Recombinant Adenoassociated Viral Vector (rAAV), its use, and pharmaceutical composition.

BR112019016444B1Active Publication Date: 2026-08-25THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
BR112019016444
Authority / Receiving Office
BR · BR
Patent Type
Patents
Current Assignee / Owner
Publication Date
2026-08-25

Smart Images

  • Figure 00000187_0000
    Figure 00000187_0000
  • Figure 00000187_0001
    Figure 00000187_0001
  • Figure 00000188_0000
    Figure 00000188_0000
Patent Text Reader

Abstract

This document describes a raav vector that has an aavhu68 capsid and at least one expression cassette in the capsid. The at least one expression cassette comprises nucleic acid sequences encoding a functional smn protein and expression control sequences that direct the expression of the smn sequences in a host cell. Compositions containing this raavhu68.vector for smn and methods of using it for spinal muscular atrophy in a patient are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant Adenoassociated Viral Vector (rAAV), its use, and pharmaceutical composition. BACKGROUND OF THE INVENTION

[0001] Spinal muscular atrophy (SMA) is a neuromuscular disease caused by mutations in telomeric SMN1, a gene that encodes a ubiquitously expressed protein (survival of motor neuron SMN) involved in pain biogenesis. SMA is an autosomal recessive disorder caused by mutations or deletion of the SMN1 gene. Provision of a functioning SMN1 gene has been shown to rescue the phenotype. See, for example, Tanguy et al., Systemic AAVrh10 provides higher transgene expression than AAV9 in the brain and the spinal cord of neonatal mic, Frontiers in Molecular Neuroscience, 8(36) (July 2015).

[0002] The International SMA Consortium classification defines several degrees of severity in the SMA phenotype, depending on the age of onset and motor development milestones. The designation SMA 0 is proposed to reflect prenatal onset and severe joint contractures, facial diplegia, and respiratory failure. SMA type 1 (or I), Werdnig-Hoffmann disease I, is the most severe postnatal form with onset within 6 months of birth. Patients are unable to sit and present with severe respiratory dysfunction. SMA Type 2 (or II) is the intermediate form with onset within the first 2 years; children can sit but cannot walk. The clinical course is variable. Type 3 (or III) (also called Kugelberg-Welander disease) begins after 2 years of age and usually has a chronic course. Children can stand and walk without assistance, at least in infancy.The adult form (type 4 or IV) is the mildest, with onset after 30 years of age; few cases have been reported and its prevalence is not precisely known.

[0003] Many inherited and acquired neuromuscular diseases Petition 870260060647, dated 06 / 22 / 2026, page 7 / 383 2 / 182 involve degeneration of lower motor neurons. One of the most common and devastating examples is spinal muscular atrophy (SMA), a hereditary deficiency of survival motor neuron (SMN) protein characterized by selective death of lower motor neurons, progressive weakness, and often death in early childhood. For unclear reasons, SMN deficiency results in selective toxicity to lower motor neurons, resulting in progressive neuronal loss and muscle weakness. The severity of the disease is modified by the number of copies of a centromeric duplication of the homologous gene (SMN2), which carries a mutation at the splice site that results in the production of only small amounts of the complete SMN transcript. Patients carrying 1-2 copies of SMN2 present with the severe form of SMA, characterized by onset in the first months of life and rapid progression to respiratory failure.Patients with three copies of SMN2 typically exhibit a mild form of the disease, usually presenting with it after six months of age. Although many never learn to walk, they rarely progress to respiratory failure and often live into adulthood. Patients with four copies of SMN2 may not present with the disease until adulthood, with a gradual onset of muscle weakness. Currently, there is no treatment for SMA other than palliative care.

[0004] The clear correlation between SMN expression and disease severity, as well as the relatively small number of cells affected, makes SMA an excellent target for gene therapy. Previous studies have demonstrated that the SMA phenotype can be rescued in transgenic mouse models using systemic injection of AAV vector serotypes with the ability to cross the blood-brain barrier. See, for example, Tanguy et al., Systemic AAVrh10 provides higher transgene expression than AAV9 in the brain and the spinal cord of neonatal mic, Frontiers in Molecular Neuroscience, 8(36) Petition 870260060647, dated 06 / 22 / 2026, page 8 / 383 3 / 182 (July 2015). Passini et al., HGT, 2014 reported a dose-dependent increase in survival up to 200 days in SMNΔ7 mice using an scAAV9.GusB.SMN1 vector. Meyer et al., Molecular Therapy, 2014 reported a dose-dependent increase in survival up to 450 days using an scAAV9.CBA.SMN1 vector at dosages of 2.7 x 10⁹ GC / pup to 3.3 x 10¹⁰ GC / pup. However, lower doses showed little improvement. See also Passini et al., JCI, 2010 and Passini et al., Sci Trans Med, 2011. Each of these documents is incorporated herein by reference.

[0005] Effective treatments for SMA are still needed. SUMMARY OF THE INVENTION

[0006] In one aspect, a recombinant adeno-associated viral vector (rAAV) is provided comprising an AAVhu68 capsid and at least one expression cassette, wherein the at least one expression cassette comprises nucleic acid sequences encoding a functional SMN protein and expression control sequences directing the expression of the SMN sequences in a host cell, wherein the AAVhu68 capsid comprises a population of AAVhu68vp1 capsid proteins having an amino acid sequence independently selected from a produced protein encoded by SEQ ID NO: 7 or having the amino acid sequence of SEQ ID NO: 8. In certain embodiments, the AAVhu68 capsid has a heterogeneous population of vp1 proteins. In certain embodiments, the AAVhu68 capsid has a heterogeneous population of vp2 proteins. In certain embodiments, the AAVhu68 capsid has a heterogeneous population of vp3 proteins.In one embodiment, the coding sequence for the AAVhu68 capsid protein has the sequence SEQ ID NO: 7. In another embodiment, the coding sequence for SMA has the sequence SEQ ID NO: 1.

[0007] Additionally, a rAAV vector is provided comprising Petition 870260060647, dated 06 / 22 / 2026, page 9 / 383 4 / 182 an AAVhu68 capsid that has packaged within it a nucleic acid molecule comprising an AAV 5'ITR, a CB7 promoter, an intron, nucleic acid sequences of SEQ ID NO: 1, a polyA and an inverted terminal repeat sequence of AAV 3', wherein the AAVhu68 capsid comprises a population of vp1 proteins, a population of vp2 proteins and a population of vp3 proteins, wherein the AAVhu68 capsid proteins have amino acid sequences independently selected from proteins produced by the capsid proteins of SEQ ID NO: 7 having the amino acid sequence of vp1, vp2 and / or vp3 of SEQ ID NO: 8. In certain embodiments, the AAVhu68 capsid has a heterogeneous population of vp1 proteins. In certain embodiments, the AAVhu68 capsid has a heterogeneous population of vp2 proteins. In certain embodiments, the AAVhu68 capsid has a heterogeneous population of vp3 proteins.

[0008] A pharmaceutical composition is provided containing an AAVhu68 vector as described above. In addition to at least one vector stock, the composition also contains at least one pharmaceutically acceptable vehicle, excipient and / or preservative.

[0009] A method is further provided for the treatment of spinal muscular atrophy in an individual requiring it, using an rAAVhu68.SMA vector or other delivery vehicle for the hSMN designed in this document. In certain embodiments, the compositions provided in this document may be administered intrathecally.

[0010] In certain embodiments, a rAAVhu68.SMN1 is provided as described in this document or a composition for use in the treatment of spinal muscular atrophy in a patient, optionally in co-therapy. In certain embodiments, the patient has SMA type 3. In certain embodiments, the composition is formulated for intrathecal distribution.

[0011] The use of a rAAVhu68.SMA as described in this Petition 870260060647, dated 06 / 22 / 2026, page 10 / 383 5 / 182 document, or a composition containing the same, for the treatment of a patient with SMA is provided, optionally in a co-therapeutic regimen. Such a composition may be formulated for intrathecal distribution.

[0012] Other aspects and advantages of the invention will become apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE FIGURES

[0013] Figure 1A is a schematic representation of the genome of the vector AAVhu68.CB7.CI.hSMN1co.RBG. ITR represents an inverted repeat of the AAV2 terminal. CB7 represents a chicken beta-actin promoter with cytomegalovirus enhancer. RBG PolyA represents a rabbit beta-globulin polyadenylation signal.

[0014] Figures 1B - 1C are an alignment of native hSMN1, variant D (Access No. NM_000344.3) (SEQ ID NO: 3) vs. the codon-optimized sequence described in this document (SEQ ID NO: 1).

[0015] Figure 2 is an evaluation of transduction in the brain and spinal cord by immunohistochemistry (IHC) and in situ hybridization (ISH). Immunohistochemistry of SMN1 was performed on sections of the cortex, cerebellum, and spinal cord, and representative images are shown in the three upper panels. ISH for codon-optimized ribonucleic acid hSMN1 (RNA) was conducted on sections of the cortex, and representative results are shown in the lower panel. Samples of SMNΔ7 (KO) mice treated with or without 3 x 1010GC of AAVhu68.CB7.CI.hSMN1.RBG per pup were collected. Wild-type (WT) and heterozygous (Het) littermates served as positive controls.

[0016] Figure 3A is a survival curve for mice. SMNΔ7 (KO) treated with or without 3 x 1010 or 8.76 x 1010GC / pup of AAVhu68.CB7.CI.hSMN1.RBG. Wild-type (WT) / heterozygous (Het) littermates and mice injected with PBS Petition 870260060647, dated 06 / 22 / 2026, page 11 / 383 6 / 182 served as controls.

[0017] Figure 3B is a statistical analysis table of the survival curve described in Figure 3A. The Median Survival has been calculated and listed.

[0018] Figure 4A is a line graph of body weights of SMNΔ7 (KO) mice treated with 3 x 1010 or 8.76 x 1010GC / pup of AAVhu68.CB7.CI.hSMN1.RBG vectors. Wild-type (WT) / heterozygous (Het) mice from the same litter injected with PBS served as controls.

[0019] Figure 4B is a line graph of body weights on postnatal day 15 of SMNΔ7 (KO) mice treated with 3 x 1010 or 8.76 x 1010GC / pup of AAVhu68.CB7.CI.hSMN1.RBG. Wild-type (WT) / heterozygous (Het) littermates and mice injected with PBS served as controls.

[0020] Figure 4C is a line graph of body weights on postnatal day 30 of SMNΔ7 (KO) mice treated with 3 x 1010 or 8.76 x 1010GC / pup of AAVhu68.CB7.CI.hSMN1.RBG. Wild-type (WT) / heterozygous (Het) littermates served as positive controls.

[0021] Figures 4D-4J are line plots of body weights after normalization by sex. The experiment was performed every two days, from postnatal day 3 to 13 or 15 in SMNΔ7 (KO) mice treated with 3 x 1010 or 8.76 x 1010GC of AAVhu68.CB7.CI.hSMN1.RBG per pup. Wild-type (WT) / heterozygous (Het) littermates and mice injected with PBS served as controls. The P-value was calculated by statistical analysis and indicated in the figure.

[0022] Figure 5A is an illustration of the scoring system used in the Hind Limb Suspension Test.

[0023] Figure 5B includes graphs of the Hind Limb Score recorded every two days from postnatal day 3 to 13 in Petition 870260060647, dated 06 / 22 / 2026, page 12 / 383 7 / 182 SMNΔ7 (KO) mice were treated with 3 x 1010 or 8.76 x 1010GC of AAVhu68.CB7.CI.hSMN1.RBG per pup. Wild-type (WT) / heterozygous (Het) littermates and PBS-injected mice served as controls.

[0024] Figures 6A - 6C include graphs showing the time an animal took to return to its normal position in the Postural Reflex Test. The experiment was performed every two days, from postnatal day 7 to 17 in SMNΔ7 (KO) mice treated with 3 x 1010 or 8.76 x 1010GC of AAVhu68.CB7.CI.hSMN1.RBG per pup. Wild-type (WT) / heterozygous (Het) littermates and mice injected with PBS served as controls.

[0025] Figures 6D - 6J are graphs showing the time an animal took to return to its normal position in the Postural Reflex Test after sex normalization. The experiment was performed every two days, from postnatal day 7 to 17 in SMNΔ7 (KO) mice treated with 3 x 1010 or 8.76 x 1010GC of AAVhu68.CB7.CI.hSMN1.RBG per pup. Wild-type (WT) / heterozygous (Het) littermates and mice injected with PBS served as controls. The P-value was calculated by statistical analysis and indicated in the figure.

[0026] Figure 7 is an image of an intracisternal delivery device, including an optional introducer needle for the coaxial insertion method, which includes a 10 cc vector syringe, a 10 cc pre-filled discharge syringe, a T-connector extension assembly, a 22G x 5 spinal needle, and an optional 18G x 3.5 introducer needle.

[0027] Figure 8A provides an alignment showing the amino acid sequence of the vp1 capsid sequences encoded by the nucleic acid sequences in Figures 8B-8D. The alignment includes the vp1 protein from AAVhu68 [SEQ ID NO: 8], with AAV9 [SEQ ID NO: Petition 870260060647, dated 06 / 22 / 2026, p. 13 / 383 8 / 182 16], AAVhu31 (marked hu.31 in alignment) [SEQ ID NO: 18] and AAVhu32 (marked hu.32 in alignment) [SEQ ID NO: 19]. Compared to AAV9, AAVhu31 and AAVhu32, two mutations (A67E and A157V) were considered critical in AAVhu68 and are circled in the figure.

[0028] Figures 8B-8D provide an alignment of the nucleic acid sequence encoding the vp1 capsid of AAVhu68 [SEQ ID NO: 7], with AAV9 [SEQ ID NO: 22], AAVhu31 [SEQ ID NO: 20] and AAVhu32 [SEQ ID NO: 21].

[0029] Figures 9A-9B are graphs showing weight monitoring results in adult wild-type (HET / WT, FIG 9A) or SMNΔ7 (KO, Figure 9B) mice treated ICV with AAVhu68.CB7.CI.hSMN1.RBG at varying doses (1x109GC, WT, n=7, KO, n=1; 3x109GC, WT, n=7, KO, n=1; 1x1010GC, WT, n=3, KO, n=5; 3x1010GC, WT, n=1, KO, n=1; or 7x1010GC, WT, n=5, KO, n=3). Animals injected with PBS (WT, n = 3; KO, n=4) were provided as controls.

[0030] Figures 10A-10B are graphs showing postural reflex results in adult wild-type (HET / WT, Figure 10A) or SMNΔ7 (KO, Figure 10B) mice treated ICV with AAVhu68.CB7.CI.hSMN1.RBG at varying doses (1x109GC, WT, n=7, KO, n=1; 3x109GC, WT, n=7, KO, n=1; 1x1010GC, WT, n=3, KO, n=5; 3x1010GC, WT, n=1, KO, n=1; or 7x1010GC, WT, n=5, KO, n=3). Animals injected with PBS (WT, n=3; KO, n=5) were provided as controls.

[0031] Figures 11A-11H are graphs showing clinical pathology, CSF chemistry and CSF cytology in adult Rhesus monkeys treated intrathecally with AAVhu68.CB7.CI.hSMN1co.RBG as described in Example 10.

[0032] Figures 12A-12B provide the quantification of motor neuron transduction by ISH (Figure 12A) and IHC (Figure 12B) in monkeys. Petition 870260060647, dated 06 / 22 / 2026, page 14 / 383 9 / 182 Adult rhesus monkeys were treated intrathecally with AAVhu68.CB7.CI.hSMN1.RBG as described in Example 10. Fluoroscopic guidance and contrast material were used to confirm needle placement in the cisterna magna (ICM) or lumbar cistern (lumbar puncture; LP). The total injection volume was 1.0 mL for the ICM group (n=3) and 2.5 mL (n=4) or 5.0 mL (n=4) for the LP groups. One month after injection, the animals were sacrificed and motor neuron transduction was quantified in spinal cord sections by in situ hybridization (ISH) for transgene mRNA and immunohistochemistry (IHC) for human SMN protein.

[0033] Figure 13 provides the biodistribution in adult Rhesus monkeys treated intrathecally with AAVhu68.CB7.CI.hSMN1.RBG as described in Example 10.

[0034] Figures 14A-14B provide weight monitoring results in adult C57BL / 6J mice treated ICV with AAVhu68.CB7.CI.hSMN1co.RBG as described in Example 9. Figure 14A provides weight monitoring results in female subjects. Figure 14B provides weight monitoring results in male subjects.

[0035] Figures 15A-15B are a manufacturing flowchart for an AAVhu68.SMN vector.

[0036] Figures 16A-16E provide graphs showing acute transaminase elevations following intravenous administration of an AAV vector expressing human SMN to non-human primates. Figure 16A provides the study design as described in Example 14. Figure 16B provides a graph of serum ALT. Figure 16C provides a graph of serum AST. Figure 16D provides a graph of serum alkaline phosphatase. Figure 16E provides a graph of total serum bilirubin. Unscheduled laboratory assessments were performed for all animals on day 5 of the study after animal 16C176 Petition 870260060647, dated 06 / 22 / 2026, page 15 / 383 10 / 182 developed acute liver failure requiring euthanasia. AST was not performed on day 5 of the study for animals 16C116 and 16C215. Dashed lines indicate laboratory reference range.

[0037] Figures 17A-17D provide representative images of IHC showing histopathological findings of the liver for animal 16C176. Massive acute hepatocellular necrosis (Figure 17A) with sinusoidal fibrin deposition (Figure 17B, arrowheads) and acute fibrin thrombi (Figure 17C) in portal veins (Hematoxylin and eosin; Scale bar = 10 pm (Figures 17A and 17C), 50 pm (Figure 17B)). Immunohistochemistry for fibrinogen represents prominent periportal sinusoidal fibrin deposition (Figure 17D) (Fibrinogen IHC, Scale bar represents 100 pm (Figure 17D)).

[0038] Figures 18A-18D provide representative histopathological findings of the nervous system in infant NHPs treated with intravenous (IV) AAVhu68 expressing human SMN 28 days post-injection. Both animals had an axonopathy of the dorsal white matter tracts of the spinal cord (Figure 18A). The dorsal axonopathy was typically bilateral and characterized by dilated myelin sheaths with and without myelomacrophages, consistent with axonal degeneration. The dorsal root ganglia of the spinal cord (Figure 18B) exhibited minimal to mild neuronal cell body degeneration, characterized by central chromatolysis, satellitosis, and mononuclear cell infiltrates surrounding and invading neuronal cell bodies (neuronophagia). A similar axonopathy was observed in the peripheral nerves of the hind limb (sciatic nerve, Figure 18C) and forelimb (median nerve, Figure 18D).The animal (16C176) that was sacrificed on day 5 due to acute liver failure had no findings in the nervous system. (Hematoxylin and eosin staining; Scale bar = 200 pm (Figure 18A), 100 pm (Figures 18B-18D)). Petition 870260060647, dated 06 / 22 / 2026, page 16 / 383 11 / 182

[0039] Figure 19 provides vector biodistribution in rhesus monkeys. Rhesus monkeys treated with intravenous AAVhu68 expressing human SMN were euthanized 28 days after injection, except for animal 16C176, which developed liver failure and shock and was euthanized 5 days after vector administration. Vector genomes were detected in tissue DNA samples by quantitative PCR. Values ​​are expressed as vector genome copies (GC) per host diploid genome. DRG = dorsal root ganglia. Data are shown for four liver lobes (caudate, left, middle, and right).

[0040] Figures 20A-20G show SMN expression in rhesus monkeys. Human SMN RNA was detected by ISH in the liver (Figure 20A). The liver was stained with control probes for albumin (Figure 20B) and GFP (Figure 20C). Cells expressing SMN were identified by ISH in the spinal cord (Figure 20D). Motor neurons were identified by ChAT ISH (Figure 20E). Rare patches of transduced neurons were detected by SMN ISH in the brain (Figure 20F, DAPI nuclear staining). The percentage of transduced ChAT+ motor neurons at each spinal cord level was quantified (Figure 20G). Error bars = SEM.

[0041] Figures 21A-21D provide representative histopathological findings from piglets treated with intravenous AAVhu68 expressing human SMN at 7 and 30 days of age. In both groups, axonopathy of the dorsal white matter sectors of the spinal cord was observed (Figure 21A). The dorsal axonopathy was bilateral and characterized by dilated myelin sheaths with and without myelomacrophages, consistent with axonal degeneration. The dorsal root ganglia of the spinal cord (Figure 21B) exhibited varying degrees of neuronal cell body degeneration, characterized by central chromatolysis, satellitosis, and mononuclear cell infiltrates surrounding and invading Petition 870260060647, dated 06 / 22 / 2026, page 17 / 383 12 / 182 neuronal cell bodies (neuronophagy). Similar axonopathy of varying degrees was observed in the peripheral nerves of the forelimb (sciatic nerve, Figure 21C) and hindlimb (median nerve, Figure 21D) in most piglets. (Hematoxylin and eosin; scale bar = 200 pm (Figure 21A), 100 pm (Figures 21B-21D))

[0042] Figure 22 provides vector biodistribution in piglets. Newborn piglets treated with intravenous AAVhu68 expressing human SMN were sacrificed 13-14 days after injection. Vector genomes were detected in tissue DNA samples by quantitative PCR. Values ​​are expressed as vector genome (GC) copies per host diploid genome. DRG = dorsal root ganglia. Data are shown for four liver lobes (caudate, left, middle, and right).

[0043] Figures 23A-23F provide representative images showing SMN expression in the spinal cord of piglets. Human SMN RNA was detected by ISH in the cervical (Figure 23A), thoracic (Figure 23B), and lumbar (Figure 23C) segments of the spinal cord. Motor neurons were identified by ChAT ISH in the corresponding sections (Figures 23D-23F). Representative images are shown. DETAILED DESCRIPTION OF THE INVENTION

[0044] A recombinant AAVhu68 vector with an AAVhu68 capsid and nucleic acid encoding a survival motor neuron (SMN) gene under the control of regulatory sequences that direct its expression in patients who require it is provided in this document. The rAAVhu68 capsid contains proteins independently possessing the amino acid sequence produced from SEQ ID NO: 7 and / or possessing the amino acid sequence from SEQ ID NO: 8. Compositions containing these vectors are provided, as well as the use of these vectors in compositions for treatment. Petition 870260060647, dated 06 / 22 / 2026, page 18 / 383 13 / 182 of patients with SMA. Although the examples focus on the treatment of SMA 3 (sometimes called Kugelberg-Welander disease), the use of these rAAV vectors alone or in combination with other co-therapies is contemplated for SMA types 1, 2, or 4. SMA can be diagnosed using a blood test to detect a mutation in the SMN1 gene on chromosome 5. Additional muscle tests, such as electromyography or muscle biopsy, may be used to aid in diagnosis. I. AAV

[0045] As used in this document, the term clade, as it refers to groups of AAVs, refers to a group of AAVs that are phylogenetically related to each other, as determined using a Neighbor-Joining algorithm by an initialization value of at least 75% (from at least 1000 replicates) and a Poisson correction distance measurement of at most 0.05, based on the alignment of the AAV vp1 amino acid sequence. The Neighbor-Joining algorithm has been previously described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method.Using these techniques and computer programs, and the sequence of an AAV vp1 capsid protein, someone skilled in the art can readily determine whether a selected AAV is contained within one of the clades identified in this document, in another clade, or outside of these clades. See, for example, G Gao, et al., J Virol, 2004 Jun; 78(10): 6381-6388, which identifies Clades A, B, C, D, E, and F, and provides nucleic acid sequences of the novel AAV, GenBank accession numbers AY530553 to AY530629. See also WO 2005 / 033321.

[0046] As used in this document, an AAV9 capsid is Petition 870260060647, dated 06 / 22 / 2026, p. 19 / 383 14 / 182 a self-assembled AAV capsid composed of several AAV9 vp proteins. The AAV9 vp proteins are typically expressed as alternative splice variants encoded by a nucleic acid sequence from SEQ ID NO: 22 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to it, which encodes the vp1 amino acid sequence from SEQ ID NO: 16 (GenBank Accession: AAS99264). These splice variants result in proteins of different lengths from SEQ ID NO: 16. In certain embodiments, the AAV9 capsid includes an AAV with an amino acid sequence that is 99% identical to AAS99264 or 99% identical to SEQ ID NO: 16. See also US7906111 and WO 2005 / 033321. As used in this document, variants of AAV9 include those described in, for example, WO2016 / 049230, US 8,927,514, US 2015 / 0344911, and US 8,734,809.

[0047] A rAAVhu68 is composed of an AAVhu68 capsid and a vector genome. An AAVhu68 capsid is an assembly of a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 proteins, and a heterogeneous population of vp3 proteins. As used in this document, when used to refer to the vp capsid proteins, the term heterogeneous, or any grammatical variation thereof, refers to a population consisting of elements that are not identical, for example, possessing vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. SEQ ID NO: 8 provides the encoded amino acid sequence of the vp1 protein of AAVhu68. See also U.S. Provisional Patent Applications Nos. 62 / 614,002, 62 / 591,002 and 62 / 464,748, each of which is entitled Novel Adeno-Associated Virus (AAV) Clade F Vector and Uses Therefor, and which are incorporated herein by reference in their entirety.

[0048] The AAVhu68 capsid contains subpopulations in the proteins Petition 870260060647, dated 06 / 22 / 2026, page 20 / 383 15 / 182 vp1, vp2, and vp3 proteins that have modifications from the amino acid residues predicted in SEQ ID NO: 8. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three, or four highly deamidated asparagine (N) positions in asparagine-glycine pairs in SEQ ID NO: 8 and optionally further comprising other deamidated amino acids, wherein deamidation results in an amino acid alteration and other optional modifications. SEQ ID NO: 26 provides the amino acid sequence of a modified AAVhu68 capsid, illustrating residue positions that may be deamidated or otherwise modified.

[0049] As used in this document, a vp protein subpopulation refers to a group of vp proteins that has at least one defined characteristic in common and that consists of at least one less member of the reference group than all members of the reference group, unless otherwise specified. For example, a vp1 protein subpopulation is at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid, unless otherwise specified. A vp3 protein subpopulation may be one (1) vp3 protein less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified. For example, vp1 proteins may be a vp protein subpopulation; vp2 proteins may be a separate vp protein subpopulation, and vp3 are yet another vp protein subpopulation in an assembled AAV capsid.In another example, the vp1, vp2, and vp3 proteins may contain subpopulations with different modifications, for example, at least one, two, three, or four highly deamidated asparagines, for example, in asparagine-glycine pairs. Petition 870260060647, dated 06 / 22 / 2026, page 21 / 383 16 / 182

[0050] Unless otherwise indicated, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 97%, 99%, up to about 100% deamidated at a referenced amino acid position, compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagines at amino acid 57 of SEQ ID NO: 8 may be deamidated based on total vp1 proteins or 20% of the asparagines at amino acid 409 of SEQ ID NO: 8 may be deamidated based on total vp1, vp2, and vp3 proteins). These percentages can be determined using 2D gel, mass spectrometry techniques, or other appropriate techniques.

[0051] Without wishing to be bound by theory, it is believed that the deamidation of at least highly deamidated residues in vp proteins in the AAVhu68 capsid is primarily non-enzymatic in nature, being caused by functional groups within the capsid protein that deamidate selected asparagines and, to a lesser extent, glutamine residues. The efficient capsid assembly of most vp1 deamidation proteins indicates that these events occur after capsid assembly or that deamidation in individual monomers (vp1, vp2, or vp3) is well tolerated structurally and largely does not affect assembly dynamics. Extensive deamidation in the VP1-u ...

[0052] Without wishing to be limited by theory, N deamidation can occur when the nitrogen atom of the main chain of its C-terminal residue conducts a nucleophilic attack on the carbon atom. Petition 870260060647, dated 06 / 22 / 2026, p. 22 / 383 17 / 182 of the amide group of the Asn side chain. It is believed that, in this way, a ring-closed succinimide intermediate residue is formed. The succinimide residue then conducts rapid hydrolysis to lead to the final product aspartic acid (Asp) or isoaspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which can interconvert via the succinimide intermediate, for example, as illustrated below. the the Isoaspartic acid

[0053] As provided in this document, each deamidated N of SEQ ID NO: 8 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate and / or an interconversion mixture of Asp and isoAsp, or combinations thereof. Any suitable ratio of α- and isoaspartic acid may be present. For example, in certain embodiments, the ratio may be 10:1 to 1:10 aspartic to iso-aspartic, approximately 50:50 aspartic:iso-aspartic or approximately 1:3 aspartic:iso-aspartic, or another selected ratio.

[0054] In certain embodiments, one or more glutamine (Q) in SEQ ID NO: 8 desamides into glutamic acid (Glu), i.e., α-glutamic acid, γ-glutamic acid (Glu), or a mixture of α- and γ-glutamic acid, which may interconvert via a common glutarinimide intermediate. Any suitable ratio of α- and γ-glutamic acid may be present. For example, in certain embodiments, the ratio may be 10:1 to 1:10 α to γ, approximately 50:50 α:γ, or approximately 1:3 α:γ, or another selected ratio. Petition 870260060647, dated 06 / 22 / 2026, p. 23 / 383 18 / 182 o glutamine (Gin) isoglutamic acid (γ-Glu)

[0055] Thus, an rAAVhu68 includes subpopulations in the rAAVhu68 capsid of the vp1, vp2, and / or vp3 proteins with deamidated amino acids, including at least one subpopulation comprising at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, modifications may include amidation at an Asp position.

[0056] In certain embodiments, an AAVhu68 capsid contains vp1, vp2, and vp3 subpopulations possessing at least 4 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10% are deamidated compared to the encoded amino acid sequence of SEQ ID NO: 8. N residues may be the majority of these. However, Q residues may also be deamidated.

[0057] In certain embodiments, an AAV68 capsid is further characterized by one or more of the following. AAV hu68 capsid proteins comprise: AAVhu68 vp1 proteins produced by the expression of a nucleic acid sequence encoding the predicted amino acid sequence 1 to 736 of SEQ ID NO: 8, vp1 proteins produced from SEQ ID NO: 7, or vp1 proteins produced from Petition 870260060647, dated 06 / 22 / 2026, p. 24 / 383 19 / 182 a nucleic acid sequence at least 70% identical to SEQ ID NO: 7 that encodes the predicted amino acid sequence 1 to 736 of SEQ ID NO: 8; AAVhu68 vp2 proteins produced by the expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least approximately amino acids 138 to 736 of SEQ ID NO: 8, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 7, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 7 encoding the predicted amino acid sequence of at least approximately amino acids 138 to 736 of SEQ ID NO: 8, and / or AAVhu68 vp3 proteins produced by the expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 8.vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 7 or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 7 that encodes the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 8.

[0058] Additionally or alternatively, an AAV capsid is provided comprising a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157, and a heterogeneous population of vp3 proteins, wherein at least one subpopulation of the vp1 and vp2 proteins comprises a valine at position 157 and optionally further comprises a glutamic acid at position 67 based on the vp1 capsid numbering of SEQ ID NO: 8. Additionally or alternatively, an AAVhu68 capsid is provided comprising a heterogeneous population of vp1 proteins that are the product of a Petition 870260060647, dated 06 / 22 / 2026, page 25 / 383 20 / 182 nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 8, a heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 8, and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 8, wherein: vp1, vp2, and vp3 proteins contain subpopulations with amino acid modifications.

[0059] The AAVhu68 vp1, vp2, and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence that encodes the complete vp1 amino acid sequence of SEQ ID NO: 8 (amino acid 1 to 736). Optionally, the vp1 coding sequence is used alone to express the vp1, vp2, and vp3 proteins.Alternatively, this sequence may be co-expressed with one or more nucleic acid sequences encoding the amino acid sequence AAVhu68vp3 of SEQ ID NO: 8 (approximately aa 203 to 736) without the vp1-exclusive region (approximately aa 1 to approximately aa 137) and / or vp2-exclusive regions (approximately aa 1 to approximately aa 202), or a complementary strand to it, the corresponding mRNA or tRNA (approximately nt 607 to approximately nt 2211 of SEQ ID NO: 7), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 7 encoding aa 203 to 736 of SEQ ID NO: 8.Additionally, or alternatively, the vp1 and / or vp2 coding sequence may be co-expressed with the nucleic acid sequence encoding the amino acid sequence of AAVhu68vp2 of SEQ ID NO: 8 (approximately aa 138 to 736) without the vp1-exclusive region (approximately aa 1 to approximately 137), or a complementary strand to it, the corresponding mRNA or tRNA (nt. Petition 870260060647, dated 06 / 22 / 2026, p. 26 / 383 21 / 182 412 to 2211 of SEQ ID NO: 7) or a sequence at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 7 that encodes approximately aa 138 to 736 of SEQ ID NO: 8.

[0060] As described in this document, an rAAVhu68 has an rAAVhu68 capsid produced in a production system that expresses capsids of an AAVhu68 nucleic acid encoding the vp1 amino acid sequence of SEQ ID NO: 8, and optionally additional nucleic acid sequences, for example, encoding a vp3 protein free of the vp1 and / or vp2-exclusive regions. The rAAVhu68 resulting from production using a single vp1 nucleic acid sequence produces heterogeneous populations of vp1 proteins, vp2 proteins, and vp3 proteins. More particularly, the AAVhu68 capsid contains subpopulations in the vp1 proteins, vp2 proteins, and vp3 proteins that have modifications from the amino acid residues predicted in SEQ ID NO: 8. These subpopulations include, at a minimum, deamidated asparagine (N or Asn) residues. For example, asparagines in asparagine-glycine pairs are highly deamidated.

[0061] In one embodiment, the nucleic acid sequence of AAVhu68vp1 has the sequence of SEQ ID NO: 7, or a complementary strand thereto, for example, the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 proteins may be additionally or alternatively expressed from different nucleic acid sequences than vp1, for example, to alter the ratio of vp proteins in a selected expression system. In certain embodiments, a nucleic acid sequence encoding the amino acid sequence of AAVhu68 vp3 from SEQ ID NO: 8 (approximately aa 203 to 736) without the vp1-exclusive region (approximately aa 1 to approximately aa 137) and / or vp2-exclusive regions (approximately aa 1 to approximately aa 137) is also provided. Petition 870260060647, dated 06 / 22 / 2026, p. 27 / 383 22 / 182 to approximately aa 202), or a complementary strand to it, the corresponding mRNA or tRNA (approximately nt 607 to approximately nt 2211 of SEQ ID NO: 7). In certain embodiments, a nucleic acid sequence encoding the amino acid sequence AAVhu68 vp2 of SEQ ID NO: 8 (approximately a to 138 to 736) without the unique region of vp1 (approximately a to 1 to approximately 137) or a complementary strand to it, the corresponding mRNA or tRNA (nt 412 to 2211 of SEQ ID NO: 7) is also provided.

[0062] However, other nucleic acid sequences that encode the amino acid sequence of SEQ ID NO: 8 may be selected for use in the production of rAAVhu68 capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 7 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 7 encoding SEQ ID NO: 8. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence from about nt 412 to about nt 2211 of SEQ ID NO: 7 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to about nt 412 to about nt 2211 of SEQ ID NO: 7 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 8.In certain embodiments, the nucleic acid sequence has the nucleic acid sequence from about nt 607 to about nt 2211 of SEQ ID NO: 7 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to about nt 607 to about nt 2211 of SEQ ID NO: 7 encoding the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 8.

[0063] It is known in the art to design acid sequences Petition 870260060647, dated 06 / 22 / 2026, p. 28 / 383 23 / 182 nucleic acids that encode this AAVhu68 capsid, including DNA (genomic or cDNA) or RNA (e.g., mRNA). In certain embodiments, the nucleic acid sequence encoding the AAVhu68vp1 capsid protein is provided in SEQ ID NO: 7. See also Figures 8B8D. In other embodiments, a nucleic acid sequence with 70% to 99.9% identity to SEQ ID NO: 7 may be selected to express the AAVhu68 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 7. Such nucleic acid sequences can be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods.This optimization can be performed using methods that are available online (e.g., GeneArt), published methods, or a company that provides codon optimization services, for example, DNA2.0 (Menlo Park, CA). One codon optimization method is described, for example, in U.S. International Patent Publication No. WO 2015 / 012924, which is incorporated herein by reference in its entirety. See also, for example, U.S. Patent Publication 2014 / 0032186 and U.S. Patent Publication 2006 / 0136184. Appropriately, the total length of the open reading frame (ORF) for the product is modified. However, in some embodiments, only a fragment of the ORF may be altered. Using one of these methods, frequencies can be applied to any polypeptide sequence and a nucleic acid fragment of a codon-optimized coding region that encodes the polypeptide can be produced.Several options are available for making the actual changes to the codons or for synthesizing the codon-optimized coding regions designed as described in this document. Such modifications or synthesis... Petition 870260060647, dated 06 / 22 / 2026, p. 29 / 383 24 / 182 can be performed using standard and routine molecular biological manipulations well known to those skilled in the art. In one approach, a series of complementary oligonucleotide pairs of 80-90 nucleotides each in length and spanning the desired sequence length are synthesized using standard methods. These oligonucleotide pairs are synthesized in such a way that after pairing, they form double-stranded fragments of 80-90 base pairs containing cohesive ends; for example, each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide in the pair. The single-stranded ends of each oligonucleotide pair are designed to pair with the single-stranded end of another oligonucleotide pair.Oligonucleotide pairs are allowed to pair up, and approximately five to six of these double-stranded fragments are then allowed to pair together via the cohesive single-stranded ends, and are then ligated and cloned into a standard bacterial cloning vector, for example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, California. The construct is then sequenced by standard methods. Several of these constructs, consisting of 5 to 6 fragments of 80 to 90 base pairs linked together, i.e., fragments of about 500 base pairs, are prepared such that the entire desired sequence is represented in a series of plasma constructs. Inserts from these plasmids are then cut with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced.Additional methods would be immediately apparent to someone skilled in the art. Furthermore, gene synthesis is readily available commercially. Petition 870260060647, dated 06 / 22 / 2026, page 30 / 383 25 / 182

[0064] In certain embodiments, the asparagine (N) in the NG pairs in the AAVhu68 vp1, vp2, and vp3 proteins is highly deamidated. In certain embodiments, an AAVhu68 capsid contains subpopulations of AAV capsid proteins vp1, vp2, and / or vp3 possessing at least four asparagine (N) positions in the AAVhu68 capsid proteins that are highly deamidated. In certain embodiments, approximately 20 to 50% of the NN pairs (excluding the NNN triplets) exhibit deamidation. In certain embodiments, the first N is deamidated. In certain embodiments, the second N is deamidated. In certain embodiments, the deamidation is between approximately 15% and approximately 25%. Deamidation at Q-position 259 of SEQ ID NO: 8 is approximately 8% to approximately 42% of the AAVhu68 capsid proteins vp1, vp2, and vp3 of an AAVhu68 protein.

[0065] In certain embodiments, the rAAVhu68 capsid is further characterized by an amidation at D297 of the vp1, vp2, and vp3 proteins. In certain embodiments, approximately 70% to approximately 75% of the D at position 297 of the vp1, vp2, and / or vp3 proteins in an AAVhu68 capsid are amidated, based on the numbering of SEQ ID NO: 8.

[0066] In certain embodiments, at least one Asp in vp1, vp2 and / or vp3 of the capsid is isomerized to D-Asp. These isomers are generally present in an amount less than about 1% of the Asp at one or more residue positions 97, 107, 384, based on the numbering of SEQ ID NO: 8.

[0067] In certain forms, a rAAVhu68 has a capsid AAVhu68 with vp1, vp2, and vp3 proteins with subpopulations comprising combinations of two, three, four, or more deamidated residues at the positions defined in the table below. Deamidation in rAAV can be determined using 2D gel electrophoresis and / or mass spectrometry and / or protein modeling techniques. Online chromatography can be performed with an Acclaim PepMap column and a system. Petition 870260060647, dated 06 / 22 / 2026, page 31 / 383 26 / 182 A Thermo UltiMate 3000 RSLC (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific) was used. MS data were acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically selecting the most abundant unsequenced precursor ions from the survey scans (200-2000 m / z). Sequencing was performed via high-energy collision dissociation fragmentation with a target value of 1e5 ions determined with predictive automatic gain control, and precursor isolation was performed with a 4 m / z window. The scans were acquired with a resolution of 120,000 am / z 200. The resolution for the HCD spectra can be set to 30,000 am / z 200, with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The RF level of the S lens can be set at 50 to provide optimal transmission of the m / z region occupied by the peptides of the digested mass.Precursor ions with single, unassigned charge states or six or more may be excluded from fragmentation selection. The BioPharma Finder 1.0 software (Thermo Fischer Scientific) can be used for analysis of the acquired data. For peptide mapping, searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a mass precision of 10 ppm, high protease specificity, and a confidence level of 0.8 for MS / MS spectra. Examples of suitable proteases may include, for example, trypsin or chymotrypsin. Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation increases the mass of the intact molecule by +0.984 Da (the mass difference between the -OH and -NH2 groups).The percentage of deamidation of a particular peptide is the determined mass area of ​​the peptide. Petition 870260060647, dated 06 / 22 / 2026, page 32 / 383 27 / 182 deamidated divided by the sum of the area of ​​the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species that are deamidated at different sites can comigrate into a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple deamidation sites. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent of the deamidation site. It will be understood by one skilled in the art that various variations of these illustrative methods can be used.For example, suitable mass spectrometers might include, for instance, a quadrupole time-of-flight (QTOF) mass spectrometer, such as a Waters Xevo or Agilent 6530, or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Appropriate liquid chromatography systems include, for example, the Acquity UPLC system from Waters or Agilent (1100 or 1200 series). Suitable data analysis software might include, for example, MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fisher Scientific), Mascote (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques can be described, for example, in X. Jin et al., Hu Gene Therapy Methods, vol. 28, no. 5, pp. 255-267, published online June 16, 2017. Petition 870260060647, dated 06 / 22 / 2026, page 33 / 383 28 / 182 Deamidation Based on AAVHu68 Predicted [SEQ ID NO: 8] % Average based on VP1 / VP2 / VP3 proteins in the capsid AAVhu68 Deamidated Residue + 1 (neighboring AA) Wide Percentage Range (%) Narrow Ranges (%) N57 (NG) 78 to 100% 80 to 100, 85 to 97 N66 (NE) 0 to 5 0.1 to 5 N94 (NH) 0 to 15, 0.1 to 15, 5 to 12, 8 N113 (NL) 0 to 2 0.1 to 2 ~N253 (NN) 10 to 25 15 to 22 Q259 (QI) 8 to 42 10 to 40, 20 to 35 ~N270 (ND) 12 to 30 15 to 28 ~N304 (NN) (position 303 also N) 0 to 5 1 to 4 N319 (NI) 0 to 5 0.1 to 5.1 to 3 N329 * (NG)*(position 328 also N) 65 to 100 70 to 95, 85 to 95, 80 to 100, 85 to 100, N336 (NN) 0 to 100 0.1 to 10, 25 to 100, 30 to 100, 30 to 95 Petition 870260060647, dated 06 / 22 / 2026, p. 34 / 383 29 / 182 Deamidation Based on AAVHu68 Predicted [SEQ ID NO: 8] % Average based on VP1 / VP2 / VP3 proteins in the AAVhu68 capsid Deamidated Residue + 1 (neighboring AA) Wide Percentage Range (%) Narrow Ranges (%) ~N409 (NN) 15 to 30 20 to 25 N452 (NG) 75 to 100 80 to 100, 90 to 100, 95 to 100, N477 (NY) 0 to 8 0.1 to 5 N512 (NG) 65 to 100 70 to 95, 85 to 95, 80 to 100, 85 to 100, ~N515 (NS) 0 to 25 0.1 to 10, 5 to 25, 15 to 25 ~Q599 (Asn-Q-Gly) 1 to 20 2 to 20, 5 to 15 N628 (NF) 0 to 10 0, 1 to 10, 2 to 8 N651 (NT) 0 to 3 0, 1 to 3 N663 (NK) 0 to 5 0, 1 to 5, 2 to 4 N709 (NN) 0 to 25 0, 1 to 22, 15 to 25 N735 0 to 40 0, 1 to 35, 5 to 50, 20 to 35

[0068] In certain embodiments, the AAVhu68 capsid is characterized by having capsid proteins in which at least 45% of the N residues are deamidated at at least one of the N57 positions, Petition 870260060647, dated 06 / 22 / 2026, p. 35 / 383 30 / 182 N329, N452, and / or N512 based on the amino acid sequence numbering of SEQ ID NO: 8. In certain embodiments, at least about 60%, at least about 70%, at least about 80%, or at least 90% of the N residues in one or more of these NG positions (i.e., N57, N329, N452, and / or N512, based on the amino acid sequence numbering of SEQ ID NO: 8) are deamidated. In these and other embodiments, an AAVhu68 capsid is further characterized by having a protein population in which approximately 1% to approximately 20% of the N residues have deamidations at one or more positions: N94, N253, N270, N304, N409, N477, and / or Q599, based on the amino acid sequence numbering of SEQ ID NO: 8. In certain embodiments, AAVhu68 comprises at least one subpopulation of vp1, vp2, and / or vp3 proteins that are deamidated at one or more of the positions N35, N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304.N305, N319, N328, N329, N336, N409, N410, N452, N477, N515, N598, Q599, N628, N651, N663, N709, N735, based on the amino acid sequence numbering of SEQ ID NO: 8 or combinations thereof. In certain embodiments, the capsid proteins may have one or more amidated amino acids.

[0069] Other modifications are also observed, most of which do not result in the conversion of one amino acid into a different amino acid residue. Optionally, at least one Lys in vp1, vp2, and vp3 of the capsid is acetylated. In certain embodiments, at least one Asp in vp1, vp2, and / or vp3 of the capsid is isomerized to D-Asp. Optionally, at least one S (Ser, Serine) in vp1, vp2, and / or vp3 of the capsid is phosphorylated. Optionally, at least one T (Thr, Threonine) in vp1, vp2, and / or vp3 of the capsid is phosphorylated. Optionally, at least one W (Trp, Tryptophan) in vp1, vp2, and / or vp3 of the capsid is oxidized. Optionally, at least one M (Met, Methionine) in vp1, vp2, and / or vp3 of the capsid is oxidized. In certain embodiments, the proteins of Petition 870260060647, dated 06 / 22 / 2026, p. 36 / 383 31 / 182 capsids have one or more phosphorylations. For example, certain vp1 capsid proteins may be phosphorylated at position 149.

[0070] In certain embodiments, an AAVhu68 capsid comprises a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 8, wherein the vp1 proteins comprise a glutamic acid (Glu) at position 67 and / or a valine (Val) at position 157; a heterogeneous population of vp2 proteins optionally comprising a valine (Val) at position 157; and a heterogeneous population of vp3 proteins. The AAVhu68 capsid contains at least one subpopulation in which at least 65% of the asparagine (N) pairs located at position 57 of the vp1 proteins and at least 70% of the asparagine (N) pairs located at positions 329, 452 and / or 512 of the vp1, vp2 and vp3 proteins are deamidated, based on the amino acid sequence residue numbering of SEQ ID NO: 8, wherein deamidation results in an amino acid change.As discussed in more detail in this document, deamidated asparagines can be deamidated into aspartic acid, iso-aspartic acid, an aspartic acid / iso-aspartic acid interconverter pair, or combinations thereof. In certain embodiments, rAAVhu68 are further characterized by one or more of the following: (a) each of the vp2 proteins is independently the product of a nucleic acid sequence encoding at least the vp2 protein of SEQ ID NO: 8; (b) each of the vp3 proteins is independently the product of a nucleic acid sequence encoding at least the vp3 protein of SEQ ID NO: 8; (c) the nucleic acid sequence encoding the vp1 proteins is SEQ ID NO: 7, or a sequence at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 7, which encodes the sequence of. Petition 870260060647, dated 06 / 22 / 2026, p. 37 / 383 32 / 182 amino acids of SEQ ID NO: 8. Optionally, this sequence is used alone to express the vp1, vp2, and vp3 proteins. Alternatively, this sequence may be co-expressed with one or more nucleic acid sequences encoding the amino acid sequence AAVhu68vp3 of SEQ ID NO: 8 (approximately aa 203 to 736) without the vp1-exclusive region (approximately aa 1 to approximately aa 137) and / or vp2-exclusive regions (approximately aa 1 to approximately aa 202), or a complementary strand to this, the corresponding mRNA or tRNA (approximately nt 607 to approximately nt 2211 of SEQ ID NO: 7), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 7 encoding aa 203 to 736 of SEQ ID NO: 8.Additionally, or alternatively, the vp1 and / or vp2 coding sequence may be co-expressed with the nucleic acid sequence encoding the amino acid sequence of AAVhu68vp2 from SEQ ID NO: 8 (approximately aa 138 to 736) without the vp1-exclusive region (approximately aa 1 to approximately 137), or a complementary strand to it, the corresponding mRNA or tRNA (nt 412 to 2211 of SEQ ID NO: 7), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 7 encoding approximately aa 138 to 736 of SEQ ID NO: 8.

[0071] Additionally or alternatively, the rAAVhu68 capsid comprises at least one subpopulation of vp1, vp2 and / or vp3 proteins that are deamidated at one or more of the positions N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N329, N336, N409, N410, N452, N477, N512, N515, N598, Q599, N628, N651, N663, N709, based on the SEQ ID NO: 8 numbering or combinations thereof; (e) the rAAVhu68 capsid comprises a subpopulation of vp1, vp2 and / or vp3 proteins comprising Petition 870260060647, dated 06 / 22 / 2026, pp. 38 / 383 33 / 182 deamidation of 1% to 20% at one or more of the positions N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, based on the numbering of SEQ ID NO: 8 or combinations thereof; (f) the rAAVhu68 capsid comprises a vp1 subpopulation in which 65% to 100% of the N at position 57 of the vp1 proteins are deamidated, based on the numbering of SEQ ID NO: 8; (g) the rAAVhu68 capsid comprises a vp1 protein subpopulation in which 75% to 100% of the N at position 57 of the vp1 proteins are deamidated; (h) the rAAVhu68 capsid comprises vp1, vp2 and / or vp3 protein subpopulations in which 80% to 100% of the N at position 329, based on the SEQ ID NO: 8 numbering, are deamidated; (i) the rAAVhu68 capsid comprises vp1, vp2 and / or vp3 protein subpopulations in which 80% to 100% of the N at position 452, based on the SEQ ID NO: 8 numbering, are deamidated;(j) the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 80% to 100% of N at position 512, based on SEQ ID NO: 8 numbering, are deamidated; (k) the rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins; (l) the rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 9 vp3 proteins.

[0072] In certain embodiments, AAVhu68 is modified to alter the glycine in an asparagine-glycine pair, to reduce deamidation. In other embodiments, the asparagine is altered to a different amino acid, for example, a glutamine that deamidates at a slower rate; or to an amino acid that does not have amide groups (for example, glutamine and asparagine contain amide groups); and / or to an amino acid that does not have amine groups (for example, lysine, arginine, and histidine contain amide groups). As used in this document, Petition 870260060647, dated 06 / 22 / 2026, pp. 39 / 383 34 / 182 amino acids that do not possess amide or amine side groups refer to, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan and / or proline. Modifications such as those described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAVhu68 amino acid sequence. In certain embodiments, these modifications are not made in all four asparagine-glycine pairs. Thus, a method to reduce the deamidation of AAVhu68 and / or AAVhu68 variants manipulated with lower deamidation rates. Additionally or alternatively, one or more other amide amino acids may be altered to a non-amide amino acid to reduce the deamidation of AAVhu68.

[0073] These amino acid modifications can be made by conventional genetic engineering techniques. For example, a nucleic acid sequence containing modified AAVhu68 codons can be generated, wherein one to three of the codons encoding glycine at positions 58, 330, 453, and / or 513 in SEQ ID NO: 8 (arginine-glycine pairs) are modified to encode an amino acid other than glycine. In certain embodiments, a nucleic acid sequence containing modified arginine codons can be manipulated in one to three of the arginine-glycine pairs located at positions 57, 329, 452, and / or 512 in SEQ ID NO: 8, so that the modified codon encodes an amino acid other than arginine. Each modified codon can encode a different amino acid. Alternatively, one or more of the altered codons can encode the same amino acid.In certain embodiments, these modified AAVhu68 nucleic acid sequences can be used to generate a mutant rAAVhu68 possessing a capsid with lower deamidation than the native hu68 capsid. Such a mutant rAAVhu68 may have reduced immunogenicity and / or increased stability during storage, particularly storage in the form of... Petition 870260060647, dated 06 / 22 / 2026, p. 40 / 383 35 / 182 suspension. As used in this document, a codon refers to three nucleotides in a sequence that codes for an amino acid.

[0074] In one embodiment, a recombinant adeno-associated virus (rAAV) is provided comprising: (A) an AAV68 capsid comprising one or more of: (1) AAV hu68 capsid proteins comprising: AAVhu68 vp1 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence 1 to 736 of SEQ ID NO: 8, vp1 proteins produced from SEQ ID NO: 7 or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 7 encoding the predicted amino acid sequence 1 to 736 of SEQ ID NO: 8, AAVhu68 vp2 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 8, vp2 proteins produced from a sequence comprising at least the nucleotides 412 to 2211 of SEQ ID NO: 7,or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 7 that encodes the predicted amino acid sequence of at least approximately amino acids 138 to 736 of SEQ ID NO: 8, AAVhu68 vp3 proteins produced by the expression of a nucleic acid sequence that encodes the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 8, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 7, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 7 that encodes the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 8; and / or (2) AAV capsid proteins comprising a heterogeneous population of vp1 proteins, Petition 870260060647, dated 06 / 22 / 2026, p. 41 / 38336 / 182 optionally comprising a valine at position 157 and / or a glutamic acid at position 67, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157 and a heterogeneous population of vp3 proteins, wherein at least one subpopulation of vp1 and vp2 proteins comprises a valine at position 157 and optionally further comprising a glutamic acid at position 67 based on the vp1 capsid numbering of SEQ ID NO: 8;and / or (3) a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 8, a heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 8, and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 8, wherein: the vp1, vp2, and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine-glycine pairs in SEQ ID NO: 8 and optionally comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid alteration;and (B) a vector genome in the AAVhu68 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product operationally linked to sequences that direct the expression of the product in a host cell. For example, four residues (N57, N329, N452, N512) routinely exhibit high levels of deamidation. Additional residues (N94, N253, N270, N304, N409, N477, and Q599) also exhibit deamidation levels of up to ~20% in various batches. Petition 870260060647, dated 06 / 22 / 2026, page 42 / 383 37 / 182

[0075] In certain embodiments, the deamidated asparagines are deamidated to aspartic acid, iso-aspartic acid, an interconverting aspartic acid / iso-aspartic acid pair, or combinations thereof. In certain embodiments, the deamidated glutamine(s) is / are deamidated to (α)-glutamic acid, γ-glutamic acid, an (α)-glutamic acid / γ-glutamic acid interconversion pair, or combinations thereof.

[0076] In certain embodiments, the AAVhu68 capsid comprises subpopulations possessing one or more of: (a) at least 65% of the asparagine (N) pairs located at positions 57 of the vp1 proteins are deamidated, based on the numbering of SEQ ID NO: 8; (b) at least 75% of the N pairs at position 329 of the vp1, vp2, and vp3 proteins are deamidated, based on the numbering of amino acid sequence residues of SEQ ID NO: 8; (c) at least 50% of the N pairs at position 452 of the vp1, vp2, and vp3 proteins are deamidated, based on the numbering of amino acid sequence residues of SEQ ID NO: 8; and / or (d) at least 75% of the N in asparagine-glycine pairs at position 512 of the vp1, vp2, and vp3 proteins are deamidated, based on the amino acid sequence numbering of SEQ ID NO: 8.In certain embodiments, the hu68 capsid comprises a vp1 subpopulation in which 75% to 100% of the N at position 57 of the vp1 proteins are deamidated, as determined by mass spectrometry. In certain embodiments, the AAVhu68 capsid comprises a subpopulation of vp1, vp2, and / or vp3 proteins in which 75% to 100% of the N at position 329, based on the SEQ ID NO: 8 numbering, are deamidated as determined using mass spectrometry. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1, vp2, and / or vp3 proteins in which 75% to 100% of the N at position 452, based on the... Petition 870260060647, dated 06 / 22 / 2026, page 43 / 383 38 / 182, based on SEQ ID number 8, are deamidated as determined using mass spectrometry. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins, and / or vp3 proteins in which 75% to 100% of N at position 512, based on SEQ ID number 8, are deamidated. In certain embodiments, the nucleic acid sequence encoding the proteins is SEQ ID NO: 7, or a sequence at least 80% to at least 99% identical to SEQ ID NO: 7 that encodes the amino acid sequence of SEQ ID NO: 8. In certain embodiments, the sequence is at least 80% to 97% identical to SEQ ID NO: 7. In certain embodiments, the rAAVhu68 capsid further comprises at least one subpopulation of vp1, vp2, and / or vp3 proteins having amino acid modifications relative to SEQ ID NO: 8 comprising at least about 50% to 100% deamidation of at least four positions selected from one or more of N57, 329, 452, 512, or combinations thereof.In certain embodiments, the AAVhu68 capsid comprises vp1, vp2 and / or vp3 protein subpopulations, further comprising from 1% to about 40% deamidation at at least one or more of the positions N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or combinations thereof. In certain embodiments, the rAAVhu68 capsid comprises the vp1, vp2, and / or vp3 protein subpopulations which further comprise one or more modifications selected from one or more modifications in one or more of the following: acetylated lysine, phosphorylated serine and / or threonine, isomerized aspartic acid, oxidized tryptophan and / or methionine, or an amidated amino acid. In certain embodiments, the rAAVhu68 comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins. In certain embodiments, the AAVhu68 capsid comprises about 60 total capsid proteins in a... Petition 870260060647, dated 06 / 22 / 2026, p. 44 / 383 39 / 182 ratio of approximately 1 vp1 to approximately 1 vp2 to 3 to 9 vp3 proteins. In certain embodiments, the vector genome comprises ITR AAV sequences from an AAV source other than AAVhu68.

[0077] In certain embodiments, a composition is provided comprising a mixed population of recombinant adeno-associated viruses hu68 (rAAVhu68), wherein each of the rAAVhu68 is independently selected from an rAAVhu68, as described in this document. In certain embodiments, the regular AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins. In certain embodiments, the regular AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 6 vp3 proteins. In certain embodiments, the composition is formulated for intrathecal distribution. In certain embodiments, the composition is formulated for intranasal or intramuscular distribution. In certain embodiments, a composition comprises at least one rAAVhu68 vector stock and an optional carrier, excipient and / or preservative.

[0078] Any suitable rAAV production system useful for producing recombinant AAVhu68 may be used. For example, such a production system may comprise: (a) an AAVhu68 capsid nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 8; (b) a nucleic acid molecule suitable for packaging into the AAVhu68 capsid, said nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding a gene product operatively linked to sequences that directly express the product in a host cell; and (c) rep functions and auxiliary AAV functions sufficient to enable packaging of the nucleic acid molecule into the AAVhu68 capsid. Petition 870260060647, dated 06 / 22 / 2026, page 45 / 383 40 / 182 recombinant. In certain embodiments, the nucleic acid sequence of (a) comprises at least SEQ ID NO: 7, or a sequence at least 70% to at least 99% identical to SEQ ID NO: 7 that encodes the amino acid sequence of SEQ ID NO: 8. In certain embodiments, the system optionally further comprises a nucleic acid sequence from about nt 607 to about nt 2211 of SEQ ID NO: 7 that encodes the AAVhu68 vp3 amino acid sequence from about aa 203 to about amino acid 736 of SEQ ID NO: 8. In certain embodiments, the system comprises human embryonic kidney cells or a baculovirus system.

[0079] In certain embodiments, a method is provided for reducing the deamidation of an AAVhu68 capsid.The method comprises producing an AAVhu68 capsid from a nucleic acid sequence containing modified AAVhu68 vp codons, with the nucleic acid sequence comprising glycine codons independently modified in one to three of the arginine-glycine pairs located at positions 58, 330, 453 and / or 513 in SEQ ID NO: 8, such that the modified codon codes for an amino acid other than glycine. In certain embodiments, the method comprises producing an AAVhu68 capsid from a nucleic acid sequence containing AAVhu68 vp codons, with the nucleic acid sequence comprising arginine codons independently modified in one to three of the arginine-glycine pairs located at positions 57, 329, 452, and / or 512 in SEQ ID NO: 8, such that the modified codon codes for an amino acid other than arginine. In certain embodiments, each modified codon codes for a different amino acid.In certain embodiments, two or more modified codons code for the same amino acid. In certain embodiments, a mutant AAVhu68 capsid, as described in this document, contains a mutation in an arginine-glycine pair, such that the glycine is altered to an alanine or serine. A mutant AAVhu68 capsid may contain one or two... Petition 870260060647, dated 06 / 22 / 2026, page 46 / 383 41 / 182 or three mutants, where the reference AAVhu68 natively contains four NG pairs. In certain embodiments, a mutant AAVhu68 capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAVhu68 capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAVhu68 capsid contains mutations in two different NG pairs that are located in a structurally separate location in the AAVhu68 capsid. In certain embodiments, the mutation is not in the VP1-exclusive region. In certain embodiments, one of the mutations is in the VP1-exclusive region. Optionally, a mutant AAVhu68 capsid does not contain modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.

[0080] As used in this document, encoded amino acid sequence refers to the amino acid that is predicted based on the translation of a known DNA codon from a referenced nucleic acid sequence into an amino acid. The following table illustrates the DNA codons and twenty common amino acids, showing the one-letter code (SLC) and the three-letter code (3LC). Amino acid SLC 3 LC DNA codons Isoleucine I lie ATT, ATC, ATA Leucine L Leu CTT, CTC, CTA, CTG, TTA, TTG Valine V Vai GTT, GTC, GTA, GTG Phenylalanine F Phe III, IIC Methionine M Met ATG Cysteine ​​C Cys TGT, TGC Alanine A Wing GCT, GCC, GCA, GCG Glycine G Gly GGT, GGC, GGA, GGG Petition 870260060647, dated 06 / 22 / 2026, p. 47 / 383 42 / 182 Amino acid SLC 3 LC DNA codons Proline P Pro CCT, CCC, CCA, CCG Threonine T Thr ACT, ACC, ACA, ACG Serine s Ser TCT, TCC, TCA, TCG, AGT, AGC Tyrosine Y Tyr TAT, TAC Tryptophan w Trp TGG Glutamine Q Gin CAA, CAG Asparagine N Asn AAT, AAC Histidine H His CAT, CAC Glutamic acid E Glu GAA, GAG Aspartic acid D Asp GAT, GAC Lysine K Lys AAA, AAG Arginine R Arg CGT, CGC, CGA, CGG, AGA, AGG Stop codons Stop TAA, TAG, TGA

[0081] Methods for generating capsids, and therefore coding sequences, and methods for producing rAAV viral vectors have been described. See, for example, Gao, et al., Proc. Natl. Acad. Sci. USA 100 (10), 6081-6086 (2003) and USA 2013 / 0045186A1. Other capsids, such as, for example, those described in WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; US 7588772 B2, which are incorporated herein by reference, may be used in humans. In one embodiment, the invention provides a manipulated molecule comprising a spacer sequence between the AAVhu68 vp1 coding sequence and the AAVhu68 rep coding sequences.

[0082] As indicated above, AAVhu68 sequences and proteins are useful in the production of rAAV. The examples below describe Petition 870260060647, dated 06 / 22 / 2026, p. 48 / 383 43 / 182 the production of rAAV vectors with AAVhu68 or AAV9 vectors. However, in other embodiments, another AAV capsid is selected. Tissue specificity is determined by the capsid type. For example, a viral vector with an AAVhu68 is illustrated in the examples below as being useful for transduction of nasal epithelial cells. The AAVhu68 sequences are described in this document. In addition, methods for generating vectors containing the AAV9 capsid and chimeric capsids derived from AAV9 have been described. See, for example, US 7,906,111, which is incorporated herein by reference. Other AAV serotypes that transduce nasal cells or other suitable targets (e.g., muscle or lung) can be selected as sources for AAV viral vector capsids (DNase-resistant viral particles), including, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7.2, AAV7, AAV8, AAV9, rh10, AAVrh64R1, AAVrh64R2, rh8 (see, for example, U.S. Published Patent Application 2007-0036760-A1; U.S. Published Patent Application 20090197338-A1; and EP 1310571). See also WO 2003 / 042397 (AAV7 and other simian AAVs), U.S. Patent 7790449 and U.S. Patent 7282199 (AAV8), WO 2005 / 033321 (AAV9) and WO 2006 / 110689, or yet to be verified, or a recombinant AAV based thereon, may be used as a source for the AAV capsid. These documents also describe other AAV capsids that can be selected to generate AAVs and are incorporated by reference. In some embodiments, an AAV capsid (cap) for use in the viral vector can be generated by mutagenesis (i.e., by insertions, deletions, or substitutions) of one of the aforementioned AAV capsids or its coding nucleic acid. In some embodiments, the AAV capsid is chimeric, comprising domains of two, three, four, or more of the aforementioned AAV capsid proteins.In some embodiments, the AAV capsid is a mosaic of Vp1, Vp2, and Vp3 monomers from two or three AAVs. Petition 870260060647, dated 06 / 22 / 2026, page 49 / 383 44 / 182 different or recombinant AAVs. In some embodiments, a rAAV composition comprises more than one of the aforementioned caps.

[0083] AAVhu68 capsids may be useful in certain applications. For example, these capsids may be used in the generation of monoclonal antibodies and / or in the generation of reagents useful in assays to monitor AAVhu68 concentration levels in gene therapy patients. Techniques for generating useful anti-AAVhu68 antibodies, labeling these antibodies or empty capsids, and suitable assay formats are known to those skilled in the art.

[0084] More typically, the AAVhu68 capsids provided in this document are useful in generating recombinant AAV vectors, in which a manipulated nucleic acid sequence is packaged into the AAVhu68 capsid. These recombinant AAV vectors, termed rAAVhu68 or rAAVhu68 vectors, and their uses are discussed in more detail in another section of this application. These rAAVhu68 vectors are useful for generating recombinant AAV (rAAV) vectors that provide good throughput and / or packaging efficiency and provide useful rAAV vectors in the transduction of several different cell and tissue types. Such cells and tissue types include, without limitation, lung, heart, muscle, liver, pancreas, kidney, brain, hippocampus, motor cortex, cerebellum, nasal epithelial cells, cardiac muscle cells or cardiomyocytes, hepatocytes, pulmonary endothelial cells, myocytes, lung epithelial cells, islet cells, acinar cells, renal cells and / or motor neurons.

[0085] In certain forms, the vectors possessing the capsids AAVhu68 vectors provide at least a 15% increase in packaged vector yield compared to AAV9-based vectors. In a comparison between AAVhu68 and AAVrh10, AAVhu68 was found to provide better transduction efficiency than AAVrh10 at low doses (e.g., approximately 1 x 10⁹) after administration. Petition 870260060647, dated 06 / 22 / 2026, page 50 / 383 45 / 182 intracerebroventricular. In a further comparison between AAVhu68 and AAV9, AAVhu68 was found to provide better transduction efficiency than AAV9 in the cerebellum, motor cortex, and hippocampus of the brain (e.g., approximately 1 x 1011GC) after intracerebroventricular administration.

[0086] A recombinant AAV or rAAV is a DNase-resistant viral particle containing two elements, an AAV capsid and a vector genome containing at least non-AAV coding sequences packaged within the AAV capsid. In certain embodiments, the capsid contains approximately 60 proteins composed of vp1 proteins, vp2 proteins, and vp3 proteins, which self-assemble to form the capsid. Unless otherwise specified, recombinant AAV or rAAV may be used interchangeably with the phrase rAAV vector. The rAAV is a replication-deficient virus or viral vector, as it lacks any functional AAV rep gene or functional AAV cap gene and cannot generate offspring.In certain embodiments, the only AAV sequences are the inverted terminal repeat sequences (ITRs) of AAV, typically located at the extreme 5' and 3' ends of the vector genome, in order to allow regulatory and gene sequences located between the ITRs to be packaged within the AAV capsid.

[0087] The term nuclease-resistant indicates that the capsid AAV was completely assembled around the expression cassette, which is designed to deliver a transgene to a host cell and protects these genomic sequences from degradation (digestion) during the nuclease incubation steps designed to remove nucleic acids that may be present in the production process.

[0088] In certain embodiments, the non-viral genetic elements used in the manufacture of an rAAV will be referred to as vectors (e.g., production vectors). In certain embodiments, these vectors Petition 870260060647, dated 06 / 22 / 2026, page 51 / 383 46 / 182 are plasmids, but the use of other suitable genetic elements is contemplated. Such production plasmids may encode sequences expressed during rAAV production, for example, AAV capsid or rep proteins required for rAAV production, which are not packaged in the rAAV. Alternatively, this production plasmid may carry the vector genome that is packaged in the rAAV.

[0089] As used in this document, a vector genome refers to the nucleic acid sequence packaged within the rAAV capsid that forms a viral particle. Such a nucleic acid sequence contains inverted terminal repeat AAV sequences (ITRs). In the examples presented in this document, a vector genome contains at least 5' to 3' AAV 5' ITR, coding sequence(s), and an AAV 3' ITR. ITRs may be selected from AAV2, an AAV of a different origin than the capsid, or ITRs that are not complete. In certain embodiments, the ITRs are from the same AAV source as the AAV that provides the rep function during production or a transcomplementary AAV. Additionally, other ITRs may be used. Furthermore, the vector genome contains regulatory sequences that direct the expression of gene products. The appropriate components of a vector genome are discussed in more detail in this document.

[0090] In certain embodiments, the term expression cassette refers to a nucleic acid molecule comprising hSMN sequences and therefore regulatory sequences (e.g., promoter, enhancer, polyA), whose cassette can be packaged into the capsid of a viral vector (e.g., a viral particle). In general, this expression cassette for generating a viral vector contains the hSMN sequences described in this document, flanked by viral genome packaging signals and other expression control sequences as described in this document. For example, for a Petition 870260060647, dated 06 / 22 / 2026, page 52 / 383 47 / 182 AAV viral vector, the packaging signals are the 5' inverted terminal repeat (ITR) and the 3' ITR. In certain embodiments, the term transgene may be used interchangeably with expression cassette. In other embodiments, the term transgene refers only to the coding sequences for a selected gene, for example, hSMN1.

[0091] As used in this document, the term SMN includes any SMN isoform that restores a desired function, reduces a symptom, or provides another desired physiological outcome when delivered using a composition or method provided in this document. The examples provided in this document use the longer isoform, Isoform D, which is believed to be the predominant transcript produced by the gene in a patient not affected by an SMN deficiency or defect. Isoform D provides a 294-amino acid protein [see, for example, NCBI accession NM_000334 / NP_000335; ENSEMBL ID ENST00000380707], the protein sequence is reproduced in SEQ ID NO: 2 and the coding sequence is reproduced in SEQ ID NO: 3. However, another isoform may be selected.For example, isoform B has an alternative exon framed within the 3' coding sequence, resulting in a protein that is shorter in length (262 amino acids) than isoform D, but with the same N and C termini as that isoform. See NCBI Accession No. NM_022874 / NP_075012; ENSEMBL ID ENST00000503079. The coding sequences and proteins of isoform B are reproduced in SEQ ID NO: 11 and 12, respectively. Isoform A lacks the penultimate exon, resulting in an alternative translation stop codon compared to isoform D. Therefore, isoform A is shorter (282 amino acids) and has a distinct C terminus compared to isoform D. See NCBI Accession No. NM_001297715 / NP_001284644; ENSEMBL ID ENSTL00000506163. The coding sequences and proteins of. Petition 870260060647, dated 06 / 22 / 2026, p. 53 / 383 48 / 182 Isoform A is reproduced in SEQ IDs 13 and 14, respectively.

[0092] In certain embodiments, a manipulated human survival motor neuron (SMN) cDNA (h) is provided in this document, which has been designed to maximize translation compared to the native hSMN sequence (SEQ ID NO: 3). An intron can be incorporated upstream of the coding sequence to improve 5' capping and mRNA stability. See, for example, SEQ ID NOs: 15 and 25. These compositions can be used in methods for treating spinal muscular atrophy, as described in this document. For comparison purposes, an alignment of the native human SMN coding sequence and a modified cDNA is illustrated in Figures 1B-1C.

[0093] The hSMN cDNA sequences described in this document can be generated in vitro or synthetically, or by any other suitable method, using techniques well known in the art. For example, precise PCR-based synthesis (PAS) of the long DNA sequence method can be used, as described by Xiong et al, Precise PCR-based synthesis of long DNA sequences, Nature Protocols 1, 791-797 (2006). A method combining the double asymmetry PCR and overlap extension PCR methods is described by Young and Dong, Two-step whole gene synthesis method, Nucleic Acids Res. 2004; 32(7): e59. See also Gordeeva et al, J Microbiol Methods. Improved PCR-based gene synthesis method and its application to the modification of the Citrobacter freundii phytase gene codon. May 2010; 81(2): 147-52. Epub 2010 March 10; see also the following patents on oligonucleotide synthesis and gene synthesis, Gene Seq. April 2012; 6(1): 10-21; US ​​8008005; and US 7985565.Each of these documents is incorporated into this document by reference. In addition, kits and protocols for generating DNA via PCR are available. Petition 870260060647, dated 06 / 22 / 2026, p. 54 / 383 49 / 182 commercially. These include the use of polymerases including, without limitation, Taq polymerase; OneTaq® (New England Biolabs); Q5® High-Fidelity DNA Polymerase (New England Biolabs); and GoTaq® G2 Polymerase (Promega). DNA can also be generated from cells transfected with plasmids containing the hOTC sequences described in this document. Kits and protocols are known and commercially available and include, without limitation, QIAGEN plasmid kits; Chargeswitch® Pro Filter Plasmid Kits (Invitrogen); and GenElute™ Plasmid Kits (Sigma Aldrich). Other useful techniques in this document include sequence-specific isothermal amplification methods that eliminate the need for thermocycling. Instead of heat, these methods typically employ a strand-shift DNA polymerase, such as Bst DNA Polymerase, Large Fragment (New England Biolabs), to separate the duplex DNA.DNA can also be generated from RNA molecules through amplification using Reverse Transcriptases (RTs), which are RNA-dependent DNA polymerases. RTs polymerize a DNA strand that is complementary to the original RNA template and is referred to as cDNA. This cDNA can then be further amplified using isothermal or PCR methods, as described above. Customized DNA can also be generated commercially by companies including, but not limited to, GenScript; GENEWIZ®; GeneArt® (Life Technologies); and Integrated DNA Technologies.

[0094] Viral vectors that include the manipulated hSMN sequences are also provided in this document. In one embodiment, a rAAVhu68.SMN is a viral vector consisting of an outer component and an inner DNA genome. The outer component of the vector is an AAVhu68 capsid as defined in this document. The capsid contains a single-stranded DNA genome consisting of a human Survival Motor Neuron (hSMN) transgene. Petition 870260060647, dated 06 / 22 / 2026, page 55 / 383 50 / 182 flanked by two inverted terminal repeats (ITRs) of AAV. An enhancer, promoter, intron, hSMN1 coding sequence, and polyadenylation signal (polyA) comprise the hSMN transgene. ITRs are the genetic elements responsible for genome replication and packaging during vector production and are the only cis-viral elements required to generate rAAV. Expression of the hSMN coding sequence is driven by a CB7 promoter, a hybrid between a cytomegalovirus (CMV) immediate early enhancer (C4) and the chicken beta-actin promoter. Transcription of this promoter is enhanced by the presence of CI. An rBG polyA signal is included to mediate the termination of human hSMN mRNA transcripts. In some embodiments, hSMN is hSMN1.

[0095] In one aspect, a coding sequence is provided that encodes a functional SMN protein. By functional hSMN, we mean a gene encoding an SMN protein that provides at least about 50%, at least about 75%, at least about 80%, at least about 90%, or approximately the same, or more than 100% of the biological activity level of the native survival motor neuron protein or a natural variant or polymorph thereof that is not associated with disease. Furthermore, the SMN1 homolog, SMN2, also encodes the SMN protein but processes the functional protein less efficiently. Based on the number of SMN2 copies, individuals lacking a functional hSMN gene exhibit SMA to varying degrees. Thus, for some individuals, it may be desirable for the SMN protein to provide less than 100% of the biological activity of the native SMN protein. In a certain embodiment, the terms hSMN1, hSMN, and functional hSMN are used interchangeably.

[0096] There is a variety of assays for measuring the expression of SMN and in vitro activity levels. See, for example, Tanguy et al., 2015, cited above. The methods described in this document also Petition 870260060647, dated 06 / 22 / 2026, p. 56 / 383 51 / 182 can be combined with any other therapy for the treatment of SMA or its symptoms. In certain modalities, the standard of care may include nusinersen, which is an antisense oligonucleotide (ASO) targeting the pre-messenger ribonucleic acid (mRNA) SMN2 accepted by the FDA and EMA [SPINRAZA™, Biogen]. See, for example, U.S. Patents Nos. 6,166,197, 6,210,892, 7,101,993; 7,838,657; 8,110,560; 8,361,977; 8,980,853. This is an antisense oligonucleotide targeting SMN2 that is administered intrathecally. The recommended dosage is 12 mg (5 mL per administration). Treatment is initiated with 4 loading doses; The first three loading doses are administered at 14-day intervals, the fourth loading dose is administered 30 days after the third, and a maintenance dose is administered once every four months thereafter.

[0097] In one embodiment, the amino acid sequence of the functional SMN is that of SEQ ID NO: 2 or a sequence sharing 95% identity with it. In one embodiment, a modified hSMN coding sequence is provided. Preferably, the modified hSMN coding sequence has less than 80% identity, preferably about 75% identity or less to the complete native hSMN coding sequence.

[0098] In one embodiment, the modified hSMN encoding sequence is characterized by an improved translation rate compared to native hSMN after AAV-mediated delivery (e.g., rAAV). In one embodiment, the modified hSMN encoding sequence shares less than approximately 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or less identity with the full-length native hSMN1 encoding sequence. In one embodiment, the modified hSMN encoding sequence is SEQ ID NO: 1, or a sequence that shares 70%, 75%, 80%, 85%, 90%, 95% Petition 870260060647, dated 06 / 22 / 2026, p. 57 / 383 52 / 182 or more identity with SEQ ID No.: 1. In other modes, a different SMN encoding sequence is selected.

[0099] In other embodiments, a coding sequence for an SMN isoform other than the D isoform is selected. Additionally or alternatively, a composition or regimen provided in this document may combine treatment using an AAVhu68 SMN stock encoding the D isoform SMN protein in combination with a vector stock encoding a different SMN protein. This vector stock may have an AAVhu68 capsid or a different capsid.

[00100] The terms percent (%) identity, sequence identity, sequence identity percent, or identical percent in the context of nucleic acid sequences refer to the residues in the two sequences that are the same when aligned for matching. The length of the sequence identity comparison can be over the entire genome length, the total length of a gene-coding sequence, or a fragment of at least about 500 to 5000 nucleotides is desired. However, identity between smaller fragments, for example, of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired.

[00101] Percent identity can be readily determined for amino acid sequences along the entire length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof, or the coding sequences of the corresponding nucleic acid sequence. A suitable amino acid fragment may be at least about 8 amino acids long and may be up to about 700 amino acids. Petition 870260060647, dated 06 / 22 / 2026, p. 58 / 383 53 / 182 Generally, when referring to the identity, homology, or similarity between two different sequences, identity, homology, or similarity is determined in reference to aligned sequences. Aligned sequences or alignments refer to sequences of multiple nucleic acids or protein (amino acid) sequences, often containing corrections for missing or additional bases or amino acids compared to a reference sequence.

[00102] Identity can be determined by preparing an alignment of the sequences and through the use of a variety of algorithms and / or computer programs known in the art or commercially available [e.g., BLAST, ExPASy; ClustalO; FASTA; using, for example, the Needleman-Wunsch algorithm, the Smith-Waterman algorithm]. Alignments are performed using any of several publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, for example, the Clustal Omega, Clustal X, MAP, PIMA, MSA, BLOCKMAKER, MEME, and Match Box programs. Generally, any of these programs is used in the default settings, although one skilled in the art may alter these settings as needed.Alternatively, someone skilled in the art may use another algorithm or computer program that provides at least the same level of identity or alignment as that provided by the referenced algorithms and programs. See, for example, JD Thomson et al, Nucl. Acids. Res., A comprehensive comparison of multiple sequence alignments, 27(13):2682-2690 (1999).

[00103] Multi-sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include Clustal Omega, Clustal W, CAP Sequence Assembly, BLAST, MAP, and MEME, which are accessible through Petition 870260060647, dated 06 / 22 / 2026, p. 59 / 383 54 / 182 web servers on the Internet. Other sources for such programs are known to those skilled in the art. Alternatively, NTI vector utilities are also used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignments and percentage sequence identity of the best overlap regions between query and search sequences. For example, the percentage sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, incorporated herein by reference. II. Expression cassette and vectors

[00104] In one embodiment, the hSMN genes described in this document are manipulated into a suitable genetic element (vector) useful for generating viral vectors and / or for delivery to a host cell, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the hSMN1 sequences carried thereon. The selected vector can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated beads, viral infection, and protoplast fusion. The methods used to make such constructs are known to those versed in nucleic acid manipulation and include genetic manipulation, recombinant manipulation, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. In one aspect, an expression cassette comprising the nucleic acid sequences of hSMN is provided. Petition 870260060647, dated 06 / 22 / 2026, p. 60 / 383 55 / 182

[00105] Thus, in one aspect, an adeno-associated viral vector is provided comprising an AAV capsid and at least one expression cassette, wherein the at least one expression cassette comprises nucleic acid sequences encoding SMNs and expression control sequences directing the expression of the SMN sequences in a host cell. The AAV vector also comprises AAV ITR sequences. In one embodiment, the ITRs are from an AAV different from that which provides a capsid. In a preferred embodiment, the ITR sequences are from AAV2, or its deleted version ^ITR), which may be used for convenience and to expedite regulatory approval. However, an AAV from other suitable sources may be selected. When the source of the ITRs is AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.Typically, the AAV vector genome comprises a 5' ITR of AAV, the hSMN coding sequences and any regulatory sequences, and a 3' ITR of AAV. However, other configurations of these elements may be suitable. An abbreviated version of the 5' ITR, termed .AITR, has been described, in which the terminal resolution site (tsr) and the D sequence are omitted. In other embodiments, full 5' and 3' ITRs are used.

[00106] In one aspect, a construct is provided which is a DNA molecule (e.g., a plasmid) useful for generating viral vectors. The expression cassette typically contains a promoter sequence as part of the expression control sequences, for example, located between the selected 5' ITR sequence and the hSMN coding sequence. The illustrative plasmid and vector described in this document utilize the ubiquitous chicken β-actin (CB) promoter with CMV immediate enhancer (CMV IE). Alternatively, neuron-specific promoters can be used [see, for example, the Lockery Lab neuron-specific promoter database]. Petition 870260060647, dated 06 / 22 / 2026, page 61 / 383 [56 / 182 accessed at chinook.uoregon.edu / promoters.html]. Such neuron-specific promoters include, without limitation, for example, synapsin I (SYN), calcium / calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase, and platelet-derived growth factor beta-chain promoters. See Hioki et al., Gene Therapy, June 2007, 14 (11): 872-82, which is incorporated herein by reference. Other neuron-specific promoters include 67 kDa glutamic acid decarboxylase (GAD67), homeobox Dlx5 / 6, glutamate receptor 1 (GluR1) promoter, preprototykikinin 1 (Tac1) promoter, neuron-specific enolase (NSE) promoters, and dopamine receptor 1 (Drd1a) promoters. See, for example, Delzor et al., Human Gene Therapy Methods. August 2012, 23 (4): 242-254. In another embodiment, the promoter is a GUSb promoter www.jci.org / articles / view / 41615#B30.

[00107] Other promoters, such as constitutive promoters, regulatable promoters [see, for example, WO 2011 / 126808 and WO 2013 / 04943], or a promoter responsive to physiological stimuli may be used in the vectors described in this document. The promoter(s) can be selected from different sources, for example, immediate and early human cytomegalovirus (CMV) enhancer / promoter, SV40 early enhancer / promoter, JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency-associated promoter (LAP), malignant sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloproteinase (MPP) promoter, and chicken beta-actin promoter.

[00108] In addition to a promoter, an expression cassette and / or a Petition 870260060647, dated 06 / 22 / 2026, page 62 / 383 The 57 / 182 vector may contain one or more other appropriate initiation, termination, transcription enhancer, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA, for example, WPRE; sequences that increase translation efficiency (i.e., Kozak consensus sequence); sequences that improve protein stability; and, when desired, sequences that increase the secretion of the encoded product. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyAs. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those that are appropriate for CNS indications. In one embodiment, the expression cassette comprises one or more expression enhancers.In one embodiment, the expression cassette contains two or more expression enhancers. These enhancers may be the same or may differ from one another. For example, one enhancer may include an immediate early CMV enhancer. This enhancer may be present in two copies that are located adjacent to one another. Alternatively, the double copies of the enhancer may be separated by one or more sequences. In yet another embodiment, the expression cassette further contains an intron, for example, the chicken beta-actin intron. Other suitable introns include those known in the art, for example, as described in WO 2011 / 126808. Optionally, one or more sequences may be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which may be manipulated upstream of the polyA sequence and downstream of the coding sequence [see, for example, MA Zanta-Boussif, et al., Gene Therapy (2009) 16: 605-619].

[00109] These control sequences are operationally Petition 870260060647, dated 06 / 22 / 2026, p. 63 / 383 58 / 182 linked to the hSMN gene sequences. As used in this document, the term operationally linked refers to expression control sequences that are contiguous to the gene of interest and expression control sequences that act trans or at a distance to control the gene of interest.

[00110] In one embodiment, a self-complementary AAV is provided. The abbreviation sc in this context refers to self-complementary. Self-complementary AAV refers to a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been engineered to form an intramolecular double-stranded DNA template. Upon infection, instead of waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form a double-stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, for example, DM McCarty et al. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis, Gene Therapy, (August 2001), Vol. 8, No. 16, pp. 1248-1254. Self-complementary AAVs are described, for example, in U.S. PatentsNos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated into this document by reference in its entirety.

[00111] Methods for generating and isolating AAV viral vectors suitable for delivery to an individual are known in the art. See, for example, U.S. Published Patent Application No. 2007 / 0036760 (February 15, 2007), U.S. Patent 7790449; U.S. Patent 7282199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and U.S. 7588772 B2]. In one system, a producer cell line is transiently transfected with a construct encoding the ITR-flanked transgene and a construct(s) encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and Petition 870260060647, dated 06 / 22 / 2026, page 64 / 383 The 59 / 182 cap is transiently transfected with a construct encoding the transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of rAAV from contaminating viruses. More recently, systems have been developed that do not require infection with helper viruses to recover AAV – the necessary helper functions (i.e., adenovirus E1, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29 and herpesvirus polymerase) are also provided, in trans, by the system. In these newer systems, the helper functions can be provided by transient transfection of cells with constructs encoding the necessary helper functions, or the cells can be manipulated to stably contain the genes encoding the helper functions, whose expression can be controlled at the transcriptional or post-transcriptional level.In yet another system, the transgene flanked by ITRs and rep / cap genes is introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, for example, Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production, Human Gene Therapy 20:922-929, the contents of each of which are incorporated herein by reference in their entirety. Production methods and use of these and other AAV production systems are also described in the following US patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893;. 7,201,898; 7,229,823; and 7,439,065.

[00112] Optionally, the hSMN genes described in this document can be manipulated in other delivery systems, including viral vectors other than rAAV. These other viral vectors can Petition 870260060647, dated 06 / 22 / 2026, page 65 / 383 60 / 182 include any viruses suitable for gene therapy that may be used, including but not limited to adenovirus; herpesvirus; lentivirus; retrovirus; bocavirus; etc. Appropriately, when one of these other vectors is generated, it is produced as a replication-deficient viral vector.

[00113] In certain embodiments, AAVhu68 is manipulated. SMN vectors are provided. In one embodiment, the genome of the rAAVhu68SMN vector has a sequence with SEQ ID No.: 15. In another embodiment, the genome of the rAAVhu68SMN vector has a sequence with SEQ ID No.: 25. In certain embodiments, the terms rAAVhu68.SMN1 and rAAVhu68.SMN are used interchangeably. III. Compositions and Uses

[00114] Pharmaceutical compositions are also provided in this document. The pharmaceutical compositions described in this document are designed to be distributed to individuals in need by any suitable route or by a combination of different routes.

[00115] These delivery methods are designed to prevent direct systemic distribution of the suspension containing the AAV composition(s) described in this document. Appropriately, this may have the benefit of reducing the dose compared to systemic administration, reducing toxicity and / or reducing undesirable immune responses to the AAV and / or transgene product.

[00116] Alternatively, other routes of administration may be selected (e.g., oral, inhalation, intranasal, intratracheal, intra-arterial, intraocular, intravenous, intramuscular, and other parenteral routes).

[00117] Optionally, immunosuppressive co-therapy may be used in an individual in need. Immunosuppressants for this co-therapy include, but are not limited to, a glucocorticoid, Petition 870260060647, dated 06 / 22 / 2026, page 66 / 383 61 / 182 steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., rapamycin or a rapogen), and cytostatic agents, including an alkylating agent, an antimetabolite, a cytotoxic antibiotic, an antibody, or an immunophilin-active agent. The immunosuppressant may include nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracycline, mitomycin C, bleomycin, mithramycin, IL2 receptor (CD25-) or antibodies directed against CD3, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, an opioid, or a TNF-α (tumor necrosis factor alpha) binding agent. In certain modalities, immunosuppressive therapy may be initiated 0, 1, 2, 3, 4, 5, 6, 7, or more days before or after the administration of gene therapy.Such immunosuppressive therapy may involve the administration of one, two, or more medications (e.g., glucocorticoids, prednisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)). These immunosuppressive drugs may be administered to an individual in need once, two, or more times at the same dose or at an adjusted dose. Such therapy may involve the co-administration of two or more drugs (e.g., prednisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after the administration of gene therapy, at the same dose or at an adjusted dose. This therapy may last approximately 1 week (7 days), approximately 60 days, or more, as needed. In certain modalities, a tacrolimus-free regimen is selected.

[00118] The rAAVhu68.hSMN vectors described in this document can be dosed in a single composition or in multiple compositions. Optionally, two or more different rAAVs can be delivered [see, for example, WO 2011 / 126808 and WO 2013 / 049493]. In another embodiment, these multiple viruses may contain different viruses with replication defects (e.g., AAV, adenovirus and / or lentivirus). Petition 870260060647, dated 06 / 22 / 2026, page 67 / 383 62 / 182 Alternatively, delivery may be mediated by nonviral constructs, for example, naked DNA, naked plasmid DNA, RNA and mRNA; coupled to various delivery compositions and nanoparticles, including, for example, micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan and other polymer compositions, lipid- and / or cholesterol-based nucleic acid conjugates – and other constructs as described in this document. See, for example, X. Su et al, Mol. Pharmaceuticals, 2011, 8 (3), pp 774-787; web publication: March 21, 2011; WO2013 / 182683, WO 2010 / 053572 and WO 2012 / 170930, both incorporated herein by reference, may be administered via the routes described above. Viral vectors, or non-viral RNA or DNA transfer fractions, can be formulated with a physiologically acceptable carrier for use in gene transfer and gene therapy applications.

[00119] In certain embodiments, rAAVhu68.SMA is purified of any contaminants associated with production prior to storage and / or formulation for delivery to an individual. Several suitable purification methods may be selected. Examples of suitable purification methods are described, for example, International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016, and its priority documents, US Patent Application No. 62 / 322,071, filed April 13, 2016, and 62 / 226,357, filed December 11, 2015, and entitled Scalable Purification Method for AAV9, incorporated herein by reference. Methods for purifying AAV8, International Patent Application No. PCT / US2016 / 065976, filed December 9, 2016, and the priority documents of US Patent Applications Nos. 62 / 322,098, filed April 13, 2016, and 62 / 266,341, filed December 11, 2015, and rh10, International Patent Application No.PCT / US16 / 66013, filed on December 9, 2016, and its amendments. Petition 870260060647, dated 06 / 22 / 2026, page 68 / 383 63 / 182 priority documents, Patent Application No. 62 / 322,055, filed on April 13, 2016, and 62 / 266,347, entitled Scalable Purification Method for AAVrh10, also filed on December 11, 2015, and for AAV1, International Patent Application No. PCT / US2016 / 065974, filed on December 9, 2016, and its priority documents, US Patent Applications Nos. 62 / 322,083, filed on April 13, 2016, and 62 / 26,351, entitled Scalable Purification Method for AAV1, filed on December 11, 2015, all incorporated herein by reference.

[00120] For the rAAVhu68.SMN1 vectors described in this document, it is possible to quantify genome copies (GC) as a measure of the dose contained in the formulation. Any method known in the art can be used to determine the number of genome copies (GC) of the replication-defective virus compositions of the invention. One method for performing the titration of the GC number of AAV is as follows: purified AAV vector samples are first treated with DNase to eliminate contaminating host DNA from the production process. DNase-resistant particles are then subjected to heat treatment to release the capsid genome. The released genomes are then quantified by real-time PCR using primer / probe sets targeted to the specific region of the viral genome (e.g., poly A signal). Another suitable method for determining genome copies is quantitative PCR (qPCR), particularly optimized qPCR or digital droplet PCR [Lock Martin, et al., Human Gene Therapy Methods. April 2014, 25 (2): 115-125. doi:. 10.1089 / hgtb.2013.131, published online prior to the December 13, 2013 edition]. Alternatively, the ViroCyt3100 can be used for particle quantification or flow cytometry.

[00121] rAAVhu68.SMN1 compositions can be formulated in dosage units to contain an amount of rAAV in the range Petition 870260060647, dated 06 / 22 / 2026, page 69 / 383 64 / 182 of approximately 1.0 x 10⁹GC to approximately 9 x 10¹⁵GC (e.g., based on approximately 2.5 kg to approximately 70 kg in body weight), including all whole numbers or fractional amounts within the range, and preferably 1.0 x 10¹²GC to 1.0 x 10¹⁴GC for a human patient. In one embodiment, the compositions are formulated to contain at least 1x10⁹, 2x10⁹, 3x10⁹, 4x10⁹, 5x10⁹, 6x10⁹, 7x10⁹, 8x10⁹, or 9x10⁹GC per dose, including all whole numbers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1010, 2x1010, 3x1010, 4x1010, 5x1010, 6x1010, 7x1010, 8x1010 or 9x1010GC per dose, including all whole numbers or fractional amounts within the range.In another embodiment, the compositions are formulated to contain at least 1x10¹¹, 2x10¹¹, 3x10¹¹, 4x10¹¹, 5x10¹¹, 6x10¹¹, 7x10¹¹, 8x10¹¹, or 9x10¹¹ GC per dose, including all whole numbers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1x10¹², 2x10¹², 3x10¹², 4x10¹², 5x10¹², 6x10¹², 7x10¹², 8x10¹², or 9x10¹² GC per dose, including all whole numbers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1x10¹³, 2x10¹³, 3x10¹³, 4x10¹³, 5x10¹³, 6x10¹³, 7x10¹³, 8x10¹³, or 9x10¹³GC per dose, including all whole or fractional numbers within the range. In another embodiment, the compositions are formulated to contain at least 1x10¹⁴, 2x10¹⁴, 3x10¹⁴, 4x10¹⁴, 5x10¹⁴, 6x10¹⁴, 7x10¹⁴, 8x10¹⁴, or 9x10¹⁴GC per dose, including all whole or fractional amounts within the range.In another embodiment, the compositions are formulated to contain at least 1x10¹⁵, 2x10¹⁵, 3x10¹⁵, 4x10¹⁵, 5x10¹⁵, 6x10¹⁵, 7x10¹⁵, 8x10¹⁵, or 9x10¹⁵GC per dose, including all whole numbers or fractional amounts within the range. In one embodiment, for human application, the dose may range from 1x10¹⁰ to approximately... Petition 870260060647, dated 06 / 22 / 2026, p. 70 / 383 65 / 182 1x1015GC per dose, including all whole numbers or fractional amounts within the range.

[00122] In certain modalities, the dose may be in the range of approximately 1 x 10⁹ GC / g of brain mass to approximately 1 x 10¹² GC / g of brain mass. In certain modalities, the dose may be in the range of approximately 3 x 10¹⁰ GC / g of brain mass to approximately 3 x 10¹¹ GC / g of brain mass. In certain modalities, the dose may be in the range of approximately 5 x 10¹⁰ GC / g of brain mass to approximately 1.85 x 10¹¹ GC / g of brain mass.

[00123] In one embodiment, rAAVhu68.SMN1 can be administered in doses of at least about 1 x 10⁹ GC to about 1 x 10¹⁵ or about 1 x 10¹¹ to 5 x 10¹³ GC. The appropriate volumes for administering these doses and concentrations can be determined by someone skilled in the art. For example, volumes of about 1 pL to 150 mL can be selected, with the higher volumes being selected for adults. In general, for newborns, an appropriate volume is about 0.5 mL to about 10 mL; for older children, about 0.5 mL to about 15 mL can be selected. For toddlers, a volume of about 0.5 mL to about 20 mL can be selected. For children, volumes up to 30 mL can be selected. For pre-adolescents and adolescents, volumes up to about 50 mL can be selected.In other modalities, a patient may receive intrathecal administration in a volume of approximately 5 mL to approximately 15 mL selected, or approximately 7.5 mL to approximately 10 mL. Other suitable volumes and doses may be determined. The dosage will be adjusted to balance therapeutic benefit against any side effects, and such dosages may vary depending on the therapeutic application for which the recombinant vector is employed.

[00124] The rAAVhu68.SMN1 described above can be delivered to Petition 870260060647, dated 06 / 22 / 2026, page 71 / 383 66 / 182 host cells according to published methods. In certain embodiments, for administration to a human patient, rAAV is suitably suspended in an aqueous solution containing saline solution, a surfactant, and a physiologically compatible salt or salt mixture. The formulation is suitably adjusted to a physiologically acceptable pH, for example, in the pH range of 6 to 9 or 6.5 to 7.5, 7.0 to 7.7, or 7.2 to 7.8. Insofar as the pH of cerebrospinal fluid is about 7.28 to about 7.32, for intrathecal administration, a pH within this range may be desirable; whereas for intravenous administration, a pH of 6.8 to about 7.2 may be desirable. However, other pHs within the wider ranges and subranges may be selected for other routes of administration.

[00125] A suitable surfactant, or a combination of surfactants, may be selected from among non-toxic non-ionic surfactants. In one embodiment, a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, for example, Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers may be selected, namely, nonionic triblock copolymers composed of a central hydrophobic polyoxypropylene (polypropylene oxide) chain flanked by two hydrophilic polyoxyethylene (poly(ethylene oxide)) chains, SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (polycaprylic glycero), polyoxy-10 oleyl ether, TWEEN (fatty acid esters and polyoxyethylene sorbitan), ethanol, and polyethylene glycol. In one embodiment, the formulation contains a poloxamer.These copolymers are usually named with the letter P (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core and the last digit x 10 indicates the... Petition 870260060647, dated 06 / 22 / 2026, page 72 / 383 67 / 182 percent polyoxyethylene. In one embodiment, Poloxamer 188 is selected. The surfactant may be present in an amount of about 0.0005% to about 0.001% of the suspension.

[00126] In one example, the formulation may contain, for example, a buffered saline solution containing one or more of the following: sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate 7H2O), potassium chloride, calcium chloride (e.g., calcium chloride^2H2O), dibasic sodium phosphate, and mixtures thereof, in water. Suitablely, for intrathecal administration, the osmolarity is within a range compatible with cerebrospinal fluid (e.g., from about 275 to about 290); see, for example, emedicine.medscape.com / -article / 2093316-overview. Optionally, for intrathecal administration, a commercially available diluent may be used as a suspending agent or in combination with another suspending agent and other optional excipients. See, for example, Elliotts B® solution [Lukare Medical]. Each 10 mL of Elliotts B solution contains: Sodium Chloride, USP 73 mg; Sodium Bicarbonate, USP 19 mg; Dextrose, USP 8 mg; Magnesium Sulfate · 7H2O, USP 3 mg; Potassium Chloride, USP 3 mg; Calcium Chloride · 2H2O, USP 2 mg; Dibasic Sodium Phosphate · 7H2O, USP 2 mg Water for Injection, USP qs 10 mL

[00127] Electrolyte concentration: Sodium 149 mEq / liter Bicarbonate 22.6 mEq / liter Potassium 4.0 mEq / liter Chloride 132 mEq / liter Calcium 2.7 mEq / liter Sulfate 2.4 mEq / liter Magnesium 2.4 mEq / liter Phosphate 1.5 mEq / liter Petition 870260060647, dated 06 / 22 / 2026, page 73 / 383 68 / 182

[00128] The formulas and molecular weights of the ingredients are: INGREDIENT MOLECULAR FORMULA MOLECULAR WEIGHT Sodium Chloride NaCl 58.44 Sodium Bicarbonate NaHCO3 84.01 Dextrose C6H12O6 180.16 Magnesium Sulfate · 7H2O Mg2SO4 • 7H2O 246.48 Potassium Chloride KCl 74.55 Calcium Chloride · 2H2O CaCl2 • 2H2O 147.01 Dibasic Sodium Phosphate · 7H2O Na2HPO4 • 7H2O 268.07

[00129] The pH of the Eliot B solution is 6 to 7.5 and the osmolarity is of 288 mOsmol per liter (calculated). In certain embodiments, the composition containing the rAAVhu68.O SMN1 gene is delivered at a pH in the range of 6.8 to 8, or 7.2 to 7.8, or 7.5 to 8. For intrathecal delivery, a pH above 7.5 may be desired, for example, 7.5 to 8 or 7.8.

[00130] In certain embodiments, the formulation may contain a buffered aqueous saline solution that does not comprise sodium bicarbonate. This formulation may contain a buffered aqueous saline solution comprising one or more sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride and mixtures thereof, in water, as a Harvard buffer. The aqueous solution may also contain Kolliphor® P188, a poloxamer commercially available from BASF, which was previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2.

[00131] In another embodiment, the formulation may contain a buffered aqueous saline solution comprising 1 mM of phosphate Petition 870260060647, dated 06 / 22 / 2026, page 74 / 383 69 / 182 sodium (NasPOa), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCb), 0.8 mM magnesium chloride (MgCh), and Kolliphor® 0.001% 188. See, for example, harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain modalities, Harvard buffer is preferred due to the better pH stability observed with Harvard buffer. The table below provides a comparison of Harvard buffer and Elliot Buffer B.

[00132] Cerebrospinal Fluid (CSF) Compositions Component Units CSF B of Elliot Harvard Na+ mEq / L 117-137 149 150 K+ mEq / L 2.3-4.6 4.0 3.0 Mg+ mEq / L 2.2 2.4 0.8 Ca2+ mEq / L 2.2 2.7 1.4 Cl- mEq / L 113-127 132 155 HCO3- mEq / L 22.9 22.6 0 Fos mg / dL 1.2-2.1 1.5 1.0 Glucose mg / dL 45-80 80 - Pluronic % - 0.001% (added) 0.001% (added) Osmolarity mOsm / L 295 288 290 pH 7.31 6.0-7.5 * Derivation for 9+ (8.2+ w / o titled) 7.2 (titled for)

[00133] In other forms, the formulation may contain one or Petition 870260060647, dated 06 / 22 / 2026, page 75 / 383 70 / 182 plus permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycolate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether or EDTA.

[00134] In another embodiment, the composition includes a carrier, diluent, excipient, and / or adjuvant. Suitable carriers can be easily selected by one skilled in the art in view of the indication for which the transfer virus is intended. For example, a suitable carrier includes saline solution, which can be formulated with a variety of buffer solutions (e.g., phosphate-buffered saline). Other exemplary vehicles include sterile saline solution, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should include a component that prevents rAAV from sticking to the infusion tubing but does not interfere with in vivo rAAV binding activity.

[00135] Optionally, the compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[00136] The compositions according to the present invention may comprise a pharmaceutically acceptable carrier, as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAVs suspended in a pharmaceutically suitable carrier and / or mixed with suitable excipients designed for distribution to the individual. Petition 870260060647, dated 06 / 22 / 2026, page 76 / 383 71 / 182 by injection, osmotic pump, intrathecal catheter, or for delivery by another device or route. In one example, the composition is formulated for intrathecal delivery. In one embodiment, intrathecal administration involves an injection into the spinal canal, for example, the subarachnoid space.

[00137] The viral vectors described in this document can be used in the preparation of a medicament for the administration of hSMN to an individual (e.g., a human patient) who needs it, providing functional SMN to an individual and / or for the treatment of spinal muscular atrophy. A course of treatment may optionally involve repeated administration of the same viral vector (e.g., an AAVhu68 vector) or a different viral vector (e.g., an AAVhu68 and an AAVrh10). Still other combinations may be selected using the viral vectors and non-viral delivery systems described in this document.

[00138] As used in this document, the term intrathecal administration refers to a route of drug administration via injection into the spinal canal, more specifically into the subarachnoid space, so that they reach the cerebrospinal fluid (CSF). Intrathecal administration may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / intracisternal, and / or C1-2. For example, material may be introduced for diffusion along the subarachnoid space via lumbar puncture. In another example, the injection may be into the cisterna magna.

[00139] As used in this document, the term intracisternal administration refers to a route of drug administration directly into the cerebrospinal fluid of the cerebellomedullary cisterna magna, more specifically through a suboccipital puncture or by direct injection into the cisterna magna or by a permanently positioned tube.

[00140] In one mode, delivery can be made using the Petition 870260060647, dated 06 / 22 / 2026, page 77 / 383 72 / 182 device described in this document. IV. Apparatus and method for delivering a pharmaceutical composition into the cerebrospinal fluid

[00141] In one aspect, the vectors provided in this document can be administered intrathecally via the method and / or device provided in this section and further described in the Examples and Figure 7. Alternatively, other devices and methods may be selected. The method comprises the steps of advancing a spinal needle into the cisterna magna of a patient, connecting a length of flexible tubing to a hub near the spinal needle and an outlet port of a valve to a nearby end of the flexible tubing, and after said advancement and connection steps and after allowing the tubing to self-activate with the patient's cerebrospinal fluid, connecting a first container containing a quantity of isotonic solution to a valve discharge inlet port and, from there, connecting a second container containing a quantity of a pharmaceutical composition to a valve vector inlet port.After connecting the first and second containers to the valve, a path is opened for fluid flow between the vector's inlet port and the valve's outlet port, and the pharmaceutical composition is injected into the patient through the spinal needle. Following the injection of the pharmaceutical composition, a path is opened for fluid flow through the discharge inlet port and the valve's outlet port, and the isotonic solution is injected into the spinal needle to discharge the pharmaceutical composition into the patient.

[00142] In another aspect, a device is provided for intracisternal administration of a pharmaceutical composition. The device includes a first container containing a quantity of a pharmaceutical composition, a second container containing an isotonic solution, and a spinal needle through which the composition is administered. Petition 870260060647, dated 06 / 22 / 2026, page 78 / 383 The pharmaceutical solution 73 / 182 can be ejected directly from the device into the cerebrospinal fluid, within the cisterna magna of a patient. The device also includes a valve that has a first inlet port connected to the first vessel, a second inlet port connected to the second vessel, an outlet port connected to the spinal needle, and a luer closure to control the flow of the pharmaceutical composition and the isotonic solution through the spinal needle.

[00143] As used in this document, Computed Tomography (CT) refers to an X-ray in which a three-dimensional image of a body structure is constructed by computer from a series of flat cross-sectional images taken along an axis.

[00144] The medical apparatus or device 10, as shown in Figure 7, includes one or more vessels, 12 and 14, interconnected by a valve 16. Vessels 12 and 14 provide a new source of a pharmaceutical composition, drug, vector or similar substance and a new source of an isotonic solution, such as saline solution, respectively. Vessels 12 and 14 may be any form of medical device that allows the injection of fluids into a patient.

[00145] By way of example, each container, 12 and 14, may be supplied in the form of a syringe, cannula or similar. For example, in the embodiment illustrated, container 12 is supplied as a separate syringe containing a quantity of a pharmaceutical composition and is referred to in this document as a vector syringe. For example purposes only, container 12 may contain approximately 10 cc of a pharmaceutical composition or similar.

[00146] Similarly, container 14 may be provided in the form of a separate syringe, cell or similar containing a quantity of saline solution and may be referred to as a discharge syringe. For example purposes only, container 14 may contain Petition 870260060647, dated 06 / 22 / 2026, page 79 / 383 74 / 182 approximately 10 cc of a saline solution.

[00147] Alternatively, vessels 12 and 14 may be supplied in different syringe forms and may be integrated into a single device, such as an integrated medical injection device having a pair of separate chambers, one for the pharmaceutical composition and the other for saline solution. Furthermore, the size of the chambers or vessels may be provided as needed to hold a desired quantity of fluid.

[00148] In the illustrated embodiment, valve 16 is provided in the form of a 4-way stopcock with a rotating male luer-lock syringe 18. Valve 16 interconnects vessels 12 and 14 (i.e., the vector syringe and the discharge syringe in the illustrated embodiment), and the rotating male luer-lock opens a path through valve 16, to be opened and closed for each of vessels 12 and 14. Thus, the path through valve 16 can be closed for either the vector syringe or the discharge syringe, or it can be opened for a selected vector syringe or discharge syringe. As an alternative to a 4-way stopcock, the valve can be a 3-way stopcock or a fluid control device.

[00149] In the embodiment illustrated, valve 16 is connected to one end of a length of extension pipe 20 or a similar fluid duct. The pipe 20 may be selected based on a desired length or internal volume. By way of example only, the pipe may be about 6 to 7 inches long.

[00150] In the illustrated embodiment, an opposite end 22 of tubing 12 is connected to a T-connector extension assembly 24, which, in turn, is connected to a spinal needle 26. By way of example, the needle 26 may be a five-inch spinal needle of 22 or 25 gauge. Additionally, as an option, the needle Petition 870260060647, dated 06 / 22 / 2026, page 80 / 383 75 / 182 spinal 26 can be connected to an introducer needle 28, such as a three and a half inch 18 gauge introducer needle.

[00151] In use, the spinal needle 26 and / or the optional introducer needle 28 can be advanced into the patient as far as the cisterna magna. After needle advancement, Computed Tomography (CT) images can be obtained that allow visualization of the needle 26 and / or 28 and relevant soft tissues (e.g., paravertebral muscles, bones, brainstem, and spinal cord). Correct needle placement will be confirmed by observation of cerebrospinal fluid (CSF) in the center of the needle and visualization of the needle tip within the cisterna magna. After this, the relatively short extension tubing 20 can be connected to the inserted spinal needle 26, and the 4-way stopcock 16 can then be connected to the opposite end of the tubing 20.

[00152] The above assembly is allowed to become self-activated with the patient's CSF.Subsequently, the pre-filled normal saline solution discharge syringe 14 is connected to a discharge port of the 4-way stopcock 16, and then the vector syringe 12 containing a pharmaceutical composition is connected to a vector port of the 4-way stopcock 16. Subsequently, the stopcock outlet port 16 is opened to the vector syringe 12, and the contents of the vector syringe can be slowly injected through the valve 16 and the assembled apparatus into the patient over a period of time. For example purposes only, this period of time could be approximately 1-2 minutes and / or any other desired period of time.

[00153] After the contents of vector syringe 12 are injected, the rotating lock 18 on the stopcock 16 is turned to a second position so that the stopcock 16 and needle assembly can be flushed with a desired amount of normal saline solution using the pre-filled flush syringe 14. By way of example only, 1 to 2 cc of normal saline solution can be used, although quantities Petition 870260060647, dated 06 / 22 / 2026, page 81 / 383 76 / 182 larger or smaller doses can be used as needed. Normal saline solution ensures that all or most of the pharmaceutical composition is forced to be injected through the assembled device and into the patient, so that little or none of the pharmaceutical composition remains in the assembled device.

[00154] After the assembled device has been flushed with saline solution, the assembled device in its entirety, including the needle(s), extension tubing, stopcock, and syringes, is slowly removed from the individual and placed on a surgical tray for disposal in a biohazardous waste container or a rigid container (for the needle(s)).

[00155] A screening process may be performed by a principal investigator, which may lead to an intracisternal (IC) procedure. The principal investigator may describe the process, the procedure, the administration procedure itself, and all possible safety risks so that the individual (or designated guardian) is fully informed. Medical history, concomitant medications, physical examination, vital signs, electrocardiogram (ECG), and laboratory test results are obtained or performed and provided to a neuroradiologist, neurosurgeon, and anesthesiologist for use in the screening assessment of the patient's eligibility for the IC procedure.

[00156] In order to allow adequate time to assess eligibility, the following procedures should be performed at any time between the first screening visit and up to one week before the study visit. For example, on Day 0, head / neck Magnetic Resonance Imaging (MRI) with and without gadolinium (i.e., eGRF > 30 mL / min / 1.73 m2) may be obtained. In addition to head / neck MRI, the investigator will determine the need for further neck assessments through flexion / extension studies. The MRI protocol will include images from the T1, T2, DTI protocols, Petition 870260060647, dated 06 / 22 / 2026, page 82 / 383 77 / 182 FLAIR and CINEMA.

[00157] Furthermore, head / neck MRA / MRV, according to institutional protocol (i.e., individuals with a history of intra / transdural operations may be excluded or require other tests (e.g., radionuclide cisternography)) that allow for adequate assessment of CSF flow and identification of possible blockages or lack of communication between CSF spaces.

[00158] The neuroradiologist, neurosurgeon, and anesthesiologist discuss and determine each individual's eligibility for IC procedures based on all available information (tests, medical history, physical and laboratory examinations, etc.). A preoperative anesthesia assessment can also be obtained from Day -28 to Day 1, which allows for a detailed evaluation of the airway, neck (shortened / thickened), and head range of motion (degree of neck flexion), keeping in mind the special physiological needs of an individual with MPS.

[00159] Prior to an IC procedure, the CT Suite will confirm that the following equipment and medications are present: Adult lumbar puncture (LP) kit (provided by institution); BD (Becton Dickinson) 22 or 25 gauge x 3-7 spinal needle (Quincke bevel); Coaxial introducer needle, used at the interventionalist's discretion (for spinal needle introduction); Small 4-hole stopcock with rotating male luer lock (Spin); T-connector extension set (tubing) with female luer lock adapter, approximately 6.7 inches long; Omnipaque 180 (iohexol), for intrathecal administration; Iodinated contrast for intravenous (IV) administration; 1% lidocaine injection solution (if not provided in adult LP kit); 10 cc pre-filled syringe of normal saline (sterile); Radiopaque marker(s); Surgical preparation equipment / razor blade; Cushions / supports to allow for proper positioning of the Petition 870260060647, dated 06 / 22 / 2026, page 83 / 383 78 / 182 intubated individual; Endotracheal intubation equipment, general anesthesia machine and mechanical ventilator; Intraoperative neurophysiological monitoring equipment (IONM) (and necessary personnel); and vector containing 10cc syringe; prepared and transported to the CT / operating room (OR) according to the separate Pharmacy Manual.

[00160] Informed consent for the procedure will be confirmed and documented in the medical record and / or study file. Separate consent for the procedure from the radiology and anesthesiology team will be obtained according to institutional requirements. The individual has an intravenous access placed within the appropriate hospital unit according to institutional guidelines (e.g., two IV access sites). Intravenous fluids will be administered at the anesthesiologist's discretion. At the anesthesiologist's discretion and in accordance with institutional guidelines, the individual may be induced and undergo endotracheal intubation with the administration of general anesthesia in an appropriate patient care unit, waiting area, or surgical / CT scan procedure area.

[00161] A lumbar puncture is performed, firstly to remove 5 cc of cerebrospinal fluid (CSF) and subsequently to inject contrast (Omnipaque 180) intrathecally to aid visualization of the cisterna magna. Appropriate placement maneuvers may be performed on the individual to facilitate diffusion of the contrast into the cisterna magna.

[00162] Intraoperative neurophysiological monitoring (IONM) equipment is attached to the individual. The individual is placed on the CT scanner table in the lateral decubitus or prone position. An appropriate team must be present to ensure the individual's safety during transport and placement. If deemed appropriate, the individual may be positioned in a manner that provides flexion of the Petition 870260060647, dated 06 / 22 / 2026, page 84 / 383 79 / 182 neck to the degree determined as safe during preoperative assessment and with normal neurophysiological monitor signs documented after positioning.

[00163] The following team can be confirmed as present and identified on site: The interventionalist / neurosurgeon performing the procedure; the anesthesiologist and respiratory technician(s); the nurses and medical assistants; the CT (or OR) technicians; the neuropsychology technicians; and the local coordinator. A break may be taken by hospital protocol / a joint committee to verify the correct individual, procedure, location, positioning, and presence of all necessary equipment in the room. The principal local investigator can then confirm with the team whether he / she can proceed with the preparation of the individual.

[00164] The individual's skin under the cranial base is shaved as needed. Computed tomography (CT) scans are performed, followed by pre-procedural planning CT with IV contrast, if deemed necessary by the interventionalist to locate the target site and visualize vascularization. Once the target site (cisterna magna) is identified and the needle path is planned, the skin is prepared and covered using a sterile technique according to institutional guidelines. A radiopaque marker is placed at the desired skin location, as indicated by the interventionalist. The skin under the marker is anesthetized by infiltration with 1% lidocaine. A 22G or 25G spinal needle is advanced toward the cisterna magna, with the option of using a coaxial introducer needle.

[00165] After needle advancement, CT images are obtained using the thinnest possible CT slice thickness, using institutional equipment (ideally < 2.5 mm). Serial computed tomography images are obtained using the lowest possible radiation dose, which Petition 870260060647, dated 06 / 22 / 2026, page 85 / 383 80 / 182 allows for adequate visualization of the needle and relevant soft tissues (e.g., paraspinal muscles, bone, brainstem, and spinal cord). Correct needle placement is confirmed by observing the CSF in the center of the needle and visualizing the needle tip within the cisterna magna.

[00166] The interventionist confirms that the vector syringe is positioned near, but outside, the sterile field. Before handling or administering the pharmaceutical composition in the vector syringe, gloves, a mask, and eye protection are put on by the team assisting the procedure within the sterile field.

[00167] The extension tubing is attached to the inserted spinal needle, which is then attached to the 4-way stopcock stopcock. Once this device is self-activated with the individual's CSF, the 10cc pre-filled normal saline discharge syringe is attached to the discharge port of the 4-way stopcock stopcock. The vector syringe is then provided to the interventionist and attached to a vector inlet port on the 4-way stopcock stopcock.

[00168] After the stopcock stopcock outlet port is opened for the vector syringe, placing the stopcock stopcock's rotating lock in the first position, the contents of the vector syringe are injected slowly (over approximately 1-2 minutes), taking care not to apply excessive force to the syringe plunger during injection.After the contents of the vector syringe have been injected, the stopcock-type injector head closure is rotated to a second position so that the stopcock-type stopcock and needle assembly can be discharged with 1-2cc of saline solution using the attached pre-filled discharge syringe.

[00169] When ready, the intervener will alert staff that he or she will remove the device from the individual. In a single movement, the needle, the extension tubing, the stopstock-type tap Petition 870260060647, dated 06 / 22 / 2026, page 86 / 383 81 / 182 and the syringes will be slowly removed from the patient and placed on a surgical tray to be disposed of in a biohazardous waste receptacle or rigid container (for the needle).

[00170] The needle insertion site will be examined for signs of bleeding or CSF leakage and treated as directed by the investigator. The site is wrapped with gauze, surgical tape, and / or Tegaderm dressing, as directed. The individual is then removed from the CT scanner and placed on a stretcher. Appropriate staff should be present to ensure the individual's safety during transport and placement.

[00171] Anesthesia is discontinued and individuals will be cared for according to institutional guidelines for post-anesthesia care. Neurophysiological monitors are removed from the individual. The head of the stretcher on which the individual lies should be slightly elevated (~30 degrees) during recovery. The individual is transported to an appropriate post-anesthesia care unit, according to institutional guidelines. After the individual has adequately regained consciousness and is in stable condition, he or she will be admitted to the appropriate floor / unit for mandatory protocol assessments. Neurological assessments will be followed according to protocol, and the Principal Investigator will supervise patient care in collaboration with the hospital and research staff.

[00172] In one embodiment, a method of administering a composition provided in this document comprises the steps of: advancing a spinal needle into the cisterna magna of a patient; connecting a length of flexible tubing to a center near the spinal needle and an outlet port of a valve to the proximal end of the flexible tubing; after said advancement and connection steps and after allowing the tubing to be Petition 870260060647, dated 06 / 22 / 2026, page 87 / 383 82 / 182 self-activated with the patient's cerebrospinal fluid, connect a first vessel containing a quantity of isotonic solution to a discharge inlet port of the valve and then connect a second vessel containing a quantity of a pharmaceutical composition to a vector inlet port of the valve; after connecting the first and second vessels to the valve, open the path for fluid to flow between the vector inlet port and the valve outlet port and inject the pharmaceutical composition into the patient via the spinal needle; and, after injecting the pharmaceutical composition, open a path for fluid to flow through the discharge inlet port and the valve outlet port and inject the isotonic solution into the spinal needle to discharge the pharmaceutical composition into the patient.In certain modalities, the method also involves ensuring proper placement of the distal tip of the spinal needle into the cisterna magna before connecting the tubing and valve to the center of the spinal needle. In certain modalities, the confirmation step includes visualizing the distal tip of the spinal needle in the cisterna magna with computed tomography (CT) imaging. In certain modalities, the confirmation step includes observing the presence of the patient's cerebrospinal fluid in the center of the spinal needle.

[00173] In the method described above, the valve may be a stopcock type tap with a rotating luer closure adapted to rotate to a first position, allowing flow from the vector inlet port to the outlet port, while simultaneously blocking flow through the discharge inlet port, and to a second position, which allows flow from the discharge inlet port to the outlet port, while simultaneously blocking flow through the vector inlet port, and in which the rotating luer closure is positioned in said first position in said second position when said pharmaceutical composition is being discharged into said patient by the solution. Petition 870260060647, dated 06 / 22 / 2026, page 88 / 383 83 / 182 isotonic. In certain embodiments, after injecting the isotonic solution into the spinal needle to deliver the pharmaceutical composition into the patient, the spinal needle is removed from the patient with the tubing, valve, and first and second vessels attached to it as a unit. In certain embodiments, the valve is a 4-way stopcock type stopcock with a rotating male luer closure. In certain embodiments, the first and second vessels are separate syringes. In certain embodiments, a T-connector is located in the center of the spinal needle and connects the tubing to the spinal needle. Optionally, the spinal needle includes an introducer needle at the distal end of the spinal needle. The spinal needle may be a five-inch spinal needle of 22 or 24 gauge. In certain embodiments, the introducer needle is a 3.5-inch introducer needle of 18 gauge.

[00174] In certain aspects, the method utilizes a device that is composed, at a minimum, of a first container to hold a quantity of a pharmaceutical composition; a second container to hold an isotonic solution; a spinal needle through which the pharmaceutical composition can be ejected directly from the device into the cerebrospinal fluid within the cisterna magna of a patient; and a valve that has a first inlet port connected to the first container, a second inlet port connected to the second container, an outlet port connected to the spinal needle, and a luer closure to control the flow of the pharmaceutical composition and the isotonic solution through the spinal needle.In certain embodiments, the valve is a stopcock type tap with a rotating luer lock adapted to rotate to a first position, allowing flow from the first inlet port to the outlet port, while simultaneously blocking flow through the second inlet port and up to a second position, allowing flow from the second inlet port to the outlet port. Petition 870260060647, dated 06 / 22 / 2026, page 89 / 383 84 / 182 simultaneously blocks the flow through the first entry port. Optionally, the valve is a 4-way stopcock with a rotating male luer closure. In certain embodiments, the first and second receptacles are separate syringes. In certain embodiments, the spinal needle is connected to the valve via a length of flexible tubing. A T-connector may connect the tubing to the spinal needle. In certain embodiments, the spinal needle is a five-inch 22- or 24-gauge spinal needle. In certain embodiments, the device further comprises an introducer needle attached to a distal end of the spinal needle. Optionally, the introducer needle is a 3.5-inch 18-gauge introducer needle.

[00175] This method and device may each optionally be used for intrathecal administration of the compositions provided in this document. Alternatively, other methods and devices may be used for such intrathecal administration.

[00176] In one embodiment, a single dose of AAVhu68.SMA as provided in this document is administered to adults (at least 18 years of age (>18)) with genetically confirmed 5q SMA and / or a clinical history of Type 3 SMA. In other embodiments, patients may be younger (e.g., 12 to 18 years, 6 to 12 years, 3 to 6 years, 18 months to 3 years, 6 months to 18 months, newborn). Patients may be non-ambulatory or ambulatory. Dosing may be via a single vector dose by ICM (intracisterna magna) injection. In one embodiment, the dose ranges from approximately 3 x 10¹³GC to a high dose of 1 x 10¹⁴GC. However, other suitable ranges are provided in this document.Efficacy assessments may include one or more of the following: motor assessments, such as the Walt six-minute walk test (6MWT), 10-meter walk time, RULM score, 4-step climb, 9-hole fitting test; pulmonary function tests. Petition 870260060647, dated 06 / 22 / 2026, page 90 / 383 85 / 182 as forced vital capacity (FVC), maximum expiratory pressure (MEP) and maximum inspiratory pressure (MIP); respiratory function measures, PedsQL (fatigue scale), SMA-FRS (functional rating scale), electrophysiology, such as nerve conduction testing, CMAP (e.g., ulnar and peroneal CMAP amplitude and sensory tests, SMN protein concentration and other exploratory biomarkers to be evaluated in the CSF.

[00177] In one embodiment, a syringe containing the vector at the appropriate concentration is used. Before administering the study vector, a lumbar puncture is performed to remove a predetermined volume of CSF, followed by the intrathecal (IC) injection of iodinated contrast to aid in visualization of the relevant anatomy of the cisterna magna. Intravenous (IV) contrast may be administered before or during needle insertion as an alternative to intrathecal contrast. The decision to use IV or IC contrast is at the discretion of the interventionalist. The patient is anesthetized, intubated, and positioned on the procedure table. Intraoperative neurophysiological monitoring (IONM) equipment is connected to the participant. The injection site is prepared and covered using sterile technique. A spinal needle (22-25 G) is advanced into the cisterna magna under fluoroscopic guidance. A larger introducer needle is used to assist in needle placement.After confirming needle placement, the extension set is attached to the spinal needle and allowed to fill with the patient's CSF. At the interventionalist's discretion, a syringe containing contrast material may be connected to the extension set and a small amount injected to confirm needle placement in the cisterna magna. After needle placement is confirmed by CT guidance + / - contrast injection, a syringe containing the vector (e.g., 5.6 mL) is connected to the extension set. The contents of the syringe are slowly injected over 1-2 minutes, providing a... Petition 870260060647, dated 06 / 22 / 2026, page 91 / 383 86 / 182 volume of 5 mL. The needle is slowly removed from the patient.

[00178] As used in this document, the individual is a mammal, for example, a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon, or gorilla. In one embodiment, the individual is a human patient who has SMA.

[00179] The International SMA Consortium classification defines various degrees of severity in the SMA phenotype, depending on the age of onset and motor development milestones. The designation SMA 0 is proposed to reflect prenatal onset and severe joint contractures, facial diplegia, and respiratory failure. SMA type I, Werdnig-Hoffmann disease I, is the most severe postnatal form with onset within 6 months of birth. Patients are unable to sit and present with severe respiratory dysfunction. SMA Type II is the intermediate form with onset within the first 2 years; children can sit but cannot walk. The clinical course is variable. Type III (also called Kugelberg-Welander disease) begins after 2 years of age and usually has a chronic course. Children can stand and walk without assistance, at least in infancy.The adult form (type IV) is the mildest, with onset after 30 years of age; few cases have been reported and its prevalence is not precisely known.

[00180] In some cases, SMA is detected in a fetus around 30 to 36 weeks of gestation. In this situation, it may be desirable to treat the newborn as soon as possible after delivery. It may also be desirable to treat the fetus in utero. Thus, a rescue and / or treatment method for a neonatal individual with SMA is provided, comprising the step of delivering an hSNM1 gene to the neuronal cells of a newborn individual (e.g., a human patient). A rescue and / or treatment method for a fetus is provided. Petition 870260060647, dated 06 / 22 / 2026, page 92 / 383 87 / 182 with SMA, comprising the step of delivering an hSMN gene to fetal neuronal cells in utero. In one embodiment, the gene is delivered in a composition described in this document by intrathecal injection. This method may use any nucleic acid sequence encoding a functional hSMN protein, whether a codon-optimized hSMN as described in this document or a native hSMN, or an hSMN allele with enhanced activity compared to a wild-type protein or a combination thereof. In one embodiment, in utero treatment is defined as the administration of an hSMN construct as described in this document following the detection of SMA in the fetus. See, for example, David et al., Recombinant adeno-associated virus-mediated in utero gene transfer gives therapeutic transgene expression in the sheep, Hum Gene Ther. April 2011; 22(4):419-26. doi: 10.1089 / hum.2010.007. Epub dated February 2, 2011, which is incorporated herein by reference.

[00181] In one embodiment, neonatal treatment is defined as administering an hSMN construct as described in this document within 8 hours, the first 12 hours, the first 24 hours, or the first 48 hours of delivery. In another embodiment, particularly for a primate (human or non-human), neonatal distribution is within the period of approximately 12 hours to approximately 1 week, 2 weeks, 3 weeks, or approximately 1 month, or after approximately 24 hours to approximately 48 hours. In another embodiment, for late-onset SMA, the composition is administered after the onset of symptoms. In one embodiment, patient treatment (e.g., a first injection) is initiated before the first year of life. In certain embodiments, for example, with infants, the construct is readministered, for example, after 1 year of age. Optionally, more than one readministration is permitted.Such readministration may be with the same type of vector, a different viral vector, or via non-viral distribution as described herein. Petition 870260060647, dated 06 / 22 / 2026, page 93 / 383 88 / 182 document. In another modality, treatment is initiated after the 1st year, or after the first 2 to 3 years of age, after 5 years of age, after 11 years of age, or at a more advanced age.

[00182] According to the present invention, a therapeutically effective amount of AAV.hSMN is delivered as described herein to achieve a desired outcome, i.e., treatment of SMA or one or more symptoms thereof. Other desired outcomes include reduction of muscle weakness, increased muscle strength and tone, prevention or reduction of scoliosis, maintenance or improvement of respiratory health, or reduction of tremors or spasms. Other desired endpoints may be determined by a physician.

[00183] In certain modalities, the therapeutic efficacy of a composition containing AAV.hSMN as provided in this document may be assessed by one or more of the following parameters. These scores may be 52 weeks or at a longer or shorter interval, for example, 8 weeks, 12 weeks, 36 weeks, 48 ​​weeks, or time points in between. RULM scores at a predetermined time after administration are compared to baseline scores. Motor function may be measured by the 6MWT and 10-meter walk test in ambulatory subjects. Motor function may be measured by the 9-hole peg test (ambulatory and non-ambulatory) and 4-step climb test (ambulatory only). Pulmonary function may be measured by forced vital capacity (FVC), maximum expiratory pressure (MEP), maximum inspiratory pressure (MIP). Changes from baseline in ulnar and peroneal amplitude of the CMAP may be assessed. PedQLVersion 3 Multidimensional Fatigue Scale.The adult reporting module 0 can be evaluated. The SMAFRS (functional rating scale) can be assessed. The pharmacokinetics of the vector in DNA and other components of AAV-based drugs in CSF, serum, and urine can be measured. Petition 870260060647, dated 06 / 22 / 2026, page 94 / 383 89 / 182

[00184] As used in this document, the 6MWT is a measure of the distance covered by an ambulatory individual in a 6MWT. The 6MWT will be performed in a long, straight, low-traffic corridor located indoors. A distance of 30 meters will be marked with orange cones at each end. A starting line will be marked with colored tape.

[00185] RULM: The revised upper limb module consists of 20 motor tasks performed with an upper extremity selected by the individual. Performance on each task is assessed on a scale of 0-2 by the assessor.

[00186] 9-Hole Peg Test: The 9-HPT is a brief, standardized quantitative test of upper limb function. The dominant and non-dominant hands are tested twice. The individual is seated at a table with a small, shallow container containing nine pegs and a wooden or plastic block containing nine empty holes. On a starting command, when a timer is started, the individual picks up the nine pegs one at a time as quickly as possible, places them in the nine holes, and once they are in the holes, removes them again as quickly as possible one at a time, replacing them in the shallow container. The total time to complete the task is recorded. Two consecutive trials with the dominant hand are immediately followed by two consecutive trials with the non-dominant hand. The score for the 9-HPT is an average of the four trials.The two attempts for each hand are calculated, converted to the reciprocals of the average times for each hand, and then the two reciprocals are calculated.

[00187] 10-meter walk time: The 10-meter walk time is a measure of the time required to walk 10 meters. The test will be conducted in a long, straight, low-traffic corridor located indoors. A distance of 10 meters will be marked. Petition 870260060647, dated 06 / 22 / 2026, page 95 / 383 90 / 182 with orange cones at each end. A starting line will be marked with colored tape.

[00188] 4-Stair Climb: The 4-stair climb test assesses the time required for an individual to ascend and descend 4 stairs. The task will be performed by a trained evaluator who will ensure that the individual can safely complete the task. The stairs should have a rise of 16 to 20 cm and a handrail. Individuals are instructed to ascend and descend as quickly and safely as possible. Both the time required to complete the task and the need to use the handrail will be recorded.

[00189] Electrophysiology studies are performed to assess the function of motor units. CMAP: Motor nerve conduction studies of the ulnar nerve should preferably be performed on the right arm unless there is a compelling reason to avoid studying this limb (e.g., premorbid superimposed nerve injury). This involves delivering current to the nerve and recording the motor response in the muscle. This response is called the compound muscle action potential. Both the height and area of ​​the CMAP (amplitude and AUC) can be measured. Functional and fatigue scales:

[00190] PedsQL Fatigue Scale, adult report: The PedsQL Multidimensional Fatigue Scale is an 18-item questionnaire that assesses general fatigue (6 items), sleep and rest (6 items), and cognitive fatigue (6 items).

[00191] SMA-FRS: SMA-FRS is an easy-to-administer ordinal rating scale based on 10 aspects of activities of daily living. Each subset is scored from 0 (totally dependent) to 5 (totally independent) by the individual or caregiver, with a maximum score of 50.

[00192] In one modality, the sequence of evaluations is carried out Petition 870260060647, dated 06 / 22 / 2026, p. 96 / 383 91 / 182 in the following order for a patient as follows: PedsQL (fatigue scale), SMA-FRS (functional assessment scale), 6MWT, 15 min rest (minimum), RULM, 9-hole peg test, 10-meter walk, 15 min rest (minimum), 4-step climb, PFTs* and ulnar and peroneal CMAP*. *Can be performed in any order. Tests that cannot be safely performed by the patient will be omitted.

[00193] Prior to treatment, patients with SMA may be assessed for neutralizing antibodies (Nab) to the capsid of the rAAV vector used to deliver the hSMN-1 gene. These Nabs can interfere with transduction efficiency and reduce therapeutic efficacy. Patients with SMA who have a baseline serum Nab titer <1:5 to <1:20, or <1:2.5 to <1:10 are good candidates for treatment with the rAAV.hSMN1 gene therapy protocol. Treatment of SMA I patients with serum Nab titers >1:5 may require combination therapy, such as transient co-treatment with an immunosuppressant before and / or during treatment with the rAAV.hSMN vector. Optionally, immunosuppressive co-therapy may be used as a precautionary measure, without prior evaluation of neutralizing antibodies against the AAV vector capsid and / or other components of the formulation.In certain modalities, prior immunosuppressive therapy may be desirable to prevent a potential adverse immune reaction to the hSMN transgenic product, especially in patients who have virtually no SMN activity levels, where the transgenic product may be perceived as foreign.

[00194] Immunosuppressants for this co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., rapamycin or rapogen), and cytostatic agents, including an alkylating agent, an antimetabolite, a cytotoxic antibiotic, an antibody, or an agent. Petition 870260060647, dated 06 / 22 / 2026, page 97 / 383 92 / 182 active in immunophilin. The immunosuppressant may include nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor (CD25-) or antibodies directed against CD3, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFNβ, IFN-γ, an opioid, or a TNF-α (tumor necrosis factor alpha) binding agent. In certain modalities, immunosuppressive therapy may be initiated before gene therapy administration. Such therapy may involve the co-administration of two or more drugs (e.g., prednisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration, at the same dose or at an adjusted dose. This therapy may last approximately one week, approximately 15 days, approximately 30 days, approximately 45 days, 60 days, or more, as needed.In certain modalities, a patient receiving the rAAVhu68.SMA gene therapy described in this document has received prior nusinersen treatment. In other modalities, the patient receives ongoing nusinersen treatment and is monitored after gene therapy for a reduction or elimination in the need for such nusinersen treatment. Patients receiving rAAVhu68.SMA may receive other therapies, including, without limitation, pyridostigmine [UMC Ultrecht], RO7034067 [Hoffman-LaRoche], celecoxib, CK-2127107 [Astellas Pharma]. In certain modalities, the efficacy of rAAVhu68.SMA is measured by a decrease in the frequency and / or dose of these co-therapies.In certain modalities, since AAVhu68-SMN1 therapy, although durable, may not result in as high a correction as desired for a selected patient, then rolling to nusinersen (Spinraza™) therapy may be desired as soon as 6 months after AAVhu68-SMN1 treatment, administration of nusinersen (Spinraza™) to patients may be considered. Petition 870260060647, dated 06 / 22 / 2026, page 98 / 383 93 / 182 co-administration of the two agents. See also Wang et al, Consensus Statement for Standard of Care in Spinal Muscular Atropy, which provides a discussion of the present standard of care for SMA and www.ncbi.nlm.nih.gov / books / NBK1352 / .

[00195] For example, when nutrition is a concern in SMA, placement of a gastrostomy tube is appropriate. As respiratory function deteriorates, tracheotomy or noninvasive respiratory support is offered. Disordered sleep breathing can be treated with the nightly use of continuous positive airway pressure. Surgery for scoliosis in individuals with SMA II and SMA III can be safely performed if forced vital capacity is greater than 30%-40%. An electric chair and other equipment can improve quality of life. See also U.S. Patent No. 8211631, which is incorporated herein by reference.

[00196] It should be noted that the term one or an refers to one or more. Thus, the terms one, one or more, and at least one are used interchangeably in this document.

[00197] The words comprehend, comprehends, and comprehending should be interpreted inclusively rather than exclusively. The words consist, consisting, and their variants should be interpreted exclusively, not inclusively. Although several modalities in the specification are presented using the term comprehending, in other circumstances a related modality should also be interpreted and described using the language consisting of or consisting essentially of.

[00198] As used in this document, the term about means a variability of 10% (±10%) relative to the given reference, unless otherwise specified.

[00199] As used in this document, disease, disorder, and condition are used interchangeably to indicate a state. Petition 870260060647, dated 06 / 22 / 2026, page 99 / 383 94 / 182 abnormal in an individual.

[00200] The term expression is used in this document in its broadest sense and includes the production of RNA or RNA and protein. With regard to RNA, the term expression or translation refers in particular to the production of peptides or proteins. Expression can be transient or stable.

[00201] The term translation refers to a process in the ribosome, in which a chain of mRNA controls the assembly of an amino acid sequence to generate a protein or a peptide.

[00202] Unless otherwise defined in this descriptive report, the technical and scientific terms used in this document have the same meaning as that understood in the art and by reference to published texts that provide those skilled in the art with a general orientation to various of the terms used in this application.

[00203] The following examples are for illustrative purposes only and are not intended to limit the present invention. Example 1 - Clade F AAV - AAVhu68 Inventive

[00204] Tissue DNA was extracted from human tissue samples as a PCR template using QIAamp columns (Qiagen) following the manufacturer's recommendations with the following modifications. The DNA polymerase Q5 (High Fidelity Core Mixture 2X Q5® Hot Start, NEB) was chosen for its extraordinary high fidelity and robust efficiency in recovering the VP1 gene from AAVs in the samples, as described by Gao, et al [Proc Natl Acad Sci USA, 2002 Sep 3, 99(18): 11854-11859 (Epub 2002 Aug 21)] with the primer set modified as follows: in place of AV1NS, primer prm504 [GCTGCGTCAACTGGACCAATGAGAAC, SEQ ID NO: 23] was used and in place of the reverse primer AV2CAS, prm505 [CGCAGAGACCAAAGTTCAACTGAAACGA, SEQ ID NO: 24] was used. The PCR conditions were modified as follows: Petition 870260060647, dated 06 / 22 / 2026, p. 100 / 383 95 / 182 pL Water 9 prm504 1.25 prm505 1.25 model 1 2X Q5 12.5 PCR program Time (seconds) Cycle (s) 98 30 1 98 10 50 59 10 72 93 72 120 1

[00205] ~3 kb PCR bands were cut from the gel; DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen) and cloned using the Zero Blunt® TOPO® PCR cloning kit (Thermo Fisher Scientific). Plasmids were sequenced to obtain the full length of the AAV VP1 gene. For most samples, at least three plasmids were fully sequenced, and consensus sequences were drawn as the final AAV sequence for that sample.

[00206] The acquired nucleic acid sequence encoding the vp1 capsid protein of AAVhu68 is provided in SEQ ID NO: 7. See also Figures 8B-8D. The amino acid sequence of vp1 of AAVhu68 is provided in Figure 8A and SEQ ID NO: 8. Compared to AAV9, AAVhu31, and AAVhu32, two critical mutations (A67E and A157V) were identified in AAVhu68 (circled in Figure 8A).

[00207] The pAAV2 / hu68 trans plasmid was then produced carrying the hu68 VP1 gene in a pAAV2 / 9 mainframe in place of the AAV9 VP1 gene, in order to evaluate packaging efficiency, yield, and transduction properties. The pAAV2 / 9 plasmid contains 5' and 3' ITRs of AAV2 flanking the capsid gene and is Petition 870260060647, dated 06 / 22 / 2026, page 101 / 383 96 / 182 available at Penn Vector Core [University of Pennsylvania, Phila, PA US, pennvectorcore.med.upenn.edu]. Example 2 - vectors AAVhu68

[00208] Vectors AAVhu68 and AAV9 carrying various markers, such as GFP and LacZ, were generated and evaluated. Each vector was generated using the triple transfection technique in 293 cells, as described by Gao et al. [Gao, Guang-Ping, et al. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proceedings of the National Academy of Sciences 99.18 (2002): 11854-11859]. 1. Production of trans pAAVhu68 plasmid

[00209] The nucleic acid sequence encoding the vp1 capsid protein provided in SEQ ID NO: 7.

[00210] The pAAV2 / hu68 trans plasmid was produced carrying the hu68 VP1 gene in a pAAV2 / 9 mainframe in place of the AAV9 VP1 gene, in order to evaluate packaging efficiency, yield, and transduction properties. The pAAV2 / 9 plasmid contains 5' and 3' ITRs of AAV2 flanking the capsid gene and is available from Penn Vector Core [University of Pennsylvania, Phila, PA US, pennvectorcore.med.upenn.edu]. 2. AAVhu68 Vector Yield

[00211] 293 cells were cultured and maintained in DMEM, 1X (Dulbecco's Eagle Medium Modification) with 4.5 g / L glucose, L-glutamine & sodium pyruvate supplemented with 10% fetal bovine serum under a 5% CO2 atmosphere at 37°C. Transfections were performed as described by Gao et al [Gao, Guang-Ping, et al. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proceedings of the National Academy of Sciences 99.18 (2002): 11854-11859] with the vector plasmid substituted with pAAV2 / hu68 or pAAV2 / 9. The transgene cassette used was Petition 870260060647, dated 06 / 22 / 2026, p. 102 / 383 97 / 182 CB7.CI.ffLuciferase.RBG. Transfected cells were further cultured in 6-well plates. Total cell lysate, as well as supernatant, were collected for virus quantification via TaqMan (Applied Biosystems) analysis using probes and primers targeting the rabbit beta-globin polyA region of the transgene cassette as described in Gao et al. [Gao, Guangping, et al. Purification of recombinant adeno-associated virus vectors by column chromatography and its performance in vivo. Human gene therapy 11.15 (2000): 2079-2091.]. Yields of six pAAV2 / 9 and six pAAV2 / hu plasmids were compared. Sixty-eight plasmids were compared in a 6-well plate, head-to-head, in terms of supernatant titer and total lysate titer. Each plasmid was from an individual bacterial colony.

[00212] It was found that the yield of AAVhu68 was similar to that of AAV9 in terms of total lysate.However, in the supernatant, the yield of AAVhu68 was significantly higher than that of AAV9. Thus, AAVhu68 was shown to be a better vector compared to AAV9 in terms of production, since the supernatant is preferred for large-scale virus production. 3. In vivo transduction of AAVhu68.LacZ

[00213] AAVhu68.CB7.nLacZ (also referred to as AAVhu68.LacZ) was generated by inserting a sequence encoding the bacterial β-galactosidase located in the nucleus (nLacZ) as a transgene and then produced as described above. To evaluate the packaging efficiency, yield, transduction properties, transduction efficiency, and tropism of AAVhu68 in vivo, mice were injected with 5 x 1011 copies of the AAVhu68 LacZ vector genome via various administration methods, such as intravenous, intramuscular, and intranasal administration. Muscle, lung, liver, and heart were collected after sacrificing the mice two weeks after vector administration. Frozen sections of each organ were Petition 870260060647, dated 06 / 22 / 2026, page 103 / 383 98 / 182 prepared, processed and analyzed as a conventional protocol detecting the expression of the LacZ gene [Bell, Peter, et al. An optimized protocol for detection of E. coli β-galactosidase in lung tissue following gene transfer. Histochemistry and cell biology 124.1 (2005): 77-85.]. These results revealed that AAVhu68 demonstrated high transduction efficiency and a broad tissue / organ tropism. 4. In vivo transduction of AAVhu68.GFP compared to AAV9.GFP

[00214] AAVhu68.GFP and AAV9.GFP were generated by inserting a gene encoding green fluorescent protein (GFP) as a transgene and then produced as described above. To evaluate the packaging efficiency, yield, transduction properties, transduction efficiency, and tropism of AAVhu68 and AAV9 in vivo, mice were administered AAVhu68.GFP or AAV9.GFP at doses of 1x1010GC or 1x1011GC. Sections of various brain regions (hippocampus, motor cortex, and cerebellum) from mice with intracerebroventricular administration of the vectors were investigated. Transduction of the AAV vectors was observed in all hippocampal samples tested, except one from mice injected with 1x1010GC of AAV9.GFP. Improved transduction of AAVhu68.GFP compared to AAV9 was observed in the motor cortex. Furthermore, transduction of AAVhu68 in the cerebellum was also observed.GFP was observed when mice were injected with IxIO11GC vector alone. In these mice, AAVhu68 exhibited higher transduction efficiency and a broader tropism in the brain compared to AAV9.

[00215] In another experiment, several organs, such as liver, kidney, heart, and pancreas, from mice administered intravenously with AAVhu68.GFP were prepared and processed as described by Wang et al [Wang L, Calcedo R, Bell P, J Lin, Grant RL, Siegel DL, Wilson JM, Hum Gene Ther. 2011 Nov; 22(11):1389-401; Wang L, Calcedo Petition 870260060647, dated 06 / 22 / 2026, page 104 / 383 99 / 182 R, Wang H, Bell P, Grant R, Vandenberghe LH, Sanmiguel J, Morizono H, Batshaw ML, Wilson JM, Mol Ther. 2010 Jan; 18(1):126-34]. A strong positive signal was observed in the liver, while kidney, heart, and pancreas also demonstrated vector transduction, indicating a broad tissue / organ tropism of the AAVhu68 vector. Example 3 - Vectors AAV Containing hSMN

[00216] The AAVhu68.CB7.CI.hSMN1co.RBG consists of an outer component and an inner DNA genome. The outer component of the vector is a serotype hu68, T = 1 icosahedral capsid consisting of 60 copies of three viral AAV proteins, VP1, VP2, and VP3, in a ratio of approximately 1:1:8-10. The capsid contains a single-stranded DNA genome consisting of the human survival of a motor neuron (hSMN1) transgene flanked by two inverted terminal repeats of AAV (ITRs). An enhancer, promoter, intron, hSMN1 coding sequence, and polyadenylation signal (polyA) comprise the human SMN1 transgene. ITRs are the genetic elements responsible for genome replication and packaging during vector production and are the only cis-viral elements required to generate rAAV.The expression of the hSMN1 coding sequence is driven by a CB7 promoter, a hybrid between an immediate early enhancer (C4) of cytomegalovirus (CMV) and the chicken beta-actin promoter. Transcription of this promoter is enhanced by the presence of the beta-actin intron (CI). A rabbit beta-globin polyA signal is included to mediate the termination of human hSMN1 mRNA transcripts. A schematic of the AAVhu68.CB7.O vector genome CI.hSMN1co.RBG is shown in Figure 1A.

[00217] Description of Sequence Elements: 1. Inverted Terminal Repeats (ITRs): AAV ITRs (GenBank # NC001401) are identical sequences at both ends, but in opposite orientation. The AAV2 ITR sequences Petition 870260060647, dated 06 / 22 / 2026, p. 105 / 383 100 / 182 function both as the origin of vector DNA replication and as the vector genome packaging signal, when the auxiliary functions of AAV and adenovirus are provided in trans. As such, ITR sequences represent the only cis sequences required for vector genome replication and packaging. 2. Immediate CMV enhancer (382 bp, GenBank # K03104.1). 3. Chicken β-actin promoter (282 bp; GenBank # X00182.1) and is used to drive the expression of high-level human survival motor neuron 1 (hSMN1). 4. Chicken β-actin intron: The 973 bp intron of the chicken beta-actin gene (GenBank # X00182.1) is present in the vector expression cassette. The intron is transcribed but removed from the mature messenger RNA (mRNA) by splicing, joining the sequences on both sides of it. The presence of an intron in an expression cassette has been shown to facilitate mRNA transport from the nucleus to the cytoplasm, thus increasing the accumulation of stable mRNA levels for translation. This is a common feature in gene vectors intended to increase gene expression levels. 5. Encoding sequence: The hSMN1 sequence (www.ncbi.nlm.nih.gov / nuccore / NM_000344.3) was codon-optimized and synthesized (UPenn). Spinal muscular atrophy (SMA) is caused by mutations in the telomeric gene Survival of Motor Neuron 1 (SMN1). Mutations in SMN1 result in selective toxicity to lower motor neurons, leading to progressive neuronal loss and associated muscle weakness and degeneration. The transgene we are using is SMN1, isoform D. Isoform D encodes the longer isoform and this variant is believed to be the predominant transcriptase / isoform produced by SMN1 both in the CNS and ubiquitously. 6. Polyadenylation Sign: The polyadenylation sign of β Petition 870260060647, dated 06 / 22 / 2026, p. 106 / 383 Rabbit 101 / 182 globin (GenBank # V00882.1) provides cis sequences for efficient polyadenylation of antibody mRNA. This element functions as a signal for transcription termination, a specific cleavage event at the 3' end of the nascent transcript and addition of a long polyadenyl tail.

[00218] The vector was prepared using conventional triple transfection techniques in 293 cells as described [Mizukami, Hiroaki et al. A Protocol for AAV vector production and purification. Diss. Division of Genetic Therapeutics, Center for Molecular Medicine, 1998.]. All vectors were produced by the Vector Nucleus at the University of Pennsylvania as previously described [Lock, M., et al., Hum Gene Ther, 21: 1259-1271 (2010)].

[00219] A droplet digital polymerase chain reaction (ddPCR)-based technique was performed to determine the genome copy titer (GC) for AAV vectors as previously described (Lock, Martin, et al. Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR. Human gene therapy methods 25.2 (2013): 115-125). The method is practical, reports titers equivalent to or better than qPCR, and does not require a plasmid standard curve. The assay used involves digestion with DNase I, followed by digital PCR analysis to measure the encapsulated vector genetic copies. DNA detection was performed using specific primers for sequences targeting the polyA region in combination with a labeled fluorescent probe, hybridizing to that same region. Example 4 - AAVhu68.CB7.CI.hSMN.RBG in the SMA model

[00220] All animal procedures were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Pennsylvania. All mice were kept at the Animal Facility of the Laboratories of Petition 870260060647, dated 06 / 22 / 2026, page 107 / 383 102 / 182 Translational Research at the University of Pennsylvania.

[00221] In mice, there is an SMN gene that is equivalent to the human SMN1 (hSMN1). Complete loss of this gene results in an embryonic lethal phenotype (Monani UR, Sendtner M, Coovert DD et al. The human centromeric survival motor neuron (SMN2) gene rescues embryonic lethality in Smn (- / -) mice and results in a mouse with spinal muscular atrophy. Hum Mol Genet 2000; 9:333-9; Schrank B, Gotz R, Gunnersen JM et al. Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. One of the most common preclinical SMA models for evaluating therapy is the SMNΔ7 mouse model. The SMNΔ7 mouse model is a transgenic mouse developed on the FVB foundation that possesses 2 copies of human SMN2 (hSMN2) and 2 copies of hSMN2 with exon 7 removed. ^MNA7).Wild-type (WT) SMNΔ7 mice carry 2 copies of murine SMN (mSMN), heterozygous (HET) mice possess 1 copy of mSMN, and SMNΔ7 knockout (KO) mice have no copies of mSMN. SMNΔ7 KO mice have a mean lifespan of 13-15 days and exhibit reduced motor neuron counts in the spinal cord, reduced myofiber size, reduced weight, impaired righting and gait, and an increased number of partially uninnervated neuromuscular junctions. A major advantage of the SMNΔ7 mouse model is an increased treatment window compared to severe SMA models, with a mean lifespan of approximately 5 days, in addition to exhibiting a sufficiently severe phenotype to quickly discern whether therapeutic interventions are affecting disease attenuation. Please see Le TT, Pham LT, Butchbach ME et al. SMNDelta7, the. Petition 870260060647, dated 06 / 22 / 2026, page 108 / 383 103 / 182, the main product of the centromeric survival motor neuron (SMN2) gene, prolongs survival in mice with spinal muscular atrophy and is associated with full-length SMN. Hum Mol Genet 2005; 14: 845-57.

[00222] In example 4, mSMN- / hSMN2+ / +SMM7+ / +(KO SMNΔ7, also noted as SMNΔ7 in the following examples) mice were used. Immunohistochemistry for SMN demonstrated that in the cortex, cerebellum, and spinal cord, SMNΔ7 pups did not exhibit SMN1 expression (Figure 2). 23 days after injection of 3 x 1010GC of AAVhu68.CB7.CI.hSMN1, RBG vectors were observed at birth, SMNΔ7 pups, wild-type pups, and heterozygotes with increased SMN expression. Administration was performed by intracerebroventricular injection into the left lateral ventricle.

[00223] Viral transduction of the tested vector was further evaluated by in situ hybridization (ISH) to codon-optimized ribonucleic acid hSMN1 (RNA) in the cortex of AAVhu68.CB7.Animals treated with CI.hSMN1co.RBG. Wild-type and SMNΔ7 animals were provided as controls. The result shown in the lower panel of Figure 2 demonstrates a high transduction rate at the test dose.

[00224] An analysis to determine the percentage of motor neuron transduction via immunohistochemistry is performed. An additional analysis via western blot to detect SMN expression from brain and spinal cord homogenates is performed. Example 5 - AAVhu68.CB7.CI.hSMN1.RBG increases survival in a rodent model of SMA.

[00225] The efficacy of intracerebroventricular injection of AAVhu68.CB7.CI.hSMN1.A RBG was evaluated in newborn mSMN1 / -hSMN2+ / +SMNΔ7+ / +^MNΔ7), heterozygous littermates (HET) and wild-type C57BL / 6J pups (WT). The tested mice received a single intracerebroventricular (ICV) injection in Petition 870260060647, dated 06 / 22 / 2026, page 109 / 383 104 / 182 left lateral ventricle with 3 x 1010 or 8.76 x 1010GC of AAVhu68.CB7.CI.hSMN1co.RBG within 24 hours after birth with phosphate-buffered saline (PBS). Pups injected with PBS were served as controls (Figure 3A). Mice were monitored daily. All mice that met euthanasia criteria (20% weight loss by previous weighing or digital necrosis) or found dead before weaning were genotyped, and all mice that survived to weaning were genotyped.

[00226] During the two-month observation period, survival rates of wild-type, PBS-injected heterozygous pups, and vector-injected heterozygous pups were similar, indicating no toxicity related to the vector or route of administration (Figure 3A). No significant differences in the righting reflex were observed between PBS-treated WT animals and WT mice treated with 3x1010GC or ~9x1010GC of AAVhu68.CB7.CI.hSMN1co.RBG (Figure 3A). The median survival of SMNΔ7 pups injected only with PBS (n = 8) was 15 days. However, after treatment with a lower dose of the vector (3x1010GC / 1.5g pup), the median survival significantly increased to 37 days (n = 7). If the vector dose was increased to 8.76 x 1010GC per pup (n = 10), the median survival was 23 days (Figure 3B). This result indicated an intracerebroventricular injection of AAVhu68.CB7.CI.hSMN1.RBG with both doses at birth successfully improved the survival of SMNΔ7 pups while minimal toxicity was detected. Example 6 - AAVhu68.CB7.CI.hSMN1.RBG promotes growth in a rodent model of SMA.

[00227] Starting on postnatal day (PND) 3, the mice were weighed every 2 days until they met the criteria for euthanasia or Petition 870260060647, dated 06 / 22 / 2026, page 110 / 383 105 / 182 were found dead and the result was plotted in Figure 4A. The overall change in the variable at all times was compared between each pair of groups.

[00228] Wild-type and heterozygous offspring treated with PBS or the vectors at low and high doses showed a similar growth curve, indicating no toxicity related to the vector or route of administration. SMNΔ7 pups treated with PBS exhibited progressive weight loss and a median survival of 15 days. However, when injected with the AAVhu68.CB7.CI.hSMN1co.RBG vectors, pup body weights increased slowly but progressively after birth. On postnatal day 15 (P15), while wild-type pups from the three groups were comparable in weight, the vector-rescued SMNΔ7 pup was significantly heavier compared to the single PBS group (Figure 4B). On postnatal day 30 (P30), SMNΔ7 pups and wild-type / heterozygous littermates showed no difference in body weight between the high and low dose vector treatments (Figure 4C).

[00229] Further comparisons were performed using linear mixed-effects modeling in the R program (version 3.3.1; cran.r-project.org) using the lme function in the nlme package. Sex was included as a covariate in the analysis. The linear mixed-effects model accounts for the dependence of observations at different time points for each individual and is a preferred method for the analysis of time-course data. No significant differences in weight were observed between WT animals treated with PBS and WT mice treated with 3x1010GC or ~9x1010GC of AAVhu68.CB7.CI.hSMN1co.RBG (Figures 4D & 4E), indicating no toxicity related to the vector or route of administration. Compared to healthy littermates, SMNΔ7 pups Petition 870260060647, dated 06 / 22 / 2026, page 111 / 383 106 / 182 showed a slower rate of body weight growth (Figure 4F), while treatments with 3 x 1010GC / pup or 8.76 x 1010GC / pup of AAVhu68.CB7.CI.hSMN1co.RBG in SMNΔ7 pups significantly increased body weight gain (Figures 4I & 4J).

[00230] These results suggest that AAVhu68.CB7.CI.hSMN1co.RBG improved the growth of SMNΔ7 pups as indicated by body weights. Example 7 - Functional Assessments Reveal Positive Effects of AAVhu68.CB7.CI.hSMN1.RBG in a Rodent Model of SMA

[00231] Two functional assessments were performed, the Lower Ligament Suspension Test and the Righting Reflex Test, to evaluate the development and progression of SMA after treatment with the vector described in this document.

[00232] To assess proximal hindlimb muscle strength and fatigue in the neonatal mouse model of SMA, the protocol for the lower limb suspension test was adopted and optimized from the Behavioral Phenotype for Neonates: Upper Limb Suspension Test (SOP # SMA_M).2,2001 by TREAT-NMD (El-Khodor et al.). The hindlimb suspension score (HLS) and time spent in suspension (TSH) were included as parameters to measure hindlimb muscle strength and fatigue. The test was performed in 2 consecutive trials every 2 days after birth. Each trial lasted a maximum of 60 seconds. Both HLS and TSH were measured in the same study. The first 15 seconds were used to determine the HLS score. For TSH, the time continued to count until the animal fell or the time reached 60 seconds, whichever came first.Furthermore, litters of more than 10 animals were excluded from this study to avoid bias due to nutritional competition. Litters with fewer than 5 pups were also excluded. Petition 870260060647, dated 06 / 22 / 2026, p. 112 / 383 107 / 182 of this study, as increased maternal care could cause a milder phenotype and lead to study bias.

[00233] Instead of an increasing HLS score after growth observed in wild-type or heterozygous pups treated with PBS or vector, SMNΔ7 pups injected with PBS exhibited a decline in HLS score indicating impaired hind limb muscle strength (Figure 5B). However, with a single injection of AAVhu68.CB7.CI.hSMN1.RBG at a dose of 3 x 1010GC per pup, the HLS score remained stable during the development of SMNΔ7 pups. Furthermore, if the dose was increased to 8.76 x 1010GC per pup, a slight increase in HLS score was observed over time. These results indicated that the AAVhu68.CB7.CI.hSMN1.RBG vector improved the functional development of SMNΔ7 pups.

[00234] Time spent hanging (TSH) was recorded as described above and served as an indicator for latency drop, with no difference between SMNΔ7 pups and their healthy littermates. This result indicated that TSH did not reveal compromised muscle function in the SMNΔ7 model, and was therefore excluded from further evaluation.

[00235] To test locomotor skills and assess muscle strength in the neonatal mouse model of SMA, a Righting Reflex Test protocol, optimized from the Behavioral Phenotype for Neonates: Righting Reflex, SOP # MD_M.2,2.002 from TREAT-NMD (Didonato et al.), was adopted. It examined overall body strength, which could be affected by muscle weakness and / or general health problems, by measuring the mice's ability to correct body orientation when removed from the normal upright position. The animal was removed from its cage and placed in dorsal recumbency, so that all four paws were facing upwards. Petition 870260060647, dated 06 / 22 / 2026, page 113 / 383 108 / 182 A finger was placed on the chest to stabilize the animals in the inverted position. The finger was then removed and a timer was started. The timer stopped when the animal rolled onto its stomach and had all four paws flattened against the surface it was on. After each attempt, the animal was returned to its cage and allowed to rest for 5 minutes.

[00236] SMNΔ7 pups were tested every two days, from postnatal day 7 to postnatal day 17. Each attempt lasted a maximum of 60 seconds. The time an animal took to return to the normal position within this period was used to quantify muscle strength. If an animal failed to succeed within the allotted time, the trial was terminated and the time to succeed was recorded as 60 seconds.

[00237] Additionally, a litter of more than 10 animals was excluded from this study to avoid bias due to nutritional competition.Litters with fewer than 5 pups were excluded from this study, as increased maternal care could result in a milder phenotype and lead to study bias. When the righting reflex test was used in conjunction with the hind limb suspension test on the same day, it was always performed first to prevent the animal from becoming exhausted.

[00238] A more in-depth analysis was performed to provide detailed comparisons between groups and reduce the variation caused by gender. The overall change in the variable at all time points was compared between each pair of groups. Comparisons were performed using linear mixed-effects modeling in the R program (version 3.3.1; cran.r-project.org) using the lme function in the nlme package. Sex was included as a covariate in the analysis. The recorded time an animal took to return to the upright position was normalized by gender, and the data were plotted in Figures 6D to 6J. No significant differences were observed in the righting reflex between WT animals treated with PBS and WT mice treated with 3x1010 Petition 870260060647, dated 06 / 22 / 2026, page 114 / 383 109 / 182 GC or ~9x1010GC of AAVhu68.CB7.CI.hSMN1co.RBG (Figures 6D & 6E).

[00239] The result demonstrated that wild-type or heterozygous pups took a limited time to return to the upright position and this time period was reduced after growth, while SMNΔ7 pups were unable to correct their orientation during the determined time (Figure 6). With an injection of AAVhu68.CB7.CI.hSMN1.RBG at birth with 3 x 1010GC per pup or 8.76 x 1010GC per pup, the time spent correcting the position decreased significantly in SMNΔ7 pups and returned to the normal level indicated by wild-type and heterozygous pups on postnatal day 17, indicating that AAVhu68.CB7.CI.hSMN1.RBG successfully improves functional development in a rodent model of SMA.

[00240] Interestingly, in KOs, median survival and weight gain did not improve in a dose-dependent manner, while the righting reflex did improve in a dose-dependent manner. Based on these data, it is concluded that 3x1010GC and ~ 9x1010GC of AAVhu68. CB7.CI.hSMN1co.RBG are above the minimum effective dose (MED) in SMNΔ7 KOs.

[00241] In conclusion, a single intracerebroventricular injection of the AAVhu68.CB7.CI.hSMN1.RBG vector resulted in substantial motor neuron transduction and concomitant functional correction when administered intrathecally (intracerebroventricularly) in neonatal SMNΔ7 mice. Example 8 - Histological Analysis Reveals Positive Effects of AAVhu68.CB7.CI.hSMN1.RBG in a Rodent Model of SMA

[00242] A more in-depth study is conducted to evaluate the histological and morphological impairment of myofibers in the SMA model and recovery due to injection of AAVhu68.CB7.CI.hSMN1.RBG. Myofiber in the anterior tibial, quadriceps, diaphragm, intercostal, capillary Petition 870260060647, dated 06 / 22 / 2026, page 115 / 383 The 110 / 182 longissimus and tongue are revealed by hematoxylin and eosin staining and immunohistochemical staining for α-dystrophin. The cross-sectional area (CSA), fiber diameter, and percentage of centronucleated fibers (CNF) are used as parameters. For CSA determination, only round or polygonal shaped fibers are considered. Example 9 - Dose variation and transduction efficiency of AAVhu68.CB7.CI.hSMN1.RBG in wild-type and SMNΔ7 mice.

[00243] To determine the potential toxicity of the highest dose, the dose-dependent expression of AAVhu68.CB7.CI.hSMN1co.RBG, as well as to determine the minimum effective dose (MED) of AAVhu68.CB7.CI.hSMN1co.RBG in SMNΔ7 mice, whole litters produced from HET / HET mating were injected into the left lateral ventricle (intracerebroventricular) (ICV) within 24 hours of birth with phosphate-buffered saline (PBS), 1x10⁹GC, 3x10⁹GC, 1x10¹⁰GC, 3x10¹⁰GC or 7x10¹⁰GC of AAVhu68.CB7.CI.hSMN1co.RBG per mouse. Mice were monitored daily throughout the study. All mice that met the euthanasia criteria (15% weight loss by previous weighing or inability to nurse) were sacrificed. No mice found dead or sacrificed before Day 13 of the study were necropsied.

[00244] On study days 3, 5, 7, 9, 11, and 13, the mice were weighed. On Study Day 3, the mice were tattooed and genotyped. On study days 7 and 13, the mice underwent three rounds of righting reflex tests. On study day 9, litters were selected to maintain uniform litter size. Litters were culled to include all KOs and a corresponding number of HETs and WTs, so that litter size Petition 870260060647, dated 06 / 22 / 2026, page 116 / 383 111 / 182 litter size equals 4 animals. On day 13 of the study, the animals were euthanized and necropsied for analysis of motor neuron transduction and muscle fiber size.

[00245] All doses of AAVhu68.CB7.CI.hSMN1co.RBG were well tolerated in HET / WT and KO SMNΔ7 mice. The data in Figures 9A and 9B represent only 2 liters per dose; therefore, the significantly reduced weight in HET / WT animals treated with 1x10⁹GC was thought to be due to variability in dams and litter sizes (Figure 9B). Furthermore, the only KO enrolled in the 1x10⁹GC group had to be sacrificed due to a weight loss exceeding 15% on Study Day 9. Higher doses of AAVhu68.CB7.CI.hSMN1co.RBG did not alter weight gain in HET / WT animals and improved weight gain in KO animals compared to PBS-treated KO controls (Figures 9A and 9B). Based on these data, it can be concluded that 1x1010GC represents the MED of AAVhu68.CB7.CI.hSMN1co.RBG in SMNΔ7 mice.

[00246] For the righting reflex, on Study Day 7 there was appreciable variation among HET / WT animals in the various dose groups (Figure 10A). However, on Study Day 13, HET / WT animals in all dose groups had a mean righting time of ~1 second (Figure 10A). This variation on Study Day 7 is thought to be due to variability in dams and litter size. Similar to the weight monitoring data, at doses of 1x1010GC and above, AAVhu68.CB7.KO treated with CI.hSMN1co.RBG exhibited a significant improvement in righting time on Study Day 13 relative to PBS-treated KO controls (Figure 10B).

[00247] Therefore, based on in vivo measurements of weight monitoring and righting reflex, it was concluded that the current MED of AAVhu68.CB7.CI.hSMN1co.RBG in SMNΔ7 mice is 1x1010 Petition 870260060647, dated 06 / 22 / 2026, page 117 / 383 112 / 182 GC.

[00248] Histological measurements of motor neuron transduction and myofiber size are evaluated. Additional litters are recorded in the experiment described above in Example 9.

[00249] Furthermore, in the enrolled litters, no signs of acute toxicity related to any dose of the vector were observed, and during the 13-day study period, there were no signs of vector-related toxicity.

[00250] To better assess the potential toxicity and tolerability of AAVhu68.CB7.CI.hSMN1co.RBG in adult mice after ICV administration, adult male and female C57BL / 6J mice were injected intrathecally with AAVhu68.CB7.CI.hSMN1co.RBG. The total doses used in this study were equivalent to those used in the neonatal experiment described above, while the doses per gram of brain mass were twice as different due to the estimated brain mass of 0.4 g for an adult mouse, compared to an estimated brain mass of 0.2 g for a neonatal mouse. All doses were included in the Study Day 14 period, while only the vehicle and 7x1010GC were duplicated in the Study Day 28 period.

[00251] Weights were monitored on Study Days 0, 7, 14, 21, and 28, as applicable. Clinical chemistry was performed on serum collected at necropsy (Study Day 14 or Study Day 28, as applicable). Brain, spinal cord, heart, lungs, liver, spleen, kidneys, sciatic nerve, and quadriceps femoris were collected for microscopic histopathological evaluation. All parameters were compared with vehicle-treated animals.

[00252] Up to day 14 of the study, there was no morbidity or mortality in any group. All doses of AAVhu68.CB7.CI.hSMN1co.RBG had no impact on weight trajectory. Petition 870260060647, dated 06 / 22 / 2026, page 118 / 383 113 / 182 compared with the control treated with the same-sex vehicle (Figures 14A-14B).

[00253] A further study is conducted to evaluate the histological and morphological involvement of myofibers in the models described above in Example 9 and the recovery due to injection of AAVhu68.CB7.CI.hSMN1.RBG. Myofibers in the tibialis anterior, quadriceps, diaphragm, intercostal, longissimus capillary, and tongue are revealed by hematoxylin and eosin staining and immunohistochemical staining for α-dystrophin. Cross-sectional area (CSA), fiber diameter, and percentage of centronucleated fibers (CNF) are used as parameters. For CSA determination, only round or polygonal shaped fibers are considered. Example 10 - AAV Vectors containing hSMN1 in Rhesus Monkeys

[00254] The aim of this study was to evaluate different intrathecal routes of administration in rhesus monkeys to determine which route results in the most robust spinal cord motor neuron transduction, as well as to assess the pharmacokinetic profile and safety of the AAVhu68.CB7.CI.hSMN1co.RBG in Rhesus Monkeys. Rhesus monkeys were used in this study because their size and central nervous system anatomy serve as a much better approximation of humans than mice.

[00255] Fluoroscopic guidance and contrast material were used to confirm needle placement in the cisterna magna (ICM) or lumbar cistern (LP) in the intervertebral space between L4 and L5. The groups were 1.0 mL ICM (n = 3), 2.5 mL LP (n = 4), and 5.0 mL LP (n = 4). Each group contained animals with a range of neutralizing antibody (NAb) titers to AAV9 from undetectable to greater than 1:20. All groups received 3.3 x 10¹¹ GC / g of brain (3 x 10¹³ total GC) of AAVhu68.CB7.CI.hSMN1co.RBG. There was no vehicle control group included in this study. Petition 870260060647, dated 06 / 22 / 2026, p. 119 / 383 114 / 182

[00256] The animals were observed daily for abnormal behavior and signs of distress by dedicated personnel throughout the study. Clinical pathology was performed at baseline, on the day of AAVhu68.CB7.CI.hSMN1co.RBG administration (Study Day 0), Study Day 3, Study Day 7, and weekly after study completion. CSF chemistry and cytology were performed on Study Day 0, Study Day 7, and weekly thereafter until study completion. Animals were sacrificed and necropsied on Study Day 28 for histological evaluation of motor neuron transduction in the spinal cord, biodistribution, and preliminary histopathological assessment.

[00257] No animals exhibited abnormal behavior or signs of distress throughout the study. One animal (RA1871) had an increase in ALT level from 55 U / L to ~80 U / L between Study Day 0 and Study Day 21, although this did not correspond with any clinical signs (Figure 11B). No other animals exhibited trends toward increased ALT (Figure 11B), AST (Figure 11A), lymphocytes (Figure 11C), or monocytes (Figure 11D) after administration of AAVhu68.CB7.CI.hSMN1co.RBG.

[00258] There appeared to be no trend of altered protein or glucose in the CSF in any animal during the study (Figure 11E11H). On study day 28, 1 animal (RA1327) had 17 white blood cells^L in the CSF (Figure 11E). On macroscopic examination, the CSF did not appear to have blood contamination but contained 250 red blood cells^L. It is unclear whether this was true pleocytosis or an impure CSF tap. CSF cytology from previous intrathecal studies showed a gradual increase in white blood cell count in the CSF from one to two digits over weeks (data not shown), leading to the conclusion that this single occurrence of 17 white blood cells^L on study day 28 (from 0 white blood cells^L on study day 21) likely occurred due to an immune tap of the CSF. Petition 870260060647, dated 06 / 22 / 2026, p. 120 / 383 115 / 182 as opposed to true pleocytosis.

[00259] At necropsy, each spinal cord was divided into cervical, thoracic, and lumbar sections. Each level of the spinal cord was subsequently divided into 4 parts. 1 piece was frozen for biodistribution, 1 piece was placed in formalin for histopathological evaluation, and the remaining 2 pieces were placed in formalin for motor neuron transduction evaluation.

[00260] Motor neuron transduction was measured by ISH (3 slides / spinal cord level piece / animal equal to 6 slides / spinal cord level / animal) for hSMN1 ribonucleic acid (RNA) and IHC (2 slides / spinal cord level piece / animal equal to 4 slides / spinal cord level / animal) for hSMN1 protein. Motor neurons were labeled with a Nissl stain to determine the percentage of motor neurons transduced. ICM administration of AAVhu68.CB7.CI.hSMN1co.RBG resulted in significantly greater motor neuron transduction than LP administration of AAVhu68.CB7.CI.hSMN1co.RBG as measured by ISH and IHC at all spinal cord levels (Figures 12A & 12B). There was agreement on transduction efficiency between ISH and IHC within each group, although the percentage of motor neurons transduced was higher when measured by IHC (Figures 12A and 12B).While cross-reactivity of the antibody with rhesus SMN protein can occur, the RNA probe used for ISH was specific for codon-optimized hSMN1 RNA produced from AAVhu68.CB7.CI.hSMN1co.RBG, which eliminated the possibility of cross-reactivity with rhesus SMN RNA. According to the published data, the percentage of transduced motor neurons increased in a caudal-to-rostral (cervical to lumbar) pattern in all groups (Hinderer C, Bell P, Vite CH et al. Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna. Molecular. Petition 870260060647, dated 06 / 22 / 2026, page 121 / 383 116 / 182 therapy Methods & clinical development 2014;1:14051) (Figures 12A & 12B).

[00261] Intrathecal delivery of AAVs can be performed using a variety of routes to access the CSF. Lumbar puncture is the most common method for accessing the CSF and has therefore been evaluated as a route of AAV administration in non-human primates. Notably, delivery of an AAV9 vector into the CSF via lumbar puncture has been shown to be at least 10 times less efficient in transducing brain and spinal cord cells compared to injecting the vector more superiorly at the level of the cisterna magna [Hinderer C, et al. (2014) Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna. Mol Ther Methods Clin Dev 1: 14051]. This finding was confirmed in an NHP study using the AAVhu68-SMN1 vector.Adult rhesus monkeys injected with the clinical candidate vector via suboccipital puncture into the cisterna magna (n = 3) exhibited motor neuron transduction at all spinal cord levels, as shown by in situ hybridization (ISH) for transgene mRNA and immunohistochemical staining (IHC) for human SMN protein. In contrast, animals receiving vector injection via lumbar puncture showed substantially lower transduction at all spinal cord levels, even when the injection volume was increased to 5 mL – approximately 40% of the animal's CSF volume – to promote rostral distribution. This study illustrated the need to deliver the vector at the cisterna magna level and supported the selection of suboccipital puncture as the clinical route of administration.

[00262] Biodistribution was performed in selected tissues from the study to determine transduction following different intrathecal administration routes. Substantial differences in brain and spinal cord transduction after administration of MCI and LP vector in Petition 870260060647, dated 06 / 22 / 2026, page 122 / 383 117 / 182 previous studies may be due to the low volume used for LP (Hinderer C, Bell P, Vite CH et al. Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna. Molecular therapy Methods & clinical development 2014;1:14051). In the present study, brain and spinal cord transduction was equivalent after ICA and LP administration of AAVhu68.CB7.CI.hSMN1co.RBG (Figure 13).

[00263] Interestingly, NAbs appear to have an impact on peripheral organ transduction. In each group, the animal with NAbs greater than 1:20 had the lowest transduction in the heart, liver, and spleen (Figure 13).

[00264] Preliminary histopathological evaluation was performed on the brain, spinal cord, dorsal root ganglia (DRG), sciatic nerve, and liver. In the brain, the main findings were minimal to mild mononuclear cell infiltration and gliosis. These findings were equally distributed across all groups. In the spinal cord, the findings were primarily present in the ICM group, with an increased frequency of findings in the lumbar spinal cord. The most common findings were minimal to mild axonal degeneration in the dorsal funiculi and minimal to mild mononuclear and histiocytic cell infiltration. In cervical, thoracic, and lumbar DRG, the primary findings were minimal to mild mononuclear cell infiltration, minimal to mild neuronal vacuolization, and minimal to moderate axonal degeneration. These findings were present at a higher prevalence in the ICM group compared to the two LP groups.

[00265] In the sciatic nerve, there was minimal to moderate axonal degeneration and minimal macrophage infiltration. These findings were mainly present in the ICM group. In the liver, there was minimal to mild mononuclear cell infiltration and minimal microgranulomas in all groups. Petition 870260060647, dated 06 / 22 / 2026, page 123 / 383 118 / 182

[00266] In addition, adrenal gland, ascending aorta, bone marrow, brain, cecum, cervix, epididymis, esophagus, eye, gallbladder, heart, kidney, large intestine, lung, lacrimal gland, lymph node, muscle, ovaries, pancreas, prostate, rectum, salivary gland, seminal vesicle, skin, small intestine, spinal cord, spleen, stomach, testes, urinary bladder, uterus, pituitary gland, thymus, thyroid gland, trachea, vagina, and gross lesions (if any) were collected for histopathological analysis. Tissues are stained with hematoxylin and eosin (H&E) and / or other immunohistochemical stains to identify / clarify histological features. Example 11 - Toxicity and Biodistribution Studies of AAV Vectors Containing hSMN1 in Rhesus Monkeys

[00267] A 180-day GLP study is conducted in rhesus monkeys to investigate the pharmacology and toxicology of AAVhu68.CB7.CI.hSMN1co.RBG following ICM administration. Rhesus monkeys receive one of three doses, 1.85x10¹⁰GC / g brain, 5.56x10¹⁰GC / g brain, or 1.85x10¹¹GC / g brain (n=3 / group / time point – both sexes) or vehicle (Elliot Buffer Formulation, EFB) (n=1 / group / time point – either sex). Baseline clinical pathology (cell counts with differentials, clinical chemistry, and coagulation panel), CSF chemistry, and CSF cytology are performed. After AAVhu68.CB7.CI.hSMN1co.RBG or vehicle administration, animals are monitored daily for signs of distress and abnormal behavior. Clinical pathology is performed weekly following AAVhu68.CB7.CI.hSMN1co.RBG or vehicle administration. Cerebrospinal fluid (CSF) chemistry and cytology are performed weekly for the first 30 days after AAVhu68.CB7.CI.hSMN1co.RBG or vehicle administration and monthly thereafter. At baseline and subsequently monthly, neutralizing antibodies to AAVhu68 and lymphocyte responses. Petition 870260060647, dated 06 / 22 / 2026, page 124 / 383 119 / 182 Cytotoxic T lymphocytes (CTLs) such as AAVhu68 and the hSMNI transgene are evaluated by the IFN-γ ELISPOT assay.

[00268] 14 days, 90 days, and 180 days after AAVhu68.CB7.CI.hSMN1co.RBG or vehicle administration, animals are euthanized and tissues are collected for comprehensive microscopic histopathological examination. The histopathological examination is particularly focused on central nervous system tissues (brain, spinal cord, and dorsal root ganglia), as these are the most strongly transduced after intrathecal administration of AAVhu68.CB7.CI.hSMN1co.RBG. In addition, lymphocytes are collected from the liver, spleen, and bone marrow to examine for the presence of CTLs in these organs at the time of necropsy.

[00269] A GLP toxicology study conducted using ICM administration of AAVhu68.CB7.CI.hSMN1co.RBG in 30 non-human primates identified transient neurological deficits in 1 / 30 animals after vector administration, which was attributed to direct brainstem puncture during the procedure caused by spontaneous animal movement under anesthesia. There were no other clinical adverse events in this study during the 180-day follow-up period, and standardized neurological examinations performed throughout the study did not identify abnormalities. Histopathology revealed dose-dependent sensory neuronal axonopathy that was not associated with clinical sequelae. Quantification of spinal motor neuron transduction indicated that a dose of X GC achieved transduction of X% of spinal motor neurons, a level of transduction that was associated with improved motor function in the SMNΔ7 mouse model.Therefore, this dose was selected as MED (update with final toxicity results).

[00270] In a non-clinical study in juvenile rhesus monkeys, intravenous administration of AAVhu68.CB7.CI.hSMN1co.RBG to a Petition 870260060647, dated 06 / 22 / 2026, page 125 / 383 An extremely high dose (2 x 10¹⁴GC / kg) of 120 / 182 resulted in acute liver toxicity in 3 / 3 animals, with one animal requiring euthanasia 5 days after vector administration. Similar toxicity was not observed in 9 adult and 5 juvenile rhesus monkeys treated by intrathecal injection at doses up to 3 x 10¹³GC, the highest dose evaluated using this route of administration, or in the 27 adult rhesus monkeys treated with AAVhu68.CB7.CI.hSMN1co.RBG by ICM injection in the GLP toxicology study. Example 12 - Clinical Study A. Newborns

[00271] A first human trial is initiated corresponding to the MED dose of 5x10¹⁰GC / g of brain mass, which translates to ~5x10¹³GC total for a human and is 3 times below the low dose proposed for the toxicology study shown in Example 11 but still 3 times below the high dose (Dekaban AS. Changes in brain weights during the human lifespan: relationship of brain weights to body heights and weights. Ann Neurol 1978; 4: 34556.). The maximum dose to administer in the first human trial should be equivalent to the highest dose in the toxicology study described in Example 11, 1.85x10¹¹GC / g brain, corresponding to 1.85x10¹⁴GC total.

[00272] To determine the safety of 2 doses of AAVhu68.CB7.CI.hSMN1co.RBG in participants with DNA-verified vertebral muscular atrophy (SMA), two different single-dose administrations of the aforementioned AAV vector in a suitable pharmaceutical carrier / solution are investigated.

[00273] Subsequent development includes expanded population groups and doses to establish an effective dose.

[00274] The main objective is to evaluate any study-related toxicity, grade III or higher, related to the treatment. Petition 870260060647, dated 06 / 22 / 2026, page 126 / 383 121 / 182

[00275] Secondary Objectives include: • Incidence of adverse events (AEs) and / or serious adverse events (SAEs) • Assessment of achievement of developmental motor milestones from the Hammersmith Infant Neurological Examination (HINE) • Change from baseline in the motor function scale of the Children's Hospital of Philadelphia Infant Neuromuscular Disorders Test (CHOP-INTEND) • Percentage of participants who develop clinically manifested spinal muscular atrophy • Percentage of participants alive at noted time points • Change from baseline in physical measurements: Weight for age / length; head, chest, and arm circumference; head-to-chest circumference ratio • Change from baseline in vital signs at rest: Pulse, blood pressure, respiration, temperature, pulse oximetry, and transcutaneous carbon dioxide • Changes from baseline in clinical laboratory parameters:

[00276] Evaluated by the following laboratory tests: Hematology: red blood cells, hemoglobin, hematocrit, platelets, white blood cells, blood chemistry: total proteins, albumin, creatinine, cystatin C, creatine phosphokinase, blood urea nitrogen, total bilirubin (direct and indirect), alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, glucose, calcium, phosphorus, chloride, sodium, potassium. Urinalysis: specific gravity, pH, protein, glucose, ketones, bilirubin, red blood cells, white blood cells, epithelial cells, bacteria, casts, crystals • Alteration in the baseline of the muscle action potential Petition 870260060647, dated 06 / 22 / 2026, page 127 / 383 122 / 182 ulnar compound (CMAP) • Cerebrospinal fluid (CSF) and plasma concentrations of SMN protein

[00277] The target population is infants <6 weeks of age with pre-symptomatic, genetically documented SMA and 2 copies of the survival motor neuron 2 (SMN2) gene.

[00278] The inclusion criteria are listed below. 1. Age at birth: <6 weeks, with a gestational age of 37 to 42 weeks for single births; gestational age of 34 to 42 weeks for twins. 2. Presymptomatic SMA with genetic documentation of homozygous deletion of the motor neuron 1 (SMN1) gene or mutation or compound heterozygous mutation. 3. Genetic documentation of 2 copies of survival motor neuron 2 (SMN2). 4. Post-procedure follow-up with a neurologist experienced in SMA studies.

[00279] The exclusion criteria are listed below. 1. Treatment with any drug, biological agent, or device marketed or under investigation administered for SMA, including a history of gene therapy, prior treatment with antisense oligonucleotides (ASOs), or cell transplantation. 2. Any clinical signs or symptoms at screening or immediately before the first dose (Day 1) that, in the Investigator's opinion, are strongly suggestive of SMA. 3. Abnormal laboratory values ​​considered clinically significant (GGT > 3XULN, bilirubin > [X] mg / dL, creatinine > [Y] mg / dL, Hgb < [Z] or > [A] g / dL; WBC > [B] per cm³) 4. Main medical condition 5. Concomitant disease that, in the investigator's opinion, creates Petition 870260060647, dated 06 / 22 / 2026, page 128 / 383 123 / 182 unnecessary risks for gene transfer 6. The family does not wish to disclose the patient's participation in the study to the primary care physician and other medical service providers.

[00280] Two doses of the AAV vector are tested, with each dosage group to include 6 participants. • Cohort 1: Low dose: 3 x 1013GC • Cohort 2: High dose: 1 x 1014GC

[00281] Six participants are enrolled in the low-dose cohort (3 x 1013GC). Participant dosing is done serially, with a four-week safety observation period between each participant's enrollment. Safety is assessed by an Internal Safety Committee (ISC). If no safety review test (SRT) is observed, 4 weeks after the sixth participant's dosing in the low-dose cohort, all available safety data will be evaluated by an Independent Data Monitoring Committee (IDMC) before proceeding to enrollment in the high-dose cohort 2.

[00282] In one embodiment, a syringe containing 5.6 mL of the vector at the appropriate concentration will be distributed in the procedure room. The following personnel are present for the administration of the study drug: interventionalist performing the procedure; anesthesiologist and respiratory technician(s); nurses and medical assistants; CT (or operating room) technicians; neurophysiology technician; site research coordinator.

[00283] Before administering the study drug, a lumbar puncture is performed to remove a predetermined volume of CSF, and then iodinated contrast is injected intrathecally (IC) to aid in visualizing the relevant anatomy of the cisterna magna. Intravenous (IV) contrast may be administered before or during needle insertion as an alternative to intrathecal contrast. The decision to use Petition 870260060647, dated 06 / 22 / 2026, page 129 / 383 124 / 182 Contrast IV or IC is at the interventionalist's discretion. The patient is anesthetized, intubated, and positioned on the procedure table. Intraoperative neurophysiological monitoring (IONM) equipment is connected to the participant. The injection site is prepared and covered using sterile technique. A spinal needle (22-25 G) is advanced into the cisterna magna under fluoroscopic guidance. A larger introducer needle may be used to assist in needle placement. After confirmation of needle placement, the extension set is attached to the spinal needle and allowed to fill with the patient's CSF. At the interventionalist's discretion, a syringe containing contrast material may be connected to the extension set and a small amount injected to confirm needle placement in the cisterna magna. After needle placement is confirmed by CT guidance + / - contrast injection, a syringe containing 5.6 mL of GTP-201 is connected to the extension set.The contents of the syringe are slowly injected over 1-2 minutes, delivering a volume of 5.0 mL. The needle is then slowly removed from the patient.

[00284] After administration of the study medication, participants are transported to an appropriate post-anesthesia care unit, in accordance with institutional guidelines. After the participant has adequately regained consciousness and is in a stable condition, he / she is admitted to the appropriate unit for clinical monitoring as required by protocol. Vital signs and neurological function are monitored frequently, including assessments every 15 minutes for 3 hours and then every hour during the 24-hour period immediately following the procedure. After the initial 24-hour period after the procedure, assessments are performed daily for two days, after which participants are discharged and return weekly for 4 weeks, then every 4 weeks for two additional visits, followed by the primary endpoint assessment visit. Petition 870260060647, dated 06 / 22 / 2026, page 130 / 383 125 / 182 week 24.

[00285] Blood is collected for safety testing and participants are clinically evaluated. Participants undergo a lumbar puncture to collect CSF in order to monitor signs of inflammation and measure biomarkers at the time of administration, weeks 4, 12, and 24. During the follow-up period, participants are evaluated every three months until 1 year after the procedure. Participants are followed by annual visits for a total of 5 years. At 3 and 6 months after vector administration, participants undergo a repeat magnetic resonance imaging (MRI) scan and CSF scan.

[00286] Evidence of CNS inflammation following AAV vector administration is assessed in CSF samples using standard techniques, including nucleated cell count and differential and total protein. Exploratory measures of treatment-associated inflammation include multiplex cytokine analysis of CSF for inflammatory markers.

[00287] To validate CSF SMN protein levels as a biomarker for successful transduction of the hSMN1 AAV vector, the assay is under development for the phase 1 / 2 intervention study.

[00288] The Compound Muscle Action Potential (CMAP) represents the electrophysiological output of a muscle after supramaximal stimulation of a peripheral nerve and serves as an objective and highly sensitive indicator of motor neuron health (García A, Calleja J, Antolín FM, Berciano J. Peripheral motor and sensory nerve conduction studies in normal infants and children. Clin Neurophysiol 2000; 111:513-20). In particular, natural history studies among patients with Type I SMA demonstrate that CMAP amplitude is abnormally low and does not improve after the onset of symptoms (Finkel RS, McDermott MP, Kaufmann P et al. Observational study of spinal muscular atrophy type I). Petition 870260060647, dated 06 / 22 / 2026, page 131 / 383 126 / 182 and implications for clinical trials. Neurology 2014;83:810-7; Swoboda KJ, Prior TW, Scott CB et al. Natural history of denervation in SMA: relation to age, SMN2 copy number, and function. Ann Neurol 2005; 57: 704-12 and Finkel RS. Electrophysiological and motor function scale association in a pre-symptomatic infant with spinal muscular atrophy type I. Neuromuscul Disord 2013;23:112-5). Furthermore, a study of SMA in a pig knockout model, which exhibits electrophysiological findings similar to SMA patients, showed that early restoration of SMN in presymptomatic animals resulted in the correction of CMAP (Duque SI, Arnold WD, Odermatt et al. A large animal model of spinal muscular atrophy and correction of phenotype. Ann Neurol 2015;77:399-414). For the reasons mentioned above, CMAP is being investigated as an exploratory biomarker.

[00289] Events that qualify for the study stopping criteria include: • Any death that is possibly, probably, or definitely related to the product under investigation • Elevated liver function test: • ALT or AST 3 times higher than the upper limit of normal • Associated elevation of total serum bilirubin (in the age range of this study, defined as a level of • More than one participant presents a Grade 3 or higher AE that is possibly, probably, or definitely related to the investigational product or injection procedure • Hemorrhage, stroke, or acute paralysis of the central nervous system that is possibly, probably, or definitely related to the investigational product or injection procedure.

[00290] Abnormal liver function is defined as any increase in alanine aminotransferase (ALT) or aspartate. Petition 870260060647, dated 06 / 22 / 2026, page 132 / 383 127 / 182 aminotransferase (AST) exceeding 3 times the upper limit of normal (ULN). Concurrent findings are those derived from a single blood collection or from separate blood samples collected within 8 days of each other. Investigations and follow-up inquiries are promptly initiated by the site of investigation to determine if the results are reproducible and / or if there is objective evidence clearly supporting causation by a disease (e.g., cholelithiasis and bile duct obstruction with distended gallbladder) or an agent other than the agent under investigation. B. Adults

[00291] This open-label, dose-escalation, phase 1 / 2 clinical trial evaluates the safety of a single administration of AAVhu68.SMA in adults with genetically confirmed 5q SMA and a clinical history of Type 3 SMA. This study enrolls non-ambulatory and ambulatory patients. Subjects receive a single dose of AAVhu68.SMA via ICM (intracisterna magna) injection. Cohort 1 (n=3, low dose, 3 x 10¹³GC) or Cohort 2 (n=6; high dose, 1 x 10¹⁴GC). The two doses evaluated in this study were selected based on non-clinical pharmacology and toxicology studies. Both doses to be evaluated in this study were well tolerated in non-human primates and achieved sufficient spinal cord motor neuron SMN expression levels to improve motor deficits in a murine disease model and are therefore expected to be safe in humans. Furthermore, the doses have the potential to offer a benefit to the study participants.The first three eligible individuals will be enrolled in Cohort 1. After each individual is administered, there is a four-week observation period during which the internal safety committee reviews safety data before administering the next individual. If no triggers for review are observed... Petition 870260060647, dated 06 / 22 / 2026, page 133 / 383 If no safety test results (SRTs) are observed within the four-week observation period for the third participant in Cohort 1, all available safety data will be evaluated by a Data Safety Monitoring Board (DSMB) before proceeding to enrollment in Cohort 2. If no safety test results are observed, four weeks after administration to the third participant in Cohort 2, all available safety data will be evaluated by a DSMB before proceeding to enrollment of the remaining three patients in Cohort 2.

[00292] Individuals are screened from days -35 to -1 prior to dosing. Those who meet the screening criteria are admitted to the hospital on the day of injection (day 1). After receiving an ICM injection of AAVhu68.CB7.CI.hSMN1co.rBG, individuals are monitored as inpatients for 2 days. A site visit, outpatient follow-up, and telephone assessments occur as specified time points for the remainder of the 52-week primary assessment period.

[00293] The safety and tolerability of AAVhu68.CB7.CI.hSMN1co.rBG are evaluated based on the incidence of AEs and SAEs, clinical and laboratory assessments, physical examination, and vital signs. The immunogenicity of the vector product and transgene is also evaluated.

[00294] Efficacy assessments include 6MWT, 10-meter walk time, RULM score, 4-step test, 9-pin-and-hole test, pulmonary function measures, PedsQL (fatigue scale), SMAFRS (functional scale), and ulnar and peroneal CMAP amplitude. SMN protein concentration and other exploratory biomarkers are assessed in the CSF.

[00295] Inclusion Criteria • Be male or female >18 years of age. • Genetic documentation of gene deletion or mutation Petition 870260060647, dated 06 / 22 / 2026, page 134 / 383 129 / 182 homozygous 5q SMA or compound heterozygous mutation and at least 2 copies of SMN2 in the screening. • Clinical history of SMA type 3. • Be willing and able to provide written and signed informed consent • Assessment by the internal team of neurointerventionalists and principal investigator at the site that the individual's anatomical and physical status would not preclude administration of the investigational product.

[00296] Non-ambulatory individuals • Unable to walk >15 feet without assistance. • RULM score of 5 to 30 in the screening. Ambulatory Individuals • Ambulatory (Able to walk > 15 feet without assistance). • Capable of safely delivering 6MWT with a 6MW distance not exceeding 530m.

[00297] Exclusion Criteria • Having a contraindication for an ICM injection. • Having any contraindication to lumbar puncture. • Have received treatment with any commercial or research drug or biological agent for SMA, including a history of gene therapy, prior treatment with ASO, or cell transplantation (OR). Have participated in any other drug or therapy research study in the three months prior to screening. • Respiratory failure, defined by the medical need for invasive or non-invasive ventilation for > 8 hours during a 24-hour period at screening. • A concomitant disease that, according to the researcher, would interfere with the conduct and evaluations of the study or create unnecessary risks for gene transfer. • Having an abnormal coagulation status (time of Petition 870260060647, dated 06 / 22 / 2026, pp. 135 / 383 130 / 182 prothrombin (PT) >1.5 x normal, partial thromboplastin time (aPTT) > 1.5 x normal. • Having thrombocytopenia (e.g., platelet count <150) • Having liver abnormalities (bilirubin > 1.5x ULN, ALT, AST, and alkaline phosphatase > 2.0x ULN). • Having uncontrolled hypertension (systolic blood pressure [SBP] > 180 mmHg, diastolic blood pressure [DBP] > 100 mmHg). • To have a clinically significant ECG abnormality that, in the investigator's opinion, would compromise the individual's safety. • History of solid organ transplantation or chronic immunosuppression. • Having a serious or unstable medical or psychological condition that, in the investigator's opinion, compromises the individual's safety or successful participation in the study or interpretation of the study results. • Use of medications intended for the treatment of SMA, including riluzole, valproic acid, hydroxyurea, sodium phenylbutyrate, butyrate derivatives, creatine, carnitine, growth hormone, anabolic steroids, probenecid, oral or parenteral use of corticosteroids at admission, agents expected to increase or decrease muscle strength, or agents with known or presumed inhibition of histone deacetylase (HDAC), in the 30 days prior to screening. Individuals using a nebulizer or requiring a steroid inhaler are permitted in the study; however, oral use of steroids is prohibited. Oral use of salbutamol is permitted with the following restrictions: individuals should have been on salbutamol for at least 6 months prior to inclusion in the trial, with good tolerance. The salbutamol dose must remain constant for the duration of the trial. Petition 870260060647, dated 06 / 22 / 2026, page 136 / 383 131 / 182 The use of inhaled beta-agonists (for the treatment of asthma attacks, for example) is permitted. Primary Study Parameters

[00298] The primary parameters of this study are the safety and tolerability of AAVhu68.CB7.CI.hSMN1co.rBG over 52 weeks. These parameters will be assessed based on the frequency of AEs and SAEs, and any changes in vital signs, physical examination, or clinical laboratory assessments considered clinically significant over 52 weeks after administration of the study drug. Secondary study parameters • To evaluate the impact of AAVhu68.CB7.CI.hSMN1co.rBG on motor function as measured by non-ambulatory RULM subjects • RULM scores will be compared to baseline scores up to 52 weeks after administration of the study drug. • To evaluate the impact of AAVhu68.CB7.CI.hSMN1co.rBG on motor function as measured by the 6MWT and 10-meter walk tests in ambulatory subjects. • Walking time in the 6MWT and 10-meter tests will be compared to baseline values ​​up to 52 weeks after drug administration in the study.

[00299] Exploratory Parameters • To evaluate the impact of AAVhu68.CB7.CI.hSMN1co.rBG on motor function as measured by the 9-pin and hole test (ambulatory and non-ambulatory) and the 4-step climb test (ambulatory only) • The 9-pin and hole test and the 4-step climb test will be compared to baseline up to 52 weeks after drug administration. • Evaluate the impact of the product on pulmonary function as measured by forced vital capacity (FVC), maximum expiratory pressure (MEP), Petition 870260060647, dated 06 / 22 / 2026, page 137 / 383 132 / 182 maximum inspiratory pressure (MIP) • Change in baseline in ulnar and peroneal CMAP amplitude • PedQLV multidimensional fatigue scale Version 3.0, adult reporting module • SMA-FRS (functional rating scale) • Vector pharmacokinetics in DNA and other drug components based on AAV in CSF, serum, and urine Example 13 - Manufacturing

[00300] An AAVhu68.O SMN vector produced by triple plasmid transfection of human HEK293 cells with: 1) the vector genome plasmid, 2) an AAV helper plasmid named pAAVhu68.KanR containing the wild-type (WT) AAV rep2 and cap hu68 genes, and 3) an adenovirus helper plasmid named pAdΔF6(Kan). The size of the packaged AAVhu68.CB7.O vector genome CI.hSMN1co.rBG is 3257 bp. 1. AAV Vector Genome Plasmids: pENN.AAV.CB7.CI.hSMNco.rBG.KanR (p4342)

[00301] The AAV-hSMN1 vector genome plasmid pENN.AAV.CB7.CI.hSMN1co.rBG (p3246) is 6077 bp in size. The vector genome derived from this plasmid is a single-stranded DNA genome with AAV2-derived ITRs flanking the hSMN1 expression cassette. Transgene cassette expression is driven by a CB7 promoter, a hybrid between an immediate early CMV enhancer (C4) and the chicken beta-actin promoter, while transcription of this promoter is increased by the presence of CI. The polyA signal for the expression cassette is polyA rBG. The plasmid was constructed by codon optimization and synthesizing the hSMN1 sequence (GeneArt), and the resulting construct was cloned into the pENN.AAV.CB7.CI.rBG (p1044) plasmid, a flanking expression cassette. Petition 870260060647, dated 06 / 22 / 2026, pp. 138 / 383 133 / 182 by ITR AAV2 containing CB7, CI, and rBG expression elements to give pAAV.CB7.CI.hSMN1co.rBG (p3246). The KanR plasmid is pENN.AAV.CB7.CI.hSMN1co.rBG.KanR (p4342). P4342 was constructed by exchanging the ampicillin-resistant mainframe in pAAV.CB7.CI.hSMN1co.rBG (p3246) with the kanamycin-resistant mainframe of pENN.AAV.TBG.PI.hLDLr.rBG.KanR (p2017) at two PacI sites. Description of Sequence Elements: • ITR: AAV ITRs (GenBank # NC001401) are identical sequences at both ends, but in opposite orientation. AAV2 ITR sequences function both as the origin of vector DNA replication and as the vector genome packaging signal, when the auxiliary functions of AAV and adenovirus are provided in trans. As such, ITR sequences represent the only cis sequences necessary for vector genome replication and packaging. • Immediate CMV enhancer (382 bp, GenBank # K03104.1). • The chicken β-actin promoter (282 bp; GenBank # X00182.1) is used to drive high-level hSMN1 expression. • Chicken beta-actin intron: The 973 bp intron of the chicken beta-actin gene (GenBank # X00182.1) is present in the vector expression cassette. The intron is transcribed but removed from the mature messenger RNA (mRNA) by splicing, joining the sequences on both sides of it. The presence of an intron in an expression cassette has been shown to facilitate mRNA transport from the nucleus to the cytoplasm, thus increasing the accumulation of stable levels of mRNA for translation. • Encoding sequence: the hSMN1 sequence: Petition 870260060647, dated 06 / 22 / 2026, p. 139 / 383 134 / 182 (www.ncbi.nlm.nih.gov / nuccore / NM_000344.3) was codon-optimized and synthesized. SMA is caused by mutations in the telomeric gene SMN1. Mutations in SMN1 result in selective toxicity to lower motor neurons, leading to progressive neuronal loss and associated muscle weakness and degeneration. The transgene is SMN1, isoform D. Isoform D encodes the longer isoform and this variant is believed to be the predominant transcriptase / isoform produced by SMN1 both in the CNS and ubiquitously. • Polyadenylation Signal: The rabbit betaglobin 127 bp polyadenylation signal (GenBank # V00882.1) provides cis sequences for efficient polyadenylation of antibody mRNA. This element functions as a signal for transcription termination, a specific cleavage event at the 3' end of the nascent transcript and addition of a long polyadenyl tail. 2. AAVhu68 auxiliary plasmid: pAAV2 / hu68n.KanR (p0068)

[00302] The AAV2 / hu68 pAAV2 / hu.68 helper plasmid (Lot # p0065; 7329 bp) is an AAV helper plasmid encoding the 4-WT AAV2 rep proteins and the 3-WT AAV VP capsid proteins of the hu68 AAV serotype. A novel AAV sequence was obtained from human cardiac tissue DNA and designated AAV serotype hu68. To create the chimeric packaging construct, the AAV2 cap gene of the pAAV2 / 9n plasmid (p0061-2), containing the wild-type AAV2 rep and AAV9 cap genes, was removed and replaced with the pAAV2 / hu68 plasmid fragment of the AAVhu68 cap gene (p0065). The AAV p5 promoter that normally drives rep expression is moved in this construct from the 5' end of rep to the 3' end of the cap. This arrangement serves to introduce a spacer between the promoter and the rep gene (i.e., the plasmid structure), downregulates rep expression, and increases the ability to support vector production.The main plasmid structure in pAAV2 / 9n is pBluescript KS. All. Petition 870260060647, dated 06 / 22 / 2026, page 140 / 383 135 / 182 the component parts of the plasmid were verified by direct sequencing. The ampicillin resistance gene was then replaced by the kanamycin resistance gene to give pAAV2 / hu68n.KanR (p0068). 3. Adenovirus helper plasmid pAdDeltaF6 (Kan)

[00303] The pAdDeltaF6 (Kan) plasmid is 15,774 bp in size. The plasmid contains the adenovirus genome regions that are important for AAV replication, namely the E2A, E4, and VA RNAs (adenovirus E1 functions are provided by cells 293), but does not contain other adenovirus replication or structural genes. The plasmid does not contain the cis elements critical for replication, such as adenoviral inverted terminal repeats, and therefore no infectious adenoviruses are expected to be generated. It was derived from an E1, E3 deleted Ad5 molecular clone (pBHG10, a pBR322-based plasmid). Deletions were introduced into the Ad5 DNA to remove the expression of unnecessary adenovirus genes and reduce the amount of adenovirus DNA from 32 kb to 12 kb. Finally, the ampicillin resistance gene was replaced with the kanamycin resistance gene to obtain pAdeltaF6(Kan).The adenoviral genes E2, E4, and VAI that remain in this plasmid, along with E1, which is present in HEK293 cells, are required for the production of the AAV vector. 4. Main Cell Banks

[00304] HEK293 cells were originally generated by transforming HEK cells with cut adenovirus type 5 DNA as described by [Graham FL, et al., (1977) Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36 (1): 59-74]. The cells express the products of the E1A and E1B genes necessary for the production of high-titer rAAV. HEK293 cells are adherent and highly transfectable, producing high Petition 870260060647, dated 06 / 22 / 2026, page 141 / 383 136 / 182 titers of rAAV after plasmid DNA transfection. Glycerol stocks from the bacterial core cell bank (BCCB) are obtained by mixing 1 mL of a 1 L overnight bacterial culture used for plasmid DNA amplification with an equal volume of 50% sterile glycerol. Two 0.5 mL aliquots of the BCCB glycerol stocks per construct are prepared from the mixture and stored in Nalgene cryogenic vials at -80°C. To verify BCCB glycerol reserves, amplified plasmid DNA is subjected to internal structure analysis involving restriction enzyme digestion followed by gel electrophoresis, and complete plasmid sequence analysis by Sanger sequencing on the Qiagen. To prepare stock aliquots of glycerol from the bacterial working cell bank (BWCB) for shipment to the plasmid DNA manufacturer (Puresyn Inc.)A 3 mL culture is inoculated from a BMCB glycerol stock and grown overnight. One mL of the overnight culture is used to prepare aliquots of BWCB glycerol stock as described above. 5. Overview of the Manufacturing Process

[00305] The AAVhu68.CB7.O vector production process of CI.hSMN1co.rBG is illustrated in the manufacturing process flowchart in Figure 15A-15B. The main reagents that go into the product preparation are indicated on the left side of the diagram, and the quality assessments in the process are represented on the right side of the diagram. A description of each production and purification step is also provided. The product manufacturing follows a linear flow of unit operations and utilizes disposable, closed bioprocessing systems unless otherwise specified. All steps of the production process involving cell culture, from cell seeding to supernatant collection, are performed aseptically using disposable tube and bag sets. Petition 870260060647, dated 06 / 22 / 2026, page 142 / 383 137 / 182 sterile single-use plates. Cells are cultured on Corning 10-layer CellSTACKs® (CS-10) and HS-36, and all manipulations are open. The purification process is performed in a closed system whenever possible; however, column chromatography manipulations are considered sanitary operations and are not viewed as a completely closed system. 6. Description of the manufacturing process a. Cell Seeding

[00306] A qualified HEK293 cell line is used for the production process. A WCB was produced at Charles River Laboratories from the MCB-2 described in 5.2.6 and will be characterized in the IND submission. The cell culture used for vector production will be initiated from a single thawed WCB flask and expanded according to a Master Batch Record Document (MBR). Cells are expanded to 5 χ 10⁹ to 5 χ 10¹⁰ cells using Corning T and CS-10 flasks, allowing sufficient cell mass to be generated for seeding up to 48 HS-36 vector production cells per batch of BDS. Cells will be cultured in a medium composed of Modified Dulbecco Medium (DMEM), supplemented with 10% Fetal Bovine Serum (FBS) of North American or New Zealand origin, irradiated with gamma radiation. The cells are anchor-dependent, and cell dissociation will be performed using TrypLE™ Select, a cell dissociation reagent without animal products.Cell seeding will be performed using sterile, single-use disposable bioprocess bags and tube sets. Cells will be maintained at 37°C (± 2°C) in a 5% (± 0.5%) CO2 atmosphere. b. Transient Transfection

[00307] After approximately 3 days of growth (DMEM medium + 10% FBS), the HS-36 cell culture medium will be replaced with fresh, serum-free DMEM medium and transfected with the 3 plasmids of Petition 870260060647, dated 06 / 22 / 2026, page 143 / 383 138 / 182 production using an optimized polyethyleneimine (PEI)-based transfection method. A sufficient DNA plasmid transfection complex will be prepared in the BSC to transfect 48 HS-36 (per BDS batch). Initially, a DNA / PEI mixture will be prepared containing cis plasmid (vector genome), trans plasmid (capsid and rep genes), and helper plasmid (Ad) in a 0.1:1:2 ratio and GMP-grade PEI (PEIPro, PolyPlus Transfection SA). This plasmid ratio has been determined to be ideal for AAV production in small-scale optimization studies. After mixing well, the solution will be left at room temperature for 25 min, then added to serum-free medium to quench the reaction, and finally added to HS-36. The transfection mixture will be equalized across all 36 layers of HS-36, and the cells will be incubated at 37°C (± 2°C) in a 5% (± 0.5%) CO2 atmosphere for 5 days. c. Cellular Media Harvesting

[00308] Transfected cells and media will be harvested from each HS36 using disposable bioprocess bags, aseptically draining the media from the units. After harvesting the media, approximately 200 liters of volume will be supplemented with MgCl2 to a final concentration of 2 mM (cofactor for Benzonase) and Benzonase nuclease will be added to a final concentration of 25 units / mL. The product (in a disposable bioprocess bag) will be incubated at 37°C for 2 hours in an incubator to provide sufficient time for enzymatic digestion of residual cellular and plasmid DNA present in the harvest as a result of the transfection procedure. This step is performed to minimize the amount of residual DNA in the final DP vector. After incubation, NaCl will be added to a final concentration of 500 mM to aid in product recovery during downstream tangential flow filtration. Petition 870260060647, dated 06 / 22 / 2026, page 144 / 383 139 / 182 d. Clarification

[00309] Cells and cell debris will be removed from the product using a depth filter capsule (1.2 μm / 0.22 μm) connected in series as a closed sterile piping and bag assembly that is driven by a peristaltic pump. Clearance ensures that downstream filters and chromatography columns are protected from fouling, and bioburden reduction filtration ensures that, at the end of the filtration train, any biological load potentially introduced during the upstream production process will be removed before downstream purification. The collected material will be passed through a Sartorius Sartoguard PES capsule filter (1.2 / 0.22 μm) (Sartorius Stedim Biotech Inc.). e. Large-Scale Tangential Flow Filtering

[00310] Volume reduction (10 times) of the clarified product will be achieved by Tangential Flow Filtration (TFF) using a sterile closed bioprocessing tube, bag, and customized membrane assembly. The principle of TFF is to flow a solution under pressure parallel to a membrane of suitable porosity (100 kDa). The pressure differential drives smaller molecules through the membrane and effectively stops the flow of waste, while retaining larger molecules beyond the membrane pores. By recirculating the solution, the parallel flow sweeps across the membrane surface, preventing fouling of the membrane pores and loss of product through membrane binding. By choosing an appropriate membrane pore size and surface area, a liquid sample can be rapidly reduced in volume while retaining and concentrating the desired molecule.Diafiltration in TFF applications involves adding a new buffer to the recirculating sample at the same rate as the liquid is passing through the membrane and into the waste stream. With increasing diafiltration volumes, increasing amounts of small molecules are also present. Petition 870260060647, dated 06 / 22 / 2026, page 145 / 383 140 / 182 removed from the recirculating sample. This results in modest purification of the clarified product, but also achieves a buffer exchange compatible with the subsequent affinity column chromatography step. Consequently, we used a 100 kDa PES membrane for concentration which is then diafiltered with a minimum of 4 diavolumes of a buffer composed of 20 mM Tris, pH 7.5 and 400 mM NaCl. The diafiltered product will be stored overnight at 4°C and then clarified with a 1.2 µm / 0.22 µm depth filter capsule to remove any precipitated material. f. Affinity chromatography

[00311] The diafiltrated product will be applied to a Poros™ Capture Select™ AAV9 affinity resin (Life Technologies) that efficiently captures the AAVhu68 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flows through the column, while AAV particles are efficiently captured. After application, the column is treated with 5 volumes of a low-salt benzonase solution (2500 U / mL benzonase, 20 mM Tris pH 7.5 and 40 mM NaCl, 1.5 mM MgCb) to remove any remaining host cells and plasmid nucleic acid. The column is washed to remove additional feed impurities followed by a low pH elution (400 mM NaCl, 20 mM sodium citrate; pH 2.5) which is immediately neutralized by collection in a 1 / 10° volume of a neutralization buffer (200 mM Tris Propane, pH 10.2). g. Anion Exchange Chromatography

[00312] To achieve a further reduction of process impurities, including AAV void particles, the PorosAAV9 elution pool is diluted 50 times (Bis Tris Propane 20 mM, Pluronic F68 0.001%, pH 10.2) to reduce ionic strength and allow binding to a QA monolith matrix (BIA Separations). After a low-salt wash, the vector product is eluted using a saline gradient. Petition 870260060647, dated 06 / 22 / 2026, page 146 / 383 A 141 / 182 linear 60 CV NaCl (10-180 mM NaCl) gradient is used. This shallow salt gradient effectively separates capsid particles without a vector genome (empty particles) from particles containing a vector genome (filled particles) and results in an enriched preparation for complete capsids. Fractions are collected in tubes containing 1 / 100th volume of 0.1% Pluronic F68 and 1 / 27th volume of Bis Tris pH 6.3 to minimize non-specific binding to the tubes and the duration of exposure to high pH, ​​respectively. The pooled total particle peak fractions are diluted 20-fold in 20 mM Bis Tris Propane, 0.001% Pluronic F68, pH 10.2 and reapplied to the same column, which has been cleaned in place. The 10-180 mM NaCl salt gradient is reapplied, and appropriate whole particle peak fractions are collected. The peak area is evaluated and compared with previous data to determine the approximate vector yield. h. Final formulation and bioburden reduction filtration to provide BDS.

[00313] TFF is used to obtain the final formulation in combined anion exchange fractions (AEX) with a 100 kDa membrane. This will be achieved by diafiltration of the final formulation buffer and concentrating to produce BDS at a desired target concentration. Samples will be removed for BDS testing (described in the section below). The BDS is sterile filtered (0.22 µm), stored in sterile polypropylene tubes, and frozen at < -60°C in a quarantine location until release for final filling. i. Final Filling

[00314] The frozen BDS will be thawed, pooled, and adjusted to the target concentration (dilution step or concentration via TFF) using the final formulation buffer. The product will then be filtered through a 0.22 µm filter and packaged in sterile crystal vials from West Pharmaceutical's Crystal Zenith (polymer) and capped with seals. Petition 870260060647, dated 06 / 22 / 2026, page 147 / 383 142 / 182 crimping in a fill volume to be determined. The vials will be individually labeled according to the specifications below. The labeled vials are stored at < -60°C. j. Vector genome identity: DNA sequencing and NGS

[00315] The viral vector genomic DNA will be isolated and the sequence determined by double-coverage sequencing using primer walking. Sequence alignment is performed and compared with the expected sequence. In certain modalities, next-generation sequencing (also known as high-throughput sequencing) is performed, for example, using Illumina® machines. k. Vector capsid identity: VP1 AAV capsid mass spectrometry

[00316] Confirmation of the AAVhu68 serotype of the vector is achieved by an assay that was developed based on the analysis of AAV capsid protein peptides. The method involves trypsin digestion of the VP followed by characterization by tandem mass spectrometry on a Q-Exactive Orbitrap mass spectrometer to sequence the capsid protein peptides. A spectral library of the sequenced tandem mass spectra and a targeted mass spectrometry method is used to test for signature peptides that can uniquely identify specific serotypes of AAV viral particles. A bank of peptides specific to eight AAVs (AAVhu68, AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh10, AAVhu37) are screened against the tandem mass spectra produced by digestion of the test article. For a positive identification, only the signature peptides of a single serotype will be detected. l. Genomic Copy Title

[00317] A digital drop-based polymerase chain reaction (ddPCR) technique for determining GC titer for vectors of Petition 870260060647, dated 06 / 22 / 2026, pp. 148 / 383 143 / 182 AAV was recently developed [Lock M, Alvira MR, Chen SJ, & Wilson JM (2014) Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR. Hum Gene Ther Methods 25(2):115-125.] The method is practical, reports titers equivalent to or better than qPCR, and does not require a plasmid standard curve. The assay used involves digestion with DNase I, followed by digital PCR analysis to measure the encapsulated vector genetic copies. DNA detection will be performed using specific primers for sequences targeting the polyA region in combination with a labeled fluorescent probe, hybridizing to that same region. A number of standards, validation samples, and controls (for background contamination and DNA) were introduced into the assay. m. Infectious Disease Unit Title

[00318] The infectious unit (IU) assay is used to determine the productive uptake and replication of the rAAV vector in RC32 cells (HeLa cells expressing rep2). A 96-well endpoint format was employed similar to that previously published. Briefly, RC32 cells are co-infected by serial dilutions of rAAV BDS and a uniform dilution of Ad5 with 12 replicates at each rAAV dilution. Seventy-two hours after infection, the cells are lysed and qPCR is performed to detect rAAV vector amplification upon entry. A tissue culture infectious dose calculation at a 50% (TCID50) endpoint dilution (Spearman-Karber) is performed to determine a replicative titer expressed as IU / mL.Since infectivity values ​​depend on particle contact with cells, receptor binding, internalization, transport to the nucleus, and genome replication, they are influenced by assay geometry and the presence of appropriate receptors and post-binding pathways in the cell line used. The receptors and post-binding pathways... Petition 870260060647, dated 06 / 22 / 2026, page 149 / 383 144 / 182 linkages are not normally maintained in immortalized cell lines, and thus infectivity assay titers are not an absolute measure of the number of infectious particles present. However, the ratio of encapsulated GC to infectious units (described as GC / IU ratio) can be used as a measure of batch-to-batch product consistency. n. Ratio of empty / filled particles

[00319] Sedimentation velocity, measured in an analytical ultracentrifuge (AUC), can detect aggregates, other minor components, and provide good quantification of relative amounts of different particle species based on their different sedimentation coefficients. This is an absolute method based on fundamental units of length and time, requiring no standard molecule as a reference. Vector samples are loaded into cells with 2-channel epon coal centerpieces with an optical path length of 12 mm. The supplied dilution buffer is loaded into the reference channel of each cell. The loaded cells are then placed in an AN-60Ti analytical rotor and loaded into a Beckman-Coulter ProteomeLab XL-I analytical ultracentrifuge equipped with absorbance and RI detectors. After total temperature equilibration at 20°C, the rotor is brought to a final speed of 12,000 rpm.Absorbance in 280 nm scans is recorded approximately every 3 minutes for approximately 5.5 hours (110 total scans for each sample). The raw data are analyzed using the c(s) method and implemented in the SEDFIT analysis program. The resulting size distributions are plotted graphically and the peaks integrated. The percentage values ​​associated with each peak represent the fraction of the peak area of ​​the total area under all peaks and are based on the raw data generated at 280 nm; many laboratories use these values ​​to calculate voids: particle ratios. Petition 870260060647, dated 06 / 22 / 2026, pp. 150 / 383 145 / 182 complete. However, since empty and filled particles have different extinction coefficients at this wavelength, the raw data may need to be adjusted accordingly. The ratio between the peak values ​​of empty particles and complete monomer before and after adjusting the extinction coefficient is used to determine the proportion of empty and complete particles, and both ratios are recorded in analysis certificates. o. Host cell DNA

[00320] A qPCR assay is used to detect residual human DNA 293. After the addition of irrelevant DNA, total DNA (relevant, vector, and genomic residue) is extracted from approximately 1 mL of product. Host cell DNA is quantified using qPCR targeting the 18S rDNA gene. The amounts of DNA detected are normalized based on the recovery of the spiked irrelevant DNA. Three different amplicon sizes are tested to establish the size spectrum of residual host cell DNA. p. Host Cell Protein

[00321] An ELISA is performed to measure the levels of contaminating cellular proteins from the HEK293 host. The Cygnus Technologies HEK293 2nd Generation Host Cell Protein ELISA Kit is used according to the instructions provided by the supplier. q. AAV Assay Replication-competent

[00322] A sample is analyzed for the presence of AAV2 / hu68 (rcAAV) competent replicants that may potentially arise during the production process. A 3-passage assay was developed consisting of cell-based amplification and passage, followed by rcAAV DNA detection by real-time qPCR (caphu68 target). The cell-based component consists of inoculating HEK293 cell monolayers (P1) with sample dilutions of Petition 870260060647, dated 06 / 22 / 2026, pp. 151 / 383 146 / 182 test and wild-type human adenovirus type 5 (Ad5). The maximum amount of the tested product will be 1 χ¹⁰ GC of the vector product. Due to the presence of adenovirus, rcAAV will amplify the cell culture. After 2 days, a cell lysate is generated and Ad5 is heat-inactivated. The clarified lysate is then passed to a second cell cycle (P2) to increase sensitivity (again in the presence of Ad5). After 2 days, a cell lysate is generated and Ad5 is heat-inactivated. The clarified lysate is then passed to a third cell cycle (P3) to maximize sensitivity (again in the presence of Ad5). After 2 days, the cells are lysed to release DNA, which is then subjected to qPCR to detect AAVhu68 cap sequences. Amplification of AAVu68 cap sequences in an Ad5-dependent manner indicates the presence of rcAAV.The use of a surrogate positive control of AAV2 / hu68 containing the AAV2 rep genes and AAVhu68 cap genes allows determining the limit of detection (LOD) of the assay to be determined (0.1, 1, 10, and 100 IU) and using a serial dilution of rAAV (1 χ 1010, 1 χ 109, 1 χ 108, and 1 χ 107GC) the approximate level of rcAAV present in the test sample can be quantified. r. In Vitro Potency

[00323] To relate the qPCR GC titer to gene expression, an in vitro bioassay is performed. Briefly, cells are plated well-to-well in a 96-well plate and incubated at 37°C / 5% CO2 overnight. The following day, cells are infected with the serially diluted AAV vector and incubated at 37°C / 5% CO2 for two days. Cells are then fixed with 4% paraformaldehyde, followed by washes with PBS containing 0.1% Triton-100, then incubated with blocking buffer. After blocking, cells are incubated with a 1:200 dilution of the primary antibody (GenTex monoclonal a-Smn1, CAT # GTX60451), washed, and incubated with 1:500 α-mouse-488 (Thermo Fisher). Before imaging, the cells are treated. Petition 870260060647, dated 06 / 22 / 2026, page 152 / 383 147 / 182 plates with PBS containing DAPI to visualize the nuclei. Plates are recorded using the Cell Insight Cx5 high-content imager (Thermo Fisher). The current method for data capture is to track 2,500 objects (i.e., cells) per well and use a modified SpotID protocol to count the number of Cajal Twin bodies per nucleus. Cajal Twin nuclear body formation depends on the functional Smn1 protein. The MOI of the log vector is plotted on the x-axis versus the instrument reading on the y-axis. Assay optimization is ongoing. s. Total protein, Capsidium protein, Protein purity and Capsidium protein ratio

[00324] Vector samples are first quantified for total protein against a bovine serum albumin (BSA) protein standard curve using a bicinchoninic acid (BCA) assay. The determination is made by mixing equal parts of the sample with a Micro-BCA reagent provided in the kit. The same procedure is applied to dilutions of a BSA Standard. The mixtures are incubated at 60 °C and the absorbance is measured at 562 nm. A standard curve is generated from the standard absorbance of known concentrations using a 4-parameter adjustment. Unknown samples are quantified according to the 4-parameter regression. To provide a semi-quantitative determination of rAAV purity, samples will be normalized to genome titer and 5 χ 109GC separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions. The gel is then stained with SYPRO Ruby dye.Any impurity bands are quantified by densitometry. Stained bands that appear in addition to the 3 specific AAV proteins VP1, VP2, and VP3 are considered protein impurities. The mass percentage of impurities, as well as the approximate molecular weight of the contaminating bands, are reported. SDS gels. Petition 870260060647, dated 06 / 22 / 2026, pp. 153 / 383 148 / 182 PAGE will also be used to quantify the VP1, VP2, and VP3 proteins and determine their ratio. t. BSA protein

[00325] This assay is performed using the bovine albumin ELISA kit obtained from Bethyl Laboratories in accordance with the protocol provided with the assay kit. u. Benzonase Endonuclease

[00326] Benzonase is used in the production process to degrade nucleic acids to facilitate vector purification and, as such, represents a process impurity. A commercial ELISA (Millipore) is used to measure the residual benzonase concentration. Since the amount of benzonase is likely to be in small quantities, it is necessary to perform an ELISA with a series of standards that include concentrations <1 ng / mL. v. Ratio of GC to IU

[00327] The GC / IU ratio is a measure of product consistency. The ddPCR titer (GC / mL) is divided by the infectious unit (IU / mL) to obtain the calculated GC / IU ratio. w. Osmolarity, pH and appearance test

[00328] Osmolarity and pH are determined according to USP. <785> and USP <791> The product's appearance is determined by visual inspection for transparency, color, and the absence / presence of foreign particles. The product is inspected against white and black backgrounds, respectively. Example 14 - Severe toxicity in primates and non-human piglets after high-dose intravenous administration of an AAV vector expressing human SMN.

[00329] Neurotropic AAV serotypes, such as AAV9, have been shown to transduce spinal motor neurons when administered intravenously at high doses. This observation Petition 870260060647, dated 06 / 22 / 2026, page 154 / 383 149 / 182 led to the recent successful application of intravenous administration of AAV9 to treat children with spinal muscular atrophy, a hereditary deficiency of survival motor neuron (SMN) protein characterized by the selective death of lower motor neurons.

[00330] To evaluate the efficiency of motor neuron transduction using this approach, three juvenile non-human primates (NHPs; 13–14 months) and three neonatal piglets (7–30 days) were treated with an intravenous injection of an AAV vector carrying a human SMN transgene closely related to AAV serotype 9 (AAVhu68) carrying a human SMN expression cassette at a dose similar to that employed in the SMA clinical trial. The animals were evaluated for spinal motor neuron transduction as well as evidence of toxicity. Administration of 2 x 1014 genome copies per kilogram of body weight resulted in widespread spinal motor neuron transduction in both species. However, severe toxicity occurred in NHPs and piglets. All three NHPs exhibited marked elevations of transaminases, and one animal was euthanized 5 days after injection with clinical and histological signs of acute liver failure and shock.Degeneration of sensory neurons in the dorsal root ganglia (DRG) was also observed, although the NHPs did not exhibit clinically apparent sensory deficits. There was no correlation between the clinical findings and the T-cell responses to the vector capsid or the transgenic product in the NHPs. The piglets showed no evidence of liver toxicity, but within 14 days of vector injection, all three animals exhibited proprioceptive deficits and ataxia, which profoundly impaired ambulation and necessitated euthanasia. These clinical findings correlated with more severe DRG sensory neuronal lesions than those observed in the NHPs. The liver and sensory neuron findings in these... Petition 870260060647, dated 06 / 22 / 2026, pp. 155 / 383 150 / 182 species appear to be a direct consequence of AAV transduction independent of an immune response to the capsid product or transgene. Preclinical and clinical studies involving high systemic exposure to AAV vectors should include careful monitoring for similar toxicity. A. Results: 1. Study on non-human primates:

[00331] 13-14-month-old rhesus monkeys were administered an intravenous (IV) dose of 2x1014GC / kg AAVhu68 vector expressing human SMN under the control of a chicken beta-actin promoter with an immediate cytomegalovirus early enhancer (Table 1). Table 1. Rhesus monkeys treated with AAVhu68.CB7.hSMN1 included in example 14 Animal ID Age (months) Weight (Kg) Baseline Titer AA- Vhu68 nAb Dose Route of Administration 16C116 13 2.52 <1:5 2x10¹⁴ GC / kg IV 16C176 14 2.22 <1:5 2x10¹⁴ GC / kg IV 16C215 14 2.40 <1:5 2x10¹⁴ GC / kg IV

[00332] All animals exhibited stable vital signs during vector infusion and recovered uneventfully from anesthesia. On day 5 of the study, animal 16C176 became acutely unresponsive. Physical examination revealed pale mucous membranes, an approximate 15% decrease in body weight from the time of vector administration, hepatomegaly, and a palpable abdominal fluid wave. Blood abnormalities included a packed cell volume of 22%, glucose <20 mg / dL, BUN of 75 mg / dL, and creatinine of 2 mg / dL. This animal's condition rapidly deteriorated, and it was subsequently euthanized. A full necropsy was performed. Petition 870260060647, dated 06 / 22 / 2026, pp. 156 / 383 151 / 182

[00333] Blood was collected at the time of euthanasia and a complete serum chemistry panel was performed. Notable findings included hypoproteinemia, markedly elevated liver enzymes (AST, ALT, GGTP, ALP), hyperbilirubinemia, increased blood urea nitrogen (BUN), elevated BUN / creatinine ratio, hyperphosphatemia, hypoglycemia, hypocalcemia, hypochloremia, hypocholesterolemia, hypertriglyceridemia, and elevated creatine phosphokinase (CPK) (Figures 16A-16E). These findings were suggestive of liver failure with renal failure likely secondary to hypoperfusion. The sample collected at necropsy was severely hemolyzed and therefore a complete blood count (CBC) and coagulation panel were not reported.

[00334] At necropsy, the abdominal cavity contained approximately 44 mL of red serosanguineous fluid. Cytological evaluation of the abdominal fluid was consistent with transudate with acute hemorrhage. The liver was diffusely enlarged, firm, and stained brown to red, corresponding histologically to massive hepatocellular necrosis and degeneration, affecting ~95% of the hepatic parenchyma, with only rare clusters of relatively normal hepatocytes remaining (Figures 17A-17D). The centrilobular to midzonal regions were severely congested with hepatocyte loss, degeneration, and necrosis. In addition, there were small foci of fibrin that occasionally formed plugs in the sinusoids and filled the lumen of the portal veins (acute fibrin thrombi). Immunohistochemistry (IHC) for fibrinogen confirmed the presence of sinusoidal fibrin plugs.Fibrinogen staining was strongly positive in the periportal to midzonal regions, which were the areas of active hepatocellular necrosis in the remaining liver parenchyma. Fibrinogen staining frequently highlighted sinusoids in these regions. Necrotic hepatocytes and associated debris were also strongly positive. Petition 870260060647, dated 06 / 22 / 2026, page 157 / 383 152 / 182

[00335] The spleen was diffusely enlarged, firm, and congested. The congestion was confirmed histologically, and the germinal centers within the white pulp were depleted of lymphocytes with extensive cellular debris (lymphocytolysis) and had prominent, occasionally hyalinized endothelial venules (HEV). Similarly, the thymus cortex exhibited mild lymphocytolysis with prominent tingible body macrophages. Roughly speaking, the mesenteric lymph nodes were diffusely enlarged and congested. Histologically, the follicles exhibited germinal center depletion with lymphocytolysis. Similar histological findings were observed in other lymphoid tissues, including other lymph nodes (submandibular, rectal), bronchus-associated lymphoid tissue (BALT) in the lung, and gut-associated lymphoid tissue (GALT) in the colon and cecum.The lymph nodes associated with the rectum, assumed to be mesorectal lymph nodes, showed subcapsular and medullary sinus erythrocytosis, consistent with red blood cell drainage. Histological findings in the lymphoid follicles were suggestive of severe systemic stress. Histologically, acute hemorrhage and edema were observed in the lung, gallbladder adventitia, heart, perirectal adipose tissue, and subcutaneous tissue near the mammary gland. The superficial mucosa of the small intestine, cecum, and rectum was congested with occasional hemorrhage, as well as superficial aggregates of hemosiderin-laden macrophages. The presence of hemorrhage and edema in the lung, gastrointestinal tract, and liver is suggestive of shock, as these are known shock organs in non-human primates. Acinar cell degeneration was observed in the pancreas, which has also been reported in cases of shock in non-human primates (Khan, NA, et al.).Mitigation of septic shock in mice and rhesus monkeys by human chorionic gonadotrophin-related oligopeptides. Clinical and Experimental Immunology 160, 466-478 (2010). Degeneration and necrosis of minimal single adrenocortical cells. Petition 870260060647, dated 06 / 22 / 2026, pp. 158 / 383 153 / 182 were present in the zona fasciculata of the adrenal glands, probably also attributable to systemic diseases such as systemic stress, ischemia, hemorrhage, and inflammation. No gross or histological findings were observed in the brain, spinal cord, cranial nerves, and peripheral nerves of this animal. No significant findings were observed in the kidneys.

[00336] The two remaining primates (16C116 and 16C215) were clinically normal throughout the study and necropsied as planned on day 28. Blood tests performed at specific times throughout the study revealed a dramatic elevation of transaminases on day 5, which decreased on day 7 and normalized on day 14 (Figures 16A-16E). One of the two remaining primates exhibited transient thrombocytopenia (platelet count 24,000 / pL) on day 5; platelets could not be quantified in the other animal due to clumping, but appeared to be normal in number on the peripheral smear. Blood tests were unremarkable throughout the study. At necropsy, the liver of one animal (16C116) was stained brown to red with a pronounced lobular pattern; no other significant abnormalities were observed in either of these two primates.

[00337] Histologically, the liver of both primates exhibited minimal multifocal single hepatocellular necrosis, which was most prominent in the periportal region (Figure 17A-17D). Additionally, animal 16C215 had multifocal aggregates of irregularly arranged hepatocytes with cytoplasmic basophilia, vesicular nuclei, and occasional mitotic figures, indicative of regeneration. These hepatocyte clusters generally involved portal areas with intercalated mononuclear cell infiltrates and proliferating fibroblasts (fibroplasia).

[00338] Histological findings in the two terminally necropsied primates (16C215 and 16C116) were observed in the nervous system, predominantly in the spinal cord, trigeminal ganglia, and Petition 870260060647, dated 06 / 22 / 2026, page 159 / 383 154 / 182 dorsal root ganglia, as well as peripheral nerves, including the median, radial, sciatic, tibial, and peroneal nerves (Figures 18A-18D, Tables 2-4). Histological lesions in the central and peripheral nervous systems were often variable, with differing severity between tissue sections within the same segment, as well as between spinal cord and peripheral nerve segments in the same animal. Dorsal root ganglia (DRG) exhibited minimal to mild neuronal cell body degeneration, characterized by central chromatolysis and surrounding mononuclear cell infiltrates (satellitosis) and neuronal cell body infiltration (neuronophagy). Based on immunohistochemistry (IHC), the mononuclear cell infiltrates were composed of CD3-positive T cells with few CD20-positive B cells.In both primates, the dorsal white matter tracts of the cervical, thoracic, and lumbar spinal cord exhibited bilateral axonopathy ranging from minimal to moderate, characterized by dilated myelin sheaths with and without myelomacrophages, indicating axonal degeneration. Occasionally, minimal to marked axonopathy was observed in the dorsal nerve roots of the spinal cord. The peripheral nerves (median, radial, sciatic, peroneal, and tibial) exhibited similar axonopathy ranging from mild to marked, along with variable mononuclear cell infiltrates and periaxonal fibrosis. Peripheral axonopathy was observed bilaterally; however, the severity varied between sections and even within some nerve sections. Table 2. Incidence and severity of axonopathy in the dorsal tracts of the white matter of the spinal cord in non-human primates and infant piglets that received AAVhu68 expressing human SMN intravenously. Excluding the NHP necropsied on day 5, the incidence and severity of dorsal axonopathy in the spinal cord were relatively similar between NHPs and piglets. Petition 870260060647, dated 06 / 22 / 2026, page 160 / 383 155 / 182 Species NHP infant Piglets Number of animals evaluated per group 3 3 Number examined 3 3 Spinal cord, Cervical (C2) Axonopathy, dorsal tracts of white matter Absent 1* - Grade 1 1 1 Grade 2 - 1 Grade 3 1 1 Spinal cord, Thoracic (T2) Axonopathy, dorsal tracts of white matter Absent 1* - Grade 1 1 1 Grade 2 1 2 Spinal cord, Lumbar (L2) Axonopathy, dorsal tracts of white matter Absent 1* - Grade 1 1 2 Grade 2 - 1 Grade 3 1 - * Denotes the unscheduled necropsy animal 16C176 (Day 5) Table 3. Incidence and severity of dorsal root and trigeminal ganglion neuronal degeneration in non-human primates and piglets that received AAVhu68 expressing human SMN intravenously. Excluding the NHP necropsied on day 5, the incidence of neuronal cell body degeneration was similar between NHPs and piglets; however, the severity was slightly increased in piglets on Petition 870260060647, dated 06 / 22 / 2026, page 161 / 383 156 / 182 comparison with the NHPs. Species NHP infant Piglets Number of animals evaluated per group 3 3 Dorsal root ganglia, Cervical Number examined 3 3 Neuronal cell body degeneration with mononuclear cell infiltrate Absent 1* - Grade 1 2 - Grade 2 - 1 Grade 4 - 2 Dorsal root ganglia, Thoracic Number examined 2 3 Neuronal cell body degeneration with mononuclear cell infiltrate Absent - - Grade 1 1 - Grade 2 1 3 Dorsal root ganglia, Lumbar Number examined 3 3 Neuronal cell body degeneration with mononuclear cell infiltrate Absent 1* - Grade 1 1 - Grade 2 1 1 Grade 3 - 2 Trigeminal ganglia Number examined 2 3 Neuronal cell body degeneration with infiltrate Petition 870260060647, dated 06 / 22 / 2026, page 162 / 383 157 / 182 Species NHP infant Mononuclear cell piglets Absent - - Grade 1 2 1 Grade 2 - 1 Grade 3 - 1 * Denotes an unscheduled necropsy animal 16C1 76 (Day 5) Table 4. Incidence and severity of peripheral nerve axonopathy in non-human primates and infant piglets that received AAVhu68 expressing human SMN intravenously. Excluding the NHP necropsied on day 5, the incidence of peripheral axonopathy was similar between NHPs and piglets; however, the severity was slightly increased in NHPs compared to piglets. Species NHP infant Piglets Number of animals evaluated per group 3 3 Number examined 3 3 Median nerve Axonopathy Absent 1* 1 Grade 1 - 1 Grade 2 1 1 Grade 3 1 - Peroneal nerve Axonopathy Absent 1* 2 Grade 1 - - Grade 2 1 - Grade 4 1 1 Radial nerve Petition 870260060647, dated 06 / 22 / 2026, pp. 163 / 383 158 / 182 Species NHP infant Piglets Axonopathy Absent 2* 1 Grade 1 - 1 Grade 2 - 1 Grade 3 1 - Sciatic nerve Axonopathy Absent 1* 1 Grade 1 - 1 Grade 3 1 1 Grade 4 1 - Tibial nerve Axonopathy Absent 1* 1 Grade 1 - 1 Grade 3 1 1 Grade 4 1 - * Denotes the unscheduled necropsy animal 16C176 (Day 5)

[00339] Vector biodistribution analysis demonstrated gene transfer to all tissues evaluated, including the brain and spinal cord (Figure 19). Notably, dorsal root ganglia (DRG) were heavily targeted with more than 10 vector genomes per cell in many samples. Extremely high hepatic transduction was also evident with more than 1000 vector genome (GC) copies per cell. Vector genome copies were detected at higher levels in animals necropsied on day 5 than in those necropsied on day 28, suggesting that some of the vector genomes detected in tissues early after injection do not represent stable transduction. Petition 870260060647, dated 06 / 22 / 2026, page 164 / 383 159 / 182

[00340] SMN expression was assessed by in-situ hybridization (Figures 20A-20G). There was marked expression of human SMN mRNA in the liver of the animal necropsied on day 5, but no detectable expression in the spinal cord or brain. The two animals necropsied 28 days after vector injection exhibited robust SMN expression in spinal motor neurons, with approximately 30-90% of cells transduced on average at each spinal cord level evaluated. There were also scattered patches of transduced neurons and ependymal cells in the brain.

[00341] T cell responses to the transgenic product of the vector capsid and human SMN were assessed by interferon gamma ELISPOT (Table 5). Peripheral blood mononuclear cells were collected for ELISPOT analysis before vector administration and at necropsy for all three animals. Mononuclear cells were also collected from the liver at necropsy. All samples exhibited a robust interferon gamma response to positive control stimulation with PHA with the exception of liver lymphocytes collected from animal 16C215, which did not exhibit any response to PHA stimulation and were excluded from subsequent analysis. No T cell response to the AAVhu68 capsid or hSMN was detectable at the time point in animals 16C176 or 16C215. Animal 16C116 did not exhibit a T-cell response in PBMCs at any point in time, but had a detectable interferon gamma response to the vector capsid and transgenic product at the time of necropsy. Table 5. Detection of IFN-gamma ELISPOT in T cell responses to the AAVhu68 capsid and the hSMN transgene in peripheral blood and liver lymphocytes. T cell responses were measured against clustered overlapping 15-mer peptides comprising the AAVhu68 VP1 sequence (3 peptide sets) or the human SMN sequence (2 peptide sets). Values ​​are expressed as Petition 870260060647, dated 06 / 22 / 2026, pp. 165 / 383 160 / 182 point-forming units (SFU) per million PBMCs. The asterisk indicates a detectable T-cell response (> 50 SFU and 3 times greater than the unstimulated control). Liver lymphocytes isolated from 16C215 exhibited an inadequate response to PHA stimulation and were excluded from the analysis. PHA: phytohemagglutinin, TNTC: too numerous to count. AA- Vhu68 hSMN Animal ID Lymphocyte Source Time Point Not stimulated PHA Set A Set B Set C Set A Set B 16C116 Peripheral Blood Baseline 8 TNTC 5 8 8 8 5 Peripheral Blood Necropsy 3 TNTC 13 8 8 13 3 Liver Necropsy 0 TNTC 28 40 80* 123* 48 16C215 Peripheral Blood Baseline 0 TNTC 30 13 8 23 15 Peripheral Blood Necropsy 10 TNTC 8 23 18 13 18 16C176 Peripheral Blood Baseline 25 TNTC 8 18 8 28 18 Peripheral Blood Necropsy 13 10 43 8 5 0 20 0 Petition 870260060647, dated 06 / 22 / 2026, pp. 166 / 383 161 / 182 Liver Necropsy 5 1023 5 5 0 3 0 2. Piglet Study

[00342] Three Yucatan micropiglets were administered an intravenous dose of 2x1014GC / kg AAVhu68.hSMN at 7 (n=1; Piglet A) or 30 (n=2; Piglets B and C) days of age (Table 6). All animals recovered without incident after vector administration. On day 14 of the study after vector administration, Piglet A developed hind limb ataxia. The ataxia was characterized by a swaying gait with intermittent joint movement and crossing of the hind limbs. When the hind feet were placed on the dorsal surface, the piglet failed to correct hoof placement (hoof placement test), indicating a deficit in conscious proprioception. This ataxia progressed to the forelimbs over 6 hours. This piglet also developed dyspnea, but auscultation of all lung fields was within normal limits.Given the progression of clinical signs, the piglet was sacrificed on day 14 after vector administration and a full necropsy was performed. Table 6. Yucatan micro piglets treated with AAVhu68.CB7.hSMN1 included in this study. Animal ID Age (days) Weight (kg) Dose Route of Administration Piglet A 7 1.56 2x10¹⁴ GC / kg IV Piglet B 30 3.35 2x10¹⁴ GC / kg IV Piglet C 30 4.30 2x10¹⁴ GC / kg IV

[00343] On day 13 after vector administration, piglets injected at 30 days of age developed similar, though less severe, neurological signs. Dyspnea was not observed in these animals. The piglets were euthanized and a full necropsy was performed.

[00344] No significant macroscopic abnormalities were observed in piglets of both age groups. Piglet injected with Petition 870260060647, dated 06 / 22 / 2026, pp. 167 / 383 Piglets 162 / 182 days old presented reasonable nutritional conditions at the time of necropsy and had a clinical history of diarrhea on day 7 of the study, which resolved on day 9 of the study after treatment with intramuscular (IM) ceftiofur. Piglets injected at 30 days of age were in adequate nutritional condition. A complete blood count (CBC) of blood collected before euthanasia from the 7-day-old injected piglet (piglet A) revealed marked neutrophilia (22,468 / pL; reference range: 2,300-11,900 / pL). No other significant abnormalities were observed in the blood test. The neutrophilia likely corresponded to histological evidence of bacterial bronchopneumonia. No significant abnormalities were observed in the blood test in piglets injected at 30 days of age.

[00345] The cervical, thoracic, and lumbar dorsal root ganglia (DRG) of all animals exhibited mild to marked neuronal cell body degeneration with mononuclear cell infiltrates (Figures 21A-21D, Tables 2-4). The histological lesions of neuronal degeneration ranged from cytoplasmic eosinophilia with bright eosinophilic cytoplasmic globules and central chromatolysis to complete obliteration with infiltrating mononuclear cells (neuronophagia). Similar, though less severe, lesions were observed in the trigeminal ganglia of all animals, ranging from minimal to moderate. In all piglets, the dorsal white matter tracts of the cervical, thoracic, and lumbar spinal cord exhibited minimal to moderate axonopathy, characterized by dilated myelin sheaths with and without myelomacrophages, consistent with axonal degeneration.The incidence of these lesions was the same in all animals; however, the severity decreased slightly in one of the piglets injected at 30 days of age (piglet C).

[00346] At 7 days of age, inject the piglet (piglet A), the peripheral nerves (median, radial, sciatic, fibular and tibial) contained a Petition 870260060647, dated 06 / 22 / 2026, pp. 168 / 383 163 / 182 Spinal cord-like axonopathy ranging from mild to severe bilaterally. Interestingly, axonopathy in the peripheral nerves of the hind limbs (moderate to marked) was more severe than in the forelimbs (mild). In piglets injected at 30 days of age, only 1 animal (piglet B) showed minimal peripheral axonopathy in most nerves except the fibular nerve. The peripheral nerves of the other piglet injected at 30 days of age (piglet C) were histologically insignificant. Histological lesions in the central and peripheral nervous systems were often variable, as severity differed between and within tissue sections of the same animal, as well as between different segments of the spinal cord. No histological changes were observed in the brain or liver.

[00347] In general, the incidence and severity of peripheral nerve injuries decreased in piglets injected at 30 days of age, compared to the piglet injected at 7 days of age, which coincided with the less severe antemortem neurological signs observed in older animals. Furthermore, the severity of spinal cord injuries and the incidence of peripheral nerve injuries were lower in one of the piglets injected at 30 days of age (piglet C), which also presented the least severe neurological signs of piglets in both age groups.

[00348] Vector genomes were detectable in all tissues analyzed, including brain and spinal cord (Figure 22). Gene transfer to DRG was generally higher than to the spinal cord, often with more than 1 vector GC per host diploid genome (dg). The highest vector genome copy numbers were found in the liver, with approximately 200 GC / dg in liver samples from all three animals. There was no apparent impact of age on the injection efficiency of gene transfer to the tissues evaluated. Petition 870260060647, dated 06 / 22 / 2026, page 169 / 383 164 / 182

[00349] Human SMN mRNA expression was detected by ISH in motor neurons throughout the spinal cord of all three animals (Figures 23A-23). ​​Most motor neurons appeared to be transduced in all animals, with no apparent difference in transduction between piglets aged 7 and 30 days. B. Discussion:

[00350] In this example, intravenous administration of a high dose of a human SMN-expressing AAV vector resulted in unexpected toxicity in piglets and juvenile NHPs. Liver toxicity was limited to NHPs, while sensory neuronal degeneration occurred in both species. The approximately 5-fold lower gene transfer to the liver in piglets treated with the same vector dose suggests that a lower hepatic tropism of AAV in this species may explain the absence of liver toxicity observed in NHPs. All three NHPs developed a rapid elevation of liver enzymes and bilirubin after vector administration. The animal with the most pronounced elevation of transaminases also exhibited evidence of coagulopathy, with extensive fibrin deposition in the liver, generalized hemorrhage, and apparent spontaneous hemoperitoneum, although coagulation studies could not be performed at the time of necropsy, limiting the interpretation of these findings.The presence of fibrin deposition in the liver associated with generalized hemorrhage was suggestive of disseminated intravascular coagulation (DIC). However, fibrin deposition was not observed outside the liver, inconsistent with true DIC. The results appear similar to those described in acute liver failure caused by acetaminophen toxicity, characterized by rapid hepatocellular degeneration and tissue factor presentation in the liver, leading to intrahepatic coagulation. See, for example, Ganey, PE, et al. Role of the coagulation system in acetaminophen-induced hepatotoxicity in mice. Hepatology 46, 1177-1186. Petition 870260060647, dated 06 / 22 / 2026, pp. 170 / 383 165 / 182 (2007); Kerr, R. New insights on haemostasis in liver failure. Blood coagulation & fibrinolysis: an international journal in haemostasis and thrombosis 14 Suppl 1, S43-45 (2003); Payen, C., Dachraoui, A., Pulce, C. & Descotes, J. Prothrombin time prolongation in paracetamol poisoning: a relevant marker of liver failure? Human and Experimental Toxicology 22, 617-621 (2003); and James, LP, Wells, E., Barba, RH & Farrar, HC. Predictors of outcome following acetaminophen poisoning in children and adolescents. The Journal of Pediatrics 140, 522-526 (2002). This is usually associated with coagulopathy, which may be related to consumption of the coagulation factor caused by intrahepatic coagulation, decreased synthesis of the coagulation factor due to liver failure, or a combination of these. See Ganey et al., 2007 and Kerr, 2003, as cited above. Transient thrombocytopenia in an animal on day 5 may also be related to intrahepatic coagulation.Another possible explanation could be the activation of a systemic inflammatory response by high doses of AAVs, with platelet activation, intravascular coagulation, shock, and liver dysfunction as secondary consequences. Investigations are underway to determine whether liver injury is the initial cause of this cascade or a secondary consequence, as attempts to reduce the hepatic tropism of AAV vectors may be beneficial in the former case but not in the latter. Insufficient data are available in this example to distinguish these possibilities, and further studies are being investigated to fully elucidate the pathophysiology of liver toxicity after high systemic exposure to AAV vectors.

[00351] DRG degeneration after AAV administration has not been reported, although a strong tropism for DRG has been observed in some studies. See, for example, Gray, SJ, Kalburgi, SN, McCown, TJ & Samulski, RJ Global CNS gene delivery and evasion of anti-AAV neutralizing antibodies by intrathecal AAV administration in non-human Petition 870260060647, dated 06 / 22 / 2026, pp. 171 / 383 166 / 182 primates. Gene therapy 20, 450-459 (2013). The lesions observed in the present example consisted of degeneration of the cell bodies of DRG sensory neurons, as well as their central and peripheral axons. These lesions likely appeared more than 5 days after gene transfer, as they were absent in the NHP sacrificed 5 days after treatment, and clinical signs first appeared in piglets 13-14 days after vector administration. DRG lesions were slightly more severe in pigs than in NHPs, while degeneration of sensory axons in the spinal cord and peripheral nerves was similar or even milder in pigs compared to NHPs, an observation that may be explained by the earlier necropsy time point in the pigs, which may not have allowed for the degeneration of all axons associated with the dying cells.Sensory deficits were apparent in pigs, but not in NHPs, suggesting that the extent of DRG lesions in NHPs fell below a threshold at which clinical signs appear. The type of sensory fibers affected in both species was not characterized. Proprioception appeared to be affected based on the deficits observed in piglets; the impact on other sensory fibers was unclear and is still being characterized in subsequent studies.

[00352] T cell responses to a neoantigen are a theoretical cause of toxicity in any study evaluating the distribution of a xenogeneic human transgene to an animal model, or in clinical gene therapy studies for recessive diseases. Furthermore, capsid-derived peptides cross-presented on MHC class I by transduced cells have been identified as potential targets for cytotoxic T cell responses following AAV-mediated gene transfer. See, for example, Manno, CS, et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med 12, 342-347 Petition 870260060647, dated 06 / 22 / 2026, pp. 172 / 383 167 / 182 (2006); and Martino, AT, et al. Engineered AAV vector minimizes in vivo targeting of transduced hepatocytes by capsid-specific CD8+ T cells. Blood 121, 2224-2233 (2013). This latter mechanism has been proposed to be responsible for the transaminase elevations observed in some clinical trials of systemic AAV release, and the administration of glucocorticoids to suppress T cell responses has been employed to mitigate this risk. See, for example, Manno et al, 2006 as cited above and George, LA, et al. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. New England Journal of Medicine 377, 2215-2227 (2017). In this example, the transaminase elevations in NHPs appeared to have no correlation with T cell responses to the capsid product or transgene.T cell responses to the capsid product and the transgene were detected in lymphocytes collected from the liver, but not in the peripheral blood of one animal, demonstrating that responses can occur to both antigens, and that responses mediated in peripheral blood may not always reflect those occurring within the target organ. However, the animal with the most severe toxicity had no detectable T cell response in peripheral blood or liver lymphocytes, and another animal exhibiting a marked elevation of transaminase showed no T cell response in peripheral blood. Furthermore, the rapid onset of liver toxicity (less than 5 days) is not consistent with a T cell response in a naive host. The finding of liver toxicity in the absence of a T cell response suggests that an alternative mechanism is responsible for the liver injury.Possible causes may include toxicity caused by massive accumulation of vector capsid in the endosomal pathway, induction of DNA damage response by the release of a large number of vector genomes, toxicity of the transgenic product expressed at extremely high levels, or impairment of normal transcription and translation of host genes caused by... Petition 870260060647, dated 06 / 22 / 2026, pp. 173 / 383 168 / 182 high levels of transgene expression. Whether this toxicity is specific to the SMN transgene can be easily tested in preclinical studies; evaluating other possibilities requires more extensive research. Severe liver toxicity, coagulation abnormalities, thrombocytopenia, and shock were observed in an adult NHP treated with the same dose of a different AAV serotype carrying a green fluorescent protein transgene, demonstrating that these findings are not exclusive to AAVhu68 vectors or the SMN transgene (data not shown). It is important to emphasize that if there are non-immune mediated mechanisms of liver toxicity occurring in humans, the glucocorticoid administration protocols currently being incorporated into clinical trials may be ineffective in mitigating this risk.

[00353] A critical question for the field of AAV gene therapy is whether the toxicity observed in this study translates to humans and, if so, which animal models are sufficiently predictive of toxicity to allow for informative preclinical safety studies. Some SMA patients treated with a similar dose of a closely related AAV9 vector exhibited marked liver toxicity, suggesting that the hepatic findings in the present study may be applicable to humans, and that monkeys may be a predictive model. It is more difficult to determine whether the DRG toxicity observed in this example translates to humans. Sensory symptoms were not reported in the SMA clinical trial, although subclinical lesions similar to those of NHPs may not be observed in routine assessments.

[00354] The present findings raise important questions about the safety of systemic administration of AAV vectors at extremely high doses. The results shown in this example support the potential of high-dose AAV to effectively transduce cells. Petition 870260060647, dated 06 / 22 / 2026, pp. 174 / 383 169 / 182 critical targets, such as lower motor neurons, but demonstrate that the necessary doses may be associated with significant toxicity. An adult NHP treated with a 10-fold lower dose of an AAV9 vector was previously treated and no significant motor neuron transduction or toxicity was observed, demonstrating that the therapeutic index for systemic AAVs targeting motor neurons may be quite narrow. See, for example, Hinderer, C., et al. Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna. Molecular therapy. Methods & clinical development 1, 14051 (2014). Similar to the reported transaminase elevations in the SMA clinical trial, NHPs treated with the same vector dose in this study exhibited interindividual variation in the severity of liver toxicity, and 2 / 3 of NHPs demonstrated effective gene transfer with only asymptomatic laboratory abnormalities.This suggests that systemic AAV at high doses may be safe and effective in some patients, although the narrow therapeutic index and the severity of findings at extreme values ​​may mean that cases of severe toxicity arise as a larger number of patients are treated.

[00355] Studies are under investigation to understand the mechanism of hepatic and sensory neuron toxicity observed in this example, and the relevance of each to humans. Currently, experiments with non-human primates may be informative for assessing hepatic and neurological toxicity associated with systemic administration of high-dose AAVs, and these studies should be conducted before proceeding to the clinic. In clinical trials, hepatic toxicity should be carefully evaluated, as well as symptoms of sensory neuropathy. Objective assessments of toxicity to sensory neurons, including somatosensory evoked potentials and nerve conduction studies, may also be valuable. When Petition 870260060647, dated 06 / 22 / 2026, pp. 175 / 383 170 / 182 elevations of transaminase or other signs of toxicity are found in clinical trials with AAV; researchers should maintain a broad differential diagnosis, as both immune and non-immune mechanisms may be responsible. C. Materials and Methods:

[00356] Animal procedures: All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. For intravenous vector administration, the vector was diluted in sterile phosphate-buffered saline and infused via the saphenous vein (NHPs) or ear vein (piglets) over 10 minutes. Euthanasia was performed with pentobarbital overdose.

[00357] Histology: Tissues were fixed in formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin according to conventional protocols. Fibrinogen IHC was also performed according to conventional methods.

[00358] In situ hybridization (ISH) was performed on formalin-fixed paraffin-embedded tissues, not exceeding a fixation time of 24 h, using the ViewRNA ISH Tissue Assay Kit (Thermo Fisher), according to the manufacturer's protocol. Probes consisting of pairs of Z-shaped probes were synthesized by the kit manufacturer. Codon-optimized human SMN-specific probes were used alone or in combination with rhesus or pig CHAT probes as markers for motor neurons. Bound SMN probes were detected by the formation of Fast Red precipitates photographed with a rhodamine filter set. CHAT probes were detected by Fast Blue deposits photographed with a custom filter set (AVR Optics, Rochester, NY) made according to the kit manufacturer's specifications. Sections were contrasted with DAPI to show nuclei.

[00359] V...

Claims

1. Recombinant adeno-associated viral vector (rAAV), characterized in that it comprises an AAVhu68 capsid and at least one expression cassette, wherein the at least one expression cassette comprises nucleic acid sequences encoding an SMN1 protein, functional D isoform, and expression control sequences that direct the expression of SMN1 sequences in a host cell, wherein the rAAV has an AAVhu68 capsid comprising: AAVhu68 vp1 proteins produced by the expression of a nucleic acid sequence encoding amino acid sequences 1 to 736 of SEQ ID NO:8, or vp1 proteins produced from SEQ ID NO:7; AAVhu68 vp2 proteins produced by the expression of a nucleic acid sequence encoding amino acid sequences 138 to 736 of SEQ ID NO:8, or vp2 proteins produced from a sequence comprising at least the nucleotides... 412 to 2211 of SEQ ID NO:7,and vp3 proteins of AAVhu68 produced by the expression of a nucleic acid sequence encoding amino acid sequences 203 to 736 of SEQ ID NO:8, or vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO:

7.

2. rAAV vector, according to claim 1, characterized in that the encoded SMN protein is a D-isoform protein; optionally wherein (i) the encoded SMN D-isoform protein has the amino acid sequence SEQ ID NO: 2; and / or (ii) the nucleic acid sequence encoding the SMN D-isoform is selected from the group consisting of: Petition 870260060647, dated 22 / 06 / 2026, p. 189 / 383 2 / 4 (a) SEQ ID NO: 1 encoding an SMN protein having the amino acid sequence SEQ ID NO: 2; (b) SEQ ID NO: 3; (c) SEQ ID NO: 4; (d) SEQ ID NO: 5, or (e) SEQ ID NO:

6.

3. rAAV vector, according to claim 1 or 2, characterized in that the expression control sequences comprise a promoter; optionally where the promoter is a chicken β-actin (CB) promoter; preferably where the promoter is a CB7 promoter comprising a chicken beta-actin promoter and a cytomegalovirus enhancer.

4. Vector rAAV, according to any one of claims 1 to 3, characterized in that it further comprises (i) one or more of an enhancer, an intron, a Kozak sequence, a polyA, a post-transcriptional regulatory element; and / or (ii) inverted terminal repeat sequences (ITRs) of AAVs of an AAV other than the AAV that provides the capsid, optionally where the ITRs are of AAV2; and / or (iii) where the rAAV is a self-complementary AAV.

5. Recombinant adeno-associated virus (rAAV) vector according to any one of claims 1 to 4, characterized in that the AAVhu68 capsid comprises (a) AAVhu68 VP1, AAVhu68 VP2 and AAVhu68 VP3 proteins produced by the expression of a nucleic acid sequence encoding amino acid sequence 1 to 736 of SEQ ID NO:8; and / or (b) AAVhu68 VP1, AAVhu68 VP2 and AAVhu68 VP3 proteins that are, respectively, amino acids 1 to 736, Petition 870260060647, dated 06 / 22 / 2026, p. 190 / 383 3 / 4 amino acids 138 to 736 and amino acids 203 to 736 of SEQ ID NO:8, which further comprise at least 60% deamidation of asparagines at positions 57, 329, 452 and 512 of SEQ ID NO: 8, as determined using mass spectrometry.

6. Recombinant adeno-associated virus (rAAV) vector, characterized in that it comprises a vector genome in an AAVhu68 capsid, wherein the vector genome comprises a 5' AAV inverted terminal repeat (ITR), a CB7 promoter comprising a cytomegalovirus enhancer and a chicken beta-actin promoter, an intron, nucleic acid sequences of SEQ ID NO:1, a polyA, and a 3' AAV ITR, and wherein the AAVhu68 capsid comprises AAVhu68 vp1 proteins produced by the expression of a nucleic acid sequence encoding amino acid sequences 1 to 736 of SEQ ID NO:8, or vp1 proteins produced from SEQ ID NO:7, AAVhu68 vp2 proteins produced by the expression of a nucleic acid sequence encoding amino acid sequences of at least about amino acids 138 to 736 of SEQ ID NO:8, or vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO:7,and vp3 proteins of AAVhu68 produced by the expression of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:8, or vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO:

7.

7. Recombinant adeno-associated virus (rAAV), according to claim 6, characterized in that the vector genome has the sequence SEQ ID NO: 15 or SEQ ID NO:

25.

8. Adeno-associated virus (AAV) vector, according to Petition 870260060647, dated 06 / 22 / 2026, pp. 191 / 383 4 / 4, any of claims 1 to 7, characterized in that the AAV is useful for the treatment of spinal muscular atrophy in a patient.

9. Pharmaceutical composition, characterized in that it comprises a pharmaceutically acceptable vehicle, excipient and / or preservative and an AAV vector, as defined in any one of claims 1 to 8.

10. Composition, according to claim 9, or rAAV, according to any one of claims 1 to 8, characterized in that it is for use in the treatment of spinal muscular atrophy.

11. Use of rAAV, as defined in any one of claims 1 to 8, characterized in that it is for the preparation of a composition for the treatment of spinal muscular atrophy in a mammal, preferably in a human.

12. Composition according to claim 10, characterized in that said rAAV is in a composition formulated for intrathecal administration.

13. Composition according to claim 9, characterized in that said rAAV is suspended in an aqueous solution with a pH of 7.2 to 7.8.