Duck enteritis virus and its uses.
Patent Information
- Application Number
- BR112018077210
- Authority / Receiving Office
- BR · BR
- Patent Type
- Patents
- Current Assignee / Owner
- Publication Date
- 2026-08-25
Smart Images

Figure 00000067_0000 
Figure 00000068_0000 
Figure 00000069_0000
Abstract
Description
1 / 61 “DUCK ENTERITIS VIRUS AND ITS USES” FIELD OF THE INVENTION
[0001] The present invention relates to innovative viruses and their uses. More particularly, the invention relates to innovative constructs of Duck Enteritis Virus and their use to express or deliver polypeptides of interest to animals, particularly birds. The invention is particularly suitable for vaccinating birds against avian pathogens. BACKGROUND OF THE INVENTION
[0002] Eggs and poultry meat are important food sources, whose consumption is continuously increasing due to the growth of the human population and their excellent quality-price ratio. The recent avian influenza epidemic has targeted public opinion regarding poultry health, as well as food safety and security, and poultry vaccine technology has become a global concern.
[0003] Pathogen proteins expressed by recombinant viruses are commonly used as avian vaccines against targeted pathogens. Vaccines that include such viruses induce the expression of exogenous pathogenic proteins or fragments thereof within infected cells, which can subsequently induce specific and protective humoral immunity as well as cell-mediated immunity.
[0004] In this regard, several viruses, into which an exogenous gene derived from a pathogen has been integrated, have been developed for use as vector vaccines. Petition 870190007121, dated 01 / 23 / 2019, page 6 / 76 2 / 61 viral. These viral vectors (or recombinant viruses) are typically based on avipoxviruses, such as fowlpox (document EP-A-0.517.292), herpesviruses, particularly HVT (e.g., documents WO-A-87 / 04463, 5.980.906, 5.853.733), Newcastle disease virus (NDV), or avian adenoviruses. These recombinant avian viruses exhibit varying levels of protection, depending on the disease and / or animal.
[0005] For example, because Poxviruses, NDV and adenoviruses do not persist in chickens, they are not considered the best candidates for long-lasting immunity in chickens. Antigens expressing recombinant HVT have shown advantages and are currently marketed for vaccination in chickens (e.g., Vectormune® IBD, Vectormune® ND or Vectormune® LT).
[0006] Considering the increasing number and diversity of pathogens and the continued growth in poultry consumption, there is, however, a need for alternative vaccination strategies and / or systems that can be used to induce effective protective immunity in poultry. In particular, there is a need for effective systems to achieve immunity in very young animals (3 days or less) or in ovo.
[0007] In this regard, innovative viral serotypes have been explored, with the aim of finding alternative compatible viral vectors to improve vaccination in animals, particularly in birds, allowing for protein expression and effective protection.
[0008] Document WO2014 / 0036735 discusses the possible use of Duck Enteritis Virus in chickens. DEV naturally infects ducks or geese, but has no tropism. Petition 870190007121, dated 01 / 23 / 2019, page 7 / 76 3 / 61 known for chickens. This document suggests that a DEV construct can be administered to 1-year-old chickens by intramuscular injection. However, in this document, only the latter administration is reported.
[0009] Through conducting further experiments with DEV, the inventors found, however, that such a virus is lethal when administered to young chickens (3 days or less) or in ovo. Surprisingly, although administration to chickens of a wild-type DEV (or a DEV construct containing all native genes as proposed in document WO2014 / 0036735) one week after hatching appears well tolerated, administration of such a construct on day 1 post-hatching or in ovo causes very massive animal mortality (i.e., between 80-100%). Even more surprisingly, the inventors were able to modify the DEV structure to produce DEV constructs that can be used in poultry, including at a very early stage (3 days or less) or in ovo, and that can cause substantial early-stage protein expression in vivo. Thus, such viruses represent potent new factors for poultry vaccination. SUMMARY OF THE INVENTION
[0010] The invention provides innovative viral constructs suitable for expressing genes or proteins in vivo in animals, particularly birds, including at a very early stage (i.e., on day 3 post-hatching or earlier, as well as in ovo). In particular, the invention provides innovative DEVs obtained by inactivating the US4 and US5 genes, and demonstrates that such DEVs are (i) attenuated in vivo, particularly in chickens, and (ii) are stable and capable of expressing genes. Petition 870190007121, dated 01 / 23 / 2019, p. 8 / 76 4 / 61 exogenous viruses are suitable for inducing protective immunity. Furthermore, these attenuated and defective DEVs retain a rapid growth rate, allowing for the production of high titer levels. Because such DEVs have no known natural tropism for, for example, chickens, the use of such DEV constructs for chicken vaccination does not involve a risk of dissemination or contamination to unvaccinated animals. Additionally, chickens have no maternal antibodies or immunity against DEVs, and the viruses of the invention can be used to induce very early emergence of immunity in vaccinated animals. Surprisingly, as previously indicated, while wild-type DEVs are lethal in young chickens or in ovo, the DEVs of the invention are safe and can effectively express the genes of interest in vivo.Thus, these innovative DEVs represent very potent vectors for vaccinating non-human animals, particularly birds, and for conferring early protective immunity.
[0011] More particularly, an object of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4 and US5 genes. In fact, the invention shows that by inactivating these genes, viable, stable and replicable DEVs can be obtained, and that such viruses can be used to create recombinant DEVs by inserting exogenous genetic material. The results further show that such exogenous genetic material is highly expressed from such viruses upon cell infection, and that such expression remains stable over time. Moreover, and surprisingly, although native DEV as well as many other DEV constructs Petition 870190007121, dated 01 / 23 / 2019, page 9 / 76 5 / 61 deleted viruses produced by the inventors were found to be pathogenic or lethal in young chickens (on day 3 post-hatching or earlier) and in ovo, the inactivation of US4 and US5 generates attenuated viruses that can be safely used to express proteins and antigens in young animals, including in ovo. This finding was completely surprising and offers significant advantages and utility to the viruses present.
[0012] Thus, a further object of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4 and US5 genes and comprises an exogenous nucleic acid.
[0013] According to the particular embodiments, the US4 and US5 genes are mutated, or deleted, or interrupted; and / or exogenous nucleic acid is located in place of all or part of the US4 and US5 gene sequences, and / or the exogenous nucleic acid encodes an avian pathogen.
[0014] In a further particular embodiment, the DEV of the invention additionally comprises an inactive UL4, UL23 or US7 gene.
[0015] A further objective of the invention consists of a nucleic acid molecule comprising the genome of a DEV that has inactive US4 and US5 genes.
[0016] The invention further relates to a host cell comprising a DEV or a nucleic acid as defined above.
[0017] The invention also provides a method for producing or replicating a DEV as defined above, comprising infecting a competent cell with an acid molecule. Petition 870190007121, dated 01 / 23 / 2019, p. 10 / 76 6 / 61 nucleic acid or with a DEV as defined above, and collect the DEV.
[0018] The invention also relates to a method for producing a recombinant DEV, comprising inserting an exogenous nucleic acid in substitution for all or at least 20% of the US4 and US5 gene sequences.
[0019] The invention also provides a composition comprising a DEV, a nucleic acid or a host cell as defined above, an acceptable or pharmaceutically acceptable veterinary carrier or excipient and, optionally, an adjuvant.
[0020] The invention also provides a vaccine comprising a DEV, a nucleic acid or a host cell as defined above, a veterinary acceptable or pharmaceutically acceptable carrier or excipient and, optionally, an adjuvant.
[0021] An additional object of the invention relates to a composition, DEV, nucleic acid or host cell as defined above, for use in vaccinating or immunizing avian species, particularly birds, more particularly chickens, more particularly young birds (on Day 3 post-hatching or before or in ovo).
[0022] A further object of the invention relates to a composition, DEV, nucleic acid or host cell as defined above, for use in inducing protective immunity in avian species, particularly birds, more particularly chickens, more particularly young birds (on Day 3 post-hatching or before or in ovo).
[0023] The invention also relates to a method of vaccinating a non-human animal, particularly birds, more Petition 870190007121, dated 01 / 23 / 2019, p. 11 / 76 7 / 61 particularly chickens, more particularly young birds (on Day 3 post-hatching or before or in ovo), which comprises administering to said non-human animal a composition, or virus as defined above.
[0024] A particular object of the invention consists in a method of vaccinating poultry comprising in ovo administration of a composition, or virus as defined above.
[0025] Another particular object of the invention consists in a method of vaccinating poultry comprising administering a composition, or virus as defined above, on Day 1 (i.e., about 24 hours) post-hatching.
[0026] In a further aspect, the invention provides a method for inducing a protective or immunogenic response in a non-human animal against one or more avian pathogens comprising administering to said non-human animal, particularly birds, more particularly chickens, more particularly young birds (on Day 3 post-hatching or before or in ovo), a composition, vaccine or virus as defined above.
[0027] The viruses or compositions of the invention can be administered by any route. Preferably, they are administered in ovo or by subcutaneous injection (e.g., sc) 1 or 2 days post-hatching, to confer very early immunity.
[0028] The invention further provides a vaccination kit for immunizing a bird, comprising the following components: a. an effective quantity of a composition as defined above, and b. a means to administer said composition for said Petition 870190007121, dated 01 / 23 / 2019, page 12 / 76 8 / 61 bird.
[0029] The invention can be used to express a polypeptide in any animal, preferably for the vaccination of a bird, and is suitable for expressing one or more polypeptides or peptides, particularly immunogenic peptides from avian pathogens. CAPTIONS FOR THE FIGURES
[0030] Figure 1 illustrates a schematic diagram of the Duck Enteritis Virus (DEV) genome and the location of the US genes.
[0031] Figure 2 illustrates schematic diagrams of the insertion site location in the parental DEV genome and of the genome structures of pUC18-KAPEVAC-US4US5delBacVP2 and DEV / US4US5del / BacVP2. The Junction 1, Junction 2, and Junction 3 locations used for amplification in PCR reactions are shown.
[0032] Figure 3 shows VP2 expression by CEF infected with DEV / US4US5del / BacVP2 in black plate analysis.
[0033] Figure 4 illustrates schematic diagrams of the insertion site location in the parental DEV genome and the genome structures of pUC18-KAPEVAC-US4US5del and DEV / US4US5del. The Junction 1 locations used for amplification in the PCR reaction are shown.
[0034] Figure 5 illustrates schematic diagrams of the insertion site location in the parental DEV genome and of the genome structures of pUC18-KAPEVAC-UL23del-Coa5VP2 and DEV / US4US5del / UL23 / Coa5VP2. The Junction 1, Junction 2, and Junction 3 locations used for amplification in PCR reactions are shown. Petition 870190007121, dated 01 / 23 / 2019, page 13 / 76 9 / 61
[0035] Figure 6 illustrates schematic diagrams of the insertion site location in the parental DEV genome and of the genome structures of pUC18-KAPEVAC-UL26-Coa5VP2 and DEV / US4US5del / UL26 / Coa5VP2. The Junction 1, Junction 2, and Junction 3 locations used for amplification in PCR reactions are shown.
[0036] Figure 7 illustrates schematic diagrams of the insertion site location in the parental DEV genome and of the genome structures of pUC18-KAPEVAC-UL45-Coa5VP2 and DEV / US4US5del / UL45 / Coa5VP2. The Junction 1, Junction 2, and Junction 3 locations used for amplification in PCR reactions are shown.
[0037] Figure 8 illustrates schematic diagrams of the insertion site location in the parental DEV genome and of the genome structures of pUC18-KAPEVAC-UL50-Coa5VP2 and DEV / US4US5del / UL50 / Coa5VP2. The Junction 1, Junction 2, and Junction 3 locations used for amplification in PCR reactions are shown.
[0038] Figure 9 shows the expression of VP2 by CEF infected with DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2 or
[0039] DEV / US4US5del / UL50 / Coa5VP2 under black plate review.
[0040] Figure 10 is a western blot analysis that detects VP2 protein expression by DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, or DEV / US4US5del / UL50 / Coa5VP2. 1: DEV / US4US5del / UL23 / Coa5VP2; 2: DEV / US4US5del / UL26 / Coa5VP2; 3: DEV / US4US5del / UL45 / Coa5VP2; 4: DEV / US4US5del / UL50 / Coa5VP2; 5: Parental DEV; 6: CEF. Petition 870190007121, dated 01 / 23 / 2019, p. 14 / 76 10 / 61 DETAILED DESCRIPTION OF THE INVENTION
[0041] The present invention generally relates to attenuated DEVs comprising exogenous gene sequence(s). The present invention also relates to compositions comprising such DEVs, as well as to their use for animal vaccination, particularly poultry, more particularly young poultry (on Day 3 post-hatching or earlier, or in ovo).
[0042] The present revelation will be best understood in reference to the following definitions: Definitions
[0043] The term virus designates in particular a viral particle comprising a nucleic acid molecule (e.g., a genome) enclosed in a capsid or capsule. The term virus also designates a viral vector or an isolated viral genome.
[0044] The term recombinant designates a molecule that has been created, designed, or modified using genetic technologies. In relation to a virus, the term recombinant more specifically designates a virus whose genome (or the genome of its ancestor) has been modified by the insertion or deletion of at least one nucleic acid sequence.
[0045] The term exogenous nucleic acid in relation to a virus designates a nucleic acid that is not found naturally in the virus's genome, or that is found naturally in said genome but in a different form or in a different position. In the present description, the term nucleic acid or nucleic acids designates any nucleic acid sequence or molecule such as deoxyribonucleotide (DNA) or ribonucleotide (RNA), which Petition 870190007121, dated 01 / 23 / 2019, page 15 / 76 11 / 61 can be, for example, single-stranded or double-stranded. Nucleic acids may or may not comprise an ORF. Nucleic acid molecules can be produced by techniques known per se in the art such as by artificial synthesis, recombinant technology, enzymatic technology, replication in host cells, or combinations thereof.
[0046] A gene designates a nucleic acid sequence or molecule comprising an open reading frame that encodes a product, such as a polypeptide (e.g., a peptide, protein, etc.) or an RNA.
[0047] Within the context of the invention, a DEV having an inactive gene designates a DEV that cannot express a functional protein or is inactive due to said gene. An inactive US4 gene thus designates a mutated US4 gene, a deleted US4 gene, and / or a disrupted US4 gene that cannot encode a wild-type US4 protein. An inactive US5 gene designates a mutated US5 gene, a deleted US5 gene, and / or a disrupted US5 gene that cannot encode a wild-type US5 protein. Where the US5 gene contains a 5'US5 coding sequence and a 3'US5 coding sequence, an inactive US5 designates a mutated US5 gene, a deleted US5 gene, and / or a disrupted US5 gene that cannot encode any wild-type protein encoded by said 5'US5 and 3'US5 coding sequences, for example, both 5'US5 and 3'US5 contain a mutation or deletion or disruption.
[0048] The term attenuated as used in this document refers to a virus that does not essentially cause disease in an animal model. An attenuated virus may Petition 870190007121, dated 01 / 23 / 2019, page 16 / 76 12 / 61 typically replicate in a host without causing its death. An attenuated virus more particularly designates a virus that is not virulent in embryos when injected at a dose of 1 x 10³ pfu / egg. The most preferred attenuated viruses are safe at a dose of 1 x 10³ pfu / egg in at least 70% of injected eggs, more preferably in at least 80% of injected eggs, and even more preferably in at least 90%, 95%, 97%, 98%, 99% or more. The attenuated viruses of the invention are also safe for post-hatch injection, which includes Day 0 (i.e., between 0.1 and 48 hours post-hatch).
[0049] The term bird is intended to encompass all types of birds, such as songbirds of the class Aves, that is, vertebrate animals that have feathers, wings, two legs, are endothermic and lay eggs.In the context of the invention, birds or avian species refer more particularly to birds of economic and / or agronomic interest, such as poultry, preferably chickens and turkeys; or ornamental birds, such as swans and psittacines.
[0050] The term vaccine as used in this document designates an agent that can be used to cause, stimulate or amplify an immune response in an organism.
[0051] An immune response refers to the development in a host of a cellular and / or antibody-mediated immune response to a composition or vaccine of interest. Usually, an immune response includes the production of antibodies, B cells, helper T cells and / or cytotoxic T cells, specifically directed against an antigen or antigens included in the composition or vaccine. Petition 870190007121, dated 01 / 23 / 2019, page 17 / 76 13 / 61 interest. Preferably, the immune response is protective so that resistance to new infection is improved and / or the clinical severity of the disease is reduced. The term in ovo injection or administration generally means inoculation or injection into the embryo contained in an egg. In ovo injection is preferably conducted anytime between Day 5 and Day 1 before hatching. Duck Enteritis Virus
[0052] Duck Enteritis Virus (DEV), also known as duck viral enteritis virus (DVEV), naturally infects ducks and geese. The complete nucleotide sequence of DEV has been determined and is available online (see, for example, JQ673560). The viral genome contains approximately 162 Kb, encoding nearly 80 distinct proteins. Several serotypes and strains of DEV have been isolated, such as the Jansen strain, the CSC strain, the CHv strain, the VAC strain, and the 2085 strain. Complete sequences of several DEV strains are available from Genbank, such as the VAC strain: ID EU082088.2; the Anathidium C-KCE alone: ID KF263690.1; the Anathidium strain CHv: ID JQ647509.1; the Anathidium strain 2085: ID JF999965; the Anatide strain CV: ID KJ549663.1 or the Anatide strain CSC: ID JQ673560.1.
[0053] DEV remains poorly characterized and its use as a vector for gene expression has not been thoroughly investigated. For example, Liu et al. (2013) and paper WO2014 / 0036735 attempted to use a recombinant DEV to express genes in chickens. They used a DEV construct in which a nucleic acid was cloned between the US7 and US8 genes of the viral genome, without altering native gene expression. Although it is reported that such a construct Petition 870190007121, dated 01 / 23 / 2019, p. 18 / 76 14 / 61 can be transferred by intramuscular injection in 1-year-old chickens; however, there is no disclosure in this document or in any other prior art document of any possible use of DEV for in ovo vaccination of poultry, or for vaccination of young birds, i.e., on Day 3 post-hatching or earlier, particularly on Day 1 or Day 2 post-hatching.
[0054] Through conducting further experiments with DEV, the inventors surprisingly found that this virus is lethal when administered to young chickens (3 days or less) or in ovo. Surprisingly, although administration to chickens of a wild-type DEV (or a DEV construct containing all native genes as proposed in document WO2014 / 0036735) one week after hatching appears well tolerated, administration of such a construct on day 1 post-hatching or in ovo causes a very massive death of the animals (i.e., between 80-100%), as reported in example 1.
[0055] Even more surprisingly, the inventors were able to modify the DEV structure to produce DEV constructs that can be used in poultry, including at a very early stage (3 days or less) or in ovo, and that can cause substantial early-stage protein expression in vivo. More particularly, the present inventors conducted further research with DEV and generated several recombinants with different gene alterations or deletions. The inventors surprisingly revealed that by inactivating both the US4 and US5 genes, recombinant DEVs can be obtained that are (i) attenuated in vivo, particularly in chickens, and (ii) stable and capable of expressing the exogenous genes of a Petition 870190007121, dated 01 / 23 / 2019, p. 19 / 76 15 / 61 suitable way to induce protective immunity. The results further show that such exogenous genetic material is highly expressed from such viruses upon cell infection, and that such expression remains stable over time. Moreover, and surprisingly, the inactivation of US4 and US5 generates attenuated DEVs that can be safely used to express proteins or antigens in young birds and in ovo, while DEVs that have only one inactive US4 gene or only one inactive US5 gene remain pathogenic or lethal in young chickens (less than 3 days old or in ovo). Due to the fact that the DEV has no known natural tropism for, for example, chickens, the use of DEV constructs of the invention for chicken vaccination involves no risk of dissemination or contamination to unvaccinated animals.Furthermore, chickens have no maternal antibodies or immunity against DEV, and the viruses of the invention can be used to induce very early emergence of immunity in vaccinated animals.
[0056] Thus, an object of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4 and US5 genes.
[0057] A further object of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4 and US5 genes and contains an exogenous nucleic acid.
[0058] The DEVs of the invention can be prepared from any strain or species of DEV. Several strains of DEV have been reported, which are available from public collections, such as the Jansen strain, the VAC strain (ID Petition 870190007121, dated 01 / 23 / 2019, p. 20 / 76 16 / 61 EU082088. 2), strain C-KCE (ID KF263690. 1), strain CHv (ID JQ647509. 1), strain 2085 (ID JF999965), strain CV (ID KJ549663. 1) or strain CSC (ID JQ673560. 1).
[0059] In a preferred embodiment, the DEV of the invention is derived or prepared from a parental strain selected from the Jansen strain or the CSC strain, or any DEV strain that has at least 90% sequence identity to the Jansen strain or the CSC strain, more preferably at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.
[0060] The invention shows that by inactivating (i.e., rendering non-functional or deleting) the US4 and US5 genes, it is possible to generate attenuated DEVs that are safe even when injected in ovo or into young birds, and that can replicate and express proteins in birds.
[0061] In particular, as shown in the examples, DEV constructs that have inactive US4 and US5 genes are stable, can be replicated in culture, and can be safely administered to bird eggs or young birds. Such viruses can thus be used to produce recombinant DEVs containing exogenous nucleic acid material, particularly antigen-coding genes, to express such genes in birds.
[0062] Within the context of the invention, a DEV having an inactive gene designates a DEV that cannot express a functional protein or an inactive gene for said gene. Thus, an inactive gene particularly designates a mutated gene, a deleted gene and / or a disrupted gene that cannot encode a wild-type protein.
[0063] In one particular form, the gene is inactive. Petition 870190007121, dated 01 / 23 / 2019, p. 21 / 76 17 / 61 as a result of one or more mutations in the coding sequence, particularly point mutations in the coding sequence that prevent the expression of a full-length protein. Such mutations may introduce a stop or nonsense codon into the sequence, or cause the substitution of an essential amino acid residue (or residues) in the encoded protein, resulting in an inactive protein.
[0064] In another embodiment, the gene is inactivated as a result of a deletion of at least a portion of the sequence (coding) of said gene, more particularly, at least 20% of the gene sequence (coding), more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 85%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 300 bp (of the coding sequence) of the gene to be inactivated. Such a deletion removes the coding sequence and thus prevents the expression of a wild-type protein, or even any protein.
[0065] In this regard, a particular embodiment of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has deletions in / of the US4 and US5 genes, particularly in / of the coding sequence of the US4 and US5 genes.
[0066] The US4 and US5 genes of DEV are expected to encode proteins. However, the actual function of these genes remains uncertain. Until the present invention, the ability to generate doubly defective US4-US5 DEV viruses was completely unknown, and the ability to Petition 870190007121, dated 01 / 23 / 2019, page 22 / 76 18 / 61 such DEV viruses replicate and express exogenous genes without being lethal in avian species.
[0067] The US4 gene is typically composed of 1380 bp of a DEV genome and encodes a protein comprising approximately 459 amino acid residues. US4 is highly conserved among DVE strains. For reference to a CSC strain, the US4 gene corresponds to nt141123 to nt142502 of the genome. It is understood that the skilled individual can easily identify the exact location of the US4 gene in any DEV strain using the information contained in this application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the US4 gene sequence (coding) is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp from the US4 gene sequence (coding), more preferably at least 600, 700, 800, 900, 1000 or more.In one specific embodiment, a DEV of the invention has a deletion spanning at least nt200-1000 of the US4 gene sequence, more preferably at least nt150-1150, and even more preferably at least nt100-1300. In a specific example, a DEV of the invention has a deletion from nt51 to nt1330 (i.e., above 90%) of the US4 gene sequence. In another particular embodiment, a DEV of the invention has a deletion of the entire US4 gene sequence (nt1-1380).
[0068] The US5 gene of DEV encodes a glycoprotein, whose function remains unknown. In most strains of Petition 870190007121, dated 01 / 23 / 2019, page 23 / 76 19 / 61 In DEV (e.g., VAC, CSC, C-KCE, CHv, CV), the US5 gene is approximately 1620 bp long and encodes a protein of approximately 539 amino acid residues. In some DEV strains, such as strain 2085 and strain Jansen (or Kapevac), the US5 gene contains two shorter coding regions: 5'US5 of approximately 396 bp and 3'US5 of approximately 1197 bp, separated by a small intergenic region of approximately 25 bp (see Figure 1). For reference, for a CSC strain, the US5 gene corresponds to nt142662 to nt144281 of the genome. It is understood that the knowledgeable individual can easily identify the exact location of the US5 gene in any DEV strain using the information contained in this application and general common knowledge, or by sequence alignment.In a particular DEV of the invention, at least 20% of the US5 gene sequence (coding) is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred embodiment, the DEV of the invention has a deletion of at least 500 bp from the US5 gene sequence (coding), more preferably at least 600, 700, 800, 900, 1000 or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt200-1000 of the US5 gene sequence, more preferably at least nt100-1100, and even more preferably at least nt80-1120. When the US5 gene contains two ORFs, it is preferable that both ORFs be inactive. In this regard, where the DVE is prepared from a viral strain that has a US5 gene sequence containing a single ORF, the DVE preferably comprises a deletion of... Petition 870190007121, dated 01 / 23 / 2019, page 24 / 76 20 / 61 at least 90% of said ORF, such as a deletion of at least nt51 to nt1570 of the US5 gene sequence, more particularly, a deletion of the entire US5 gene. Where the DVE is prepared from a viral strain that has a US5 gene sequence containing two ORFs, the DVE preferably comprises a deletion of at least 90% of each of said ORFs, more preferably a deletion comprising at least 90% of the first ORF, the complete intergenic region, and at least 90% of the second ORF.
[0069] In a specific embodiment, a DEV of the invention has a deletion of a continuous region encompassing at least a portion of the US4 gene, the complete US4-US5 intergenic region, and a portion of the US5 gene.
[0070] In a further specific embodiment, DVE comprises a deletion of a nucleotide region comprising at least 50% of the US4 gene, the entire intergenic region between the US4 gene and the US5 gene, and at least 50% of the US5 gene.
[0071] In a more preferred embodiment, the DVE comprises a deletion of a nucleotide region comprising the entire US4 gene, the entire intergenic region between the US4 and US5 genes, and the entire US5 gene. A specific example of such a construct is, for example, DEV / US4US5 / BacVP2).
[0072] As indicated above, the DVEs of the invention may contain one or more exogenous nucleic acids of interest. The exogenous nucleic acid is generally under the control of a transcriptional promoter. Preferably, the promoter is cloned with the exogenous nucleic acid. The promoter may be Petition 870190007121, dated 01 / 23 / 2019, page 25 / 76 21 / 61 any natural or synthetic promoter derived from cellular or viral genes. Examples of suitable promoters include, for example, the chicken beta-actin (Bac) promoter or a derivative thereof such as Coa5, the Pec promoter, the early immediate (ie)1 promoter of Murine Cytomegalovirus (Mcmv), the Human Cytomegalovirus (Hcmv) promoter, the Simian virus (SV)40 promoter, and the Rous Sarcoma virus (RSV) promoter or any fragments thereof that retain promoter activity. In one variant, exogenous nucleic acid is cloned downstream and under transcriptional control of a transcriptional promoter present in the DEV genome.
[0073] In a particular embodiment, the exogenous nucleic acid is located at the US4 gene sequence of the DEV viral genome, in addition to the existing US4 gene sequence (thus rendering the gene inactive by interrupting the gene sequence), or replacing a deleted US4 gene sequence, or at a mutated US4 gene sequence. In an alternative embodiment, the exogenous nucleic acid is located at the US5 gene sequence of the DEV viral genome, in addition to the existing US5 gene sequence (thus rendering the gene inactive by interrupting the gene sequence), or replacing a deleted US5 gene sequence, or at a mutated US5 gene sequence.
[0074] In a preferred embodiment, the DEV of the invention has a deletion in the US4 and US5 gene sequences, and contains an exogenous nucleic acid located in place of the deleted nucleotides.
[0075] In an alternative embodiment, the DEV of the invention Petition 870190007121, dated 01 / 23 / 2019, page 26 / 76 22 / 61 has inactive US4 and US5 genes and contains an exogenous nucleic acid located at a different cloning site, such as a site selected from the UL4 gene, the UL44 gene, the UL27-UL26 intergenic region, the UL23 gene, the UL45-UL46 intergenic region, the UL50-UL51 intergenic region, the US7 gene, the US7-US8 intergenic region, or the US10 gene. In this case, the exogenous nucleic acid can be cloned to replace all or part of said gene, or it can be inserted within said gene.
[0076] Furthermore, the DEVs of the invention may comprise several exogenous nucleic acids. In this regard, the various exogenous nucleic acids may be inserted at the same position in the virus, for example, in the US4 / US5 region as described above, under the control of a single promoter or several distinct promoters. Alternatively, the exogenous nucleic acids may be inserted at distinct cloning sites of the virus, such as one in the US4 / US5 region as described above, and at least one in a distinct region preferably selected from the UL4 gene, the UL44 gene, the UL27-UL26 intergenic region, the UL23 gene, the UL45-UL46 intergenic region, the UL50-UL51 intergenic region, the US7 gene, the US7-US8 intergenic region, or the US10 gene, typically replacing all or part of the endogenous gene or region.
[0077] The UL4 gene is typically composed of 717 bp of a DEV genome. As a reference for a CSC strain, the UL4 gene corresponds to nt112845 to nt113561 of the genome. It is understood that the knowledgeable individual can easily identify the exact location of the UL4 gene in any DEV strain using the information contained in this application and Petition 870190007121, dated 01 / 23 / 2019, p. 27 / 76 23 / 61 common general knowledge, or by sequence alignment. In a particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4, US5 and UL4 genes. More particularly, the invention relates to a DEV, wherein said virus has inactive US4, US5 and UL4 genes and comprises a first exogenous nucleic acid cloned into the US4 / US5 genes or the UL4 gene, preferably replacing at least 20% of said gene. In a particular DEV of the invention, at least 20% of the UL4 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp from the UL4 gene sequence, more preferably at least 600, 700, 800, 900, 1000 or more.
[0078] The UL23 gene is typically composed of 1077 bp of a DEV genome. As a reference for a CSC strain, the UL23 gene corresponds to nt77997 to nt79073 of the genome. It is understood that the skilled individual can easily identify the exact location of the UL23 gene in any DEV strain using the information contained in this application and general common knowledge, or by sequence alignment. In a particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4, US5 and UL23 genes. More particularly, the invention relates to a DEV, wherein said virus has inactive US4, US5 and UL23 genes and comprises a first exogenous nucleic acid cloned into the US4 / US5 genes or the UL23 gene, preferably replacing Petition 870190007121, dated 01 / 23 / 2019, p. 28 / 76 24 / 61 at least 20% of said gene. In a particular DEV of the invention, at least 20% of the UL23 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred embodiment, the DEV of the invention has a deletion of at least 500 bp from the UL23 gene sequence, more preferably at least 600, 700, 800, 900, 1000 or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt200-900 of the UL23 gene sequence, more preferably at least nt100-1000, even more preferably at least nt80-1000. In one specific example, a DEV of the invention has a deletion from nt51 to nt1027 (i.e., about 90%) of the UL23 gene sequence.
[0079] The US7 gene is typically composed of lll6 bp of a DEV genome. As a reference for a CSC strain, the US7 gene corresponds to ntl45769 to ntl46884 of the genome.It is understood that the skilled individual can easily identify the exact location of the US7 gene in any DEV strain using the information contained in this application and general common knowledge, or by sequence alignment. In a particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has inactive US4, US5, and US7 genes. More particularly, the invention relates to a DEV, wherein said virus has inactive US4, US5, and US7 genes and comprises a first exogenous nucleic acid cloned into the US4 / US5 genes or the US7 gene, preferably replacing at least 20% of said gene. In a particular DEV of the invention, at least 20% of the US7 gene sequence is deleted, more preferably. Petition 870190007121, dated 01 / 23 / 2019, p. 29 / 76 25 / 61 at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp from the US7 gene sequence, more preferably at least 600, 700, 800, 900, 1000 or more.
[0080] The invention also relates to a DEV, wherein said virus comprises a first exogenous nucleic acid cloned into genes US4 / US5 and a second exogenous nucleic acid cloned into an intergenic region located between genes UL27 and UL26, preferably replacing at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises inactive genes US4 and US5, and wherein said virus comprises an exogenous nucleic acid cloned into an intergenic region located between genes UL27 and UL26. By way of reference to a CSC strain, the intergenic region located between UL27 and UL26 corresponds to nt72195 to nt72646 of the genome. Cloning can be performed at any position within such a domain, most preferably between nt72300 and nt72500, and additionally, preferably between nt72350 and nt72450. In one specific embodiment, cloning is performed between nt72431 and nt72432.
[0081] The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene, and wherein said virus comprises an exogenous nucleic acid cloned into an intergenic region located between genes US7 and US8, or between genes UL45 and UL46, or between genes UL50 and UL51. By way of reference to a CSC strain, the intergenic region located between UL45 and UL46 corresponds to. Petition 870190007121, dated 01 / 23 / 2019, page 30 / 76 26 / 61 nt25132 to nt25352 of the genome. Cloning can be performed at any position within this domain, with greater preference between nt25200 and nt25300. In a specific embodiment, cloning is performed between nt25275 and nt25276. For reference to a CSC strain, the intergenic region located between UL50 and UL51 corresponds to ntl5914 to ntl6063 of the genome. Cloning can be performed at any position within this domain, with greater preference between ntl5970 and nt16010. In a specific embodiment, cloning is performed between ntl5979 and ntl5980.
[0082] Cloning and virus construction can be performed by techniques known to the art. Gene cloning and plasmid construction are well known to a person of average technical skill and can essentially be performed by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 4th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012).Typically, recombinant viruses can be prepared by homologous recombination between the viral genome and a construct (e.g., a homology plasmid) comprising the nucleic acid to be inserted, flanked by insertion site nucleotides to allow recombination. Cloning can be done with or without deletion of endogenous sequences. In one particular embodiment, the recombinant sequence is cloned in place of at least part of a genome sequence, such as at least 50 nucleotides or more. Such deletion increases the cloning capacity of the virus.
[0083] For construction, a sequence that contains the Petition 870190007121, dated 01 / 23 / 2019, page 31 / 76 The targeted insertion region (27 / 61) is typically first cloned into a suitable vector to produce a homology vector. Examples of vectors include plasmids such as pBR322, pBR325, pBR327, pBR328, pUC18, pUC19, pUC7, pUC8, or pUC9; phages such as lambda phage and M13 phage; or cosmids such as pHC79. The target region sequence is integrated into the vector by conventional cloning methods. The target region sequence used is preferably of sufficient length to allow subsequent homologous recombination in vivo with a DEV viral genome. Preferably, the cloned target region sequence should be at least approximately 100 nucleotides long, typically above 300, such as between 500 and 2000 nucleotides. The exogenous nucleic acid (which typically contains a gene and a promoter) is thus inserted into the cloned target region in the vector.The insertion should preferably be done in such a way that it leaves a portion of the target region sequence on each side of the cloned insert of sufficient length to allow homologous recombination (e.g., at least 50 nucleotides, preferably at least 100 nucleotides). The exogenous nucleic acid can be introduced into the cloned target region by classical techniques such as ligation procedures and restriction enzymes. If appropriate, the mutation (or mutations) can be introduced into a specific site of the target region to create a new cleavage site for a restriction enzyme. Conventional mutagenesis techniques well known to a person skilled in the art can be used for this purpose, such as in vitro mutagenesis or PCR. The homology vectors into which the exogenous nucleic acid was inserted. Petition 870190007121, dated 01 / 23 / 2019, page 32 / 76 28 / 61 in the target region can thus be introduced into a DEV-infected cell or cells transfected with DEV genome using known techniques such as electroporation, calcium phosphate, lipofectin-based method or similar. Recombinant viruses are thereby produced by recombination in said cells between the virus and the vector. The resulting recombinant virus can be selected genotypically or phenotypically using known techniques, for example, by hybridization, sequencing, PCR or a functional analysis to detect any product encoded by the exogenous nucleic acid, as described in the examples. The selected recombinant virus can be grown on a large scale in cell culture after which the recombinant viruses can be harvested. Exogenous gene
[0084] The DEV of the invention may contain any exogenous nucleic acid, preferably any exogenous gene. The exogenous gene may encode any product of interest, such as biologically active and / or immunogenic (e.g., antigenic) RNAs or proteins, polypeptides, or peptides. In a preferred embodiment, the exogenous gene encodes an antigen, even more preferably a peptide or polypeptide derived from an antigen of a pathogenic organism capable of causing infection in an animal, particularly a bird. Examples of pathogens that cause infection in birds include viruses, bacteria, fungi, protozoa, etc. The immunogenic (poly)peptide may preferably be (derived from) a surface protein, a secreted protein, or a structural protein of said pathogen, or fragments thereof. Petition 870190007121, dated 01 / 23 / 2019, page 33 / 76 29 / 61 same. The polypeptide can be derived from any source, for example, viral, prokaryotic, eukaryotic, or synthetic.
[0085] In a preferred embodiment, the exogenous gene encodes an antigenic peptide of a bird pathogen.
[0086] Specific examples of pathogens include, but are not limited to, avian influenza virus, avian paramyxovirus type 1, also known as Newcastle disease virus (NDV), avian metapneumovirus, Marek's disease virus, Gumboro disease virus, also known as infectious bursal disease virus (IBDV), infectious laryngotracheitis virus (ILTV), infectious bronchitis virus (IBV), Escherichia coli, Salmonella species, Pasteurella multocida, Riemerella anatipestifer, Ornithobacterium rhinotracheale, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma microorganisms that infect avian species, or coccidia.
[0087] Preferably, the exogenous gene encodes an antigen selected from NDV F protein, NDV HN protein, IBDV VP2 protein, ILTV gB protein, Mycoplasma galisepticum 40K protein, or avian influenza virus hemagglutinin (HA) surface protein or immunogenic fragments thereof.Within the context of the invention, the term "protein fragment" preferably designates a fragment comprising at least 5 consecutive amino acid residues of said protein, even more preferably 5-100. In a preferred embodiment, such a fragment comprises at least one epitope and / or is immunogenic in vivo, that is, it can cause the production of antibodies that bind to the protein. Petition 870190007121, dated 01 / 23 / 2019, page 34 / 76 30 / 61 full length.
[0088] Specific examples of immunogenic peptides include, for example, a peptide comprising amino acid residues 1-453 of VP2, 1-469 of gB, or 1-540 of F. Preferred DEVs
[0089] A preferred DEV of the invention comprises a deletion of all genes US4 and US5.
[0090] A particular DEV of the invention comprises a deletion of a continuous region comprising at least 50% of the nucleotide sequence of the US4 gene sequence, the entire US4-US5 intergenic region, and at least 50% of the nucleotide sequence of the US5 gene sequence.
[0091] A particular additional DEV of the invention comprises a deletion of a continuous region comprising the entire nucleotide sequence of the US4 gene sequence, the entire US4-US5 intergenic region, and the entire nucleotide sequence of the US5 gene sequence.
[0092] In a preferred embodiment of the invention, the exogenous nucleic acid encodes an avian antigen, more preferably a VP2, HN or F protein or an immunogenic fragment thereof.
[0093] Another preferred DEV of the invention comprises inactive US4 and US5 genes and at least one additional deletion selected from: . a deletion of at least nt100-nt1000 from the US7 gene sequence. . a deletion of at least nt100-nt1200 from the UL4 gene sequence, and / or . a deletion of at least nt100-nt1000 from the UL23 gene sequence. Petition 870190007121, dated 01 / 23 / 2019, page 35 / 76 31 / 61
[0094] Another preferred DEV of the invention comprises inactive US4 and US5 genes and at least one exogenous nucleic acid cloned in a distinct region, preferably selected from the UL4 gene, the UL44 gene, the UL27-UL26 intergenic region, the UL23 gene, the UL45-UL46 intergenic region, the UL50-UL51 intergenic region, the US7 gene, the US7-US8 intergenic region or the US10 gene. Nucleic acids
[0095] The invention also relates to a nucleic acid molecule comprising the genome of a DEV that has inactive US4 and US5 genes. Such nucleic acid may be single-stranded or double-stranded, DNA or RNA. In a particular embodiment, the nucleic acid is a DNA molecule containing the genome of a DEV as defined above.
[0096] Nucleic acid can be in free form, or in a vector such as a plasmid, BAC, and the like. Nucleic acid can be isolated, or contained within a host cell. Cell cultures
[0097] The recombinant viruses of the present invention can be propagated in any competent cell cultures. After the required growth of the viruses is achieved, the cells can be released from the wells using a scraper or with trypsin and the infected cells can be separated from the supernatant by centrifugation.
[0098] Examples of competent cells include CEF, embryonated eggs, chicken kidney cells, and the like. The cells or viruses can be cultured in a culture medium such as Eagle's MEM, Leibowitz-L15 / McCoy 5A culture medium (1:1 mixture) at about 37 °C for 3 to 6 days. Petition 870190007121, dated 01 / 23 / 2019, page 36 / 76 32 / 61 Infected cells are typically suspended in a culture medium containing 10% dimethyl sulfoxide (DMSO) and stored by freezing under liquid nitrogen. Compositions and vaccines
[0099] The invention also relates to compositions, such as vaccines, comprising one or more DEVs of the invention.
[0100] The compositions and vaccines of the invention may comprise the DEVs in an acceptable or pharmaceutically acceptable veterinary excipient or vehicle. The compositions and vaccines may additionally or alternatively comprise a suitable adjuvant.
[0101] The compositions and vaccines according to the present invention may comprise a suitable solvent, such as, for example, an aqueous buffer or a phosphate buffer. Preferably, the compositions and vaccines also comprise additives, such as a stabilizing agent, a preservative, a coloring agent, a surfactant, etc.
[0102] For example, the compositions or vaccines of the present invention may be formulated with one or more additional additives to maintain isotonicity, physiological pH and stability, for example, a buffer such as physiological saline solution (0.85%), phosphate-buffered saline (PBS), citrate buffers, Tris(hydroxymethyl)aminomethane (TRIS), Tristamponed saline solution and the like, or an antibiotic, for example, neomycin or streptomycin, etc.
[0103] In a particular embodiment, the composition of the invention comprises a preservative.
[0104] In another particular embodiment, the composition of the invention comprises a solubilizing agent. Petition 870190007121, dated 01 / 23 / 2019, page 37 / 76 33 / 61
[0105] In another particular embodiment, the composition of the invention comprises an adjuvant. Adjuvants can be obtained from any of several sources including various animal-derived proteins and peptides (e.g., hormones, cytokines, co-stimulatory factors), and innovative nucleic acids derived from viruses and other sources (e.g., double-stranded RNA, CpG), and the like which, alone or in combination(s), are sufficient to enhance the immune response.
[0106] The compositions of the invention may be liquid (solutions, suspensions, emulsions) or solid (powder, gel, paste, oil) and may be formulated for any route of administration. Preferably, they are formulated for injection, such as in ovo injection or for, for example, intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal and / or intraperitoneal injection. Alternatively, they may be formulated for oral, ocular (e.g., by eye drops), intranasal or oculonasal administration, for example, using aerosol or spray.
[0107] Each vaccine dose may contain an adequate dose sufficient to elicit a protective immune response in avian species. The optimization of such a dose is well known in the art. The amount of antigen per dose can be determined by known methods using antigen / antibody reactions, for example, by the ELISA method.
[0108] The vaccines of the invention can be administered as single doses or in repeated doses, depending on the vaccination protocol. Petition 870190007121, dated 01 / 23 / 2019, page 38 / 76 34 / 61
[0109] In a particular embodiment, the invention relates to a vaccine comprising a virus, nucleic acid or cell as defined above and a suitable adjuvant or excipient.
[0110] In a further particular embodiment, the invention relates to a vaccine comprising a liquid composition of a virus, nucleic acid or cell as defined above and a suitable adjuvant or excipient.
[0111] The present invention further relates to the use of the virus, composition, vaccine, nucleic acid or cell as described above for immunizing avian species, such as birds, and to the method of immunizing avian species by administering an immunologically effective amount of the virus, composition, vaccine, nucleic acid or cell as described above.
[0112] A further object of the invention relates to a composition, DEV, nucleic acid or host cell as defined above, for use in vaccinating or immunizing avian species, particularly birds, more particularly chickens, more particularly young birds (on Day 3 post-hatching or before) or in ovo.
[0113] A further object of the invention relates to a composition, vaccine, DEV, nucleic acid or host cell as defined above, for use in inducing protective immunity in avian species, particularly birds, more particularly chickens, more particularly young birds (on Day 3 post-hatching or earlier) or in ovo.
[0114] The invention also relates to a method of vaccinating a non-human animal, particularly birds, more particularly chickens, more particularly young birds. Petition 870190007121, dated 01 / 23 / 2019, p. 39 / 76 35 / 61 (on Day 3 post-hatching or before or in ovo), which comprises administering to said non-human animal a composition, vaccine, DEV, nucleic acid or host cell as defined above.
[0115] A particular object of the invention consists in a method of vaccinating poultry comprising the in ovo administration of a composition, vaccine, DEV, nucleic acid or host cell as defined above.
[0116] Another particular object of the invention consists in a method of vaccinating poultry comprising administering a composition, vaccine, DEV, nucleic acid or host cell as defined above, on Day 1 or Day 2 post-hatching.
[0117] In a further aspect, the invention provides a method for inducing a protective or immunogenic response in a non-human animal against one or more avian pathogens, comprising administering to said non-human animal, particularly birds, more particularly chickens, more particularly young birds (on Day 3 post-hatching or before) or in ovo, a composition, vaccine, DEV, nucleic acid or host cell as defined above.
[0118] As indicated in the experimental section, the viruses of the invention are particularly advantageous for vaccinating young birds (on Day 1, Day 2, or Day 3 post-hatching) or for in ovo vaccination. In fact, the invention surprisingly shows that the viruses of the invention are safe under such early administration, while wild-type or feral DEV is lethal. Such early administration, combined with the early emergence of immunity caused by these viruses, is particularly advantageous for inducing the Petition 870190007121, dated 01 / 23 / 2019, p. 40 / 76 36 / 61 early protective immunity, before birds can be substantially exposed to pathogens.
[0119] In this regard, in a more general aspect, the invention also relates to a method for vaccinating or immunizing a bird, particularly birds, more particularly chickens, wherein the method comprises administering in ovo to said bird an attenuated DEV encoding an antigen. The invention also relates to a method for expressing an exogenous gene in a bird, particularly birds, more particularly chickens, wherein the method comprises administering in ovo to said bird an attenuated DEV containing said exogenous gene. The invention also relates to the use of an attenuated DEV containing an exogenous gene to express said gene in a bird by administering in ovo said DEV. The invention also relates to an attenuated DEV encoding an antigen, for use in inducing an immune response or for vaccinating a bird by administering in ovo said DEV.The DEV preferably comprises an inactive endogenous gene, which makes said DEV attenuated and well tolerated under in ovo injection.
[0120] The present invention further relates to vaccination kits for immunizing avian species comprising an effective quantity of the multivalent vaccine as described above and a means for administering said components to said species. For example, such a kit comprises an injection device pre-filled with the vaccine according to the invention and instructions for intradermal, subcutaneous, intramuscular or in ovo injection. Alternatively, the kit comprises a spray / aerosol or Petition 870190007121, dated 01 / 23 / 2019, page 41 / 76 37 / 61 eye droplet device filled with the vaccine according to the invention and instructions for oculonasal administration, oral administration or mucosal administration.
[0121] The additional aspects and advantages of the invention will be revealed in the following experimental section, which is illustrative of the claimed invention. EXAMPLES Example 1: Virulence of wild-type DEV in eggs or young birds.
[0122] A clinical study was conducted to investigate the pathogenicity or virulence of DEV in chickens by injection at different times. More specifically, the injection was performed in ovo (Day 3 before hatching), on Day 1 post-hatching, or on Day 4 post-hatching. DEV used was a wild-type Jansen strain of DEV. The dose administered was 100 or 1000 pfu / dose. As a control, a PBS solution was administered. Pathogenicity was assessed by measuring mortality each day after hatching.
[0123] The results are presented in the following table. Group Vaccine Dose pfU Route Day1 n Number of birds dying each day % Mortality D0 D1 D2 D3 D4 D5 D6 D7 D8 >D92 1 PBS - in ovo -3 17 0 0 0 0 0 0 0 0 0 2 12 2 DEV 100 in ovo -3 16 3 1 9 1 1 - - - - - 100 3 DEV 1000 in egg -3 17 5 2 9 1 - - - - - - 100 4 DEV 1000 sc 1 17 0 0 0 0 0 6 4 2 1 1 82 5 DEV 1000 sc 4 17 0 0 0 0 0 0 0 0 0 0 0 (1) Day of age at inoculation (2) Number of dead birds between 9 and 19 days of age Petition 870190007121, dated 01 / 23 / 2019, p. 42 / 76 38 / 61 age
[0124] The above results show that injection of DEV by weight on Day 4 post-hatching is safe with a 100% survival rate (see group 5). In stark contrast, after in ovo injection of DEV, 100% of the birds died at 4 days of age, while in ovo injection of PBS is safe. These results thus showed that although DEV by weight may be suitable for administration to adult animals, surprisingly, it is lethal in young animals (Day 3 or less post-hatching) or when administered in ovo. Example 2: Virulence of DEV that has an inactive US4 or US5 gene. 2.1 DEV construct comprising an inactive US4 gene or US5 gene.
[0125] In an attempt to reduce virulence to chick embryos, inactive DEVs in US4 or US5 were constructed. Construction of rpsLneo-DsRed2 cassette
[0126] A 2.8 kb DND fragment of rpsLneo-DsRed2 cassette was constructed by PCR reactions. Briefly, three PCR reactions were conducted. The first PCR reaction was conducted using the primer pair SEQ ID NO: 1 (5'GGCCTGGTGATGATGGCGGGATCGTTGTAT -3') and SEQ ID NO: 2 (5'CCATGGTGCTGCGCTCAGAAGAACTCGTCA-3') with the sintered rpsLneo fragment array (SEQ ID NO: 3). The second PCR reaction was conducted using the primer pair SEQ ID NO: 4 (5'-ACGAGTTCTTCTGAGCGCAGCACCATGGCC-3') and SEQ ID NO: 5 (5'-TCGGAGGAGGCCATCCTTAAGAGCTGTAAT-3') with the Petition 870190007121, dated 01 / 23 / 2019, p. 43 / 76 39 / 61 pSI Mammalian Expression Vectors array plasmid (Promega, Catalog No. E1721). The third PCR reaction was conducted using the primer pair SEQ ID NO: 6 (5'-TACAGCTCTTAAGGATGGCCTCCTCCGAGA-3') and SEQ ID NO: 7 (5'GCAGTGAAAAAAATGCTTTATTTGTGAAAT-3') with the pIRES2-DsRed2 array plasmid (Clontech, Catalog No. 632420). Another PCR reaction was conducted using a mixture of PCR products from the first and second PCR reactions as a matrix and SEQ ID NO: 1 and SEQ ID NO: 5 as primers. This PCR product and the PCR product from the third PCR reaction were mixed and used for the final PCR reaction with the primer pair SEQ ID NO: 1 and SEQ ID NO:7, which results in rpsLneo-DsRed2 cassette. Insert cassette construction
[0127] A DNA fragment from an rpsLneo-DsRed2 cassette that was added to homologous sequences of DEV US4 or US5 regions (50 bp each) from both the 5' and 3' ends to both ends was conducted by PCR reaction. The PCR reaction was conducted using the rpsLneo-DsRed2 cassette as a matrix. The primer pair used is SEQ ID NO: 8 (5'ATGGCAACAATGATAGCTGTGGTGTTAGTTTTTTTGGGACGCGTTTTAGGGGCCTGGTG ATGATGGCGGG-3') and SEQ ID NO: 9 (5'TTAAACTAATGGAACGCGTTGGAATTTCAAGTCTTGGCGCCCAAACATCGGCAGTGAAA AAAATGCTTTA-3') for inactive DEV in US4 and SEQ ID NO: 10 (5'ATGTATACAGACGTTACGGTCATGTGGGTAGCCGTGATTTTATTTACTATGGCCTGGTG ATGATGCGGG-3') and SEQ ID NO: 11 (5'TCATACCATACAAAGGCATAGGTACAGCCCACAGGTTAAAAACAAAGAAAGCAGTGAAA AAAATGCTTTA-3') for inactive DEV in US5. The fragments of Petition 870190007121, dated 01 / 23 / 2019, p. 44 / 76 40 / 61 PCR samples (US4-rpsLneo-DsRed2 and US5-rpsLneoDsRed2 cassettes) were electrophoresized and purified. Construction of a recombinant DEV carrying the rpsLneoDsRed2 gene.
[0128] The construction of recombinant DEV carrying the rpsLneo-DsRed2 gene in the US4 or US5 region was conducted by homologous recombination in an E. coli strain carrying the DEV genome, transfected with 0.5 μg of US4-rpsLneoDsRed2 or US5-rpsLneoDsRed2. Transfection was performed by electroporation using the Xcell Gene Pulser (Bio-Rad Laboratories) at 1.75 kV, 25 μE, and 200 ohms. After transfection, E. coli was cultured on Luria-Bertani (LB) agar plates and incubated overnight at 30 °C. E. coli clones carrying an appropriate insert containing the rpsLneo-DsRed2 gene in US4 or US5 regions were identified by PCR using the primer pair that amplifies a region between the rpsLneo-DsRed2 gene and the DEV genome insertion site region (Junction 1). The primers are SEQ ID NO: 12 (5'AAGTGTATAAATTAGACAAGTAGCTATGCG-3') and SEQ ID NO: 13 (5'TCAGAAGAACTCGTCAAGAAGGC-3') for DEV inactive in US4 and SEQ ID NO: 13 and SEQ ID NO: 14 (5'-GTTTATATTGACGCGGAATGTTGAC-3') for DEV inactive in US5.DEV DNA was extracted from E. coli clones bearing an appropriate insert and transfected into CEF using a Nucleofector II (Lonza, Basel, Switzerland). Transfected cells were added to Leibovitz L-15 (Life Technologies Corp., Catalog No. 41300-39), McCoy's 5A Medium (Life Technologies Corp., Catalog No. 21500061) (1:1) and 4% calf serum [LM (+) medium], and cultured in 96-well tissue culture plates. Petition 870190007121, dated 01 / 23 / 2019, page 45 / 76 41 / 61 and thus incubated at 37 °C in 4-5% CO2 for 5-7 days until the cytopathic effect of DEV (CPE) became visible. DEVs carrying the rpsLneo-DsRed2 gene in US4 or US5 regions were successfully recovered (DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2). Genome structure verification
[0129] The genome structure of recombinant DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2 was verified by three PCR reactions that amplify the junction regions (Junction 1, Junction 2, and Junction 3) at each end of the inserted gene. The primer pairs used in the PCR reactions for Junction 1 are described above. In DEV / US4 / rpsLneo-DsRed2, the primer pairs used in the PCR reactions are SEQ ID NO: 6 and SEQ ID NO: 15 (5'CATTTTAACCGTTTAAGTCAACATTCCGC-3') for Junction 2 and SEQ ID NO: 12 and SEQ ID NO: 15 for Junction 3. In DEV / US5 / rpsLneoDsRed2, the primer pairs used in the PCR reactions are SEQ ID NO: 6 and SEQ ID NO: 16 (5'ACTGAGATGTTGGACCATCAAATCCTG-3') for Junction 2 and SEQ ID NO: 14 and SEQ ID NO: 16 for Junction 3. The expected sizes of PCR products were observed, confirming that DEV / US4 / rpsLneo-DsRed2 and DEV / US5 / rpsLneo-DsRed2 had the expected genome structures. 2.2 Expression of an exogenous gene by recombinant DEVs possessing an inactive US4 or US5 gene.
[0130] The expression of the DsRed2 protein by DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2 was confirmed by excitation to DsRed2. Excitation to DsRed2 was conducted using CEF infected with DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2. Petition 870190007121, dated 01 / 23 / 2019, pp. 46 / 76 42 / 61 Briefly, CEF cells in a 6-well plate were infected with DEV / US4 / rpsLneo-DsRed2. DEV / US5 / rpsLneo-DsRed2, or the main DEV strain, was detected at a multiplicity of infection of approximately 0.01. Three days post-inoculation, cells were excited at 563 nm and red fluorescence was observed on recombinant DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2 plates, thus confirming current protein expression by recombinant DEVs. 2.3 Viability and Stability of recombinant DEVs that have an inactive US4 or US5 gene.
[0131] DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2 were cultured in CEF fifteen times and confirmed the stability of the inserted gene of rpsLneo-DsRed2. Passage was conducted every three to four days. Every five passages, the DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2 plates were checked with red fluorescence by fluorescence microscopy, and their genome structures were confirmed by PCR analysis amplifying the junction regions (Junction 1, Junction 2, and Junction 3) with the primers shown in Example 2. Red fluorescence and the expected sizes of PCR products were observed in all viruses examined, confirming that DEV / US4 / rpsLneo-DsRed2 and DEV / US5 / rpsLneoDsRed2 retained the rpsLneo-DsRed2 gene for at least fifteen passages. 2.4 Virulence of inactivated DEV in US4 or US5 via in ovo administration.
[0132] DEV / US4 / rpsLneo-DsRed2 or DEV / US5 / rpsLneo-DsRed2 were inoculated into 18-day-old chicken embryos Petition 870190007121, dated 01 / 23 / 2019, page 47 / 76 43 / 61 of SPF to investigate its pathogenicity or virulence to chick embryos. Chick embryos were administered in ovo with approximately 1000 pfu / 0.1 ml of DEV / US4 / rpsLneo-DsRed2, DEV / US5 / rpsLneo-DsRed2, DEV main, or 0.1 ml of PBS through 20-gauge, 38.1 mm (1.5-inch) needles. Chicks were observed daily for clinical signs associated with DEV, such as depression and death, for 11 days. The results are shown in the following table. Vaccine n Non-Hatching Number of birds dying each day % Mortality D0 D1 D2 D3 D4 D5 >D61 PBS 22 2 0 0 0 0 2 0 0 18 DEV / US4 / rspLneoDs Red2 22 5 3 1 6 5 2 100 DEV / US5 / rspLneoDs Red2 22 2 6 0 6 4 4 100 DEV 22 0 6 1 8 4 2 0 0 95 (1) Number of dead birds between 6 and 11 days old
[0133] All chicks inoculated in ovo with inactive DEVs in US4 or US5 died 4 days after hatching, while 95% of chicks inoculated with the main DEV died. These results showed that inactive DEV in US4 or US5 still has pathogenicity and virulence for chick embryos upon in ovo administration. Example 3: Construction of DEVs comprising inactive US4 and US5 genes.
[0134] For the construction of inactive DEV in US4 and US5, a homology vector was first constructed and then used to generate the virus by homologous recombination in E. coli. Plasmid constructs and DNA manipulation were essentially performed according to standard molecular biology techniques (Molecular Cloning: A Petition 870190007121, dated 01 / 23 / 2019, page 48 / 76 44 / 61 Laboratory Manual. 4th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012) . Construction of the homology vector
[0135] A 1.1 kb DNA fragment from the DEV genome flanking the US3 and US6 genes was cloned by PCR reactions that add the Sfil recognition site to the insertion site. Briefly, using DNA extracted from DEV as a template, two PCR reactions were conducted. The primer pairs used are SEQ ID NO: 17(5'GCGCATGCTAGCTGATCTAACTTTAC-3') and SEQ ID NO: 18(5'GGTGGCCAATAAGGCCTGACGGCAATATGT-3'), and SEQ ID NO: 19(5'TCAggccttattggccACCAGCTACACAAG-3') and SEQ ID NO: 20(5'GCGAATTCGATTAATTCTCCCGAACTGTTG-3'). Another PCR reaction was conducted using a mixture of PCR products from the two previous PCR reactions as matrices and SEQ ID NO: 17 and SEQ ID NO: 20 as primers. A PCR fragment obtained was cloned into the pUC18 vector (GenBank Accession No. L09136) after digestion with EcoRI and SphI, resulting in pUC18-KAPEVAC-US4US5del-SfiI, which comprises a portion of the US3 and US6 regions of the DEV genome.Next, a homology vector containing a promoter and IBDV VP2 gene from the standard challenge strain (VP2-STC) was constructed using the pUC18-KAPEVAC-US4US5del-SfiI plasmid. First, pUC18-KAPEVAC-US4US5del-SfiI was cleaved with SfiI and dephosphorylated with recombinant Shewanella sp. S1B1 Alkaline Phosphatase (PAP) (Funakoshi No. DE110). Thus, the chicken Beta-actin (Bac) promoter (SEQ ID NO: 21) and VP2-STC genes were obtained by Bg1L digestion of p45 / 46bacVP2STC#l1 (Patent No. US 6,764,684). Finally, this Bac promoter-VP2-STC cassette was inserted into pUC18-KAPEVACPetition 870190007121, dated 01 / 23 / 2019, page 49 / 76. 45 / 61 US4US5del-SfiI digested by SfiI, resulting in pUC18KAPEVAC-US4US5del-BacVP2stc (Fig. 2). This plasmid, pUC18-KAPEVAC-US4US5del-BacVP2stc, was used to construct DEV / US4US5del / BacVP2stc (Fig. 2). Construction of DEV / US4US5del / BacVP2
[0136] The construction of DEV carrying the BacVP2 gene in the US4-US5 region was conducted by homologous recombination in an E. coli strain carrying the DEV genome, transfected with 0.5 μg of pUC18-KAPEVAC-US4US5del-BacVP2stc. The transfection condition was described in Example 2. E. coli clones carrying an appropriate insert containing the BacVP2 gene were identified by PCR using the primer pair that amplifies a region between the BacVP2 gene and the DEV genome insertion site region (Junction 1, Figure 2). The primers are SEQ ID NO: 22 (5'-GTCCACTATGCCATGACATAGGTG3') and SEQ ID NO: 23 (5'-GAGCAACTTCGAGCTGATCC-3'). DEV DNA was extracted from E. coli clones carrying an appropriate insert and transfected into CEF. The transfected cells were incubated until the DEV CPE became visible. DEV / US4US5del / BacVP2, which eliminates its US4 and US5 genes and has the BacVP2 gene, was successfully constructed. Genome structure verification
[0137] The genome structure of DEV / US4US5del / BacVP2 was verified by three PCR reactions that amplify the junction regions (Junction 1, Junction 2, and Junction 3; Figure 2) at each end of the inserted gene. The primer pairs used in the PCR reactions for Junction 1 are described above. The primer pair used in the PCR reactions for Junction 2 is SEQ ID NO: 24 (5'GCCAGGGAATCCAGGGAAAAAGAC-3') and SEQ ID NO: 12 for Junction 3. Petition 870190007121, dated 01 / 23 / 2019, pp. 50 / 76 46 / 61 3, SEQ ID NO: 22 and SEQ ID NO: 12 were used. The expected sizes of PCR products were observed, confirming that DEV / US4US5del / BacVP2 had the expected genome structure. Example 4: VP2 gene expression by DEV / US4US5del / BacVP2.
[0138] Expression of the VP2 protein by recombinant DEV / US4US5del / BacVP2 was confirmed by black plate analysis. In summary, CEF infected with DEV / US4US5del / BacVP2s was fixed with a methanol:acetone mixture (1:2) and incubated with R63 monoclonal anti-IBDV VP2 antibody (ATCC No.: HB-9490). Subsequently, incubated with biotinylated anti-mouse IgG antibody (Vector Laboratories, Cat. No. BA-9200) and then with VECTASTAIN ABC-AP kit (Vector Laboratories, Cat. No. AK5000), the plates expressing the VP2 protein were stained by the addition of NBT / BCIP solution (Roche Applied Science, Cat. No. 1681451). As shown in Figure 3, the expression of the VP2 protein was observed in cells infected with DEV / US4US5del / BacVP2. Example 5: In ovo administration of DEV / US4US5del / BacVP2.
[0139] DEV / US4US5del / BacVP2 were inoculated into 18-day-old SPF chick embryos. All embryo groups were vaccinated in ovo with approximately 1000 pfu / 0.1 ml of recombinant DEV / US4US5del / BacVP2, primary DEV, or 0.1 ml of PBS using 20-gauge, 38.1 mm (1.5-inch) needles. Chicks were observed daily for clinical signs associated with DEV, such as depression and death, for 35 days. Five weeks post-hatching, hens were examined for weight gain and autopsied and observed for gross lesions. Petition 870190007121, dated 01 / 23 / 2019, pp. 51 / 76 47 / 61 observables. The results are shown in the following table. Vaccine No Hatching Number of birds dying each day % Mortality Depressed birds Average BW (g) D0 D1 D2 D3- D81 D9 D10 D11 >D122 PBS 16 0 0 0 0 0 0 0 0 0 0.0 0 433.3 DEV / US4US5del / BacVP2 16 0 0 0 0 0 1 0 1 0 11.8 0 468.3 DEV 17 7 4 0 6 - - - - - 100.0 - - (1) Number of dead birds between 3 and 8 days old (2) Number of dead birds between 12 and 35 days old
[0140] The mortality of birds inoculated with DEV / US4US5del / BacVP2, which eliminated both the US4 and US5 genes, was 11.8%, while with the main DEV it was 100%, showing that the virulence and pathogenicity of DEV were substantially reduced by inactivation (i.e., deletion) of both the US4 and US5 genes. Furthermore, the average body weight of surviving birds inoculated with DEV / US4US5del / BacVP2 was comparable to that with PBS. These results demonstrate the effectiveness of the DEVs of the invention for in ovo vaccination. Example 6: DEV / Coa5VP2 construction comprising inactive US4 and US5 genes.
[0141] In this section, DEVs that had deletions in both the US4 and US5 genes and carried the VP2 gene driven by the Bac major promoter region (Coa5 promoter; SEQ ID NO: 25) were constructed. For the construction of these DEVs, the homology vectors were, firstly, Petition 870190007121, dated 01 / 23 / 2019, pp. 52 / 76 48 / 61 constructed and thus used to generate viruses by homologous recombination in E. coli. Construction of puC18-KAPEVAC-US4US5del
[0142] A 1.1 kb DNA fragment from the DEV genome flanking the US3 and US6 genes was cloned by PCR reactions (Figure 4). Briefly, using DNA extracted from DEV as a template, two PCR reactions were conducted. The primer pairs used were SEQ ID NO: 17 and SEQ ID NO: 26 (5'GCTTGTGTAGCTGGTTGACGGCAATATG-3'), and SEQ ID NO: 27 (5'CATATTGCCGTCAACCAGCTACACAAGC-3') and SEQ ID NO: 20 (5'gcGAATTCGATTAATTCTCCCGAACTGTTG-3'). Another PCR reaction was conducted using a mixture of PCR products from the two previous PCR reactions as a template and SEQ ID NO: 17 and SEQ ID NO: 20 as primers. A PCR fragment obtained was cloned into a pUC18 vector after digestion with EcoRI and SphI, resulting in pUC18-KAPEVAC-US4US5del (Figure 4). Construction of DEV / US4US5del
[0143] The construction of recombinant DEV / US4US5del, which had a deletion in both the US4 and US5 genes, was conducted by homologous recombination in E. coli carrying a DEV genome, transfected with 0.5 μg of pUC18-KAPEVACUS4US5del. E. coli clones carrying an appropriate deletion (DH10B / DEV / US4US5del) were identified by PCR using the primer pair that amplifies a region between US3 and US6 (Junction 1; Figure 4). The primers used are SEQ ID NO: 22 and SEQ ID NO: 20. DEV DNA was extracted from the E. coli clones and transfected into CEF to rescue DEV / US4US5del. Petition 870190007121, dated 01 / 23 / 2019, page 53 / 76 49 / 61 Construction of puC18-KAPEVAC-UL23del-Coa5VP2
[0144] A 1.0 kb DNA fragment of DEV genome flanking the UL24 and UL22 genes was cloned by PCR reactions that add the SfiI recognition site to the insertion site (Figure 5). Briefly, using DNA extracted from DEV as a template, two PCR reactions were conducted. The primer pairs used are SEQ ID NO: 28 (5'-GCGCATGCCAATTGTCTAATTCCAG-3') and SEQ NO: 29 (5'CCCGGCCAATAAGGCCACAGAAAAAGCGCG-3'), and SEQ ID NO: 30 (5'CTGTGGCCTTATTGGCCGGGATCTGGAAC-3') and SEQ ID NO: 31 (5'GCGAATTCATGTGCTACGCCCAG-3'). Another PCR reaction was conducted using a mixture of PCR products from the two previous PCR reactions as a matrix and SEQ ID NO: 28 and SEQ ID NO: 31 as primers. A PCR fragment obtained was cloned into a pUC18 vector after digestion with EcoRI and SphI, resulting in pUC18-KAPEVAC-UL23del-SfiI. Subsequently, a homology vector containing a promoter and VP2-STC was constructed using the pUC18KAPEVAC-UL23del-SfiI plasmid.First, pUC18-KAPEVACUL23del-SfiI was cleaved with SfiI and dephosphorylated with PAP. The Coa5 promoter was obtained from the pGICOA plasmid (US Patent No. 6,866,852) by digestion of Bg1I and XbaI, and ligated with an XbaI-EcoRI fragment (6.3 kb) and an EcoRI-Bg1I fragment (0.1 kb) from p45 / 46bacVP2-STC#11 (US Patent No. 6,764,684), resulting in p45 / 46COA5VP2-STC#11. The Coa5 promoter cassette-VP2-STC was thus cut from p45 / 46COA5VP2-STC#11 by Bg1I digestion and ligated with SfiI-digested pUC18-KAPEVAC-UL23del-SfiI, resulting in pUC18-KAPEVAC-UL23del-Coa5VP2. This plasmid was used to construct DEV / US4US5del / UL23 / Coa5VP2. Petition 870190007121, dated 01 / 23 / 2019, pp. 54 / 76 50 / 61 Construction of puC18-KAPEVAC-UL26-Coa5VP2
[0145] A 1.0 kb DNA fragment from the DEV genome flanking the UL26 and UL27 genes was cloned by PCR reactions that add the SfiI recognition site to the insertion site (Figure 6). Briefly, using DNA extracted from DEV as a template, two PCR reactions were conducted. The primer pairs used are SEQ ID NO: 32 (5'-CGGTCGACACTCCCAGGGGTGAAGC-3') and SEQ ID NO: 33 (5'CGGCCAATAAGGCCAAGAATGCATTCGGCC-3'), and SEQ ID NO: 34 (5'TGGCCTTATTGGCCGCCGTATGAATTGCGC-3') and SEQ ID NO: 35 (5'GCGAGCTCTGCAACCACAGACCGC-3'). Another PCR reaction was conducted using a mixture of PCR products from the two previous PCR reactions as a matrix and SEQ ID NO: 32 and SEQ ID NO: 35 as primers. A PCR fragment obtained was cloned into a pUC18 vector after digestion with SalI and SacI, resulting in pUC18-KAPEVAC-UL26-SfiI.Next, a homology vector containing a promoter and IBDV VP2 gene from the standard challenge strain was constructed using the pUC18-KAPEVAC-UL26-SfiI plasmid. First, pUC18-KAPEVAC-UL26-SfiI was cleaved with SfiI and dephosphorylated with PAP. The Coa5-VP2-STC promoter cassette was cut from pUC18-KAPEVAC-UL23del-Coa5VP2 by SfiI digestion and ligated with the SfiI-digested pUC18-KAPEVAC-UL26-SfiI, resulting in pUC18-KAPEVAC-UL26Coa5VP2. This plasmid was used to construct DEV / US4US5del / UL26 / Coa5VP2. Construction of puC18-KAPEVAC-UL45-Coa5VP2
[0146] A 1.0 kb DNA fragment of the DEV genome flanking the UL45 and UL46 genes was cloned by PCR reactions adding the SfiI recognition site to Petition 870190007121, dated 01 / 23 / 2019, pp. 55 / 76 51 / 61 insertion site (Figure 7). Briefly, using DNA extracted from DEV as a matrix, two PCR reactions were conducted. The primer pairs used are SEQ ID NO: 36 (5'-CGGTCGACATAGAACGCGCTTCATCTAA-3') and SEQ ID NO: 37 (5'TGGCCAATAAGGCCGTTTATTGTTTATTAT-3'), and SEQ ID NO: 38 (5'CGGCCTTATTGGCCAATCTGATTCATCCAA-3') and SEQ ID NO: 39 (5'GCGAGCTCCGCCTAATCACAATCGGTATTG-3'). Another PCR reaction was conducted using a mixture of PCR products from the two previous PCR reactions as a matrix and SEQ ID NO: 36 and SEQ ID NO: 39 as primers. A PCR fragment obtained was cloned into a pUC18 vector after digestion with SalI and SacI, resulting in pUC18-KAPEVAC-UL45-SfiI. Subsequently, a homology vector containing a promoter and IBDV VP2 gene from the standard challenge strain was constructed using the pUC18-KAPEVAC-UL45-SfiI plasmid. First, pUC18-KAPEVAC-UL45-SfiI was cleaved with SfiI and dephosphorylated with PAP.The Coa5 promoter cassette-VP2STC was cut from pUC18-KAPEVAC-UL23del-Coa5VP2 by SfiI digestion and ligated with pUC18-KAPEVAC-UL45-SfiI digested in SfiI, resulting in pUC18-KAPEVAC-UL45Coa5VP2. This plasmid was used to construct DEV / US4US5del / UL45 / Coa5VP2. Construction of puC18-KAPEVAC-UL50-Coa5VP2
[0147] A 1.0 kb DNA fragment from the DEV genome flanking the UL50 and UL51 genes was cloned by PCR reactions adding the SfiI recognition site to the insertion site (Figure 8). Briefly, using DNA extracted from DEV as a template, two PCR reactions were conducted. The primer pairs used are SEQ ID NO: 40 (5'-CCGCATGCGCAACTATATATGTCGGTC-3') and SEQ ID NO: 41 (5' Petition 870190007121, dated 01 / 23 / 2019, pp. 56 / 76 52 / 61 GGGCCAATAAGGCCCAAAAGTACATTTTGT-3'), and SEQ ID NO: 42 (5'GGGCCTTATTGGCCCAATTTATTTACTATT-3') and SEQ ID NO: 43 (5'GCGAATTCTGGATATGATATACCGTTGC-3'). Another PCR reaction was conducted using a mixture of PCR products from the two previous PCR reactions as a matrix and SEQ ID NO: 40 and SEQ ID NO: 43 as primers. A PCR fragment obtained was cloned into the pUC18 vector after digestion with EcoRI and SphI, resulting in pUC18-KAPEVAC-UL50-SfiI. Subsequently, a homology vector containing a promoter and IBDV VP2 gene from the standard challenge strain was constructed using the pUC18-KAPEVAC-UL50-SfiI plasmid. First, pUC18-KAPEVAC-UL50-SfiI was cleaved with SfiI and dephosphorylated with PAP. The Coa5 promoter cassette-VP2STC was cut from pUC18-KAPEVAC-UL23del-Coa5VP2 by SfiI digestion and ligated with SfiI-digested pUC18-KAPEVAC-UL50-SfiI, resulting in pUC18-KAPEVAC-UL50Coa5VP2. This plasmid was used to construct DEV / US4US5del / UL50 / Coa5VP2. Construction of DEV / US4US5del / Coa5VP2stc
[0148] The construction of recombinant DEVs having deletions in the US4 and US5 genes and carrying the COSL5 VP2 gene in the UL23, UL26 / UL27, UL45 / UL46, or UL50 / UL51 regions was conducted by homologous recombination in an E. coli strain transfected with DEV / US4US5del and 0.5 μg of one of pUC18-KAPEVAC-UL23del-Coa5VP2, pUC18-KAPEVAC-UL26-Coa5VP2, pUC18-KAPEVAC-UL45-Coa5VP2, or pUC18-KAPEVAC-UL50-Coa5VP2. The transfection condition was described in Example 2. After transfection, E. coli clones carrying an appropriate insert containing the Coa5VP2 gene were identified by PCR using the primer pair that amplifies a region Petition 870190007121, dated 01 / 23 / 2019, pp. 57 / 76 53 / 61 between the Coa5VP2 gene and the DEV genome insertion site region (Junction 1, Figure 5-8). The primers are SEQ ID NO: 23 and SEQ ID NO: 28 for insertion site UL23, SEQ ID NO: 32 for insertion site UL26 / UL27, SEQ ID NO: 36 for insertion site UL45 / UL46, or SEQ ID NO: 40 for insertion site UL50 / UL51. Modified DEV DNAs were extracted from E. coli clones carrying an appropriate insert and transfected into CEF using Nucleofector II. Transfected cells were added to LM (+) medium, cultured in 96-well tissue culture plates, and incubated at 37 °C in 4-5% Co2 for 5-7 days until DEV CPE became visible. After transfection, DEVs that have inactive US4 and US5 genes and carry the Coa5VP2 gene were successfully recovered (DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2 and DEV / US4US5del / UL50 / Coa5VP2). Genome structure verification
[0149] The genome structures of DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, and DEV / US4US5del / UL50 / Coa5VP2 were verified by three PCR reactions that amplify the junction regions (Junction 1, Junction 2, and Junction 3; Figure 58) at each end of the inserted gene. The primer pairs used in the PCR reactions for Junction 1 are described above. The primer pair used in PCR reactions for Junction 2 is SEQ ID NO: 24 and SEQ ID NO: 31 (insertion site UL23), SEQ ID NO: 35 (insertion site UL26 / UL27), SEQ ID NO: 39 (insertion site UL45 / UL46), or SEQ ID NO: 43 (insertion site UL50 / UL51). For Junction 3, the primer pairs are SEQ ID NO: 28 / SEQ ID NO: 31 (insertion site UL50 / UL51). Petition 870190007121, dated 01 / 23 / 2019, pp. 58 / 76 54 / 61 (insertion site UL23), SEQ ID NO: 32 / SEQ ID NO: 32 / SEQ ID NO: 35 (insertion site UL26 / UL27), SEQ ID NO: 36 / SEQ ID NO: 39 (insertion site UL45 / UL46), or SEQ ID NO: 40 / SEQ ID NO: 43 (insertion site UL50 / UL51) were used. The expected sizes of PCR products were observed, which confirms that DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, and DEV / US4US5del / UL50 / Coa5VP2 had the expected genome structure. Example 7: Expression of the VP2 gene by DEV / Coa5VP2 comprising inactive US4 and US5 genes.
[0150] The expression of the VP2 protein by DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, and DEV / US4US5del / UL50 / Coa5VP2 was confirmed by black plaque analysis and western blot analysis. The black plaque analysis method was described in Example 4. As shown in Figure 9, VP2 protein expression was observed in cells infected with DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, or DEV / US4US5del / UL50 / Coa5VP2. Western blot analysis was conducted using scleroderma cells (SDCs) infected with DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, or DEV / US4US5del / UL50 / Coa5VP2 and anti-IBDV VP2 monoclonal antibody R63. Briefly, SDCs in 12-well plates were infected with one of the recombinant viruses or the primary DEV. Four days after inoculation, cells were harvested with trypsin and centrifuged at 913 xg for 5 minutes. The pellet was washed with PBS and resuspended with 25 μl of PBS.After adding the same volume of 2 x SDS sample buffer (130 mM of. Petition 870190007121, dated 01 / 23 / 2019, pp. 59 / 76 55 / 61 A cell suspension of 12.5% polyacrylamide gel (Tris-Cl), 6% SDS, 20% Glycerol, 10% 2-Mercaptoethanol, and 0.01% Bromophenol Blue was scalded for 5 minutes. Samples were separated by SDS-PAGE using 12.5% polyacrylamide gel and transferred to a PVDF membrane (Immobilon-P, Millipore). The membrane was completely dried and then incubated with the monoclonal antibody R63. After the R63 antibody was removed, the biotinylated anti-mouse IgG antibody was then incubated with the VECTASTAIN ABC-AP kit. The protein bound to the monoclonal antibody R63 was visualized by adding NBT / BCIP solution. The 40 kilodalton protein bands, which is the expected size of the VP2 protein, were observed in all pathways with recombinant cells (Figure 10), confirming that cells infected with recombinant viruses expressed VP2 protein. Example 9: Stability of DEV / Coa5VP2 comprising inactive US4 and US5 genes.
[0151] DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2 and DEV / US4US5del / UL50 / Coa5VP2 were cultured in CEF fifteen times and the stability of the inserted BacVP2 gene was correctly confirmed. Passage was conducted every three to four days. After every five passages, cells infected with DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2 or DEV / US4US5del / UL50 / Coa5VP2 were verified for VP2 gene expression by black plate analysis and their genome structures were confirmed by PCR analysis amplifying the junction regions (Junction 1, Junction 2, and Petition 870190007121, dated 01 / 23 / 2019, pp. 60 / 76 56 / 61 Junction 3; Figure 5-8) with the primers shown in Example 7. As a result, no revision of the US4 and US5 genes and no deletion in the Coa5VP2 gene were observed, which shows that these viruses are stable in CEF. Example 10: In ovo administration of DEV / Coa5VP2 comprising inactive US4 and US5 genes.
[0152] In this study, the protective and safe in ovo efficacy against virulent IBDV is examined. DEV / US4US5del / UL23 / Coa5VP2, DEV / US4US5del / UL26 / Coa5VP2, DEV / US4US5del / UL45 / Coa5VP2, and DEV / US4US5del / UL50 / Coa5VP2, or primary DEV, are inoculated into 18-day-old SPF chicken embryos. All embryo groups are vaccinated in ovo with approximately 1000 pfu / 0.1 ml of recombinant virus, primary DEV, or 0.1 ml of PBS using 20-gauge, 38.1 mm (1.5-inch) needles. Chicks are observed daily for clinical signs associated with DEV, such as depression and death, for 42 days. The animals are combined and weighed weekly between 1 and 5 weeks of age to assess humoral immunity against IBDV and to verify the virulence of the viruses. Anti-IBDV antibodies are quantified using a commercial IBDV ELISA kit (ID SCREEN IBD VP2; ID Vet).All chickens except those in Group 1 are investigated with an average embryonic infectious dose of 103 (EID50) of a standard challenge strain (STC) of virulent IBDV via oral administration. Chickens are observed daily for clinical signs associated with IBD, such as depression and death. Seven days after the challenge, chickens are autopsied and grossly observable bursal lesions are noted, such as edema, discoloration, atrophy, and hemorrhage. Petition 870190007121, dated 01 / 23 / 2019, pp. 61 / 76 57 / 61 and gelatinous or yellow exudates. Body and bursa weights are also measured at necropsy to calculate the B / B index, which is the ratio between the bursa weight and the body weight of the birds investigated divided by the same ratio for birds not investigated.
[0153] The results of this trial confirmed the safety, stability and effective expression in vivo. LIST OF SEQUENCES SEQ ID NO: 1 F-rpsL: (5'-GGCCTGGTGATGATGGCGGGATCGTTGTAT-3') SEQ ID NO: 2 R-SV40promoter-neoR-rpsL: (5'CCATGGTGCTGCGCTCAGAAGAACTCGTCA-3') SEQ ID NO: 3 rpsLneo: (5'GGCCTGGTGATGATGGCGGGATCGTTGTATATTTCTTGACACCTTTTCGGCATCGCCCT AAAATTCGGCGTCCTCATATTGTGTGAGGACGTTTTATTACGTGTTTACGAAGCAAAAG CTAAAACCAGGAGCTATTTAATGGCAACAGTTAACCA GCTGGTACGCAAACCACGTGCTCGCAAAGTTGCGAAAAGCAACGTGCCTGC GCTGGAAGCATGCCCGCAAAAACGTGGCGTATGTACTCGTGTATATACTAC CACTCCTAAAAAACCGAACTCCGCGCTGCGTAAAGTATGCCGTGTTCGTCTGACTAACG GTTTCGAAGTGACTTCCTACATCGGTGGTGAAGGTCACAACCTGCAGGAGCACTCCGTG ATCCTGATCCGTGGCGGTCGTGTTAAAGACCTCCCGG GTGTTCGTTACCACACCGTACGTGGTGCGCTTGACTGCTCCGGCGTTAAAGACCGTAAG CAGGCTCGTTCCAAGTATGGCGTGAAGCGTCCTAAGGCTTAAGG AGGACAATCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCT TGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGC TCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGAC CGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGC GGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACT GAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCA GGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAA TGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACAT Petição 870190007121, de 23 / 01 / 2019, pág. 62 / 76 58 / 61 CGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTC TTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCG AACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCG TGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGA TTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTAC CCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCT GACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCCCTTCTAT CGCCTTCTTGACGAGTTCTTCTGA-3') SEQ ID NO: 4 F-neoR-SV40promoter:(5'ACGAGTTCTTCTGAGCGCAGCACCATGGCC-3') SEQ ID NO: 5 R-dsRedSV40promoter-intron: (5'-TCGGAGGAGGCCATCCTTAAGAGCTGTAAT-3') SEQ ID NO: 6 F-SV40promoter-intron-dsRed:(5'TACAGCTCTTAAGGATGGCCTCCTCCGAGA-3') SEQ ID NO: 7 R-SV4 0polyA-dsRed:(5'GCAGTGAAAAAATGCTTTATTTGTGAAAT-3') SEQ ID NO: 8 F-DEV-US4-rpsLneo:(5'ATGGCAACAATGATAGCTGTGGTGTTAGTTTTTTTGGGACGCGTTTAGGGCCTGGTG ATGATGGCGGG-3') SEQ ID NO: 9 R-DEV-US4-rpsLneoSV40DsRed:(5'TTAAACTAATGGAACGCGTTGGAATTTCAAGTCTTGGCGCCCAAACATCGGCAGTGAAA AAAATGCTTTA-3') SEQ ID NO: 10 F-DEV-US5-rpsLneo:(5'ATGTATACAGACGTTACGGTCATGTGGGTAGCCGTGATTTTATTTACTATGCCTGGTGA TGATGGCGGG-3') SEQ ID NO: 11 R-DEV-US5-rpsLneosSV40DsRed: (5'TCATACCATACAAAGGCATAGGTACAGCCCACAGGTTAAAAACAAAGAAGCAGTGAAA AAAATGCTTTA-3') SEQ ID NO: 12 F-VAC-136981: (5'AAGTGTATAAATTAGACAAGTAGCTATGCG-3') SEQ ID NO: 13 R-neo: (5'-TCAGAAGAACTCGTCAAGAAGGC-3') Petition 870190007121, of 23 / 01 / 2019, p. 63 / 76 59 / 61 SEQ ID NO: 14 F-VAC-138520: (5'-GTTTATATTGACGCGGAATGTTGAC3') SEQ ID NO: 15 R-VAC-138560:(5'CATTTTAACCGTTTAAGTCAACATTCCGC-3') SEQ ID NO: 16 R-VAC—140339:(5'ACTGAGATGTTGGACCATCAAATCCTG-3') SEQ ID NO: 17 F-SphIKAPEVAC-138500: (5'-gcGCATGCTAGCTGATCTAACTTTAC-3') SEQ ID NO: 18 R-KAPE-US45del-Sfflinsertion:(5'GGTGGCCAATAAGGCCTGACGGCAATATGT-3') SEQ ID NO: 19 F-KAPE-US45del-SfiIinsertion:(5'TCAggccttattggccACCAGCTACACAAG-3') SEQ ID NO: 20 R-EcoRIKAPEVAC- 142750: (5'-gcGAATTCGATTAATTCTCCCGAACTGTTG-3') SEQ ID NO: 21 Chicken Beta-actin Promoter: (5'tgcagctcagtgcatgcacgctcattgcccatcgctacctgcctcctgct cacacgcggaccccgctccccctcccaaaagcactgtggaatcaaaaagggggg gggggatggaggggcgtcacccccgccccacaccctcgaggtgagcccca cgttctgcttcactctccccccccccccccccccctttgtattttt atttttaattattttgtgcgcgatgggcggggggggggggcgcgcggcggcggcggcggcggcgccaat cagagcggcgcgctccgaaagtttccttttatggcggcggcggcggcggcggc taaaaagcgaagcgcgcggcgcggcgcgctgcgcgctcgccgcccggctgactgaccgcgttactcccacg gtgagcgcgcgcggccccgcgcgcgcgcgc gctcgtttctttctgtggctgcgtgaaagccttaaagggctccgggggggcctttgt gcgggggggcggcgggggggcgtggtgtgtgtggggggcgcgcgtg cggctcgcgctgcccggcggctgcgcgcgcgcggcggcgg tccgcagtgtcgcgaggggcgcggcgggcgggcccgcggtgcgaggggaacaaaggctgcgtgcggggggtgtgggtgggggggtgcgggggctgcaccccccccgaagttgctgagca cggcccggctc Petition 870190007121, of 23 / 01 / 2019, p. 64 / 76 60 / 61 gcggggggtggcggcgggggggcgcggcggcggccgcggcggcgcggcggctgtcgaggcgcggcgcgcgcgcggcggc aaatctgtgcggagccgaaatctgggaggcgcgcgcacccctctagcgggcgcggg gcgaagcgggcggcgcggcggcgc ttcggggggggacggggcggcggggttcggctctggtgtgacggcggggtttat atcttccctctctgttcctcgcgccc-3') SEQ ID NO: 22 F-KAPEVAC-138407: (5'GTCCACTATGCCATGACATAGGTG-3') SEQ ID NO: 23 STC1109S: (5'-GAGCAACTTCGAGCTGATCC-3') SEQ ID NO: 24 STC201AS: (5'-GCCAGGGAATCCAGGGAAAAAGAC-3') SEQ ID NO: 25 promoter Coa5: (5'TATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGCGCGCGCCAGGC GGGGCGGGGCGGGGCGAGGGGCGGGCGGGCGAGGCGGAGAGGTGCGG CGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGC GGCGGCGGCGGCGGCCCTATAAAGCGAAGCGCGCGGCGGGCGGGAGT CGCTGCGCGCTGCCTTCCGCCCCGTGCCCCGCTCCGCGCGCCTCGCGCCCG CCCGCCCCGGCTCTGACTGACCGCGT-3') SEQ ID NO: 26 R-KAPEUS45del: (5'-GCTTGTGTAGCTGGTTGACGGCAATATG-3') SEQ ID NO: 27 F-KAPE-US45del:(5'CATATTGCCGTCAACCAGCTACACAAGC-3') SEQ ID NO: 28 F-SphI-KAPEVAC-76350:(5'GCGCATGCCAATTGTCTAATTCCAG-3') SEQ ID NO: 29 R-KAPE-UL23del-SfiIinsertion:(5'CCCGGCCAATAAGGCCACAGAAAAAGCGCG-3') SEQ ID NO: 30 F-KAPE-UL23del-SfiIinsertion:(5'CTGTGGCCTTATTGGCCGGGATCTGGAAC-3') SEQ ID NO: 31 R-EcoRIKAPEVAC-7 8 35 0: (5'-GCGAATTCATGTGCTACGCCCAG-3') SEQ ID NO: 32 F-SalI-VAC68400:(5'Petition 870190007121, of 23 / 01 / 2019, pp. 65 / 76 61 / 61 CGGTCGACACTCCCAGGGGTGAAGC-3') SEQ ID NO: 33 R-SfiI-UL26-27insertion: (5'-CGGCCAATAAGGCCAAGAATGCATTCGGCC-3') SEQ ID NO: 34 F-SfiI-UL26-27-insertion:(5'TGGCCTTATTGGCCGCCGTATGAATTGCGC-3') SEQ ID NO: 35 R-SacIVAC 6 94 0 0: (5'-GCGAGCTCCTGCAACCACAGACCGC-3') SEQ ID NO: 36 F-SalI-VAC21300:(5'CGGTCGACATAGAACGCGCTTCATCTAA-3 ' ) SEQ ID NO: 37 R-SfiI-UL45-46-insertion:(5'TGGCCAATAAGGCCGTTTATTGTTTATTAT-3') SEQ ID NO: 38 F-SfiIUL45-46-insertion: (5'-CGGCCTTATTGGCCAATCTGATTCATCCAA-3') SEQ ID NO: 39 R-SacI-VAC22300:(5'GCGAGCTCCGCCTAATCACAATCGGTATTG-3') SEQ ID NO: 40 F-Sphl-VAC 12000:(5'CCGCATGCGCAACTATATAGTCGGTC-3') SEQ ID NO: 41 R-SfiI-UL50-51-insertion:(5'GGGCCAATAAGGCCCAAAAGTACATTTTGT-3') SEQ ID NO: 42 F-SfiI-UL50-51-insertion:(5'GGGCCTTATTGGCCCAATTTATTTACTATT-3') SEQ ID NO: 43 R-EcoRIVAC13000: (5'-GCGAATTCTGGATATGATATACCGTTGC-3') Petition 870190007121, of 23 / 01 / 2019, p. 66 / 76
Claims
1 / 5 CLAIMS 1. Duck Enteritis Virus (DEV) characterized in that said virus has inactive US4 and US5 genes.
2. DEV, according to claim 1, characterized in that said genes US4 and US5 are independently of each other mutated, deleted or interrupted.
3. DEV, according to claim 1 or 2, characterized in that at least 20% of the coding sequence of each of said genes US4 and US5 is deleted, more preferably at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.
4. DEV, according to any one of claims 1 to 3, characterized in that the intergenic region between genes US4 and US5 is deleted.
5. DEV, according to any one of claims 1 to 4, characterized in that said virus comprises a deletion of a nucleotide region comprising at least 50% of the US4 gene, the entire intergenic region between the US4 gene and the US5 gene, and at least 50% of the US5 gene.
6. DEV, according to any one of claims 1 to 5, characterized in that said virus additionally comprises an inactive UL23, US7 and / or UL4 gene.
7. DEV, according to claim 6, characterized in that said virus comprises (i) a deletion of a nucleotide region comprising at least 50% of the US4 gene, the entire intergenic region between the US4 gene and the US5 gene, and at least 50% of the US5 gene and (ii) a deletion of at least 50% of the UL23 gene sequence. Petition 870260062980, dated 06 / 26 / 2026, page 10 / 19 2 / 5 8. DEV, according to claim 6, characterized in that said virus comprises (i) a deletion of a nucleotide region comprising at least 50% of the US4 gene, the entire intergenic region between the US4 gene and the US5 gene, and at least 50% of the US5 gene and (ii) a deletion of at least 50% of the US7 gene sequence.
9. DEV, according to claim 6, characterized in that said virus comprises (i) a deletion of a nucleotide region comprising at least 50% of the US4 gene, the entire intergenic region between the US4 gene and the US5 gene, and at least 50% of the US5 gene and (ii) a deletion of at least 50% of the UL4 gene sequence.
10. DEV, according to any one of claims 1 to 9, characterized by further comprising an exogenous nucleic acid.
11. DEV, according to claim 10, characterized in that the exogenous nucleic acid is located in the inactive US4 or US5 gene.
12. DEV, according to claim 11, characterized in that said virus comprises a deletion of a nucleotide region comprising at least 50% of the US4 gene, the entire intergenic region between the US4 gene and the US5 gene, and at least 50% of the US5 gene, and wherein exogenous nucleic acid is located in place of said deleted region.
13. DEV, according to claim 10, characterized in that the exogenous nucleic acid is located at an insertion site selected from the UL4 gene, the UL44 gene, the UL27-UL26 intergenic region, the UL23 gene, the UL45-UL46 intergenic region, the UL50-UL51 intergenic region, the US7 gene, the US7-US8 intergenic region, or the US10 gene. Petition 870260062980, dated 06 / 26 / 2026, page 11 / 19 3 / 5 14. DEV, according to any one of claims 10 to 13, characterized in that the exogenous nucleic acid encodes an antigen or an immunostimulatory molecule, preferably an antigen of an avian pathogen.
15. DEV, according to claim 14, characterized in that the antigen is an antigenic protein or peptide of avian paramyxovirus type 1, preferably the F protein of Newcastle disease virus (NDV) or a fragment thereof, an antigenic peptide of Gumboro disease virus, preferably the VP2 protein of infectious bursal disease virus (IBDV) or a fragment thereof, an antigenic peptide of infectious laryngotracheitis virus (ILTV), preferably the gB protein or a fragment thereof, an antigenic peptide of Mycoplasma gallisepticum, preferably the 40K protein or a fragment thereof, and an antigenic peptide of avian influenza virus, preferably a hemagglutinin (HA) surface protein or a fragment thereof.
16. DEV, according to claim 15, characterized in that the antigenic peptide is an IBDV VP2 protein or an immunogenic fragment thereof, or an influenza virus hemagglutinin (HA) protein or an immunogenic fragment thereof.
17. Nucleic acid molecule characterized by comprising the genome of a DEV, as defined in any one of claims 1 to 16.
18. Host cell that is a transgenic microorganism characterized by comprising a DEV, as defined in any one of claims 1 to 16, or a nucleic acid molecule, as defined in claim 17.
19. Method for producing or replicating a DEV, as defined in any of claims 1 to 16, characterized by Petition 870260062980, dated 06 / 26 / 2026, page 12 / 19 4 / 5 comprising infecting a competent cell with a nucleic acid molecule, as defined in claim 17, or with a DEV, as defined in claim 1, and collecting the DEV.
20. DEV, according to any one of claims 1 to 16, or a nucleic acid, as defined in claim 17, characterized in that it is for use in vaccinating or immunizing poultry, preferably chickens.
21. DEV, according to any one of claims 1 to 16, or a nucleic acid, as defined in claim 17, characterized in that it is for use in inducing protective immunity in birds, preferably in chickens.
22. DEV for use according to claim 20 or 21, wherein the DEV is characterized by being administered by injection.
23. DEV for use according to any one of claims 20 to 22, wherein the DEV is characterized by being administered in ovo or on day 1 or day 2 post-hatching.
24. Composition characterized by comprising a DEV, as defined in any one of claims 1 to 16, a nucleic acid, as defined in claim 17, or a host cell, as defined in claim 18, and a veterinary acceptable or pharmaceutically acceptable carrier or excipient.
25. Composition according to claim 24, characterized by further comprising an adjuvant.
26. Vaccination kit for immunizing a bird, characterized by comprising the following components: a. an effective quantity of a composition, as defined in claim 24 or 25, and b. a means for administering said composition to said bird.
27. Use of DEV, as defined in any of claims 1 to 16, or of a nucleic acid, as defined in claim 17, characterized in being for the manufacture of a medicament for vaccinating or immunizing birds, preferably chickens.
28. Use of DEV, as defined in any one of claims 1 to 16, or of a nucleic acid, as defined in claim 17, characterized in that it is for the manufacture of a medicament to induce protective immunity in birds, preferably in chickens.
29. Use according to claim 27 or 28, characterized in that the DEV is administered by injection.
30. Use, according to any of claims 27 to 29, wherein DEV is characterized by being administered in ovo or on day 1 or day 2 post-hatching. Petition 870260062980, dated 06 / 26 / 2026, p. 14 / 19