEQ ID NO: 55.

64. The engineered meganuclease of any one of claims 50-63, wherein said HVR2 region comprises a residue corresponding to residue 263 of any one of SEQ ID NOs: 56-59.2026223416   31 Aug 202665. The engineered meganuclease of any one of claims 50-64, wherein said HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 53-59.

66. The engineered meganuclease of any one of claims 50-65, wherein said HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 53-59.

67. The engineered meganuclease of any one of claims 60-66, wherein said second subunit comprises an amino acid sequence having at least 80% sequence identity to residues 198-344 of any one of SEQ ID NOs: 53-59.

68. The engineered meganuclease of any one of claims 50-67, wherein said second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 53 or 55-59.

69. The engineered meganuclease of any one of claims 50-68, wherein said second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 54-59.

70. The engineered meganuclease of any one of claims 50-69, wherein said second subunit comprises residues 198-344 of any one of SEQ ID NOs: 53-59.

71. The engineered meganuclease of any one of claims 50-70, wherein said engineered meganuclease is a single-chain meganuclease comprising a linker, wherein said linker covalently joins said first subunit and said second subunit.

72. The engineered meganuclease of any one of claims 50-71, wherein said engineered meganuclease comprises an amino acid sequence having at least 80% sequence identity any one of SEQ ID NOs: 53-59.

73. The engineered meganuclease of any one of claims 50-72, wherein said engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 5359.2026223416   31 Aug 202674. The engineered meganuclease of any one of claims 50-73, wherein said engineered meganuclease is encoded by a nucleic sequence having at least 80% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 77-83.

75. The engineered meganuclease of any one of claims 50-74, wherein said engineered meganuclease is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 77-83.

76. A polynucleotide comprising a nucleic acid sequence encoding said engineered meganuclease of any one of claims 1-75.

77. The polynucleotide of claim 76, wherein said polynucleotide is an mRNA.

78. A recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding said engineered meganuclease of any one of claims 1-75.

79. The recombinant DNA construct of claim 78, wherein said recombinant DNA construct encodes a recombinant virus comprising said polynucleotide.

80. The recombinant DNA construct of claim 79, wherein said recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV).

81. The recombinant DNA construct of claim 79 or claim 80, wherein said recombinant virus is a recombinant AAV.

82. The recombinant DNA construct of claim 81, wherein said recombinant AAV has an rh.74 capsid or an AAV9 capsid.

83. The recombinant DNA construct of any one of claims 78-82, wherein said polynucleotide comprises a promoter operably linked to said nucleic acid sequence encoding said engineered meganuclease.2026223416   31 Aug 202684. The recombinant DNA construct of claim 83, wherein said promoter is a muscle-specific promoter.

85. The recombinant DNA construct of claim 84, wherein said muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter.

86. A recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding said engineered meganuclease of any one of claims 1-75.

87. The recombinant virus of claim 86, wherein said recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV.

88. The recombinant virus of claim 87, wherein said recombinant virus is a recombinant AAV.

89. The recombinant virus of claim 87 or claim 88, wherein said recombinant AAV has an rh.74 capsid or an AAV9 capsid.

90. The recombinant virus of any one of claims 86-89, wherein said polynucleotide comprises a promoter operably linked to said nucleic acid sequence encoding said engineered meganuclease.

91. The recombinant virus of claim 90, wherein said promoter is a muscle-specific promoter.

92. The recombinant virus of claim 91, wherein said muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter.2026223416   31 Aug 202693. A lipid nanoparticle composition comprising lipid nanoparticles comprising a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence encoding said engineered meganuclease of any one of claims 1-75.

94. The lipid nanoparticle composition of claim 93, wherein said polynucleotide is an mRNA.

95. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and said engineered meganuclease of any one of claims 1-75.

96. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and said polynucleotide of claim 76 or claim 77.

97. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and said recombinant DNA construct of any one of claims 78-85.

98. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and said recombinant virus of any one of claims 86-92.

99. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and said lipid nanoparticle composition of claim 93 or claim 94.

100. A polynucleotide comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease, wherein said first engineered meganuclease is said engineered meganuclease of any one of claims 2-26, and wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 27-49 or said engineered meganuclease of any one of claims 50-75.

101. The polynucleotide of any one of claim 100, wherein said polynucleotide is anmRNA.2026223416   31 Aug 2026102. The polynucleotide of any one of claim 100 or claim 101, wherein said first nucleic acid sequence and said second nucleic acid sequence are separated by an IRES or 2A sequence.

103. A recombinant DNA construct comprising said polynucleotide of claim 100.

104. The recombinant DNA construct of claim 103, wherein said first nucleic acid sequence and said second nucleic acid sequence are separated by an IRES or 2A sequence.

105. The recombinant DNA construct of claim 103, wherein said polynucleotide comprises a promoter operably linked to said first nucleic acid sequence and said second nucleic acid sequence.

106. The recombinant DNA construct of claim 105, wherein said promoter is a muscle-specific promoter.

107. The recombinant DNA construct of claim 106, wherein said muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter.

108. The recombinant DNA construct of claim 103, wherein said polynucleotide comprises a first promoter operably linked to said first nucleic acid sequence and a second promoter operably linked to said second nucleic acid sequence.

109. The recombinant DNA construct of claim 108, wherein said first promoter and said second promoter are muscle-specific promoters.

110. The recombinant DNA construct of claim 109, wherein said muscle-specific promoters comprise a MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, a SP-905 promoter, or a combination thereof.2026223416   31 Aug 2026111. The recombinant DNA construct of any one of claims 103-110, wherein said recombinant DNA construct encodes a recombinant virus comprising said polynucleotide.

112. The recombinant DNA construct of claim 111, wherein said recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV).

113. The recombinant DNA construct of claim 111 or claim 112, wherein said recombinant virus is a recombinant AAV.

114. The recombinant DNA construct of claim 113, wherein said recombinant AAV has an rh.74 capsid or an AAV9 capsid.

115. A recombinant virus comprising said polynucleotide of claim 100.

116. The recombinant virus of claim 115, wherein said polynucleotide comprises a promoter operably linked to said first nucleic acid sequence and said second nucleic acid sequence.

117. The recombinant virus of claim 115 or claim 116, wherein said first nucleic acid sequence and said second nucleic acid sequence are separated by an IRES or 2A sequence.

118. The recombinant virus of claim 116 or claim 117, wherein said promoter is a muscle-specific promoter.

119. The recombinant virus of claim 118, wherein said muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter.

120. The recombinant virus of claim 115, wherein said polynucleotide comprises a first promoter operably linked to said first nucleic acid sequence and a second promoter operably linked to said second nucleic acid sequence.2026223416   31 Aug 2026121. The recombinant virus of claim 120, wherein said first promoter and said second promoter are muscle-specific promoters.

122. The recombinant virus of claim 121, wherein said muscle-specific promoters comprise a MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, a SP-905 promoter, or a combination thereof.

123. The recombinant virus of any one of claims 115-122, wherein said recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV).

124. The recombinant virus of any one of claims 115-123, wherein said recombinant virus is a recombinant AAV.

125. The recombinant virus of claim 123 or claim 124, wherein said recombinant AAV has an rh.74 capsid or an AAV9 capsid.

126. A lipid nanoparticle composition comprising lipid nanoparticles comprising said polynucleotide of claim 100.

127. The lipid nanoparticle composition of claim 126, wherein said polynucleotide is said mRNA of claim 101 or claim 102.

128. The lipid nanoparticle composition of claim 126, wherein said polynucleotide is said recombinant DNA construct of any one of claims 103-114.

129. A pharmaceutical composition comprising a pharmaceutically acceptable carrier, a first engineered meganuclease, and a second engineered meganuclease, wherein said first engineered meganuclease is said engineered meganuclease of any one of claims 226, and wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 27-49 or said engineered meganuclease of any one of claims 50-75.2026223416   31 Aug 2026130. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and said polynucleotide of any one of claims 100-102.

131. The pharmaceutical composition of claim 130, wherein said polynucleotide comprises said mRNA of claim 101 or claim 102.

132. The pharmaceutical composition of claim 130, wherein said polynucleotide comprises said recombinant DNA construct of any one of claims 103-114.

133. The pharmaceutical composition of claim 130, wherein said pharmaceutical composition comprises said recombinant virus of any one of claims 115-125.

134. The pharmaceutical composition of claim 130, wherein said pharmaceutical composition comprises said lipid nanoparticle composition of any one of claims 126-128.

135. A method for producing a genetically modified eukaryotic cell comprising a modified dystrophin gene, said method comprising:introducing into a eukaryotic cell one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease,wherein said first engineered meganuclease is said engineered meganuclease of any one of claims 2-26, and wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 27-49 or said second engineered meganuclease is said engineered meganuclease of any one of claims 50-75,wherein said first engineered meganuclease and said second engineered meganuclease are expressed in said eukaryotic cell,wherein said first engineered meganuclease produces a first cleavage site in said dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, wherein said second engineered meganuclease produces a second cleavage site in said dystrophin gene at a recognition sequence comprising SEQ ID NO: 10 or SEQ ID NO: 12,wherein said first cleavage site and said second cleavage site have complementary 3' overhangs,wherein the intervening genomic DNA between said first cleavage site and said second cleavage site is excised from said dystrophin gene,2026223416   31 Aug 2026and wherein said dystrophin gene is annealed to generate said modified dystrophin gene.

136. The method of claim 135, wherein said complementary 3' overhangs of said first cleavage site and said second cleavage site are directly re-ligated to one another.

137. The method of claim 135 or claim 136, wherein said dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32 or 34.

138. The method of any one of claims 135-137, wherein a normal reading frame is restored in said modified dystrophin gene as compared to a full-length wild-type dystrophin gene.

139. The method of any one of claims 135-138, wherein said modified dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of a wild-type dystrophin gene.

140. The method of any one of claims 135-139, wherein said method comprises introducing into said eukaryotic cell a first polynucleotide comprising a first nucleic acid sequence encoding said first engineered meganuclease and a second polynucleotide comprising a second nucleic acid sequence encoding said second engineered meganuclease.

141. The method of claim 140, wherein said first polynucleotide is a first mRNA.

142. The method of claim 140 or claim 141, wherein said second polynucleotide isa second mRNA.

143. The method of claim 141 or claim 142, wherein said first mRNA and / or said second mRNA is said mRNA of claim 77.

144. The method of claim 140, wherein said first polynucleotide is a first recombinant DNA construct.2026223416   31 Aug 2026145. The method of claim 140 or 144, wherein said second polynucleotide is a second recombinant DNA construct.

146. The method of claim 144 or claim 145, wherein said first recombinant DNA construct and / or said second recombinant DNA construct is said recombinant DNA construct of any one of claims 78-85.

147. The method of any one of claims 140-146, wherein said first polynucleotide and said second polynucleotide are introduced into said eukaryotic cell by one or more lipid nanoparticles.

148. The method of any one of claims 140-147, wherein said first polynucleotide is introduced into said eukaryotic cell by a first lipid nanoparticle.

149. The method of any one of claims 140-148, wherein said second polynucleotide is introduced into said eukaryotic cell by a second lipid nanoparticle.

150. The method of any one of claims 140-143, wherein said first polynucleotide is introduced into said eukaryotic cell by a first recombinant virus.

151. The method of any one of claims 140-143 and 150, wherein said second polynucleotide is introduced into said eukaryotic cell by a second recombinant virus.

152. The method of claim 150 or claim 151, wherein said first recombinant and / or said second recombinant virus are said recombinant virus of any one of claims 86-92.

153. The method of claim 135, wherein said method comprises introducing into said eukaryotic cell a polynucleotide comprising a first nucleic acid encoding said first engineered meganuclease and a second nucleic acid sequence encoding said second engineered meganuclease.

154. The method of claim 153, wherein said polynucleotide is an mRNA.2026223416   31 Aug 2026155. The method of claim 154, wherein said mRNA is said mRNA of claim 101 or claim 102.

156. The method of claim 153, wherein said polynucleotide is a recombinant DNA construct.

157. The method of claim 156, wherein said recombinant DNA construct is said recombinant DNA construct of any one of claims 103-114.

158. The method of any one of claims 153-157, wherein said polynucleotide is introduced into said eukaryotic cell by a lipid nanoparticle.

159. The method of claim 153, wherein said polynucleotide is introduced into said eukaryotic cell by a recombinant virus.

160. The method of claim 159, wherein said recombinant virus is said recombinant virus of any one of claims 115-125.

161. The method of any one of claims 135-160, wherein said eukaryotic cell is a mammalian cell.

162. The method of claim 161, wherein said mammalian cell is a muscle cell.

163. The method of claim 162, wherein said muscle cell is a muscle precursor cell,a skeletal muscle cell, or a cardiac muscle cell.

164. The method of any one of claims 161-163, wherein said mammalian cell is a human cell.

165. A method for modifying a dystrophin gene in a target cell in a subject, wherein said dystrophin gene is characterized by a mutation that alters the reading frame of said dystrophin gene from wild-type, said method comprising:2026223416   31 Aug 2026delivering to said target cell one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease,wherein said first engineered meganuclease is said engineered meganuclease of any one of claims 2-26, wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 27-49, or wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 50-75,wherein said first engineered meganuclease and said second engineered meganuclease are expressed in said target cell,wherein said first engineered meganuclease produces a first cleavage site in said dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, wherein said second engineered meganuclease produces a second cleavage site in said dystrophin gene at a recognition sequence comprising SEQ ID NO: 10 or SEQ ID NO: 12,wherein said first cleavage site and said second cleavage site have complementary 3' overhangs,wherein the intervening genomic DNA between said first cleavage site and said second cleavage site is excised from said dystrophin gene, wherein said dystrophin gene is annealed,and wherein a normal reading frame of said dystrophin gene is restored as compared to a full-length wild-type dystrophin gene.

166. The method of claim 165, wherein said complementary 3' overhangs of said first cleavage site and said second cleavage site are directly re-ligated to one another.

167. The method of claim 165 or claim 166, wherein said dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32 or 34.

168. The method of any one of claims 165-167, wherein said dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of a wild-type dystrophin gene.

169. The method of any one of claims 165-168, wherein said subject is converted to a Becker Muscular Dystrophy phenotype.2026223416   31 Aug 2026170. The method of any one of claims 165-169, wherein said method comprises delivering to said target cell a first polynucleotide comprising a first nucleic acid encoding said first engineered meganuclease and a second polynucleotide comprising a second nucleic acid sequence encoding said second engineered meganuclease.

171. The method of claim 170, wherein said first polynucleotide is a first mRNA.

172. The method of claim 170 or claim 171, wherein said second polynucleotide isa second mRNA.

173. The method of claim 171 or claim 172, wherein said first mRNA and / or said second mRNA is said mRNA of claim 77.

174. The method of claim 170, wherein said first polynucleotide is a first recombinant DNA construct.

175. The method of claim 170 or claim 174, wherein said second polynucleotide is a second recombinant DNA construct.

176. The method of claim 174 or claim 175, wherein said first recombinant DNA construct and / or said second recombinant DNA construct is said recombinant DNA construct of any one of claims 78-85.

177. The method of any one of claims 170-176, wherein said first polynucleotide and said second polynucleotide are delivered to said target cells by one or more lipid nanoparticles.

178. The method of any one of claims 170-177, wherein said first polynucleotide is delivered to said target cell by a first lipid nanoparticle.

179. The method of any one of claims 170-178, wherein said second polynucleotide is delivered to said target cell by a second lipid nanoparticle.2026223416   31 Aug 2026180. The method of any one of claims 170-173, wherein said first polynucleotide is delivered to said target cell by a first recombinant virus.

181. The method of any one of claims 170-173 and 180, wherein said second polynucleotide is delivered to said target cell by a second recombinant virus.

182. The method of claim 180 or claim 181, wherein said first recombinant and / or said second recombinant virus are said recombinant virus of any one of claims 86-82.

183. The method of claim 165, wherein said method comprises delivering to said target cell a polynucleotide comprising a first nucleic acid encoding said first engineered meganuclease and a second nucleic acid sequence encoding said second engineered meganuclease.

184. The method of claim 183, wherein said polynucleotide is an mRNA.

185. The method of claim 184, wherein said mRNA is said mRNA of claim 100 or101.

186. The method of claim 183, wherein said polynucleotide is a recombinant DNA construct.

187. The method of claim 186, wherein said recombinant DNA construct is said recombinant DNA construct of any one of claims 102-113.

188. The method of claim 183, wherein said polynucleotide is delivered to said target cell by a lipid nanoparticle.

189. The method of claim 183, wherein said polynucleotide is delivered to said target cell by a recombinant virus.

190. The method of claim 189, wherein said recombinant virus is said recombinant virus of any one of claims 115-125.2026223416   31 Aug 2026191.   The method of any one of claims 165-190, wherein said subject is a mammal.

192. The method of any one of claims 165-191, wherein said target cell is a musclecell.

193. The method of claim 192, wherein said muscle cell is a muscle precursor cell, a skeletal muscle cell, or a cardiac muscle cell.

194. The method of any one of claims 165-193, wherein said subject is a human.

195. A method for treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof, wherein said DMD is characterized by a mutation in a dystrophin gene that alters the reading frame of said dystrophin gene relative to a full-length wild-type dystrophin gene, said method comprising:administering to said subject an effective amount of one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease,wherein said first engineered meganuclease is said engineered meganuclease of any one of claims 2-26, wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 27-49, or wherein said second engineered meganuclease is said engineered meganuclease of any one of claims 50-75,wherein said one or more polynucleotides are delivered to a target cell in said subject, wherein said first engineered meganuclease and said second engineered meganuclease are expressed in said target cell,wherein said first engineered meganuclease produces a first cleavage site in said dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, wherein said second engineered meganuclease produces a second cleavage site in said dystrophin gene at a recognition sequence comprising SEQ ID NO: 10 or SEQ ID NO: 12,wherein said first cleavage site and said second cleavage site have complementary 3' overhangs,wherein the intervening genomic DNA between said first cleavage site and said second cleavage site is excised from said dystrophin gene, wherein said dystrophin gene is annealed,2026223416   31 Aug 2026and wherein a normal reading frame of said dystrophin gene is restored as compared to a full-length wild-type dystrophin gene.

196. The method of claim 195, wherein said complementary 3' overhangs of said first cleavage site and said second cleavage site are directly re-ligated to one another.

197. The method of claim 195 or claim 196, wherein said dystrophin gene comprises a nucleic acid sequence set forth in SEQ ID NO: 32 or 34.

198. The method of any one of claims 195-197, wherein said dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of a wild-type dystrophin gene.

199. The method of any one of claims 195-198, wherein said subject is converted to a Becker Muscular Dystrophy phenotype.

200. The method of any one of claims 195-199, wherein said method comprises administering to said subject a first polynucleotide comprising a first nucleic acid encoding said first engineered meganuclease and a second polynucleotide comprising a second nucleic acid sequence encoding said second engineered meganuclease.

201. The method of claim 200, wherein said first polynucleotide is a first mRNA.

202. The method of claim 200 or claim 201, wherein said second polynucleotide is a second mRNA.

203. The method of claim 201 or claim 202, wherein said first mRNA and / or said second mRNA is said mRNA of claim 77.

204. The method of claim 200, wherein said first polynucleotide is a first recombinant DNA construct.

205. The method of claim 200 or claim 204, wherein said second polynucleotide is a second recombinant DNA construct.2026223416   31 Aug 2026206. The method of claim 204 or claim 205, wherein said first recombinant DNA construct and / or said second recombinant DNA construct is said recombinant DNA construct of any one of claims 78-85.

207. The method of any one of claims 200-206, wherein said first polynucleotide and said second polynucleotide are administered to said subject by a lipid nanoparticle.

208. The method of any one of claims 200-207, wherein said first polynucleotide is administered to said subject by a first lipid nanoparticle.

209. The method of any one of claims 200-208, wherein said second polynucleotide is administered to said subject by a second lipid nanoparticle.

210. The method of any one of claims 200-203, wherein said first polynucleotide is administered to said subject by a first recombinant virus.

211. The method of any one of claims 200-203 and 210, wherein said second polynucleotide is administered to said subject by a second recombinant virus.

212. The method of claim 210 or claim 211, wherein said first recombinant and / or said second recombinant virus are said recombinant virus of any one of claims 85-91.

213. The method of claim 195, wherein said method comprises administering to said subject a polynucleotide comprising a first nucleic acid encoding said first engineered meganuclease and a second nucleic acid sequence encoding said second engineered meganuclease.

214. The method of claim 213, wherein said polynucleotide is an mRNA.

215. The method of claim 214, wherein said mRNA is said mRNA of claim 101 orclaim 102.

216. The method of claim 213, wherein said polynucleotide is a recombinant DNA construct.2026223416   31 Aug 2026217. The method of claim 216, wherein said recombinant DNA construct is said recombinant DNA construct of any one of claims 103-114.

218. The method of claim 213, wherein said polynucleotide is administered to said subject by a lipid nanoparticle.

219. The method of claim 213, wherein said polynucleotide is administered to said subject by a recombinant virus.

220. The method of claim 219, wherein said recombinant virus is said recombinant virus of any one of claims 115-125.

221. The method of any one of claims 195-220, wherein said subject is a mammal.

222. The method of any one of claims 195-221, wherein said target cell is a musclecell.

223. The method of claim 222, wherein said muscle cell is a muscle precursor cell, a skeletal muscle cell, or a cardiac muscle cell.

224. The method of any one of claims 195-223, wherein said subject is a human.