Method for improving the efficiency of a plant's transformation process

Abstract

The present invention provides a method for improving the transformation efficiency of a plant. The method according to the present invention comprises the use of a nucleic acid encoding the amino acid sequence described in sequence ID no. 2 or 4, or a nucleic acid encoding a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in sequence ID no. 2 or 4 and that has the function of improving the transformation efficiency of a plant.

Description

1 / 56 Descriptive Report of the Invention Patent for METHOD FOR IMPROVING THE TRANSFORMATION EFFICIENCY OF A PLANT. TECHNICAL FIELD

[001] The present invention relates to a method for improving the transformation efficiency of a plant and a method for transforming a plant.

[002] The present invention also relates to a nucleic acid construct. The nucleic acid construct according to the present invention can be used in a method to improve the transformation efficiency of a plant or in a method to transform a plant.

[003] The present invention also relates to the transformed plant.

[004] The present invention also relates to an application of a TaWox5 wheat gene in improving the efficiency of monocotyledon processing, especially wheat, corn and rice. PREVIOUS TECHNIQUE

[005] Since the success of plant transgene technology in Since 1983, the use of genetic engineering to improve plants has grown very rapidly. By 2016, a total of 28 countries worldwide planted transgenic crops covering an area of ​​179.7 million hectares, an increase of approximately 100 times compared to 1996, and about 18 million farmers have benefited from cultivating transgenic crops. The cultivation of transgenic crops has not only increased productivity and income, but has also reduced pesticide use, protected the environment and biodiversity, and improved the quality of agricultural products. However, commercially planted transgenic crops worldwide are currently limited to insect-resistant corn and cotton, soybeans, and... Petition 870240088548, dated 10 / 16 / 2024, page 7 / 121 2 / 56 herbicide-resistant rapeseed, antiviral papaya, etc., and there is no wheat and other major cereal crops. In contrast, global research and industrialization of transgenic wheat are clearly lagging behind. Besides limitations in safety, industrial policies, understanding of the genetic functions of transgenic varieties, inefficient genetic transformation techniques are the main limiting link in transgenic wheat research and development (Harwood, (2012) J. Exp. Bot. Mar;63(5):17918). In order to cultivate transgenic wheat with disease resistance, drought tolerance, salt tolerance, high quality, and efficient nutrient uptake, it is necessary to identify the functions of a large number of candidate genes.Since the expression of the target gene is affected by factors such as insertion sites and the number of insertion copies, as well as by the exogenous insertion of genes in the inheritance and functions of the endogenous gene, it is necessary to obtain a certain number of transgenic plants to identify the functions of each candidate gene. Furthermore, with the completion of the wheat genome sequencing work, a large number of genes will be cloned and subjected to functional research. Therefore, it is urgently necessary to improve the efficiency of wheat transformation, expand the scale of transformation, establish an efficient, safe, and large-scale transgenic technology system, and promote the industrialization of transgenic wheat and the functional genomic research process of wheat, because transgenic wheat research and the development and functional genomic research of wheat require a large number of transgenic plants.

[006] Among the major crops, wheat is a difficult crop for genetic transformation (Harwood, 2012). The efficiency of genetic transformation is low and reproducibility is poor. The genetic engineering process is obviously lagging behind crops such as soybeans, corn, cotton, and rice. It is known Petition 870240088548, dated 10 / 16 / 2024, page 8 / 121 3 / 56 Japan Tobacco Inc. has significantly increased the efficiency of wheat genetic transformation in recent years, and Australia could use this technology to improve wheat transformation efficiency by about 40% (Richardson et al., (2014) Plant Cell Tiss. Organ. Cult.; 64(1):1-19). But this technology only has effects on Fielder, Westonia, and some genotypes; most wheat varieties still have low transformation efficiency or cannot even be transformed. This unit introduced this technology in 2014. Through digestion, absorption, and enhancement of the technology, the transformation efficiency of the Fielder and CB037 wheat genotypes also reaches 40%, and 15 commercial varieties, such as Zhoumai 18, Yangmai 16, and Ji 5264, are successfully transformed.However, except that the transformation efficiency of Kenong 199 reaches 20%, the transformation efficiency of other varieties is not high, with Jimai 22 having a transformation efficiency of only 2.7%, Zhongmai 895 only 3.6%, and Aikang 58 and Jing 411 not being successfully transformed. Considering the prospect of industrializing transgenic wheat, breeders need to use wheat varieties that are promoted over a large area as transformation recipients, and therefore, the transformation of commercial wheat varieties is the biggest limiting factor.

[007] WUSCHEL genes (WUS genes) are homeodomain transcription factors that enhance or suppress the expression of other genes. Most of them are known to be expressed asymmetrically along the embryonic apical-basal axis. Plural genes with the WUS homeobox have been found in several plants and these genes are called WOX.

[008] WUS / WOX is considered to play an important role in maintaining seedling stem cells in early development. WUS / WOX has been found in many plants, Petition 870240088548, dated 10 / 16 / 2024, page 9 / 121 4 / 56 including Arabidopsis, petunia, corn and rice.

[009] The document, Graaff et al. (Genome Biology, 2009, 10, 248) is a review of the WOX family. 14 members of the WOX family, WOX1 to WOX14, are listed in the document. Among the WOX family members, WOX5 was originally identified in rice and considered to be involved in lateral root formation and shoot formation in early development. It plays an important role in stem cell maintenance. As cell differentiation prevents further elongation in the meristem (root covering, apical bud) in particular, cells in such parts are maintained with suppressed differentiation (stem cell maintenance) to allow for greater growth, and the genes responsible for maintenance are considered to be WUX.

[0010] It has been suggested that WUS / WOX may promote callus formation in somatic embryogenesis (e.g., Ikeuchi et al., The Plant Cell, 2013, 25, 3159-3173). However, it has been reported that overexpression of WUS / WOX alone results in negative phenomena, including callus death, lack of rediffering, or abnormal morphologies that do not develop into normal individuals (Plant Journal, 30 (3), 2000). Therefore, measures such as controlling the expression of the WUS / WOX gene at an inducible promoter, introducing a nucleic acid different from the desired nucleic acid to be expressed, such as BBM (Baby Boomer), or removing the WUS / WOX gene when it becomes unnecessary have been implemented.

[0011] In addition to the wheat mentioned above, for example, soybeans, beans, red peppers, and similar crops are difficult to cultivate and are considered so-called difficult-to-grow species. Furthermore, even within a single species, there are varieties (e.g., B73 maize) that are more difficult to cultivate compared to general research varieties (e.g., A188 in the case of maize). There are no methods Petition 870240088548, dated 10 / 16 / 2024, page 10 / 121 5 / 56 effective methods have been obtained for the efficient transformation of plants, particularly plants or varieties considered difficult to cultivate to obtain transformed plants, and the development of such a method has been desired. LIST OF QUOTES Patent Literature

[0012] PTL 1: JP 2010-166924 A

[0013] PTL 2: WO2007 / 148819 Non-Patent Literature

[0014] NPL 1: Harwood, (2012) J. Exp. Bot. Mar;63 (5): 1791-8

[0015] NPL 2: Richardson et al., (2014) Plant Cell Tiss. Organ. Cult 119 , 647–6

[0016] NPL 3: Graaff et al

[0017] NPL 4: Ikeuchi et al

[0018] NPL 5: Plant Journal 30(3)2000

[0019] NPL 6: Xu et al., (1996) Plant Mol. Biol. 30:387

[0020] NPL 7: Ohshima et al,.(1990) Plant Cell 2:95

[0021] NPL 8: Aguan et al., (1993) Mol. Gen. Genet. 240:1

[0022] NPL 9: Van Breusegem et al., (1994) Planta 193:57

[0023] NPL 10: Nundy et al., (1990) Proc. Natl. Acad. Sci. USA 87: 1406

[0024] NPL 11: Schulze-Lefert et al., (1989) EMBO J. 8:651

[0025] NPL 12: Walker et al., (1987) Proc. Natl. Acad. Sci. USA 84:6624

[0026] NPL 13: Shinozaki, K. and Yamaguchi-Shinozaki, K., (2000). Curr. Open. Plant Biol. 3, 217-2

[0027] NPL 14: Gupta et al., (2012) Plant Cell Rep. 31: 839-850

[0028] NPL 15: Xu et al., (1995) Plant Mol Biol 27:237-248

[0029] NPL 16: Komari et al., (1996) Plant J, 10:165-174

[0030] NPL 17: Komori et al., (2004) Plant J, 37: 315-325 Petição 870240088548, de 16 / 10 / 2024, pág. 11 / 121 6 / 56

[0031] NPL 18: Wang et. (2017) Plant biotechnology journal 15: 614-623

[0032] NPL 19: Rongcheng Wang, Rui Zhang, Acta Agriculturae Boreali-occidentalis Sinica, (2012), 21 (6): 63-66

[0033] NPL 20: Ishida, et al., (2015) In Agrobacterium Protocols: Volume 1. Methods in Molecular Biology, vol.1223 (Wang, K., ed), pp.189-198.Nova York: Springer Science + Business Media

[0034] NPL 21: Yin Gui-xiang et al., (2014) Journal of Plant Genetic Resources, DOI:10.13430 / j.cnki.jpgr.2014.06.022

[0035] NPL 22: Barcelo and Lazzeri, (1995) Plan Gene Transfer and Expression protocols pp 113-123

[0036] NPL 23: Medvecká E. et al., (2015), In Agrobacterium Protocols: Volume 1. Methods in Molecular Biology, vol. 1223 (Wang, K., ed), pp. 199-209. New York: Springer Science + Business Media.

[0037] NPL 24: Ishida et al., (2007) NATURE PROTOCOLS, vol. 2, No. 7, 1614-1621 SUMMARY OF THE INVENTION TECHNICAL PROBLEM

[0038] One objective of the present invention is to provide an effective method for improving the transformation efficiency of a plant and a method for transforming a plant. SOLUTION TO THE PROBLEM

[0039] The present invention includes the following non-limiting embodiments. [Modality 1]

[0040] A method for improving the transformation efficiency of a plant, comprising making 1) a nucleic acid encoding the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid encoding a polypeptide comprising an amino acid sequence that Petition 870240088548, dated 10 / 16 / 2024, p. 12 / 121 7 / 56 has at least 85% identity with the amino acid sequence described in SEQ ID NO: 2 and has a function that improves the transformation efficiency of a plant; or 2) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 4 and has a function that improves the transformation efficiency of a plant, overexpressed in the plant. [Modality 2]

[0041] The method according to embodiment 1, comprising the production of a nucleic acid encoding a polypeptide comprising an amino acid sequence with an identity of at least 85% with the amino acid sequence described in SEQ ID NO: 2 or 4 and having a function that improves the efficiency of plant transformation, overexpressed in the plant. [Modality 3]

[0042] The method according to modality 1 or 2, in which the plant is a monocotyledon. [Modality 4]

[0043] The method according to any of the modalities 1 to 3, in which the plant is selected from the group consisting of maize, wheat, barley, rice, sorghum and rye. [Modality 5]

[0044] The method according to any of the modalities 1 to 4, in which the improvement in the transformation efficiency of a plant comprises one or more of: a) improved efficiency of callus formation in the plant; b) improved plant redifferentiation rate; and Petition 870240088548, dated 10 / 16 / 2024, page 13 / 121 8 / 56 c) improved efficiency of gene transfer. [Modality 6]

[0045] A nucleic acid construct comprising: 1) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 2 and that has a function that improves the transformation efficiency of a plant; or 2) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 4 and that has a function that improves the transformation efficiency of a plant, and

[0046] a promoter for the production of a nucleic acid in the plant. [Modality 7]

[0047] The nucleic acid construct according to the modality 6, where the promoter is a constitutive promoter, an inducible promoter, or a site-specific promoter. [Modality 8]

[0048] A method for transforming a plant, comprising introducing into a plant a nucleic acid construct according to embodiment 6 or 7 and a nucleic acid desired to be expressed in the plant. [Modality 9]

[0049] The method for transformation according to the modality 8, in which the nucleic acid construct according to modality 6 Petition 870240088548, dated 10 / 16 / 2024, page 14 / 121 9 / 56 or 7 or the nucleic acid desired to be produced in the plant is expressed transiently. [Modality 10]

[0050] A transformed plant obtained by the transformation method according to embodiment 9 or 10. [Modality 11]

[0051] A nucleic acid construct comprising: 1) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 2 and that has a function that improves the transformation efficiency of a plant; or 2) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 4 and that has a function that improves the transformation efficiency of a plant;

[0052] a promoter for the production of a nucleic acid in the plant; and

[0053] a nucleic acid desired to be produced in the plant. [Modality 12]

[0054] The nucleic acid construct according to the modality 11, in which 1) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in Petition 870240088548, dated 10 / 16 / 2024, page 15 / 121 10 / 56 SEQ ID NO: 2 and that has a function that improves the transformation efficiency of a plant; or 2) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence having at least 85% identity with the amino acid sequence described in SEQ ID NO: 4 and having a function that improves the transformation efficiency of a plant; and

[0055] a nucleic acid desired to be produced in the plant,

[0056] are connected directly or via a linker. [Modality 13]

[0057] The nucleic acid construct according to the modality 12, where the desired nucleic acid to be produced in the plant is connected to the 3' end of nucleic acid 1) or 2). [Modality 14]

[0058] A method for transforming a plant, comprising introducing a nucleic acid construct in accordance with any of embodiments 11 to 13 into a plant. [Modality 15]

[0059] The method for transformation according to the modality 14, in which a nucleic acid construct according to any of the embodiments 11 to 13 is transiently expressed. [Modality 16]

[0060] A transformed plant obtained by the transformation method according to embodiment 14 or 15.

[0061] In other respects, the present invention also includes the following embodiments. [Modality 17]

[0062] An application of a TaWox5 protein, or a gene Petition 870240088548, dated 10 / 16 / 2024, p. 16 / 121 11 / 56 encoding of said gene or an expression cassette containing said gene or a recombinant vector containing said gene, or a recombinant bacterium containing said gene, to improve the efficiency of transformation of a nucleic acid molecule into a target plant. [Modality 18]

[0063] An application of a TaWox5 protein or a gene encoding such protein or an expression cassette containing said gene that promotes the introduction of a nucleic acid molecule into a target plant. [Modality 19]

[0064] The application according to embodiment 17 or 18, in which the TaWox5 protein is derived from wheat;

[0065] or an amino acid sequence of the TaWox5 protein is the SEQ ID NO. 2). [Modality 20]

[0066] The application in accordance with any of the modalities to 19, in which

[0067] a gene encoding the TaWox5 protein are molecules of DNA, as described in any one of the following 1) to 3): 1) DNA molecules in 11825-12573 that have a nucleotide sequence with SEQ ID NO:1; 2) DNA molecules that have greater than 95%, 98%, or 99% homology with the DNA molecules shown in 1); 3) DNA molecules hybridized under stringent conditions with the DNA sequence defined by 1) and encoded with the same functional polypeptide. [Modality 21]

[0068] The application according to any of the modalities at 20, where the plant is wheat. Petition 870240088548, dated 10 / 16 / 2024, p. 17 / 121 12 / 56 [Modality 22]

[0069] The application in accordance with any of the modalities to 21, in which,

[0070] the nucleic acid molecule is a plasmid;

[0071] or the nucleic acid molecule is a plasmid and the plasmid is pDE003. [Modality 23]

[0072] A method for improving the transformation efficiency of a nucleic acid molecule in a target plant, comprising the following step of transferring an expression cassette containing a gene encoding a TaWox5 protein and the nucleic acid molecule to the target plant to improve the transformation efficiency of the nucleic acid molecule in the target plant. [Modality 24]

[0073] The method according to modality 23, in which,

[0074] the TaWox5 gene is derived from wheat;

[0075] a gene encoding the TaWox5 protein are molecules of DNA, as described in any one of the following 1) to 3): 1) DNA molecules in 11825-12573 that have a nucleotide sequence with SEQ ID NO:1; 2) DNA molecules that have greater than 95%, 98%, or 99% homology with the DNA molecules shown in 1); 3) DNA molecules hybridized under stringent conditions with the DNA sequence defined by 1) and encoded with the same functional polypeptide;

[0076] the expression cassette containing the gene has DNA molecules, as described in either of the following a) c) d) e): a) DNA molecules in 9812-12837 that have a nucleotide sequence with SEQ ID NO:1; Petition 870240088548, dated 10 / 16 / 2024, p. 18 / 121 13 / 56 b) DNA molecules with homology greater than 95%, 98% or 99% with the DNA molecules shown in 1); c) DNA molecules hybridized under stringent conditions with the DNA sequence defined by 1) and encoded with the same functional polypeptide. [Modality 25]

[0077] The method according to modality 23 or 24, in which,

[0078] the plant is wheat;

[0079] or the nucleic acid molecule is a plasmid;

[0080] or the nucleic acid molecule is a plasmid and the plasmid is pDE003. [Modality 26]

[0081] The method according to modality 25, in which,

[0082] the expression cassette containing the gene encoding the TaWox5 protein and the nucleic acid molecule are transferred to the target plant via the pDE003-TaWox5 vector; the nucleotide sequence of the pDE003-TaWox5 vector is SEQ ID NO:1 ADVANTAGEOUS EFFECTS OF THE INVENTION

[0083] In the present invention, the transformation efficiency (callus formation / redifferentiation efficiency) of plants has been improved solely by overexpression of nucleic acid 1) or 2), which is a gene related to WOX5, without driving the expression of another gene, such as BBM genes, different from the gene of interest, controlling the expression or eliminating or removing the WOX5-related gene. In particular in wheat, callus formation and redifferentiation have been successfully conducted with elite varieties, including difficult-to-grow varieties. Furthermore, also in maize, callus formation of the difficult-to-grow variety (B73) was successfully achieved for the first time and redifferentiation also became possible. B73 is known to be one of the most difficult varieties to obtain callus formation. Petition 870240088548, dated 10 / 16 / 2024, p. 19 / 121 14 / 56 of calluses and redifferentiation. According to the present invention, it has become possible to transform B73. Thus, it is expected that other plants and varieties that are difficult to cultivate will be similarly transformed according to the present invention.

[0084] In addition, transformed plants expressing a chimeric protein of a nucleic acid-encoded protein from 1) or 2) and a protein of interest have been successfully obtained.

[0085] By means of the above method to improve the transformation efficiency of the nucleic acid molecule in the target plant, the transformation efficiency when TaWox5 and other nucleic acid molecules are mixed and introduced into the target plant is greater than the transformation efficiency when other nucleic acid molecules are introduced into the target plant alone.

[0086] According to the present invention, the TaWox5 wheat gene is cloned and the result of introducing the gene into a different wheat variety shows that the gene can significantly improve the efficiency of wheat processing. Therefore, not only has the processing efficiency of easy-to-process wheat varieties, such as Fielder, been improved, but also the processing efficiency of difficult-to-process wheat varieties, such as Jimai 22, Aikang 58 and Jing 411, and the problem of genotype limitation in wheat processing is solved. BRIEF DESCRIPTION OF THE DRAWINGS

[0087] Figure 1 is a schematic diagram of a pDE001 vector.

[0088] Figure 2 is a schematic diagram of a pDE003 vector.

[0089] Figure 3 is a schematic diagram of a pDE003TaWox5 vector.

[0090] Figure 4 is a result of PCR detection of a gene. Bar.

[0091] Figure 5 is a schematic diagram of a pCUB vector. Petition 870240088548, dated 10 / 16 / 2024, p. 20 / 121 15 / 56 DESCRIPTION OF THE MODALITIES 1. Method for improving plant transformation efficiency

[0092] In one aspect, the present invention relates to a method for improving the transformation efficiency of a plant.

[0093] Without limitation, the method for improving the transformation efficiency of a plant comprises overexpression in the plant: 1) of a nucleic acid encoding the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid encoding a polypeptide comprising an amino acid sequence having at least 85% identity with the amino acid sequence described in SEQ ID NO: 2 and having a function that improves the transformation efficiency of a plant; or 2) of a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 4 and having a function that improves the transformation efficiency of a plant; (1) Nucleic acid

[0094] The nucleic acid according to the present invention is 1) of a nucleic acid encoding the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid encoding a polypeptide comprising an amino acid sequence having at least 85% identity with the amino acid sequence described in SEQ ID NO: 2 and having a function that improves the transformation efficiency of a plant; or 2) of a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence Petition 870240088548, dated 10 / 16 / 2024, p. 21 / 121 16 / 56 described in SEQ ID NO: 4 and that has a function that improves the transformation efficiency of a plant.

[0095] The amino acid sequence described in SEQ ID NO: 2 is an amino acid sequence encoded by a WOX5-related gene (TaWox5 gene) derived from wheat found in the present invention. The WOX-related gene (TaWox5 gene) derived from wheat has the amino acid sequence described in SEQ ID NO: 2. The amino acid sequence described in SEQ ID NO: 2 is encoded by the nucleic acid sequence shown in SEQ ID NO: 11 (cDNA sequence) which corresponds to nucleotides 11825 to 12573 of the nucleic acid sequence described in SEQ ID NO: 1 (genome DNA sequence).

[0096] The amino acid sequence shown in SEQ ID NO: 4 is an amino acid sequence encoded by a WOX5-related gene (osTaWox5 gene) derived from rice. The WOX5-related gene derived from rice has an amino acid sequence of SEQ ID NO: 4. The amino acid sequence of SEQ ID NO: 4 is encoded by the nucleic acid sequence described in SEQ ID NO: 12 (cDNA sequence) corresponding to the nucleic acid sequence shown in SEQ ID NO: 3 (genome DNA sequence).

[0097] Nucleic acid 1) is a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence with at least 85% identity to the amino acid sequence described in SEQ ID NO: 2 and with a function that improves the transformation efficiency of a plant. Nucleic acid 2) is a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence with at least 85% identity to the amino acid sequence described in SEQ ID NO: 4 Petition 870240088548, dated 10 / 16 / 2024, p. 22 / 121 17 / 56 and with a function that improves the transformation efficiency of a plant.

[0098] The amino acid sequence encoded by the nucleic acid 1) or nucleic acid 2) includes a variant of the amino acid sequence described in SEQ ID NO: 2 or SEQ ID NO: 4 and, more specifically, amino acid sequences with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity with the amino acid sequence presented in SEQ ID NO: 2 or SEQ ID NO: 4. In one aspect, the amino acid sequence encoded by nucleic acid 1) or nucleic acid 2) according to the present invention includes an amino acid sequence that has at least 95% identity with the amino acid sequence described in SEQ ID NO: 2 or SEQ ID NO: 4.

[0099] As used herein, the % identity between 2 amino acid sequences can be determined by visual inspection and a mathematical calculation. Furthermore, the % identity can be determined using a computer program. Examples of such a computer program include BLAST and ClustalW. In particular, the conditions (parameters) for identity searching using the BLAST program are those described in Altschul et al. (Nucl. Acid Res. 25, p. 3389-3402, 1997) and are publicly available on the NCBI and DNA Data Bank of Japan (DDBJ) websites (BLAST manual, Altschul et al. NCB / NLM / NIH Bethesda, MD 20894; Altschul et al.). Furthermore, the percentage of identity can be determined using a program such as the genetic information processing program GENETYX Ver. 7 (GENETYX), DNASIS Pro (Hitachi Software Engineering Co., Ltd.) or Vector NTI (Infomax).

[00100] Nucleic acid 1) or nucleic acid 2) may have the nucleic acid sequence described in SEQ ID NO: 11 or a variant Petition 870240088548, dated 10 / 16 / 2024, page 23 / 121 18 / 56 of the nucleic acid sequence described in SEQ ID NO: 12.

[00101] Specifically, the nucleic acid may be, for example, a nucleic acid sequence modified from the nucleic acid sequence described in SEQ ID NO: 11 or the nucleic acid sequence described in SEQ ID NO: 12 by deletion, substitution, insertion, or addition of 1 or more nucleotides.

[00102] As used herein, deletion, substitution, insertion or addition of one or more nucleotides relative to a nucleic acid sequence refers to a nucleic acid sequence in which one or more nucleotides are deleted or replaced by other nucleotides, other nucleotides are inserted and / or other nucleotides are added compared to a target nucleic acid sequence. "Multiple nucleotides" means, without limitation, 600 or less, 300 or less, 150 or less, 100 or less, 50 or less, 30 or less, 20 or less, 15 or less, 12 or less, 10 or less, 8 or less, 6 or less, 4 or less, 3 or less nucleotides. Alternatively, the expression "multiple nucleotides" means nucleotides that make up 30%, preferably 25%, 20%, 15%, 10%, 5%, 3%, 2%, or 1% of the total length of the nucleic acid sequence.It is preferred that no phase change occurs in the sequence encoding amino acids through the deletion, substitution, insertion, or addition of the aforementioned nucleotides.

[00103] Alternatively, nucleic acid 1) or nucleic acid 2) comprises nucleotides 11825 to 12573 of the nucleic acid sequence described in SEQ ID NO: 1 or a nucleic acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity with the nucleic acid sequence described in SEQ ID NO 3 or consists of any of these nucleic acid sequences. In one aspect, nucleic acid 1) or nucleic acid 2) according to the present invention Petition 870240088548, dated 10 / 16 / 2024, page 24 / 121 19 / 56 comprises a nucleic acid sequence with at least 95% identity to the nucleic acid sequence described in SEQ ID NO: 11 or the nucleic acid sequence described in SEQ ID NO: 12.

[00104] As used herein, the % identity between 2 amino acid sequences can be determined by visual inspection and a mathematical calculation. Additionally, the % identity can be determined using a computer program. Examples of such a computer program for sequence comparison include the BLASTN program (Altschul et al. (1990) J. Mol. Biol., 215: 403-10), version 2.2.7, or the WU-BLAST 2.0 algorithm, available on the U.S. National Library of Medicine website: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi. The standardized parameter settings for WU-BLAST 2.0 described on the website: http: / / blast.wustl.edu can be used.

[00105] Alternatively, nucleic acid 1) or nucleic acid 2) may be a nucleic acid that hybridizes with the nucleic acid sequence described in SEQ ID NO: 11 or the nucleic acid sequence described in SEQ ID NO: 12 under stringent conditions. Alternatively, nucleic acid 1) or nucleic acid 2) may be a nucleic acid that hybridizes with a nucleic acid complementary to the nucleic acid sequence described in SEQ ID NO: 11 or the nucleic acid sequence described in SEQ ID NO: 12 under stringent conditions.

[00106] The expression “under stringent conditions” as used here means hybridization under moderately or highly stringent conditions. Specifically, moderately stringent conditions can be easily determined by an average person, for example, based on DNA length. The basic conditions are illustrated in Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6-7, Cold Spring Harbor Laboratory Press, 2001. Preferably, examples of the conditions Petition 870240088548, dated 10 / 16 / 2024, p. 25 / 121 Moderately stringent conditions include hybridization conditions of 1xSSC to 6xSSC and 42°C to 55°C, more preferably conditions of 1xSSC to 3xSSC and 45°C to 50°C, and most preferably conditions of 2xSSC and 50°C. If the hybridization solution contains, for example, approximately 50% formamide, a temperature 5 to 15°C below the temperatures described above will be used. Examples of washing conditions include 0.5xSSC to 6xSSC at 40°C to 60°C. In hybridization and washing, 0.05% to 0.2%, preferably approximately 0.1%, of SDS can generally be added. Highly stringent conditions can be easily determined by a specialist in the technique, for example, based on the length of the DNA. In general, highly stringent conditions (high stringency) involve hybridization and / or washing at a higher temperature and / or lower salt concentration than those of moderately stringent conditions.Examples of conditions include hybridization conditions that are 0.1xSSC to 2xSSC and 55°C to 65°C, more preferably conditions that are 0.1xSSC to 1xSSC and 60°C to 65°C, and most preferably conditions that are 0.2xSSC and 63°C. Examples of washing conditions include conditions that are 0.2xSSC to 2xSSC and 50°C to 68°C, and most preferably 0.2xSSC and 60 to 65°C.

[00107] Nucleic acid 1) and nucleic acid 2) encode polypeptides that function to improve the transformation efficiency of a plant. Nucleic acid 1) and nucleic acid 2) are WOX5-related genes. In one aspect, nucleic acid 1) and nucleic acid 2) maintain functions that WOX5-related genes have (including functions of the proteins encoded by WOX5-related genes). An example of the functions encoded by WOX5-related genes is the maintenance of stem cells.

[00108] The identity between the amino acid sequences of SEQ ID Petition 870240088548, dated 10 / 16 / 2024, p. 26 / 121 21 / 56 The identity of the nucleic acid sequence described in SEQ ID NO: 2 and SEQ ID NO: 4 is 79%. The identity of the nucleic acid sequence described in SEQ ID NO: 11 and the nucleic acid sequences described in SEQ ID NO: 12 is 84%. (2) Plant

[00109] In the present invention, the type of plant whose transformation efficiency is to be improved is not particularly limited.

[00110] The plant may be a dicotyledon or a monocotyledon and is preferably a monocotyledon. More preferably, it is a plant of the Poaceae family, more preferably it is maize, wheat, barley, rice, sorghum, rye or similar and most preferably it is maize, wheat or rice.

[00111] The method according to the present invention can be used for a plant or variety considered to be difficult to cultivate in particular, but without limitation. The expression difficult to cultivate means that it is difficult to grow and, more specifically, that it is difficult, for example, to grow isolated cells from the plant body, to form calluses by treatment such as dedifferentiation or to redifferentiate calluses into plant bodies.

[00112] In general, monocots are more difficult to grow than dicots, but examples of difficult-to-grow plants include soybeans, beans, and red peppers. The expression difficult-to-grow varieties means varieties that are more difficult to grow than general research varieties (such as A188 for maize) of the same species. Examples of these include B73 maize or elite maize varieties derived from B73; elite wheat varieties (e.g., TAM); barley varieties other than Golden Promise and Igri; and sorghum varieties other than 296B, C401, SA281, P898012, Pioneer 8505, and Tx430. (3) Superexpression

[00113] In the present invention, a gene is overexpressed in a Petition 870240088548, dated 10 / 16 / 2024, page 27 / 121 22 / 56 plant.

[00114] The term making (a nucleic acid) overexpressed (here, also simply referred to as expressed) refers to the artificial expression of a nucleic acid that is not expressed under natural conditions or to the artificial expression of a nucleic acid in an amount greater than that expressed under natural conditions.

[00115] The means for nucleic acid overexpression are not particularly limited. Any known means that allows the overexpression of a nucleic acid in plants (including any form such as eggs, sperm, seeds, cells, immature embryos, mature embryos, calluses, and adult plants) can be used. A gene can be introduced into a plant by a gene transfer technique such as, but not particularly limited to, Agrobacterium-mediated gene transfer after incorporation of a foreign gene into a vector. Furthermore, a gene present in a plant can be overexpressed using a technique such as genome editing.

[00116] The method of gene transfer for the introduction of an exogenous nucleic acid is not particularly limited and examples of the same include well-known methods such as Agrobacterium-mediated gene transfer, polyethylene glycol (PEG) method, whisker method, microinjection, glass bead method, particle bombardment and electroporation.

[00117] The technique of genome editing for the overexpression of a gene present in a plant is not particularly limited. Examples of this include the CRISPR-Cas method, the TALLEN method, zinc finger-mediated mutagenesis, cooling, homologous recombination, oligonucleotide-specific mutagenesis, meganuclease-mediated mutagenesis, and a combination thereof. Examples of methods include, without limitation, methods for editing the promoter of an endogenous gene to overexpress the gene and Petition 870240088548, dated 10 / 16 / 2024, page 28 / 121 23 / 56 methods for editing a portion of an endogenous gene to transform it into gene sequences according to the present invention.

[00118] In one aspect, overexpression includes not only the constitutive overexpression of the nucleic acid mentioned above, but also transient or site-specific overexpression. (4) Transformation efficiency

[00119] The method according to the present invention improves the transformation efficiency of a plant. The expression "improving transformation efficiency" generally refers to one or more of: a) improving the efficiency of callus formation in the plant; b) improving the rate of plant redifferentiation; and c) improving the efficiency of gene transfer. Improving transformation efficiency is preferably improving the efficiency of callus formation and / or improving the rate of redifferentiation, and even more preferably improving the efficiency of callus formation.

[00120] The term "improve" refers, without limitation, to improving the efficiency of plant callus formation, the rate of plant redifferentiation, or the efficiency of gene transfer, for example, 1.5 or more times, 2 or more times, 3 or more times, 4 or more times, or 5 or more times compared to that when the aforementioned nucleic acid is not overexpressed. Alternatively, it refers to making plant callus formation, plant redifferentiation, or gene transfer possible when this is not possible without overexpression of the aforementioned nucleic acid.

[00121] For example, in the Examples described below, both the efficiency of callus formation and the efficiency of redifferentiation were improved solely by the overexpression of the aforementioned nucleic acid in wheat. Furthermore, callus formation in maize, which was impossible before the present invention, became possible. 2. Nucleic acid construct (Modality A) Petition 870240088548, dated 10 / 16 / 2024, p. 29 / 121 24 / 56

[00122] In one aspect, the present invention relates to a nucleic acid construct (embodiment A).

[00123] Without limitation, the nucleic acid construct (modality A) comprises: 1) a nucleic acid encoding the amino acid sequence described in SEQ ID NO: 2 or a nucleic acid encoding a polypeptide comprising an amino acid sequence having at least 85% identity with the amino acid sequence described in SEQ ID NO: 2 and having a function that improves the transformation efficiency of a plant; or 2) a nucleic acid that encodes the amino acid sequence described in SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence described in SEQ ID NO: 4 and that has a function that improves the transformation efficiency of a plant and a promoter for the production of a nucleic acid in the plant.

[00124] Nucleic acid 1) or 2) as described in “1. Method for improving plant transformation efficiency” above. (1) Prosecutor

[00125] The nucleic acid construct of the present invention includes a promoter for expressing the nucleic acid in a target plant.

[00126] The promoter is not particularly limited as long as the promoter can achieve a transcription of a nucleic acid of interest in a target plant cell. In one embodiment, the promoter is a constitutive promoter, an inducible promoter, or a site-specific promoter.

[00127] Examples of promoters include the cauliflower mosaic virus 35S promoter (CaMV35S), various ubiquitin promoters, various actin promoters, the tobacco PR1a gene promoter, Petition 870240088548, dated 10 / 16 / 2024, p. 30 / 121 25 / 56 promoter of the nopalin synthase gene, promoter of the napin gene, promoter of the oleosin gene and similar genes.

[00128] In one embodiment, an inducible promoter may be used. Examples of inducible promoters include a known promoter whose expression is induced by external factors such as infection or invasion by filamentous fungi, bacteria, or viruses; low temperature, high temperature, drying, or irradiation with ultraviolet rays; application of specific chemicals such as hormones like auxin and brassinosteroid; and other external factors. More specific examples of promoters include the promoter of the rice chitinase gene (Xu et al. 1996 Plant Mol. Biol. 30: 387) and the promoter of the tobacco PR protein genes (Ohshima et al. 1990 Plant Cell 2: 95), whose expressions are induced by infection or invasion by filamentous fungi, bacteria, or viruses; the promoter of the rice lip19 gene (Aguan et al. 1993 Mol. Gen. Genet. 240:1) whose expression is induced by low temperature; the rice hsp80 and hsp72 gene promoters (Van Breusegem et al.1994 Planta 193: 57), whose expression is induced by high temperature; the promoter of the Arabidopsis thaliana rab16 gene (Nundy et al. 1990 Proc.Natl.Acad. Sci. USA 87: 1406), whose expression is induced by drying; the promoter of the parsley chalcone synthase gene (Schulze-Lefert et al. 1989 EMBO J. 8: 651), whose expression is induced by ultraviolet irradiation; the promoter of the corn alcohol dehydrogenase gene (Walker et al. 1987 Proc. Natl.Acad.Sci.USA 84: 6624) whose expression is induced by anaerobic conditions; and the promoter whose expression is induced by saline stress (Shinozaki, K. and Yamaguchi-Shinozaki, K., Curr. Opin. Plant Biol. 3, 217-223 (2000)). In addition, the tetracycline-inducible system that utilizes the tetracycline resistance operon (tet operon) found in the tetracycline-induced E. coli Tn10 transposon; the amino acid sequence of LexA (amino acids 1-87), a repressor. Petition 870240088548, dated 10 / 16 / 2024, p. 31 / 121 26 / 56 of the estradiol-induced E. coli SOS regulon; the transcriptional active site (amino acid residues 403-479) of VP16 (amino acid sequence) from Herpes Simplex virus (HSV); the synthetic transcriptional activator XVE (amino acid sequence) prepared by fusing the regulatory region of the human estrogen receptor (amino acid residues 282-595); and the transcriptional induction system in which a plurality of SOS boxes (5'-TACTGTATATATACAGTA-3'), originally an operator to which LexA binds, are arranged upstream of the TATA box of the CaMV 35S minimal promoter as cis sequences to which XVE binds.

[00129] A site-specific promoter can also be used. Examples of site-specific promoters include a leaf-specific promoter for expressing a nucleic acid (e.g., rice psb0 gene promoter (JP-A-2010-166924)), a stem-specific promoter for expressing a nucleic acid (e.g., Arabidopsis thaliana FA6 promoter (Gupta et al. 2012 Plant Cell Rep 31: 839-850)), a root-specific promoter for expressing a nucleic acid (e.g., RCc3 promoter (Xu et al. 1995 Plant Mol Biol 27: 237-248)), and promoters that express primarily in vegetative organs of roots, stems, and leaves (e.g., Arabidopsis thaliana AS promoter).

[00130] In one embodiment of the present invention, simply by overexpressing the nucleic acid, it is possible to form a callus on the target plant that had difficulty forming callus and improve transformation efficiency. Without limitation, in one embodiment, the promoter is not an inducible promoter, but a constitutive promoter. (2) Vector

[00131] The nucleic acid of 1) or 2) and the promoter for expressing the nucleic acid in a target plant can be linked to either vector. A vector is a nucleic acid molecule for amplifying, Petition 870240088548, dated 10 / 16 / 2024, p. 32 / 121 27 / 56 To maintain and introduce a recombinant nucleic acid to be used in recombinant gene technology. The vector containing a nucleic acid and a promoter to express the nucleic acid in a target plant as a whole may be referred to as a nucleic acid construct or a vector. Note that the vector may be linear or circular, and preferably circular.

[00132] A recombinant vector can be used to link the nucleic acid and the promoter to express the nucleic acid in a target plant in a conventional manner. The vector used in the present invention is not particularly limited, provided it can be used to achieve the desired effects of the present invention in a target plant cell. For example, pBI series vectors, pBluescript series vectors, and pUC series vectors can be used. Examples of pBI series vectors include pBI121, pBI101, pBI101.2, pBI101.3, and pBI221. Binary vectors, such as pBI series vectors, are preferred because they can introduce a nucleic acid of interest via Agrobacterium into a target plant. Examples of pBluescript series vectors include pBluescript SK(+), pBluescript SK(), pBluescript II KS(+), pBluescript II KS(-), pBluescript II SK(+), and pBluescript II SK(-). Examples of vectors in the pUC series include pUC19 and pUC119.Vectors from the pBluescript and pUC series are preferred because they can directly introduce a nucleic acid into a target plant. In addition, binary vectors such as the pGreen series (www.pgreen.ac.uk), the pCAMBIA series (www.cambia.org), and vectors from the pLC series (WO2007 / 148819), and superbinary vectors such as pSB11 (Komori et al., 1996, Plant J, 10: 165-174) and pSB200 (Komori et al., 2004, Plant J, 37: 315-325) may also be used preferentially. Furthermore, vectors made by combining these parts may also be used preferentially. Petition 870240088548, dated 10 / 16 / 2024, page 33 / 121 28 / 56

[00133] The vector of the present invention may also contain a transformant identification marker. As the marker, for example, a drug-selectable marker gene may be used. The drug-selectable marker gene is not particularly limited and any known gene may be used. Specific examples of drug-selectable marker genes include the gentamicin resistance gene, the kanamycin resistance gene, the ampicillin resistance gene, the spectinomycin resistance gene, the tetracycline resistance gene, the hygromycin resistance gene, and various other drug-selectable marker genes. In addition, a phosphinothricin acetyltransferase (bar) gene resistant to the herbicide phosphinothricin and similar substances may be used. Furthermore, a marker gene labeled with a fluorescent material, such as DsRed2 (TaKaRa-Bio) and GFP, may be used.

[00134] The vector of the present invention may also contain a transcription terminator sequence and the like. The transcription terminator sequence is not particularly limited as long as it has a function as a transcription termination site and may be any known transcription terminator sequence. The transcription terminator sequence is selectable depending on the promoter used, and examples include a transcription termination region of the cauliflower mosaic virus 35S (CaMV35S terminator) and a transcription termination region of the nopalin synthase gene (Nos terminator). In the recombinant expression vector described above, by arranging the transcription terminator sequence in an appropriate location, it is possible to prevent the occurrence of phenomena such as the synthesis of unnecessarily long transcripts after the vector is introduced into a target plant cell.

[00135] In addition, the recombinant expression vector may also contain other nucleic acid segments. The other nucleic acid segment Petition 870240088548, dated 10 / 16 / 2024, page 34 / 121 29 / 56 nucleic acid is not particularly limited, and examples include a transformant selection marker, an enhancer, and a nucleotide sequence to increase translation efficiency. Furthermore, the recombinant expression vector described above may also include a T-DNA region. The T-DNA region, especially when the recombinant expression vector is introduced into a target plant using Agrobacterium, can enhance gene transfer efficiency. Note that the number of T-DNAs per recombinant expression vector is not predetermined and can be selected according to the purpose.

[00136] Examples of nucleotide sequences to increase translation efficiency include an omega sequence from the tobacco mosaic virus. By arranging the omega sequence in the untranslated region of the promoter (5'UTR), it is possible to increase the translation efficiency of the fusion gene.

[00137] In addition, examples of the enhancer include an enhancer region containing an upstream sequence within the CaMV35S promoter. Thus, the recombinant expression vector described above can include various nucleic acid segments, depending on the purpose.

[00138] The nucleic acid construct of the present invention (embodiment A) can be used in a method to improve transformation efficiency in a target plant and / or in a transformation method of a target plant of the present invention. The present invention includes the use of the nucleic acid construct in the method to improve transformation efficiency in a target plant and the use of the nucleic acid construct in the transformation method. 3. Transformation method (mode A)

[00139] In one embodiment, the present invention includes a method for transforming a target plant (embodiment A). Petition 870240088548, dated 10 / 16 / 2024, p. 35 / 121 30 / 56

[00140] The method of transforming a target plant (modality A) includes introducing the nucleic acid construct (modality A) and a desired nucleic acid to be expressed in a target plant into the target plant.

[00141] The desired nucleic acid to be expressed in a target plant (Gene of interest: GOI) is a nucleic acid that possesses any of the sequences to be introduced into a target plant cell and is not particularly limited. It can be a nucleic acid sequence encoding an amino acid sequence (structural gene) or it can be a non-structural gene. The nucleic acid sequence of interest can be linked to a desired promoter and terminator. For example, it can be a combination of a gene capable of achieving a desired trait (phenotype) by overexpression in a target plant and a promoter, and it can be, as RNAi, a nucleic acid sequence capable of achieving a desired trait by suppressing an endogenous plant gene. Additionally, it can be a nucleic acid sequence for performing genome editing, such as a gene encoding the Cas protein and a guide sequence.

[00142] The nucleic acid length is not particularly limited, but preferably is a length suitable to be introduced into a target plant cell with the nucleic acid construct (embodiment A) and expressed. Without limitation, the length is 100 kbp or less, preferably 50 kbp or less, more preferably 30 kbp, 10 kbp or less, and 1 kbp or less.

[00143] The means of introducing the nucleic acid construct (modality A) and the desired nucleic acid to be expressed in a target plant into the target plant is not particularly limited. Without limitation, the means may include incorporating a foreign gene into a vector or similar and then introducing the gene into a target plant by a gene transfer method, such as the method Petition 870240088548, dated 10 / 16 / 2024, page 36 / 121 31 / 56 Agrobacterium. Alternatively, the means of introducing the nucleic acid construct (modality A) and the desired nucleic acid to be expressed in a target plant into the target plant may include the modality in which a gene present in a target plant is edited using genome editing or similar techniques and expressed.

[00144] The order of introduction is not limited, provided that the nucleic acid construct (modality A) and the nucleic acid desired to be expressed in a target plant have been introduced at a given point in the target plant transformation process. The nucleic acid construct and the nucleic acid desired to be expressed in a target plant can be introduced simultaneously (co-transformation) or a transformed plant obtained by introducing the nucleic acid construct can be generated beforehand and then the nucleic acid desired to be expressed in the target plant will be introduced into the generated transformed plant or vice versa.

[00145] The nucleic acid construct and the desired nucleic acid to be expressed in a target plant may be present in different vectors or may be present in one vector. When both are present in one vector, they may be under the control of the same promoter or may be under the control of different promoters. The nucleic acid construct and the desired nucleic acid to be expressed in a target plant may be introduced into the target plant while remaining in the linear fragment and then expressed.

[00146] Cotransformation is the transformation of two or more independent exogenous genetic materials at the same time. Examples of the cotransformation method include a method for introducing a plurality of binary vectors, each with a plurality of T-DNA, during a single gene transfer to a target plant (multi-vector method), a method for introducing a binary vector with two or more T-DNAs during a single transfer of Petition 870240088548, dated 10 / 16 / 2024, p. 37 / 121 32 / 56 gene (one vector, multiple T-DNA method), a method for introducing a binary vector with only one T-DNA during a single gene transfer and arranging a T-DNA that constitutes two or more genes using two or more right-edge sequences (one vector, two-edge method: Yau and Stewart, 2013); and a method for introducing a binary vector with only one T-DNA, the T-DNA possessing two or more promoters, nucleic acids desired to be expressed in a target plant, and terminators during a single gene transfer (one vector, one T-DNA method). In the present invention, any of these means can preferably be carried out.

[00147] The type of vector for introducing the nucleic acid construct and the desired nucleic acid to be expressed in a target plant is not particularly limited. Any vector as described in 2. nucleic acid construct (embodiment A) can be used. In the case of the multi-vector method, the vector can be used in any combination.

[00148] Furthermore, the nucleic acid construct and / or the nucleic acid desired to be expressed in a target plant may be expressed transiently or in a stable manner. In one embodiment, without limitation, the nucleic acid construct or the nucleic acid desired to be expressed in a target plant is expressed transiently. 4. Transformed Plant (Mode A)

[00149] In one embodiment, the invention relates to the transformed plant (embodiment A).

[00150] The transformed plant of the present invention (embodiment A) is a transformed plant obtained by the transformation method of the present invention (embodiment A). In particular, the present invention has made it possible, for the first time, to supply a transformed plant. Petition 870240088548, dated 10 / 16 / 2024, p. 38 / 121 33 / 56 in so-called difficult-to-grow plants or varieties. In the transformed plant of the present invention, the nucleic acid is constitutively, transiently, or specifically overexpressed at the site. 5. Nucleic acid construct (mode B)

[00151] In one embodiment, the present invention relates to a nucleic acid construct (embodiment B).

[00152] Without limitation, the nucleic acid construct (modality B) includes 1) a nucleic acid that encodes the amino acid sequence of SEQ ID NO: 2 or a nucleic acid that encodes a polypeptide that has an amino acid sequence that is at least 85% identical to the amino acid sequence of SEQ ID NO: 2 and that has a function that improves the transformation efficiency of a plant; or 2) a nucleic acid that encodes the amino acid sequence of SEQ ID NO: 4 or a nucleic acid that encodes a polypeptide comprising an amino acid sequence that has at least 85% identity with the amino acid sequence of SEQ ID NO: 4 and that has a function that improves the transformation efficiency of a target plant; a promoter to express the nucleic acid in a target plant and a nucleic acid desired to be expressed in the target plant.

[00153] The nucleic acid of 1) or 2) is as described above in 1. Method for improving transformation efficiency in the target plant. The promoter for expressing the nucleic acid in a target plant is as described above in 2. Nucleic acid construct (embodiment A). The nucleic acid desired to be expressed in a target plant is as described above in 3. Transformation method (embodiment A).

[00154] The nucleic acid of 1) or 2) and the promoter to express the Petition 870240088548, dated 10 / 16 / 2024, page 39 / 121 34 / 56 nucleic acids in a target plant can be linked to any vector. Vector is as described above in 2. Nucleic acid construct (modality A).

[00155] By expressing the nucleic acid construct (modality B) in a target plant, a fusion protein composed of the protein encoded by nucleic acid 1) or 2) and the protein encoded by the desired nucleic acid, i.e., the chimeric protein, is obtained. The method for preparing the chimeric protein is not particularly limited, and any known genetic manipulation technique can be used to express the chimeric protein.

[00156] Without limitation, in one embodiment, the nucleic acid of 1) or 2) and the nucleic acid desired to be expressed in a target plant is linked directly or through a linker. In another embodiment, the nucleic acid desired to be expressed in a target plant is linked to the 3' side of the nucleic acid of 1) or 2).

[00157] In the chimeric protein obtainable by expression of the nucleic acid construct (embodiment B) in a target plant, the protein encoded by nucleic acid 1) or 2) and the protein encoded by the desired nucleic acid can be linked directly or through a linker. The linker is not particularly limited and can be an amino acid linker. In one embodiment, the length of the amino acid linker is, without limitation, 1 or more amino acid residues, 2 or more amino acid residues, 3 or more amino acid residues, 4 or more amino acid residues, 5 or more amino acid residues, 8 or more amino acid residues, 10 or more amino acid residues, and 12 or more amino acid residues. In one embodiment, the length of the amino acid linker is, without limitation, 50 amino acid residues or less, 40 amino acid residues or less, 30 amino acid residues or less, 25 amino acid residues or less, 20 amino acid residues or less, 15 amino acid residues or less. Petition 870240088548, dated 10 / 16 / 2024, page 40 / 121 35 / 56 less and 12 amino acid residues or less. In one embodiment, the length of the amino acid linker is, without limitation, in the range of 1 to 50 amino acid residues, preferably 5 to 25 amino acid residues. It is preferable that the linker does not affect the functions of the protein encoded by nucleic acid 1) or 2) and the protein encoded by the desired nucleic acid and, for example, neutral amino acids such as glycine, serine, or alanine are preferred.

[00158] In chimeric protein, the protein encoded by nucleic acid 1) or 2) can be ligated on the N-terminal side or the C-terminal side of the protein encoded by the desired nucleic acid. Preferably, the protein encoded by nucleic acid 1) or 2) is on the N-terminal side of the protein encoded by the desired nucleic acid. In Example 5, higher transformation efficiency was obtained when the protein encoded by nucleic acid 1) or 2) was on the N-terminal side.

[00159] The nucleic acid construct of the present invention (embodiment B) can be used in a method to improve transformation efficiency in a target plant and / or in a transformation method of a target plant of the present invention. The present invention includes the use of the nucleic acid construct in a method to improve transformation efficiency in a target plant and the use of the nucleic acid construct in a transformation method. 6. Transformation method (mode B)

[00160] In one embodiment, the present invention includes a method for transforming a target plant (embodiment B).

[00161] The transformation method of the present invention (embodiment B) includes introducing the nucleic acid construct (embodiment B) into a target plant.

[00162] The nucleic acid construct (modality B) is as described in 5. Nucleic acid construct (modality B). The medium Petition 870240088548, dated 10 / 16 / 2024, p. 41 / 121 36 / 56 to introduce a nucleic acid construct (mode B) into a target plant is not particularly limited and as described in 3. Transformation method (mode A). By performing the transformation method of a target plant (mode B) on the target plant, a fusion protein composed of the proteins encoded by the nucleic acid of 1) or 2) and the protein encoded by the desired nucleic acid, i.e., the chimeric protein, is expressed in the target plant.

[00163] Without limitation, in one embodiment, the nucleic acid construct (embodiment B) is transiently expressed. 7. Transformed plant (type B)

[00164] In one embodiment, the present invention relates to the transformed plant (embodiment B).

[00165] The transformed plant of the present invention (embodiment B) is a transformed plant obtained by the transformation method of the present invention (embodiment B). The present invention has made it possible, especially for the first time, to supply a transformed plant in so-called difficult-to-grow plants or varieties. In the transformed plant of the present invention (embodiment B), the chimeric protein of the protein encoded by the nucleic acid of 1) or 2) and the protein encoded by the desired nucleic acid is constitutively, transiently, or specifically overexpressed at the site. EXAMPLES

[00166] Hereafter, the present invention will be described in detail with reference to examples, but the present invention is not limited to those examples. Those skilled in the art can easily add modifications and / or alterations to the present invention based on the description contained herein, and the modified and / or altered inventions are also included in the technical scope of the present invention.

[00167] The experimental methods used in the following examples Petition 870240088548, dated 10 / 16 / 2024, p. 42 / 121 37 / 56 are conventional methods unless otherwise specified.

[00168] Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

[00169] The plasmids and strains illustrated in the examples below are for purposes of further elaboration of the present invention and are not intended to limit the substantial content of the present invention. Where specific test conditions are not indicated, conventional conditions well known to those skilled in the art, such as those described by Sambrook, et al., in Molecular Cloning: The Experimental Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or those suggested by the manufacturer, shall apply. Example 1

[00170] The plasmids and strains illustrated in this example are derived from the following: - a pMD-18T cloning vector is a commercially available product from Takara; - The plant expression vectors pDE001 and pDE003 are commercially available products from Biodee; - Escherichia coli TOP 10 is commercially available from Beijing TransGen Biotech; Escherichia coli PRK2013 and Agrobacterium tumefaciens C58C1 are preserved by this laboratory. - Kenong 199, Lunxuan 987, Jimai 22, Aikang 58, Yangmai 16, Jing 411, Fielder, CB037 and Xinong 979 are all registered in the following literature: Wang et al., 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacteria-mediated cotransformation strategy in commercial Chinese wheat varieties. Journal of Plant Biotechnology 15: 614-623; Rongcheng Wang, Rui Zhang, Effect of Fertilizer Application on the Limit and Population of Strong Gluten Wheat Petition 870240088548, dated 10 / 16 / 2024, p. 43 / 121 38 / 56 Xinong 979, Acta Agriculturae Boreali-occidentalis Sinica, 2012, 21 (6): 63-66.

[00171] This example describes the cloning of TaWox5 genes from wheat and its application in wheat transgenes. I. Cloning of Wheat TaWox5 Genes;

[00172] Initiators' Project: (F: GTGTCAATGGAGGCGCTGAGCG; R: GTGTCAATGGAGGCGCTGAGCG)) (SEQ ID NO:5 and SEQ ID NO:6)

[00173] Genomic DNA from a CB037 wheat variety is extracted as a template and subjected to AS-PCR amplification using the F and R primers described above to obtain fragments of approximately 760 bp.

[00174] The PCR product is connected to a pMD-18T vector to obtain pMD-18T-TaWox5 and sent for sequencing.

[00175] The sequencing result is that the PCR product has the nucleotide shown in SEQ ID NO: 1 in a sequence table, named the TaWox5 gene. The gene is 749 bp long, contains a 116 bp intron, and encodes 210 amino acids. The amino acid sequence of a protein encoded by the gene is SEQ ID NO: 2, which is called TaWox5.

[00176] SEQ ID NO: 1 can also be artificially synthesized and connected to a pMD-18T vector to obtain pMD-18T-TaWox5. II. Application of the TaWox5 Gene in Wheat Transgenes 1. Construction of the Plant Transformation Vector pDE003-TaWox5

[00177] The Wox5SmaF initiators: AAACCCGGGATGGAGGCGCTGAGCGG and Wox5KpnR: AAAGGTACCTTAGACCAGATACCGAT (SEQ ID No: 7 and 8), respectively, are subjected to PCR amplification with pMD18T-TaWox5 as a template using the high-fidelity KOD enzyme. Then, the PCR product and the pDE001 vector (Figure 1) are subjected to... Petition 870240088548, dated 10 / 16 / 2024, p. 44 / 121 39 / 56 to enzymatic digestion with Kpnl and Smal to obtain a PCR amplification product of 773 bp and a pDE001 vector scaffold with 4535 bp. Finally, the PCR amplification product with 773 bp and the pDE001 vector scaffold with 4535 bp are combined to obtain an intermediate plant expression vector pDE001-TaWox5. pDE001-TaWox5 and pDE003 (Figure 2) are then subjected to enzymatic digestion with HindIII to obtain an enzyme-digested TaWox5 product with 3033 bp and the pDE003 vector scaffold with 10170 bp. Finally, the two enzyme-digested products are combined to obtain a final plant expression vector pDE003TaWox5 (Figure 3).

[00178] A nucleotide sequence of the pDE003-TaWox5 vector is SEQ ID NO: 1, which is a vector obtained by inserting DNA molecules (an expression cassette containing the TaWox5 gene) shown in 9812-12837 at SEQ ID NO: 1 into the HindIII enzymatic digestion sites of the pDE003 vector.

[00179] In SEQ ID NO: 1, sites 7832-9817 are from a UBI promoter, sites 7257-7808 are from a Bar gene, sites 6989-7242 are from a Nos terminator, sites 9818-11815 are from a UBI promoter, sites 11825-12573 are from a TaWox5 gene, and sites 12586-12837 are from a Nos terminator.

[00180] The plant expression vector pDE003-TaWox5 is transferred to Escherichia coli Top 10 to obtain an Escherichia coli Top 10 strain containing pDE003-TaWox5. 2. Transfer of the recombinant plasmid pDE003-TaWox5 to Agrobacterium C58C1 1) A host strain of Agrobacterium C58C1 (Wang et. Al., 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties, Plant biotechnology journal 15: 614-623) is Petition 870240088548, dated 10 / 16 / 2024, p. 45 / 121 40 / 56 cultured in a 4 ml test tube containing Rif, Gen LB medium at 180 rpm for 40 hours at 28°C to obtain a solution of Agrobacterium C58C1 bacteria.

[00181] A Top 10 strain of Escherichia coli containing pDE003TaWox5 and adjuvant bacterium PRK2013 (Wang et al., 2017 Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties, Plant biotechnology journal 15: 614-623) are cultured in a 4 ml test tube containing Kan LB medium at 225 rpm for 16 ha at 37°C to obtain a solution of Top 10 Escherichia coli bacteria containing pDE003-TaWox5 and a solution of PRK2013 bacteria. 2) 100 μI of Agrobacterium C58C1 bacterial solution, Escherichia coli Top 10 bacterial solution containing pDE003-TaWox5, and PRK2013 bacterial solution are added respectively to a 1.5 ml centrifuge tube and mixed uniformly; only 100 μI of the Agrobacterium C58C1 bacterial solution and the PRK2013 bacterial adjuvant solution are added, respectively, to a 1.5 ml centrifuge tube as a control and centrifuged at 4000 rpm for 3 min to collect the stems. 3) The supernatant is discarded, the remaining supernatant is aspirated with a pipette, 50 μl of antibiotic-free LB medium is added, and the stems are resuspended. 4) The thalli are added to a solid LB culture medium without antibiotics. Take care not to agitate the flat plates so that the thalli are clumped together and sealed with a sealing film after the flat plates are aerated and cultured at 28°C for 24 h. 5) A small amount of thalli is extracted from the bacterial clump with an inoculation needle, inoculated into a solid LB medium containing Rif, Gen, Kan and cultured at 28°C for 48 h, with a target bacterium and a control being inoculated into each flat plate. Petition 870240088548, dated 10 / 16 / 2024, page 46 / 121 41 / 56 6) Individual clones are selected from the triplet hybridized plates, and positive Agrobacterium strains are identified by PCR.

[00182] The primers for identification by PCR are primers F and R and, as a result, a positive Agrobacterium strain with 700 bp is obtained.

[00183] The positive strain of Agrobacterium is a recombinant bacterium obtained by transferring the recombinant plasmid pDE003-TaWox5 to Agrobacterium C58C1, named Agrobacterium C58C1 containing pDE003-TaWox5.

[00184] The empty vector pDE003 is transferred to Agrobacterium C58C1 by the same method to obtain a recombinant bacterium called Agrobacterium C58C1 containing pDE003. 3. Wheat Transformation Mediated by Agrobacterium

[00185] Detailed steps and methods refer to Wang et al., 2016 and Ishida et al., 2015, which are specifically as follows: 1) Four days prior to infection, Agrobacterium C58C1 containing pDE003TaWox5 and Agrobacterium C58C1 containing pDE003 are inoculated onto a solid YEP medium containing Gent 50 mg L-1, Spec 50 mg L-1 and Rif 50 mg L-1, respectively, and resuscitated at 28°C for 3 days in the dark. Single colonies are collected, added to a 10 ml liquid YEP medium containing Gent 50 mg L-1, Spec 50 mg L-1 and Rif 50 mg L-1, and shaken and cultured overnight at 200 rpm at 28°C in the dark. 2) Agrobacterium thalli are collected by centrifugation at 3500 rpm for 10 minutes at room temperature. The supernatant is discarded. The Agrobacterium thalli are resuspended with resuspension MS (basic medium 1 / 10 MS (Beijing Ximeijie Technology Co., Ltd., Item M519, glucose 10 g L-1)) to obtain an Agrobacterium C58C1 resuspension containing pDE003-TaWox5 and an Agrobacterium C58C1 resuspension containing pDE003. Petition 870240088548, dated 10 / 16 / 2024, page 47 / 121 42 / 56 3) Different varieties of immature wheat embryos (approximately 14 days after flowering), appropriate in size, are selected and equally divided into two parts, which are mixed with Agrobacterium C58C1 resuspension containing pDE003-TaWox5 and Agrobacterium C58C1 resuspension containing pDE003 and infected, and then plated on a basic AS co-culture medium (basic medium 1 / 10 MS, glucose 10 g L-1, agarose 8 g L-1) at 25°C for 3 days. 4) The co-cultured immature embryos are transferred to a WLS-RES recovery medium (MS basic medium, 2,4-D 0.5 mg L-1, picloram 2.2 mg L-1, CB 400 mg L-1, Cef 100 mg L-1) for 5 days in the dark. 5) Immature embryos subjected to recovery culture are transferred to a first screening medium WLS-P5 (MS basic medium, 2,4-D 0.5 mg L-1, picloram 2.2 mg L-1, PPT 5 mg L-1, Cb 400 mg L-1, Cef 100 mg L-1) for 14 days in the dark. 6) Next, the callus is transferred to the first WLS-P10 tracking medium (MS basic medium, 2,4-D 0.5 mg L-1, picloram 2.2 mg L-1, PPT 10 mg L-1, Cb 400 mg L-1) and cultured for 21 days in the dark. 7) The callus is transferred to an LSZ-P5 differentiation medium (MS medium, PPT 5 mg L-1) and cultured for 2 weeks under light. 8) Green wheat shoots are separated and placed in an MSF-P5 rooting medium (MS medium, PPT 5 mg L-1, IBA 0.5 mg L-1) and grown for 21 days. 9) Seedlings with well-developed roots are transplanted into the soil to obtain trans-pDE003-TaWox5 seedlings and trans-pDE003 seedlings. 4. Identification of Positive Seedlings 1) PCR method

[00186] Trans-pDE003-TaWox5 seedlings are subjected to PCR amplification using Bar primers (pDE003 vector containing the Bar gene) (F: ACCATCGTCAACCACTACATCG; R: GCTGCCAGAAACCACGTCATG). (SEQ ID NO: 9 and SEQ ID NO: 10) Petition 870240088548, dated 10 / 16 / 2024, p. 48 / 121 43 / 56

[00187] The results are shown in Figure 4, in which M: 5,000 bp DNA marker; CK: Fielder common wheat; 1-15: trans-pDE003-TaWox5 seedlings and it can be seen that 429 bp fragments are trans-pDE003-TaWox5 positive seedlings.

[00188] pDE003 seedlings are subjected to PCR amplification and, as a result, 429 bp fragments are trans-pDE003 positive seedlings.

[00189] The results above indicate that all transgenic seedlings are positive. 2) Statistical Analysis of Transformation Efficiency

[00190] Transformation efficiency = (positive number of plantlets / number of immature embryos) *%

[00191] The results are shown in Table 1. Compared with the trans-empty pDE003 vector, the trans-pDE003-TaWox5 vector can significantly improve the transformation efficiency of wheat of the same variety, for example, the transformation efficiency of the Fielder control is 45.3%, while the transformation efficiency of the trans-TaWox5 vector reaches up to 154%; the transformation efficiency of Kenong 199 is 22.7% and the transformation efficiency of the trans-TaWox5 vector is improved to about 70%; the transformation efficiency of the trans-TaWox5 vectors of varieties with lower transformation efficiency, such as Jimai 22, Lunxuan 987 and Yangmai 16, is improved to more than 20%, respectively; Furthermore, the transformation efficiency of trans-TaWox5 vectors of varieties such as Aikang 58, Jing 411, and Xinong 979, which were previously untransformable, can reach more than 10%, respectively.

[00192] It can be observed that TaWox5 can significantly improve the efficiency of wheat transformation and solve the genotype problem of wheat transformation. Petition 870240088548, dated 10 / 16 / 2024, p. 49 / 121 Table 1: Comparison of Control Vector and TaWox5 Vector Transformation Efficiencies Varieties pDE003 pDE003- TaWox5 Number of immature embryos Positive plants Transformation Efficiency (%) Number of immature embryos Positive plants Transformation Efficiency (%) Kenong 199 122 20 17.6 263 207 78.7 Zhoumai 18 335 48 14.3 333 573 172.1 Lunxuan 987 323 9 2.8 361 151 41.8 Jingdong 18 178 21 11.8 117 36 30.8 Jimai 22 342 19 5.5 2762 1333 48.3 Zhongmai 895 222 8 3.6 99 114 115.2 AK58 434 0 0 88 10 11.4 Yangmai16 196 5 2.6 85 22 25.9 Jing411 305 4 1.3 141 29 20.6 154.0 Xinong 979 144 0 0 245 41 16.7 44 / 56 Petition 870240088548, dated 10 / 16 / 2024, p. 50 / 121 Bs366 272 0 0 Sumai 3 150 4 2.67 Sunstate 113 0 0 Ningchun 4 136 0 0 Zhengmai 1860 84 4 4.8 Chinese Spring 124 0 0 84 50 59.5 284 166 58.5 224 26 11.6 214 31 14.5 300 73 24.3 96 12 12.5 45 / 56 Petition 870240088548, dated 10 / 16 / 2024, p. 51 / 121 46 / 56 Example 2

[00193] In this example, it was examined whether overexpression of the TaWox5 and GUS genes as GOI leads to an increase in transformation efficiency using the bombardment method in wheat.

[00194] First, a callus was prepared from immature wheat embryos (variety: Fielder) as follows. The wheat callus (variety: Fielder) was prepared according to Ke Wang, et al. (Ke Wang, Huiyun Liu, Lipu Du and Xingguo Ye (2017) Plant Biotechnology Journal 15, pp. 614-623) and Ishida, et al. (Ishida, Y., Tsunashima, M., Hiei, Y. and Komari, Y. (2015) Transformation of wheat (Triticum aestivum L.) using immature embryos. In Agrobacterium Protocols: Volume 1. Methods in Molecular Biology, vol. 1223 (Wang, K., ed), pp. 189-198. New York: Springer Science + Business Media.) Immature embryos were isolated from immature seeds under a stereomicroscope. The embryos were transferred to WLS-Res medium without cefotaxime and carbenicillin. After 2 days, the embryonic axis was excised from the immature embryos using a scalpel and forceps and then placed in WLS-Res medium without cefotaxime and carbenicillin for 5 days.The tissues were transferred to callus induction medium (WLS-P5) and cultured for 2 weeks.

[00195] The plasmid containing the TaWox5 gene and GUS as GOI was prepared as described below. First, the plasmid containing GUS was prepared as pAH006 containing GUS and bar (Yin Gui-xiang et al., (2014) Journal of Plant Genetic Resources, DOI:10.13430 / j.cnki.jpgr.2014.06.022. pDE003-TaWox5 prepared in Example 1 was also used in this experiment.

[00196] pAH006 and pDE003-TaWox5 and pAH006 as a negative control were transferred to wheat callus (Fielder) by gene gun and then placed in WLS-Res medium without cefotaxime and carbenicillin for 5 more days. Gene induction by the particle gun method was conducted according to Barcelo and Lazzeri (Plant Petition 870240088548, dated 10 / 16 / 2024, p. 52 / 121 47 / 56 Gene Transfer and Expression Protocols (1995) pp 113-123, Transformation of Cereals by Microprojectile Bombardment of Immature Inflorescence and Scutellum Tissues). The callus in which the vectors were induced was redifferentiated to obtain the transformed plant (transpAH006 + pDE003-TaWox5 and trans-pAH006 as control) and then statistical analysis on the efficiency of the transformation was conducted according to Example 1.

[00197] As a result, the transformation efficiency of transpAH006 + pDE003-TaWox5 was 9.55%, much higher than that of the control, 4.04%. Furthermore, the transformants grew normally and without negative effects on their morphology. Example 3

[00198] In this example, it was examined whether overexpression of the TaWox5 and GUS genes as GOI leads to an increase in transformation efficiency using mature embryos in wheat.

[00199] First, a callus was prepared from mature wheat embryos (variety: Fielder) as follows. Mature wheat grains (variety: Verry and CB037) were sterilized with 70% ethanol for 10 min, immersed in 25% bleach for 25 min, and then soaked in sterile water overnight at 25°C in the dark after being washed with sterile water three times. Slightly germinated seeds were sterilized again with 25% bleach for 15 min and then rinsed with sterile water three times.

[00200] Mature embryos in seeds placed on sterile filter paper were carefully and completely scraped into small, thin pieces (0.1 mm thick and 0.5 mm in diameter) with a sharp knife using back-and-forth movements 5 to 6 times, and the scraped tissues were gently inoculated into callus induction medium for one week.

[00201] The positive strain of Agrobacterium was a bacterium. Petition 870240088548, dated 10 / 16 / 2024, p. 53 / 121 48 / 56 recombinant plants were obtained by transferring the recombinant plasmid pDE003-TaWox5 or empty pDE003 into Agrobacterium C58C1. Agrobacterium C58C1 containing pDE003-TaWox5 or empty pDE003 was infected with the callus, followed by redifferentiation to obtain the transformed plants according to Example 1. Statistical analysis of transformation efficiency in the transformed plants was conducted according to Example 1.

[00202] The result was shown in Table 2. Although no transformant was obtained using the empty pDE003 vector, some transformant was obtained and the transformation efficiency using pDE003-TaWox5 was 1.19% and 1.81%, respectively. This result shows that the TaWox5 gene can significantly improve the transformation efficiency of mature embryos in both varieties, Verry and CB037. Petition 870240088548, dated 10 / 16 / 2024, p. 54 / 121 Table 2 Variety pDE003 pDE003- TaWox5 Number of immature embryos Positive plants Transformation Efficiency (%) Number of immature embryos Positive plants Transformation Efficiency (%) Verry 228 0 0 252 3 1.19 CB037 381 0 0 441 8 1.81 Total 1218 0 0 1386 22 1.59 49 / 56 Petition 870240088548, dated 10 / 16 / 2024, p. 55 / 121 50 / 56

[00203] All methods and other steps were in accordance with Medvecká and Harwood (2015) (Medvecká E. and Harwood WA (2015) Wheat (Triticum aestivum L.) transformation using mature embryos. In Agrobacterium Protocols: Volume 1. Methods in Molecular Biology, vol.1223 (Wang, K., ed), pp. 199-209. New York: Springer Science + Business Media.)

[00204] In the comparative example without the introduction of CB1 (gDNA), transformation did not occur. However, after the co-introduction of CB1, transformation became possible. Example 4

[00205] In this example, TaWox5 and a TaWox5 homolog from rice, osTaWox5, were introduced into maize (varieties A188 and B73) using the Agrobacterium method. The genes introduced were the following: wheat TaWox5 gDNA obtained in Example 1, cDNA synthesized according to information in the nucleotide sequence of TaWox5 (TaWox5cDNA) (SEQ ID NO: 11), gDNA from a rice TaWox5 homolog, osTaWox5 (osTaWox5gDNA) (SEQ ID NO: 3), and osTaWox5 cDNA (osTaWox5cDNA) (SEQ ID NO: 12). In this example, TaWox5 obtained in Example 1 was introduced by transformation with a vector that has one T-DNA region, and the other genes were introduced using a vector, a two-T-DNA method that uses a vector that has two T-DNA regions. (1) Vector construction

[00206] The PCR reaction was performed, using pLC41 (LC215698.1) as a template, to replace the restriction enzyme sites AflII and PspOMI 10667 to 52 of pLC41 (pLC41AflII-PspOMI).

[00207] Next, the PCR reaction was performed using pLC41AflII-PspOMI as a template to amplify RB-AflII-PspOMI-LB between approximately 330 bp upstream of RB and approximately 520 bp downstream of LB, and also using pLC41 as a template to amplify pLC41KorB. Petition 870240088548, dated 10 / 16 / 2024, page 56 / 121 51 / 56 for oriT from KorB to oriT. In the PCR reactions for RB-AflIIPspOMI-LB, a phosphorylated primer at the 5' end, consisting of a sequence encoding approximately 330 bp of the upstream portion of RB (pLC41 330 bp-RB F+P) and a phosphorylated primer at the 5' end consisting of a sequence encoding approximately 520 bp of the downstream portion of LB (pLC41 LB-520 bp R + P) were used. In the PCR reaction for pLC41 GUS-HPT KorB to oriT, a pLC41 oriT-IncC F primer consisting of a sequence encoding an oriT-IncC interval in the downstream direction and a pLC41 oriT-IncC R primer consisting of a sequence encoding an oriT-IncC interval in the upstream direction were used. As a result, a PCR product of 1100 bp of the RB-AflII-PspOMI-LB fragment and a PCR product of approximately 10000 bp of the pLC41KorB to oriT fragment were obtained.

[00208] The RB-AflII-PspOMI-LB fragment and the pLC41KorB fragment for oriT were ligated to produce pLC41 against AflII-PspOMI. The fragments containing osTaWox5gDNA, osTaWox5cDNA, TaWox5gDNA or TaWox5cDNA were synthesized using the primers described in Table 3 and inserted between the ubiquitin-ubiquitin intron promoter and the Nos terminator. In the first pLC41 T-DNA against AflII-PspOMI, the maize ubiquitin-ubiquitin intron promoter in each TaWox5-Nos terminator expression cassette and the GUS-Nos 35S promoter terminator expression cassette were inserted on the RB side. In the second T-DNA, the 35S-Bar-35S terminator promoter expression cassette was inserted. Petition 870240088548, dated 10 / 16 / 2024, p. 57 / 121 52 / 56 Table 3 Primer name Sequence TaWox5-FW GGGGACAAGTTTGTACAAAAAAGCAGGCTA TGGAGGCGCTGAGCGGGCGG TaWox5-RV GGGGACCACTTTGTACAAGAAAGCTGGGTT TAGACCAGATACCGATCGAA 5 osTaWox5-FW GGGGACAAGTTTGTACAAAAAAGCAGGCTA TGGAGGCTCTTAGCGGGCGAGTG osTaWox5-RV GGGGACCACTTTGTACAAGAAAGCTGGGTC TAGAGGCCGAAGCTGCAAAGCC (SEQ ID Nos: 13-16)

[00209] Thus, pLC41-osTaWox5cDNA-GUS-bar prepared, pLC41-osTaWox5gDNA-GUS-bar, pLC41-TaWox5cDNA-GUS-bar and pLC41TaWox5gDNA-GUS-bar and pDE003-TaWox5 prepared in Example 1 as a vector with TaWoxõ gDNA, and also a control vector (pLC41-GUS-bar) possessing a 35s cauliflower mosaic virus promoter-himacatalase-maize GUS-Nos terminator and the maize ubiquitin-ubiquitin-bar-Nos terminator promoter in TDNA were subjected to testing. Each of these vectors was introduced into the Agrobacterium tumefaciens LBA4404 strain with pVGW9. (2) Corn processing 1

[00210] The LBA4404 strain introduced by pDE003-TaWox5, pLC41TaWox5cDNA-GUS-bar, pLC41-TaWox5gDNA-GUS-bar or pLC41GUS-bar and pLC41-GUS-bar and pVGW9 were inoculated into immature maize embryos (variety: B73). Inoculation and co-cultivation were conducted according to the method of Ishida et al., (2007) NATURE PROTOCOLS, vol. 2, 7, 1614-1621.

[00211] On day 5 of co-culture (day 7 after inoculation), the number of immature embryos forming a compact callus on the scutellum surface was counted. The result is shown in Table 4. In immature embryos inoculated with the control pLC41-GUS-bar, immature embryos forming a compact callus were not observed. In contrast, in immature embryos transformed with the vector containing the TaWoxõ gene, immature embryos forming a Petition 870240088548, dated 10 / 16 / 2024, p. 58 / 121 53 / 56 compact callus with efficiency of 12 to 86.2%. These calluses proliferated through continuous cultivation. And regenerated plants were obtained from the proliferated callus by transferring and culturing such calluses in the regeneration culture. It was confirmed that these regenerated plants could root and grow in the greenhouse, transferring them to potted soil. Table 4 Vector Introduced Number of immature embryos Number of callus formations Callus formation efficiency (%) pLC41-GUS-bar 23 0 0 pDE003-TaWox5 25 3 12.0 pLC41-TaWox5cDNA-GUS-bar 29 25 86.2 pLC41-TaWox5gDNA-GUS-bar 29 15 51.7 (3) Corn transformation 2

[00212] The LBA4404 strain introduced by pLC41-osTaWox5cDNAGUS-bar, pLC41-osTaWox5gDNA-GUS-bar, pLC41-TaWox5cDNAGUS-bar, or pLC41-GUS-bar and pV41W-bar and pVGW9 was inoculated into immature maize embryos (variety B73). Inoculation and co-cultivation were conducted according to the method of Ishida et al., NATURE PROTOCOLS, 2007, vol. 2, 7, 1614-1621.

[00213] On day 5 of co-culture (day 7 after inoculation), the number of immature embryos that formed a compact callus on the scutellum surface was counted. The result is shown in Table 5. In immature embryos inoculated with the control pLC41-GUS-bar, immature embryos forming a compact callus were not observed. In contrast, in immature embryos transformed with vectors comprising multiple TaWox5 genes, embryos Petition 870240088548, dated 10 / 16 / 2024, p. 59 / 121 54 / 56 immature cells that form a compact callus with an efficiency of 32.1 to 85.2%. Table 5 Vector Introduced Number of immature embryos Number of callus formation Callus formation efficiency (%) pLC41-GUS-bar 28 0 0 pLC41-osTaWox5cDNA-GUS-bar 27 21 77.8 pLC41-osTaWox5gDNA-GUS-bar 28 9 32.1 pLC41-TaWox5gDNA-GUS-bar 27 23 85.2 (4) Corn processing 3

[00214] The LBA4404 strain introduced by pLC41-osTaWox5cDNA-GUS-bar or pLC41-TaWox5cDNA-GUS-bar and pVGW9 was inoculated into immature maize embryos (variety: A188). Inoculation and co-cultivation, selection and redifferentiation were performed according to the method of Ishida et al., NATURE PROTOCOLS, 2007, vol. 2, 7, 1614-1621.

[00215] The leaf portion of redifferentiated plants was cut and the expression of the GUS gene was examined. The examination of GUS gene expression was performed according to the method of Ishida et al., NATURE PROTOCOLS, 2007, vol.2, 7, 1614-1621. In the leaves of redifferentiated plants obtained from immature embryos that were inoculated with any of the vectors, both leaves showed blue coloration. Thus, it was confirmed that redifferentiated plants can be obtained from immature embryos transformed with various TaWox5, without excluding the TaWox5 gene.

[00216] As mentioned above, in the method of the present invention, the formation and regeneration of calluses in the B73 variety of Petition 870240088548, dated 10 / 16 / 2024, pp. 60 / 121 55 / 56 maize, which is known as a difficult variety to cultivate. Furthermore, in the A188 maize variety, callus efficiency was improved and even redifferentiation was successful without removing the TaWoxõ gene. Similar effects were observed when the W0X5-related gene from wheat and the W0X5-related gene from rice were used. Additionally, the use of gDNA and cDNA was also observed to be effective. Example 5

[00217] In this example, the chimeric proteins TaWoxõ and GFP: 3'-TaWox5-GFP-5' and 3'-GFP-TaWox5-5 were expressed in wheat. In both cases, TaWoxõ and GFP were combined via a linker composed of 10 Gly residues. All sequence data for the primers used in this example are shown in Table 6. Table 6 Primer name Sequence GFPbamFinf4 CAGGTCGACTCTAGAGGAATGGTGAGCAAGGG CGAG 10 GFPbamRmf4 TTCGAGCTCGGTACCCGGGGAtccaccaccgccacctcc gccaccgcctccAGATCTGTACAGCTCG Wox5bamFinf3 CAGGTCGACTCTAGAGGAATGGAGGCGCTGAG CGG Wox5bamRinf3 TTCGAGCTCGGTACCCGGGGAtccaccaccgccacctcc gccaccgcctccGACCAGATACCGAT Wox5Finf4 gcggaggtggcggtggtggaATGGAGGCGCTGAGCGG Wox5Rinf4 TTCGAGCTCGGTACCCGGGATTAGACCAGAtÀ CCGAT GFPFinf3 gcggaggtggcggtggtggaATGGTGAGCAAGGGCGAG GFPRinf3 TTCGAGCTCGGTACCCGGGGATTAAGATCTGTA CAGCTCG (SEQ ID Nos: 17-24)

[00218] To construct a vector that harbors the chimeric protein, first, the fragment harboring the GFP gene with the BamH1 site and the 10 Gly ligand and the fragment harboring the TaWoxõ gene with the BamH1 site and the 10 Gly ligand were obtained using the primers Petition 870240088548, dated 10 / 16 / 2024, pp. 61 / 121 56 / 56 GFPbamFinf4 and GFPbamRinf4, Wox5bamFinf3 and Wox5bamRinf3, respectively. Then, the GFP fragment, the TaWox5 fragment, and the pCUB vector (shown in Figure 5) were digested with BamHI, followed by ligation between the GUS-containing fragment and the digested pCUB to obtain pCUB-10 Gly-GFP and pCUB-10 Gly-TaWox5. (1) For constructing a vector to express 5'-TaWox5-(10 Gly)GFP-3'; The fragment containing the TaWox5 gene without the stop codon was amplified using Wox5Finf4 and Wox5Rinf4 as primers. This fragment and BamHI-digested pCUB-10Gly-GFP were ligated to obtain pCUB-TaWox5-10Gly-GFP by homologous recombination. (2) For the construct of a vector to express 5'-GFP- (10 Gly) TaWox5-3';

[00219] The fragment containing the GFP gene without the stop codon was amplified using GFPFinf3 and GFPRinf3 as primers. This fragment and pCUB-10Gly-TaWox5 digested by BamHI were ligated to obtain pCUB-GFP-10Gly-TaWox5 by homologous recombination.

[00220] These vectors pCUB-GFP-10Gly-TaWox5, pCUB-TaWox5-10Gly-GFP and empty pCUB were introduced into immature wheat embryos (variety: Jimai22) followed by redifferentiation to obtain transformants and statistical analysis of transformation efficiency. The procedure for plant transformation and statistical analysis was conducted according to Example 1. As a result, the transformation efficiency of pCUB-TaWox5-10Gly-GFP was 39.6%, although that of pCUB-GFP-10Gly-TaWox5 and empty pCUB was 0%, no transformant was obtained. Petition 870240088548, dated 10 / 16 / 2024, pp. 62 / 121

Claims

1 / 1 CLAIMS 1. A method for improving the transformation efficiency of plants of the Poaceae family, characterized in that it comprises (a) introducing into a plant (1) a nucleic acid construct comprising a nucleic acid comprising SEQ ID NO: 11, and degenerate nucleotide sequences thereof encoding a polypeptide comprising SEQ ID NO: 2, and a promoter for the production of said nucleic acid in a plant, wherein said promoter is heterologous with respect to said nucleic acid; and (2) a nucleic acid desired to be expressed in the plant; and (b) selecting from a plurality of cells of said plant a transformed plant cell with improved transformation efficiency, wherein the improvement comprises at least one improvement selected from the group consisting of: a) improved efficiency of plant callus formation that is 1.5 times or more compared to that when the aforementioned nucleic acid is not overexpressed; b) improved plant redifferentiation rate that is 1.5 times or more compared to that when the aforementioned nucleic acid is not overexpressed; and c) improved gene transfer efficiency that is 1.5 times or more compared to that when the aforementioned nucleic acid is not overexpressed. Petition 870260066382, dated 06 / 07 / 2026, page 6 / 14

Images