Anti-TNF antibody compositions and methods for the treatment of juvenile idiopathic arthritis

Abstract

20 26 25 39 95 16 O ct 2 02 6 A B S T R A C T 2 0 2 6 2 5 3 9 9 5 1 6 O c t 2 0 2 6

Description

CROSS-REFERENCE TO RELATED APPLICATIONS 5 This application is a divisional application of Australian Patent Application No. 2020208828, and is related to International Patent Application No. PCT / IB2020 / 050266, and claims priority to U.S. Patent Application No. 62 / 899,171, 62 / 820,593 and 62 / 792,568, the disclosure of each of which is incorporated herein by reference in their entirety. 10 REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY Preceding applications contained a Sequence Listing which is hereby incorporated by reference in its entirety. The present application contains a sequence listing which has been 15 submitted electronically as an XML document in the ST.26 format and is also hereby incorporated by reference in its entirety. FIELD OF THE INVENTION 20          The present invention relates to compositions and methods utilizing anti-TNF antibodies, e.g., the anti-TNF antibody golimumab having a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37, for use in treatment of juvenile idiopathic arthritis (JIA), and in particular for polyarticular juvenile idiopathic arthritis (pJIA). 25 BACKGROUND OF THE INVENTION TNF alpha is a soluble homotrimer of 17 kD protein subunits. A membrane-bound 26 kD precursor form of TNF also exists. 30          Cells other than monocytes or macrophages also produce TNF alpha. For example, human non-monocytic tumor cell lines produce TNF alpha and CD4+ and CD8+ peripheral blood T lymphocytes and some cultured T and B cell lines also produce TNF alpha. 2026253995   16 Oct 2026 TNF alpha causes pro-inflammatory actions which result in tissue injury, such as degradation of cartilage and bone, induction of adhesion molecules, inducing procoagulant activity on vascular endothelial cells, increasing the adherence of neutrophils and 5 lymphocytes, and stimulating the release of platelet activating factor from macrophages, neutrophils and vascular endothelial cells. TNF alpha has been associated with infections, immune disorders, neoplastic pathologies, autoimmune pathologies and graft-versus-host pathologies. The association 10                                     [text continues on page 2] 2026253995   16 Oct 2026 of TNF alpha with cancer and infectious pathologies is often related to the host's catabolic state. Cancer patients suffer from weight loss, usually associated with anorexia The extensive wasting which is associated with cancer, and other diseases, is known as "cachexia". Cachexia includes progressive weight loss, anorexia, and persistent 5 erosion of lean body mass in response to a malignant growth. The cachectic state causes much cancer morbidity and mortality. There is evidence that TNF alpha is involved in cachexia in cancer, infectious pathology, and other catabolic states. TNF alpha is believed to play a central role in gram-negative sepsis and endotoxic shock, including fever, malaise, anorexia, and cachexia. Endotoxin strongly activates 10 monocyte / macrophage production and secretion ofTNF alpha and other cytokines. TNF alpha and other monoevte-derived cytokines mediate the metabolic and neurohormonal responses to endotoxin. Endotoxin administration to human volunteers produces acute illness w ith flu-like symptoms including fever, tachycardia, increased metabolic rate and stress hormone release. Circulating TNF alpha increases in patients suffering from Gram- 15 negative sepsis. Thus. TNF alpha has been implicated in inflammatory diseases, autoimmune diseases, viral, bacterial and parasitic infections, malignancies, and / or neurodegenerative diseases and is a useful target for specific biological therapy in diseases, such as rheumatoid arthritis and Crohn's disease. Beneficial effects in open-label trials with 20 monoclonal antibodies to TNF alpha have been reported with suppression of inflammation and w ith successfill retreatment after relapse in rheumatoid arthritis and in Crohn's disease. Beneficial results in a randomized, double-blind, placebo-controlled trials have also been reported in rheumatoid arthritis w ith suppression of inflammation. Neutralizing antisera or mAbs to TNF have been shown in mammals other than 25 man to abrogate adverse physiological changes and prevent dcadi after lethal challenge in experimental endotoxemia and bacteremia. This effect has been demonstrated, e.g.. in rodent lethality assays and in primate pathology model systems. Putative receptor binding loci of hTNF has been disclosed and the receptor binding loci ofTNF alpha as consisting of amino acids 11-13. 37-42. 49-57 and 155-157 30 of TNF have been disclosed Non-human mammalian, chimeric, polyclonal (e.g.. anti-sera) and / or monoclonal antibodies (Mabs) and fragments (e g., proteolytic digestion or fusion protein products 2026253995   16 Oct 2026 thereof) arc potential therapeutic agents that arc being investigated in some cases to attempt to treat certain diseases. However, such antibodies or fragments can elicit an immune response when administered to humans Such an immune response can result in an immune complex-mediated clearance of the antibodies or fragments from the circulation, and make repeated administration unsuitable for therapy, thereby reducing the therapeutic benefit to the patient and limiting the re-administration of the antibody or fragment. For example, repeated administration of antibodies or fragments comprising non-human portions can lead to serum sickness and / or anaphylaxis. In order to avoid these and other problems, a number of approaches have been taken to reduce the immunogenicity of such antibodies and portions thereof, including chimerization and humanization, as well known in the art. These and other approaches, however, still can result in antibodies or fragments having some immunogenicity, low affinity, low avidity, or with problems in cell culture, scale up. production, and / or low yields Thus, such antibodies or fragments can be less than ideally suited for manufacture or use as therapeutic proteins. A need to provide TNF inhibitors that overcame one more of these problems led to development of currently marketed anti-TNF antibodies and other TNF inhibitors, e.g., anti-TNF antibodies such as REMICADE k (infliximab). HUMIRA k (adaliinumab). and S1MPONI k (golimumab) Other TNF inhibitors include, e g.. C1MZIA K (certolizumab pegol), a PEGylated antibody fragment, and ENBRELF (etanercept), a soluble TNF receptor fusion protein. For a review of TNF inhibitors, see. e.g.. Lis ct al.. Arch Med Sei. 2014 Dee 22; 10(6): 1175-1185. SUMMARY OF THE INVENTION The general and preferred embodiments are defined. rcspccti\ ely. by the independent and dependent claims appended hereto, w hich for the sake of brevity are incorporated by reference herein. Other preferred embodiments, features, and advantages of the various aspects of the invention will become apparent from the detailed description below taken in conjunction w ith the appended draw ing figures. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a patient the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective 2026253995   16 Oct 2026 amount. wherein the anti-TNF antibody composes a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence ofSEQIDNO:37 In certain embodiments, the present invention provides a method of treating 5 juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an ammo acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein said patient is a pediatric patient that is 2-17 years 10 old In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically7 proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an 15 amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an ammo acid sequence of SEQ ID NO:37. wherein said patient is a pediatric patient that is 2-17 years old and said juvenile idiopathic arthritis (JIA) is poly articular juvenile idiopathic arthritis (pJJA). In certain embodiments, the present invention provides a method of treating 20 juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein said patient is a pediatric patient that is 2-17 years 25 old and said juvenile idiopathic arthritis (JIA) is poly articular juvenile idiopathic arthritis (pJIA). and wherein the anti-TNF antibody is administered with an intravenous (IV) dose of 80mg / m2. at w eeks 0. 4. and then every 8 w eeks thereafter. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a patient the method comprising administering an 30 anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an 2026253995   16 Oct 2026 amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein the method further comprises administering methotrexate (MTX) to the patient In certain embodiments, the present invention provides a method of treating 5 juvenile idiopathic artliritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein the anti-TNF antibody is administered with an 10 intravenous (IV) dose of 80mg / m’. at weeks 0. 4. and then every 8 weeks thereafter, and wherein the method further comprises administering methotrexate (MTX) to the patient. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective 15 amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein after 28 weeks of treatment with the anti-TNF antibody the patient meets the criteria for inactive disease In certain embodiments, the present invention provides a method of treating 20 juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein the anti-TNF antibody is administered with an 25 intravenous (IV) dose of 80mg / m’. at weeks 0, 4. and then every 8 weeks thereafter, and wherein the method further comprises administering methotrexate (MTX) to the patient, wherein after 28 weeks of treatment w ith the anti-TNF antibody the patient meets the criteria for inactive disease. In certain embodiments, the present invention provides a method of treating 30 juvenile idiopathic artliritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective 2026253995   16 Oct 2026 amount, w herein the anti-TNF antibod}' comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO37. wherein after 28 weeks of treatment with the anti-TNF antibody >29% of the patients meet the criteria for inactive disease. 5           In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibod) to the patient in a clinically proven safe and clinically proven effective amount, wherein tire anti-TNF antibod) comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid 10 sequence of SEQ ID NO:37. wherein the anti-TNF antibod) is administered with an intravenous (IV) dose of 80mg / nr. at weeks 0. 4. and then every 8 weeks thereafter, and wherein the method further comprises administering methotrexate (MTX) to the patient, wherein after 28 weeks of treatment w ith the anti-TNF antibod) >29% of the patients meet tlie criteria for inactive disease. 15           in certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a paticnL the method comprising administering an anti-TNF antibody to the patient in a clinical!) proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid 20 sequence of SEQ ID NO: 37. wherein after 28 weeks of treatment tlie patient has an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response selected from the group consisting of: JIA ACR 30. JIA ACR 50, JIA ACR 70. and JIA ACR 90. In certain embodiments, the present invention provides a method of treating 25 juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein tlie anti-TNF antibod) comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37, wherein after 28 weeks of treatment >83% of the patients 30 meet the criteria for JIA ACR 30. >79% of the patients meet the criteria for JIA ACR 50, >70% of tlie patients meet the criteria for JI A ACR 70. and >46% of the patients meet the criteria for JIA ACR 90 2026253995   16 Oct 2026 In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an 5 amino acid sequence of SEQ ID NO:36 and a light chain (LC) composing an ammo acid sequence of SEQ ID NO:37, wherein the anti-TNF antibody is administered with an intravenous (IV) dose of SOmg / nr. at weeks 0. 4. and then every 8 weeks thereafter, and wherein the method further comprises administering methotrexate (MTX) to the patient, wherein after 28 weeks of treatment >83% of the patients meet the criteria for JIA ACR 10   30, >79% of the patients meet the criteria for JIA ACR 50, >70% of the patients meet the criteria for JIA ACR 70. and >46% of the patients meet the criteria for JIA ACR 90. The method of any of claims 1-5, wherein after 28 weeks of treatment with the anti-TNF antibody the patient has a change from baseline in Juvenile Arthritis Disease Activity Score (JADAS) selected from the group consisting of: JADAS 10. JADAS 27, 15 and JADAS 71 The method of claim 10, wherein patients with JADAS 10 have a median decrease from baseline >14. patients with JADAS 27 have a median decrease from baseline >16. and patients with JADAS 71 have a median decrease from baseline >20. In certain embodiments, the present invention provides a method of treating 20 juvenile idiopathic arthritis (JIA) in a patient, the method comprising administering an anti-TNF antibody to the patient in a clinically proven safe and clinically proven effective amount, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. wherein the anti-TNF antibody is administered with an 25 intravenous (IV) dose of 80mg / m2. at weeks 0, 4. and dien every 8 weeks thereafter, and wherein the method further comprises administering methotrexate (MTX) to the patient, wherein after 28 weeks of treatment patients with JADAS 10 have a median decrease from baseline >14. patients with JADAS 27 have a median decrease from baseline >16. and patients with JADAS 71 have a median decrease from baseline >20 30           In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, die method comprising 2026253995   16 Oct 2026 administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37, and wherein the patients treated with the anti-TNF antibody meet the criteria for 5 inactive disease after 4 weeks of treatment, 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 24 weeks of treatment, or 28 weeks of treatment. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising 10 administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37, and wherein the patients treated with the anti-TNF antibody meet the criteria for inactive disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 15   16 weeks of treatment. 20 weeks of treatment 24 weeks of treatment, or 28 weeks of treatment, wherein >10% of the patients meet the criteria for inactive disease after 8 weeks of treatment, >20% of the patients meet the criteria for inactive disease after 16 weeks of treatment, and >29% of the patients meet the cntcria for inactive disease after 28 weeks of treatment. 20           In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, tlie method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid sequence of SEQ ID 25   NO:37. and wherein the patients treated with tlie anti-TNF antibody meet the criteria for inactive disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment, 24 weeks of treatment, or 28 weeks of treatment, wherein said pediatric patients arc 2-17 years old. In certain embodiments, the present invention provides a method of treating 30 juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein tlie anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence 2026253995   16 Oct 2026 of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO37. and wherein the patients treated with the anti-TNF antibody meet the criteria for inactive disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment, 16 w eeks of treatment. 20 w eeks of treatment. 24 w eeks of treatment, or 28 w eeks of 5 treatment, wherein said juvenile idiopathic arthritis (JIA) is polyarticular juvenile idiopathic arthritis (pJIA). In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein 10 the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. and wherein the patients treated with the anti-TNF antibody meet the criteria for inactive disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 w eeks of treatment. 24 w eeks of treatment, or 28 w eeks of 15 treatment, w herein the IV dose is 80mg / m-. at weeks 0, 4. and then every 8 weeks thereafter. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein 20 the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. and wherein the patients treated with the anti-TNF antibody meet the criteria for inactive disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment, 20 weeks of treatment. 24 weeks of treatment, or 28 weeks of 25 treatment, wherein the method further comprises administering methotrexate (MTX) to the pediatric patients. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient wherein 30 the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO 37. and wherein the patients treated with the anti-TNF antibody have an improvement 2026253995   16 Oct 2026 from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of treatment. 5           In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO 36 and a light chain (LC) comprising an amino acid sequence of SEQ ID 10   NO37, and wherein the patients treated with the anti-TNF antibody have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment. 8 weeks of treatment. 12 w eeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment or 28 weeks of treatment, wherein after 4 weeks of 15 treatment >50% of the patients meet the criteria for JIA ACR 30 and JIA ACR 50 In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence 20   of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO 37. and wherein the patients treated w itli the anti-TNF antibody have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment. 8 w eeks of treatment. 12 weeks of treatment. 16 weeks of treatment, 20 weeks 25   of treatment. 2 weeks of treatment, or 28 weeks of treatment, wherein after 12 weeks of treatment >50% of the patients meet the criteria for JIA ACR 30, JIA ACR 50. and JIA ACR 70 In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising 30 administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO 36 and a light chain (LC) comprising an amino acid sequence of SEQ ID 2026253995   16 Oct 2026 NO:37. and wherein the patients treated with the anti-TNF antibod} have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment. 8 weeks of treatment, 12 weeks of treatment, 16 weeks of treatment, 20 weeks of treatment. 2 weeks of treatment, or 28 w ecks of treatment, w herein after 28 w eeks of treatment >83% of the patients meet the criteria for JIA ACR 30, >79% of the patients meet the criteria for JIA ACR 50, >70% of the patients meet the criteria for JIA ACR 70 and >46% of die patients meet the criteria for JIA ACR 90. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. and wherein the patients treated with the anti-TNF antibod} have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment, 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment, 20 weeks of treatment. 2 weeks of treatment, or 28 w eeks of treatment, wherein said pediatric patients arc 2-17 years old. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibod} to the patient, wherein the anti-TNF antibod}- comprises a heavy chain (HC) composing an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37. and wherein the patients treated with die anti-TNF antibody have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30, JIA ACR 50. JIA ACR 70, or JIA ACR 90 after 4 weeks of treatment, 8 w eeks of treatment, 12 w eeks of treatment, 16 w eeks of treatment, 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of treatment, wherein said juvenile idiopathic arthritis (JIA) is polyarticular juvenile idiopathic arthritis (pJIA). In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising 2026253995   16 Oct 2026 administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) composing an amino acid sequence of SEQ ID NO:37, and wherein the patients treated with the anti-TNF antibody have an improvement 5 from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment, 16 weeks of treatment, 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of treatment, wherein the IV dose is 80mg / m2, at weeks 0. 4, and then even 8 weeks thereafter. 10           In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO36 and a light chain (LC) comprising an amino acid sequence of SEQ ID 15 NO 37. and wherein the patients treated with the anti-TNF antibody have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 90 after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of treatment, wherein the method further 20 comprises administering methotrexate (MTX) to the pediatric patients. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence 25   of SEQ ID NO 36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO 37. and wherein the patients treated with the anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27, or JADAS 71 minimal disease after 4 weeks of treatment 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of 30 treatment In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising 2026253995   16 Oct 2026 administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) composing an amino acid sequence of SEQ ID NO:37, and wherein the patients treated with the anti-TNF antibody have a Juvenile 5 Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or JADAS 71 minimal disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of treatment, wherein > 10% of patients have JADAS 10. JADAS 27. and JADAS 71 minimal disease activity' disease after 12 weeks of treatment. 16 weeks of treatment. 20 10 weeks of treatment, 24 weeks of treatment, and 28 weeks of treatment In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence 15   of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO37. and wherein the patients treated with the anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or JADAS 71 minimal disease after 4 weeks of treatment, 8 weeks of treatment. 12 weeks of treatment, 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of 20 treatment, wherein > 15% of patients have JADAS 10. JADAS 27. and JADAS 71 minimal disease activity disease after 24 weeks of treatment and 28 weeks of treatment. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein 25 the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO 36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO 37. and wherein the patients treated with tire anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or JADAS 71 minimal disease after 4 weeks of treatment 8 w eeks of treatment. 12 w eeks of treatment. 30   16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of treatment, wherein said pediatric patients are 2-17 years old 2026253995   16 Oct 2026 In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence 5   of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37, and wherein the patients treated with the anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or JADAS 71 minimal disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment. 2 weeks of treatment, or 28 weeks of 10 treatment, wherein said juvenile idiopathic arthritis (JIA) is polyarticular juvenile idiopathic arthritis (pJ IA). In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein 15 the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO 37. and wherein the patients treated with the anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or JADAS 71 minimal disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 20   16 weeks of treatment. 20 w eeks of treatment. 2 weeks of treatment, or 28 w eeks of treatment, wherein the IV dose is 80mg / m2. at weeks 0. 4. and then even 8 weeks thereafter. In certain embodiments, the present invention provides a method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising 25 administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy' chain (HC) comprising an amino acid sequence of SEQ ID NO 36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:37, and wherein the patients treated with the anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or JADAS 71 30 minimal disease after 4 w eeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 weeks of treatment. 20 weeks of treatment, 2 weeks of treatment, or 28 weeks of 2026253995   16 Oct 2026 treatment, wherein the method further comprises administering methotrexate (MTX) to the pediatric patients. DESCRIPTION OF THE FIGURES 5           Fig. 1 shows a graphical representation showing an assay for ability of TNV inAbs in hybridoma cell supernatants to inhibit TNFa binding to recombinant TNF receptor. Varying amounts of hybridoma cell supernatants containing known amounts of TNV mAb were prcincubatcd with a fixed concentration (5 ng / ml) of l25I-labclcd TNFa Tire mixture was transferred to 96-wcll Optiplates that had been previously coated w ith 10   p55-sf2. a recombinant TNF reccptor / IgG fusion protein The amount of TNFa that bound to the p55 receptor in the presence of the mAbs was determined after washing away the unbound material and counting using a gamma counter Although eight TNV mAb samples were tested in these experiments, for simplicity three of tire mAbs that were shown by DNA sequence analyses to be identical to one of the other TNV mAbs are not 15 shown here. Each sample was tested in duplicate. The results shown arc representative of two independent experiments. Fig. 2A-B shows DNA sequences of the TNV mAb heavy chain variable regions. The gcrmlinc gene show n is the DP-46 gene. 'TNVs' indicates that the sequence shown is the sequence of TNV 14. TNV 15. TNV 148. and TNV 196. The first three nucleotides in 20 the TNV sequence define the translation initiation Met codon. Dots in the TNV mAb gene sequences indicate the nucleotide is the same as in the germline sequence. The first 19 nucleotides (underlined) of the TNV sequences correspond to the oligonucleotide used to PCR-amplify the variable region. An amino acid translation (single letter abbreviations) starting w ith the mature mAb is shown only for the gcrmlinc gene. The 25 three CDR domains in the gcrmline amino acid translation are marked in bold and underlined. Lincs labeled TNV 148(B) indicate that the sequence shown pertains to both TNV 148 and TNVI48B Gaps in the gcrmlinc DNA sequence (CDR3) were due to the sequence not being known or not existing in the germline gene at the time. The TNV mAb heavy chains use the J6 joining region. 30          Fig. 3 shows DNA sequences of the TNV mAb light chain variable regions. The germline gene shown is a representative member of the Vg / 38K family of human kappa gcrmlinc variable region genes. Dots in the TNV mAb gene sequences indicate the 2026253995   16 Oct 2026 nucleotide is the same as in the germlinc sequence. The first 16 nucleotides (underlined) of the TNV sequences correspond to the oligonucleotide used to PCR-amplify the variable region. An amino acid translation of the mature mAb (single letter abbreviations) is shown only for the germline gene. The three CDR domains in the germline ammo acid translation are marked in bold and underlined. Lincs labeled TNV 148(B) indicate that the sequence shown pertains to both TNV 148 and TNV148B. Gaps in the germline DNA sequence (CDR3) arc due to the sequence not being know n or not existing in the germline gene. The TNV mAb light chains use the J3 joining sequence. Fig. 4 shows deduced amino acid sequences of the TNV mAb heavy chain variable regions. The amino acid sequences shown (single letter abbreviations) w ere deduced from DNA sequence determined from both uncloned PCR products and cloned PCR products. The amino sequences arc shown partitioned into the secretory signal sequence (signal), framework (FW). and complementarity determining region (CDR) domains The ammo acid sequence for the DP-46 germlinc gene is shown on the top line for each domain. Dots indicate that the amino acid in the TNV in Ab is identical to the germline gene. TNV 148(B) indicates that tire sequence shown pertains to both TNV 148 and TNV148B. 'TNVs' indicates that the sequence shown pertains to all TNV mAbs unless a different sequence is shown. Dashes in the germlinc sequence (CDR3) indicate that the sequences arc not known or do not exist in the germlinc gene. Fig. 5 shows deduced amino acid sequences of the TNV mAb light chain variable regions. The amino acid sequences shown (single letter abbreviations) were deduced from DNA sequence determined from both uncloncd PCR products and cloned PCR products. The amino sequences are shown partitioned into the secretory signal sequence (signal), framework (FW). and complementarity determining region (CDR) domains. The amino acid sequence for the Vg / 38K-tv pc light chain germline gene is shown on the top line for each domain. Dots indicate that the amino acid in the TNV mAb is identical to the germlinc gene. TNV 148 (B) indicates that the sequence shown pertains to both TNV 148 and TNVI48B. 'AH' indicates that the sequence shown pertains to TNV 14. TNV 15. TNV148. TNVI48B. and TNV186. Fig. 6 show s schematic illustrations of the heavy and light chain expression plasmids used to make the rTNV148B-expressing C466 cells p 1783 is the heavy chain plasmid and pl776 is the light chain plasmid. The rTNV148B variable and constant region coding domains are show n as black boxes. The immunoglobulin enhancers in the 2026253995   16 Oct 2026 J-C introns are shown as gray boxes. Relevant restriction sites are show n. The plasmids arc shown oriented such that transcription of the Ab genes proceeds in a clockwise direction. Plasmid pl783 is 19.53 kb in length and plasmid pl776 is 15.06 kb in length. The complete nucleotide sequences of both plasmids are known. The variable region 5 coding sequence in pl783 can be easily replaced with another heavy chain vanable region sequence by replacing the BsiWl / BstBl restriction fragment. The variable region coding sequence in pl776 can be replaced with another variable region sequence by replacing the Sall / Aflll restriction fragment. Fig. 7 shows graphical representation of growth curve analyses of five 10 rTNV148B-producing cell lines. Cultures were initiated on day 0 by seeding cells into T75 flasks in 15Q+MHX media to have a viable cell density of 1.0 X 10’ cells / ml in a 30 ml volume. The cell cultures used for these studies had been in continuous culture since transfections and subclonings w ere performed On subsequent days, cells in the T flasks were thoroughly resuspended and a 0.3 mi aliquot of the culture w as removed. The 15 growth curve studies were terminated yvhen cell counts dropped below 1.5 X 105 cells / ml. The number of live cells in the aliquot was determined by tn pan blue exclusion and the remainder of the aliquot stored for later mAb concentration determination. An ELISA for human IgG was performed on all sample aliquots at the same time. Fig. 8 shows a graphical representation of the comparison of cell growth rates in 20 the presence of varying concentrations of MHX selection. Cell subclones C466A and C466B were thawed into MHX-frce media (IMDM. 5% FBS. 2 mM glutamine) and cultured for two additional days. Both cell cultures were then divided into three cultures that contained cither no MHX. 0.2X MHX. or IX MHX One day later, fresh T75 flasks were seeded with the cultures at a starting density of 1 X 105 cells / ml and cells counted at 25   24 hour intervals for one week. Doubling times during the first 5 days were calculated using the formula in SOP PD32.O25 and are shown above the bars. Fig. 9 shows graphical representations of the stability of mAb production over time from two rTNV148B-producing cell lines. Cell subcloncs that had been in continuous culture since performing transfections and subclonings were used to start 30 long-term serial cultures in 24-well culture dishes. Cells were cultured in 15Q media w ith and w ithout MHX selection. Cells were continually passaged by splitting the cultures even 4 to 6 days to maintain new viable cultures while previous cultures were allowed to go spent. Aliquots of spent cell supernatant were collected shortly after cultures were 2026253995   16 Oct 2026 spent and stored until the mAb concentrations were determined. An ELISA for human IgG was performed on all sample aliquots at the same time. Fig. 10 shows arthritis mouse model mice Tg 197 weight changes in response to anti-TNF antibodies of the present invention as compared to controls in Example 4. At 5 approximately 4 weeks of age the Tg 197 study mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single intraperitoneal bolus dose of Dulbecco's PBS (D-PBS) or an anti-TNF antibody of the present invention (TNVI4. TNV148 or TNV196) at either 1 mg / kg or 10 mg / kg. When the weights were analyzed as a change from pre-dose, the animals treated with 10 mg / kg cA2 showed 10 consistently higher weight gain than the D-PBS-treated animals throughout the study This weight gain was significant at weeks 3-7, The animals treated with 10 mg / kg TN V148 also achieved significant weight gain at week 7 of the study. Fig. 11A-C represent the progression of disease severity based on the arthritic index as presented in Example 4. The 10 mg / kg cA2-trcatcd group s arthritic index was 15 lower than the D-PBS control group starting at week 3 and continuing throughout tire remainder of the study (week 7). The animals treated with 1 mg / kg TNV14 and the animals treated with 1 mg / kg cA2 failed to show significant reduction in Al after week 3 when compared to the D-PBS-treated Group. There were no significant differences between the 10 mg / kg treatment groups when each w as compared to the others of similar 20 dose (10 mg / kg cA2 compared to 10 mg / kg TNV 14. 148 and 196). When the 1 mg / kg treatment groups were compared, the 1 mg / kg TNV 148 showed a significantly lower Al than 1 mg / kg cA2 at 3. 4 and 7 weeks. The 1 mg / kg TNV 148 was also significantly lower than the I mg / kg TNV14-treatcd Group at 3 and 4 weeks. Although TNV 196 showed significant reduction in Al up to w eek 6 of tire study (when compared to the D-PBS- 25 treated Group), TNV 148 was tire only 1 mg / kg treatment that remained significant at tire conclusion of the study. Fig. 12 shows arthritis mouse model mice Tg 197 weight changes in response to anti-TNF antibodies of the present invention as compared to controls in Example 5. At approximately 4 weeks of age the Tg 197 study mice were assigned, based on body 30 weight, to one of 8 treatment groups and treated with a intraperitoneal bolus dose of control article (D-PBS) or antibody (TNV 14. TNV 148) at 3 mg / kg (week 0). Injections were repeated in all animals at w eeks 1. 2. 3. and 4. Groups 1-6 were evaluated for test article efficacy Scrum samples, obtained from animals in Groups 7 and 8 were evaluated 2026253995   16 Oct 2026 for immune response inductively and pharmacokinetic clearance ofTNV14 or TNV 148 at weeks 2,3 and 4. Fig. 13A-C are graphs representing the progression of disease severity in Example 5 based on the arthritic index. The 10 mg / kg cA2-treatcd group s arthritic index was 5 significantly lower than the D-PBS control group starting at week 2 and continuing throughout the remainder of the study (week 5). The animals treated with 1 mg / kg or 3 mg / kg of cA2 and the animals treated with 3 mg / kg TNV 14 failed to achieve any significant reduction in Al at any time throughout the study when compared to the d-PBS control group. The animals treated with 3 mg / kg TNV 148 showed a significant reduction 10 when compared to the d-PBS-treatcd group starting at week 3 and continuing through week 5. The 10 mg / kg cA2-trcated animals showed a significant reduction in Al when compared to both the lower doses (1 mg / kg and 3 mg / kg) of cA2 at weeks 4 and 5 of the study and was also significantly lower than the TNV 14-treated animals at weeks 3-5. Although there appeared to be no significant differences betw een any of the 3mg / kg 15 treatment groups, the Al for the animals treated witli 3 mg / kg TNV 14 were significantly higher at some time points than the 10 mg / kg whereas the animals treated with TNV148 were not significantly different from the animals treated witli 10 mg / kg of cA2. Fig. 14 shows arthritis mouse model mice Tg 197 weight changes in response to anti-TNF antibodies of the present invention as compared to controls in Example 6. At 20 approximately 4 weeks of age the Tgl97 study mice were assigned, based on gender and body weight, to one of 6 treatment groups and treated with a single intraperitoneal bolus dose of antibody (cA2. or TNV 148) at cither 3 mg / kg or 5 mg / kg. This study utilized the D-PBS and 10 mg / kg cA2 control Groups. Fig. 15 represents the progression of disease severity' based on the arthritic index 25 as presented in Example 6. All treatment groups showed some protection at the earlier time points, with the 5 mg / kg cA2 and the 5 mg / kg TNV 148 showing significant reductions in Al at weeks 1-3 and all treatment groups show ing a significant reduction at week 2 Later in the study the animals treated with 5 mg / kg cA2 showed some protection, w ith significant reductions at w eeks 4. 6 and 7. The low dose (3 mg / kg) of both the cA2 30 and the TNV 148 showed significant reductions at 6 and all treatment groups showed significant reductions at week 7. None of the treatment groups w ere able to maintain a significant reduction at the conclusion of the study (week 8). There were no significant 2026253995   16 Oct 2026 differences between any of the treatment groups (excluding the saline control group) at any time point Fig. 16 shows arthritis mouse model mice Tg 197 weight changes in response to anti-TNF antibodies of the present invention as compared to controls in Example 7. To 5 compare the efficacy of a single intraperitoneal dose of TN V148 (derived from hybridoma cells) and rTNV 148B (derived from transfected cells). At approximately 4 weeks of age the Tgl97 study mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single intraperitoneal bolus dose of Dulbecco’s PBS (D-PBS) or antibody (TNVI48. rTNV148B) at 1 mg / kg. 10           Fig. 17 represents the progression of disease severity based on the arthritic index as presented in Example 7. The 10 mg / kg cA2-treated group s arthritic index was lower than the D-PBS control group starting at week 4 and continuing throughout the remainder of the study (w eek 8). Both of the TNV148-treated Groups and die 1 mg / kg cA2-trcated Group showed a significant reduction in Al at week 4 Although a previous study (P-099 15   017) showed that TNV148 was slightly more effective at reducing the Arthritic Index following a single 1 mg / kg intraperitoneal bolus, this study showed that the AI from both versions of the TNV antibody-treated groups was slightly higher. Although (with die exception of w eek 6) the 1 mg / kg cA2-treated Group w as not significantly increased when compared to the 10 mg / kg cA2 group and the TNV 148-trcatcd Groups were 20 significantly higher at weeks 7 and 8. there w ere no significant differences in AI between the I mg / kg cA2. 1 mg / kg TNVI48 and 1 mg / kg TNV 148B at any point in the study. Fig. 18 shows a diagram of the pJIA clinical study design. DBL = Database Lock. LTE = Long-term extension. MSE = Major secondary endpoint. PE = Primary endpoint Golimumab 80 mg / ni2 IV infusions arc marked witii an arrow at die indicated times. 25 Patients also received commercial MTX through at least Week 28 at the same w eekly BSA-based dose as at the time of study entry. Fig. 19 shows die proportion of JIA ACR 30, 50. 70. and 90 responders through week 28. Sy mbols for JIA ACR 30. 50. 70. and 90 arc closed circle, closed square, closed triangle, and closed diamond, respectively. 30           Fig. 20 shows the proportion of patients w ith inactive disease through week 28. 2026253995   16 Oct 2026 Fig. 21 shows the proportion of patients with JADAS 10, 27. or 71 minimal disease activity through week 28. *Note: In this analysis, values for the JADAS 10. 27. and 71 endpoints are the same. Fig. 22 shows population PK (PPK) model goodness of fit plots for individual 5 prediction (pg / ml), population prediction (pg / ml), and days post Is' dose for observed concentrations (pg / ml) and for condition weighted residuals (CWRES). Fig. 23 show s Week 28 primary endpoints in different age categories for observed Ctrough.ss (serum golimumab trough concentration in pg / ml) and post-hoc AUC.ss over 8-wcceks (AUCss of scrum golimumab concentration in pg*day / ml). The horizontal line 10 within the box represents the median: the lower edge of the box represents the Is' quartile: the upper edge of the box represents the 3"* quartile: and the whiskers are the most extreme observations w ithin 1.5 x IQ range. Fig. 24 shows Week 52 secondary endpoints in different age categories for observed Ctrough.ss (scrum golimumab trough concentration in pg / ml) and post-hoc 15 AUC.ss over 8-weecks (AUCss of scrum golimumab concentration in pg*day / ml), The horizontal line within the box represents the median: the lower edge of the box represents the 1st quartile: the upper edge of the box represents the 3rd quartile: and the whiskers are the most extreme observations within 1.5 x IQ range. Fig. 25 shows Week 28 PK by body-weight quartiles for Ctrough.ss (serum 20 golimumab trough concentration in pg / ml) and post-hoc AUC.ss over 8-weeeks (AUCss of serum golimumab concentration in pg*dav / ml). The horizontal line within the box represents the median: the low er edge of the box represents the Is' quartile: the upper edge of the box represents the 3,d quartile: and the w hiskers are the most extreme observations within 1.5 x IQ range. 25          Fig. 26 shows Week 28 PK by C-reactive protein (CRP) quartiles for Ctrough.ss (serum golimumab trough concentration in pg / ml) and post-hoc AUC.ss over 8-weecks (AUCss of scrum golimumab concentration in pg*day / ml). The horizontal line within the box represents the median: the lower edge of the box represents the 1st quartile, the upper edge of the box represents the 3"1 quartile: and the vv hiskers are the most extreme 30 observations within 1.5 x IQ range 2026253995   16 Oct 2026 Fig. 27 shows observed Ctrough.ss (serum golimumab trough concentration in pg / ml) at Week 28 in different age categories for pIJA subjects in the GO-VIVA study and Week 20 and Week 36 in Adult RA subjects in the GO-FURTHER study. Fig. 28 shows post-hoc AUC.ss over 8-wcceks (AUCss of serum golimumab 5 concentration in pg*day / ml) at Week 28 in different age categories for pIJA subjects in the GO-VIVA study and in Adult RA subjects in the GO-FURTHER study. Fig. 29A-D show Week 52 JIA ACR responses by PK quartiles for serum golimumab concentration (pg / ml). Fig. 29A shows JIC ACR 30 Responders. Fig. 29B shows JIC ACR 50 Responders. Fig. 29C shows JIC ACR 70 Responders, and Fig. 29D 10 shows JIC ACR 90 Responders. DESCRIPTION OF THE INVENTION The present invention provides compositions comprising anti-TNF antibodies having a heavy chain (HC) composing SEQ ID NO36 and a light chain (LC) comprising 15 SEQ ID NO:37 and manufacturing processes for producing such anti-TNF antibodies. As used herein, an "anti-tumor necrosis factor alpha antibody.' “anti-TNF antibody." "anti-TNF antibody portion." or "anti-TNF antibody fragment" and / or "anti-TNF antibody variant" and the like include any protein or peptide containing molecule that comprises at least a portion of an immunoglobulin molecule, such as but not limited 20 to at least one complementarity determining region (CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a framework region, or any portion thereof, or at least one portion of an TNF receptor or binding protein, which can be incorporated into an antibody of the present invention. Such antibody optionally further affects a specific 25 ligand, such as but not limited to where such antibody modulates, decreases, increases, antagonizes, agonizes, mitigates, alleviates, blocks, inhibits, abrogates and / or interferes w ith at least one TNF activity or binding, or with TNF receptor activity or binding, in vitro, in situ and / or in vivo. As a non-limiting example, a suitable anti-TNF antibody, specified portion or variant of the present invention can bind at least one TNF. or 30 specified portions, variants or domains thereof A suitable anti-TNF antibody, specified portion, or variant can also optionally affect at least one of TNF activity or function, such as but not limited to. RNA. DNA or protein synthesis, TNF release. TNF receptor 2026253995   16 Oct 2026 signaling, membrane TNF cleavage. TNF activity, TNF production and / or synthesis. The term "antibody "is further intended to encompass antibodies, digestion fragments. specified portions and variants thereof, including antibody mimetics or comprismg portions of antibodies that mimic the structure and / or function of an antibody or specified 5 fragment or portion thereof, including single chain antibodies and fragments thereof. Functional fragments include antigen-binding fragments that bind to a mammalian TNF. For example, antibody fragments capable of binding to TNF or portions thereof. including, but not limited to Fab (eg.. by papain digestion). Fab' (eg.. by pepsin digestion and partial reduction) and F(ab'): (e g., by pepsin digestion), facb (eg.. by plasmin 10 digestion), pFc’ (e g., by pepsin or plasmin digestion), Fd (eg.. by pepsin digestion, partial reduction and reaggregation). Fv or scFv (e.g.. by molecular biology techniques) fragments, arc encompassed by the invention (sec. e g.. Colligan, Immunology, supra). Such fragments can be produced by enzymatic cleavage, synthetic or recombinant techniques, as known in the art and / or as described herein, antibodies can also be 15 produced in a variety' of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site. For example, a combination gene encoding a Ffab'h heavy chain portion can be designed to include DNA sequences encoding tire CHi domain and / or hinge region of the heavy chain. The various portions of antibodies can be joined together chemically by conventional 20 techniques or can be prepared as a contiguous protein using genetic engineering techniques. As used herein, the term "human antibody" refers to an antibody in which substantially every part of the protein (e.g.. CDR. framework. Ct. Ch domains (e g . Ch 1. Ch2. and CH3), hinge. ( Vl, Vh)) is substantially non-immunogenic in humans, with only 25 minor sequence changes or variations. Similarly, antibodies designated pnmatc (monkey, baboon, chimpanzee, etc ), rodent (mouse, rat. rabbit, guinea pig. hamster, and the like) and other mammals designate such species, sub-genus, genus, sub-family, family specific antibodies. Further, chimeric antibodies include any combination of the above. Such changes or variations optionally and preferably retain or reduce the immunogenicity in 30 humans or other species relative to non-modified antibodies Thus, a human antibody is distinct from a chimeric or humanized antibody. It is pointed out that a human antibody can be produced by a non-human animal or prokary otic or eukaryotic cell that is capable of expressing functionally rearranged human immunoglobulin (e.g.. heavy chain and / or 2026253995   16 Oct 2026 light chain) genes. Further. vv hen a human antibody is a single chain antibody, it can comprise a linker peptide that is not found in native human antibodies. For example, an Fv can compose a linker peptide, such as two to about eight glycine or other amino acid residues, which connects the variable region of the heavy chain and the variable region of 5 the light chain. Such linker peptides are considered to be of human origin. Bispecific, e.g.. DuoBody « (bispccific antibody), heterospecific, heteroconjugate or similar antibodies can also be used that are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for at least one TNF protein, the other 10 one is for any other antigen. Methods for making bispccific antibodies arc known in the art Traditional!} , the recombinant production of bispecific antibodies is based on the co-exprcssion of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (Milstein and Cuello. Nature 305:537 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas 15 (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule, which is usually done by affinity chromatography steps, can be cumbersome with low product y iclds and different strategics have been developed to facilitate bispccific antibody production 20          Full length bispecific antibodies can be generated for example using Fab arm exchange (or half molecule exchange) between two monospecific bivalent antibodies by' introducing substitutions at the heavy chain CH3 interface in each half molecule to favor heterodimer formation of two antibody half molecules having distinct specificity cither in vitro in cell-free environment or using co-expression. The Fab arm exchange reaction is 25 the result of a disulfide-bond isomerization reaction and dissociation-association of CH3 domains. The heavy-chain disulfide bonds in the hinge regions of the parent monospecific antibodies arc reduced. The resulting free cysteines of one of the parent monospecific antibodies form an inter heavy -chain disulfide bond with cysteine residues of a second parent monospecific antibody molecule and simultaneously CH3 domains of the parent 30 antibodies release and reform by dissociation-association The CH3 domains of the Fab arms may' be engineered to favor hctcrodimerization over homodimcrization. The resulting product is a bispccific antibody having two Fab arms or half molecules which each can bind a distinct epitope. 2026253995   16 Oct 2026 Homodimerization” as used herein refers to an interaction of two heavy chains having identical CH3 amino acid sequences. ’Homodimer” as used herein refers to an antibody having two heavy chains with identical CH3 amino acid sequences. "Heterodimerization” as used herein refers to an interaction of two heavy chains 5 having non-identical CH3 amino acid sequences. “Hcterodimcr" as used herein refers to an antibody having two heavy chains with non-identical CH3 amino acid sequences. The "knob-in-hole” strategy (see. e.g.. PCT Inti. Publ. No. WO 2006 / 028936) can be used to generate frill length bispecific antibodies. Briefly, selected amino acids forming the interface of the CH3 domains in human IgG can be mutated at positions 10 affecting CH3 domain interactions to promote heterodimer formation. An amino acid with a small side chain (hole) is introduced into a heavy chain of an antibody specifically binding a first antigen and an amino acid with a large side chain (knob) is introduced into a heavy chain of an antibody specifically binding a second antigen. After co-expression of the two antibodies, a hcterodimcr is formed as a result of the preferential interaction of 15 the heavy chain with a "hole” with the heavy chain with a “knob”. Exemplar) CH3 substitution pairs forming a knob and a hole arc (expressed as modified position in the first CH3 domain of the first heavy chain / modified position in the second CH3 domain of the second heavy chain): T366Y / F405A, T366W / F405W. F405W / Y407A. T394W / Y407T. T394S / Y407A. T366W / T394S. F405W / T394S and 20  T366W / T366SL368A Y407V. Other strategies such as promoting heavy chain heterodimerization using electrostatic interactions by substituting positively charged residues at one CH3 surface and negatively charged residues at a second CH3 surface may be used, as described in US Pat Publ. No. US2O1O / OO15133; US Pat. Publ. No. US2009 / 0182127; US Pat. Publ. No. 25 US2010 / 028637 or US Pat. Publ. No. US2011 / 0123532. In other strategies, hctcrodimcrization may be promoted by follow ing substitutions (expressed as modified position in the first CH3 domain of the first heavy chain / modified position in the second CH3 domain of the second heavy chain): L35 IY_F405A_Y407V / T394W. T366I_K392M_T394W / F405A_Y407V. T366L K392M T394W / F405A Y407V. 30   L351YY407A / T366AK409F. L351YY407A / T366V _K409F. Y407A / T366A _K409F. or T350V_L351Y_F405A_Y407V / T350V_T366L_K392L_T394W as described in U.S. Pat. Publ. No. US2012 / 0I49876 or U.S. Pat. Publ. No. US2013 / 0195849. 2026253995   16 Oct 2026 In addition to methods described above, bispccific antibodies can be generated in vitro in a cell-free environment by introducing asymmetrical mutations in the CH3 regions of two monospecific homodimeric antibodies and forming the bispecific heterodimeric antibody from two parent monospecific homodimeric antibodies in 5 reducing conditions to allow disulfide bond isomerization according to methods described in Inti. Pat. Publ. No. WO2011 / 131746. In the methods, the first monospecific bivalent antibody and the second monospecific bivalent antibody arc engineered to have certain substitutions at the CH3 domain that promoter heterodimer stability; the antibodies arc incubated together under reducing conditions sufficient to allow the cysteines in the hinge 10 region to undergo disulfide bond isomerization; thereby generating the bispecific antibody by Fab ann exchange. The incubation conditions may optimally be restored to non-reducing. Exemplary reducing agents that may be used are 2-mercaptoethylamine (2-MEA). dithiothrcitol (DTT). dithiocry thntol (DTE), glutathione. tns(2-carboxyethyDphosphinc (TCEP). L-cy stcine and beta-mcrcaptocthanol. preferably a 15 reducing agent selected from the group consisting of: 2-mercaptoethylamine. dithiothrcitol and tris(2-carbo.xy ethy l)phosphine. For example, incubation for at least 90 min at a temperature of at least 20° C. in the presence of at least 25 mM 2-MEA or in the presence of at least 0.5 mM dithiothrcitol at a pH of from 5-8. for example at pH of 7.0 or at pH of 7.4 may be used. 20          Anti-TNF antibodies (also termed TNF antibodies) useful in the methods and compositions of the present invention can optionally be characterized by high affinity binding to TNF and optionally and preferably having low toxicity . In particular, an antibody, specified fragment or variant of the invention, where the individual components, such as the variable region, constant region and framework, individually 25 and / or collectively, optionally and preferably possess low immunogenicity. is useful in the present invention. The antibodies that can be used in the invention arc optionally characterized by their ability to treat patients for extended periods with measurable alleviation of sy mptoms and low and / or acceptable toxicity . Low or acceptable immunogenicity and / or high affinity. as well as other suitable properties, can contribute to 30 die therapeutic results achieved. "Low immunogenicity" is defined herein as raising significant HAHA, HACA or HAMA responses in less than about 75%. or preferably less than about 50% of the patients treated and / or raising low titres in the patient treated (less than about 300, preferably less than about 100 measured with a double antigen enzy me 2026253995   16 Oct 2026 immunoassay) (Elliott el al.. Lancet 344:1125-1127 (1994). entirely incorporated herein by reference). Utility: The isolated nucleic acids of the present invention can be used for production of at least one anti-TNF antibody or specified variant thereof, which can be 5 used to measure or effect in an cell, tissue, organ or animal (including mammals and humans), to diagnose, monitor, modulate, treat, alleviate, help prevent the incidence of. or reduce the symptoms of. at least one TNF condition, selected from, but not limited to. at least one of an immune disorder or disease, a cardiovascular disorder or disease, an infectious, malignant, and / or neurologic disorder or disease. 10          Such a method can comprise administering an effective amount of a composition or a pharmaceutical composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient in need of such modulation, treatment, alleviation, prevention, or reduction in symptoms, effects or mechanisms. The effective amount can comprise an amount of about 0.001 to 500 mg / kg per single (e.g.. bolus), multiple or 15 continuous administration, or to achieve a serum concentration of 0.01-5000 pg / ml serum concentration per single, multiple, or continuous administration, or any effective range or value therein, as done and determined using known methods, as described herein or known in the relevant arts. Citations. All publications or patents cited herein are entirely incorporated herein by reference as they show the state of the art at the time of the present 20 invention and / or to provide description and enablement of the present invention. Publications refer to any scientific or patent publications, or any other information available in any media format, including all recorded, electronic or printed formats. The follow ing references are entirely incorporated herein by reference: Ausubel, et al., ed.. Current Protocols in Molecular Biology. John Wiley & Sons. Inc.. NY. NY (1987-2001); 25 Sambrook, ct al.. Molecular Cloning. A Laboratory Manual. 2nd Edition. Cold Spring Harbor, NY (1989); Harlow and Lane, antibodies, a Laboratory Manual. Cold Spring Harbor. NY (1989); Colligan. et al., cds.. Current Protocols in Immunology. John Wiley & Sons. Inc.. NY (1994-2001); Colligan ct al.. Current Protocols in Protein Science. John Wiley & Sons. NY. NY. (1997-2001). 30          Antibodies of the Present Invention: At least one anti-TNF antibody of the present invention comprising all of the heavy chain variable CDR regions of SEQ 1D NOS: I. 2 and 3 and / or all of the light chain variable CDR regions of SEQ ID NOS;4. 5 and 6 can be optionally produced by a cel) line, a mixed cell line, an immortalized cell or 2026253995   16 Oct 2026 clonal population of immortalized cells, as well known in the art. See. e g.. Ausubel, ct al. cd.. Current Protocols in Molecular Biology. John Wiley & Sons. Inc.. NY. NY (1987-2001); Sambrook. ct al.. Molecular Cloning: A Laboratory Manual. 2^ Edition. Cold Spring Harbor. NY (1989): Harlow and Lane, antibodies, a Laboratory Manual. 5 Cold Spring Harbor. NY (1989); Colligan. ct al., eds.. Current Protocols in Immunology, John Wiley & Sons. Inc.. NY (1994-2001). Colligan et al.. Current Protocols in Protein Science. John Wiley & Sons. NY, NY. (1997-2001), each entirely incorporated herein by reference. Human antibodies that arc specific for human TN F proteins or fragments thereof 10 can be raised against an appropriate immunogenic antigen, such as isolated and / or TNF protein or a portion thereof (including synthetic molecules, such as synthetic peptides) Other specific or general mammalian antibodies can be similarly raised Preparation of immunogenic antigens, and monoclonal antibody production can be performed using any suitable technique. 15           In one approach, a hybridoma is produced by fusing a suitable immortal cell line (eg.. a myeloma cell line such as. but not limited to. Sp2 / 0. Sp2 / 0-AG 14. NSO. NS 1. NS2. AE-1. L.5. >243. P3X63Ag8.653. Sp2 SA3. Sp2 MAI. Sp2 SSL Sp2 SA5. U937, MLA 144, ACT IV. MOLT4. DA-I. JURKAT. WEH1. K-562, COS. RAJI. N1H 3T3. HL-60, MLA 144. NAMAIWA. NEURO 2A. or the like, or hctcromylomas. fusion 20 products thereof, or any cell or fusion cell derived therefrom, or any other suitable cell line as known in the art. See, e g., www. atcc.org. www.lifctcch.com.. and the like, with antibody producing cells, such as. but not limited to. isolated or cloned spleen, peripheral blood, lymph, tonsil, or other immune or B cell containing cells, or any other cells expressing heavy or light chain constant or variable or framework or CDR sequences. 25 either as endogenous or heterologous nucleic acid, as recombinant or endogenous, viral, bacterial, algal, prokaryotic, amphibian, insect, reptilian, fish, mammalian, rodent, equine, ovine, goat, sheep, primate, eukaryotic, genomic DNA. cDNA. rDNA. mitochondrial DNA or RNA. chloroplast DNA or RNA. hnRNA. mRNA. tRNA. single, double or triple stranded, hybridized, and the like or any combination thereof. Sec. c.g.. Ausubel, supra. 30 and Colligan. Immunology, supra, chapter 2. entirely incorporated herein by reference. Antibody producing cells can also be obtained from the peripheral blood or. preferably the spleen or lymph nodes, of humans or other suitable animals that have been immunized with the antigen of interest Any other suitable host cell can also be used for 2026253995   16 Oct 2026 expressing heterologous or endogenous nucleic acid encoding an antibody, specified fragment or variant thereof of the present invention. The fused cells (hybridomas) or recombinant cells can be isolated using selective culture conditions or other suitable known methods, and cloned by limiting dilution or cell sorting, or other known methods. 5 Cells which produce antibodies with the desired specificity can be selected by a suitable assay (e.g.. ELISA) Other suitable methods of producing or isolating antibodies of the requisite specificity can be used, including, but not limited to, methods that select recombinant antibod}' from a peptide or protein library (e.g.. but not limited to. a bacteriophage, 10 ribosome, oligonucleotide. RNA. cDNA. or the like, display library, e g., as available from Cambridge antibody Technologies. Cambridgeshire, UK; MorphoSys, Martinsrcid / Plancgg. DE; Biovation. Aberdeen. Scotland. UK; BioInvent. Lund. Sweden; Dyax Corp.. Enzon. Affvmax / Biositc; Xoma. Berkeley. CA; Lxsys. Sec. e g . EP 368.684, PCT / GB91 / 01134; PCT / GB92 / 01755; PCT / GB92 / 002240: PCT / GB92 / OO883; 15   PCT / GB93 / 00605; US 08 / 350260(5 / 12 / 94); PCT / GB94 / 01422; PCT / GB94 / 02662; PCT / GB97 / 01835; (CAT / MRC); WO90 / I4443; WO90 / I4424; WO90 / I4430; PCT / US94 / 1234; WO92 / 18619; WO96 / 07754; (Scripps); EP 614 989 (MorphoSys); WO95 / 16027 (BioInvent); WO88 / 06630; WO90 / 3809 (Dyax), US 4.704.692 (Enzon); PCT / US9I / 02989 (Aflymax): WO89 / 06283; EP 371 998; EP 550 400; (Xoma); EP 229 20   046; PCT / US9I / 07149 (lxsys): or stochastically generated peptides or proteins - US 5723323. 5763192. 5814476. 5817483. 5824514. 5976862. WO 86 / 05803. EP 590 689 (lxsys. now Applied Molecular Evolution (AME). each entirely incorporated herein by reference) or that rely upon immunization of transgenic animals (e g .. SC1D mice. Nguyen ct al., Microbiol Immunol. 41:901-907 (1997); Sandhu et al, Crit. Rev 25 BiotcchnoL 16:95-118 (1996); Eren ct al.. Immunol. 93:154-161 (1998). each entirely incorporated by reference as well as related patents and applications) that arc capable of producing a repertoire of human antibodies, as known in the art and / or as described herein. Such techniques include, but arc not limited to, ribosome display (Hanes et aL. Proc Natl Acad. Sei. USA. 94 4937-4942 (May 1997): Hanes ct al., Proc Natl Acad. 30 Sci. USA. 95:14130-14135 (Nov. 1998)); single cell antibody producing technologies (e g., selected lymphocyte antibody method ("SLAM”) (US pat. No. 5,627,052, Wen et al.. J. Immunol. 17:887-892 (1987): Babcook ct al.. Proc Natl. Acad. Sci. USA 93:78437848 (1996)); gel microdroplet and flow cytometry (Powell ct al.. BiotcchnoL 8:333-337 2026253995   16 Oct 2026 (1990); One Cell Systems. Cambridge. MA; Gray et al.. J 1mm. Meth 182:155-163 (1995); Kenny ct al.. Bio / Tcchnoi. 13:7X7-790 (1995)); B-ccll selection (Steenbakkers et al.. Molcc Biol. Reports 19:125-134 (1994); Jonak et al. Progress Biotech. Vol. 5. In Vitro Immunization in Hybridoma Technology, Borrcbaeck, ed.. Elsevier Science 5 Publishers B V.. Amsterdam. Netherlands (1988)). Methods for engineering or humanizing non-human or human antibodies can also be used and are well known in the art. Generally, a humanized or engineered antibody has one or more amino acid residues from a source which is non-human. e.g„ but not limited to mouse, rat. rabbit, non-human primate or other mammal. These human amino acid 10 residues arc often referred to as "import" residues, which are ty pically taken from an "import" variable, constant or other domain of a known human sequence. Know n human 1g sequences are disclosed in numerous publications and websites, for example: wwv ncbi.nlm.nih.gov / entrcz / qucry.fcgi 15          www atcc.org / phage / hdb.html; www sciqucst.com / : w w w .abcam.com / ; www antibodyresourcc.com / onlinccomp.html; www public.iastate.edu / ~pcdro / research_tools.html; 20          www mgen.uni-heidclbcrg.dc / SD / IT / IT.html; w ww .whfreeman.com / immunology / CH05 / kuby05.htm; www library thjnkquest.org / 12429 / Immune / Antibody.html; www hhmi.org / grants / lecturcs / 1996 / vlab / ; www path, cam.ac.uk / ~mrc7 / mikeimages.html; 25         www. antibodiTcsourcc.com / ; w w w mcb.han ard.edu / BioLinks / Inimunology htmL www immunologylink.com / ; www pathbox.wustl.edu / ~hcentcr / indcx.html; www.biotcch.ufl.cdu / ~hcl / ; 30          www.pebio.com / pa / 340913 / 340913.html; w w w nal.usda gov / aw ic / pubs / antibody / ; w ww .rn.ehimc-u.ac.jp / ~yasuhito / Elisa.html; www biodesign com / table asp; www icnct.uk / axp / facs / daiics / lmks.htiTil; 2026253995   16 Oct 2026 www biotcch.ufl.edu / ~fccl / protocol.html: www. isac-net.org / sitcs^eo.htmk www aximt 1 .imt.uni-marburg.de / ~rck / AEPStart.html; www bascrv.uci.kun.nl / ~jraats / linksl .html: 5          www.rccab.uni-hd.de / iiTnnuno.bnie.nwu.cdu / ; www mrc-cpe.cam.ac.uk / imt-doc / public / INTRO.html; w ww . ibt.unam.mx / vir / V mice.html; imgt.cnusc.fr:8104 / . w w w biochem.ucl.ac.uk / ~martin / abs / index.html; antibody.bath.ac.uk / www abgen.cvm.tamu.edu / lab / 10         www. abgen html; www unizh.ch / ~honcggcr / AHOscminar / SlidcOI html; w w w cryst.bbk.ac.uk / ~ubcgO7s / ; www. nimr.mrc.ac.uk / CC / ccaewg / ccaewg.htm; www path cam.ac.uk / ~nirc7 / humanisation / TAHHP.html; 15          www ibt.unam.mx / vir / stnicture / stat_aim.html; www biosci.missouri.edu / smithgp / indcx.html; www cryst.bioc.cam.ac.uk / ~frnolina / Wcb-pagcs / Pept / spottcch.htmk www jerini .de / frproducts.htmk www. patents ibm.com / ibni.html.Kabat ct al., 20          Sequences of Proteins of Immunological Interest. U.S. Dept. Health (1983). each entirely incorporated herein by reference. Such imported sequences can be used to reduce immunogenicity or reduce, enhance or modify binding, affinity, on-rate, off-rate, avidity. specificity , half-life, or any other suitable characteristic, as know n in the art. Generally, part or all of the non-human 25 or human CDR sequences arc maintained while the non-human sequences of the variable and constant regions are replaced with human or other amino acids, antibodies can also optionally be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, humanized antibodies can be optionally prepared by a process of analy sis of the parental sequences and various 30 conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs arc available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits 2026253995   16 Oct 2026 analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way. FR residues can be selected and combined from the consensus and import sequences so that the desired antibody 5 characteristic, such as increased affinity for the target antigen(s). is achieved. In general, the CDR residues arc directly and most substantially involved in influencing antigen binding. Humanization or engineering of antibodies of the present invention can be performed using any known method, such as but not limited to those described in. Winter (Jones ct al.. Nature 321:522 (1986). Ricchmann et al.. Nature 332:323 (1988); 10 Verhoeyen et al . Science 239:1534 (1988)), Sims et al . J Immunol 151: 2296(1993): Chothia and Lcsk. J Mol. Biol. 196:901 (1987). Carteret al.. Proc. Natl. Acad. Sci U S A. 89:4285 (1992): Prcsta et al . J Immunol. 151:2623 (1993), US patent Nos: 5723323, 5976862. 5824514, 5817483, 5814476. 5763192. 5723323. 5,766886, 5714352. 6204023. 6180370, 5693762. 5530101. 5585089. 5225539; 4816567. PCT / : US98 / 16280. 15   US96 / 18978. US91 / 09630. US91 / 05939. US94 / 01234. GB89 / 01334. GB91 / 01134. GB92 / 01755; WO90 / 14443, WO90 / I4424. WO90 / 14430. EP 229246. each entirely incorporated herein by reference, included references cited therein. The anti-TNF antibody can also be optionally generated by immunization of a transgenic animal (eg.. mouse, rat. hamster, non-human primate, and the like) capable of 20 producing a repertoire of human antibodies, as described herein and / or as known m the art. Cells that produce a human anti-TNF antibody can be isolated from such animals and immortalized using suitable methods, such as the methods described herein. Transgenic mice that can produce a repertoire of human antibodies that bind to human antigens can be produced by known methods (e.g., but not limited to. U.S. Pat. 25 Nos: 5.770.428, 5.569.825, 5.545,806. 5,625.126. 5.625.825, 5.633,425. 5.661.016 and 5.789.650 issued to Lonbcrg ct al.; Jakobovits et al. WO 98 / 50433. Jakobovits et al. WO 98 / 24893. Lonbcrg el al. WO 98 / 24884. Lonbcrg el al. WO 97 / 13852. Lonbcrg el al. WO 94 / 25585. Kuchcrlapatc et al. WO 96 / 34096. Kuchcrlapatc el al. EP 0463 151 BL Kuchcrlapatc el al. EP 0710 719 Al, Surani et al. US. Pat. No. 5.545.807. Bruggemann et 30 al. WO 90 / 04036. Bruggemann el al. EP 0438 474 B I. Lonberg el al. EP 0814 259 A2. Lonbcrg el al. GB 2 272 440 A. Lonberg el al. Nature 368:856-859 (1994). Taylor et al.. Ini. Immunol. 6(4)579-591 (1994). Green et al. Nature Genetics 7:13-21 (1994). Mendez etal.. Nature Genetics 15:146-156(1997). Taylor el al. Nucleic Acids Research 2026253995   16 Oct 2026 20(23):6287-6295 (1992). Tuaillon el al.. Proc Natl Acad Sci USA 90(8)3720-3724 (1993). Lonberg el al.. Im Rev Immunol 13(1):65-93 (1995) and Fishuald et al.. Nai Riotechno! 14(7):845-851 (1996). which are each entirely incorporated herein by reference). Generally, these mice comprise at least one transgenc comprising DNA from 5 at least one human immunoglobulin locus that is functionally rearranged, or which can undergo functional rearrangement. The endogenous immunoglobulin loci in such mice can be disniptcd or deleted to eliminate the capacity of the animal to produce antibodies encoded by endogenous genes. Screening antibodies for specific binding to similar proteins or fragments can be 10 com enicntly achieved using peptide display libraries. This method invokes the screening of large collections of peptides for individual members having the desired function or structure, antibody screening of peptide display libraries is well known in the art The displayed peptide sequences can be from 3 to 5000 or more amino acids in length, frequently from 5100 amino acids long, and often from about 8 to 25 amino acids long. In addition to direct 15 chemical synthetic methods for generating peptide libraries, several recombinant DNA methods have been described. One ty pe involves the display of a peptide sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell contains the nucleotide sequence encoding the particular display ed peptide sequence. Such methods arc described in PCT Patent Publication Nos. 91 / 17271,91 / 18980.91 / 19818. and 93 / 08278 Other systems 20    for generating libraries of peptides have aspects of both in vitro chemical sy nthesis and recombinant methods. Sec. PCT Patent Publication Nos. 92 / 05258. 92 / 14843. and 96 / 19256. Sec also. U.S. Patent Nos. 5.658.754: and 5.643.768 Peptide display libraries, vector, and screening kits are commercially available from such suppliers as Invitrogen (Carlsbad. CA). and Cambridge antibody Technologies (Cambridgeshire, UK.) See, e g., U.S Pat. Nos. 25   4704692.4939666. 4946778. 5260203.5455030. 5518889. 5534621. 5656730. 5763733. 5767260.5856456, assigned to Enzon: 5223409. 5403484. 5571698. 5837500. assigned to Dy ax. 5427908. 5580717. assigned to Affy max: 5885793. assigned to Cambridge antibody Technologies: 5750373. assigned to Gcncntcch, 5618920,5595898.5576195. 5698435. 5693493.5698417. assigned to Xoma Colligan, supra; Ausubel. supra: or Sambrook. supra. 30   each of the above patents and publications entirely incorporated herein by reference. Antibodies of the present invention can also be prepared using at least one anti-TNF antibody encoding nucleic acid to provide transgenic animals or mammals, such as goats, cows, horses, sheep, and the like, that produce such antibodies in their milk. Such 2026253995   16 Oct 2026 animals can be provided using known methods Sec, e g., but not limited to. US patent nos. 5.827.690; 5.849.992; 4.873.316; 5.849.992; 5.994.616; 5.565.362; 5.304.489. and the like, each of which is entirely incorporated herein by reference. Antibodies of the present invention can additionally be prepared using at least one 5 anti-TNF antibody encoding nucleic acid to provide transgenic plants and cultured plant cells (eg.. but not limited to tobacco and maize) that produce such antibodies, specified portions or variants in the plant parts or in cells cultured therefrom. As a non-limiting example, transgenic tobacco leaves expressing recombinant proteins have been successfully used to provide large amounts of recombinant proteins, e g., using an 10 inducible promoter. See. e.g.. Cramer et al.. Curr. Top. Microbol. Immunol. 240:95-118 (1999) and references cited therein. Also, transgenic maize have been used to express mammalian proteins at commercial production levels, with biological activities equivalent to those produced in other recombinant systems or purified from natural sources. See. e.g.. Hood ct al.. Adv. Exp. Med Biol. 464:127-147 (1999) and references cited therein 15 antibodies have also been produced in large amounts from transgenic plant seeds including antibody fragments, such as single chain antibodies (scFv's). including tobacco seeds and potato tubers. Sec. e.g., Conrad ct al.. Plant Mol. Biol. 38:101-109 (1998) and reference cited therein. Thus, antibodies of the present invention can also be produced using transgenic plants, according to know methods. Sec also, e.g., Fischer ct al.. 20 Biotcchnol. Appl. Biochem 30:99-108 (Oct.. 1999). Ma ct al.. Trends Biotcchnol. 13:522-7 (1995); Ma ct al., Plant Physiol. 109:341-6 (1995); Whitclam ct al.. Biochcm Soc. Trans. 22:940-944 (1994); and references cited therein. See. also generally for plant expression of antibodies, but not limited to. Each of the above references is entirely incorporated herein by reference. 25          The antibodies of the invention can bind human TNF with a wide range of affinities (Kd). In a preferred embodiment, at least one human mAb of the present invention can optionally bind human TNF with high affinity. For example, a human mAb can bind human TNF with a Ku equal to or less than about 10'7 M, such as but not limited to. 0.1-9.9 (or any range or value therein) X 10'. 10'*. 10’9.10’10, 10’11. I0'12. 10‘l3orany 30 range or value therein. The affinity or avidity of an antibod) for an antigen can be determined experimentally using any suitable method. (Sec. for example. Bcrzofsky. el al., "Antibody-Antigen Interactions," In Fundamental Immunology. Paul. W. E.. Ed . Raven 2026253995   16 Oct 2026 Press: New York. NY (1984); Kuby. Janis Immunology. W H. Freeman and Company: New York. NY (1992); and methods described herein). The measured affinity of a particular antibod)-antigen interaction can vary if measured under different conditions (eg., salt concentration. pH). Tinis, measurements of affinity and other antigen-binding parameters (e.g., Ko. Ka, Ka) arc preferably made with standardized solutions of antibody and antigen, and a standardized buffer, such as the buffer described herein. Nucleic Acid Molecules. Using the information provided herein, such as the nucleotide sequences encoding at least 70-100% of the contiguous amino acids of at least one of SEQ ID NOS: 1. 2. 3. 4. 5. 6. 7. 8. specified fragments, variants or consensus sequences thereof, or a deposited vector comprising at least one of these sequences, a nucleic acid molecule of the present invention encoding at least one anti-TNF antibod) comprising all of the heavy chain variable CDR regions of SEQ ID NOS: 1. 2 and 3 and / or all of the light chain vanable CDR regions of SEQ ID NOS4. 5 and 6 can be obtained using methods described herein or as known in the art. Nucleic acid molecules of the present invention can be in the fomi of RNA, such as mRNA. hnRNA. tRNA or any other form, or in the fonn of DNA. including, but not limited to. cDNA and genomic DNA obtained by cloning or produced synthetical!) , or any combinations thereof. The DNA can be triplc-stranded, double-stranded or singlestranded, or any combination thereof. Any portion of at least one strand of the DNA or RNA can be the coding strand, also known as the sense strand, or it can be the non-coding strand, also referred to as the anti-sense strand. Isolated nucleic acid molecules of the present invention can include nucleic acid molecules comprising an open reading frame (ORF), optionally w ith one or more introns, eg., but not limited to. at least one specified portion of at least one CDR. as CDR I. CDR2 and / or CDR3 of at least one heavy chain (e.g.. SEQ ID NOS: 1-3) or light chain (e.g.. SEQ ID NOS: 4-6); nucleic acid molecules comprising the coding sequence for an anti-TNF antibod) or variable region (e.g.. SEQ ID NOS:7.8); and nucleic acid molecules which comprise a nucleotide sequence substantial!) different from those described above but w hich, due to the degeneracy of the genetic code, still encode at least one anti-TNF antibod)’ as described herein and / or as know n in the art. Of course, the genetic code is well known in the art Thus, it would be routine for one skilled in the art to generate such degenerate nucleic acid variants that code for specific anti-TNF antibodies of the present invention Sec, e.g., AusubeL ct al., supra, and such nucleic acid variants arc included in 2026253995   16 Oct 2026 the present invention. Non-limiting examples of isolated nucleic acid molecules of the present invention include SEQ ID NOS: 10, 11. 12. 13. 14. 15, corresponding to nonlimiting examples of a nucleic acid encoding, respectively. HC CDR1. HC CDR2. HC CDR3. LC CDRL LC CDR2. LC CDR3. HC variable region and LC variable region 5           As indicated herein, nucleic acid molecules of the present invention which comprise a nucleic acid encoding an anti-TNF antibody can include, but are not limited to. those encoding the amino acid sequence of an antibody fragment, by itself: the coding sequence for the entire antibody or a portion thereof: the coding sequence for an antibody, fragment or portion, as well as additional sequences, such as the coding sequence of at 10 least one signal leader or fusion peptide, with or without the aforementioned additional coding sequences, such as at least one intron, together with additional, non-coding sequences, including but not limited to. non-coding 5' and 3* sequences, such as the transcribed, non-translated sequences that play a role in transcription. mRNA processing, including splicing and polyadenylation signals (for example - ribosome binding and 15   stabiIity of inRN A), an additional coding sequence that codes for additional amino acids, such as those that provide additional functionalities. Thus, the sequence encoding an antibody can be fused to a marker sequence, such as a sequence encoding a peptide that facilitates purification of the fused antibody comprising an antibody fragment or portion. Polynucleotides Which Selectively Hybridize to a Polynucleotide as Described 20 Herein. The present invention provides isolated nucleic acids that hybridize under selective hybridization conditions to a polynucleotide disclosed herein. Thus, the polynucleotides of this embodiment can be used for isolating, detecting, and / or quantifying nucleic acids comprising such polynucleotides. For example, polynucleotides of the present invention can be used to identify. isolate, or amplify partial or full-length clones in a deposited library. In 25 some embodiments, the polynucleotides are genomic or cDNA sequences isolated, or otherwise complementary to, a cDNA from a human or mammalian nucleic acid library. Preferably. the cDNA library' composes at least 80% full-length sequences, preferably at least 85% or 90% full-length sequences, and more preferably at least 95% fulllength sequences. The cDNA iibranes can be nonnalized to increase the representation of 30 rare sequences. Low or moderate stringency hy bridization conditions are ty pically , but not exclusively, employ ed with sequences having a reduced sequence identity relative to complementary sequences. Moderate and high stringency conditions can optionally be employed for sequences of greater identity Low stringency conditions allow selective 2026253995   16 Oct 2026 hybridization of sequences having about 70% sequence identity and can be employed to identify orthologous or paralogous sequences. Optionally, polynucleotides of this invention will encode at least a portion of an antibody encoded by the polynucleotides described herein. The polynucleotides of this invention embrace nucleic acid sequences that can be employed for selective hybridization to a polynucleotide encoding an antibody of the present invention. See. e.g.. Ausubel. supra: Colligan. supra, each entirely incorporated herein by reference. Construction of Nucleic Acids. The isolated nucleic acids of the present invention can be made using (a) recombinant methods, (b) synthetic techniques, (c) purification techniques, or combinations thereof, as well-known in the art The nucleic acids can conveniently comprise sequences in addition to a polynucleotide of the present invention. For example, a multi-cloning site comprising one or more endonuclease restriction sites can be inserted into the nucleic acid to aid in isolation of the polynucleotide. Also, translatable sequences can be inserted to aid in the isolation of the translated polynucleotide of the present invention. For example, a hexa-histidine marker sequence provides a convenient means to purify the proteins of the present invention The nucleic acid of the present invention - excluding the coding sequence - is optionally a vector, adapter, or linker for cloning and / or expression of a polynucleotide of the present invention. Additional sequences can be added to such cloning and / or expression sequences to optimize their function in cloning and / or expression, to aid in isolation of the polynucleotide, or to improve the introduction of the polynucleotide into a cell. Use of cloning vectors, expression vectors, adapters, and linkers is well known in the art (See. e g . Ausubel. supra. or Sambrook. supra). Recombinant Methods for Constructing Nucleic Acids. The isolated nucleic acid compositions of this invention, such as RNA. cDNA, genomic DNA, or any combination thereof, can be obtained from biological sources using any number of cloning methodologies known to those of skill in the art. In some embodiments, oligonucleotide probes that selectively hybridize, under stringent conditions, to the polynucleotides of the present invention are used to identify the desired sequence in a cDNA or genomic DNA library. The isolation of RNA. and construction of cDNA and genomic libraries, is well known to those of ordinary skill in the art. (See. e.g. Ausubel. supra; or Sambrook. supra) 2026253995   16 Oct 2026 Nucleic Acid Screening and Isolation Methods. A cDNA or genomic library can be screened using a probe based upon the sequence of a polynucleotide of the present invention, such as those disclosed herein. Probes can be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different oiganisms. 5 Those of skill in the art will appreciate that various degrees of stringency of hybridization can be employed in the assay, and either the hybridization or the wash medium can be stringent. As the conditions for hybridization become more stringent, there must be a greater degree of complementarity between the probe and the target for duplex formation to occur. The degree of stringency can be controlled by one or more of temperature, ionic strength. pH 10 and the presence of a partially denaturing solvent such as formamide For example, the stringency of hybridization is conveniently varied by changing the polarity of the reactant solution through, for example, manipulation of the concentration of formamide w i th in the range of 0%to 50% Tire degree of complementarity (sequence identity) required for detectable binding will van in accordance with the stringency of the hybridization medium 15 and / or wash medium. The degree of complementarity will optimally be 100%. or 70-100%. or any range or value therein. However, it should be understood that minor sequence variations in the probes and primers can be compensated for by reducing the stringency of the hybridization and / or wash medium. Methods of amplification of RNA or DNA are well known in the art and can be 20 used according to the present invention without undue experimentation, based on the teaching and guidance presented herein. Known methods of DNA or RNA amplification include, but arc not limited to. polymerase chain reaction (PCR) and related amplification processes (see. e g.. U.S. Patent Nos. 4.683.195. 4.683.202. 4.800.159. 4.965.188. to Mullis, et al.; 4.795.699 and 25    4.921.794 to Tabor, et al; 5.142,033 to Innis; 5.122.464 to Wilson, ct al.; 5.091.310 to Innis; 5.066.584 to Gyllcnstcn. ct al; 4.889.818 to Gelfand, ct al; 4.994.370 to Silver, ct al; 4.766.067 to Biswas; 4.656.134 to Ringold) and RNA mediated amplification that uses anti-sense RNA to the target sequence as a template for double-stranded DNA synthesis (U.S Patent No. 5.130.238 to Malek, et al. with the trade name NASBA). the entire 30   contents of w hich references are incorporated herein by reference (See, eg.. Ausubel. supra. or Sambrook. supra.) For instance, polymerase chain reaction (PCR) technology can be used to amplify tltc sequences of polynucleotides of the present invention and related genes directly from 2026253995   16 Oct 2026 genomic DNA or eDNA libraries. PCR and other in vitro amplification methods can also be usefill, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes. Examples of techniques 5 sufficient to direct persons of skill through in vitro amplification methods are found in Berger, supra. Sambrook. supra, and Ausubel. supra, as well as Mullis, et al, U.S. Patent No 4.6X3.202 (1987); and Innis, ct al.. PCR Protocols A Guide to Methods and Applications. Eds.. Academic Press Inc.. San Diego. CA (1990). Commercially available kits for genomic PCR amplification arc known in the art. See. e g.. Advantagc-GC Genomic 10 PCR Kit (Clontech) Additionally, e g., the T4 gene 32 protein (Boehringer Mannheim) can be used to improve yield of long PCR products Synthetic Methods for Constructing Nucleic Acids. The isolated nucleic acids of die present invention can also be prepared by direct chemical synthesis by known methods (sec. e g.. Ausubel. ct al., supra). Chemical synthesis generally produces a single-stranded 15 oligonucleotide, which can be converted into double-stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template One of skill in the art will recognize that while chemical synthesis of DNA can be limited to sequences of about 100 or more bases, longer sequences can be obtained by the ligation of shorter sequences. 20           Recombinant Expression Cassettes. The present invention further provides recombinant expression cassettes composing a nucleic acid of the present invention. A nucleic acid sequence of the present invention, for example a cDN A or a genomic sequence encoding an antibody of the present invention, can be used to construct a recombinant expression cassette that can be introduced into at least one desired host cell. A recombinant 25 expression cassette will typical!) comprise a polynucleotide of the present invention operably linked to transcriptional initiation regulator)- sequences that will direct the transcription of the pol) nucleotide in the intended host cell. Both heterologous and non-hetcrologous (i .e.. endogenous) promoters can be employed to direct expression of the nucleic acids of the present invention. 30           In some embodiments, isolated nucleic acids that serve as promoter, enhancer, or other elements can be introduced in the appropriate position (upstream, downstream or in intron) of a non-hctcrologous form of a polynucleotide of the present invention so as to up or down regulate expression of a pohuuclcotidc of the present invention. For example. 2026253995   16 Oct 2026 endogenous promoters can be altered in vivo or in vitro by mutation, deletion and / or substitution. Vectors and Host Cells. The present invention also relates to vectors that include isolated nucleic acid molecules of the present invention, host cells that are genetically 5 engineered with the recombinant vectors, and the production of at least one anti-TNF antibody by recombinant techniques, as is well know n in the art. See. e g.. Sambrook, et al., supra; Ausubel. ct al., supra, each entirely incorporated herein by reference. The polynucleotides can optionally be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a 10 precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line and then transduced into host ceils. The DNA insert should be operatively linked to an appropriate promoter. The expression constructs will further contain sites for transcription initiation, termination 15 and. in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating site at the beginning and a termination codon (e.g., UAA. UGA or UAG) appropriately positioned at the end of the mRNA to be translated, with UAA and UAG preferred for mammalian or eukaryotic cell expression. 20           Expression vectors will preferably but optionally include at least one selectable marker. Such markers include, e g., but not limited to. methotrexate (MTX). dihydrofolate reductase (DHFR. US Pat Nos 4.399,216; 4,634.665; 4,656,134; 4,956.288; 5.149,636; 5.179.017. ampicillin, neomycin (G418). mycophenolic acid, or glutamine synthetase (GS. US Pat. Nos. 5.122.464; 5,770.359; 5.827.739) resistance for eukaryotic cell culture. 25 and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria or prokaryotics (the above patents arc entirely incorporated hereby by reference). Appropriate culture mediums and conditions fortlie above-described host cells are known in the art. Suitable vectors w ill be readily apparent to the skilled artisan. Introduction of a vector construct into a host cell can be affected by calcium phosphate transfection. 30 DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other known methods. Such methods are 2026253995   16 Oct 2026 described in the art. such as Sambrook. supra. Chapters 1-4 and 16-18; Ausubel. supra. Chapters 1.9. 13. 15, 16 At least one antibody of the present invention can be expressed in a modified form, such as a fusion protein, and can include not only secretion signals, but also 5 additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, can be added to the N-tenninus of an antibody to improve stability and persistence in die host cell. during purification, or during subsequent handling and storage Also, peptide moictics can be added to an antibody of the present invention to facilitate purification. Such regions can be removed prior to final 10 preparation of an antibody or at least one fragment thereof. Such methods are described in many standard laboratory manuals, such as Sambrook. supra. Chapters 17.29-17.42 and 18.1-18.74; Ausubel. supra. Chapters 16. 17 and 18. Those of ordinary skill in the art arc knowledgeable in the numerous expression systems available for expression of a nucleic acid encoding a protein of the present 15 invention. Alternatively, nucleic acids of the present invention can be expressed in a host cell by turning on (by manipulation) in a host cell that contains endogenous DN A encoding an antibody of the present invention. Such methods are well known in the art. c.g., as described in US patent Nos. 5.580.734.5.641.670. 5.733.746. and 5.733.761. entirely incorporated 20 herein by reference. Illustrative of cell cultures useful for the production of the antibodies, specified portions or variants thereof, arc mammalian cells. Mammalian cell systems often will be in the form of monolayers of cells although mammalian cell suspensions or biorcactors can also be used. A number of suitable host cell lines capable of expressing intact gly cosylated 25 proteins have been developed in the art. and include the COS-1 (e g.. ATCC CRL 1650). COS-7 (e g.. ATCC CRL-1651). HEK293. BHK2I (eg.. ATCC CRL-10). CHO (eg.. ATCC CRL 1610) and BSC-1 (e g.. ATCC CRL-26) cell lines. Cos-7 cells. CHO cells, hep G2 cells. P3X63Ag8.653, SP2 / 0-Agl4. 293 cells. HeLa cells and die like, which arc readily available from, for example. American Type Culture Collection. Manassas. VA 30 Preferred host cells include CHO cells and cells of lymphoid origin such as myeloma and lymphoma cells Particularly preferred host cells are CHO cells. P3X63Ag8 653 cells 2026253995   16 Oct 2026 (ATCC Accession Number CRL-1580). and SP2 / 0-Agl4 cells (ATCC Accession Number CRL-I85I) Expression vectors for these cells can include one or more of the following expression control sequences, such as. but not limited to an origin of replication; a promoter 5   (e.g.. late or early SV40 promoters, the CMV promoter (US Pai. Nos. 5.168.062; 5,385.839). an HSV tk promoter, a pgk (phosphoglyccrate kinase) promoter, an EF-1 alpha promoter (US Pat. No. 5.266.491). at least one human immunoglobulin promoter; an enhancer, and / or processing information sites, such as ribosome binding sites. RNA splice sites, polyadenylation sites (e.g.. an SV40 large T Ag poly A addition site), and transcriptional 10 terminator sequences. See, e.g.. Ausubel et al., supra; Sambrook. et al., supra. Other cells useful for production of nucleic acids or proteins of the present invention are known and / or available, for instance, from the American Type Culture Collection Catalogue of Cell Lincs and Hybridomas or other known or commercial sources. When eukary otic host cells are employ ed, poly adenlyation or transcription 15 terminator sequences arc ty pically incorporated into the vector. An example of a terminator sequence is the poly adenlyation sequence from the bovine growth hormone gene. Sequences for accurate splicing of the transcript can also be included. An example of a splicing sequence is the VP1 intron from SV40 (Sprague, et al.. J Virol. 45:773-781 (1983)). Additionally', gene sequences to control replication in the host cell can be incorporated into 20 the vector, as known in the art. Purification of an Antibody. An anti-TNF antibody can be recovered and purified from recombinant cell cultures by well-known methods including, but not limited to. protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography. phosphocellulose chromatography. 25 hy drophobic interaction chromatography, affinity chromatography, hydroxy lapatite chromatography and lectin chromatography'. High performance liquid chromatography ("HPLC") can also be employ ed for purification. See. e.g.. Colligan. Current Protocols in Immunology. or Current Protocols in Protein Science. John Wiley & Sons, NY. NY. (1997-2001), e.g.. Chapters I. 4. 6. 8. 9, 10. each entirely incorporated herein by 30 reference Antibodies of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from 2026253995   16 Oct 2026 a eukary otic host, including, for example, yeast, higher plant, insect and mammalian cells Depending upon the host employed in a recombinant production procedure, the antibody of the present invention can be gly cosy lated or can be non-glycosy lated. with glycosylated preferred. Such methods arc described in many standard laboratory manuals, such 5 as Sambrook, supra; Ausubcl, supra. Chapters 10. 12. 13, 16, 18 and 20. Colligan. Protein Science, supra. Chapters 12-14. all entirely incorporated herein by reference. Exemplary Anti-TNF Antibodies The isolated antibodies of the present invention, comprising all of the heavy chain variable CDR regions of SEQ ID NOS: 1, 2 and 3 and / or all of the light chain variable CDR regions 10 of SEQ ID NOS:4. 5 and 6. comprise antibody amino acid sequences disclosed herein encoded by any suitable poly nucleotide, or any isolated or prepared antibody. Preferably, the human antibody or antigen-binding fragment binds human TNF and. thereby partially or substantially neutralizes at least one biological activity of the protein. An antibody, or specified portion or variant thereof, that partially or preferably substantially neutralizes at 15 least one biological activity of at least one TNF protein or fragment can bind tire protein or fragment and thereby inhibit activities mediated through the binding of TNF to the TNF receptor or through other TN F-dcpcndcnt or mediated mechanisms. As used herein, the term "neutralizing antibody ’ refers to an antibody that can inhibit an TNF-dependent activity by about 20-120%, preferably by at least about 10,20, 30.40, 50. 55.60.65. 70. 75. 80. 85. 90. 20   91,92. 93. 94. 95. 96. 97. 98. 99. 100% or more depending on die assay The capacity of an anti-TNF antibody to inhibit an TNF-dcpendcnt activity' is preferably assessed by at least one suitable TNF protein or receptor assay, as described herein and / or as known in the art. A human antibody of die invention can be of any class (IgG. IgA, IgM. IgE. IgD. etc.) or isotype and can comprise a kappa or lambda light chain. In one embodiment, the human 25 antibody comprises an IgG heavy chain or defined fragment, for example, at least one of isotypes, IgG I. IgG2, lgG3 or IgG4 Antibodies of this type can be prepared by employing a transgenic mouse or other transgenic non-human mammal comprising at least one human light chain (e g.. IgG, IgA) and IgM (eg., yl, y2, y3, y4) transgenes as described herein and / or as known in die art In anodicr embodiment die anti-human TNF human antibody 30 comprises an IgG 1 heavy chain and a IgGl light chain. As used herein, the terms "antibody" or ■ antibodies", include biosimilar antibody molecules approved under the Biologies Price Competition and innovation Act of 2009 (BPCI Act) and similar laws and regulations globally. Under the BPCI Act. an antibody may be demonstrated to be 2026253995   16 Oct 2026 biosimilar if data show that it is “highly similar" to the reference product notwithstanding minor differences in clinically inactive components and are "expected" to produce the same clinical result as (lie reference product in terms of safety. purity and potency (Endocrine Practice: February 2018. Vol. 24. No 2, pp. 195-204). These biosimilar antibody molecules are provided an abbreviated approval 5 pathway, whereby the applicant relies upon the innovator reference product's clinical data to secure rcgulaton approval. Compared to the original innovator reference antibody that was FDA approved based on successful clinical trials, a biosimilar antibody molecule is referred to herein as a "follow -on biologic". As presented herein. SIMPONI R (golimumab) is the original innovator reference anti-TNF antibody that was FDA approved based on successful clinical trials. Golimumab has been on 10 sale in the United Stales since 2009. Example Sequences In various embodiments, the TNF inhibitor composes the anti-TNF antibody SIMPONI k (golimumab). or an antigen-binding fragment thereof comprising the sequences shown below For more infonnation about the anti-TNF antibody SIMPONI R 15 (golimumab) and other anti-TNF antibodies, sec e.g., U.S. Pat. Nos.: 7.250.165: 7.691.378; 7.521.206; 7.815.909; 7.820.169; 8.241.899; 8.603.778; 9.321.836; and 9.828.424. Example anti-TNF antibody sequences, e.g., SIMPONI® (golimumab) 20         Heavy chain CDRs (HCDRs) and light chain CDRs (LCDRs) arc defined by Kabat Amino acid sequence of golimumab heavy chain (HC) with CDRs underlined: 30 (SEQ ID NO 36 1 QVQLVESGGG WQPGRSLRL SCAASGFIFS SYAMHWVRQA PGMGLEWVAF MSYDGSNKKY 61 ADSVKGRFTI SRDNSKNTLY LQMNSLRAED TAVYYCARDR GIAAGGNYYY YGMDVWGQGT 121 TVTVSSASTK GPSVFPLAPS SKSTSGGTAA LGCLVKDYFP EPVTVSWNSG ALTSGVHTFP 181 AVLQSSGLYS LSSWTVPSS SLGTQTYICN VNHKPSNTKV DKKVEPKSCD KTHTCPPCPA 241 PELLGGPSVF LFPPKPKDTL MISRTPEVTC WVDVSHEDP EVKFNWYVDG VEVHNAKTKP 301 REEQYNSTYR WSVLTVLHQ DWLNGKEYKC KVSNKALPAP IEKTISKAKG QPREPQVYTL 361 PPSRDELTKN QVSLTCLVKG FYPSDIAVEW ESNGQPENNY KTTPPVLDSD GSFFLYSKLT 421 VDKSRWQQGN VFSCSVMHEA LHNHYTQKSL SLSPGK 456 Amino acid sequence of golimumab light chain (LC) with CDRs underlined. (SEQIDNO:37) 1 EIVLTQSPAT LSLSPGERAT LSCRASQSVY SYLAWYQQKP GQAPRLLIYD ASNRATGIPA 61 RFSGSGSGTD FTLTISSLEP EDFAVYYCQQ RS!4WPPFTFG PGTKVDIKRT VAAPSVFIFP 35   121 PSDEQLKSGT ASWCLLNNF YPREAKVQWK VDNALQSGNS QESVTEQDSK DSTYSL5STL 2026253995   16 Oct 2026 131 TLSKADYEKH KVYACEVTHQ GLSSPVTKSF NRGEC Amino acid sequence of golimumab variable heavy chain (VH) with CDRs underlined: (SEQ ID NO38) 1 QVQLVESGGG WQPGRSLRL SCAASGFIFS SYAMHWVRQA PGXGLEWVAF MSYDGSNKKY 5    61 AD5VKGRFTI SRDNSKNTLY LQMNSLPAED TAVYYCARDR GIAAGGNYYY YGMDVWGQGT 121 TVTVSS Amino acid sequence of golimumab variable light chain (VL) with CDRs underlined: (SEQ ID NO:39) 1 EIVLTQSPAT LSLSPGERAT LSCRASQSVY SYLAWYQQKP GQAPRLLIYD ASNRATGIPA 10    61 RFSGSGSGTD FTLTISSLEP EDFAVYYCQQ RS WPP FT FC- PGTKVDIKRT V Amino acid sequence of golimumab heavy chain complementant) determining region 1 (HCDR1): (SEQ ID NO:40) SYAMH Amino acid sequence of golimumab antibod) heavy chain complementarity 15 determining region 2 (HCDR2) (SEQ ID NO41) FMSYDGSNKKYADSVKG Amino acid sequence of golimumab heavy chain complementarity determining region 3 (HCDR3): (SEQ ID NO:42) DRGIAAGGNYYYYGMDV 20          Amino acid sequence of golimumab light chain complementarity determining region 1 (LCDR1): (SEQ IDNO 43) RASQSVYSYLA Amino acid sequence of golimumab light chain complementarity determining region 2 (LCDR2) (SEQ ID NO 44) 25                                    DASNRAT Amino acid sequence of golimumab light chain complementant) determining region 3 (LCDRL): (SEQ ID NO 45) QQRSNWPPFT 2026253995   16 Oct 2026 At least one antibody of the invention binds at least one specified epitope specific to at least one TNF protein, subunit fragment, portion or any combination thereof The at least one epitope can comprise at least one antibody binding region that comprises at least one portion of said protein, which epitope is preferably comprised of at least one 5 extracellular, soluble, hydrophilic, external or cytoplasmic portion of said protein. The at least one specified epitope can comprise any combination of at least one amino acid sequence of at least 1-3 amino acids to the entire specified portion of contiguous amino acids of the SEQ ID NO:9. Generally, the human antibody or antigen-binding fragment of the present 10 invention will comprise an antigen-binding region that comprises at least one human complementarity determining region (CDR1, CDR2 and CDR3) or variant of at least one heavy chain variable region and at least one human complementarity determining region (CDRL CDR2 and CDR3) or variant of at least one light chain variable region. As a nonlimiting example, the antibody or antigen-binding portion or variant can comprise at least 15 one of the heavy chain CDR3 having the amino acid sequence of SEQ ID NO:3, and / or a light chain CDR3 having the amino acid sequence of SEQ ID NO:6 In a particular embodiment, the antibody or antigen-binding fragment can have an antigen-binding region that comprises at least a portion of at least one heavy chain CDR (i.c.. CDRI. CDR2 and / or CDR3) having the amino acid sequence of the corresponding CDRs I. 2 20 and / or 3 (e.g.. SEQ ID NOS: 1. 2. and / or 3). In another particular embodiment, the antibody or antigen-binding portion or variant can have an antigen-binding region that comprises at least a portion of at least one light chain CDR (i.c.. CDR I. CDR2 and / or CDR3) having the amino acid sequence of the corresponding CDRs 1. 2 and / or 3 (e.g., SEQ ID NOS 4, 5, and / or 6). In a preferred embodiment the three heavy chain CDRs and 25 the three light chain CDRs of the antibody or antigen-binding fragment have the amino acid sequence of the corresponding CDR of at least one of mAb TNV148. TNVI4. TNV15. TNV 196. TNV 118. TNV32, TNV86. as described herein. Such antibodies can be prepared by chemically joining together the various portions (e.g.. CDRs. framework) of the antibody using conventional techniques, by preparing and expressing a (i .c.. one or 30 more) nucleic acid molecule that encodes the antibody using conventional techniques of recombinant DN A technology or by using any other suitable method The anti-TNF antibody can comprise at least one of a heavy or light chain variable region having a defined amino acid sequence. For example, in a preferred embodiment. 2026253995   16 Oct 2026 the anti-TNF antibody comprises at least one of heavy chain variable region, optionally having the amino acid sequence of SEQ ID NO:7 and / or at least one light chain variable region, optionally having the amino acid sequence of SEQ ID NO:8 antibodies that bind to human TNF and that comprise a defined heavy or light chain variable region can be 5 prepared using suitable methods, such as phage display (Katsube. Y .et al.. Int J Mol. Med, 1(5):863-868 (1998)) or methods that employ transgenic animals, as known in the art and / or as described herein. For example, a transgenic mouse, comprising a functionally rearranged human immunoglobulin heavy chain transgene and a transgcnc comprising DNA from a human immunoglobulin light chain locus that can undergo 10 functional rearrangement, can be immunized with human TNF or a fragment thereof to elicit the production of antibodies. If desired, the antibod) producing cells can be isolated and hybridomas or other immortalized antibody-producing cells can be prepared as described herein and / or as known in the art. Alternatively, the antibody, specified portion or variant can be expressed using the encoding nucleic acid or portion thereof in a 15 suitable host cell. The invention also relates to antibodies, antigen-binding fragments, immunoglobulin chains and CDRs comprising amino acids in a sequence that is substantially the same as an amino acid sequence described herein. Preferably, such antibodies or antigen-binding fragments and antibodies comprising such chains or CDRs 20 can bind human TNF with high affinity (eg.. Kd less than or equal to about 10‘9 M). Amino acid sequences that arc substantially the same as the sequences described herein include sequences comprising conservative amino acid substitutions, as well as amino acid deletions and / or insertions. A conservative amino acid substitution refers to the replacement of a first ammo acid by a second amino acid that has chemical and / or 25 physical properties (e.g.. charge, structure, polarity. hydrophobicity / hydrophilicity) that arc similar to those of the first amino acid. Conservative substitutions include replacement of one amino acid by another w ithin the following groups, lysine (K), arginine (R) and histidine (H); aspartate (D) and glutamate (E); asparagine (N), glutamine (Q). serine (S). threonine (T). tyrosine (Y), K. R. H. D and E: alanine (A), valine (V), 30 leucine (L). isoleucine (I), proline (P), phenylalanine (F). tryptophan (W). methionine (M), cysteine (C) and glycine (G): F. W and Y; C. S and T Amino Acid Codes. The amino acids that make up anti-TNF antibodies of the present invention are often abbreviated. The amino acid designations can be indicated by 2026253995   16 Oct 2026 designating the ammo acid by its single letter code, its three letter code, name, or three nucleotide codon(s) as is well understood in the art (see Alberts. B.. ct al., Molecular Biology ofThe Cell, Third Ed.. Garland Publishing. Inc.. New York, 1994): SINGLE LETTER CODE THREE LETTER CODE NAME THREE NUCLEOTIDE: CODON(S) A Ala Alanine GCA. GCC. GCG. GCU C Cys Cysteine UGC. UGU D Asp Aspartic acid GAC.GAU E Glu Glutamic acid GAA, GAG F Phe Phenylanine UUC. UUU G Gh Glycine GGA. GGC, GGG. GGU H His Histidine CAC. CAU 1 lie Isoleucine AUA. AUC. AUU K Lys Lysine AAA. AAG L Leu Leucine UUA. UUG. CUA. CUC. CUG. CUU M Met Methionine AUG N Asn Asparagine AAC. AAU P Pro Proline CCA, CCC. CCG. CCU Q Gin Glutamine CAA. CAG R Arg Arginine AGA. AGG.CGA. CGC, CGG. CGU S Ser Serine AGC. AGU. UCA. UCC. UCG. UCU T Thr Threonine ACA. ACC. ACG. ACU V Vai Valine GUA GUC. GUG. GUU w Trp Tryptophan UGG Y Tyr Tyrosine UAC. UAU 2026253995   16 Oct 2026 An anti-TNF antibody of the present invention can include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation, as specified herein. 5          Of course, the number of amino acid substitutions a skilled artisan would make depends on many factors, including those described above. Generally speaking, the number of amino acid substitutions, insertions or deletions for any given anti-TNF antibody, fragment or variant will not be more than 40. 30, 20. 19. 18. 17. 16, 15. 14. 13. 12. 11. 10, 9, 8. 7. 6. 5, 4. 3. 2, 1. such as 1-30 or any range or value therein, as specified 10 herein Amino acids in an anti-TNF antibody of the present invention that are essential for function can be identified by methods known in the art. such as site-directed mutagenesis or alanine-scanning mutagenesis (eg., Ausubei, supra. Chapters 8. 15; Cunningham and Wells. Science 244:1081-1085 (1989)). The latter procedure introduces single alanine 15 mutations at even residue in the molecule. The resulting mutant molecules arc then tested for biological activity, such as. but not limited to at least one TNF neutralizing activity Sites that are critical for antibody binding can also be identified by structural analysis such as cry stallization, nuclear magnetic resonance or photoaflfinity labeling (Smith, ct al.. J. Mol. Biol. 224:899-904 (1992) and de Vos. ct al.. Science 255:306-312 (1992)). 20          Anti-TNF antibodies of the present invention can include, but are not limited to. at least one portion, sequence or combination selected from 1 to all of the contiguous amino acids of at least one of SEQ ID NOS: 1. 2. 3. 4. 5. 6. A(n) anti-TNF antibody can further optionally comprise a polypeptide of at least one of 70-100% of the contiguous amino acids of at least one of SEQ ID NOS: 7. 8. 25          In one embodiment, the amino acid sequence of an immunoglobulin chain, or portion thereof (eg., variable region. CDR)has about 70-100% identity (c.g.. 70. 71. 72, 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99, 100 or any range or value therein) to the amino acid sequence of the corresponding chain of at least one of SEQ ID NOS7. 8. For example, the amino acid 30 sequence of a light chain variable region can be compared w ith the sequence of SEQ ID NO:8. or the amino acid sequence of a heavy chain CDR3 can be compared with SEQ ID NO 7 Preferably, 70-100% amino acid identity (i e„ 90, 91, 92. 93. 94. 95, 96. 97, 98. 99. 2026253995   16 Oct 2026 100 or any range or value therein) is determined using a suitable computer algorithm, as known in the art Exemplary' heavy chain and light chain variable regions sequences are provided in SEQ ID NOS: 7. 8. The antibodies of tire present invention, or specified variants thereof, can 5 comprise any number of contiguous amino acid residues from an antibody of the present invention, wherein that number is selected from the group of integers consisting of from 10100% of the number of contiguous residues in an anti-TNF antibody. Optionally. this subsequence of contiguous amino acids is at least about 10.20. 30. 40.50. 60, 70, 80.90, 100. 110. 120. 130. 140. 150. 160. 170. 180. 190. 200. 210. 220. 230. 240. 250 or more 10   amino acids in length, or any range or value therein. Further, the number of such subsequences can be any integer selected from the group consisting of from 1 to 20. such as at least 2.3.4. or 5. As those of skill will appreciate, the present invention includes at least one biologically active antibody of the present invention. Biologically active antibodies have a 15 specific activity at least 20%, 30%. or 40%. and preferably at least 50%. 60%. or 70%. and most preferably at least 80%. 90%. or 95%-!000%of that of the native (non-synthetic). endogenous or related and known antibody. Methods of assaying and quantify ing measures of enzymatic activity and substrate specificity. arc well known to those of skill in the art. In another aspect the invention relates to human antibodies and antigen-binding 20 fragments, as described herein, w hich arc modified by the covalent attachment of an organic moiety . Such modification can produce an antibody or antigen-binding fragment with improved pharmacokinetic properties (e g., increased in vivo serum half-life). The organic moiety can be a linear or branched hy drophilic polymeric group, fatty acid group, or fatty acid ester group. In particular embodiments, the hy drophilic polymeric group can 25   have a molecular w eight of about 800 to about 120.000 Daltons and can be a poly alkane gly col (e.g., poly ethylene gly col (PEG), poly propylene gly col (PPG)), carbohydrate poly mer. amino acid poly mer or polyviny l py rolidone. and the fatty acid or fatty acid ester group can comprise from about eight to about forty carbon atoms. The modified antibodies and antigen-binding fragments of the invention can 30 comprise one or more organic moieties that are covalently bonded, directly or indirectly, to the antibody. Each organic moiety that is bonded to an antibody or antigen-binding fragment of the invention can independently be a hy drophilic polymeric group, a fatty 2026253995   16 Oct 2026 acid group or a fatty acid ester group. As used herein, the term ‘'fatty acid" encompasses mono-carboxylic acids and di-carboxylic acids. A "hydrophilic pohineric group," as the term is used herein, refers to an organic polymer that is more soluble in water than in octane. For example, polylysine is more soluble in water than in octane. Thus, an 5 antibody modified by the covalent attachment of polylysine is encompassed by the invention. Hydrophilic polymers suitable for modifying antibodies of the invention can be linear or branched and include, for example, polyalkanc glycols (e g.. PEG. monomethoxy-polycthylcnc glycol (mPEG). PPG and the like), carbohydrates (e g., dextran, cellulose, oligosaccharides, polysaccharides and the like), polymers of 10 hydrophilic ammo acids (eg.. polylysine, polyarginine, polyaspartate and the like), polyalkanc oxides (eg.. polyethylene oxide, polypropylene oxide and the like) and polyvinyl pyrolidonc Preferably, the hydrophilic polymer that modifies the antibody of the invention has a molecular weight of about 800 to about 150.000 Daltons as a separate molecular entity. For example. PEGsono and PEG20.000. wherein the subscript is the 15 average molecular weight of the polymer in Daltons, can be used The hy drophilic polymeric group can be substituted with one to about six alky l, fatty' acid or fatty acid ester groups. Hydrophilic polymers that arc substituted w ith a fatty acid or fatty acid ester group can be prepared by employ ing suitable methods. For example, a polymer comprising an amine group can be coupled to a carboxylate of the fatty acid or fatty acid 20 ester, and an activated carboxylate (e g., activated with N. N-carbonyl diimidazolc) on a fatty acid or fatty acid ester can be coupled to a hy droxy 1 group on a poly mer Fatty acids and fatty acid esters suitable for modifying antibodies of the invention can be saturated or can contain one or more units of unsaturation. Fatty acids that are suitable for modifying antibodies of the invention include, for example, n-dodccanoatc 25    (C12. laurate), n-tctradccanoatc (Cu, myristate), n-octadccanoatc (Cis, stearate), n- cicosanoatc (Cao, arachidatc). n-docosanoate (C22, behenate), n-triacontanoatc (Cm). n-tctracontanoatc (Cw). c / s-A9-octadecanoatc (Cis. oleate), all CA-A5.8.11.14-eicosatctracnoate (C20. arachidonate), octanedioic acid, tetradecanedioic acid. octadccancdioic acid, docosancdioic acid, and the like. Suitable fatty acid esters include 30 mono-esters of dicarboxylic acids that comprise a linear or branched loyver alky 1 group. The loyver alkyl group can comprise from one to about twelve, preferably one to about six. carbon atoms. 2026253995   16 Oct 2026 The modified human antibodies and antigen-binding fragments can be prepared using suitable methods, such as by reaction with one or more modifying agents. A “modifying agent as the term is used herein, refers to a suitable organic group (e g.. hydrophilic polymer, a fatty acid, a fatty acid ester) that comprises an activating group. 5 An "activating group" is a chemical moiety or functional group that can. under appropriate conditions, react with a second chemical group thereby forming a covalent bond between the modifying agent and the second chemical group. For example, aminereactive activating groups include electrophilic groups such as tosylatc. mesylate, halo (chloro, bromo, fluoro, iodo). N-hydroxysuccinimidyl esters (NHS). and the like. 10 Activating groups that can react with thiols include, for example, maleimide, iodoacetv I, acrylolyl, pyridyl disulfides. 5-thiol-2-nitrobenzoic acid thiol (TNB-thiol). and the like. An aldehyde functional group can be coupled to amine- or hv drazidc-containing molecules, and an azide group can react with a trivalent phosphorous group to form phosphoramidatc or phosphorimide linkages. Suitable methods to introduce activating 15 groups into molecules are known in the art (see for example. Hermanson. G. T.. Bioconjugate Techniques, Academic Press: San Diego. CA (1996)). An activating group can be bonded directly to the organic group (c.g.. hydrophilic polymer, fattv acid, fatty acid ester), or through a linker moiety, for example a divalent C1-C12 group wherein one or more carbon atoms can be replaced by a heteroatom such as oxygen, nitrogen or sulfur. 20 Suitable linker moictics include, for example, tetraethy lene glycol. -(CH’)j-. -NH-(CH2)f.-NH-. -(CHjh-NH- and -CH2-O-CH2-CH2-O-CH2-CH2-O-CH-NH- Modifying agents that comprise a linker moiety can be produced, for example, by reacting a mono-Boc-alkyldiamine (e.g.. mono-Boc-ethylenediamine. mono-Boc-diaminohexane) with a fattv acid in the presence of l-cthyl-3-(3-dimethylaminopropyl) carbodiimidc (EDC) to form 25 an amide bond between the free amine and the fattv acid carboxylate. The Boc protecting group can be removed from the product by treatment with tri fluoroacetic acid (TFA) to expose a primary amine that can be coupled to another carboxylate as described or can be reacted w ith maleic anhydride and the resulting product cyclized to produce an activated maleimido derivative of the fattv acid. (Sec. for example. Thompson, el al . WO 30   92 / 16221 the entire teachings of w hich arc incorporated herein by reference.) The modified antibodies of the invention can be produced by reacting a human antibody or antigen-binding fragment with a modify ing agent. For example, the organic moieties can be bonded to the antibody in a non-site specific manner by employing an 2026253995   16 Oct 2026 amine-reactive modifying agent, for example, an NHS ester of PEG Modified human antibodies or antigen-binding fragments can also be prepared by reducing disulfide bonds (eg., intra-cham disulfide bonds) of an antibody or antigen-binding fragment. The reduced antibody or antigen-binding fragment can then be reacted with a thiol-reactive 5 modify mg agent to produce the modified antibody of the invention. Modified human antibodies and antigen-binding fragments comprising an organic moiety that is bonded to specific sites of an antibody of the present invention can be prepared using suitable methods, such as reverse proteolysis (Fisch et al.. Bioconjugate Chem.. 3:147-153 (1992): Wcrlcn el al.. Bioconjugate Chem., 5:411-417 (1994): Kumaran et al.. Protein Sci 10    6(10):2233-2241 (1997): Itoh el al.. Bioorg. ('hem., 24( 1): 59-68 (1996); Capellas et al., Biotechnol. Bioeng., 56(4):456-463 (1997)). and the methods described in Hermanson. G. T . Bioconjugate Techniques. Academic Press: San Diego. CA (1996). Anti-Idiotype Antibodies To Anti-Tnf Antibody Compositions. In addition to monoclonal or chimeric anti-TNF antibodies, the present invention is also directed to an 15   anti-idiotypic (anti-Id) antibody specific for such antibodies of the invention. An anti-Id antibody is an antibody which recognizes unique determinants generally associated with the antigen-binding region of another antibody. The anti-Id can be prepared by immunizing an animal of the same species and genetic type (eg. mouse strain) as the source of the Id antibody with the antibod) or a CDR containing region thereof. The 20 immunized animal will recognize and respond to the idiot) pic determinants of the immunizing antibod) and produce an anti-Id antibody. The anti-Id antibod) may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti-anti-Id antibody Anti-Tnf Antibody Compositions. The present invention also provides at least 25 one anti-TNF antibod) composition comprising at least one. at least two. at least three, at least four, at least five, at least six or more anti-TNF antibodies thereof, as described herein and / or as known in the art that are provided in a non-naturally occurring composition, mixture or form. Such compositions comprise non-naturally occurring compositions comprising at least one or two full length. C- and / or N-terminally deleted 30 variants, domains, fragments, or specified variants, of the anti-TNF antibod) amino acid sequence selected from the group consisting of 70-100% of the contiguous amino acids of SEQ ID NOS: 1. 2. 3,4.5, 6. 7. 8. or specified fragments, domains or variants thereof Preferred anti-TNF antibod) compositions include at least one or two full length. 2026253995   16 Oct 2026 fragments, domains or variants as at least one CDR or LBR containing portions of the anti-TNF antibody sequence of 70-100% of SEQ ID NOS: I. 2, 3. 4, 5, 6. or specified fragments, domains or variants thereof. Further preferred compositions comprise 40-99% of at least one of 70-100% of SEQ ID NOS: 1. 2. 3. 4. 5. 6. or specified fragments. 5 domains or variants thereof. Such composition percentages arc by weight, volume, concentration, molarity, or molality as liquid or dry solutions, mixtures, suspension, emulsions or colloids, as known in the art or as described herein Anti-TNF antibody compositions of the present invention can further comprise at least one of any suitable and effective amount of a composition or pharmaceutical 10 composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient in need of such modulation, treatment or therapy. optionally further comprising at least one selected from at least one TNF antagonist (e.g., but not limited to a TNF antibody or fragment, a soluble TNF receptor or fragment, fusion proteins thereof, or a small molecule TNF antagonist), an antirheumatic (e g., methotrexate, auranofin. 15 aurothioglucosc. azathioprinc. etanercept, gold sodium thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalzine). a muscle relaxant a narcotic, a non-steroid antiinflammatory drug (NSA1D). an analgesic, an anesthetic, a sedative, a local anethetic. a neuromuscular blocker, an antimicrobial (e.g.. aminoglycoside, an antifungal, an antiparasitic, an antiviral, a carbapencm. cephalosporin, a flurorquinolone, a macrolide, a 20 penicillin, a sulfonamide, a tetracycline, another antimicrobial), an anti psoriatic, a corticostcriod. an anabolic steroid, a diabetes related agent, a mineral, a nutritional, a thy roid agent, a vitamin, a calcium related hormone, an antidiarrheal, an antitussive, an antiemetic, an antiulcer, a laxative, an anticoagulant, an erytliropieitin (e g., epoetin alpha), a filgrastim (e.g., G-CSF, Neupogen), a sargramostim (GM-CSF. Leukine), an 25 immunization, an immunoglobulin, an immunosuppressive (e g., basiliximab. cy closporinc. daclizumab). a growth hormone, a hormone replacement drug, an estrogen receptor modulator, a my driatic. a cycloplegic, an alky lating agent, an antimetabolite, a mitotic inhibitor, a radiopharmaceutical, an antidepressant, antimanic agent, an antipsychotic, an anxioly tic, a hypnotic, a sy mpathomimetic, a stimulant, doncpczil. 30 tacrine, an asthma medication, a beta agonist, an inhaled steroid, a leukotriene inhibitor, a methy Ixanthinc, a cromolyn, an epinephrine or analog, doniasc alpha (Pulmozymc), a cytokine or a cytokine antagonist. Non-limiting examples of such cytokines include, but are not limtcd to. any of IL-1 to IL-23. Suitable dosages arc well known in the art. See. 2026253995   16 Oct 2026 e.g.. Wells et al., eds.. Pharmacotherapy Handbook. 2nd Edition. Appleton and Lange. Stamford. CT (2()()()). PDR Pharmacopoeia. Tarascon Pocket Pharmacopoeia 2000. Deluxe Edition. Tarascon Publishing, Loma Linda, CA (2000). each of which references arc entirely incorporated herein by reference. 5           Such anti-cancer or anti-infectivcs can also include toxin molecules that are associated, bound, co-formulatcd or co-administered with at least one antibody of the present invention. The toxin can optionally act to selectively kill the pathologic cell or tissue The pathologic cell can be a cancer or other cell. Such toxins can be. but arc not limited to. purified or recombinant toxin or toxin fragment comprising at least one 10 functional cytotoxic domain of toxin, eg., selected from at least one of ricin, diphtheria toxin, a venom toxin, or a bacterial toxin The term toxin also includes both endotoxins and exotoxins produced by any naturally occurring, mutant or recombinant bacteria or viruses which may cause any pathological condition in humans and other mammals, including toxin shock, which can result in death Such toxins may include, but are not 15 limited to. enterotoxigenic E. coli heat-labile enterotoxin (LT), heat-stable enterotoxin (ST). Shigella cytotoxin. Aeromonas enterotoxins, toxic shock syndrome toxin-1 (TSST- 1). Staphylococcal enterotoxin A (SEA). B (SEB), or C (SEC). Streptococcal enterotoxins and the like. Such bacteria include, but arc not limited to, strains of a species of enterotoxigenic E. coli (ETEC), enterohcmorrhagic E. coli (e.g., strains of serotype 20   0157:H7), Staphylococcus species (e.g., Staphylococcus aureus. Staphylococcus pyogenes). Shigella species (eg., Shigella dysenteriae. Shigella flexneri, Shigella hoydii. and Shigella sonnet). Salmonella species (e g.. Salmonella typhi. Salmonella cholera-suis. Salmonella enteritidis), Clostridium species (e.g., Clostridium perfringens. Clostridium dificile. Clostridium botulinum). Camphlobacter species (e.g., Camphlobacter jejuni. 25 Camphlobacter fetus). Heliocbacter species, (e.g.. HeUocbacter pylori). Aeromonas species (e g., Aeromonas sobria. Aeromonas hydrophila. Aeromonas caviae), Pleisomonas shigelloides, Yersinia enterocolitica, Vibrio species (e.g.. Vibrio cholerae. Vibrio parahemolyticus). Klebsiella species. Pseudomonas aeruginosa, and Streptococci. See. e g . Stein, cd., INTERNAL MEDICINE. 3rd cd . pp 1-13. Little. Brown and Co.. 30 Boston. (1990); Evans ct al., eds.. Bacterial Infections of Humans: Epidemiology and Control. 2d Ed., pp 239-254, Plenum Medical Book Co.. New York (1991); Mandell et al. Principles and Practice of Infectious Diseases. 3d. Ed.. Churchill Livingstone, New' York (1990); Berkow ct al. eds.. The Merck Manual. 16th edition. Merck and Co.. 2026253995   16 Oct 2026 Rahway.NJ., 1992; Woodctal. FEMS Microbiology Immunology. 76:121-134(1991); Marrack ct al. Science, 248:705-711 (1990). the contents of which references arc incorporated entirely herein by reference. Anti-TNF antibody compounds, compositions or combinations of the present 5 invention can further comprise at least one of any suitable auxiliary. such as. but not limited to. diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like. Pharmaceutically acceptable auxiliaries arc preferred. Non-limiting examples of. and methods of preparing such sterile solutions arc well known in the art. such as. but limited to. Gennaro. Ed.. Remington s Pharmaceutical Sciences. 18"' Edition. 10 Mack Publishing Co. (Easton. PA) 1990. Pharmaceutically acceptable carriers can be routinely selected that are suitable for the mode of administration, solubility and / or stability of the anti-TNF antibody, fragment or variant composition as well known in the art or as described herein Pharmaceutical excipients and additives useful in the present composition include 15 but are not limited to proteins, peptides, amino acids, lipids, and carbohydrates (e g., sugars, including monosaccharides, di-, tri-, tetra-, and oligosaccharides; derivatized sugars such as alditols, aldomc acids, csterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include scrum 20 albumin such as human serum albumin (HSA). recombinant human albumin (rHA). gelatin, casein, and the like. Representative amino acid / antibody components, which can also function in a buffering capacity, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine. valine, methionine, phenylalanine, aspartame, and the like. One preferred amino acid is glycine. 25           Carbohydrate excipients suitable for use in the invention include, for example, monosaccharides such as fructose, maltose, galactose, glucose, D-mannosc. sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, mclczitose. maltodcxtrins. dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol. lactitol. xylitol sorbitol (ghicitol), 30 myoinositol and the like. Preferred carbohy drate excipients for use in the present invention are mannitol, trehalose, and raffinose. 2026253995   16 Oct 2026 Anti-TNF antibods compositions can also include a buffer ora pH adjusting agent; typically. the buffer is a salt prepared from an organic acid or base Representative buffers include organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris, tromethamine 5 hydrochloride, or phosphate buffers Preferred buffers for use in the present compositions are organic acid salts such as citrate. Additionally. anti-TNF antibody compositions of the invention can include pohincric excipients / additivcs such as polyvinylpyrrolidones, ficolls (a polymeric sugar), dextrates (e.g.. cyclodextrins, such as 2-hydroxypropyl-P-cyclode.xtrin), polyethylene 10 glycols, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (e.g.. polysorbates such as 'TWEEN 20" and ' TWEEN 80"), lipids (e.g., phospholipids, fatty acids), steroids (e.g.. cholesterol), and chelating agents (e.g.. EDTA). These and additional known pharmaceutical excipients and / or additives suitable for use in the anti-TNF antibody, portion or variant compositions according to the 15 invention are known in the art. e g., as listed in "Remington: The Science & Practice of Pharmacy", 19,h cd.. Williams & Williams. (1995), and in the "Physician's Desk Reference". 52nd cd . Medical Economics. Montvale. NJ (1998). the disclosures of which are entirely incorporated herein by reference. Preferred earner or excipient materials arc carbohydrates (e g., saccharides and alditols) and buffers (e.g.. citrate) or polymeric 20 agents. Formulations. As noted above, the invention provides for stable formulations, w hich is preferably a phosphate buffer w ith saline or a chosen salt, as well as preserved solutions and formulations containing a preservative as well as multi-use preserved formulations suitable for pharmaceutical or vetcrinan use, comprising at least one anti- 25 TNF antibody in a pharmaceutically acceptable fonnulation. Preserved formulations contain at least one know n preservative or optionally selected from the group consisting of at least one phenol, m-cresol. p-cresol. o-cresol. chlorocresol, benzyl alcohol, phenyl mercuric nitrite, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (e.g.. hexahydrate), alkylparaben (methyl, ethyl, propyl, butyl and the like), 30 benzalkonium chloride, benzethonium chloride, sodium dehydroacctate and thitncrosal. or mixtures thereof in an aqueous diluent. Any suitable concentration or mixture can be used as know n in the art. such as 0.001-5%. or any range or value therein, such as. but not limited to 0.001. 0.003. 0.005. 0.009. 0.01. 0.02. 0.03. 0.05. 0.09. 0.1. 0.2. 0.3. 0.4.. 0.5. 2026253995   16 Oct 2026 0.6.0.7. 0.8.0.9. 1.0. 1.1. 1.2. 1.3, 1.4. 1.5, 1.6. 1.7, 1.8. 1.9,2.0.2.1.2.2.2.3,2.4.2.5, 2.6. 2.7. 2.8. 2.9. 3.0. 3.1. 3.2, 3.3, 3.4. 3.5. 3.6. 3.7. 3.8. 3.9. 4.0. 4 3. 4.5. 4.6. 4.7. 4.8. 4.9. or any range or value therein. Non-limiting examples include, no preservative, 0.12% m-cresol (eg.. 0.2. 0.3. 0.4. 0.5. 0.9. 1.0%). 0.1-3% benzyl alcohol (eg.. 0.5. 0.9, 11.. 5    1.5, 1.9. 2.0, 2.5%). 0.001-0.5% thimerosal (c.g.. 0.005. 0.01). 0.001-2.0% phenol (e.g.. 0.05. 0.25, 0.28, 0.5. 0.9, 1.0%). 0.0005-1.0% alkyIparaben(s) (e.g.. 0.00075. 0.0009. 0,001, 0.002, 0005. 0,0075, 0.009,0.01, 0.02. 0.05. 0.075, 0.09, 0.1, 0.2, 0.3. 0.5, 0.75. 0.9. 1.0%). and the like. As noted above, the invention prov ides an article of manufacture, comprising 10 packaging material and at least one vial comprising a solution of at least one anti-TNF antibody with the prescribed buffers and / or preservatives, optionally in an aqueous diluent, wherein said packaging material comprises a label that indicates that such solution can be held over a period of 1. 2. 3. 4. 5. 6. 9. 12. 18. 20. 24. 30. 36. 40. 48. 54. 60. 66. 72 hours or greater. The invention further comprises an article of manufacture. 15 comprising packaging material, a first vial comprising lyophilized at least one anti-TNF antibody, and a second vial comprising an aqueous diluent of prescribed buffer or preservative, wherein said packaging material comprises a label that instructs a patient to reconstitute the at least one anti-TNF antibody in the aqueous diluent to form a solution that can be held over a period of twenty-four hours or greater 20          The at least one anti-TNFantibody used in accordance w ith the present invention can be produced by recombinant means, including from mammalian cell or transgenic preparations, or can be purified from other biological sources, as described herein or as known in the art. The range of at least one anti-TNF antibody in the product of the present invention 25 includes amounts yielding upon reconstitution, if in a wet / dry system, concentrations from about 1,0 pg / ml to about 1000 mg / ml. although lower and higher concentrations are operable and arc dependent on the intended delivery vehicle, e g., solution formulations will differ from transdermal patch, pulmonary, transmucosal. or osmotic or micro pump methods 30           Preferably, the aqueous diluent optionally further comprises a pharmaceutically acceptable preservative Preferred preservatives include those selected from the group consisting of phenol, m-cresol, p-crcsoL o-crcsol. chlorocrcsol. benzyl alcohol. 2026253995   16 Oct 2026 alkylparabcn (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimcrosal. or mixtures thereof. The concentration of preservative used in the formulation is a concentration sufficient to yield an anti-microbial effect. Such concentrations are dependent on the preservative selected and are readily determined by the skilled artisan. Other excipients, e.g. isotonicity agents, buffers, antioxidants, preservative enhancers, can be optionally and preferably added to the diluent. An isotonicity agent, such as glycerin, is common!) used at known concentrations. A physiologically tolerated buffer is preferably added to provide improved pH control The formulations can cover a wide range of pHs. such as from about pH 4 to about pH 10. and preferred ranges from about pH 5 to about pH 9, and a most preferred range of about 6 0 to about 8.0. Preferably the formulations of the present invention have pH between about 6.8 and about 7.8. Preferred buffers include phosphate buffers, most preferably sodium phosphate particular!) phosphate buffered saline (PBS). Other additives, such as a pharmaceutically acceptable solubilizers like Tween 20 (polyoxyethylene (20) sorbitan monolaurate). Tween 40 (polyoxyethylene (20) sorbitan monopalmitatc). Tween 80 (polyoxyethylene (20) sorbitan monooleate). Pluromc F68 (pol) oxyethylene pol) oxyprop) lenc block copolymers), and PEG (polyethylene glycol) or non-ionic surfactants such as polysorbate 20 or 80 or poloxamcr 184 or 188. Pluronic® polyols, other block co-polymcrs. and chelators such as EDTA and EGTA can optional!) be added to the formulations or compositions to reduce aggregation. These additives are particularly usefi.il if a pump or plastic container is used to administer the formulation. The presence of pharmaceutical!) acceptable surfactant mitigates the propensit) for the protein to aggregate The formulations of the present invention can be prepared by a process w hich comprises mixing at least one anti-TNF antibody and a preservative selected from the group consisting of phenol, m-cresol, p-cresol. o-cresol, chlorocresol, benzyl alcohoL alk) Iparabcn. (meth) 1, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof in an aqueous diluent. Mixing the at least one anti-TNF antibody and preservative in an aqueous diluent is carried out using conventional dissolution and mixing procedures. To prepare a suitable formulation, for example, a measured amount of at least one anti-TNF antibody tn buffered solution is combined w itli the desired preservative in a buffered 2026253995   16 Oct 2026 solution in quantities sufficient to provide the protein and preservative at the desired concentrations. Variations of this process would be recognized by one of ordinary skill in the art. For example, the order the components are added, whether additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can 5 be optimized for the concentration and means of administration used. The claimed formulations can be provided to patients as clear solutions or as dual vials comprising a vial of lyophilized at least one anti-TNF antibody that is reconstituted w ith a second vial containing water, a preservative and / or excipients, preferably a phosphate buffer and / or saline and a chosen salt, in an aqueous diluent. Either a single 10 solution vial or dual vial requiring reconstitution can be reused multiple times and can suffice for a single or multiple cycles of patient treatment and thus can provide a more convenient treatment regimen than currently available. The present claimed articles of manufacture are useful for administration over a period of immediately to twenty-four hours or greater Accordingly, the presently claimed 15 articles of manufacture offer significant advantages to the patient. Formulations of the invention can optional!) be safely stored at temperatures of from about 2 to about 40°C and retain the biologically activity of the protein for extended periods of time. thus, allowing a package label indicating that the solution can be held and / or used over a period of 6. 12, 18. 24. 36, 48. 72. or 96 hours or greater. If preserved diluent is used, such label 20 can include use up to 1-12 months, one-half, one and a half, and / or two years. The solutions of at least one anti-TNF antibod) in the invention can be prepared by a process that comprises mixing at least one antibod) in an aqueous diluent. Mixing is carried out using conventional dissolution and mixing procedures. To prepare a suitable diluent, for example, a measured amount of at least one antibod) in water or buffer is 25 combined in quantities sufficient to provide the protein and optionally a preservative or buffer at the desired concentrations. Variations of this process would be recognized by one of ordinary skill in the art. For example, the order the components are added, whether additional additives are used, the temperature and pH at which the formulation is prepared, are all factors that can be optimized for the concentration and means of 30 administration used. The claimed products can be provided to patients as clear solutions or as dual vials comprising a vial of lyophilized at least one anti-TNF antibody that is reconstituted with a 2026253995   16 Oct 2026 second vial containing the aqueous diluent. Either a single solution vial or dual vial requiring reconstitution can be reused multiple times and can suffice for a single or multiple cycles of patient treatment and thus provides a more convenient treatment regimen than currently available. 5           The claimed products can be provided indirectly to patients by providing to pharmacies, clinics, or other such institutions and facilities, clear solutions or dual vials comprising a vial of lyophilized at least one anti-TNF antibody that is reconstituted with a second vial containing the aqueous diluent. The clear solution in this case can be up to one liter or even larger in size, providing a large reservoir from which smaller portions of 10 the at least one antibody solution can be retrieved one or multiple times for transfer into smaller vials and provided by the pharmacy or clinic to their customers and / or patients Recognized devices comprising these single vial systems include those peninjector devices for deliver) of a solution such as B-D " (pen injector device). NOVOPEN" (pen injector device). AUTOPEN" (pen injector device). OPTIPEN" (pen 15 injector device). GENOTROPIN PEN" (pen injector device).-HUMATROPEN" (pen injector device). B1OJECTOR" (pen injector device). Rcco-Pcn. Humajcct. J-tip Needle-Free Injector. Intraject. Medi-Ject. eg . as made or developed by Becton Dickcnscn (Franklin Lakes. NJ. www bectondickenson com). Disctronic (Burgdorf. Switzerland, www.disctronic.com; 20 Bioject. Portland. Oregon (www bioject.com); Weston Medical (Peterborough. UK. www .wcston-mcdical.com). Medi-Ject Corp (Minneapolis. MN. www.medijcct.com) Recognized devices comprising a dual vial system include those pen-injector systems for reconstituting a lyophilized drug in a cartridge for delivers of the 25 reconstituted solution such as the HUMATROPEN “ (pen injector device) The products presently claimed include packaging material. The packaging material provides, in addition to the information required by the regulatory agencies, the conditions under which the product can be used. The packaging material of the present invention provides instructions to the patient to reconstitute the at least one anti-TNF 30 antibody in the aqueous diluent to form a solution and to use the solution over a period of 2-24 hours or greater for the two vial, wet / dry. product. For the single vial, solution 2026253995   16 Oct 2026 product, the label indicates that such solution can be used over a period of 2-24 hours or greater The presently claimed products arc useful for human pharmaceutical product use The formulations of the present invention can be prepared by a process that comprises mixing at least one anti-TNF antibody and a selected buffer, preferably a 5 phosphate buffer containing saline or a chosen salt. Mixing the at least one antibody and buffer in an aqueous diluent is carried out using conventional dissolution and mixing procedures. To prepare a suitable formulation, for example, a measured amount of at least one antibody in water or buffer is combined with the desired buffering agent in water in quantities sufficient to provide the protein and buffer at the desired concentrations. 10 Variations of this process would be recognized by one of ordinary skill in tire art. For example, the order the components are added, whether additional additives are used, the temperature and pH at which the formulation is prepared, arc all factors that can be optimized for the concentration and means of administration used. The claimed stable or preserved formulations can be provided to patients as clear 15 solutions or as dual vials comprising a vial of lyophilized at least one anti-TNF antibody that is reconstituted w ith a second vial containing a preservative or buffer and excipients in an aqueous diluent. Either a single solution vial or dual vial requiring reconstitution can be reused multiple times and can suffice for a single or multiple cycles of patient treatment and thus provides a more convenient treatment regimen than currently 20 available. At least one anti-TNF antibody in either the stable or preserved formulations or solutions described herein, can be administered to a patient in accordance with the present invention via a variety of delivery methods including SC or IM injection; transdcnnal. pulmonary. transmucosal. implant, osmotic pump, cartridge, micro pump, or other means 25 appreciated by the skilled artisan, as well-known in the art. Therapeutic Applications. The present invention also provides a method for modulating or treating at least one TNF related disease, in a cell, tissue, organ, animal, or patient, as known in the art or as described herein, using at least one dual mtegrin antibody of the present invention 30          The present invention also provides a method for modulating or treating at least one TNF related disease, in a cell, tissue, organ, animal, or patient including, but not 2026253995   16 Oct 2026 limited to. at least one of obesity. an immune related disease, a cardiovascular disease, an infectious disease, a malignant disease or a neurologic disease. The present invention also provides a method for modulating or treating at least one immune related disease, in a cell, tissue, organ, animal, or patient including, but not 5 limited to. at least one of rheumatoid arthritis, juvenile . systemic onset juvenile rheumatoid arthritis. Ankylosing Spondylitis, ankylosing spondilitis. gastric ulcer, seronegative arthropathies, osteoarthritis, inflammatory bowel disease, ulcerative colitis, systemic lupus enthematosis. antiphospholipid syndrome, iridocyclitis / uvcitis / optic neuritis, idiopathic pulmonary fibrosis, systemic vasculitis / wegcncr's granulomatosis. 10 sarcoidosis, orchitis / vasectomy reversal procedures, allergic / atopic diseases, asthma, allergic rhinitis, eczema, allergic contact dermatitis, allergic conjunctivitis, hypersensitivity pneumonitis, transplants, organ transplant rejection, graft-versus-host disease, systemic inflammatory response syndrome, sepsis syndrome, gram positive sepsis, gram negative sepsis, culture negative sepsis, fungal sepsis, neutropenic fever. 15 urosepsis, incningococccmia. trauma / hcmorrhagc. bums, ionizing radiation exposure, acute pancreatitis, adult respirators distress syndrome, alcohol-induced hepatitis, chronic inflammatory pathologies, sarcoidosis. Crohn’s pathology, sickle cell anemia, diabetes, nephrosis, atopic diseases, hypersensitivity reactions, allergic rhinitis, hay fever, perennial rhinitis, conjunctivitis, endometriosis, asthma, urticaria, systemic anaphylaxis, dermatitis. 20 pernicious anemia, hemolytic disease, thrombocytopenia, graft rejection of any organ or tissue, kidney transplant rejection, heart transplant rejection, liver transplant rejection, pancreas transplant rejection, lung transplant rejection, bone marrow transplant (BMT) rejection, skin allograft rejection, cartilage transplant rejection, bone graft rejection, small bowel transplant rejection, fetal thymus implant rejection, parathyroid transplant 25 rejection, xenograft rejection of any organ or tissue, allograft rejection, anti-receptor hypersensitivity reactions. Graves disease. Raymond's disease, type B insulin-resistant diabetes, asthma, myasthenia gravis, antibody-meditated cytotoxicity, type III hypersensitivity reactions, systemic lupus erythematosus. POEMS syndrome (polyneuropathy, organomegaly, cndocrinopathy, monoclonal gammopathy, and skin 30 changes syndrome), polyneuropathy, organomegaly, cndocrinopathy. monoclonal gammopathy. skin changes syndrome, antiphospholipid syndrome, pemphigus, scleroderma, mixed connective tissue disease, idiopathic Addison's disease, diabetes mellitus. chronic active hepatitis, primary billiary cirrhosis, vitiligo, vasculitis, post-MI 2026253995   16 Oct 2026 cardiotomy syndrome, type IV hypersensitivity , contact dermatitis, hypersensitiv ily pneumonitis, allograft rejection, granulomas due to intracellular organisms, drug sensitivity, metabolic / idiopathic. Wilson's disease, hemachromatosis, alpha-1-antitrypsin deficiency, diabetic retinopathy, hashimoto's thyroiditis, osteoporosis, primary biliary 5 cirrhosis, thyroiditis, encephalomyelitis, cachexia, cystic fibrosis, neonatal chronic lung disease, chronic obstnictive pulmonary disease (COPD). familial hematophagocytic ly mphohistiocy tosis. dcmiatologic conditions, psoriasis, alopecia, nephrotic syndrome, nephritis, glomerular nephritis, acute renal failure, hemodialysis, uremia, toxicity, prccclampsia. okt3 therapy. anti-cd3 therapy, cytokine therapy. chemotherapy, radiation 10 therapy (eg., including but not limited to asthenia, anemia, cachexia, and the like), chronic salicylate intoxication, and the like. Sec, c.g.. the Merck Manual. 12th-17th Editions. Merck & Company . Rahway, NJ (1972, 1977. 1982, 1987. 1992. 1999). Pharmacotherapy Handbook, Wells et al., eds.. Second Edition. Appleton and Lange, Stamford. Conn. (1998. 2000). each entirely incorporated by reference. 15           The present invention also provides a method for modulating or treating at least one cardiovascular disease in a cell, tissue, organ, animal, or patient including, but not limited to. at least one of cardiac stun sy ndrome. my ocardial infarction, congestive heart failure, stroke, ischemic stroke, hemorrhage, arteriosclerosis, atherosclerosis, restenosis, diabetic arteriosclerotic disease, hy pertension. arterial hypertension, renovascular 20 hypertension, sy ncope. shock, sy philis of the cardiovascular system, heart failure, cor pulmonale, primary pulmonary hypertension, cardiac arrhythmias, atrial ectopic beats, atrial flutter, atrial fibrillation (sustained or paroxysmal), post perfusion syndrome, cardiopulmonary bypass inflammation response, chaotic or multifocal atrial tachy cardia, regular narrow QRS tachycardia, specific arrhy thmias, ventricular fibrillation. His bundle 25 arrhythmias, atrioventricular block, bundle branch block, myocardial ischemic disorders, coronary artery disease, angina pectoris, myocardial infarction, cardiomyopathy, dilated congestive cardiomyopathy , restrictive cardiomy opathy. valvular heart diseases, endocarditis, pericardial disease, cardiac tumors, aortic and peripheral aneurysms, aortic dissection, inflammation of the aorta, occlusion of the abdominal aorta and its branches. 30 peripheral vascular disorders, occlusive arterial disorders, peripheral atherosclerotic disease, tliromboangitis obliterans, functional peripheral arterial disorders, Raynaud's phenomenon and disease, acrocy anosis, erythromelaigia. venous diseases, venous thrombosis, varicose veins, arteriovenous fistula, lymphedema, lipedema, unstable 2026253995   16 Oct 2026 angina, reperfusion injury. post pump syndrome, ischemia-reperfusion injury, and the like. Such a method can optionally comprise administering an effective amount of a composition or pharmaceutical composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient in need of such modulation, treatment or therapy 5           The present invention also provides a method for modulating or treating at least one infectious disease in a cell, tissue, organ, animal or patient, including, but not limited to. at least one of: acute or chronic bacterial infection, acute and chronic parasitic or infectious processes, including bacterial, viral and fungal infections. HIV infcction / HIV neuropathy, meningitis, hepatitis (A.B or C. or the like), septic arthritis, peritonitis. 10 pneumonia, epiglottitis, e. coli 0157:117. hemolytic uremic syndrome / thrombolvtic thrombocytopenic purpura, malaria, dengue hemorrhagic fever, leishmaniasis, leprosy. toxic shock syndrome, streptococcal myositis, gas gangrene, mycobacterium tuberculosis, mycobacterium avium intracellulare. pneumocystis carinii pneumonia, pelvic inflammatory disease, orchitis / cpidydimitis. legionclla. lyme disease, influenza a. cpstcin- 15 barr virus, viral-associated hemaphagocytic syndrome, vital enccphalitis / ascptic meningitis, and die like. The present invention also provides a method for modulating or treating at least one malignant disease in a cell, tissue, organ, animal or patient, including, but not limited to. at least one of: leukemia, acute leukemia, acute lymphoblastic leukemia (ALL). B-ccll. 20 T-cell or FAB ALL. acute myeloid leukemia (AML), chronic myelocytic leukemia (CML). chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodyplastic syndrome (MDS), a lymphoma. Hodgkin's disease, a malignant lymphoma. nonHodgkin's lymphoma. Burkitt’s lymphoma, multiple myeloma. Kaposi's sarcoma, colorectal carcinoma, pancreatic carcinoma, nasopharyngeal carcinoma, malignant 25 histiocytosis, paraneoplastic syndrome / hypercalcemia of malignancy, solid tumors, adenocarcinomas, sarcomas, malignant melanoma, hemangioma, metastatic disease, cancer related bone resorption, cancer related bone pain, and the like The present invention also provides a method for modulating or treating at least one neurologic disease in a cell, tissue, organ, animal or patient, including, but not limited 30 to, at least one of: neurodegenerative diseases, multiple sclerosis, migraine headache, AIDS dementia complex, demyelinating diseases, such as multiple sclerosis and acute transverse myelitis: extrapyramidal and cerebellar disorders, such as lesions of the corticospinal system: disorders of the basal ganglia or cerebellar disorders; hyperkinetic 2026253995   16 Oct 2026 movement disorders such as Huntington's Chorea and senile chorea; drug-induced movement disorders, such as those induced by drugs which block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; Progressive supranucleo Palsy; structural lesions of the cerebellum; spinocerebellar degenerations, 5 such as spinal ataxia, Friedreich's ataxia, cerebellar cortical degenerations, multiple systems degenerations (Mencel, Dejenne-Thomas. Shi-Drager, and Machado-Joseph); systemic disorders (Refsum's disease, abetalipoprotemia, ataxia tclangicctasiaa, and mitochondrial multisystem disorder); demyelinating core disorders, such as multiple sclerosis, acute transverse myelitis; and disorders of the motor unit' such as neurogenic 10 muscular atrophies (anterior horn cell degeneration, such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy and juvenile spinal muscular atrophy): Alzheimer's disease: Down's Syndrome in middle age: Diffuse Lewy body disease; Senile Dementia of Lewy body type; Wemicke-Korsakoff syndrome; chronic alcoholism: Creutzfeldt-Jakob disease; Subacute sclerosing panencephalitis. Hallerrordcn-Spatz disease, and 15 Dementia pugilistica. and the like. Such a method can optionally comprise administering an effective amount of a composition or pharmaceutical composition comprising at least one TNF antibody or specified portion or variant to a cell, tissue, organ, animal or patient in need of such modulation, treatment or therapy. Sec, e.g., the Merck Manual. 16th Edition. Merck & Company. Rahway, NJ (1992) 20          Any method of the present invention can comprise administering an effective amount of a composition or pharmaceutical composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient in need of such modulation, treatment or therapy. Such a method can optionally further comprise co-administration or combination therapy for treating such immune diseases, w herein the administering of said 25 at least one anti-TNF antibody, specified portion or variant thereof, further comprises administering, before concurrently, and / or after, at least one selected from at least one TNF antagonist (e.g., but not limited to a TNF antibody or fragment, a soluble TNF receptor or fragment, fusion proteins thereof, or a small molecule TNF antagonist), an antirheumatic (eg.. methotrexate, auranofin. aurothioghicosc. azathioprinc. etanercept. 30 gold sodium thiomalate, hy droxychloroquine sulfate, leflunomide, sulfasalzine). a muscle relaxant, a narcotic, a non-steroid anti-inflammatory drug (NSAID), an analgesic, an anesthetic, a sedative, a local anethetic, a neuromuscular blocker, an antimicrobial (eg., aminoglycoside, an antifungal, an antiparasitic, an antiviral, a carbapenem, cephalosporin. 2026253995   16 Oct 2026 a flurorquinolone. a macrolide, a penicillin, a sulfonamide, a tetracycline, another antimicrobial), an antipsoriatic. a corticostcriod. an anabolic steroid, a diabetes related agent, a mineral, a nutritional, a thyroid agent, a vitamin, a calcium related hormone, an antidiarrheal, an antitussive. an antiemetic, an antiulcer, a laxative, an anticoagulant, an 5 en thropieitin (e.g.. epoetin alpha), a filgrastim (eg.. G-CSF. Neupogen), a sargramostim (GM-CSF. Leukine), an immunization, an immunoglobulin, an immunosuppressive (e.g.. basiliximab, cyclosporine, daclizumab). a grow th hormone, a hormone replacement drug, an estrogen receptor modulator, a mydriatic, a cycloplegic, an alkylating agent, an antimetabolitc. a mitotic inhibitor, a radiopharmaceutical, an antidepressant, antimanic 10 agent, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, doncpcziL tacrine, an asthma medication, a beta agonist, an inhaled steroid, a leukotriene inhibitor, a methylxanthinc, a cromolyn, an epinephrine or analog, doniasc alpha (Puhnozyme). a cytokine or a cjlokine antagonist Suitable dosages are well known in the art. Sec. e.g.. Wells et al., eds.. Pharmacotherapy Handbook. 2nd Edition. Appleton and 15 Lange. Stamford. CT (2000); PDR Pharmacopoeia. Tarascon Pocket Pharmacopoeia 2000, Deluxe Edition. Tarascon Publishing. Loma Linda. CA (2000). each of w hich references arc entirely incorporated herein by reference. TNF antagonists suitable for compositions, combination therapy, coadministration, devices and / or methods of the present invention (further comprising at 20 least one anti body, specified portion and variant thereof, of the present invention), include, but are not limited to. anti-TNF antibodies, antigen-binding fragments thereof, and receptor molecules which bind specifically to TNF; compounds which prevent and / or inhibit TNF synthesis. TNF release or its action on target cells, such as thalidomide. tenidap. phosphodiesterase inhibitors (e.g.. pentoxifylline and rolipram), A2b adenosine 25 receptor agonists and A2b adenosine receptor enhancers; compounds which prevent and / or inhibit TNF receptor signaling, such as mitogen activated protein (MAP) kinase inhibitors; compounds which block and / or inhibit membrane TNF cleavage, such as metalloproteinase inhibitors; compounds which block and / or inhibit TNF activity, such as angiotensin converting enzyme (ACE) inhibitors (e.g., captopril); and compounds which 30 block and / or inhibit TNF production and / or synthesis, such as MAP kinase inhibitors. As used herein, a "tumor necrosis factor antibody." "TNF antibody." "TNFa antibody," or fragment and the like decreases, blocks, inhibits, abrogates or interferes with TNFa activity in vitro, in situ and / or preferably in vivo. For example, a suitable TNF 2026253995   16 Oct 2026 human antibody of the present invention can bind TNFa and includes anti-TNF antibodies, antigen-binding fragments thereof, and specified mutants or domains thereof that bind specifically to TNFa. A suitable TNF antibody or fragment can also decrease block, abrogate, interfere, prevent and / or inhibit TNF RNA, DNA or protein synthesis. 5 TNF release. TNF receptor signaling, membrane TNF cleavage. TNF activity, TNF production and / or synthesis. Chi meric antibody cA2 consists of the antigen binding variable region of the high-affinity neutralizing mouse anti-human TNFa IgGl antibody, designated A2, and the constant regions of a human IgG 1. kappa immunoglobulin. The human IgG 1 Fc region 10 improves allogeneic antibody effector function, increases the circulating serum half-life and decreases the immunogenicity of the antibody. The avidity and epitope specificity of the chimeric antibody cA2 is derived from the variable region of the murine antibody A2. In a particular embodiment, a preferred source for nucleic acids encoding the variable region of the murine antibody A2 is the A2 hybridoma cell line. 15           Chimeric A2 (cA2) neutralizes the cytotoxic effect of both natural and recombinant human TNFa in a dose dependent manner. From binding assays of chimeric antibody cA2 and recombinant human TNFa. the affinity constant of chimeric antibody cA2 was calculated to be 1.04xl010M'. Preferred methods for determining monoclonal antibod) specificity and affinity* by competitive inhibition can be found in Harlow, etal.. 20 antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. New York. 1988; Colligan etal., eds.. Current Protocols in Immunology’. Greene Publishing Assoc, and Wiley Interscience, New York, (1992-2000); Kozbor et al., Immunol. Today. 4:12-19 (1983); Ausubel et a!., eds. Current Protocols tn Molecular Biology. Wiley Interscience, New York (1987-2000); and Muller, Meth. Enzymol.. 25   92:589-601 (1983), which references are entirely incorporated herein by reference In a particular embodiment, murine monoclonal antibody A2 is produced by a cell line designated C134A. Chimeric antibody cA2 is produced by a cell line designated CI68A Additional examples of monoclonal anti-TNF antibodies that can be used in the 30 present invention are described in the art (see, e.g., U.S. Patent No. 5,231,024; Moller. A. el al.. Cytokine 2(3): 162-169 (1990); U.S Application No. 07 / 943.852 (filed September 11. 1992): Rathjcn et a!.. International Publication No. WO 91 / 02078 (published 2026253995   16 Oct 2026 February 21. 1991); Rubin el al., EPO Patent Publication No. 0 218 868 (published April 22, 1987); Yone el al.. EPO Patent Publication No. 0 288 088 (October 26. 1988); Liang. et al., Biochem. Biophys. Res. Comm. 737:847-854 (1986); Meager, et al.. Hybridoma 6:305-311 (1987); Fondly et al.. Hybridoma 6:359-369 (1987): Bringman. eta!.. 5 Hybridoma 6:489-507 (1987); and Hirai, et a!.. J. Immunol. Meth. 96:57-62 (1987). which references are entirely incorporated herein by reference). TNF Receptor Molecules. Preferred TNF receptor molecules useful in the present invention arc those that bind TNFa with high affinity (see. e g.. Feldmann et al.. International Publication No. WO 92 / 07076 (published April 30. 1992); Schall el al.. Cell 10   67:361-370 (1990): and Loctschcr et al.. Cell 67:351-359 (1990). which references arc entirely incorporated herein by reference) and optionally possess low immunogenicity In particular, the 55 kDa (p55 TNF-R) and the 75 kDa (p75 TNF-R) TNF cell surface receptors are useful in the present invention. Truncated forms of these receptors, comprising the extracellular domains (ECD) of the receptors or functional portions 15 thereof (see. e.g.. Corcoran el al.. Eur. J. Biochem. 223:831-840 (1994)), are also useful in the present invention. Truncated forms of the TNF receptors, comprising tire ECD. have been detected in urine and senim as 30 kDa and 40 kDa TNFa inhibitory binding proteins (Engelmann. H el al.. J Biol. Chern. 265:1531-1536 (1990)). TNF receptor multimeric molecules and TNF immunoreceptor fusion molecules, and derivatives and 20 fragments or portions thereof, are additional examples of TNF receptor molecules which arc useful in the methods and compositions of the present invention. Tire TNF receptor molecules which can be used in the invention arc characterized by their ability to treat patients for extended periods w ith good to excellent alleviation of symptoms and low toxicity. Low immunogenicity and / or high affinity, as well as other undefined properties. 25 can contribute to the therapeutic results achieved. TNF receptor multimeric molecules useful in the present invention comprise all or a functional portion of the ECD of two or more TNF receptors linked via one or more polypeptide linkers or other nonpeptide linkers, such as polyethylene glycol (PEG). The multimeric molecules can further comprise a signal peptide of a secreted protein to direct 30 expression of the multimeric molecule. These multimeric molecules and methods for their production have been described in U.S. Application No. 08 / 437,533 (filed May 9. 1995), the content of w hich is entirely incorporated herein by reference 2026253995   16 Oct 2026 TNF immunoreceptor fusion molecules useful in the methods and compositions of the present invention comprise at least one portion of one or more immunoglobulin molecules and all or a functional portion of one or more TNF receptors. These immunoreceptor fusion molecules can be assembled as monomers, or hetero- or homo- 5 multimers. The immunoreceptor fusion molecules can also be monovalent or multivalent. An example of such a TNF immunoreceptor fusion molecule is TNF receptor / IgG fusion protein. TNF immunoreceptor fusion molecules and methods for their production have been described in the art (Lcsslaucr el al.. Eur. J. Immunol. 2 / :2883-2886 (1991); Ashkenazi el a!.. Proc. Nall. Acad. Sci. USA 88:10535-10539 (1991); Peppcl el al.. J. 10 Exp. Med. / 72:1483-1489 (1991); Koi Is el al.. Proc. Nad. Acad. Sci. USA 97:215-219 (1994); Butler et a!.. Cytokine 6(6):616-623 (1994): Baker et a!.. Eur. J. Immunol. 22:2040-2048 (1994); Beutler el al.. U.S. Patent No. 5.447.851. and U.S. Application No 08 / 442.133 (filed May 16. 1995). each of which references are entirely incorporated herein by reference). Methods for producing immunoreceptor fusion molecules can also 15 be found in Capon el al.. U.S. Patent No. 5.116.964; Capon et al.. U.S. Patent No. 5.225.538; and Capon et al.. Nature 337:525-531 (1989). which references are entirely incorporated herein by reference. A functional equivalent derivative, fragment or region of TNF receptor molecule refers to the portion of the TNF receptor molecule, or the portion of the TNF receptor 20 molecule sequence which encodes TNF receptor molecule, that is of sufficient size and sequences to functionally resemble TNF receptor molecules that can be used in the present invention (e.g., bind TNFa with high affinity and possess low immunogenicity). A functional equivalent of TNF receptor molecule also includes modified TNF receptor molecules that functionally resemble TNF receptor molecules that can be used in the 25 present invention (eg.. bind TNFa with high affinity and possess low immunogenicity). For example, a functional equivalent of TNF receptor molecule can contain a "SILENT” codon or one or more amino acid substitutions, deletions or additions (e.g.. substitution of one acidic amino acid for another acidic amino acid; or substitution of one codon encoding the same or different hy drophobic amino acid for another codon encoding a 30 hy drophobic amino acid). Sec Ausubcl et al.. Current Protocols in Molecular Biology. Greene Publishing Assoc, and Wiley-Interscience. New York (1987-2000) Cy tokines include any known cytokine. Sec. e g.. Copew ithCytokincs.com. Cy tokine antagonists include, but arc not limited to. any antibody, fragment or mimetic. 2026253995   16 Oct 2026 any soluble receptor, fragmentor mimetic, any small molecule antagonist, or any combination thereof. Therapeutic Treatments. Any method of the present invention can compose a method for treating a TNF mediated disorder, comprising administering an effective 5 amount of a composition or pharmaceutical composition comprising at least one anti-TNF antibody to a cell, tissue, organ, animal or patient in need of such modulation, treatment or therapy. Such a method can optionally further comprise co-administration or combination therapy for treating such immune diseases, wherein the administering of said at least one anti-TNF antibody, specified portion or variant thereof, further comprises 10 administering, before concurrently, and / or after, at least one selected from at least one TNF antagonist (eg., but not limited to a TNF antibody or fragment, a soluble TNF receptor or fragment, fusion proteins thereof, ora small molecule TNF antagonist), an antirheumatic (e g., methotrexate, auranofin. aurothioglucose, azathioprine, etanercept, gold sodium thiomalate, hydroxychloroquine sulfate, leflunomide, sulfasalzinc). a muscle 15 relaxant, a narcotic, a non-stcroid anti-inflammatory drug (NSA1D), an analgesic, an anesthetic, a sedative, a local anethetic. a neuromuscular blocker, an antimicrobial (eg . aminoglycoside, an antifungal, an antiparasitic, an antiviral, a carbapcncm. cephalosporin, a flurorquinolonc, a macrolide, a penicillin, a sulfonamide, a tetracycline, another antimicrobial), an antipsoriatic. a corticosteriod. an anabolic steroid, a diabetes related 20 agent, a mineral, a nutritional, a thyroid agent, a vitamin, a calcium related hormone, an antidiarrheal, an antitussivc. an antiemetic, an antiulcer, a laxative, an anticoagulant, an crythropicitin (e.g., epoetin alpha), a filgrastim (e g.. G-CSF. Neupogen), a sargramostim (GM-CSF. Leukine), an immunization, an immunoglobulin, an immunosuppressive (eg., basiliximab. cyclosporine, daclizumab), a growth hormone, a hormone replacement drug, 25 an estrogen receptor modulator, a mydriatic, a cycloplegic, an alkylating agent, an antimetabolite, a mitotic inhibitor, a radiopharmaceutical, an antidepressant, antimanic agent, an antipsychotic, an anxiolytic, a hypnotic, a sympathomimetic, a stimulant, donepeziL tacrine, an asthma medication, a beta agonist, an inhaled steroid, a leukotriene inhibitor, a methylxanthine, a cromolyn, an epinephrine or analog, domasc alpha 30   (Pulmozymc). a cytokine or a cytokine antagonist As used herein, the term "safe”, as it relates to a composition, dose, dosage regimen, treatment or method with an anti-TNF antibody of the present invention (e.g.. the anti-TNF antibody golimumab). refers to a favorable risk:benefit ratio with an 2026253995   16 Oct 2026 acceptable frequency and / or acceptable severity of adverse events (AEs) and serious adverse events (SAEs) compared to the standard of care or to another comparator such as other anti-TNF agents. An adverse event is an untoward medical occurrence in a patient administered a medicinal product. In particular, safe as it relates to a composition, dose. 5 dosage regimen, treatment or method with an anti-TNF antibods of the present invention refers to an acceptable frequency and / or acceptable severity of adverse events including, for example, infusion reactions, hepatobiliary laboratory abnormalities, infections including TB. and malignancies. The terms "efficacy " and "effective'' as used herein in the context of a 10 composition, dose, dosage regimen, treatment or method refer to the effectiveness of a particular composition, dose, dosage, treatment or method with an anti-TNF antibody of the present invention (c.g.. the anti-TNF antibody golimumab). Efficacy can be measured based on change in the course of the disease in response to an agent of the present invention For example, an anti-TNF antibody of the present invention is administered to 15 a patient in an amount and for a time sufficient to induce an improvement, preferably a sustained improvement, in at least one indicator that reflects the severity of the disorder that is being treated. Various indicators that reflect the extent of the subject's illness, disease or condition may be assessed for determining whether the amount and time of the treatment is sufficient. Such indicators include, for example, clinically recognized 20 indicators of disease seventy, symptoms, or manifestations of the disorder in question The degree of improvement generally is determined by a physician or other adequately trained individual, who may make the determination based on signs, symptoms, biopsies, or other test results that indicate amelioration of clinical sy mptoms or any other measure of disease activity . For example, an anti-TNF antibody of the present invention may be 25 administered to achieve an improvement in a patient s condition related to juvenile idiopathic arthritis (JIA), and in particular for polyarticular juvenile idiopathic arthritis (pJIA). Efficacy for the treatment of JIA and / or pJIA can be determined, for example by patients meeting the criteria for inactive disease, patients having an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response 30 selected from JIA ACR 30. JIA ACR 50. JIA ACR 70. and / or JIA ACR 90. and / or patients having a decrease from baseline in Juvenile Arthritis Disease Activity Score (JADAS) selected from JADAS 10. JADAS 27. and / or JADAS 71 2026253995   16 Oct 2026 As used herein, unless otherwise noted, the term “clinically proven” (used independently or to modify the terms “safe” and / or ■ effective”) shall mean that it has been proven by a clinical trial wherein the clinical trial has met tire approval standards of U.S. Food and Drug Administration, EMEA or a corresponding national regulator} 5 agency. For example, the clinical study may be an adequately sized, randomized, doubleblinded study used to clinically prove the effects of the drug. Typically, treatment of pathologic conditions is effected by administering a safe and effective amount or dosage of at least one anti-TNF antibody composition that total, on average, a range from at least about 0.01 to 500 milligrams of at least one anti- 10 TNFantibody per kilogram of patient per dose, and preferably from at least about 0.1 to 100 milligrams antibody / kilogram of patient per single or multiple administration, depending upon the specific activity of contained in the composition. Alternatively, the effective serum concentration can comprise 0.1-5000 pg / ml serum concentration per single or multiple administration. Suitable dosages are known to medical practitioners and 15 w ill, of course, depend upon the particular disease state, specific acti v ity of the composition being administered, and the particular patient undergoing treatment In some instances, to achieve the desired therapeutic amount, it can be necessary to provide for repeated administration, i.e., repeated individual administrations of a particular monitored or metered dose, where the individual administrations are repeated until the desired daily 20 dose or effect is achieved. Preferred doses can optionally include 0.1. 0.2. 0.3. 0.4. 0.5. 0.6. 0.7. 0.8. 0.9. 1. 2. 3.4. 5.6. 7.8.9. 10. 11, 12. 13. 14. 15. 16. 17. 18. 19.20.21.22.23.24. 25,26.27.28. 29, 30, 31, 32, 33. 34. 35, 36, 37, 38. 39. 40, 41. 42, 43. 44. 45, 46. 47, 48. 49. 50. 51, 52, 53, 54. 55. 56. 57. 58. 59. 60. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73, 74. 75. 76. 77. 25    78. 79. 80. 81. 82. 83. 84, 85. 86. 87. 88. 89, 90. 91. 92. 93. 94. 95. 96. 97. 98. 99 and / or 100-500 mg / kg / administration. or any range, value or fraction thereof, or to achieve a serum concentration of 0.1. 0.5. 0.9. 1.0, 1.1. 1.2. 1.5, 1.9.2.0.2.5.2.9.3.0,3.5.3.9,4.0, 4.5. 4.9, 5.0. 5.5. 5.9. 6.0. 6.5, 6.9. 7.0. 7.5, 7.9. 8.0. 8.5. 8.9. 9.0. 9.5, 9.9. 10. 10.5. 10.9, 11. 11.5. 11.9, 20. 12.5. 12.9. 13.0, 13.5,13.9, 14.0. 14.5, 15. 15.5. 15.9, 16. 16.5. 16.9, 30    17. 17.5, 17.9. 18. 18.5. 18.9, 19. 19.5. 19.9. 20. 20.5,20.9. 21. 22. 23. 24. 25. 26. 27, 28. 29. 30. 35. 40. 45. 50. 55. 60. 65. 70. 75. 80. 85. 90. 96. 100. 200. 300. 400. 500. 600. 700, 800. 900. 1000, 1500. 2000. 2500. 3000. 3500. 4000. 4500. and / or 5000 pg / ml 2026253995   16 Oct 2026 scrum concentration per single or multiple administration, or any range, value or fraction thereof. Alternatively, the dosage administered can van depending upon known factors, such as the pharmacodynamic characteristics of the particular agent, and its mode and 5 route of administration; age. health, and weight of the recipient; nature and extent of symptoms, kind of concurrent treatment, frequency of treatment, and die effect desired Usually a dosage of active ingredient can be about 0.1 to 100 milligrams per kilogram of bod\ weight. Ordinarily 0.1 to 50. and preferably 0.1 to 10 milligrams per kilogram per administration or in sustained release form is effective to obtain desired results. 10          Asa non-limiting example, treatment of humans or animals can be provided as a one-time or periodic dosage of at least one antibod)' of the present invention 0.1 to 100 mg / kg. such as 0.5. 0.9. 1.0, 1.1, 1.5.2, 3,4.5.6. 7. X. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28.29. 30. 40. 45. 50. 60. 70. 80. 90 or 100 mg / kg, per day. on at least one of day 1.2,3.4.5. 6. 7. 8.9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 15    20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 3 I, 32. 33. 34. 35, 36. 37. 38. 39. or 40. or alternatively or additionally, at least one of week 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21, 22, 23, 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44.45. 46. 47.48. 49,50, 51, or 52, or alternatively or additionally, at least one of 1.2,3.4.5.6.. 7. X. 9. 10. 11. 12. 13. 14. 15. 16. 17. IX. 19, or 20 years, or 20 any combination diereof, using single, infusion or repeated doses. Dosage forms (composition) suitable for internal administration generail) contain from about 0.1 milligram to about 500 milligrams of active ingredient per unit or container. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 0.5-99.999% by weight based on the total w eight of the 25 composition. For parenteral administration, the antibod) can be formulated as a solution, suspension, emulsion or lyophilized powder in association, or separately provided, with a pharmaceutically acceptable parenteral vehicle. Examples of such vehicles arc w ater, saline. Ringer's solution, dextrose solution, and 1-10% human scrum albumin. Liposomes 30 and nonaqueous vehicles such as fixed oils can also be used. The vehicle or lyophilized pow der can contain additives that maintain isotonicity (e.g.. sodium chloride, mannitol) 2026253995   16 Oct 2026 and chemical stability (eg.. buffers and preservatives). The formulation is sterilized by known or suitable techniques. Suitable pharmaceutical carriers are described in the most recent edition of Remington's Pharmaceutical Sciences. A. Osol. a standard reference text in this field. 5         Alternative Administration. Many known and developed modes of administration can be used according to the present invention for administering pharmaceutically effective amounts of at least one anti-TNF antibody according to the present invention. While pulmonary administration is used in the following description, other modes of administration can be used according to the present invention with 10 suitable results. TNF antibodies of the present invention can be delivered in a carrier, as a solution, emulsion, colloid, or suspension, or as a dry powder, using any of a variety of devices and methods suitable for administration by inhalation or other modes described here within or known in the art. 15          Parenteral Formulations and Administration. Formulations for parenteral administration can contain as common excipients sterile water or saline, polyalkylcnc gly cols such as poly ethy lene glycol, oils of vegetable origin, hydrogenated naphthalenes and the like. Aqueous or oily suspensions for injection can be prepared by using an appropriate emulsifier or humidifier and a suspending agent, according to known 20 methods. Agents for injection can be a non-toxic. non-orally administrable diluting agent such as aqueous solution ora sterile injectable solution or suspension in a solvent. As the usable vehicle or solvent, water. Ringer's solution, isotonic saline, etc. are allowed: as an ordinary solvent, or suspending solvent, sterile involatile oil can be used. For these purposes, any kind of involatilc oil and fatty acid can be used, including natural or 25 synthetic or semisynthetic fatty oils or fatty acids; natural or synthetic or semisynthetic mono- or di- or tri-glyccridcs. Parental administration is known in the art and includes, but is not limited to. conventional means of injections, a gas pressured needle-less injection device as described in U.S. Pat. No. 5.851,198. and a laser perforator device as described in U.S. Pat. No. 5,839.446 entirely incorporated herein by reference. 30           Alternative Delivery. The invention further relates to the administration of at least one anti-TNF antibody by parenteral, subcutaneous, intramuscular, intravenous, intrarticular. intrabronchial, intraabdominal, intracapsular. intracartilaginous. 2026253995   16 Oct 2026 intracavitary. intracclial. intracelebellar. intraccrcbrovcntncular. intracolic, intracervical. intragastric. intrahcpatic. intramyocardial. intraosteal, intrapclvic, intrapcricardiac. intraperitoneal, intrapleural. intraprostatic. intrapuhnonary, intrarectal. intrarenal, intraretinal, intraspinal. intrasynoviaL intrathoracic. intrauterine, intravesical, bolus. 5 vaginal, rectal, buccal, sublingual, intranasal, ortransdermal means. At least one anti-TNF antibody composition can be prepared for use for parenteral (subcutaneous, intramuscular or intravenous) or any other administration particularly in the form of liquid solutions or suspensions; for use in vaginal or rectal administration particularly in semisolid forms such as. but not limited to. creams and suppositories; for buccal, or 10 sublingual administration such as, but not limited to, in the form of tablets or capsules; or intranasally such as. but not limited to. the form of pow ders, nasal drops or aerosols or certain agents; or transdermally such as not limited to a gel. ointment, lotion, suspension or patch delivery sy stem with chemical enhancers such as dimethyl sulfoxide to either modify the skin structure or to increase the drug concentration in the transdcrmal patch 15 (Junginger. et al. In "Drug Permeation Enhancement"; Hsieh. D. S . Eds., pp. 59-90 (Marcel Dekker. Inc New York 1994. entirely incorporated herein by reference), or with oxidizing agents that enable the application of formulations containing proteins and peptides onto the skin (WO 98 / 53847). or applications of electric fields to create transient transport pathways such as electroporation, or to increase the mobility of charged drugs 20 through the skin such as iontophoresis, or application of ultrasound such as sonophoresis (U.S. Pat. Nos. 4.309.989 and 4.767.402) (the above publications and patents being entirely incorporated herein by reference) Pulmonary / Nasal Administration. For pulmonary administration, preferably at least one anti-TNF antibody composition is delivered in a particle size effective for 25 reaching the lower airways of the lung or sinuses. According to the invention, at least one anti-TNF antibody can be delivered by any of a variety of inhalation or nasal devices known in the art for administration of a therapeutic agent by inhalation. These devices capable of depositing aerosolized formulations in the sinus cavity or alveoli of a patient include metered dose inhalers, nebulizers, dry powder generators, spray ers, and the like 30 Other devices suitable for directing the pulmonary or nasal administration of antibodies are also known in the art. All such devices can use of formulations suitable for the administration for the dispensing of antibody in an aerosol. Such aerosols can be comprised of either solution (both aqueous and non-aqueous) or solid particles. Metered 2026253995   16 Oct 2026 dose inhalers like the VENTOLIN" (metered dose inhaler), typically use a propellant gas and require actuation during inspiration (Sec. e g.. WO 94 / 16970. WO 98 / 35888). Dr} powder inhalers like Turbuhaler (Astra). Rotahaler (Glaxo). DISKUS" (inhaler) (Glaxo). SPIROS’ (inhaler) (Dura), devices marketed by Inhale Therapeutics, and the Spinhalcr 5 powder inhaler (Fisons), use breath-actuation of a mixed powder (US 4668218 Astra. EP 237507 Astra. WO 97 / 25086 Glaxo, WO 94 / 08552 Dura. US 5458135 Inhale. WO 94 / 06498 Fisons. entirely incorporated herein by reference) Nebulizers like AERX“ (nebulizer) Aradigm. the ULTRAVENT" (nebulizer) (Mallinckrodt). and the Acorn II nebulizer (Marqucst Medical Products) (US 5404871 Aradigm. WO 97 / 22376). the above 10 references entirely incorporated herein by reference, produce aerosols from solutions, while metered dose inhalers, dry powder inhalers, etc. generate small particle aerosols. These specific examples of commercially available inhalation devices arc intended to be a representative of specific devices suitable for the practice of th is invention and are not intended as limiting the scope of the invention. Preferably, a composition comprising at 15 least one anti-TNF antibody is delivered by a dry pow der inhaler or a sprayer. There are a several desirable features of an inhalation device for administering at least one antibody of the present invention. For example, deliver} by the inhalation device is advantageously reliable, reproducible, and accurate. The inhalation device can optionally deliver small dry particles, eg. less than about 10 pm. prcfcrabh about 1-5 pm. for good respirability 20         Administration of TNF antibody Compositions as a Spray. A spray including TNF antibody composition protein can be produced by forcing a suspension or solution of at least one anti-TNF antibod} through a nozzle under pressure. The nozzle size and configuration, the applied pressure, and the liquid feed rate can be chosen to achieve the desired output and particle size. An electrospray can be produced, for example, by an 25 electric field in connection w ith a capillar} or nozzle feed. Advantageously. particles of at least one anti-TNF antibody composition protein delivered by a sprayer have a particle size less than about 10 pm. preferably in the range of about I pm to about 5 pm. and most preferably about 2 pm to about 3 pm. Formulations of at least one anti-TNF antibody composition protein suitable for 30 use with a sprayer typically include antibody composition protein in an aqueous solution at a concentration of about 0.1 mg to about 100 mg of at least one anti-TNF antibody composition protein per ml of solution or mg / gm, or any range or value therein, e g., but not limited to. .1. .2.. .3. .4. .5. .6. .7. .8. .9. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 2026253995   16 Oct 2026 16, 17. 18. 19. 20.21,22,23.24.25.26.27. 28.29. 30.40.45.50. 60. 70. 80. 90 or 100 mg / ml or mg / gm. The formulation can include agents such as an excipient a buffer, an isotonicity agent, a preservative, a surfactant, and. preferably, zinc. The formulation can also include an excipient or agent for stabilization of the antibody composition protein, 5 such as a buffer, a reducing agent, a bulk protein, or a carbohydrate. Bulk protems useful in formulating antibody composition proteins include albumin, protamine, or the like. Typical carbohy drates useful in formulating antibody composition proteins include sucrose, mannitol, lactose, trehalose, glucose, or the like. The antibody composition protein formulation can also include a surfactant, which can reduce or prevent surface- 10 induced aggregation of the antibody composition protein caused by atomization of the solution in forming an aerosol. Various conventional surfactants can be employed, such as poly oxycthy lene fatty acid esters and alcohols, and poly oxy ethylene sorbitol fatty acid esters Amounts will generally range between 0.001 and 14% by weight of the formulation. Especially preferred surfactants for purposes of this invention arc 15    polyoxy ethylene sorbitan monooleate, polysorbate 80. poly sorbate 20. or the like. Additional agents known in die art for formulation of a protein such as TNF antibodies, or specified portions or variants, can also be included in the formulation. Administration of TNF antibody compositions by a Nebulizer. Antibody composition protein can be administered by a nebulizer, such as jet nebulizer or an 20 ultrasonic nebulizer. Typically. in a jet nebulizer, a compressed air source is used to create a high-velocity air jet through an orifice. As the gas expands bey ond the nozzle, a low-pressure region is created, which draws a solution of antibody composition protein through a capillary tube connected to a liquid reservoir. The liquid stream from the capillary tube is sheared into unstable filaments and droplets as it exits the tube, creating 25 the aerosol. A range of configurations, flow rates, and baffle types can be employed to achieve the desired performance characteristics from a given jet nebulizer. In an ultrasonic nebulizer, high-frequency electrical energy is used to create vibrational, mechanical energy, typically employing a piezoelectric transducer. This energy is transmitted to the formulation of antibody composition protein either directly or through a 30 coupling fluid, creating an aerosol including the antibody composition protein. Advantageously, particles of antibody composition protein delivered by a nebulizer have a particle size less than about 10 pm, preferably in the range of about 1 pm to about 5 pm. and most preferably' about 2 pm to about 3 pm. 2026253995   16 Oct 2026 Formulations of at least one anti-TNF antibody suitable for use with a nebulizer, cither jet or ultrasonic, typically include a concentration of about 0.1 mg to about 100 mg of at least one anti-TNF antibody protein per ml of solution. The formulation can include agents such as an excipient, a buffer, an isotonicity agent, a preservative, a surfactant, and. preferably, zinc. The formulation can also include an excipient or agent for stabilization of tire at least one anti-TNF antibody composition protein, such as a buffer, a reducing agent, a bulk protein, or a carbohydrate. Bulk proteins usefill in formulating at least one anti-TNF antibody composition proteins include albumin, protamine, or die like. Typical carbohydrates useful in formulating at least one anti-TNF antibody include sucrose, mannitol, lactose, trehalose, glucose, or the like. The at least one anti-TNF antibody formulation can also include a surfactant, which can reduce or prevent surface-induced aggregation of the at least one anti-TNF antibody caused by atomization of the solution in forming an aerosol. Various conventional surfactants can be employed, such as polyoxyethylene fatty acid esters and alcohols, and polyoxyethylene sorbital fatty acid esters. Amounts will generally range between 0.001 and 4% by w eight of the formulation. Especially preferred surfactants for purposes of this invention are poly oxycthy lenc sorbitan mono-olcatc. polysorbate 80. poly sorbate 20, or die like. Additional agents known in the art for formulation of a protein such as antibody protein can also be included in the formulation. Administration of TNF antibody compositions By A Metered Dose Inhaler. In a metered dose inhaler (MD1), a propellant, at least one anti-TNF antibody. and any excipients or other additives are contained in a canister as a mixture including a liquefied compressed gas. Actuation of die metering valve releases the mixture as an aerosol, preferably containing particles in the size range of less than about 10 pm. preferably about 1 pm to about 5 pm. and most preferably about 2 pm to about 3 pm The desired aerosol particle size can be obtained by employ ing a formulation of antibody composition protein produced by various methods known to those of skill in the art, including jetmilling. spray dry ing, critical point condensation, or the like. Preferred metered dose inhalers include those manufactured by 3M or Glaxo and employ ing a hy drofluorocarbon propellant. Formulations of at least one anti-TNF antibody for use with a metered-dose inhaler device will generally include a finely divided powder containing at least one anti-TNF antibody as a suspension in a non-aqueous medium, for example, suspended in a 2026253995   16 Oct 2026 propellant with the aid of a surfactant. The propellant can be any conventional material employed for this purpose, such as chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, ora hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotctrafluoroethanol and 1,1,1.2-tetrafluorocthane. HFA- 5 I34a(hydrofluroalkane-I34a). HFA-227 (hydrofluroalkanc-227). or the like. Preferably the propellant is a hydrofluorocarbon. The surfactant can be chosen to stabilize the at least one anti-TNF antibody as a suspension in the propellant, to protect the active agent against chemical degradation, and the like. Suitable surfactants include sorbitan trioleate, soya lecithin, oleic acid, or the like. In some cases, solution aerosols are preferred using 10 solvents such as ethanol Additional agents known in the art for formulation of a protein can also be included in the formulation. One of ordinary skill in the art will recognize that the methods of die current invention can be achieved by pulmonary administration of at least one anti-TNF antibody compositions via devices not described herein. 15          Oral Formulations and Administration. Formulations for oral rely on the co administration of adjuvants (e g., resorcinols and nonionic surfactants such as poly oxyethy lene oleyl ether and n-hexadecy Ipoly ethy lene ether) to increase artificially the permeability of the intestinal walls, as w ell as the co-admmistration of enzy matic inhibitors (e g., pancreatic try psin inhibitors, diisopropy Ifluorophosphatc (DFF) and 20 trasy lol) to inhibit enzy matic degradation. The active constituent compound of the solidtype dosage form for oral administration can be mixed with at least one additive, including sucrose, lactose, cellulose, mannitol, trehalose, raffinose, maltitol. dextran, starches, agar, arginates. chitins, chitosans, pectins, gum tragacanth, gum arabic. gelatin, collagen, casein, albumin, sy nthetic or semiSynthetic poly mer, and glyceride. These 25 dosage forms can also contain other type(s) of additives, e.g., inactive diluting agent, lubricant such as magnesium stearate, paraben, preserving agent such as sorbic acid, ascorbic acid, alpha-tocopherol, antioxidant such as cysteine, disintegrator, binder, thickener, buffering agent, sweetening agent, flavoring agent, perfuming agent, etc. Tablets and pills can be further processed into enteric-coated preparations. The 30 liquid preparations for oral administration include emulsion, syrup, elixir, suspension and solution preparations allowable for medical use. These preparations can contain inactive diluting agents ordinarily used in said field, e g., water. Liposomes have also been described as drag delivery sy stems for insulin and hepann (U.S. Pat. No 4.239.754) 2026253995   16 Oct 2026 More recently, microsphercs of artificial polymers of mixed amino acids (proteinoids) have been used to deliver pharmaceuticals (U S. Pat. No. 4.925,673). Furthermore, carrier compounds described in U.S. Pat. No. 5,879.681 and U.S. Pat. No 5.5,871,753 arc used to deliver biologically active agents orally are known in the art. Mucosal Formulations and Administration. For absorption through mucosal surfaces, compositions and methods of administering at least one anti-TNF antibody include an emulsion comprising a plurality of submicron particles, a mucoadhesive macromolecule, a bioactivc peptide, and an aqueous continuous phase, which promotes absorption through mucosal surfaces by achieving mucoadhesion of the emulsion particles (U.S. Pat. Nos. 5,514,670). Mucous surfaces suitable for application of the emulsions of the present invention can include comeal, conjunctival, buccal, sublingual, nasal, vaginal, pulmonary, stomachic, intestinal, and rectal routes of administration. Formulations for vaginal or rectal administration, e.g. suppositories, can contain as excipients, for example, polyalkylcncglycols. vaseline, cocoa butter, and the like. Formulations for intranasal administration can be solid and contain as excipients, for example, lactose or can be aqueous or oily solutions of nasal drops. For buccal administration excipients include sugars, calcium stearate, magnesium stearate, prcgclinatincd starch, and the like (U.S Pat. Nos. 5.849.695). Transdermal Formulations and Administration. For transdcrmal administration, the at least one anti-TNF antibody is encapsulated in a delivery device such as a liposome or polymeric nanoparticles, microparticle, microcapsulc. or microsphercs (referred to collectively as microparticles unless otherwise stated). A number of suitable devices are known, including microparticles made of synthetic polymers such as polyhydroxy acids such as polylactic acid, polyglycolic acid and copolymers thereof, polyorthoesters, polyanhydridcs, and polyphosphazenes, and natural polymers such as collagen, polyamino acids, albumin and other proteins, alginate and other polysaccharides, and combinations thereof (U .S Pat. Nos. 5.814,599). Prolonged Administration and Formulations. It can be sometimes desirable to deliver the compounds of the present invention to the subject over prolonged periods of time, for example, for periods of one week to one year from a single administration. Various slow release, depot or implant dosage forms can be utilized. For example, a dosage form can contain a pharmaceutically acceptable non-toxic salt of the compounds that has a low degree of solubility in body fluids, for example, (a) an acid addition salt 2026253995   16 Oct 2026 with a pol) basic acid such as phosphoric acid, sulfuric acid, citric acid, tartaric acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalene mono- or disulfonic acids, pohgalacturonic acid, and the like; (b) a salt with a polyvalent metal cation such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt. 5 nickel, cadmium and the like, or with an organic cation formed from e.g.. N.N'-dibenz) I-ethylenediamine or ethylenediamine; or (c) combinations of (a) and (b) e.g. a zinc tannate salt Additionally, the compounds of the present invention or, preferably, a relatively insoluble salt such as those just described, can be formulated in a gel. for example, an aluminum monostcaratc gel with. e.g.. sesame oil. suitable for injection. Particular!) 10 preferred salts are zinc salts, zinc tannate salts, pamoate salts, and the like. Another type of slow release depot formulation for injection would contain the compound or salt dispersed for encapsulated in a slow degrading, non-toxic. non-antigcnic polymer such as a polylactic acid / polygl) colic acid polymer for example as described in U .S Pat No. 3.773.919. The compounds or. prcfcrabl). relatively insoluble salts such as those 15 described above can also be formulated in cholesterol matrix silastic pellets, particular!) for use in animals. Additional slow release, depot or implant formulations, e.g. gas or liquid liposomes arc known in the literature (U.S. Pat. No 5.770,222 and "Sustained and Controlled Release Drug Deliver) Systems". J R Robinson cd.. Marcel Dekker. Inc.. N.Y.. 1978). 20           Having generally described the invention, the same w ill be more readily understood by reference to the follow ing examples, which are provided by way of illustration and arc not intended as limiting. Example 1: Cloning and Expression of TNF antibody in Mammalian Cells. A typical mammalian expression vector contains at least one promoter element. 25 which mediates the initiation of transcription of mRNA, the antibody coding sequence, and signals required for the termination of transcription and pol) adeny lation of the transcript Additional elements include enhancers. Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved w ith the early and late promoters from SV40. the long 30 terminal repeats (LTRS) from Rctroy iruses. e.g.. RSV. HTLVL H1VI and the early promoter of the cytomegalovirus (CMV) How ever, cellular elements can also be used (eg., the human actin promoter). Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pIRES Inco. pRctro-Off. pRctro- 2026253995   16 Oct 2026 On. PLXSN. or pLNCX (Clonetech Labs. Palo Alto. CA). pcDNA3.1 (+ / -). pcDNA / Zco (+ / -) or pcDNA3.1 / Hygro (+ / -) (Invitrogcn). PSVL and PMSG (Pharmacia, Uppsala. Sweden). pRSVcat (ATCC 37152). pSV2dhfr (ATCC 37146) and pBCl2MI (ATCC 67109). Mammalian host cells that could be used include human Hela 293. H9 and Jurkat 5 cells, mouse NIH3T3 and C127 cells. Cos I. Cos 7 and CV I. quail QCI -3 cells, mouse L cells and Chinese hamster ovary (CHO) cells Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome. The co-transfcction with a selectable marker such as dhfr, gpt. neomycin, or hygromycin allows the identification and isolation of the transfected 10 cells. The transfected gene can also be amplified to express large amounts of the encoded antibody The DHFR (dihydrofolate reductase) marker is useful to develop cell lines that earn, several hundred or even several thousand copies of the gene of interest. Another useful selection marker is the enzyme glutamine synthase (GS) (Murph)-, ct al. 15 Biochcm. J 227:277-279(1991); Bebbington. et al.. Bio / Technology 10:169-175 (1992)). Using these markers, the mammalian cells arc grown in selective medium and the cells w ith the highest resistance are selected These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells arc often used for the production of antibodies. 20          The expression vectors pC I and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen, ct al. Molec Cell Biol 5:438-447 (1985)) plus a fragment of the CMV-enhancer (Boshart. ct al.. Cell 41:521-530 (1985)). Multiple cloning sites, e g., with the restriction enzyme cleavage sites BamHL Xbal and Asp7l8. facilitate the cloning of the gene of interest. The vectors contain in addition the 3' intron, the 25 polyaden) lation and termination signal of tire rat preproinsulin gene. Cloning and Expression in CHO Cells. The vector pC4 is used for the expression of TNF antibody. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146). The plasmid contains the mouse DHFR gene under control of the SV40 early promoter Chinese hamster ovan - or other cells lacking 30 dihydrofolate activity that are transfected with these plasmids can be selected by grow ing the cells in a selective medium (eg., alpha minus MEM. Life Technologies, Gaithersburg. MD) supplemented w itli the chemotherapeutic agent methotrexate. The amplification of 2026253995   16 Oct 2026 the DHFR genes in cells resistant to methotrexate (MTX) has been well documented (see. e g . F W Alt. ct al.. J Biol Chern. 253:1357-1370 (1978): J. L. Hamlin and C Ma. Biochem. ct Biophys. Acta 1097.107-143 (1990): and M J Page and M. A. Sydenham. Biotechnology 9:64-68 (1991)). Cells grown in increasing concentrations of MTX 5 develop resistance to the drug by overproducing the target enzyme. DHFR. as a result of amplification of the DHFR gene. If a second gene is linked to the DHFR gene, it is usually co-amplified and over-expressed. It is known in the art that this approach can be used to develop cell lines carrying more than 1.000 copies of the amplified gcne(s). Subsequently, when the methotrexate is withdrawn, cell lines arc obtained that contain the 10 amplified gene integrated into one or more chromosome(s) of the host cell. Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen, ct al., Molcc. Cell. Biol. 5:438-447 (1985)) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart. ct al.. Cell 41:521-530 (1985)) 15 Dow nstream of the promoter arc BamHI. XbaL and Asp718 restriction enzyme cleavage sites that allow integration of the genes. Behind these cloning sites the plasmid contains the 3' intron and poh adenylation site of the rat preproinsulin gene. Other high efficiency promoters can also be used for the expression, e g., the human beta-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., 20 HIV and HTLVI. Clontech's Tet-Off and Tet-On gene expression systems and similar sy stems can be used to express the TNF in a regulated way in mammalian cells (M. Gosscn, and H. Bujard. Proc. Natl. Acad. Sci. USA 89: 5547-5551 (1992)) For the polyadenylation of the mRNA other signals, eg., from the human growth hormone or globin genes can be used as well Stable cell lines earn ing a gene of interest integrated 25 into the chromosomes can also be selected upon co-transfection w ith a selectable marker such as gpt. G418 or hygromycin. It is advantageous to use more than one selectable marker m the beginning, e g.. G418 plus methotrexate. The plasmid pC4 is digested with restriction enzymes and then dephosphon latcd using calf intestinal phosphatase by procedures known in the art. The vector is then 30 isolated from a 1% agarose gel. The isolated variable and constant region encoding DNA and the dcphosphorylatcd vector arc then ligated with T4 DNA ligase. E. coll HB101 or XL-1 2026253995   16 Oct 2026 Blue cells are then transformed, and bacteria arc identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzy me analysis Chinese hamster ovary (CHO) cells lacking an active DHFRgene are used for transfection. 5 pg of the expression plasmid pC4 is cotransfected with 0.5 pg of the plasmid pSV2-neo using lipofectin. The plasmid pSV2neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418 The cells arc seeded in alpha minus MEM supplemented with 1 pg / ml G418. After 2 days, the cells are try psinized and seeded in hybndoma cloning plates (Greiner. Germany) in alpha minus MEM supplemented with 10. 25. or 50 ng / ml of methotrexate plus 1 pg / ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well pctri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM. 100 nM. 200 nM. 400 nM. 800 nM). Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 inM. 2 mM. 5 mM. 10 mM, 20 mM). The same procedure is repeated until clones are obtained that grow at a concentration of 100 - 200 mM Expression of the desired gene product is analyzed, for instance, by SDS-PAGE and Western blot or by reverse phase HPLC analysis. Example 2: Generation of High Affinity Human IgG Monoclonal Antibodies Reactive With Human TNF Using Transgenic Mice, Summary. Transgenic mice have been used that contain human heavy and light chain immunoglobulin genes to generate high affinity, completely human, monoclonal antibodies that can be used therapeutically to inhibit the action of TNF for the treatment of one or more TNF-mcdiated disease. (CBA / J x C57 / BL6 / J) F? hybrid mice containing human variable and constant region antibody transgcncs for both heavy and light chains are immunized with human recombinant TNF (Tay lor ct al.. Inti. Immunol. 6:579-591 (1993); Lonbcrg. et al„ Nature 368.856-859 (1994). Neuberger. M . Nature Biotech. 14:826 (1996): Fishwild, et al.. Nature Biotechnology 14:845-851 (1996)) Several fusions yielded one or more panels of completely human TNF reactive IgG monoclonal antibodies. The completely human anti-TNF antibodies arc further characterized. All are IgGIk. Such antibodies are found to have affinity constants somewhere between 1x10° and 9xl()li. The unexpectedly high affinities of these fully human monoclonal antibodies make them suitable candidates for therapeutic applications in TNF related diseases, pathologies or disorders 2026253995   16 Oct 2026 Abbreviations. BSA - bovine scrum albumin; CO2 - carbon dioxide; DMSO -dimethyl sulfoxide; El A - enzyme immunoassay; FBS - fetal bovine scrum; H2O2 -hydrogen peroxide; HRP - horseradish peroxidase; ID - interadcrmal; Ig -immunoglobulin: TNF - tissue necrosis factor alpha; IP - intraperitoneal; IV — 5 intravenous; Mab or mAb - monoclonal antibody; OD - optical density; OPD - o-Phenylenediamine dihydrochloride: PEG - polyethylene glycol; PSA - penicillin, streptomycin, amphotericin; RT - room temperature; SQ - subcutaneous; v / v - volume per volume: w / v - weight per volume Materials and Methods 10          Animals. Transgenic mice that can express human antibodies are known in the art (and are commercially available (e.g., from GenPhann International. San Jose. CA; Abgenix. Freemont. CA. and others) that express human immunoglobulins but not mouse IgM or IgK. For example, such transgenic mice contain human sequence transgenes that undergo V(D)J joining, heavy-chain class sw itching, and somatic mutation to generate a 15 repertoire of human sequence immunoglobulins (Lonberg, et al.. Nature 368:856-859 (1994)). The light chain transgenc can be derived, e.g.. in part from a yeast artificial chromosome clone that includes nearly half of the germline human Vk region. In addition, the heavy-chain transgenc can encode both human p and human yl(Fishwild. ct al.. Nature Biotechnology 14:845-851 (1996)) and / ory3 constant regions. Mice derived 20 from appropriate genotypic lineages can be used in the immunization and fusion processes to generate fully human monoclonal antibodies to TNF. Immunization. One or more immunization schedules can be used to generate the anti-TNF human hybridomas. The first several fusions can be performed after the following exemplars immunization protocol, but other similar known protocols can be 25 used. Several 14-20 week old female and / or surgically castrated transgenic male mice arc immunized IP and / or ID with I-1000 pg of recombinant human TNF emulsified with an equal volume of TITERMAX or complete Freund's adjuvant in a final volume of 100-400pL (e.g.. 200). Each mouse can also optionally receive 1-10 pg in 100 pL physiological saline at each of 2 SQ sites. The mice can then be immunized 1-7. 5-12. Ki- 30   18. 17-25 and / or 21-34 days later IP (1-400 pg) and SQ (1-400 pg x 2) with TNF emulsified with an equal volume of TITERMAX or incomplete Freund's adjuvant Mice can be bled 12-25 and 25-40 days later by retro-orbital puncture w ithout anti-coagulant. 2026253995   16 Oct 2026 The blood is then allowed to clot at RT for one hour and the serum is collected and titered using an TNF El A assay according to known methods. Fusions arc performed when repeated injections do not cause titers to increase. At that time, the mice can be given a final IV booster injection of 1-400 pg TNF diluted in 100 pL physiological saline. Three 5 days later, the mice can be euthanized by cervical dislocation and the spleens removed aseptically and immersed in 10 mL of cold phosphate buffered saline (PBS) containing 100 U / mL penicillin. 100 pg / mL streptomycin, and 0.25 pg / mL amphotericin B (PSA). The splcnocytcs are harvested by stcrilely perfusing the spleen with PSA-PBS. The cells are washed once in cold PSA-PBS. counted using Try pan blue dye exclusion and 10 resuspended in RPMI 1640 media containing 25 mM Hepes. Cell Fusion. Fusion can be carried out at a 1:1 to 110 ratio of murine myeloma cells to viable spleen cells according to known methods, e g., as known in the art. As a non-limiting example, spleen cells and myeloma cells can be pelleted together. The pellet can then be slowly resuspended, over 30 seconds, in 1 mL of 50% (w / v) PEG / PBS 15 solution (PEG molecular weight 1.450. Sigma) at 37 C. The fusion can then be stopped by slowly adding 10.5 mL of RPMI 1640 medium containing 25 mM Hepes (37 C) over 1 minute. The fused cells arc centrifuged for 5 minutes at 500-1500 rpm. The cells arc then resuspended in HAT medium (RPMI 1640 medium containing 25 mM Hepes. 10% Fetal Clone I serum (Hyclonc). I mM sodium pyruvate. 4 mM L-glutamine. 10 pg / mL 20 gentamicin. 2.5% Origen culturing supplement (Fisher). 10% 653-conditioned RPMI 1640 / Hcpcs media, 50 pM 2-mcrcaptoethanol. 100 pM hypoxanthine, 0.4 pM aminopterin, and 16 pM thymidine) and then plated at 200 pL / wcll in fifteen 96-well flat bottom tissue culture plates. The plates arc then placed in a humidified 37 C incubator containing 5% CO: and 95% air for 7-10 days. 25          Detection of Human IgG Anti-TNF Antibodies in Mouse Serum. Solid phase EIAs can be used to screen mouse sera for human IgG antibodies specific for human TNF. Briefly, plates can be coated with TNF at 2 pg / mL in PBS overnight. After washing in 0.15M saline containing 0.02% (v / v) Tween 20. the wells can be blocked with 1% (w / v) BSA in PBS. 200 pL / wcll for 1 hour at RT Plates arc used immediately or frozen 30 at -20 C for future use. Mouse serum dilutions are incubated on the TNF coated plates at 50 pL / well at RT for 1 hour. The plates arc washed and then probed w ith 50 pL / wcll HRP-labcled goat anti-human IgG. Fc specific diluted 1:30,000 in 1% BSA-PBS for I hour at RT The plates can again be washed and 100 pL / well of the citrate-phosphate 2026253995   16 Oct 2026 substrate solution (0.IM citric acid and 0.2M sodium phosphate. 0.01% H2O2 and I mg / mL OPD) is added for 15 minutes at RT Stop solution (4N sulfuric acid) is then added at 25 pL / well and the OD's arc read at 490 nm via an automated plate spectrophotometer. 5         Detection of Completely Human Immunoglobulins in Hybridoma Supernates. Growth positive hybridomas secreting fully human immunoglobulins can be detected using a suitable EIA. Briefly. 96 well pop-out plates (VWR. 610744) can be coated witli 10 pg / mL goat anti-human IgG Fc in sodium carbonate buffer overnight at 4 C. The plates arc w ashed and blocked w ith 1% BSA-PBS for one hour at 37°C and used 10 immediately or frozen at -20 C Undiluted hybridoma supernatants are incubated on the plates for one hour at 37°C. The plates arc washed and probed with HRP labeled goat anti-human kappa diluted 1:10.000 in 1 % BSA-PBS for one hour at 37°C The plates arc then incubated with substrate solution as described above. Determination of Fully Human Anti-TNF Reactivity. Hybridomas. as above. 15 can be simultaneously assayed for reactivity to TNF using a suitable RIA or other assay For example, supernatants arc incubated on goat anti-human IgG Fc plates as above, washed and then probed witli radiolabled TNF w ith appropriate counts per well for 1 hour at RT. The wells arc washed twice witli PBS and bound radiolabled TNF is quantitated using a suitable counter. 20          Human IgGIk anti-TNF secreting hybridomas can be expanded in cell culture and serially subcloncd by limiting dilution The resulting clonal populations can be expanded and cryoprcscrved in freezing medium (95% FBS. 5% DMSO) and stored in liquid nitrogen. Isotyping. Isoty pe determination of the antibodies can be accomplished using an 25 EIA in a format similar to that used to screen the mouse immune sera for specific titers TNF can be coated on 96- well plates as described above and purified antibody at 2 pg / mL can be incubated on the plate for one hour at RT. The plate is w ashed and probed with HRP labeled goat anti-human IgGi or HRP labeled goat anti-human IgG. diluted at 1:4000 in 1% BSA-PBS for one hour at RT. The plate is again washed and incubated with 30 substrate solution as described above. Binding Kinetics of Human Anti-Human TNF Antibodies With Human TNF. Binding characteristics for antibodies can be suitably assessed using an TNF capture EIA 2026253995   16 Oct 2026 and BIAcore technology, for example. Graded concentrations of purified human TNF antibodies can be assessed for binding to EIA plates coated with 2 pg / mL of TNF in assays as described above. The OD's can be then presented as semi-log plots showing relative binding efficiencies. 5           Quantitative binding constants can be obtained, e g., as follows, or by any other known suitable method. A BIAcore CM-5 (carboxymethyl) chip is placed in a BIAcore 2000 unit. HBS buffer (0.01 M HEPES. 0.15 M NaCL 3 mM EDTA. 0.005% v / v P20 surfactant. pH 7.4) is flowed over a flow cell of the chip at 5 pL / minute until a stable baseline is obtained. A solution (100 pL) of 15 mg of EDC 10 (N-ethyl-N’-(3-dimcthyl-aminopropyl)-carbodiimidc hydrochloride) in 200 pL water is added to 100 pL of a solution of 2.3 mg of NHS (N-hydroxysuccinimide) in 200 pL w ater. Forty (40) pL of the resulting solution is injected onto the chip. Six pL of a solution of human TNF (15 pg / mL in 10 mM sodium acetate. pH 4.8) is injected onto the chip, resulting in an increase of ca. 500 RU. The buffer is changed to TBS / Ca / Mg / BSA 15 running buffer (20 mM Tris. 0.15 M sodium chloride. 2 mM calcium chloride. 2 mM magnesium acetate. 0.5% Triton X-100. 25 pg / mL BSA. pH 7.4) and flow ed over the chip overnight to equilibrate it and to hydrolyze or cap any unreacted succinimide esters. Antibodies arc dissolved in the running buffer at 33.33. 16.67. 8.33. and 4.17 nM The flow rate is adjusted to 30 pL / min and the instrument temperature to 25 C Two 20 flow cells are used for the kinetic runs, one on which TNF had been immobilized (sample) and a second, undcnvatized flow cell (blank). 120 pL of each antibody concentration is injected over the flow cells at 30 pL / min (association phase) followed by an uninterrupted 360 seconds of buffer flow (dissociation phase). The surface of the chip is regenerated (tissue necrosis factor alpha / antibody complex dissociated) by two 25   sequential injections of 30 pL each of 2 M guanidine thiocy anate. Analysis of the data is done using BIA evaluation 3.0 or CLAMP 2.0. as known in the art. For each antibody concentration the blank sensogram is subtracted from the sample sensogram. A global fit is done for both dissociation (kd.scc1) and association (ka, mol’1 see"1) and the dissociation constant (Kd, mol) calculated (kd / ka). Where the antibodv 30 affinity is high enough that the RUs of antibody captured are >100. additional dilutions of the antibody arc run. 2026253995   16 Oct 2026 Results and Discussion Generation of Anti-Human TNF Monoclonal Antibodies. Several fusions are performed, and each fusion is seeded in 15 plates (1440 wells / fusion) that yield several dozen antibodies specific for human TNF. Of these, some are found to consist of a combination of human and mouse Ig chains. The remaining hybridomas secret anti-TNF antibodies consisting solely of human heavy and light chains. Of the human hybridomas all are expected to be IgGlK. Binding Kinetics of Human Anti-Human TNF Antibodies. ELISA analysis confirms that purified antibody from most or all of these hybridomas bind TNF in a concentration-dependent manner, Fig. I and Fig. 2 show the results of the relative binding efficiency of these antibodies. In this case, the avidity of the antibody for its cognate antigen (epitope) is measured. It should be noted that binding TNF directly to the E1A plate can cause denaturation of the protein and the apparent binding affinities cannot be reflective of binding to undenatured protein Fifty percent binding is found over a range of concentrations. Quantitative binding constants are obtained using BIAcore analysis of the human antibodies and reveals that several of the human monoclonal antibodies are ven high affinity with Kd in the range of lxl0"Q to 7x| 0'12 Conclusions. Sc\ cral fusions arc performed utilizing splcnocytcs from hybrid mice containing human variable and constant region antibody transgenes that are immunized with human TNF. A set of several completely human TNF reactive IgG monoclonal antibodies of the IgGlK isotype were generated. The completely human anti-TNF antibodies are further characterized. Several of generated antibodies have affinity constants between IxlO9 and 9x1012 The unexpectedly high affinities of these fully human monoclonal antibodies make them suitable for therapeutic applications in TNF-dcpendcnt diseases, pathologies or related conditions. Example 3: Generation of Human IgG Monoclonal Antibodies Reactive to Human TNFa. Summary. (CBA / J x C57BL / 6J) F? hy brid mice (1-4) containing human variable and constant region antibody transgcncs for both heavy and light chains were immunized 2026253995   16 Oct 2026 with recombinant human TNFa One fusion, named GenTNV. yielded eight totally human IgG I k monoclonal antibodies that bind to immobilized recombinant human TNFa. Shortly after identification, the eight cell lines were transferred to Molecular Biology for further characterization. As these Mabs arc totally human in sequence, they 5 are expected to be less immunogenic than cA2 (Remicade) in humans. Abbreviations. BSA - bovine scrum albumin; CO? - carbon dioxide; DMSO -dimethyl sulfoxide; EIA - enzyme immunoassay; FBS - fetal bovine serum; H?O? -hydrogen peroxide; HC - heavy chain; HRP - horseradish peroxidase; ID - interadcrmal. Ig - immunoglobulin; TNF - tissue necrosis factor alpha; IP - intraperitoneal; IV - 10 intravenous; Mab - monoclonal antibody; OD - optical density; OPD - o-Phcny lenediaminc dihydrochloride; PEG - polyethylene glycol; PSA - penicillin, streptomycin, amphotericin; RT - room temperature; SQ - subcutaneous; TNFa - tumor necrosis factor alpha ; v / v - volume per volume; w / v - weight per volume. Introduction. Transgenic mice that contain human heavy and light chain 15 immunoglobulin genes were utilized to generate totally human monoclonal antibodies that arc specific to recombinant human TNFa It is hoped that these unique antibodies can be used, as cA2 (Remicade) is used to therapeutically inhibit the inflammatory processes involved in TNFa-mediated disease with the benefit of increased serum half-life and decreased side effects relating to immunogenicity. 20           As defined herein, the term " half-life" indicates that the plasma concentration of a drug (c.g.. a therapeutic anti-TNFa antibody) is halved after one elimination half-life. Therefore, in each succeeding half-life, less drug is eliminated. After one half-life the amount of drug remaining in the body is 50% after two half-lives 25%, etc The half-life of a drug depends on its clearance and volume of distribution. The elimination half-life is 25 considered to be independent of the amount of drug in the body. Materials and Methods. Animals. Transgenic mice that express human immunoglobulins, but not mouse IgM or IgK, have been developed by GenPharm International. These mice contain functional human antibody transgenes that undergo V(D)Jjoining, heavy-chain class 30 switching and somatic mutation to generate a repertoire of antigen-specific human immunoglobulins (I) The light chain transgenes are derived in part from a y east artificial chromosome clone that includes nearly half of the germline human Vk locus. In addition 2026253995   16 Oct 2026 to several VH genes, the heavy -chain (HC) transgenc encodes both human p and human yl (2) and / or y3 constant regions. A mouse derived from the HCol2 / KCo5 genotypic lineage was used in the immunization and fusion process to generate the monoclonal antibodies described here. 5          Purification of Human TNFa. Human TNFa was purified from tissue culture supernatant from C237A cells by affinity chromatography using a column packed with the TNFa reccptor-Fc fusion protein (p55-sf2) (5) coupled to Sepharose 4B (Pharmacia). The cell supernatant was mixed with one-ninth its volume of lOx Dulbccco’s PBS (D-PBS) and passed through the column at 4 0 C at 4 mL / min The column was then washed 10 with PBS and the TNFa was eluted with 0.1 M sodium citrate. pH 3.5 and neutralized with 2 M Tris-HCI pH 8.5. The purified TNFa was buffer exchanged into 10 mM Tris. 0.12 M sodium chloride pH 7.5 and filtered through a 0.2 um syringe filter. Immunizations. A female GcnPharm mouse, approximately 16 weeks old. was immunized IP (200 pL) and ID (100 pL at the base of the tail) w ith a total of 100 pg of 15 TNFa (lot JG102298 or JG102098) emulsified with an equal volume of Titermax adjuvant on days 0. 12 and 28. The mouse was bled on days 21 and 35 by retro-orbital puncture without anti-coagulant. The blood was allowed to clot at RT for one hour and the serum was collected and titered using TNFa solid phase EIA assay. The fusion, named GcnTN V. was performed after the mouse was allowed to rest for seven weeks 20 follow ing injection on day 28. The mouse, with a specific human IgG titer of 1:160 against TNFa. was then given a final IV booster injection of 50 pg TNFa diluted in 100 pL physiological saline. Three days later, the mouse was euthanized by cervical dislocation and the spleen was removed aseptically and immersed in 10 mL of cold phosphatc-buftcrcd saline (PBS) containing 100 U / mL penicillin. 100 pg / mL 25 streptomycin, and 0.25 pg / mL amphotericin B (PSA). The splcnocytes were harvested by sterilely perfusing the spleen with PSA-PBS. The cells were washed once in cold PSA-PBS. counted using a Coulter counter and resuspended in RPMI 1640 media containing 25 mM Hopes. Cell Lines The non-secreting mouse myeloma fusion partner. 653 was received 30 into Cell Biology Sen ices (CBS) group on 5-14-97 from Centocor's Product Development group. The cell line was expanded in RPMI medium (JRH Bioscicnccs) supplemented with 10% (v / v) FBS (Cell Culture Labs). 1 mM sodium pyruvate. 0.1 mM NEAA. 2 mM L-glutamine (all from JRH Biosciences) and cryopreserved in 95% FBS 2026253995   16 Oct 2026 and 5% DMSO (Sigma), then stored in a vapor phase liquid nitrogen freezer in CBS. The cell bank was sterile (Quality Control Centocor. Malvern) and free of mycoplasma (Bionique Laboratories). Cells were maintained in log phase culture until fusion. They were washed in PBS. counted, and viability determined (>95%) via trypan blue dye 5 exclusion prior to fusion. Human TNFa was produced by a recombinant cell line, named C237A. generated in Molecular Biology at Centocor The cell line was expanded in IMDM medium (JRH Bioscienccs) supplemented with 5% (v / v) FBS (Cell Culture Labs). 2 mM L-glutaminc (all from JRH Biosciences), and 0.5 :g / mL mycophenolic acid, and cryopreserved in 95% 10 FBS and 5% DMSO (Sigma), then stored in a vapor phase liquid nitrogen freezer in CBS (13). The cell bank was sterile (Quality Control Centocor. Malvern) and free of mycoplasma (Bionique Laboratories). Cell Fusion The cell fusion was carried out using a 1:1 ratio of 653 murine myeloma cells and viable murine spleen cells. Briefly, spleen cells and myeloma cells 15 were pelleted together. The pellet was slowly resuspended over a 30 second period in 1 mL of 50% (w / v) PEG / PBS solution (PEG molecular weight of 1.450 g / molc. Sigma) at 37°C. The fusion was stopped by slowly adding 10.5 mL of RPMI media (no additives) (JRH) (37°C) over I minute. The fused cells were centrifuged for 5 minutes at 750 rpm The cells were then resuspended in HAT medium (RPMI / HEPES medium containing 20   10% Fetal Bovine Scrum (JRH). 1 mM sodium pyruvate. 2 mM L-glutaminc. 10 pg / mL gentamicin. 2.5% Origen culturing supplement (Fisher). 50 pM 2-mercaptoethanol. 1% 653-conditioncd RPMI media. 100 pM hypoxanthine. 0.4 pM aminoptcrin. and 16 pM thymidine) and then plated at 200 pL / well in five 96-well flat bottom tissue culture plates The plates were then placed in a humidified 37°C incubator containing 5% COi and 95% 25 air for 7-10 days. Detection of Human IgG Anti-TNFa Antibodies in Mouse Scrum. Solid phase EIAs were used to screen mouse sera for human IgG antibodies specific for human TNFa Briefly, plates were coated with TNFa at 1 pg / mL in PBS overnight. After washing in 0 15 M saline containing 0.02% (v / v) Tween 20. the wells were blocked with 1% (w / v) 30 BSA in PBS. 200 pL / well for 1 hour at RT. Plates were either used immediately or frozen at -20 °C for future use. Mouse sera were incubated in two-fold serial dilutions on the human TNFa-coatcd plates at 50 pL / well at RT for 1 hour The plates were washed and then probed with 50 pL / well HRP-labeled goat anti-human IgG. Fc specific (Accurate) 2026253995   16 Oct 2026 diluted 1:30.000 in 1% BSA-PBS for 1 hour at RT The plates were again washed and 100 pL / well of the citratc-phosphatc substrate solution (0.1 M citric acid and 0.2 M sodium phosphate. 0.01% H2O? and 1 nig / mL OPD) was added for 15 minutes at RT. Stop solution (4N sulfuric acid) was then added at 25 pL / well and the OD's were read at 5   490 nm using an automated plate spectrophotometer. Detection of Totally Human Immunoglobulins in Hybridoma Supernatants. Because the GenPharm mouse is capable of generating both mouse and human immunoglobulin chains, two separate E1A assays were used to test growth-positive hybridoma clones for the presence of both human light chains and human heavy chains 10 Plates were coated as described above and undiluted hybridoma supernatants were incubated on the plates for one hour at 37°C. The plates w ere washed and probed w ith cither HRP-conjugatcd goat anti-human kappa (Southern Biotech) antibody diluted 1:10.000 in 1% BSA-HBSS or HRP-conjugatcd goat anti-human IgG Fc specific antibody diluted to 1:30.000 in 1% BSA-HBSS for one hour at 37°C. The plates were then 15 incubated w ith substrate solution as described above. Hybridoma clones that did not give a positive signal in both the anti-human kappa and anti-human IgG Fc EIA formats were discarded. Isotyping. Isotypc determination of the antibodies was accomplished using an EIA in a format similar to that used to screen the mouse immune sera for specific titers. EIA 20 plates were coated with goat anti-human IgG (H+L) at 10 :g / mL in sodium carbonate buffer overnight at 4EC and blocked as described above. Neat supernatants from 24 well cultures were incubated on the plate for one hour at RT The plate was w ashed and probed w ith HRP-labcled goat anti-human IgGi. IgGi. IgG? or IgG? (Binding Site) diluted at I 4000 in 1% BSA-PBS for one hour at RT. The plate was again washed and incubated 25 w ith substrate solution as described above. Results and Discussion. Generation of Totally Human Anti-Human TNFa Monoclonal Antibodies. One fusion, named GcnTNV. was perfonned from a GenPharm mouse immunized with recombinant human TNFa protein. From this fusion. 196 growthpositive hybrids were screened. Eight hybridoma cell lines were identified that secreted 30 totally human IgG antibodies reactive with human TNFa, These eight cell lines each secreted immunoglobulins of the human IgG 1 k isotypc and all w ere subcloncd twice by limiting dilution to obtain stable cell lines (>90% homogeneous). Cell line names and 2026253995   16 Oct 2026 respective C code designations arc listed in Table 1. Each of the cell lines was frozen in 12-vial research cell banks stored in liquid nitrogen. Parental cells collected from wells of a 24-well culture dish for each of the eight cell lines were handed over to Molecular Biology group on 2-18-99 for transfection and 5 further characterization. Table 1: Gen TN V Cell Line Designations Name C Code Designation GenTN V14.17.12 C414A GenTNV15.28.ll C4I5A GenTN V32.2.16 C4I6A GenTN V86.14.34 C417A GenTNVl 18.3.36 C418A GenTN VI 22.23.2 C4I9A GenTNV 148.26.12 C420A GenTNV196.9.1 C421A Conclusion. The GenTNV fusion was performed utilizing splcnocytes from a hybrid mouse 10 containing human variable and constant region antibody transgenes that was immunized w ith recombinant human TNFa prepared at Centocor. Eight totally human. TNFa-reactive IgG monoclonal antibodies of the IgGlK isotype w ere generated Parental cell lines were transferred to Molecular Biolog) group for further characterization and development One of these new human antibodies may prove useful in anti-inflammatory 15 w ith the potential benefit of decreased immunogenicity and allergic-type complications as compared w ith Remicade. References: Taylor, et al... International Immunology 6:579-591 (1993) 2026253995   16 Oct 2026 Lonbcrg. et al.. Nature 368:856-859 (1994). Neuberger. M. Nature Biotechnology 14:826 (1996). Fishwild. etal.. Nature Biotechnology 14:845-851 (1996) Scallon. etal.. Cytokine 7:759-770 (1995) 5 Example 4: Cloning and Preparation of Cell Lines Expressing Human anti-TNFa antibody. Summan A panel of eight human monoclonal antibodies (m Abs) with a TNV designation were found to bind immobilized human TNFa with apparently high avidity. Seven of the eight mAbs were shown to efficiently block huTNFa binding to a 10 recombinant TNF receptor. Sequence analysis of the DNA encoding the seven mAbs confirmed that all the mAbs had human V regions. The DNA sequences also revealed that three pairs of the mAbs were identical to each other, such that the original panel of eight mAbs contained only four distinct mAbs. represented by TNV 14. TNV 15. TNV 148. and TNV 196. Based on analyses of the deduced amino acid sequences of the mAbs and 15 results of in vitro TNFa neutralization data. mAb TNV 148 and TNV 14 were selected for further study. Because the proline residue at position 75 (framework 3) in the TNV148 heavy chain was not found at that position in other human antibodies of the same subgroup during a database search, site-directed DNA mutagenesis was performed to encode a 20 serine residue at that position in order to have it conform to known gcrmlinc framew ork e sequences The serine modified mAb was designated TNV148B PCR-amplificd DNA encoding the heavy and light chain vanable regions of TNV 148B and TNV 14 was cloned into newly prepared expression vectors that were based on the recently cloned heavy and light chain genes of another human mAb (12B75). disclosed in US patent application No. 25   60 / 236,827. filed October 7. 2000. entitled IL-12 Antibodies. Compositions. Methods and Uses, published as WO 02 / 12500which is entirely incorporated herein by reference. P3X63Ag8.653 (653) cells or Sp2 / 0-Agl4 (Sp2 / 0) mouse myeloma cells were transfected w ith the respective heavy and light chain expression plasmids and screened through two rounds of subcloning for cell lines producing high levels of recombinant 30 TNV148B and TNV 14 (rTNVI48B and rTNVI4) mAbs. Evaluations of growth curves and stability of mAb production over time indicated that 653-transfectant clones C466D 2026253995   16 Oct 2026 and C466C stably produced approximately 125 :g / ml of rTNVI48B mAb in spent cultures whereas Sp2 / 0 transfcctant 1.73-12-122 (C467A) stably produced approximately 25 :g / ml of rTNV148B mAb in spent cultures. Similar analyses indicated that Sp2 / O-transfectant clone C476A produced 18 :g / ml of rTNV14 in spent cultures. 5          Introduction. A panel of eight mAbs derived from human TNFa-immunizcd GcnPharm / Mcdarcx mice (HCol2 / KCo5 genotype) were previously shown to bind human TNFa and to have a totally human IgG 1. kappa isotype. A simple binding assay was used to determine whether the exemplary mAbs of the invention were likely to have TNFa-ncutralizing activity by evaluating their ability to block TNFa from binding to 10 recombinant TNF receptor Based on those results. DNA sequence results, and in vitro characterizations of several of the mAbs. TNV148 was selected as tine mAb to be further characterized DNA sequences encoding the TNV148 mAb were cloned, modified to fit into gene expression vectors that encode suitable constant regions, introduced into the well- 15 characterized 653 and Sp2 / 0 mouse myeloma cells, and resulting transfected cell lines screened until subclones were identified that produced 40-fold more mAb than tine original hybridoma cell line Materials and Methods. Reagents and Cells. TRIZOL reagent was purchased from Gibco BRL 20 Proteinase K was obtained from Sigma Chemical Company Reverse Transcriptase was obtained from Life Sciences, Inc. Taq DNA Polymerase was obtained from either Perkin Elmer Cetus or Gibco BRL Restriction enzymes were purchased from New England Biolabs QIAquick PCR Purification Kit was from Qiagen A QuikChangc Site-Directed Mutagenesis Kit was purchased from Stratagenc. Wizard plasmid miniprcp kits and 25 RNasin were from Promcga. Optiplates were obtained from Packard. 125lodine was purchased from Amcrsham. Custom oligonucleotides were purchased from Kcystone / Biosource International. The names, identification numbers, and sequences of the oligonucleotides used in this work are shown in Table 2. Table 2. Oligonucleotides used to clone, engineer, or sequence the TNV mAb genes. 30          The amino acids encoded by oligonucleotide 5' 14s and HuH-J6 arc shown above the sequence. The 'M' amino acid residue represents the translation start codon. The underlined sequences in oligonucleotides 5'14s and HuH-J6 mark the BsiWI and BstBl 2026253995   16 Oct 2026 restriction sites, respectively. The slash in HuH-J6 corresponds to the exon / intron boundary. Note that oligonucleotides whose sequence corresponds to the minus strand arc written in a 3-5'orientation Name ID ___________________Sequence___________ HGl-4b 119 3'-TTGGTCCAGTCGGACTGG-5' (SEQ ID NO: 10) HGl-5b 354 3-CACCTGCACTCGGTGCTT-5' (SEQ IDNO 11) HGIhg 360 3'-CACTGTTTTGAGTGTGTACGGGCTTAAGTT-5' (SEQ ID NO: 12) HG1-6 35 3'-GCCGCACGTGTGGAAGGG-5' (SEQ ID NO: 13) HCKI-3E 117 3'-AGTCAAGGTCGGACTGGCTTAAGTT-5’ (SEQ ID NO: 14) HuK-3'Hd 208 3'-GTTGTCCCCTCTCACAATCTTCGAATTT-5' (SEQ ID NO: 15) HVKRNAscq 34 3'-GGCGGTAGACTACTCGTC-5' (SEQ IDNO 16) BsiWl M D W T W S I (SEQ IDNO 17) 5'14s 366 5-TTTCGTACGCCACCATGGACTGGACCTGGAGCATC-3' (SEQ ID NO: 18) 5'46s 367 5'-TTTCGTACGCCACCATGGGGTTTGGGCTGAGCTG-3' (SEQ IDNO 19) 5'47s 368 5'-TTTCGTACGCCACCATGGAGTTTGGGCTGAGCATG-3' (SEQIDNO20) 5'63s 369 5'-TTTCGTACGCCACCATGAAACACCTGTGGTTCTTC-3' (SEQ IDNO 2I) 5'73s 370 5-TTTCGTACGCCACCATGGGGTCAACCGCCATCCTC-3' (SEQ IDNO 22) BstBI T V T V S (SEQ ID NO:23) HuH-J6 388 3'GTGCCAGTGGCAGAGGAGTCCATTCAAGCTTAAGTT-5' (SEQ IDNO24) Sall M D M R V (SEQ ID NO:25) 2026253995   16 Oct 2026 LK7s 362 5'-TTTGTCGACACCATGGACATGAGGGTCC(TC)C-3, (SEQ IDNO 26) LVgs 363 5’-TTTGTCGACACCATGGAAGCCCCAGCTC-3' (SEQIDNO27) Afl2 T K V D 1 K (SEQIDNO:28) HuL-J3 380 3’CTGGTTTCACCTATAGTTTG / CATTCAGAATTCGGCGCCTTT (SEQIDNO29) V148-QCI 399 5'-CATCTCCAGAGACAATtCCAAGAACACGCTGTATC-3' (SEQ IDNO 30) VI48-QC2 400 3'-GTAGAGGTCTCTGTTAaGGTTCTTGTGCGACATAG-5' (SEQIDNO3I) A single frozen vial of 653 mouse myeloma cells was obtained. The vial was thawed that day and expanded in T flasks in IM DM. 5% FBS. 2 mM glutamine (media) These cells were maintained in continuous culture until they were transfected 2 to 3 5 weeks later with the anti-TNF DNA described here. Some of the cultures were harvested 5 days after the thaw date, pelleted by centrifugation, and resuspended in 95% FBS. 5% DMSO. aliquoted into 30 vials, frozen, and stored for future use. Similarly, a single frozen vial of Sp2 / 0 mouse myeloma cells was obtained. The vial was thawed, a new freeze-down prepared as described above, and the frozen vials stored in CBC freezer 10 boxes AA and AB These cells were thawed and used for all Sp2 / 0 transfections described here. Assay for Inhibition of TNF Binding to Receptor. Hybridoma cell supernatants containing the TN V mAbs were used to assay for the ability' of the mAbs to block binding of l25l-labeled TNFa to the recombinant TNF receptor fusion protein. p55-sf2 (Scallon ct 15 al. (1995) Cytokine 7:759-770). 50:1 ofp55-sf2 at 0.5 :g / ml in PBS was added to Optiplates to coat the w ells during a one-hour incubation at 37°C. Serial dilutions of the eight TNV cell supernatants were prepared in 96-wcll roimd-bottom plates using PBS / 0.1% BSA as diluent. Cell supernatant containing anti-IL-18 mAb was included as a negative control and the same anti-IL-18 supernatant spiked with cA2 (anti-TNF chimcnc 20 antibody. Remicade. US patent No. 5.770,198, entirely incorporated herein by reference) was included as a positive control. nsI-labeled TNFa (58 :Ci / :g. D Shealy) was added to 100 :1 of cell supernatants to have a final TNFa concentration of 5 ng / ml. The mixture 2026253995   16 Oct 2026 was preincubated for one hour at RT. The coated Optiplates were washed to remove unbound p55-sf2 and 50 :1 of the 135I-TNFa / cel] supernatant mixture was transferred to the Optiplates. After 2 hrs at RT. Optiplates were washed three times with PBS-Tween 100 :1 of Microscint-20 w as added and the cpm bound determined using the TopCount 5 gamma counter. Amplification of V Genes and DNA Sequence Analysis. Hybridoma cells were washed once in PBS before addition of TRIZOL reagent for RNA preparation Between 7 X 106 and 1.7 X 107 cells were resuspended in 1 ml TRIZOL. Tubes were shaken vigorously after addition of 200 pl of chloroform. Samples w ere centrifuged at 4°C for 10 10 minutes. The aqueous phase was transferred to a fresh microftige tube and an equal volume of isopropanol was added Tubes were shaken vigorously and allowed to incubate at room temperature for 10 minutes. Samples were then centrifuged at 4°C for 10 minutes The pellets were washed once with 1 ml of 70% ethanol and dried briefly in a vacuum dryer. The RNA pellets were resuspended with 40 pl of DEPC-treatcd watcr. The 15 quality of the RNA preparations was determined by fractionating 0.5 pl in a 1% agarose gel The RNA was stored in a-80°C freezer until used. To prepare heavy and light chain cDNAs. mixtures were prepared that included 3 pl of RNA and 1 pg of either oligonucleotide 119 (heavy chain) or oligonucleotide 117 (light chain) (see Table 1) in a volume of 11.5 pl. The mixture was incubated at 70°C for 20    10 minutes in a water bath and then chilled on ice for 10 minutes. A separate mixture was prepared that was made up of 2.5 pl of 10X reverse transcriptase buffer. 10 pl of 2.5 mM dNTPs. I pl of reverse transcriptase (20 units), and 0.4 pl of ribonuclease inhibitor RNasin (1 unit). 13.5 pl of this mixture w as added to the 11.5 pl of the chilled RNA / oligonucleotidc mixture and the reaction incubated for 40 minutes at 42°C The 25 cDNA synthesis reaction was then stored in a -20°C freezer until used. The unpurified heavy and light chain cDNAs were used as templates to PCR-amplify die variable region coding sequences. Five oligonucleotide pairs (366 / 354. 367 / 354. 368 / 354. 369 / 354. and 370 / 354. Table 1) were simultaneously tested fortheir ability to prime amplification of the heavy chain DNA Two oligonucleotide pairs 30   (362 / 208 and 363 / 208) were simultaneously' tested for their ability to prime amplification of the light chain DNA PCR reactions were carried out using 2 units of PLATINUM 1M high fidelity (HI Fl) Taq DNA polymerase in a total volume of 50 pl. Each reaction 2026253995   16 Oct 2026 included 2 pl of a eDNA reaction, 10 pmoles of each oligonucleotide. 0.2 mM dNTPs. 5 pl of 10 X HIFI Buffer, and 2 mM magnesium sulfate The thermal cycler program was 95°C for 5 minutes followed by 30 cycles of (94°C for 30 seconds. 62°C for 30 seconds. 68°C for 1.5 minutes). There was then a final incubation at 68°C for 10 minutes. 5          To prepare the PCR products for direct DNA sequencing, they were purified using the QIAquick™ PCR Purification Kit according to the manufacturer's protocol The DNA was eluted from the spin column using 50 pl of sterile water and then dried down to a volume of 10 pl using a vacuum dryer DNA sequencing reactions were then set up with I pl of purified PCR product. 10 pM oligonucleotide primer. 4 pl BigDye Terminator™ 10 ready reaction mix. and 14 pl sterile water for a total volume of 20 pl Heavy chain PCR products made with oligonucleotide pair 367 / 354 were sequenced with oligonucleotide primers 159 and 360. Light chain PCR products made with oligonucleotide pair 363 / 208 were sequenced with oligonucleotides 34 and 163. The thermal cycler program for sequencing was 25 cycles of (96°C for 30 seconds. 50°C for 15 seconds. 60°C for 4 15 minutes) followed by overnight at 4°C. The reaction products were fractionated through a polyacrylamide gel and detected using an ABI 377 DNA Sequencer. Site-directed Mutagenesis to Change an Amino Acid A single nucleotide in the TN V148 heavy chain variable region DNA sequence was changed in order to replace Pro75 with a Serine residue in the TNV 148 mAb. Complimentary oligonucleotides, 399 20 and 400 (Table I). were designed and ordered to make this change using the QuikChange™ site-directed mutagenesis method as described by the manufacturer. The two oligonucleotides were first fractionated through a 15% polyacrylamide gel and the major bands purified. Mutagenesis reactions were prepared using either 10 ng or 50 ng of TNV 148 heavy chain plasmid template (pl753). 5 pl of 10X reaction buffer, 1 pl of 25 dNTP mix, 125 ng of primer 399. <25 ng of primer 400. and I pl of Pfu DNA Polymerase. Sterile water was added to bring the total volume to 50 pl The reaction mix was then incubated in a thermal cycler programmed to incubate at 95°C for 30 seconds, and then cycle 14 times with sequential incubations of 95°C for 30 seconds, 55°C for 1 minute. 64°C for 1 minute, and 68°C for 7 minutes, followed by 30°C for 2 minutes (I 30 cycle). These reactions were designed to incorporate the mutagenic oligonucleotides into otherwise identical, newly synthesized plasmids. To rid of the original TNV 148 plasmids, samples were incubated at 37°C for 1 hour after addition of 1 pl of Dpnl endonuclease. 2026253995   16 Oct 2026 which cleaves only the original methylated plasmid. One pl of the reaction was then used to transform Epicurian Coli XL 1-Blue supcrcompctcnt E. coli by standard heat-shock methods and transformed bacteria identified after plating on LB-ampicillin agar plates. Plasmid minipreps were prepared using the Wizard™ kits as described by the 5 manufacturer. After elution of sample from the Wizard™ column, plasmid DNA was precipitated with ethanol to further purify the plasmid DNA and then resuspended in 20 pl of sterile water DNA sequence analysis was then performed to identify plasmid clones that had the desired base change and to confirm that no other base changes were inadvertently introduced into the TNV148 coding sequence. One pl of plasmid was 10 subjected to a cycle sequencing reaction prepared with 3 pl of BigDyc mix. I pl of pUC 19 Forward primer, and 10 pl of sterile water using the same parameters described in Section 4.3. Constreiction of Expression Vectors from 12B75 Genes. Several recombinant DNA steps were performed to prepare a new human IgG I expression vector and a new 15 human kappa expression vector from the previously-cloned genomic copies of the 12B 75-encoding heavy and light chain genes, respectively, disclosed in US patent application No. 60 / 236.827. filed October 7. 2000. entitled 1L-12 Antibodies. Compositions. Methods and Uses.-publishcd as WO 02 / 12500. which is entirely incorporated herein b\ reference. The final vectors were designed to pennit simple, one-step replacement of the existing 20 variable region sequences with any appropriately-designed. PCR-amplificd. variable region. To modify the 12B75 heavy chain gene in plasmid pl560. a 6.85 kb BamHI / Hindlll fragment containing the promoter and variable region was transferred from pl 560 to pUC19 to make pl 743. The smaller size of this plasmid compared to 25   p!560 enabled use of QuikChange™ mutagenesis (using oligonucleotides BsiWI-1 and BsiWl-2) to introduce a unique BsiWl cloning site just upstream of the translation initiation site, following the manufacturer's protocol. The resulting plasmid was termed p 1747 To introduce a BstBI site at the 3' end of the variable region, a 5' oligonucleotide primer was designed w ith Sall and BstBI sites. Tins primer was used with the pUC 30 reverse primer to amplify a 2 75 kb fragment from pl747. This fragment was then cloned back into the naturally-occurring Sall site in the I2B75 variable region and a Hindlll site, thereby introducing the unique BstBI site. The resulting intermediate vector, designated pl750. could accept variable region fragments with BsiWl and BstBI ends To prepare a 2026253995   16 Oct 2026 version of heavy chain vector in which the constant region also derived from the 12B75 gene, the BainHI-Hindlll insert in p 1750 was transferred to pBR322 in order to have an EcoRI site downstream of the HmdIII site Tire resulting plasmid, pl768, was then digested with Hindlll and EcoRI and ligated to a 5.7 kb Hindlll-EcoRl fragment from 5 p 1744. a subclone derived by cloning the large BamHl-BamHI fragment from p 1560 into pBC Tire resulting plasmid, pl 784. was then used as vector for tire TNV Ab eDNA fragments with BsiWl and BstBI ends. Additional work was done to prepare expression vectors, pl788 and pl798. which include the IgGI constant region from the 12B75 gene and differ from each other by how much of the 12B75 heavy chain J-C intron they 10 contain To modify the 12B75 light chain gene in plasmid pl558, a 5.7 kb Sall / AfllI fragment containing the I2B75 promoter and variable region was transferred from pl558 into the Xhol / Afl 11 sites of plasmid L28 This new plasmid, pl 745. provided a smaller template for the mutagenesis step. Oligonucleotides (C340sall and C340sal2) were used 15 to introduce a unique Sall restriction site at the 5’ end of the variable region by QuikChange™ mutagenesis. The resulting intermediate vector, pl746, had unique Sall and AfiII restriction sites into which variable region fragments could be cloned. Any variable region fragment cloned into pl 746 would preferably be joined with the 3' half of the light chain gene To prepare a restriction fragment from the 3' half of the 12B75 light 20 chain gene that could be used for this purpose, oligonucleotides BAHN-1 and BAHN-2 were annealed to each other to form a double-stranded linker containing the restriction sites BsiWl. Aflll. Hindll. and Notl and which contained ends that could be ligated into Kpnl and Sacl sites. This linker was cloned between the Kpnl and Sacl sites of pBC to give plasmid pl757 A 7.1 kb fragment containing the 12B75 light chain constant region, 25 generated by digesting pl558 with Aflll. then partially digesting with Hindlll. was cloned between the Aflll and Hindll sites ofpl757 to yield p 1762. This new plasmid contained unique sites for BsiWl and Aflll into which the BsiWI / Aflll fragment containing the promoter and variable regions could be transferred uniting the two halves of the gene. cDNA Cloning and Assembly' of Expression Plasmids. All RT-PCR reactions (sec 30 above) were treated with Klenow enzy me to further fill in the DNA ends Heavy chain PCR fragments were digested with restriction enzy mes BsiWl and BstBI and then cloned between the BsiWl and BstBI sites of plasmid L28 (L28 used because the l2B75-bascd intermediate vector pl 750 had not been prepared yet). DNA sequence analy sis of the 2026253995   16 Oct 2026 cloned inserts showed that the resulting constructs were correct and that there were no errors introduced during PCR amplifications. The assigned identification numbers for these L28 plasmid constructs (for TNV14. TNV15. TNVI4X. TNV14XB. and TNV 196) arc shown in Table 3. The BsiWI / BstBI inserts forTNV14. TNV148. and TNVI48B heavy chains were transferred from the L28 vector to the newly prepared intermediate vector, pl750. The assigned identification numbers for these intermediate plasmids are shown in Table 2. This cloning step and subsequent steps were not done for TN V15 and TN V196. The variable regions were then transferred into two different human IgG I expression vectors Restriction enzymes EcoRI and Hindlll were used to transfer the vanable regions into Centocor's previously-used IgG 1 vector, pl04 The resulting expression plasmids, which encode an IgG 1 of the Gm(f+) allotype, were designated p 1781 (TNV 14). p 1782 (TNV148). and pl 783 (TNV148B) (sec Table 2) The variable regions were also cloned upstream of the IgG I constant region derived from tlie 12B75 (GcnPhann) gene. Those expression plasmids, which encode an IgG I of the G lm(z) allotype, arc also listed in Table 3 Table 3. Plasmid identification numbers for various heavy and light chain plasmids. The L28 vector or pBC vector represents the initial Ab cDNA clone The inserts in those plasmids were transferred to an incomplete 12B75-bascd vector to make tire intermediate plasmids. One additional transfer step resulted in the final expression plasmids that were either introduced into cells after being linearized or used to purify the niAb gene inserts prior to cell transfection. (ND) = not done. Mab Gm(f+) Glm(z) 128 vector Plasmid ID Intermediate Plasmid ID Expression Plasmid ID Expression Plasmid ID Heavy Chains TNV14 pl 751 pl 777 p!781 pl 786 TNV15 pi 752 (ND) (ND) (ND) TNV148 pl753 p!778 pl 782 pl 787 TNV14XBpl760 pi 779 pl 783 p!788 2026253995   16 Oct 2026 TNV 196 pl754 (ND)      (ND) (ND) pBC vector Plasmid ID Intermediate Expression Plasmid ID Plasmid ID Light Chains TNV14 pl 748 pl 755 pl 775 TNV15 pl 748 pl 755 pl 775 TNV148 pl 749 pl 756 pl 776 TN VI96 pl 749 pl 756 pl 776 Light chain PCR products were digested with restriction enzymes Sall and Sacll and then cloned between the Sall and Sacll sites of plasmid pBC The two different light chain versions, which differed by one amino acid, were designated pl 748 and pl 749 (Table 2). DNA sequence analysis confirmed that these constructs had the correct 5 sequences. The Sall / Aflll fragments in pl748 and pl 749 were then cloned between the Sall and Afll 1 sites of intermediate vector pl746 to make p 1755 and p!756. respectively. These 5' halves of the light chain genes were then joined to the 3' halves of the gene by transferring the BsiWI / Aflll fragments from p 1755 and pl756 to the newly prepared construct pl762 to make the final expression plasmids pl 775 and pl776, respectively 10 (Table 2). Cell Transfections. Screening, and Subcloning. A total of 15 transfections of mouse myeloma cells were performed with the various TNV expression plasmids (see Table 3). These transfections were distinguished by whether (1) the host cells were Sp2 / 0 or 653: (2) the heavy chain constant region was encoded by Centocor's previous IgG 1 15 vector or the I2B75 heavy chain constant region: (3) the mAb was TNV I48B. TNV 148. TNV 14. or anew HC7LC combination: (4) whether the DNA was linearized plasmid or purified Ab gene insert: and (5) the presence or absence of the complete J-C intron sequence in the heavy chain gene. In addition, several of the transfections were repeated to increase the likelihood that a large number of clones could be screened 20          Sp2 / 0 cells and 653 cells were each transfected with a mixture of heavy and light chain DNA (8-12 :g each) by electroporation under standard conditions as previously described (Knight DM ct al (1993)Molecular Immunology 30:1443-1453). For transfection numbers I, 2. 3. and 16. the appropriate expression plasmids were linearized 2026253995   16 Oct 2026 by digestion with a restriction enzyme prior to transfection. For example. Sall and Notl restriction enzymes were used to linearize TN VI48B heavy chain plasmid p 1783 and light chain plasmid p 1776, respectively. For the remaining transfections. DNA inserts that contained only the mAb gene were separated from tire plasmid vector by digesting heavy 5 chain plasmids with BarnHI and light chain plasmids with BsiWI and Notl. The mAb gene inserts were then purified by agarose gel electrophoresis and Qiex purification resins. Cells transfected with purified gene inserts were simultaneously transfected with 3-5 :g of Pstl-linearizcd pSV2gpt plasmid (pl 3) as a source of selectable marker. Following electroporation, cells were seeded in 96-well tissue culture dishes in IMDM. 10   15% FBS. 2 mM glutamine and incubated at 37°C in a 5% CO? incubator. Two days later. an equal volume of IMDM. 5% FBS. 2mM glutamine. 2 X MHX selection (1 X MHX = 0.5 :g / ml mycophenolic acid. 2.5 :g / ml hypoxanthine. 50 :g / nil xanthine) was added and the plates incubated for an additional 2 to 3 weeks while colonics formed. Cell supernatants collected from wells w ith colonics were assayed for human IgG 15 by ELISA as described. In brief, vary ing dilutions of the cell supernatants were incubated in 96-well E1A plates coated w ith polyclonal goat anti-human IgG Fc fragment and then bound human IgG was detected using Alkaline Phosphatase-conjugated goat anti-human IgG(H+L) and the appropriate color substrates. Standard curves, which used as standard the same purified mAb that was being measured in the cell supernatants, were included 20 on each EIA plate to enable quantitation of the human IgG in the supernatants. Cells in those colonics that appeared to be producing die most human IgG were passaged into 24-wcll plates for additional production detennmations in spent cultures and die highest-producing parental clones were subsequently identified. The highest-producing parental clones were subcloncd to identify higher-25 producing subclones and to prepare a more homogenous cell line. 96-well tissue culture plates were seeded with one cell per well or four cells per well in of IMDM. 5% FBS. 2mM glutamine. I X MHX and incubated at 37°C in a 5% CO? incubator for 12 to 20 days until colonics were apparent. Cell supernatants were collected from wells that contained one colony per well and analy zed by ELISA as described above. Selected 30 colonies were passaged to 24-well plates and the cultures allowed to go spent before identify ing die highest-producing subclones by quantitating die human IgG levels in their supernatants. This process was repeated when selected first-round subcloncs were 2026253995   16 Oct 2026 subjected to a second round of subcloning. The best second-round subcloncs were selected as the cell lines for development Characterization of Cell Subclones. The best second-round subclones w ere chosen and growth curves performed to evaluate mAb production levels and cell growth 5 characteristics T75 flasks were seeded w ith 1 X 105 cclls / ml in 30 ml IMDM. 5% FBS, 2 mM glutamine, and IX MHX (or serum-free media). Aliquots of 300 pl were taken at 24 hr interv als and live cell density determined. Tire analyses continued until the number of live cells w as less than I X 105 cells / ml. The collected aliquots of cell supernatants were assayed for the concentration of antibody present. ELISA assays were performed using as 10 standard rTNV 148B or rTNV14 JG92399. Samples were incubated for I hour on ELISA plates coated with polyclonal goat anti-human IgG Fc and bound mAb detected with Alkaline Phosphatase-conjugated goat anti-human IgG(H+L) at a 1:1000 dilution. A different grow th curve analysis w as also done for tw o cell lines for the purpose of comparing growth rates in the presence of varying amounts of MHX selection. Cell 15 lines C466A and C466B were thawed into MHX-frce media (IMDM. 5% FBS. 2 mM glutamine) and cultured for two additional days. Both cell cultures were then divided into three cultures that contained cither no MHX. 0.2X MHX. or IX MHX (IX MHX = 0.5 :g / ml mycophenolic acid. 2.5 :g / ml hypoxanthine. 50 :g / ml xanthine). One day later, fresh T75 flasks were seeded with the cultures at a starting density of 1 X 105 cells / ml and cells 20 counted at 24 hour intervals for one week. Aliquots for mAb production were not collected. Doubling times w ere calculated for these samples using the formula provided in SOP PD32.025. Additional studies were performed to evaluate stability of mAb production over time. Cultures were grown in 24-wcll plates in IMDM. 5% FBS. 2 mM glutamine, cither 25 with or w ithout MHX selection. Cultures were split into fresh cultures whenever they became confluent and the older culture was then allow ed to go spent At this time, an aliquot of supernatant was taken and stored at 4°C. Aliquots were taken over a 55-78 day period. At the end of this period, supernatants were tested for amount of antibody present by the anti-human IgG Fc ELISA as outlined above. 2026253995   16 Oct 2026 Results and Discussion. Inhibition of TNF binding to Recombinant Receptor. A simple binding assay was done to determine whether the eight TNV mAbs contained in hybridoma cell supernatant w ere capable of blocking TNFa binding to receptor. The concentrations of the TNV mAbs in their respective cell supernatants were first determined by standard ELISA analysis for human IgG. A recombinant p55 TNF receptor / IgG fusion protein. p55-sf2. was then coated on E1A plates and ,25I-labeled TNFa allowed to bind to the p55 receptor in the presence of varying amounts of TNV mAbs As shown in Fig. I. all but one (TNV 122)of the eight TNV mAbs efficiently blocked TNFa binding to p55 receptor. In fact, the TNV mAbs appeared to be more effective at inhibiting TNFa binding than cA2 positive control mAb that had been spiked into negative control hybridoma supernatant. These results were interpreted as indicating that it was highly likely that the TNV mAbs would block TNFa bioactivity in cell-based assays and in vivo and therefore additional analyses w ere warranted. DNA Sequence Analysis. Confirmation that the RNAs Encode Human mAbs. As a first step in characterizing the seven TNV mAbs (TNV 14. TNV 15. TNV32. TNV86. TNV 118. TNV 148. and TNV 196) that showed TN Fa-blocking activity in the receptor binding assay, total RN A was isolated from the seven hybridoma cell lines that produce these mAbs. Each RNA sample was then used to prepare human antibody heavy or light chain cDNA that included the complete signal sequence, the complete variable region sequence, and part of the constant region sequence for each mAb. These cDN A products were then amplified in PCR reactions and the PCR-amplificd DNA was directly sequenced w ithout first cloning the fragments. The heavy chain cDNAs sequenced were >90% identical to one of the five human germline genes present in the mice. DP-46 (Fig. 2). Similarly, the light chain cDNAs sequenced were cither 100% or 98% identical to one of the human germline genes present in the mice (Fig. 3). These sequence results confirmed that the RNA molecules that were transcribed into cDNA and sequenced encoded human antibody heavy chains and human antibody light chains. It should be noted that, because the variable regions were PCR-amplified using oligonucleotides that map to the 5' end of the signal sequence coding sequence, the first few amino acids of the signal sequence may not be the actual sequence of the original TNV translation products, but they do represent the actual sequences of the recombinant TNV mAbs 2026253995   16 Oct 2026 Unique Neutralizing mAbs. Analyses of the cDNA sequences for the entire variable regions of both heavy and light chains for each in Ab revealed that TNV32 is identical to TN V15, TN V11X is identical to TNV14. and TNV86 is identical to TNV148. The results of the receptor 5 binding assay were consistent with the DNA sequence analyses, i.e. both TNV86 and TNV148 were approximately 4-fold better than both TNV118 and TNV14 at blocking TNF binding. Subsequent work was therefore focused on only the four unique TNV mAbs. TNV14. TNV 15. TNV148. and TNV196. Relatedness of the Four mAbs 10          The DNA sequence results revealed that the genes encoding the heavy chains of the four TNV mAbs were all highly homologous to each other and appear to have all derived from the same germline gene. DP-46 (Fig. 2) In addition, because each of the heavy chain CDR3 sequences arc so similar and of the same length, and because they all use the J6 exon, they apparently arose from a single VDJ gene rearrangement event that 15 was then followed by somatic changes that made each mAb unique. DNA sequence analyses revealed that there were only two distinct light chain genes among the four mAbs (Fig. 3). The light chain variable region coding sequences in TNV 14 and TNV 15 are identical to each other and to a representative gennlinc sequence of the Vg / 38K family of human kappa chains The TNV 148 and TN VI96 light chain coding sequences 20 are identical to each other but differ from the germline sequence at tw o nucleotide positions (Fig. 3). The deduced amino acid sequences of the four mAbs revealed the relatcdncss of the actual mAbs The four mAbs contain four distinct heavy chains (Fig. 4) but only two distinct light chains (Fig. 5). Differences between the TNV mAb sequences and the 25 germline sequences were mostly confined to CDR domains but three of the mAh heavy chains also differed from the gennlinc sequence in the framework regions (Fig. 4). Compared to the DP-46 gennline-cncoded Ab framework regions. TNV 14 was identical. TNV15 differed by one amino acid. TNVI48 differed bx two amino acids, and TNVI96 differed by three ammo acids. 30          Cloning of cDNAs. Site-specific Mutagenesis, and Assembly of Final Expression Plasmids. Cloning of cDNAs. Based on the DNA sequence of the PCR-amplificd variable regions, new oligonucleotides were ordered to perfonn another round of PCR 2026253995   16 Oct 2026 amplification for the purpose of adapting the coding sequence to be cloned into expression vectors. In the case of the heavy chains, the products of this second round of PCR were digested with restriction enzymes BsiWI and BstBI and cloned into plasmid vector L28 (plasmid identification numbers shown in Table 2), In the case of the light chains, the second-round PCR products were digested with Sall and AfiII and cloned mto plasmid vector pBC. Individual clones were then sequenced to confirm that their sequences were identical to the previous sequence obtained from direct sequencing of PCR products, which reveals the most abundant nucleotide at each position in a potentially heterogeneous population of molecules. Site-specific Mutagenesis to Change TNV148. mAbs TNV148 and TNV196 were being consistently observed to be four-fold more potent than the next best mAb (TNV14) at neutralizing TNFa bioactivity. However, as described above, the TNV148 and TNV 196 heavy chain framework sequences differed from the germline framework sequences. A comparison of the TNV 148 heavy chain sequence to other human antibodies indicated that numerous other human mAbs contained an 11c residue at position 28 in framework 1 (counting mature sequence only) w hereas the Pro residue at position 75 in framework 3 was an unusual amino acid at that position. A similar comparison of the TN VI96 heavy chain suggested that the three ammo acids by w hich it differs from the germline sequence in framework 3 may be rare in human mAbs. There was a possibility that these differences may render TNV 148 and TNV196 immunogenic if administered to humans. Because TNV148 had only one amino acid residue of concern and this residue was believed to be unimportant for TNFa binding, a site-specific mutagenesis technique w as used to change a single nucleotide in die TNV148 heavy chain coding sequence (in plasmid pl 753) so that a germline Ser residue w ould be encoded in place of the Pro residue at position 75. The resulting plasmid was termed p 1760 (sec Table 2). The resulting gene and mAb were termed TNV 148B to distinguish it from the original TNV 148 gene and mAb (sec Fig. 5). Assembly of Final Expression Plasmids. New antibody expression vectors were prepared diat were based on the 12B75 heavy chain and light chain genes previously cloned as genomic fragments. Although different TNV expression plasmids were prepared (see Table 2). in each case the 5' flanking sequences, promoter, and intron enhancer derived from die respective 12B75 genes. For the light chain expression plasmids, the complete J-C intron, constant region coding sequence and 3' flanking 2026253995   16 Oct 2026 sequence were also derived from the 12B75 light chain gene. For the heavy chain expression plasmids that resulted in the final production cell lines (p 1781 and p 1783. sec below), the human IgG I constant region coding sequences derived from Centocor's previously-used expression vector (p 104). Importantly, the final production cell lines 5 reported here express a different allotype (Gm(f+)) of the TNV mAbs than the original, hybridoma-derived TNV mAbs (Glm(z)). This is because the 12B75 heavy chain gene derived from the GenPharm mice encodes an Arg residue at the C-terminal end of the CH 1 domain whereas Centocor's IgG I expression vector p 104 encodes a Lys residue at that position. Other heavy chain expression plasmids (eg. pl 786 and pl 788) were 10 prepared in which the J-C intron, complete constant region coding sequence and 3' flanking sequence were derived from the 12B75 heavy chain gene, but cell lines transfected with those genes were not selected as the production cell lines. Vectors were carefully designed to permit one-step cloning of future PCR-amplified V regions that would result in final expression plasmids. 15          PCR-amplified variable region cDN As were transferred from L28 or pBC vectors to intermediate-stage. 12B75-based vectors that provided the promoter region and part of die J-C intron (sec Table 2 for plasmid identification numbers). Restriction fragments that contained die 5' half of the antibody genes were then transferred from these intermediatestage vectors to the final expression vectors that provided the 3' half of the respective 20 genes to form the final expression plasmids (see Table 2 for plasmid identification numbers). Cell Transfections and Subcloning. Expression plasmids were either linearized by restriction digest or the antibody gene inserts in each plasmid were purified away from the plasmid backbones. Sp2 / 0 and 653 mouse myeloma cells were transfected with the 25 heavy and light chain DNA by electroporation. Fifteen different transfections were done, most of which were unique as defined by the Ab. specific characteristics of the Ab genes, whether the genes were on linearized whole plasmids or purified gene inserts, and the host cell line (summarized in Table 4). Cell supernatants from clones resistant to mycophenolic acid w ere assayed for the presence of human IgG by ELISA and 30 quantitated using purified rTNV 148B as a reference standard curve 2026253995   16 Oct 2026 Highest-producing rTNV148B Cell Lines Ten of the best-producing 653 parental lines from r'fNV148B transfection 2 (produced 5-10 :g / ml in spent 24-well cultures) were subcloned to screen for higher-producing cell lines and to prepare a more homogeneous cell population. Two of the 5 subcloncs of the parental line 2.320. 2.320-17 and 2.320-20, produced approximately 50 :g / ml in spent 24-well cultures, which was a 5-fold increase over their parental line. A second round of subcloning of subcloned lines 2 .320-17 and 2.320-20 led The identification numbers of the heavy and light chain plasmids that encode each mAb arc shown. In the case of transfections done with purified mAb gene inserts, plasmid 10   p 13 (pSV2gpt) was included as a source of the gpt selectable marker. The heavy chain constant regions were encoded either by the same human IgG 1 expression vector used to encode Remicade (’old1) or by the constant regions contained within the 12B75 (GcnPharm / Mcdarex) heavy chain gene ('new'). H1 / L2 refers to a "novel" mAb made up of the TNV14 heavy chain and the TNV14X light chain. Plasmids p 1783 and p 1801 differ 15 only by how much of the J-C intron their heavy chain genes contain. The transfection numbers, which define the first number of the generic names for cell clones, arc show n on the right. The rTNV l48B-producing cell lines C466 (A. B. C. D) and C467A described here derived from transfection number 2 and 1, respectively. The rTNV14-producing cell line C476A derived from transfection number 3. 20 Table 4. Summary of Cell Transfections. Transfection no. Plasmids HC DNA mAb HC / LC / gpt vectoi format Sp2 / 0 653 rTNV USB 1783 / 1776 old linear 1 2 rTNV 14 1781 / 1775 old linear 3 - rTNV148B 1788 / 1776 / 13 new insert 4.6 5,7 rTNV 14 1786 / 1775 / 13 new insert 8.10 9.11 rTNV 148 1787 / 1776 / 13 new insert 12 17 rH 1 / L2 1786 / 1776 / 13 new insert 13 14 rTNVI48B 1X01 / 1776 old linear 16 2026253995   16 Oct 2026 ELISA assays on spent 24-well culture supernatants indicated that these second-round subclones all produced between 98 and 124 :g / ml. which was at least a 2-fold increase over the first-round subclones. These 653 cell lines were assigned C code 5 designations as show n in Table 5. Three of the best-producing Sp2 / O parental lines from rTNV I486 transfection I were subcloncd. Two rounds of subcloning of parental line 1.73 led to the identification of a clone that produced 25 :g / ml in spent 24-well cultures. This Sp2 / 0 cell line was designated C467A (Table 5). 10 Highest-producing rTNV14 Cell Lines Three of the best-producing Sp2 / O parental lines from rTNV 14 transfection 3 were subcloncd once Subclone 3.27-1 was found to be the highest-producer in spent 24-well cultures with a production of 19 :g / ml. This cell line was designated C476A (Table 5) Table 5. Summary of Selected Production Cell Lines and their C codes. 15           The first digit of the original clone names indicates which transfection the cell line derived from. All of the C-codcd cell lines reported here were derived from transfections with heavy and light chain whole plasmids that had been linearized w ith restriction enzymes. inAb Original Clone Name C code Spent 24-well Host Cell Production rTNV148B 2.320-17-36 C466A 653 103 :g / ml 2.320-20-111 C466B 653 102 :g / ml 2.320-17-4 C466C 653 98 :g / ml 2.320-20-99 C466D 653 124 :g / ml 1.73-12-122 C467A Sp2 / 0 25 :g / ml rTNV 14 3.27-1 C476A Sp2 / 0 19 :g / ml Characterization of Subcloned Ceil Lines 20          To more carefully characterize cell line grow th characteristics and determine mAb-production levels on a larger scale, growth curves analyses were performed using 2026253995   16 Oct 2026 T75 cultures. The results showed that each of the four C466 senes of cell lines reached peak cell density between I 0 X IO6 and 1.25 X IO6 cclls / ml and maximal mAb accumulation levels of between 110 and 140 :g / ml (Fig. 7). In contrast, the bestproducing Sp2 / 0 subclone, C467A. reached peak cell density of 2.0 X 106 cclls / ml and 5 maximal mAb accumulation levels of 25 :g / ml (Fig. 7). A grow th curve analysis was not done on the rTNV 14-producing cell line, C476A. An additional grow th curve analy sis w as done to compare the grow th rates in different concentrations of MHX selection. Tins comparison was prompted by recent observations that C466 cells cultured in the absence of MHX seemed to be grow ing faster 10 than the same cells cultured in the normal amount of MHX (1X). Because the cytotoxic concentrations of compounds such as mycophenolic acid tend to be measured over orders of magnitude, it was considered possible that the use of a lower concentration of MHX might result in significantly faster cell doubling times w ithout sacrificing stability of mAb production Cell lines C466A and C466B were cultured cither in: no MHX, 0.2X MHX. 15 or IX MHX. Live cell counts were taken at 24-hour intervals for 7 days. The results did reveal an MHX concentration-dependent rate of cell growth (Fig. 8). Cell line C466A showed a doubling time of 25.0 hours in IX MHX but only 20.7 hours in no MHX. Similarly, cell line C466B showed a doubling time of 32.4 hours in IX MHX but only 22.9 hours in no MHX. Importantly, the doubling times for both cell lines in 0.2X MHX 20 were more similar to what was observed in no MHX than in 1X MHX (Fig. 8). This observation raises the possibility than enhanced cell performance in biorcactors, for which doubling times are an important parameter, could be realized by using less MHX. However, although stability test results (see below) suggest that cell line C466D is capable of stably producing rTNV 148B for at least 60 days even w i th no MHX present. 25 the stability test also showed higher mAb production levels when the cells were cultured in the presence of MHX compared to the absence of MHX To evaluate mAb production from the various cell lines over a period of approximately 60 days, stability tests were performed on cultures that either contained, or did not contain. MHX selection. Not all of the cell lines maintained high mAb production 30   After just tw o weeks of culture, clone C466A was producing approximately 45% less than at the beginning of the study Production from clone C466B also appeared to drop significantly. However, clones C466C and C466D maintained fairly stable production, with C466D showing the highest absolute production levels (Fig. 9). 2026253995   16 Oct 2026 Conclusion From an initial panel of eight human mAbs against human TNFa. TNV148B was selected as preferred based on several criteria that included protein sequence and TNF neutralization potency, as well as TNV14. Cell lines were prepared that produce greater 5 than 100 :g / ml of rTNVI48B and 19 :g / ml rTNVI4. Example 5: Arthritic Mice Study using Anti-TNF Antibodies and Controls Using Single Bolus Injection At approximately 4 weeks of age the Tgl97 study mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single 10 intraperitoneal bolus dose of Dulbecco’s PBS (D-PBS) or an anti-TNF antibody of the present invention (TNV14. TN V148 orTNV196) at either I mg / kg or 10 mg / kg. RESULTS: When the weights were analyzed as a change from pre-dose, the animals treated with 10 mg / kg cA2 showed consistently higher weight gain than the D-PBS-trcated animals throughout the study This weight gain was significant at weeks 3-7 15 The animals treated with 10 mg / kg TNV148 also achieved significant weight gain at week 7 of the study. (Sec Fig. 10). Fig 1 i A-C represent the progression of disease severity based on the arthritic index. The 10 mg / kg cA2-treated group’s arthritic index w as lower than the D-PBS control group starting at week 3 and continuing throughout the remainder of the study 20 (week 7). The animals treated with 1 mg / kg TNV 14 and the animals treated with I mg / kg cA2 failed to show significant reduction in AI after week 3 when compared to the D-PBS-treated Group. There were no significant differences between the 10 mg / kg treatment groups w hen each was compared to the others of similar dose (10 mg / kg cA2 compared to 10 mg / kg TNV 14. 148 and 196). When the 1 mg / kg treatment groups were 25 compared, the 1 mg / kg TNV 148 showed a significantly lower AI than 1 mg / kg cA2 at 3. 4 and 7 weeks. The 1 mg / kg TNV 148 was also significantly lower than the I mg / kg TNV 14-trcatcd Group at 3 and 4 weeks. Although TNV 196 showed significant reduction in Al up to week 6 of the study (when compared to the D-PBS-treatcd Group). TNV 148 w as the only I mg / kg treatment that remained significant at the conclusion of the study 30 Example 6: Arthritic Mice Study using Anti-TNF Antibodies and Controls as 2026253995   16 Oct 2026 Multiple Bolus Doses At approximately 4 weeks of age the Tg 197 studs mice were assigned, based on body weight, to one of 8 treatment groups and treated with a intraperitoneal bolus dose of control article (D-PBS) or antibody (TNV14. TNV148) at 3 mg / kg (week 0). Injections 5 were repeated in all animals at weeks 1.2, 3, and 4 Groups 1-6 were evaluated for test article efficacy. Serum samples, obtained from animals in Groups 7 and 8 were evaluated for immune response induction and pharmacokinetic clearance of TN V14 or TN V148 at weeks 2, 3 and 4. RESULTS: No significant differences were noted when the weights were 10 analyzed as a change from pre-dose. The animals treated with 10 mg / kg cA2 showed consistently higher weight gain than the D-PBS-treated animals throughout the study. (Sec Fig. 12). Fig. J 3A-C represent the progression of disease severity based on the arthritic index. The 10 mg / kg cA2-treatcd group's arthritic index was significantly lower than the 15 D-PBS control group starting at week 2 and continuing throughout the remainder of the study (week 5). The animals treated with I mg / kg or 3 mg / kg of cA2 and the animals treated with 3 mg / kg TNV 14 failed to achieve any significant reduction in Al at any time throughout the study w hen compared to the d-PBS control group. The animals treated with 3 mg / kg TNV148 showed a significant reduction when compared to the d-PBS- 20 treated group starting at week 3 and continuing through week 5. The 10 mg / kg cA2-treated animals showed a significant reduction in AI when compared to both the lower doses (1 mg / kg and 3 mg / kg) of cA2 at weeks 4 and 5 of the study and was also significantly lower than the TNV 14-treated animals at weeks 3-5. Although there appeared to be no significant differences betw een any of the 3mg / kg treatment groups, the 25 Al for the animals treated w ith 3 mg / kg TNV 14 were significantly higher at some time points than the 10 mg / kg whereas the animals treated with TNV 148 were not significantly different from the animals treated with 10 mg / kg of cA2. Example 7: Arthritic Mice Study using Anti-TNF Antibodies and Controls as Single Intraperitoneal Bolus Dose 30          At approximately 4 weeks of age the Tg 197 study mice w ere assigned, based on gender and bod) w eight, to one of 6 treatment groups and treated w ith a single 2026253995   16 Oct 2026 intraperitoneal bolus dose of antibody (cA2, or TNV148) at cither 3 mg / kg or 5 mg / kg. This study utilized the D-PBS and 10 mg / kg cA2 control Groups. When the weights were analyzed as a change from pre-dose, all treatments achieved similar weight gains. The animals treated with either 3 or 5 mg / kg TNV 148 or 5 mg / kg cA2 gained a significant amount of weight early in the study (at weeks 2 and 3). Only the animals treated with TNV 148 maintained significant weight gain in the later time points. Both the 3 and 5 mg / kg TNV 148-treated animals showed significance at 7 weeks and the 3 mg / kg TNV 148 animals were still significantly elevated at 8 weeks post injection. (See Fig. 14). Fig 15 represents the progression of disease severity based on the arthritic index. All treatment groups showed some protection at the earlier time points, with the 5 mg / kg cA2 and the 5 mg / kg TNV 148 showing significant reductions in Al at weeks 1-3 and all treatment groups show ing a significant reduction at week 2. Later in the study the animals treated with 5 mg / kg cA2 showed some protection, with significant reductions at weeks 4. 6 and 7 The low dose (3 mg / kg) of both the cA2 and the TN V148 show ed significant reductions at 6 and all treatment groups showed significant reductions at week 7. None of the treatment groups w ere able to maintain a significant reduction at the conclusion of the stud) (week 8). There were no significant differences between am of the treatment groups (excluding the saline control group) at any time point. Example 8: Arthritic Mice Study using Anti-TNF Antibodies and Controls as Single Intraperitoneal Bolus Dose Between Anti-TNF Antibody and Modified Anti-TNF Antibody To compare the efficacy of a single intraperitoneal dose of TNV 148 (derived from hybridoma cells) and rTNVI48B (derived from transfected cells). At approximately 4 w eeks of age the Tgl97 studs' mice were assigned, based on gender and body weight, to one of 9 treatment groups and treated with a single intraperitoneal bolus dose of Dulbecco=S PBS (D-PBS) or antibody (TNV 148. rTNV148B)at 1 mg / kg. When the weights were analyzed as a change from pre-dose, the animals treated with 10 mg / kg cA2 showed a consistently higher weight gam than the D-PBS-treated animals throughout die study. This weight gain was significant at weeks I and weeks 3-8. The animals treated with I mg / kg TNV 148 also achieved significant weight gain at weeks 5, 6 and 8 of the studs (See Fig. 16). 2026253995   16 Oct 2026 Fig. 17 represents the progression of disease severity based on the arthritic index. The 10 mg / kg cA2-trcated group s arthritic index was lower than the D-PBS control group starting at week 4 and continuing throughout the remainder of the study (week 8). Both of the TNV148-treated Groups and the 1 mg / kg cA2-treated Group showed a significant 5 reduction in AI at week 4. Although a previous stud) (P-099-017) showed that TNVI48 was slightly more effective at reducing the Arthritic Index following a single 1 mg / kg intraperitoneal bolus, this stud) showed that the Al from both versions of the TNV antibod) -treated groups w as slightly higher. Although (w ith the exception of w eek 6) the I mg / kg cA2-trcatcd Group was not significant!)' increased when compared to the 10 mg / kg 10 cA2 group and the TNV 148-treated Groups were significant!) higher at weeks 7 and 8, there were no significant differences in Al between the 1 mg / kg cA2. 1 mg / kg TNV 148 and I mg / kg TNV 148B at any point in the study. 2026253995   16 Oct 2026 Example 9: GO-VIVA - A Multicenter*, Open-Label Trial of Intravenous Golimumab, a Human Anti-TNFa Antibody, in Pediatric Subjects With Active Polyarticular Course Juvenile Idiopathic Arthritis Despite Methotrexate Therapy Protocol Number:...

Claims

I A method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO.

37. and wherein the patients treated with the anti-TNF antibody meet the criteria for inactive disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment 16 weeks of treatment 20 weeks of treatment 24 weeks of treatment, or 28 w eeks of treatment.

2. The method of claim 1. wherein > 10% of the patients meet the criteria for inactive disease after 8 weeks of treatment. >20% of the patients meet the criteria for inactive disease after 16 w eeks of treatment, and >29% of the patients meet the criteria for inactive disease after 28 w eeks of treatment.

3. The method of claim 1. wherein said pediatric patients are 2-17 years old4      The method of claim 1. wherein said juvenile idiopathic arthritis (JIA) ispohurticular juvenile idiopathic arthritis (pJIA).

5. The method of claim 1. wherein the IV dose is 80mg / m2. at weeks 0.

4. and then every 8 w eeks thereafter6. The method of claim 1. w herein the method further comprises administering methotrexate (MTX) to the pediatric patients.

7. A method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO:36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:

37. and wherein the patients treated with the anti-TNF antibod} have an improvement from baseline corresponding to a JIA American College of Rheumatology (JIA ACR) response of JIA ACR 30. JIA ACR 50. JIA ACR 70. or JIA ACR 9() after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 162026253995   16 Oct 2026weeks of treatment. 20 weeks of treatment 2 weeks of treatment, or 28 w eeks of treatment8.     The method of claim 7. wherein after 4 weeks of treatment >50% of the patientsmeet the criteria for JIA ACR 30 and JIA ACR 509.     The method of claim 7. w herein after 12 w eeks of treatment >50% of the patientsmeet the criteria for JIA ACR 30. JIA ACR 50. and JIA ACR 70.10, The method of claim 7. wherein after 28 w ecks of treatment >83% of the patients meet the criteria for JIA ACR 30. >79% of the patients meet the criteria for JIA ACR 50, >70% of the patients meet the criteria for JIA ACR 70, and >46% of the patients meet the criteria for JIA ACR 9011.    The method of claim 7. wherein said pediatric patients are 2-17 years old.

12. The method of claim 7, wherein said juvenile idiopathic arthritis (JIA) ispolyarticular juvenile idiopathic arthritis (pJ IA).13    The method of claim 7. w herein the IV dose is 80mg / m3, at w eeks 0.

4. and theneven 8 weeks thereafter.

14. The method of claim 7. wherein the method further comprises administering methotrexate (MTX) to the pediatric patients.15 A method of treating juvenile idiopathic arthritis (JIA) in pediatric patients, the method comprising administering an intravenous (IV) dose of an anti-TNF antibody to the patient, wherein the anti-TNF antibody comprises a heavy chain (HC) comprising an amino acid sequence of SEQ ID NO.36 and a light chain (LC) comprising an amino acid sequence of SEQ ID NO:

37. and wherein the patients treated with the anti-TNF antibody have a Juvenile Arthritis Disease Activity Score (JADAS) of JADAS 10. JADAS 27. or J ADAS 71 minimal disease after 4 weeks of treatment. 8 weeks of treatment. 12 weeks of treatment. 16 w eeks of treatment, 20 weeks of treatment. 2 weeks of treatment, or 28 w eeks of treatment.2026253995   16 Oct 202616 The method of claim 15. wherein > 10% of patients have JADAS 10. JADAS 27, and JADAS 71 minimal disease activity disease after 12 weeks of treatment 16 weeks of treatment. 20 weeks of treatment. 24 weeks of treatment, and 28 weeks of treatment17. The method of claim 15, wherein > 15% of patients have JADAS 10. JADAS 27. and JADAS 71 minimal disease activity disease after 24 weeks of treatment and 28 weeks of treatment18    The method of claim 15. wherein said pediatric patients arc 2-17 years old19.    The method of claim 15. wherein said juvenile idiopathic arthritis (JIA) ispolyarticular juvenile idiopathic arthritis (pJIA).20 The method of claim 15. wherein the IV dose is 80mg / m2. at weeks 0.

4. and then even, 8 weeks thereafter.21 The method of claim 15. w herein the method further comprises administering methotrexate (MTX) to the pediatric patients.

Images