Process for obtaining and selecting yeast strains, yeast strain, use of a strain, and, process for production of fermentation products or ethanol

Abstract

The present invention relates to methods for obtaining yeast strains suitable for metabolizing arabinose and to improved strains with good performance in their ability to ferment arabinose as well as xylose and glucose, including in the presence of inhibitors such as acetic acid.

Description

/ 45 PROCESS FOR OBTAINING AND SELECTING YEAST STRAINS, YEAST STRAIN, USE OF A STRAIN, AND PROCESS FOR PRODUCING FERMENTATION PRODUCTS OR ETHANOL FIELD OF THE INVENTION

[001] The present invention relates to yeast strains capable of metabolizing arabinose, advantageously in combination with their ability to ferment xylose and glucose in the presence of inhibitors of these latter two fermentations, such as acetic acid in undissociated form.

[002] More specifically, the present invention provides a process for selecting strains capable of metabolizing arabinose and their improved strains, operating on their ability to metabolize arabinose and also xylose, both types of pentoses recovered in lignocellulosic hydrolysates. FUNDAMENTALS OF THE INVENTION

[003] Lignocellulose or plant biomass, mainly from agricultural and agro-industrial activity, is a complex substrate consisting of three main fractions: cellulose, hemicellulose, and lignin. These are recyclable residues used in the manufacture of ethanol, the demand for which continues to increase due to, for example, its use as a biofuel.

[004] The process for producing ethanol from lignocellulose biomass consists of recovering as much of the sugars present in the cellulose and hemicellulose fractions as possible by hydrolysis and then transforming them into ethanol by fermentation.

[005] Regarding the fermentation of the sugars present in this biomass, including C6 sugars (hexoses) and C5 sugars (pentoses), anaerobic fermentation by yeasts is currently preferred, in particular using Saccharomyces cerevisiae, whose ability to ferment glucose into ethanol is well controlled. Petition 870260064944, dated 01 / 07 / 2026, page 11 / 110 / 45 and developed.

[006] However, all attention is given to the fermentation of pentoses, in particular xylose, which can represent up to 25 to 40% of the total sugars contained in lignocellulose biomass. Thus, yeast strains capable of fermenting glucose have been modified to also be able to metabolize pentoses.

[007] As an example, document WO 2010 / 000464 reports obtaining yeast strains capable of fermenting pentoses because of a bacterial gene encoding a xylose isomerase (XI) that converts xylose into xylulose which can be metabolized by yeast.

[008] It should be noted that, alternatively, a pathway comprising a xylose reductase (XR or XYL1) generating xylitol and a xylitol dehydrogenase (XDH or XYL2) can also produce xylulose.

[009] Thus, document WO 2012 / 072793 describes improved yeast strains that combine exogenous genes encoding a xylose isomerase and a xylitol dehydrogenase capable of eliminating xylitol, which proves to be an inhibitor of xylose isomerase. These strains, in particular the deposit deposited in the CNCM (National Collection of Microorganism Cultures) on October 5, 2011 under number I-4538, improved yields and therefore proved industrial use for ethanol production.

[0010] Another crucial problem was showing, in lignocellulose hydrolysates, the presence of fermentation inhibitors, among them furfuraldehydes (furfural and HMF), phenolic compounds and organic acids (acetic acid, levulinic acid, formic acid, etc.). In particular, the presence of high concentrations of acetic acid, above 5 g / kg (initial medium) and which can reach 10 g / kg, is intrinsically linked to the presence of acetyl groups covalently bonded to hemicellulose molecules.

[0011] Previous work assumed improved resistance of the strains to the presence of acetic acid in fermentation musts. Thus, the Petition 870260064944, dated 01 / 07 / 2026, page 12 / 110 / 45, document WO 2011 / 080411, reported obtaining yeast strains with improved resistance to acetic acid in glucose.

[0012] However, acetic acid is also an inhibitor of xylose fermentation. This inhibition is characterized by a reduction in the kinetics of xylose consumption (Bellisimi et al., FEMS Yeast Res., 2009, 9: 358-364), whereas with glucose, this inhibition is reflected by a delay in the initiation of fermentation, the kinetics subsequently remaining unchanged. It should be noted that, in the presence of both glucose and xylose in the medium, yeast strains ferment glucose first due to catabolic repression.

[0013] Thus, documents WO 2013 / 178915 and WO 2013 / 178918 describe processes for obtaining yeast strains capable of metabolizing pentoses, in particular xylose, and resistant to fermentation inhibitors, in particular acetic acid.

[0014] Further improved strains, particularly in their ability to ferment glucose and xylose in the presence of acetic acid, are described in documents WO 2015 / 121595 and FR 3 035 405.

[0015] All this work is concentrated on xylose as the pentose of interest. Even though it is generally considered the most abundant pentose in hemicellulose, xylose is not the only one. Thus, arabinose can also be found in plant structures (Saddler, 1993, Wallingford, Oxon, UK: CAB International), in a proportion sometimes greater than 40% (Schädel et al., 2010, Physiologia Plantarum 139, 241-255). Furthermore, arabinose is found in bagasse (Hanko and Rohrer, 2000, Anal. Biochem. 283, 192-199) or in corn fibers called “corn fibers” (Gulati et al., 1996, Bioresource Technology 58, 253-264).

[0016] In addition to the obvious economic value of further fermentation of arabinose, it is also noteworthy that residual arabinose can form a substrate of choice for the growth of microorganisms. Petition 870260064944, dated 01 / 07 / 2026, page 13 / 110 / 45 contaminants, possibly capable of converting it into organic acids that are inhibitors of glucose and xylose fermentation, as previously stated (Schell et al., 2007, Bioresour. Technol. 98, 2942-2948.

[0017] Numerous microorganisms have been described as capable of metabolizing arabinose, as well as fungal microorganisms, in particular hemiascomycetes such as Scheffersomyces stipitis, basidiomycetes and filamentous fungi, such as bacteria like Erwinia chrysanthemi, Thermoanaerobacterium saccharolyticum, Escherichia coli, Zymomonas mobilis, Bacillus subtilis, Bacillus licheniformis and Lactobacillus plantarum.

[0018] However, among the yeast strains that can be used industrially, notably those that can withstand ethanol titers as high as those tolerated by Saccharomyces cerevisiae yeast, none are reported as naturally capable of fermenting arabinose.

[0019] Document WO 03 / 095627 reported the possibility of obtaining S. cerevisiae strains capable of growing on arabinose by transforming a laboratory strain with multicopy plasmids specifically containing araA genes (encoding an L-arabinose isomerase) from B. subtilis, araB (encoding an advantageously mutated L-ribulokinase) and araD (encoding an L-ribulose-5-P-4 epimerase) from E. coli. This document openly raises the question of the possibility of obtaining a strain capable of co-fermenting xylose.

[0020] Document WO 2008 / 122354 describes S. cerevisiae strains transformed using self-replicating vectors containing the araA genes from B. licheniformis, araB (advantageously mutated) and araD from E. coli, advantageously with optimized codons, capable of growing in aerobic or anaerobic media containing arabinose as the sole carbon source. The transformants are selected by culture in a medium containing glucose as a carbon source.

[0021] Document WO 2008 / 041840 describes sequences Petition 870260064944, dated 01 / 07 / 2026, page 14 / 110 / 45, refers to specific genes for araA, araB, and araD that confer upon a yeast the ability to metabolize arabinose, in this case, L. plantarum. In practice, the genes are introduced via plasmids into a laboratory strain of S. cerevisiae, suppressed for the GRE3 gene of aldose reductase, overexpressing the pentose phosphate pathway (TAL1, TKL1, RPE1, and RKI1) and expressing the xylose fermentation pathway (XI or XylA and XKS1). According to the authors, a strain like this cannot grow directly in a medium containing arabinose, and pre-culture in a medium containing galactose is necessary. Additionally, the strains obtained from these cultures lost their ability to metabolize xylose.

[0022] Document WO 2012 / 143513 reports the chromosomal integration of at least the araA, araB, and araD genes and XylA in a Saccharomyces yeast strain that, after culture using the “Sequential Batch Repeat” method described in document WO 2009 / 112472, in a medium containing 20 g / l arabinose and 20 g / l xylose, gives it the ability to ferment glucose, xylose, and arabinose. Mutations of different genes (SSY1, YJR154w, CEP3, GAL80, PMR1) were observed.

[0023] However, the need arose to obtain new yeast strains capable of metabolizing arabinose, in addition to their ability to ferment glucose and xylose even in the presence of inhibitors such as acetic acid. DESCRIPTION OF THE INVENTION

[0024] The present invention relates to the identification of new yeast strains suitable for metabolizing at least arabinose, based on the inventors' contributions in relation to several aspects: - highlight the fact that the introduction of the arabinose metabolic pathway is necessary, but insufficient to guarantee the effective metabolism of arabinose; - highlight the possibility of directly selecting the Petition 870260064944, dated 01 / 07 / 2026, page 15 / 110 / 45 transformants that integrated the arabinose metabolism pathway in a medium containing arabinose as the sole carbon source; - to emphasize the need for strict control of polyol production to ensure efficient arabinose fermentation; - highlight that xylose and arabinose fermentation can coexist in a stable environment; - To refine a protocol for selecting yeast strains capable of enhancing the fermentation of arabinose, xylose, and glucose simultaneously, including the fermentation of the latter two sugars in the presence of fermentation inhibitors such as acetic acid.

[0025] According to a first aspect, the present invention relates to a process for obtaining and / or selecting a yeast strain capable of metabolizing arabinose, comprising the following steps: - introduction of the arabinose metabolism pathway in a yeast strain; - selection of a strain capable of expressing the aforementioned pathway based on at least one of the following criteria: a / its ability to metabolize arabinose present in a culture medium containing the aforementioned arabinose as the sole carbon source and / or b / low or no aldose reductase activity.

[0026] According to a particular embodiment, the aforementioned process comprises: - Chromosomal integration of the araA, araB, and araD genes, advantageously araA from B. licheniformis, and araB and araD from E. coli, into a yeast strain; - direct culturing of transformed strains in a medium containing arabinose as the sole carbon source to select strains capable of metabolizing said arabinose. Petition 870260064944, dated 01 / 07 / 2026, page 16 / 110 / 45

[0027] Advantageously, the process further comprises selecting transformed strains possessing metabolized arabinose based on their aldose reductase activity of less than or equal to 0.002 U / g of protein, even less than or equal to 0.0005 U / g of protein.

[0028] In the context of the invention, "yeast strain" means a population of yeasts that are rigorously identical from a genetic point of view. This includes both strains referred to as laboratory strains and those referred to as industrial strains.

[0029] Advantageously, the yeast strain used in the aforementioned process is chosen from among strains of Saccharomyces, Schizosaccharomyces, Pichia, Yarrowia, Paffia, Kluyveromyces, Candida, Talaromyces, Brettanomyces, Pachysolen, Hansenula, Kloeckera, Schwanniomyces and Debaryomyces, advantageously a strain of Saccharomyces cerevisiae. These yeasts are known for their inability to metabolize arabinose naturally or to a very low level, not industrially applicable. Furthermore, they are advantageously chosen for their anaerobic fermentation capacity, even more advantageously for their anaerobic alcoholic fermentation.

[0030] According to a particular embodiment, the process, the subject of this application, is carried out in a strain suitable for fermenting xylose, advantageously for fermenting xylose in the presence of an organic acid in undissociated form, such as acetic acid. As widely disclosed in the prior art, the ability to metabolize xylose can result from the introduction of a gene encoding a xylose isomerase, for example, from Clostridium phytofermentans and / or a xylulokinase.

[0031] Advantageously, these are the following strains: - the strain deposited with the CNCM on October 5, 2011 under number I-4538; - the strain deposited with the CNCM on May 16, 2013 under the Petition 870260064944, dated 01 / 07 / 2026, p. 17 / 110 / 45 number I-4749; - the strain deposited with the CNCM on December 12, 2013 under number I-4829; - the strain deposited with the CNCM on April 9, 2015 under number I-4966; More advantageously, the strain deposited with the CNCM on January 29, 2015, under number I-4953.

[0032] For the purposes of the invention, a yeast strain capable of metabolizing arabinose is a strain capable of consuming or using arabinose, advantageously L-arabinose, present in its culture medium. Thus, and notably based on the culture conditions, a yeast strain can use arabinose for the production of its biomass and / or the generation of fermentation products. For the purposes of the present application, arabinose fermentation is understood to be the metabolization of arabinose that occurs under hypoxia and / or anaerobiosis, that is, under conditions of low availability (typically less than 20%) or complete absence of oxygen.

[0033] In the context of the invention, the term “metabolize” can therefore refer to the ability of the yeast strain to use arabinose to ensure its growth and its ability to ferment arabinose into various fermentation products, such as hydroxylated derivatives, including ethanol or isobutanol, and / or carboxylates, including organic acids.

[0034] According to a particular embodiment, reference is made to its ability to convert L-arabinose into L-ribulose and / or L-ribulose-5-phosphate and / or D-xylulose-5-phosphate and / or a fermentation product such as ethanol. According to an advantageous embodiment, and as seen in Figure 1, L-arabinose is converted into L-ribulose under the action of an arabinose isomerase (araA; EC: 5.3.1.4). L-ribulose can be converted into L-ribulose-5-phosphate under the action of a ribulokinase (araB; EC: 2.7.1.16). L-ribulose-5-phosphate can thus be transformed into Petition 870260064944, dated 01 / 07 / 2026, page 18 / 110 / 45 D-xylulose-5-phosphate under the action of ribulose 5-phosphate epimerase (araD; EC: 5.1.3.4). Advantageously, D-xylulose-5-phosphate is carried by the non-oxidative part of the pentose phosphate pathway and can result in the production of ethanol.

[0035] In a first step of the process according to the invention, the gene(s) that allow the metabolization of arabinose is / are introduced into the yeast strain, which is then designated as the transforming strain.

[0036] Hereafter, the terms “gene” or “sequence” mean a nucleic acid sequence comprising a coding sequence (encoding, for example, an enzyme of the pathway of interest) potentially flanked by regulatory sequences, particularly a promoter or a terminator. A coding sequence is optifiable, that is, modifiable to incorporate the preferred codons of the host, here a yeast, in which this sequence is expressed.

[0037] According to a particular embodiment, the genes encoding the arabinose metabolic pathway are genetic elements called exogenous or heterologous elements, which may be synthetic or come from other organisms (or sources). Advantageously, they originate from microorganisms capable of metabolizing arabinose, advantageously hemiascomycetes such as Scheffersomyces stipitis, basidiomycetes and filamentous fungi, or bacteria such as Erwinia chrysanthemi, Thermoanaerobacterium saccharolyticum, Escherichia coli, Zymomonas mobilis, Bacillus subtilis, Bacillus licheniformis or Lactobacillus plantarum. According to a particular embodiment, these genes come from the bacterium Bacillus licheniformis and / or Escherichia coli. According to another preferred embodiment, these genes correspond to the araA gene of B. licheniformis, the araB gene of E. coli, and the araD gene of E.E. coli as described by Widemann and Boles (2008, Applied and Environmental Microbiology 74, 2043-2050; WO 2008 / 122354).

[0038] The techniques used to introduce DNA into a host Petition 870260064944, dated 01 / 07 / 2026, page 19 / 110 / 45 (or transformation) are well known to those skilled in the art and comprise the permeabilization of membranes by applying an electric field (electroporation), with heat (application of a thermal shock) or chemically, for example, using lithium acetate.

[0039] The introduced genes can be integrated into the host genome, namely by homologous recombination or chromosomal integration, advantageously with the use of integrative cassettes, or expressed extrachromosomally using plasmids or vectors. Different types of plasmids, advantageously self-replicating, are well known to those skilled in the art, differing notably in the origin of replication, the promoter (inducible or constitutive), the marker (e.g., resistance to an antibiotic or ability to grow in a selective medium), and the number of copies per cell.

[0040] According to one embodiment, the genes encoding the arabinose metabolism pathway are chromosomally integrated, advantageously at the HO locus level of the yeast strain, more advantageously at all HO loci level of the yeast strain.

[0041] Advantageously, the cassette that carries this gene(s) and serves to incorporate or integrate them into the yeast strain does not have a marker, namely, for antibiotic resistance.

[0042] According to another preferred embodiment, the cassette carrying this gene(s) does not possess any gene encoding an arabinose transporter, namely, the araT gene.

[0043] The proper introduction of the gene(s) can be easily verified by techniques known to the expert in the art, using a marker possibly housed in an expression cassette, for example, or preferably by performing a PCR using primers targeting the introduced gene(s). Furthermore, the same PCR technique can be used Petition 870260064944, dated 01 / 07 / 2026, p. 20 / 110 / 45 to verify the integration of the gene(s) into the target locus, notably using primers directed to the locus.

[0044] In a later step of the process according to the invention, a strain of interest having incorporated and effectively expressing the arabinose metabolization pathway is selected for its ability to metabolize arabinose present in the culture medium as the sole carbon source.

[0045] In a characteristic manner according to the invention, the selection of transformants is made directly in a medium containing arabinose as the sole carbon source. In other words, the ability of a yeast strain to metabolize arabinose is tested by cultivating said strain in a medium containing arabinose as the sole carbon source. This excludes any prior induction, in particular a prior culture in the presence of galactose or the addition of galactose to the medium, or a pre-selection of transformants in a medium containing another carbon source such as glucose.

[0046] Within the scope of the invention, a culture or growth medium is a medium containing the ingredients necessary for the multiplication of the yeasts present. Advantageously, it refers to a complete medium suitable for yeast growth that may contain conventional ingredients such as salts, buffers, yeast extract or any other source of nitrogen that the yeast can metabolize, vitamins, etc. In the context of the invention, "synthetic medium" is understood to mean a medium whose chemical composition is known.

[0047] Appropriately, the culture conditions used are conditions favorable to yeast growth, particularly: - a culture medium with an acidic pH, advantageously between 4 and 6, even 4.5 and 5.5, most advantageously equal to 5 or 5.4; - a temperature between 28 and 37°C, even between 30 and 35°C, Petition 870260064944, dated 01 / 07 / 2026, page 21 / 110 / 45 advantageously equal to 32° C; - a growth time ranging from 24 hours to several days, for example, 72 hours.

[0048] Advantageously, this growth occurs in a solid medium, making it possible to isolate the strains that are actually capable of metabolizing arabinose. According to another advantageous embodiment, the selection of strains of interest is done using cultures in a Petri dish. In a known way, the solid media contain agar, advantageously at a concentration of 15 to 20 g / l.

[0049] According to a first embodiment, a yeast strain capable of metabolizing arabinose is selected by aerobic growth of this strain in a growth medium containing arabinose as the sole carbon source.

[0050] A suitable medium for this aerobic growth is the synthetic medium YNB Difco®, whose exact composition is given in the embodiments, containing arabinose as the sole carbon source, advantageously at a concentration of 10 g / l, such as the medium referred to hereafter as YNB-Ara.

[0051] Alternatively, a yeast strain capable of metabolizing arabinose can be selected by growing it under anaerobic or hypoxic conditions in a growth medium containing arabinose as the sole carbon source.

[0052] A suitable medium for this anaerobic growth or growth in hypoxia is the synthetic medium YF, the exact composition of which is given in the examples, comprising arabinose as the sole carbon source, advantageously at a concentration of 70 g / l, the medium referred to hereafter as YF-ara.

[0053] Advantageously, this medium is suitable for growth in a solid medium, by adding agar for example, thus allowing the Petition 870260064944, dated 01 / 07 / 2026, page 22 / 110 / 45 direct isolation of the strains of interest.

[0054] According to an alternative embodiment, yeast strains into which the arabinose metabolization pathway has been introduced are isolated by culture in a solid medium, advantageously in a selective medium such as the YNB-Ara medium described above, then selected in a liquid medium under anaerobic or hypoxic conditions, in a suitable medium such as the YF-ara medium described above. Said liquid cultures can be carried out in microplates such as Deep Well or in flasks, under low agitation, for example, 100 rpm, or without agitation and under reduced oxygen supply conditions (under limited O2 or anaerobiosis).

[0055] Under these conditions, the ability of yeast strains to metabolize arabinose can be assessed by: - its growth, namely by monitoring the optical density (OD) of the culture medium, advantageously measured at 600 nm; and / or - the fermentation of arabinose, namely by monitoring the concentration of arabinose present in the culture medium, by HPLC, for example, or by evaluating the mass loss directly correlated with CO2 production, which is stoichiometric with that of ethanol.

[0056] It should be noted that, to the Applicant's knowledge, this is the first time that the possibility of selecting yeast strains capable of directly metabolizing arabinose by cultivating them in a medium containing arabinose as the sole carbon source has been reported. Conversely, it was considered that a person skilled in the art would have been dissuaded from using such an approach, given the information in Wisselink et al. (2007; Appl Environ Microbiol 73, 4881-4891; WO 2008 / 041840) which reported that such direct selection did not work.

[0057] According to another advantageous embodiment, the yeast strains obtained can also be tested simultaneously or subsequently under the following conditions: Petition 870260064944, dated 01 / 07 / 2026, page 23 / 110 / 45 - in a growth medium containing glucose as the sole carbon source, for example, in a YF medium as described above, but containing 150 g / l of glucose and under the culture conditions given above. This step allows verifying the validity of the selected strains, mainly their ability to ferment glucose. Note that one or more passages in the glucose medium can be performed before culturing the selected strains in a medium containing arabinose as the sole carbon source (described above) and verifying whether the [ara+] phenotype is stable and preserved; - a growth medium containing xylose as the sole carbon source, for example, in a YF medium as described above, but containing 70 g / l of xylose (YF-xylose medium in the embodiments) and under the culture conditions given above. This step allows verification that the selected strains retain their ability to ferment xylose and shows interest when the yeast strain in which the process of the invention is used is capable of fermenting xylose.

[0058] Additionally, and within the scope of the invention, it has been shown that an important criterion in selecting strains of interest for arabinose metabolism is their level of polyol production.

[0059] Polyols, such as xylitol, are known to have an inhibitory effect on xylose isomerase (xylA) activity (Kovalevsky et al., 2012, Acta Crystallogr. D Biol. Crystallogr. 68, 12011206). In the context of the present invention, it has been shown that polyols can also inhibit arabinose isomerase (araA; Figure 1) activity and thus reduce the arabinose metabolization performance of a strain selected by the process according to the invention.

[0060] It is likely that arabitol is generated from arabinose under the action of aldose reductase(s), in the same way that xylitol is generated from xylose. It should be noted that, in a known manner, the GRE3 gene encodes the main aldose reductase in S. cerevisiae, but that, even Petition 870260064944, dated 01 / 07 / 2026, page 24 / 110 / 45 when this is deleted or deactivated, aldose reductase activity may persist. Furthermore, the presence of xylitol dehydrogenase activity in yeast strains has the potential to eliminate xylitol.

[0061] Thus, and according to this assumption, a strain selected for particular interest shows: - strong polyol dehydrogenase activity, advantageously greater than or equal to 0.001 U / g of protein, or even more advantageously greater than or equal to 0.002 U / g of protein; and / or - low aldose reductase activity.

[0062] In practice and within the scope of the invention, it has been pointed out that a strain of interest could be selected based on its low, even zero, aldose reductase activity. Advantageously, this activity is less than 0.005 U / g of protein, even less than 0.004, 0.003 or even 0.002 U / g of protein. More preferably, it is less than or equal to 0.0015 U / g of protein, even less than or equal to 0.001 U / g of protein, most advantageously less than or equal to 0.0005 U / g of protein.

[0063] A detailed protocol for measuring aldose reductase activity is described in the “Examples”.

[0064] Furthermore and advantageously, the yeast strain used in the process according to the invention shows one or more inactive or deleted GRE3 genes.

[0065] According to another preferred embodiment, a yeast strain used in the present invention has at least one supernumerary copy of the HAA1 gene encoding the transcriptional regulator Haa1p. In a known manner, the former is capable of giving yeast strains, specifically S. cerevisiae, the ability to resist acetic acid, thus improving growth in a medium containing organic acid-type fermentation inhibitors, such as acetic acid. Additionally, the Applicant has demonstrated that overexpression of this gene would make it resistant. Petition 870260064944, dated 01 / 07 / 2026, p. 25 / 110 / 45 to other inhibitors of phenolic compounds, in particular vanillin.

[0066] Advantageously, the expression of the supernumerary gene encoding Haa1p is placed under the control of a heterologous promoter, for example, the pPGK1 promoter. This supernumerary copy of the HAA1 gene can encode the native protein or a mutated form thereof, for example, the constitutively active HAA1S135F version described by Swinnen et al. (2017, Cell Factories 16: 7).

[0067] According to a preferred embodiment, the additional copy of the HAA1 gene is integrated at the chromosome level, even more advantageously by insertion at the level of the GRE3 gene. From this, there are two advantageous results within the framework of the invention, which are: - inactivation of the GRE3 gene encoding an aldose reductase; Overexpression of the HAA1 gene makes yeast strains more resistant to acetic acid, but also to vanillin.

[0068] The second step in the process according to the invention, corresponding to the step of selecting the yeast strains of interest, can be used to evaluate either of the two criteria mentioned above, advantageously both. According to a particular embodiment, the ability to metabolize arabinose present in the culture medium is evaluated first, then the selected strains are tested for their aldose reductase activity.

[0069] The interest in the strains thus selected, notably their ability to ferment arabinose, but also glucose and eventually xylose, can be confirmed by evaluating their performance in synthetic media containing the different sugars in mixture, i.e., arabinose and glucose, up to arabinose, glucose and xylose in the case of strains of origin capable of fermenting xylose. In order to mimic the real fermentation conditions, these media also contain acetic acid, advantageously at a concentration of 1 to 10 g / l, known to inhibit the fermentation of glucose and xylose. Petition 870260064944, dated 01 / 07 / 2026, page 26 / 110 / 45

[0070] Examples of such media are YPF or YFCF, whose composition is given below: YFCF Medium:

[0071] - 10 g / l of yeast extract; - 10 g / l of bacto-peptone; - 63 g / l of glucose; - 28 g / l of xylose; - 28 g / l of arabinose; - 4 g / L of acetic acid (amount added to the culture medium at pH 5). YFP Medium:

[0072] - 10 g / l of yeast extract; - 10 g / l of bacto-peptone; - 63 g / l of glucose; - 52 g / l of xylose; 6.1 g / L of arabinose; - 4 g / L of acetic acid (amount added to the culture medium at pH 5).

[0073] Standard culture conditions favorable for ethanol production in yeast are: - a stable acidic pH, with an advantage between 4 and 6, for example equal to 5; - a temperature between 28 and 37°C, even between 30 and 35°C, advantageously equal to 30°C; - low agitation, 100 rpm for example; - Reduced oxygen supply conditions (under limited O2). In practice, the culture can be done in a stoppered flask using a lid that reduces the O2 supply to the medium, allowing the CO2 produced to escape; Petition 870260064944, dated 01 / 07 / 2026, page 27 / 110 / 45 - sowing with an inoculum of 0.25 g / kg DM eq of the propagated strain under YPG saturation for 24 hours; - a growth period of at least 24 hours, for example, 72 hours.

[0074] Within the scope of the invention, the strains selected through this procedure reveal: - the ability to use arabinose as the sole carbon source to ensure the production of its biomass; - the ability to ferment arabinose; - the ability to ferment glucose and possibly xylose, even in the presence of an undissociated organic acid, especially acetic acid.

[0075] It was observed after 72 hours of fermentation under the conditions described above: - Consumption of 95%, even all, of the glucose and xylose present in the culture medium, converted into biomass, or ethanol and CO2; - Consumption of more than 50%, up to 60%, 70%, or even 80% of the arabinose present in the culture medium.

[0076] Thus, and according to a further aspect, the present invention relates to a yeast strain obtainable using the described process, capable of fermenting at least 50%, even 60%, 70% or even 80% of arabinose after 72 hours of fermentation in a medium comprising glucose (advantageously at a concentration of 1 to 100 g / l, for example, 63 g / l), xylose (advantageously at a concentration of 1 to 100 g / l, for example, 28 or 52 g / l), arabinose (advantageously at a concentration of 1 to 100 g / l, for example, 6.1 or 28 g / l) and acetic acid (advantageously at a concentration of 1 to 10 g / l, for example, 4 g / l). Ideally, such a yeast strain is capable of simultaneously fermenting at least 90%, even 95%, of the glucose and xylose also present. Petition 870260064944, dated 01 / 07 / 2026, p. 28 / 110 / 45

[0077] This strain also advantageously exhibits at least one of the following characteristics, even all of the characteristics: - at least one copy of an araA gene, preferably from B. licheniformis, advantageously integrated at the chromosomal level, most advantageously at the level of at least one HO locus; - at least one copy of the araB gene, preferably from E. coli, advantageously integrated at the chromosomal level, most advantageously at the level of at least one HO locus; - at least one copy of the araD gene, preferably from E. coli, advantageously integrated at the chromosomal level, most advantageously at the level of at least one HO locus; - at least one copy of an exogenous gene that codes for a xylose isomerase, advantageously from Clostridium phytofermentans; - at least one supernumerary copy of the GAL2 gene, encoding a hexose transporter also capable of ensuring xylose uptake. According to another embodiment, the strain in question comprises at least two supernumerary copies of the GAL2 gene. This can be placed under the control of a strong, constitutive pADH1-type promoter; - Suppression of aldose reductase activity encoded by GRE3, advantageously by insertion of the HAA1 gene at the GRE3 locus; - overproduction of xylulokinase (XKS1), particularly due to promoter modification or the introduction of supernumerary copies; - the expression or overproduction of the pentose phosphate pathway (RPE1, RKL1, TKL1, TAL1, etc.); - absence of xylose reductase (XR) activity.

[0078] According to a particular embodiment, this strain is not silenced at the following gene levels: SSY1, YJR154w, CEP3, GAL80 and / or PMR1. According to another particular embodiment, the strain does not Petition 870260064944, dated 01 / 07 / 2026, p. 29 / 110 / 45, has the following mutations: G1363T in the SSY1 gene, A512T in the YJR15w gene, A1186G in the CEP3 gene, A436C in the GAL80 gene, A113G in the PMR1 gene.

[0079] A strain of particular interest, obtained using the claimed process, is the strain registered with the CNCM (National Collection of Microorganism Cultures, Pasteur Institute, 25 rue du Docteur Roux, 75724 Paris Cedex 15) on May 19, 2016 under number 1-5085.

[0080] According to another aspect, the invention relates to a process for obtaining and / or selecting yeast strains with an improved capacity to ferment arabinose, xylose and glucose in the presence of organic acid fermentation inhibitors, particularly acetic acid, characterized by an increase in ethanol production and by a greater consumption of arabinose present in the medium.

[0081] The invention also relates to a process for obtaining and / or selecting a yeast strain with an improved capacity to ferment glucose, xylose and arabinose, advantageously in the presence of an organic acid in undissociated form such as acetic acid, wherein a yeast strain exhibiting such a capacity is successively cultivated under the following conditions: - an anaerobic culture in a first medium containing, as the only carbon sources, arabinose and xylose in limited quantities for biomass production; then - two successive anaerobic cultures, one in a medium containing glucose as the sole carbon source and the other in a medium containing xylose as the sole carbon source in the presence of an organic acid in undissociated form, advantageously acetic acid; - optionally, an aerobic culture in a minimal medium containing, as the sole carbon source, a strictly respiratory carbon source, advantageously glycerol. Petition 870260064944, dated 01 / 07 / 2026, page 30 / 110 / 45

[0082] This process is, therefore, to achieve a directed evolution of the yeast strains used. Without wanting to adhere to any theory, the selection pressure exerted by consecutive cultures in the growth media defined below allows the strain to acquire the phenotypic characteristics necessary to increase its ability to ferment arabinose and retain its ability to ferment xylose and glucose and in the presence of organic acid in undissociated form, in particular acetic acid.

[0083] Thus, the process according to the invention makes it possible to select, from an isolated strain or a mixture of strains, a strain with a selective advantage in terms of growth in a medium containing these three sugars and said organic acid in undissociated form.

[0084] The aforementioned process, which is also the subject of this application, can be used on an isolated strain, particularly on the strain registered with the CNCM (National Collection of Microorganism Cultures, Pasteur Institute, 25 rue du Docteur Roux, 75724 Paris Cedex 15) on May 19, 2016, under number I-5085.

[0085] According to the aforementioned process, the yeast strain or mixture of strains is cultivated consecutively in at least three growth media. As stated previously, the terms “growth medium” and “culture medium” are used interchangeably to designate a medium that comprises the ingredients necessary for the multiplication of the yeasts that are present.

[0086] The first growth medium, advantageously liquid, is characterized by containing the pentoses arabinose and xylose as the only carbon sources.

[0087] It should be noted that it is traditionally agreed that when a yeast population has two sugars, it generally uses only one to produce biomass. Once this first sugar is consumed, the second can be used. Thus, there was a real risk to the stability of Petition 870260064944, dated 01 / 07 / 2026, page 31 / 110 / 45 fermentation phenotype of the two pentoses of interest, namely, xylose and arabinose.

[0088] In a characteristic manner according to the invention, the first medium contains a concentration of pentoses that makes it possible to cover 100%, advantageously 50% each, of the carbon requirements of the yeast strain. According to another embodiment, arabinose and xylose are present in equivalent concentrations, for example, at a ratio of 5 g / l for arabinose and 4 g / l for xylose.

[0089] According to another preferred characteristic, a synthetic medium whose exact composition is controlled, advantageously a medium whose chemical composition is entirely determined. Such a medium is called, for example, “GO xylose arabinose”, whose composition is given in the examples. It should be noted that in such a medium, it is not the nitrogen source that limits biomass production (10 g / l of (NH4)2PO4), but the amount of carbon sources, in this case xylose (4 g / l) and arabinose (5 g / l). Thus, such a medium favors the growth and multiplication of yeast strains that use both sugars.

[0090] The next step is designed to anticipate a possible risk of loss of tolerance to inhibitors in the selected strains, particularly acetic acid in its undissociated form.

[0091] Thus, at this stage, two successive anaerobic cultures are implemented: - one in a growth medium containing glucose as the sole carbon source; and - the other in a growth medium containing xylose as the sole carbon source.

[0092] The order of passage in the two culture media can optionally be reversed (xylose medium, then glucose medium).

[0093] Advantageously, the concentration of glucose or xylose in the medium Petition 870260064944, dated 01 / 07 / 2026, page 32 / 110 / 45 of growth is that commonly implemented when it is used as the sole carbon source, specifically understood to be between 5 and 200 g / l in the case of a liquid medium (5 and 200 g / kg in the case of a solid medium), for example equal to 150 g / l for glucose and 70 g / l for xylose.

[0094] Advantageously, the aforementioned medium also includes the organic acid capable of inhibiting the fermentation of both sugars. Advantageously, it involves acetic acid or formic acid, even more advantageously acetic acid.

[0095] It should be noted that it is known that only the undissociated or non-ionized form of such acids has inhibitory capacity. In the context of the invention, “non-ionized or non-dissociated form” of a carboxylic acid is understood to be its protonated form. In practice, the form of such organic acids depends on the pH of the medium in which they are incorporated. At a pH higher than the pKa of the acid, the acid will be found mainly in dissociated form or COO-. In contrast, and at a lower pH, the predominant form is the undissociated or non-ionized form (COOH). In the rest of the description, reference is made to acetic acid added to the medium, encompassing dissociated and undissociated forms according to the pH of said medium.

[0096] Advantageously, the concentration of the organic acid in its undissociated form, advantageously as acetic acid, in the growth medium is between 0.5 and 5 g / l in liquid medium (equivalent to 0.5 and 5 g / kg in solid medium), advantageously between 1.3 and 2.6 g / l. In practice and as an example, this final range corresponds to a concentration of acetic acid added to a growth medium at pH 5 between 3 and 6 g / l, for example, 4 or 5 g / l.

[0097] In addition to these two media, the aforementioned growth medium is advantageously a complete synthetic medium adapted to the anaerobic or hypoxic growth of yeasts, such as, for example, the medium Petition 870260064944, dated 01 / 07 / 2026, page 33 / 110 / 45, called YF acid, whose exact composition is detailed in the examples.

[0098] Suitable means for implementing the second stage of the process according to the invention are, for example, the means called YF-glucose acid and YF-xylose acid, the composition of which is detailed in the examples.

[0099] In addition to the specific composition of these growth media, the culture of the yeast strain or mixture of strains in these first and second stages of the process according to the invention is advantageously carried out under standard conditions favorable to the growth of yeasts, in particular Saccharomyces type, under anaerobiosis or hypoxia, and their fermentation activity, namely: - an acidic pH advantageously between 4 and 6, even between 4.5 and 5.5, and even more advantageously equal to 5 or 5.4; - a temperature between 28 and 37°C, even between 30 and 35°C, advantageously equal to 32°C; - under gentle agitation, for example, equal to 100 rpm; - under reduced oxygen supply conditions (under limited O2). In practice, the culture can be done in a lidded flask, reducing the O2 supply to the medium and allowing the CO2 produced to escape.

[00100] Generally, the culture is stopped when the carbon dioxide source has been completely consumed. In practice, and advantageously, the culture is left for at least 24 hours, even several days, advantageously for up to 7 days.

[00101] According to a specific embodiment, the method according to the invention further comprises transferring the yeast to a fourth growth medium, advantageously liquid, intended to select cells capable of respiration, specifically possessing functional mitochondria. In practice, this step, which can be implemented with each cycle Petition 870260064944, dated 01 / 07 / 2026, page 34 / 110 / 45 or at least once in the method, serves to overcome the appearance of “petites” whose deficient respiratory phenotype may be disadvantageous in the context of industrial yeast production methods.

[00102] Advantageously, this fourth medium is a poor or minimal medium containing as its only carbon source a carbon that can only be used by cells that have retained functional mitochondria. In this case, we are talking about a strictly respiratory carbon source, meaning a carbon source that systematically involves mitochondrial oxidation and does not produce ethanol. Advantageously, it can be glycerol or possibly ethanol. In other words, this medium is free of fermentable sugar.

[00103] Advantageously, the glycerol concentration of the growth medium is that which is usually used when it is used as the sole carbon source, specifically between 5 and 50 g / l, advantageously between 10 and 50 g / l, for example equal to 10 g / l in order to obtain sufficient biomass to inoculate the first culture medium of the following cycle.

[00104] By definition, a minimal medium contains, in addition to a carbon source, a nitrogen source, a potassium source, a phosphorus source, a sulfur source, a magnesium source, a calcium source, an iron source, a trace element source and water.

[00105] A medium that can be used for the preparation of this culture medium may include: - a base, such as “Yeast nitrogen base” DIFCO®, advantageously at a concentration of 3.4 g / l; - and, optionally, ammonium sulfate, advantageously at a concentration of 5 g / l.

[00106] In addition to the specific composition of this growth medium, the culture of the yeast strain or mixture of strains is advantageously carried out under standard conditions favorable to the aerobic growth of yeasts, the Petition 870260064944, dated 01 / 07 / 2026, p. 35 / 110 / 45, see: - An acidic pH is advantageously between 4 and 6, even 4.5 and 5.5, for example equal to 5; - a temperature between 28 and 37°C, even between 30 and 35°C, advantageously equal to 32°C; - under medium agitation, for example, equal to 150 rpm; - in aerobic conditions. In practice, the culture can be done in a flask with a lid, sealed by a porous cap that allows O2 to be supplied to the medium.

[00107] Again, the culture is stopped when the carbon source, advantageously glycerol, has been completely consumed. In practice and advantageously, the culture is carried out over several hours, advantageously 48 hours.

[00108] The said succession of crops in these three, up to four environments, and under the conditions described, constitutes a cycle.

[00109] In practice, a selection cycle according to the invention may be as follows: - a first culture under anaerobic or hypoxic conditions in the presence of xylose and arabinose; - a second culture under anaerobic or hypoxic conditions in the presence of glucose and acetic acid; - a third culture under anaerobic or hypoxic conditions in the presence of xylose and acetic acid; - possibly a fourth culture aerobically in the presence of glycerol; or - a first culture under anaerobic or hypoxic conditions in the presence of xylose and arabinose; - a second culture under anaerobic or hypoxic conditions in the presence Petition 870260064944, dated 01 / 07 / 2026, page 36 / 110 / 45 of xylose and acetic acid; - a third culture under anaerobic or hypoxic conditions in the presence of glucose and acetic acid; - possibly a fourth culture aerobically in the presence of glycerol.

[00110] According to the invention, these different cultures are made according to the “Simple batch repetition” method, for example, without renewal of the culture medium present.

[00111] According to a particular embodiment, this cycle is repeated at least twice (“Repetition of several batches”), for example, 2 times.

[00112] This process made it possible to select yeast strains that, during fermentation in a medium close to natural media containing arabinose, glucose, xylose and acetic acid, exhibit better ethanol production (higher alcohol content) and better consumption of arabinose present in the medium.

[00113] According to another aspect, the present invention relates to a yeast strain obtained using the process described above. In this way, it was possible to isolate yeast strains that, at the end of this selection process, have the capacity to increase the consumption of arabimose present in the medium by at least 10%, even 20%, 30%, 40%, 50%, 60%, 70% or even more than 80%. These performances are advantageously evaluated under the fermentation conditions described above in relation to the YFCF medium and after 160 hours.

[00114] In fact, under these conditions, consumption exceeding 90%, even 95% or even 97.5% of arabinose present in the culture medium was observed.

[00115] Thus, and according to a further aspect, the present invention relates to a yeast strain obtainable using the described process, which is capable of fermenting at least 90%, even 95% or Petition 870260064944, dated 01 / 07 / 2026, p. 37 / 110 / 45 even 97.5% arabinose after 160 hours of fermentation in a medium comprising glucose (advantageously in an amount of 1 to 100 g / l, for example, 63 g / l), xylose (advantageously in an amount of 1 to 100 g / l, for example, 28 g / l), arabinose (advantageously in an amount of 1 to 100 g / l, for example, 28 g / l) and acetic acid (advantageously in an amount of 1 to 10 g / l, for example, 4 g / l). Preferably, such a yeast strain is capable of simultaneously fermenting at least 90%, up to 95%, or even 100% of the glucose and xylose present.

[00116] This strain also advantageously exhibits at least one of the following characteristics, or even all of them: - at least one copy of an araA gene, preferably from B. licheniformes, advantageously integrated at the chromosomal level, most advantageously at the level of all HO loci; - at least one copy of an araB gene, preferably from E. coli, advantageously integrated at the chromosomal level, and more advantageously at the level of all HO loci; - at least one copy of the araD gene, preferably from E. coli, advantageously integrated at the chromosomal level, and more advantageously at the level of all HO loci; - at least one copy of an exogenous gene that codes for a xylose isomerase, advantageously from Clostridium phytofermentans; - at least one supernumerary copy of the GAL2 gene, encoding a hexose transporter also capable of ensuring xylose uptake. According to another embodiment, the strain includes at least two supernumerary copies of the GAL2 gene. This can be placed under the control of a strong, constitutive pADH1-type promoter; - suppression of aldose reductase activity encoded by GRE3, advantageously by inserting the HAA1 gene into the GRE3 locus; - overproduction of xylulokinase (XKS1), namely Petition 870260064944, dated 01 / 07 / 2026, p. 38 / 110 / 45 through the modification of the prosecutor or the introduction of supernumerary copies; - the expression or overproduction of the pentose phosphate pathway (RPE1, RKI1, TKL1, TAL1, etc.); - absence of xylose reductase (XR) activity.

[00117] According to another advantageous embodiment, such a strain exhibits at least one of the following characteristics, advantageously both: - strong polyol dehydrogenase activity, advantageously greater than or equal to 0.001 U / g of protein, even more advantageously greater than or equal to 0.002 U / g of protein; - Aldose reductase activity less than 0.005 U / g of protein, even 0.004, 0.003, or even 0.002 U / g of protein, preferably less than or equal to 0.0015 U / g of protein, up to less than or equal to 0.001 U / g of protein, more preferably less than or equal to 0.0005 U / g of protein.

[00118] According to a particular embodiment, this strain is not mutated at the level of the following genes: SSY1, YJR154w, CEP3, GAL80 and / or PMR1. According to another particular embodiment, the strain does not have the following mutations: G1363T in the SSY1 gene, A512T in the YJR154w gene, A1186G in the CEP3 gene, A436C in the GAL80 gene, A113G in the PMR1 gene.

[00119] A strain of particular interest is the strain deposited at the CNCM (National Collection of Microorganism Cultures, Institut Pasteur, 25 rue du Doctor Roux, 75724 Paris Cedex 15) on May 19, 2016, under number I-5086.

[00120] According to a particular embodiment, this strain has at least one supernumerary copy of the HAA1 gene, advantageously inserted at the level of the GRE3 gene.

[00121] According to another aspect, the present invention also Petition 870260064944, dated 01 / 07 / 2026, p. 39 / 110 / 45, targets a yeast obtained by culturing the strains as defined above.

[00122] In the context of the invention, "yeast" means a commercial product obtained through the implementation of a process for the production of a yeast strain. Thus, yeasts with different properties can be obtained from a single strain, where these differences are related to the production process implemented.

[00123] According to another aspect, the invention relates to the use of strains or yeasts as defined above for the fermentation of a material, advantageously containing arabinose and / or xylose and / or glucose, and / or for the production of ethanol.

[00124] According to a specific embodiment, the material is a lignocellulosic material. This material generally contains: - pentoses, in particular D-xylose and L-arabinose; - hexoses, in particular D-mannose, D-galactose, L-rhamnose and D-glucose; - uronic acids.

[00125] In particular respects, the invention relates to a process for producing fermentation products or ethanol comprising the following steps: - incubation of a material or medium containing arabinose and / or xylose and / or glucose, advantageously arabinose, xylose and acetic acid, with a strain or yeast as defined above; - fermentation under anaerobic or semi-anaerobic conditions (hypoxia); - recovery of one or more fermentation products, or ethanol.

[00126] According to a particular embodiment, the material or medium is hemicellulose, or “corn fibers”. Petition 870260064944, dated 01 / 07 / 2026, page 40 / 110 / 45

[00127] The present invention will be illustrated further using the following examples, supported by the attached figures. However, they are not limiting in scope. CAPTIONS FOR THE FIGURES:

[00128] Figure 1 shows the metabolic pathways for the conversion of Larabinose and D-xylose to D-xylulose-5-phosphate.

[00129] Figure 2 shows the pL1285-055 plasmid allowing the integration of the araA / araB / araD genes at the HO locus level of Saccharomyces cerevisiae.

[00130] Figure 3 shows the PCR products obtained using the oligonucleotides in Table 1 below. Lane 1 corresponds to a size marker (1 kb of DNA ladder), lanes 2 to 9 correspond to the PCR products obtained using the DNA genomic matrix of the 8 transformers tested, lane 10 is obtained with the untransformed strain. Lane 11 is the negative control of the technique (water) and lane 12 is the positive control with the pL1285-055 plasmid as a matrix.

[00131] Figure 4 illustrates the growth of colonies in a YPG medium + blasticidin 50 mg / l (A) and in a YNB-Ara medium containing 10 g / l of arabinose (B).

[00132] Figure 5 illustrates the growth of selected clones in a medium containing arabinose (A) or xylose (B) as the sole carbon source.

[00133] Figure 6 represents the evolution of the concentration (expressed in g / kg) of the various constituents based on fermentation time, in a YFCF medium (63 g / kg of glucose, 28 g / kg of xylose, 28 g / kg of arabinose and 4 g / kg of acetic acid (pH = 5)), by clones 13 (A) and 126 (B) selected for their ability to ferment arabinose. The values ​​represent the average values ​​of 3 biologically independent experiments.

[00134] Figure 7 represents the aldose reductase activity measured in different sets of genes tested (I-4953; clone 13; clone 126). The Petition 870260064944, dated 01 / 07 / 2026, page 41 / 110 / 45 values ​​represent the average values ​​of 2 biologically independent experiments.

[00135] Figure 8 represents the mass loss observed after 48 hours of fermentation in clone 126 and transformers (transformed with pADH1-GRE3).

[00136] Figure 9 shows (A) the change in ethanol concentration (g / kg) as a function of fermentation time in a YFCF medium of different clones selected after a directed evolution made from the EG31 strain; (B) the arabinose concentration (g / kg) after 160 hours of fermentation in YFCF medium of these same clones and EG31 strain. EXAMPLES I / Obtaining a Saccharomyces cerevisiae strain capable of fermenting arabinose: 1. Transformation via the arabinose pathway:

[00137] The arabinose fermentation pathway is shown in Figure 1.

[00138] The annotated strain I-4953, deposited at the CNCM (National Collection of Microorganism Cultures, Pasteur Institute, 25 rue du Docteur Roux, 75724 Paris Cedex 15) under the number CNCM I-4953 on January 29, 2015, was transformed using the pL1285-055 plasmid (Figure 2), a derivative of the pHD22 plasmid containing an arabinose pathway expression cassette allowing the integration of the araA genes from Bacillus lichenformis and araB / araD from Escherichia coli at the HO locus level of this S. cerevisiae strain.

[00139] This strain is also known for its ability to metabolize xylose due to the presence of at least one copy of an exogenous gene that encodes the xylose isomerase of Clostridium phytofermentans.

[00140] In addition, this strain overexpresses genes that encode enzymes from the non-oxidative part of the pentose phosphate pathway, notably the TAL1 and TKL1 genes. Petition 870260064944, dated 01 / 07 / 2026, p. 42 / 110 / 45 2. Validation of chromosomal integration of the arabinose pathway:

[00141] The correct integration of the various genes encoding the enzymes that form the arabinose metabolism pathway, particularly the ara A, B, and D genes, was verified by PCR using genomic DNA from the transformants as a template and oligonucleotides amplifying a fragment of each of the corresponding 3 ORFs. The aforementioned oligonucleotides and their sequence are shown in Table 1 below: Name Sequence Expected Size araA-vf-1 (SEQ ID NO: 1) ATGATTCAAGCTAAGACCC 350 bp araA-vr-1 (SEQ ID NO: 2) ATGTCAATCTTGTCCCATGG araB-vf-1 (SEQ ID NO: 3) ATGGCTATTGCTATTGGTTT 357 bp araB-vr-2 (SEQ ID NO: 4) CCACAAAACGAACATAGCGT araD-vf-1 (SEQ ID NO: 5) ATGTTGGAAGACTTGAAGAG 363 bp araD-vr-1 (SEQ ID NO: 6) TAGAAGTAGTCAGCGTGGGT

[00142] The PCR products obtained were analyzed on 0.8% agarose gel after one hour of migration at 50 Volts at TAE 0.5x.

[00143] The results shown in Figure 3 show that a PCR product was actually amplified for the 3 arabinose pathway genes in all transformants tested (8). This finding suggests that these genes were effectively integrated into the yeast genome.

[00144] In addition, standard sequencing was performed to check that the araA, B, and D genes are not mutated (data not shown). 3. Selection of strains that are truly capable of metabolizing arabinose:

[00145] To proceed with the investigations, it was decided to simplify the expression system of the arabinose pathway. For this purpose, the cassette was modified to express the ara A, B and D genes while being deprived of the coding sequence for an arabinose transporter (araT).

[00146] To measure the frequency of appearance of strains that can metabolize arabinose, strain I-4953, deposited at the CNCM on January 29, 2015, was transformed using 1.3 µg of said cassette containing araA, B, and D. Petition 870260064944, dated 01 / 07 / 2026, page 43 / 110 / 45

[00147] The product of the transformation was distributed in two types of media: - a first medium corresponding to YPG (10 g / l yeast extract; 10 g / l peptone; 20 g / l glucose as the sole carbon source) containing blasticidin in an amount of 50 mg / l. The aim is to determine the number of cells that have integrated the cassette into their genome; - a second medium called YNB-Ara corresponding to a minimal medium (YNB Difco®) containing 10 g / l of arabinose as the sole carbon source. This medium should allow the determination of the number of cells that acquired the [ara +] phenotype.

[00148] YNB Difco® medium (“Yeast nitrogen base without amino acids and ammonium sulfate”), referenced under number 0335-15, contains: Biotin 2 pg / L - Pantothenate (calcium) 400 pg / l - Folic acid 2 pg / l Inositol 2000 pg / l Niacin 400 pg / l - p-aminobenzoic acid 200 pg / l - Pyridoxine (hydrochloride) 400 pg / l Riboflavin 200 pg / l - Thiamine (hydrochloride) 400 pg / l Boric acid 500 pg / l Copper sulfate 40 pg / l - potassium iodide 100 pg / l Ferric chloride 200 pg / l Manganese sulfate 400 pg / l - Sodium molybdate 200 pg / l Zinc sulfate 400 pg / l Petition 870260064944, dated 01 / 07 / 2026, page 44 / 110 / 45 Monobasic potassium phosphate 1 g / l Magnesium sulfate 500 mg / l - Sodium chloride 100 mg / l Calcium chloride 100 mg / l, final pH = 5.4 Ammonium sulfate (5 g / l)

[00149] Figure 4 illustrates the result obtained in both types of media.

[00150] After 6 days of growth in both media, the colonies were counted. It was observed that the number of colonies in the YNB-Ara medium was approximately 18% of that observed in the YPG + Blasticidin medium. In other words, only 18% of the colonies that integrated the araA, B, and D genes into their genome appear capable of growing using arabinose as the sole carbon source.

[00151] It is clear from the above that: - the cassette-coding genes araA, B, and D are necessary but not sufficient to obtain an [ara+] phenotype; - Direct selection of transformants in a medium containing arabinose as the sole carbon source is possible and, contrary to the teachings of Wisselink et al. (2007; Appl Environ Microbiol 73, 48814891), reveals that a prior growth step in the presence of galactose is not necessary.

[00152] To continue, the cassette was further simplified and stripped of any selection marker, notably antibiotic resistance.

[00153] 1156 transformants that grew in YNB-Ara medium were then tested in Deep Well format (= microplate with 96 wells) to confirm their ability to grow anaerobically on arabinose and also to verify the maintenance of their ability to ferment xylose and glucose.

[00154] The composition of the means used for this purpose is detailed. Petition 870260064944, dated 01 / 07 / 2026, page 45 / 110 / 45 below: YF Medium =

[00155] - yeast extract (EXL) 5 g / l; - diammonium phosphate 4.7 g / l - citric acid 11.4 g / l; - trisodium citrate 13.5 g / l; - ZnSO4 21.2 mg / l; - MgSO4 7H2O 1 g / l; - thiamine 18.24 mg / l; - pyridoxine 5.28 mg / l; - biotin 1.76 g / l; - pantothenate 3.8 mg / l; - Nicotinic acid 20 mg / l; - meso-inositol 50 mg / l; - riboflavin 1 mg / l; - para-aminobenzoate 1.2 mg / l; Tween 80, 1 g / l.

[00156] YF-ara medium: YF medium containing 70 g / l of arabinose YF-xylose medium: YF medium containing 70 g / l of xylose

[00157] The pH of the medium is maintained at 5. The culture is carried out at 32°C.

[00158] Figure 5 illustrates the results obtained with a series of strains whose growth was simultaneously monitored in a medium containing arabinose (A) or xylose (B) as the sole carbon source, the latter medium being suitable for selecting strains that retained their ability to metabolize xylose.

[00159] The results shown in Figure 5 show that the [ara+] strain selection method has been further improved: Figure 5A shows that 15 of the 91 clones tested do not appear capable of starting to multiply again using arabinose. This suggests that, unlike selection based on Petition 870260064944, dated 01 / 07 / 2026, page 46 / 110 / 45 resistance to an antibiotic, selection in YNB-Ara makes it possible to obtain 85% of the transformants that acquired the [ara+] phenotype.

[00160] Another aspect that emerged from the results shown in Figure 5 refers to the cohabitation of two metabolic pathways: xylose and arabinose. It is thus evident that certain strains acquired the [ara+] phenotype at the expense of the [xyl+] phenotype. Others, on the other hand, did not retain the [ara+] phenotype after subculture on glucose (results not shown). However, of the 91 strains tested, 67 appear to have acquired and retained the dual [ara+; xyl+] phenotype, which is almost 3 / 4 of the transformants. 4. Comparison between two selected strains: - Fermentation in YFCF medium:

[00161] The performance of 2 isolated clones (called clones 13 and 126, respectively) was compared during fermentation in YFCF medium at pH 5 containing glucose as a carbon source, but also represented balanced arabinose and xylose, as well as acetic acid, thus approximating natural fermentation media.

[00162] More specifically, the composition of the YFCF medium is as follows: - 10 g / l of yeast extract; - 10 g / l of bacto-peptone; - 63 g / l of glucose; - 28 g / l of xylose; - 28 g / l of arabinose; - 4 g / L of acetic acid (amount added to the culture medium at pH 5).

[00163] The fermentation conditions are as follows: pH: 5 Temperature: 32°C - O2 conditions: no oxygen supply Petition 870260064944, dated 01 / 07 / 2026, page 47 / 110 / 45 - Agitation: 100 rpm - Duration of cultivation: up to 72 hours - Pre-Culture / Incubation: 0.25 g / kg DM eq of yeast previously propagated in saturation in YPG medium for 24 hours.

[00164] Ethanol production is measured indirectly by measuring the mass loss of the fermentation flask, the mass loss being directly correlated with CO2 production, which is stoichiometric with that of alcohol. It is expressed in grams per kilogram of medium.

[00165] The concentrations of glucose, xylose, arabinose, and glycerol in the medium are followed by HPLC.

[00166] Biomass variations are evaluated by measuring the residual dry material after 4 hours at 105°C.

[00167] The results shown in Figure 6 reveal: - a reduction in the rate of xylose consumption for clone 13 compared to clone 126, also corresponding to a lower rate of ethanol production; - It is noteworthy that the rate of arabinose consumption is slower in clone 13 than in clone 126. Thus, after 32 hours of fermentation, clone 13 consumed 12.1 + / - 0.6 g / kg of arabinose, while clone 126 consumed 15.3 + / - 0.5 g / kg.

[00168] It is also noteworthy that the pentoses were consumed while the extracellular glucose concentration was not zero.

[00169] An attempt was made to explain the observed difference between clones 13 and 126, in particular the rate of arabinose fermentation. Analysis of route activities:

[00170] The intracellular enzymatic activity involved in the metabolic pathways of arabinose and xylose was tested.

[00171] First, no notable difference was observed in the level of xylitol dehydrogenase activity (results not shown). Petition 870260064944, dated 01 / 07 / 2026, page 48 / 110 / 45

[00172] On the other hand, a different arabinose isomerase activity profile (encoded by araA) was observed between clones 13 and 126, with a more significant competitive inhibition for clone 13 (results not shown).

[00173] As shown in Figure 7, this difference can be correlated with a difference in the level of aldose reduction, more precisely the aldose reductase activity of both clones. It should be noted that in the initial strain I-4953, the GRE3 gene encoding the main aldose reductase in S. cerevisiae was eliminated, but residual activity remained (see Figure 7). Aldose reductase activity assay in a cell extract: Propagation of strains

[00174] The strains to be tested were placed in rich medium (YPG) to grow. Two successive propagation phases of 24 ha at 30°C, under agitation, were necessary to obtain sufficient biomass. Once the biomass was harvested, the dry matter was measured in 1 ml of each cream after passing through the oven at 105°C for 4 hours. Fermentations were carried out in 250 ml flasks containing 100 g of YF-xylose fermentation medium. Each flask was seeded at a rate of 0.5 g / kg of equivalent dry matter. Fermentation proceeded at 32°C under agitation at 110 rpm for 3 days. At this stage, 50 ml of fermentation product are collected and then used to determine the different enzymatic activities and protein concentration of the sample. Preparation of the cell extract

[00175] 50 ml of fermentation product are collected by centrifugation (4700 rpm, 2 min, 4°C) and then resuspended in 3 ml of 0.1 M potassium phosphate buffer, pH 7. After another centrifugation, each pellet is then resuspended in 1 ml of 0.1 M potassium phosphate buffer, pH 7.

[00176] 1 ml of resuspended sediment is then transferred to 1 tube Petition 870260064944, dated 01 / 07 / 2026, page 49 / 110 / 45 for Fast Prep (previously filled with 250 μL of spheres) and then crushed at 4°C: 4 x 30 seconds (6 m / s), spaced 30 seconds apart. The homogenate is then centrifuged for 3 minutes at 10,000 rpm (to make the spheres fall out along with the cellular debris) and the entire supernatant is transferred to an Eppendorf tube cooled in ice. Enzyme activity assay

[00177] Enzyme activity is measured by monitoring absorbance at 340 nm. Measurements are taken in a thermostatically controlled environment at 32°C. White (μ^ sample (μ^ Phosphate buffer (KH2PO4 / K2HPO4 0.1 M pH=7) pH = 7) NAD (0.04 M) Cell extract water xylitol 2 M 750 750 750 100 20 430 (qs 1300) 200

[00178] The substrate is added after 1 minute.

[00179] The results shown in Figure 7 show a very sharp decline in aldose reductase activity in clones 13 and 126 compared to the parental strain I-4953. However, it should be noted that this activity is twice as high in clone 13 as in clone 126. This observation seems capable of explaining the poor performance of clone 13 compared to clone 126. To corroborate this result with the xylose and / or arabinose fermentation performances, an attempt was made to increase aldose reductase activity in clone 126. Impact of reintroducing a gene encoding aldose reductase on the ability of cells to metabolize arabinose:

[00180] There are two primary differences between clones 126 and 13 in their ability to ferment xylose and arabinose and their ability to reduce them to xylitol and arabitol, respectively. As these two phenotypes appear to be anti-correlated, attempts were made to enhance this activity in cells of clone 126. Petition 870260064944, dated 01 / 07 / 2026, page 50 / 110 / 45

[00181] In this sense, the GRE3 gene that encodes the main ladose reductase in the yeast S. cerevisiae (Garay-Arroyo and Covarrubias, 1999, Yeast 15, 879-892; Trãff et al., 2001 Appl. Environ. Microbiol. 67, 5668-5674) was reintroduced. In practice, a copy of the GRE3 gene placed under the promoter dependency of the ADH1 gene was integrated at the level of the native GRE3 locus in the genome of clone 126.

[00182] In order to validate the good integration of the gene into the right locus, the following primers were used in the PRC reactions: - B6C2 (CCTATTGCTGTTTCCTCTTCAAAGTAC; SEQ ID NO: 7), hybridizing on the selection marker terminator; - B13B1, AGTTGTCAGTGCAATCCTTC; (SEQ ID NO: 8), complementary to a terminator region of the GRE3 gene.

[00183] After verifying the integration of the cassette into the genome of the selected transformants (results not shown), their ability to use arabinose as the sole carbon source under anaerobic conditions was tested. In this regard, both transformants and clone 126 were inoculated at a rate of 2 g (DM eq) / kg in YF-Ara medium.

[00184] The mass loss after 48 hours of fermentation is shown in Figure 8. These results show that all clones that integrated the GRE3 gene have the ability to ferment arabinose, which is diminished compared to clone 126. This result thus supports the hypothesis that very strong aldose reductase activity limits the ability of cells to ferment arabinose. CONCLUSIONS:

[00185] Integration of the arabinose fermentation pathway, i.e., of the araA (B. licheniformis) / araB (E. coli) / araD (E. coli) genes at the HO locus level of the S. cerevisiae I-4953 strain, followed by screening in a medium containing arabinose as the sole carbon source, made it possible to select strains capable of fermenting arabinose. Furthermore, it was demonstrated that among Petition 870260064944, dated 01 / 07 / 2026, p. 51 / 110 / 45 of these strains, the most favorable were those that showed low aldose reductase activity. In this context, a particularly interesting strain was isolated, namely strain EG31, and was deposited in the CNCM (National Collection of Microorganism Cultures, Pasteur Institute, 25 rue du Docteur Roux, 75724 Paris Cedex 15) under number CNCM I-5085 on May 19, 2016. II / Obtaining a Saccharomyces cerevisiae strain optimized for arabinose and xylose fermentation: 1. Selection of a strain capable of fermenting arabinose and xylose through directed evolution:

[00186] With the aim of selecting a strain that is still optimized for pentose fermentation, particularly arabinose, the EG31 strain was subjected to directed batch evolution.

[00187] Thus, a protocol for directed evolution was perfected, making it possible to obtain the desired phenotype. For this, a medium was defined and implemented in which the yeast that would consume only one of the two sugars would be at a disadvantage. In practice, in the first medium called “GO xylose arabinose” and defined below, it is not the nitrogen source that is limiting, but the carbon sources. In practice, this medium contains 10 g / l of (NH4)2PO4 but only 4 g / l of xylose and 5 g / l of arabinose. Medium 1: GO xylose arabinose (pH 5):

[00188] - Xylose 4 g / l - Arabinose 5 g / l - (NH4)2HPO4 (DAP) 10 g / l - Citric acid 11.4 g / l - Trisodium citrate 13.5 g / l - ZnSO4 (0.004 g / l) - MgSO4 0.5 g / l - KH2PO4 1 g / l Petition 870260064944, dated 01 / 07 / 2026, page 52 / 110 / 45 - NaCl 0.1 g / l - CaCl2 0.1 g / l - CuSO4 0.00006 g / l - H3BO3 0.0005 g / l KI 0.0001 g / l - MnSO4 0.0004 g / l - Na2MoO4 0.0002 g / l - FeCl3 0.0002 g / l Pyridoxine 0.002 g / l Biotin 0.0008 g / l - Pantothenate (0.002 g / l) - Nicotinic acid 0.001 g / l Meso-inositol 0.001 g / l Tween 80, 1 g / l

[00189] The culture is carried out at 32°C with agitation at 100 rpm in flasks sealed with lids that serve to reduce the oxygen supply to the medium and allow the CO2 produced by this culture under excess pressure to escape. Under these conditions, the harvest lasts about 7 days. 2. Selection of a strain that retained its ability to ferment glucose and / or xylose in the presence of acetic acid.

[00190] To anticipate a possible risk of loss of tolerance to inhibitors, particularly acetic acid in its undissociated form, two successive cultures were introduced into the directed batch evolution cycle in a medium containing glucose or xylose as the sole carbon source, and in both cases in the presence of strong concentrations of acetic acid. Medium 2: YF-glucose acid:

[00191] The YF-glucose acid medium corresponds to the YF medium described above, containing 150 g / l of glucose and having an acetic acid concentration (amount introduced into the culture medium at pH 4.4) equal to 5 g / l. Petition 870260064944, dated 01 / 07 / 2026, page 53 / 110 / 45 Medium 3: YF-xylose acid:

[00192] The YF-xylose acid medium corresponds to the YF-xylose medium described above, with an acetic acid concentration (amount introduced into the culture medium at pH 5) equal to 4 g / l. Growing conditions:

[00193] The culture is carried out at 32°C with agitation at 100 rpm in flasks sealed with lids that serve to reduce the oxygen supply to the medium and allow the excess CO2 produced by this culture to escape. Under these conditions, the culture lasts about seven days. 3. Elimination of "petites":

[00194] To avoid selecting mitochondria-deprived strains, which would not be compatible with industrial production processes, a step was also added for culturing in a medium containing glycerol as the sole carbon source. This step requires the presence of a chain for the transfer of functional electrons to the cells, so that they can multiply. Medium 4: YNB glycerol:

[00195] - 3.4 g / l of DIFCO® nitrogen-based yeast; - 5 g / l of ammonium sulfate; - 10 g / l of glycerol as the only carbon source.

[00196] The culture is carried out at 30°C with agitation at 150 rpm in baffle-equipped flasks with porous stoppers that allow oxygen to be supplied to the medium. Under these conditions, the culture lasts 24 to 48 hours.

[00197] In practice, a directed evolution cycle is characterized by: - a culture in GO medium of xylose arabinose; then - a culture in YF acid glucose medium; then - a culture in acidic YF xylose medium; then - a culture in YNB glycerol medium. Petition 870260064944, dated 01 / 07 / 2026, page 54 / 110 / 45 4. Evaluation of obtained clones:

[00198] In practice, two crop cycles were carried out.

[00199] At the end of this directed evolution, the clones were individually placed on complete medium plates, and the performance of the resulting clones was evaluated in a YFCF medium whose composition is given above. Figure 9A shows the evolution of ethanol production as a function of fermentation time for 6 of the best clones obtained.

[00200] These results reveal that 5 of the 6 clones have kinetics close to that of the EG31 strain, however with a final alcohol content higher than that of the EG31 strain. The last clone observed that C7 appears faster during the transition between the metabolism of 6-carbon sugars and that of 5-carbon sugars. Subsequently, the fermentation kinetics appear to be the same as the other clones. At the end of fermentation, it appears that the alcohol content is higher with this strain than during the implementation of the other clones.

[00201] To validate that this improvement is indeed related to better arabinose consumption, an HPLC assay was performed to quantify the other sugars. Figure 9B represents the arabinose concentrations in the fermentation medium after 160 hours of fermentation. The results confirm that all selected clones from the directed evolution consumed more arabinose than the EG31 strain; the observed clone, C7, appears to be the most efficient. This clone was renamed the EG32 strain, which was deposited in the CNCM (National Collection of Microorganism Cultures, Pasteur Institute, 25 rue du Docteur Roux, 75724 Paris Cedex 15) under the number CNCM I-5086 on May 19, 2016. Petition 870260064944, dated 01 / 07 / 2026, p. 55 / 110

Claims

1 / 3 CLAIMS 1. A process for obtaining and selecting yeast strains capable of fermenting arabinose, glucose, and xylose in the presence of acetic acid in undissociated form, characterized in that it comprises: - chromosomal integration of an L-arabinose isomerase gene (araA) from Bacillus licheniformis, an L-ribulokinase gene (araB) from Escherichia coli, and an L-ribulose-5-P-4 epimerase gene (araD) from E. coli into a yeast strain capable of fermenting xylose in the presence of acetic acid in undissociated form and possessing at least one inactivated or deleted aldose reductase gene (GRE3); - placing the transformed strains in a direct culture in a medium containing arabinose as the sole carbon source for the selection of strains capable of fermenting said arabinose; e - select transformed strains that metabolized arabinose based on their aldose reductase activity less than or equal to 0.002 U / g of protein, or even less than or equal to 0.0005 U / g of protein.

2. Process according to claim 1, characterized in that the yeast strain capable of fermenting xylose in the presence of acetic acid in undissociated form and possessing at least one inactivated or deleted GRE3 gene is chosen from Saccharomyces, Schizosaccharomyces, Pichia, Yarrowia, Paffia, Kluyveromyces, Candida, Talaromyces, Brettanomyces, Pachysolen, Hansenula, Kloeckera, Schwanniomyces and Debaryomyces.

3. Process according to claim 2, characterized in that the yeast strain is a strain of Saccharomyces cerevisiae.

4. Process according to any one of claims 1 to 3, characterized in that the yeast strain capable of fermenting xylose in the presence of acetic acid in the undissociated form and possessing at least one inactive or deleted GRE3 gene is the strain deposited in the CNCM in Petition 870260064944, dated 01 / 07 / 2026, page 56 / 110 2 / 3 January 29, 2015 under number I-4953.

5. Yeast strain obtained using the process as defined in claim 1, characterized in that it also exhibits an aldose reductase activity of less than or equal to 0.002 U / g of protein, or even less than or equal to 0.0005 U / g of protein, and is strain I-5085, filed with the CNCM on May 19, 2016.

6. Process for obtaining and selecting a yeast strain with improved capacity to ferment arabinose, glucose and xylose in the presence of acetic acid in undissociated form, characterized in that a yeast strain capable of fermenting arabinose, glucose and xylose in the presence of acetic acid in undissociated form, and obtained using the process as defined in claim 1, or the I-5085 strain as defined in claim 5, is successively cultivated under the following conditions: - a culture in anaerobic or hypoxic conditions in a medium containing, as the only carbon sources, arabinose and xylose in concentrations limiting the production of biomass, in amounts of 5 g / L and 4 g / L, respectively; then - two successive cultures in anaerobic or hypoxic conditions in the presence of acetic acid in undissociated form, one in a medium containing glucose as the only carbon source and the other in a medium containing xylose as the only carbon source;- an anaerobic culture in a minimal medium containing, as the only carbon source, a strictly respiratory carbon source, glycerol.

7. Process according to claim 6, characterized in that the successive culture of the strain in the various media is repeated at least 2 times.

8. Yeast strain obtained using the process defined in claim 6, characterized in that it is strain I-5086, deposited in Petition 870260064944, dated 01 / 07 / 2026, page 57 / 110 3 / 3 CNCM on May 19, 2016.

9. Yeast strain according to any one of claims 5 or 8, characterized in that it has at least one supernumerary copy of the HAA1 gene inserted at the level of the GRE3 gene.

10. Use of a yeast strain as defined in any one of claims 5, 8 or 9, characterized in that it is for fermentation of a material containing arabinose and / or xylose, and / or for the production of ethanol.

11. Process for the production of fermentation products or ethanol, characterized in that it comprises the following steps: - incubation of a material or medium containing arabinose and / or xylose with a yeast strain, as defined in any one of claims 5, 8 or 9; - fermentation under anaerobic or semi-anaerobic conditions; and - recovery of one or more fermentation products or ethanol.

12. Process according to claim 11, characterized in that the material or medium also contains glucose.

13. Process according to claim 11, characterized in that the material or medium is hemicellulose or “corn fiber”. Petition 870260064944, dated 01 / 07 / 2026, pp. 58 / 110

Images