Method for detecting an aneuploid in a brassica oleracea plant, for genetic improvement of brassica oleracea, for controlling seed quality of brassica oleracea and for controlling plants of brassica oleracea, and, primer and probe set

BR112020003129B1Active Publication Date: 2026-08-25SAKATA SEED CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
BR112020003129
Authority / Receiving Office
BR · BR
Patent Type
Patents
Current Assignee / Owner
Publication Date
2026-08-25

Smart Images

  • Figure 00000053_0000
    Figure 00000053_0000
  • Figure 00000054_0000
    Figure 00000054_0000
  • Figure 00000054_0001
    Figure 00000054_0001
Patent Text Reader

Abstract

The present invention relates to a method for detecting a heteroploidy in a Brassica oleracea plant, the method including performing real-time PCR using DNA extracted from a sample of a Brassica oleracea plant of interest as a template and using DNA markers respectively specific for at least two chromosomes of a Brassica oleracea plant to obtain a relative difference in amplification levels between the DNA markers and then detecting chromosomal aneuploidy from a relative difference. According to the present invention, it becomes possible to detect a variant (chromosomal heteroploidy) that may occur in varieties of Brassica oleracea in a simple, accurate and rapid manner in a laboratory or similar, which is versed in molecular biology common in the course of seed quality control or the study of genetic improvement.
Need to check novelty before this filing date? Find Prior Art

Description

50 METHOD FOR DETECTING AN ANEUPLOID IN A BRASSICA OLERACEA PLANT, FOR GENETIC IMPROVEMENT OF BRASSICA OLERACEA, FOR CONTROLLING SEED QUALITY OF BRASSICA OLERACEA AND FOR CONTROLLING PLANTS OF BRASSICA OLERACEA, AND, PRIMER AND PROBE SET [CROSS-REFERENCE TO RELATED REQUESTS]

[001] The present application is based on and claims the benefit of priority of the prior JP Patent Application No. 2017-157384, filed on August 17, 2017; the full content of which is incorporated herein by reference. [FUNDAMENTALS OF THE INVENTION] Technical Field

[002] The present invention relates to a method for detecting a variant type (chromosomal aneuploid) in a culture of Brassica oleracea. More specifically, the present invention relates to a method that is capable of accurately and rapidly classifying and detecting individuals exhibiting various abnormal morphologies due to aneuploidies in Brassica oleracea (hereinafter, it may be abbreviated as “B. oleracea”) at any stage of growth by the biological method. Related technique

[003] Brassicaceae plants are plant species originating from The Middle East and the Mediterranean coast. This family includes plants of the genus Brassica, extremely important agricultural crops. The species of Brassica oleracea plants are very important and these include, but are not limited to, B. oleracea var. capitata (cabbage), B. oleracea var. italica (broccoli), B. oleracea var. botrytis (cauliflower), B. oleracea var. gemmifera (Brussels sprouts), B. oleracea var. gongyloides (kohlrabi), B. oleracea var. acephara (cabbage, ornamental cabbage), and B. oleracea var. Petition 870200043201, dated 03 / 04 / 2020, p. 8 / 68 / 50 albograbra (Chinese cabbage).

[004] In Brassica oleracea crops, commercial genetic improvement is often directed at first-generation (F1) filial hybrid plants utilizing the properties of self-incompatibility (SI) or cytoplasmic male sterility (CMS). Compared to native varieties or OP (open-pollinated) varieties, F1 varieties show an excellent ability to adapt to the environment and exhibit high uniformity. Consequently, these varieties have a high commercial value and are used in many countries.

[005] It has been reported that individuals exhibiting a morphology different from the common morphology appear with some frequency, even if they are F1 varieties inheriting parental genes (see the article by V. Ruffio-Chable et al., ISHS Acta Horticulturae 539 (2000) p. 89, Developmentally “Aberrant” plants in F1 hybrids of Brassica oleracea (Non-patent document 1)). Generally, such variant types of individuals have extremely low value as agricultural products and typically cannot be transported as fresh produce. If large quantities of individuals exhibiting a variant type of phenotype involve certain seeds or varieties, this can lead to a major commercial problem. Consequently, seed companies may have to discard such seeds.

[006] The cause or occurrence of such variant types was not known until some time ago, but scientists speculated that environmental influences occurred during seed production or crop breeding, or that influences such as mutation or epigenetic changes occurred.

[007] The aforementioned problem of variant types is also very problematic for the quality control function of agricultural seed production companies. Seed companies that produce and Petition 870200043201, dated 03 / 04 / 2020, p. 9 / 68 / 50: Companies that sell F1 hybrid seeds conduct tests using polymorphic DNA markers or isozymes to test the varietal purity of seeds before marketing said products. However, these variant-type individuals have the same F1 genotype as the variety and cannot be detected by such laboratory tests. For this reason, the development of a faster testing method for variant types has long been desired.

[008] Furthermore, in genetic improvement research it is necessary to improve varietal characteristics so that variant type individuals do not occur frequently. However, it is difficult to identify variant types by their appearance at the seedling stage. For this reason, in order to accurately count the rate of occurrence of variant types, it was necessary to cultivate plants on a large scale in the field and have the characteristics of the individuals carefully evaluated by a specialist grower. However, such a growth test tends to be based on subjectivity, and there is a concern that the result may vary depending on the person performing the evaluation. Additionally, it is difficult even for a specialist grower to make an accurate judgment, and the results may differ depending on the growth stage and genetic improvement environment.In light of this context, a simple testing method for seedlings has long been desired by seed production companies.

[009] For example, the article by V. Chable et al., Euphytica 170 (2009) p. 275, “Aberrant” Plants in Cauliflower: 2. Aneuploidy and Global DNA Methylation (Non-Patent Document 2) reports the possibility that an abnormal morphology appearing in the F1 variety of cauliflower originates from an aneuploid. Several experimental studies have reported the use of a flow cytometer as a general method for detecting aneuploidy.

[0010] However, it is not easy to accurately detect the difference of a chromosome using the flow cytometer method, and even if a Petition 870200043201, dated 03 / 04 / 2020, page 10 / 68 / 50. When endogenous control is added to the sample, it can be difficult to make a judgment, as shown in the data described in the article by N. Roux et al., Plant Cell Report 21 (2003) p. 483, Rapid detection of aneuploidy in Musa using flow cytometry (Non-patent document 3). There is also a difference in chromosome size, and the genomic ratio of the larger chromosome to the smaller chromosome can reach close to 2:1. In the case where a relatively small chromosome is added, it is difficult to judge because the difference between peaks of normal and aneuploid individuals is extremely small, and the sensitivity of detection has a large influence on the accuracy of the results.

[0011] For this reason, the method that uses the flow cytometer creates problems such as not being able to perform a large-scale test in a common laboratory.

[0012] Additionally, in the method that uses the flow cytometer, even if a highly reliable experimental system were assembled, in the case of plants that have aneuploidy in a plurality of chromosomes, for example, in the case of an aneuploid in which trisomy of chromosome 1 and monosomy of chromosome 2 are combined, 18 chromosomes are consequently contained in the nucleus and, thus, it is determined as a normal individual.

[0013] Additionally, it is difficult to identify which chromosome caused aneuploidy in a simple test using a flow cytometer. Depending on the trisomic chromosome, there are also types in which the fresh product can be harvested without concerns about quality; although the maturity of the plant changes somewhat. For example, in the case involving trisomies of chromosomes 2 and 7 of broccoli and trisomies of chromosomes 1, 2, and 7 of cauliflower, thus, in some cases, being aneuploid is not immediately associated with a reduction in the value of the commodity. For this reason, it is important to be able to discriminate the type of trisomy. Petition 870200043201, dated 03 / 04 / 2020, page 11 / 68 / 50 individually in the field. From the point of view of advancing genetic improvement, the fact that any chromosome tends to become a trisomy provides important information. Due to this, there is a demand for the development of a simple test method that can analyze the detailed aneuploidy for each chromosome.

[0014] Up to now, in plants, methods for discriminating genotypes using DNA markers that utilize PCR have been reported. For example, JP 3836451 B2 (Patent Document 1) discloses a method for determining the genotype involved in the production of pungent ingredients from Capsicum plants. However, to the best of the present inventors' knowledge, a method for testing a variant type in a Brassicaceae plant has not yet been reported. [List of Preceding Techniques] Patent Document

[0015] Patent Document 1: Japanese Patent Publication No. 3836451 (JP 3836451 B2) Non-Patent Document

[0016] Non-patent document 1: V. Ruffio-Chable et al., ISHS Acta Horticulturae 539 (2000) p89, “Aberrant” development plants in F1 hybrids of Brassica oleracea.

[0017] Non-patent document 2: V. Chable et al., Euphytica 170 (2009) p275, “Aberrant” plants in cauliflower: 2. Aneuploidy and global DNA methylation.

[0018] Non-patent document 3: N. Roux et al., Plant Cell Report 21 (2003) p483, Rapid detection of aneuploidies in Musa using flow cytometry.

[0019] Non-patent document 4: I. Parkin et al., Genetics 171 (2005) p765, Segmental structure of the Brassica napus genome based on comparative analysis with Arabidopsis thaliana.

[0020] Non-patent document 5: X. Cheng et al., Theorist Petition 870200043201, dated 03 / 04 / 2020, p. 12 / 68 / 50 Applied Genetics 118 (2009) p1121, Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus. [SUMMARY OF THE INVENTION] [Problems to be solved by the invention]

[0021] An object of the present invention is to provide a method for accurately and rapidly detecting a variant type (chromosomal aneuploid) that can occur in Brassica oleracea species, to solve the problem described above, which affects the course of seed quality control and genetic improvement research. Additionally, the method can be performed in a laboratory equipped for general molecular biological methods. [Means to Solve the Problems]

[0022] As a result of extensive studies conducted to meet the demands of scientists for seed quality control and genetic improvement, the present inventors have succeeded in accurately and rapidly identifying aneuploids of all chromosomes in Brassica oleracea species using real-time PCR. This method makes it possible to easily perform the method in a laboratory equipped for real-time PCR, and it was possible to easily detect plants of variant types. Furthermore, this method was able to accurately and rapidly detect and classify individuals exhibiting various abnormal morphologies caused by aneuploidy at any stage of growth using the molecular biological method.

[0023] That is, according to the present invention, the following inventions are provided: <1> A method for detecting an aneuploid in a Brassica oleracea plant, comprising: perform real-time PCR using DNA extracted from a sample derived from the Brassica oleracea plant to be tested as a template, and Petition 870200043201, dated 03 / 04 / 2020, page 13 / 68 / 50 specific DNA markers for each of two or more chromosomes of the Brassica oleracea plant; and to detect chromosomal aneuploidy from a relative difference between the amplification values ​​obtained by DNA markers.

[0024] <2> The method according to <1> , comprising determining whether a plant to be tested is aneuploid for one chromosome out of all chromosomes using DNA markers specific to each of chromosomes 1 to 9 of the Brassica oleracea plant.

[0025] <3> The method according to <1> or <2> In this method, a primer is used as the DNA marker, which is specific only to any one of the chromosomal DNAs of the Brassica oleracea plant and can produce an amplification product by a PCR reaction when the chromosomal DNA is present.

[0026] <4> The method according to anyone of <1> the <3> , wherein the method uses, as DNA markers, (i) a primer that is specific only to any one of the chromosomal DNAs of the plant Brassica oleracea and can produce an amplification product by a PCR reaction when the chromosomal DNA is present; and (ii) a probe that is specific to chromosomal DNA identical to any of the chromosomal DNAs described in (i) and can detect an amplification product by a PCR reaction based on the primer described in (i).

[0027] <5> The method according to <3> or <4> , in which the method uses an intercalator that binds to double-stranded DNA synthesized by a PCR reaction and emits fluorescence, or uses a probe modified with a fluorescent dye so as to emit fluorescence by a PCR elongation reaction.

[0028] <6> The method according to any of the <1> the <5> , in which the method uses an increase in the fluorescence signal obtained by real-time PCR as an index to detect chromosome aneuploidy. Petition 870200043201, dated 03 / 04 / 2020, p. 14 / 68 / 50

[0029] <7> The method according to any of the <1> the <6> , in which the method uses, as the DNA marker, one or more primers having nucleotide sequences shown in SEQ ID NOs: 1 to 18.

[0030] <8> The method according to any of the <1> the <7> , in which the method uses, as the DNA marker, one or more primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18 and one or more probes having the nucleotide sequences shown in SEQ ID NOs: 19 to 27.

[0031] <9> A set of primers for detecting an aneuploid of a Brassica oleracea plant, comprising: at least one or more primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18.

[0032] <10> A primer and probe set for detecting an aneuploid of Brassica oleracea plant, comprising: at least one or more primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18; and at least one or more fluorescent dye-modified probes having the nucleotide sequences shown in SEQ ID NOs: 19 to 27.

[0033] <11> A method for cultivating a Brassica oleracea crop, comprising evaluating the frequency of occurrence of chromosome aneuploids for each genetic lineage of the Brassica oleracea plant using the method according to any of <1> the <8> in order to select a lineage with a low rate of aneuploidy.

[0034] <12> A method for controlling seed quality Brassica oleracea, comprising a test to determine the rate of aneuploid contamination contained in seeds and a batch of Brassica oleracea seeds using the method according to any of <1> the <8> .

[0035] <13> A method for controlling plant quality. Petition 870200043201, dated 03 / 04 / 2020, page 15 / 68 / 50 Brassica oleracea, comprising a test to determine the rate of aneuploid contamination contained in Brassica oleracea plants using the method according to any of <1> the <8> . [Effects of the Invention]

[0036] According to the test method of the present invention, it is possible to estimate, simply and accurately, the rate of occurrence of variant types and the future morphology of each of the detected aneuploids, thus allowing testing of the varietal purity of commercial seed lots and the frequency of occurrence of variant types in breeding lines. As a result, it becomes possible to efficiently, quickly and immediately provide means to stably supply high-quality commercial seeds and breeding lines with good characteristic traits. [BRIEF DESCRIPTION OF DRAWINGS]

[0037] Figure 1 shows aneuploid phenotypes of broccoli plants, where in the figure, (A) represents a normal individual (Normal), (B) represents trisomy of chromosome 1 (+C1), (C) represents trisomy of chromosome 2 (+C2), (D) represents trisomy of chromosome 3 (+C3), (E) represents trisomy of chromosome 4 (+C4), (F) represents trisomy of chromosome 5 (+C5), (G) represents trisomy of chromosome 6 (+C6), (H) represents trisomy of chromosome 7 (+C7), (I) represents trisomy of chromosome 8 (+C8), and (J) represents trisomy of chromosome 9 (+C9); Figure 2 shows an image of the amplification curve when performing quantitative analysis by real-time PCR, where the figure is based on an example of chromosome 6 trisomy, and when the amount of DNA as a template to be added to the PCR reaction solution is constant, for example, in the case of chromosome 6 trisomy (Trisomy), the amplification curve of the marker located on chromosome 6 increases faster than that of the normal individual (Normal); Petition 870200043201, dated 03 / 04 / 2020, page 16 / 68 / 50 Figure 3 shows an example of aneuploidy detection, that is, an example of the calculated result of a relative difference between the amplification values ​​obtained by DNA markers performing real-time PCR. Ninety-six individuals, obtained from the F1 generation of a broccoli variety being used as materials, were tested by multiplex PCR using a chromosome 4 marker and a chromosome 6 marker. The marker on chromosome 6 was subjected to a relative difference between the amplification values ​​on chromosome 4 as a standard, and as a result, trisomy of chromosome 6 and trisomy of chromosome 4 could be identified; Figure 4 shows micrographs of chromosomes observed in pollen mother cells of trisomic plants. Using microscopic observation of cells in the first metaphase of meiosis of pollen mother cells, nine divalent chromosomes were observed in the case of the normal chromosome (2n = 18). While nine divalent chromosomes and one additional chromosome (indicated by an arrow) were observed in the case of the trisomic plant chromosome level (2n+1); Figure 5 shows aneuploid phenotypes of the cauliflower variety, where in the figure, (A) represents a normal individual (Normal), (B) represents trisomy of chromosome 1 (+C1), (C) represents trisomy of chromosome 2 (+C2), (D) represents trisomy of chromosome 4 (+C4), (E) represents trisomy of chromosome 6 (+C6), (F) represents trisomy of chromosome 7 (+C7), and (G) represents trisomy of chromosome 9 (+C9); Figure 6 shows aneuploid phenotypes of a cabbage variety, where in the figure, (A) represents a normal individual (Normal), (B) represents trisomy of chromosome 1 (+C1), (C) represents trisomy of chromosome 2 (+C2), (D) represents trisomy of chromosome 4 (+C4), (E) represents trisomy of chromosome 5 (+C5), (F) represents trisomy of chromosome 6 (+C6), (G) represents trisomy of chromosome 7 (+C7), (H) Petition 870200043201, dated 03 / 04 / 2020, page 17 / 68 / 50 represents trisomy of chromosome 8 (+C8), and (I) represents trisomy of chromosome 9 (+C9), and (J) represents an individual with aneuploidy in chromosome 1 and chromosome 2 (+C1, +C2), (K) represents an individual with aneuploidy in chromosome 1 and chromosome 8 (+C1, +C8), and (L) represents an individual with aneuploidy in chromosome 5 and chromosome 8 (+C5, +C8); and Figure 7 shows the phenotypic characteristics of aneuploids obtained from varieties of broccoli, cauliflower, and cabbage; these characteristics refer only to some of the phenotypic characteristics observed in the test of this example and it is not necessarily possible to generalize and characterize the characteristics for respective plant species and aneuploids. [METHODS FOR CARRYING OUT THE INVENTION]

[0038] The present invention will be described in detail below.

[0039] As described above, the present invention relates to a method for detecting an aneuploidy in a Brassica oleracea plant, including: performing real-time PCR using DNA extracted from a sample derived from a Brassica oleracea plant to be tested as a template and specific DNA markers for each of two or more chromosomes of a Brassica oleracea plant; and detecting chromosomal aneuploidy from a relative difference between the amplification values ​​obtained by DNA markers. According to a preferred embodiment of the present invention, the number of chromosomes used for the detection method is 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, and 8 or more are most preferred in this order. Most preferably, markers for all nine chromosomes are used.

[0040] Therefore, the method of the present invention preferably includes: determining whether a plant to be tested is aneuploid for a chromosome using DNA markers specific for each of the Petition 870200043201, dated 03 / 04 / 2020, p. 18 / 68 / 50 chromosomes, 1 to 9, of the plant Brassica oleracea.

[0041] In the present invention, the plant Brassica oleracea means a plant of the species Brassica oleracea of ​​the genus Brassica, which includes, but is not limited to, B. oleracea var. capitata (cabbage), B. oleracea var. italica (broccoli), B. oleracea var. botrytis (cauliflower), B. oleracea var. gemmifera (Brussels sprouts), B. oleracea var. gongyloides (kohlrabi), B. oleracea var. acephara (cabbage, ornamental cabbage), B. oleracea var. albograbra (Chinese cabbage). In the present invention, the plant Brassica oleracea is preferably broccoli, cauliflower or cabbage.

[0042] The term “aneuploid” or “variant type” used here means an individual with an abnormality in the number of chromosomes (aneuploidy). In this case, there is an abnormality in the number of chromosomes found in the Brassica oleracea plant. The number of chromosomes in a normal Brassica oleracea plant is eighteen (2n = 18), therefore resulting in nine pairs of chromosomes in a cell. For example, in the case of an aneuploid, specifically an aneuploid plant with trisomy of chromosome 1, the number on chromosome 1 is increased from two to three; this indicates that the ploidy level of chromosome 1 is abnormal. Although some aneuploid individuals may be acceptable as agricultural products or fresh produce depending on the plant species and growing conditions, more often variant type individuals are inadequately assessed as agricultural products and in many cases cannot be sold as fresh produce.For this reason, it is important to be able to detect aneuploids quickly and easily.

[0043] In the aneuploid detection method of the present invention, a Brassica oleracea plant to be tested is sampled, DNA is extracted from a sample derived from the Brassica oleracea plant to be tested, and the DNA is used as a template for PCR.

[0044] With regard to the method of DNA extraction, any method Petition 870200043201, dated 03 / 04 / 2020, page 19 / 68 / 50 known to those skilled in the art can be used to extract nucleic acid. In the present invention, the extracted 'raw' DNA can be used as such to serve as a template for PCR. For example, a phenol / chloroform method, a cell lysis method with a detergent, a cell lysis method with a protease enzyme, a physical destruction method with glass beads, a treatment method including repeated freeze-thaw, and a combination thereof can be used to perform DNA extraction. Various DNA extraction kits sold by reagent manufacturers, such as the QIAGEN Plant mini Kit (manufactured by QIAGEN GmbH), can also be used. The DNA extracted by these methods is preferably kept in a state suitable for use as a template for PCR. For example, the DNA is preferably stored at a low temperature after being dissolved in an appropriate buffer solution.The purity of the obtained DNA can be measured by measuring the absorbance at 230, 260, and 280 nm using a spectrophotometer. In performing PCR, it is preferable that the absorbance ratio at 260 / 230 nm be 2.0 or higher and the absorbance ratio at 260 / 280 nm be 1.8 to 2.0. Regarding the obtained DNA solution, it can be confirmed that amplification occurs by PCR using a primer pair for a common endogen for plants.

[0045] In the detection method of the present invention, real-time PCR is performed using DNA extracted from a sample derived from the Brassica oleracea plant to be tested as a template and a DNA marker capable of amplifying a portion of each chromosome of the Brassica oleracea plant. Specifically, real-time PCR is performed using two or more DNA markers specific for each of two or more chromosomes of a Brassica oleracea plant as the DNA marker.More specifically, real-time PCR is performed using two or more DNA markers specific to each of two or more chromosomes from chromosomes 1 to 9 of a Brassica oleracea plant as the marker. Petition 870200043201, dated 03 / 04 / 2020, p. 20 / 68 / 50 DNA.

[0046] The DNA marker used here is not particularly limited as long as it is a DNA marker located on any of the chromosomes of the Brassica oleracea plant that is present as a single copy in the genome and is not affected by other sequences present on different chromosomes. In the present invention, such a marker is used, thus enabling the ability to detect a relative difference between the amplification values ​​obtained by DNA markers by real-time PCR and to test for aneuploids from various Brassica oleracea crops.

[0047] Therefore, it is preferable that the marker be a primer pair that is specific to only one of the chromosomal DNAs of the Brassica oleracea plant and can produce an amplification product by PCR reaction when the chromosomal DNA is present. Here, the term “specific to only one of the chromosomal DNAs of the Brassica oleracea plant” means that the primer is specific to only one of the nine chromosome pairs, but is not specific to other chromosomes. When the chromosomal DNA specific to only one of the nine chromosome pairs is present, the primer can amplify a target product by PCR reaction. For example, the DNA marker to be used may include a primer that is specific only to chromosome 1 DNA and can produce an amplification product by PCR reaction when chromosome 1 DNA is present.

[0048] With regard to the primer design used herein, those skilled in the art may appropriately prepare a primer designed to be specific only for any one of the chromosomal DNAs of the plant Brassica oleracea and be capable of producing an amplification product by PCR reaction when the chromosomal DNA is present. Specifically, those skilled in the art may appropriately prepare a desired primer by reference to the description of Example 1 described later. Petition 870200043201, dated 03 / 04 / 2020, page 21 / 68 / 50

[0049] In the present invention, it is possible to test an aneuploid by performing real-time PCR using a primer having the above properties, and the intercalator method can be used as a preferred mode. In the intercalator method, an intercalator that has been added to a PCR reaction solution binds to the double-stranded DNA synthesized by a PCR reaction, and the intercalator emits fluorescence. Consequently, an elongation reaction by the primer occurs to amplify a product, thus emitting fluorescence. This fluorescence is detected, making it possible to measure the relative difference between the amplification values ​​obtained by DNA markers.

[0050] For example, SYBR Green I can be used as the interleaving agent.

[0051] According to a specific embodiment of the intercalator method, (i) a primer pair that is specific for only one of the chromosomal DNAs of the Brassica oleracea plant and can amplify a product by PCR reaction when the chromosomal DNA is present and (ii) an intercalator is added to a PCR reaction solution, a fluorescence signal emitted in an elongation reaction step in PCR is measured for each cycle, and the amplification values ​​obtained by DNA markers are calculated. Consequently, it is possible to measure the relative difference between the amplification values ​​obtained by DNA markers.

[0052] Another preferred embodiment of the present invention is a probe method using a probe capable of detecting an amplification product generated by a PCR reaction based on the primer having the above properties. The probe to be used is not particularly limited as long as the probe can detect a target amplification product, and it is preferable to use a labeled probe that is modified with a fluorescent dye so that fluorescence is emitted by the PCR elongation reaction. The method for calculating the relative difference between the amplification values ​​obtained by Petition 870200043201, dated 03 / 04 / 2020, page 22 / 68 / 50 DNA markers are identified by measuring the fluorescence emitted during the PCR elongation reaction, so the method can be performed using the same principle as the intercalator method. Furthermore, the probe method can reduce the risk of detecting non-specific PCR products compared to the intercalator method.

[0053] According to a specific embodiment of the probe method, (i) a pair of primers that is specific for only one of the chromosomal DNAs of the plant Brassica oleracea and can amplify a product by PCR reaction when the chromosomal DNA is present; and (ii) a probe that is specific for chromosomal DNA identical to any of the chromosomal DNAs described in (i) and can detect an amplification product by PCR reaction based on the primers described in (i) are used, a fluorescence signal emitted in a PCR elongation reaction step is measured for each cycle, and the amplification values ​​obtained by DNA markers are calculated. Consequently, it is possible to measure the relative difference between the amplification values ​​obtained by DNA markers.

[0054] As for the fluorescently labeled probe, a TaqMan probe doubly labeled with a fluorescent substance and an quenching substance is preferred.In the TaqMan probe, the 5' end of a nucleic acid probe is usually modified with a fluorescent substance (fluorescent reporter dye) and the 3' end is usually modified with a quenching substance (fluorescent quenching dye). Examples of fluorescent reporter dyes include: fluorescein-based fluorescent dyes such as Cy3, Cy5, 6-carboxyfluorescein (6-FAM), 6-carboxy-4,7,2',7'-tetrachlorofluorescein (TET), and 6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX). As for the fluorescent quenching dye, a rhodamine-based fluorescent dye such as 6-carboxytetramethylrhodamine (TAMRA) or 6-carboxy-X-rhodamine (ROX) can be used. In the case of performing multiplex PCR, this is preferable. Petition 870200043201, dated 03 / 04 / 2020, p. 23 / 68 / 50 select a dark quenching agent such as BHQ-1, BHQ-2, BHQ-3 or Eclipse. In the present invention, it is possible to use, for example, a hydrolysis probe labeled with three types of fluorescent dye such as FAM, HEX, and Cy5 at the 5' end and two types of quenching agents such as BHQ-1 and BHQ-3 at the 3' end.

[0055] Therefore, in the detection method of the present invention, it is preferable to use an intercalator that binds to double-stranded DNA synthesized by a PCR reaction and emits fluorescence, or to use a probe modified with a fluorescent dye in order to emit fluorescence by a PCR elongation reaction.

[0056] In the case of using a fluorescent dye-modified probe, multiplex PCR can be performed using probes labeled with different types of fluorescent dyes and mixing them with various types of markers. Similar to the method described above, with respect to each of the individual samples to be tested and each of the markers, it is possible to measure a relative difference between the amplification values ​​obtained by DNA markers based on the fluorescent signals emitted by fluorescent probes. In this process, in the case of multiplex PCR, it is possible to calculate the relative difference between the amplification values ​​obtained by DNA markers in the same reaction solution set, as the control of endogenous factors and reduction of experimental errors would result in improved reliability of the result.

[0057] Therefore, according to a further preferred embodiment of the present invention, multiplex PCR is performed by the probe method.

[0058] Thus, according to a preferred embodiment of the present invention, an increase in the fluorescence signal obtained by real-time PCR is used as an index to detect an aneuploid of a chromosome in the detection method of the present invention. Petition 870200043201, dated 03 / 04 / 2020, page 24 / 68 / 50

[0059] The oligonucleotide to be used as a primer or probe can be synthesized by a method known in the art as a method for synthesizing oligonucleotides, such as a phosphotriethyl method or a phosphodiester method, using a standard automated DNA synthesizer.

[0060] According to a more preferred embodiment of the present invention, the DNA marker to be used may be one or more primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18, and more preferably, one or more primers described in Table 1 below may be used. According to another more preferred embodiment of the present invention, it is possible to use one or more primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18 and one or more probes having the nucleotide sequences shown in SEQ ID NOs: 19 to 27. More preferably, it is possible to use one or more primers described in Table 1 and one or more probes described in Table 2. These markers are markers corresponding to chromosomes 1 to 9.

[0061] Here, the DNA marker “having” a nucleotide sequence means that the marker has the nucleotide sequence. In the present invention, the DNA marker is specific to DNA of a predetermined chromosome as described above. Therefore, as long as the DNA marker has properties such as the marker, one or more (e.g., one, two, or three, preferably one or two, and more preferably one) of any of the bases in the nucleotide sequence corresponding to the DNA may be substituted, deleted, added, or eliminated, or the DNA marker may be a sequence that contains the nucleotide sequence corresponding to the DNA as a part and retains certain properties. In such a case, the term “having” may be paraphrased as “including”. Additionally, in the case where the substitution, deletion, addition, or elimination of a base is permitted, the term “having” may Petition 870200043201, dated 03 / 04 / 2020, p. 25 / 68 / 50, can be paraphrased as "substantially consisting of".

[0062] According to another more preferred embodiment of the present invention, the DNA marker to be used may be one or more primer pairs having the nucleotide sequences shown in SEQ ID NOs: 1 to 18, and more preferably, it may be one or more primer pairs described in Table 1 below. According to another more preferred embodiment of the present invention, it is possible to use one or more primer pairs having the nucleotide sequences shown in SEQ ID NOs: 1 to 18 and a probe having the nucleotide sequences shown in SEQ ID NOs: 19 to 27 corresponding to the primer pairs. More preferably, it is possible to use one or more primer pairs described in Table 1 and one or more probes described in Table 2.

[0063] According to a further preferred embodiment of the present invention, a more accurate and reproducible test can be performed using DNA markers divided into the following three sets: - Chromosome 6 marker, chromosome 4 marker, and chromosome 2 marker; - Chromosome 9 marker, chromosome 3 marker, and chromosome 8 marker; and - Chromosome 1 marker, chromosome 5 marker, and chromosome 7 marker.

[0064] In the present invention, in addition to the use of primer and probe pairs described above, the real-time PCR method can be performed. For example, the method can be based on the common methods described in Real-Time PCR Experiment Guide in Experimental Medicine, Supplement Edition, (YODOSHA CO., LTD), Saiki RK, et al., Science, 230: 1350-1354 (1985), and Plant PCR Experimental Protocol in Plant Cell Engineering, Supplement Edition, supervised by Ko Shimamoto and Takuji Sasaki (1995), and can be performed using a real-time PCR kit or real-time PCR apparatus. Petition 870200043201, dated 03 / 04 / 2020, page 26 / 68 / 50 commercially available in accordance with the attached instructions.

[0065] As a real-time PCR apparatus, for example, LightCycler 480 System II (manufactured by Roche) or similar equipment can be used. At this time, for example, “Premix Ex Taq (Perfect Real Time)” (manufactured by Takara Bio Inc.) or similar reagents can be used as a reaction reagent, but the use is not particularly limited to the materials mentioned above.

[0066] First, using the DNA sample obtained by the above method as a template and using a primer or primer pair predetermined in the present invention, PCR is performed. PCR amplification is not particularly limited except that the primer or primer pair above are used, and PCR amplification can be performed according to a common method.With reference to PCR conditions (such as temperature and time for each of the denaturation, annealing, and elongation steps, and the number of cycles) and the composition of a PCR reaction solution (such as the amount of DNA template, the type of buffer solution, the concentration of a primer, the type and concentration of DNA polymerase, the concentration of dNTPs, and the concentration of magnesium chloride), those skilled in the art can select and determine the conditions under which PCR amplification products can be obtained with a desired high sensitivity by PCR using the primer or primer pair described above, based on preliminary or similar experiments. Furthermore, a standard mixture for real-time PCR in which the DNA polymerase, dNTP concentration, and magnesium chloride concentration are approximately optimized is commercially available; thus, these can be used as appropriate.

[0067] As described above, the chromosome number of Brassica oleacea is eighteen (2n = 18), so in the case of a normal plant there are nine pairs of chromosomes in each cell. On the other hand, for example, in Petition 870200043201, dated 03 / 04 / 2020, page 27 / 68 / 50: In the case of an aneuploid plant with trisomy of chromosome 1, chromosome 1 is increased from two to three copies. When real-time PCR is performed using DNA extracted from these plants as a template and the DNA markers described in Table 1 or Tables 1 and 2, in order to precisely standardize the amount of DNA added to the reaction solution, in trisomy of chromosome 1, the amplification curve of the marker located on chromosome 1 increases in the initial cycles, compared to the normal individual. That is, a low cycle threshold value (also abbreviated as "Ct value", which is the intersection point of the marker amplification curve obtained from the fluorescence intensity, and the threshold line defined with a given standard) is given.

[0068] As a specific example, as shown in Figure 2, when the amount of DNA to be added to the PCR reaction solution as a template is constant, for example, in the case of trisomy of chromosome 6 (Trisomy), the amplification curve of the marker located on chromosome 6 increases faster than that of the normal individual (Normal).

[0069] However, it is difficult to accurately standardize the amount of DNA in a large number of samples at a real testing site. Therefore, instead of standardizing the amount of DNA, the amplification of chromosome markers is subjected to relative quantification, whereby the number of each of the chromosomes can be estimated from the relative difference between the amplification values ​​obtained by each of the DNA markers, and aneuploidy such as trisomy can be determined.

[0070] In order to apply this method widely to Brassica oleracea species, it is necessary to design PCR primers in a region common to Brassica oleracea species in which single nucleotide polymorphisms (SNPs) do not exist. As a result of intensive studies by the present inventors, success has been achieved in the design of Petition 870200043201, dated 03 / 04 / 2020, page 28 / 68 / 50 DNA markers that can be widely applied to Brassica oleracea species and with which an efficient test can be performed by multiplex PCR. This led to the invention of the detection method of the present invention.

[0071] Therefore, in the detection method of the present invention, as described above, real-time PCR is performed using a chromosome-specific DNA marker, and chromosomal aneuploidy is detected from a relative difference between the amplification values ​​obtained by DNA markers.

[0072] Here, the relative difference between amplification values ​​obtained by DNA markers can be confirmed by performing real-time PCR on DNA markers that are specific to each of two or more chromosomes of the Brassica oleracea plant to be tested and comparing the amplification values ​​for each of the chromosome markers. Consequently, when the amplification of a plurality of chromosome markers is subjected to relative quantification and an abnormality in any of the chromosomes is present, an obvious difference occurs between the amplification of the marker on the aneuploid chromosome and the amplification of the markers on chromosomes with normal ploidy levels. As a result, it has become possible to detect the presence of aneuploids.

[0073] The amplification values ​​obtained by DNA markers can be confirmed using the marker amplification curve. The marker amplification curve can be easily created based on the fluorescence intensity measured by PCR reaction.

[0074] In the case of measuring the relative difference between amplification values ​​obtained by DNA markers, that is, performing relative quantification, it is preferable to use the amplification curve obtained for each marker. For example, an intersection point between the amplification curve and the threshold line defined with a given standard is defined Petition 870200043201, dated 03 / 04 / 2020, page 29 / 68 / 50, uses a threshold cycle value (Ct value) as a value, and each Ct value is compared with another Ct value from different chromosomes, thus achieving an estimate of the target chromosome number. From the point of view of seeking reproducible estimates of the chromosome number, the Ct value can be replaced by different values ​​calculated by the 2-derivative method, which differentiates the amplification curve twice, and adopts the cycle value of the position showing the maximum score.

[0075] In the present invention, with respect to the Ct value indicated by each of the individuals in a sample to be tested and each of the markers, the value calculated by the second derivative method as described above is adopted, and the copy number ratio between the target labeled genomic regions can be estimated based on the relative difference between the amplification values ​​obtained by DNA markers by the ΔΔί'I method.

[0076] In other words, a part of the preferred embodiment of the detection method according to the present invention can be specifically expressed as the following methods (a) or (b): (a) a method including: detecting the Ct value of each individual in a sample to be tested and each of the markers of the signal emitted by a fluorescent dye such as SYBR Green I; and estimating the copy number ratio of a target-labeled genomic region based on the relative difference between the amplification values ​​obtained by DNA markers by methods such as the ΔΔO method, in which a fluorescent dye such as SYBR Green I is mixed with a PCR reaction solution, and chromosome markers are amplified separately by PCR; or (b) a method including: detecting the Ct value of each individual in a sample to be tested and each of the markers of the fluorescence signal emitted by a fluorescent probe; and estimating the copy number ratio of a target-labeled genomic region based on the Petition 870200043201, dated 03 / 04 / 2020, page 30 / 68 / 50 relative difference between the amplification values ​​obtained by DNA markers using methods such as the ΔΔO method, in which multiplex PCR is performed using probes labeled with different types of fluorescent dyes and mixing various types of markers.

[0077] Although method (a) can be performed with a relatively inexpensive reagent, separate PCR tests are performed for each chromosome. Thus, multiple PCR tests are required for each plant. In method (b), it is necessary to synthesize a fluorescent probe, while the relative difference between the amplification values ​​obtained by DNA markers can be performed with the endogenous control as a standard. Thus, the number of tests can also be reduced.

[0078] The primers, primer pairs, and probes described above can also be prepared as a kit. The kit of the present invention can be any kit provided that it includes the primer or primer pair described above, or at least one primer or a primer pair and a probe. If necessary, the kit may include a DNA molecule containing a target sequence as a positive control for PCR, a reagent for DNA extraction, a PCR buffer solution, a PCR reagent such as DNA polymerase, a labeling substance, and a manual.

[0079] Thus, according to another preferred embodiment of the present invention, a primer set is provided for the purpose of detecting an aneuploid of a Brassica oleracea plant, including at least one or more primer types having the nucleotide sequences shown in SEQ ID NOs: 1 to 18. Additionally, also according to another preferred embodiment of the present invention, a primer set is provided for the purpose of detecting an aneuploid of a Brassica oleracea plant, including: at least one or more primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18; and at least one or more fluorescent dye-modified probes having the sequences of Petition 870200043201, dated 03 / 04 / 2020, p. 31 / 68 / 50 nucleotides shown in SEQ ID NOs: 19 to 27.

[0080] The method for detecting an aneuploid of the present invention is used to evaluate the frequency of occurrence of chromosome aneuploids for each lineage of the Brassica oleracea plant. Using this, the present invention can provide a method for cultivating a Brassica oleracea crop, including selection of a lineage with a low rate of aneuploid occurrence.

[0081] The method for detecting an aneuploid of the present invention is used in such a way that it is possible to provide a method for controlling the quality of Brassica oleracea seeds, including testing the contamination rate of aneuploids contained in seeds from a batch of Brassica oleracea seeds.

[0082] The aneuploid content of seeds was estimated by growth testing. Such testing requires a large-scale field and a growth period of several months. Additionally, it is impossible to obtain accurate results unless the growth is evaluated by a qualified examiner. According to the seed quality control method of the present invention, it is possible to perform the aneuploid content test in a space-saving manner and to obtain fast and accurate results.

[0083] The method for detecting an aneuploid of the present invention is used in such a way that it is possible to provide a method for controlling the quality of Brassica oleracea plants, including testing the contamination rate of aneuploids contained in the batch of Brassica oleracea seeds.

[0084] According to the Brassica oleracea plant quality control method of the present invention, it is also possible to test newly emerged cotyledons from germinated seeds as a material. Additionally, if the test for aneuploids is carried out up to the planting stage, it is possible to select and cultivate only normal individuals. As a result, a Petition 870200043201, dated 03 / 04 / 2020, page 32 / 68 / 50 normal fresh produce can be harvested from almost all plants. [EXAMPLES]

[0085] The present invention will be described specifically with reference to the following examples, but the present invention is not limited to these examples. For example, the sample to be tested, from which DNA is extracted, can be at any stage of growth. Seeds, cotyledons, true leaves, roots, and any tissues can be used. No special method is required for the DNA extraction method as long as the DNA is purified to the extent that PCR can be performed without problems. As for the fluorescent dye, any fluorescent dye can be used as long as it is a dye commonly used in the real-time PCR method.

[0086] As shown in the following examples, the method of the present invention is versatile and can detect aneuploids in different crops such as broccoli, cauliflower and cabbage using a common marker. Furthermore, the present inventors have confirmed that this method can be performed on a large number of lineages beyond these examples, and this method is not limited to the lineage used in the following examples. Example 1: Marker Preparation

[0087] PCR was performed using random amplified polymorphic DNA primers (RAPD) (10 mers), Operon Technologies, Inc., and sequence-related amplified polymorphism primers (SRAP) designed by the present inventors, and F2 broccoli population DNA as a template, thus constructing a linkage map of Brassica oleracea.

[0088] Then, the linkage map constructed by the present inventors was compared with the article: I. Parkin et al., Genetics 171 (2005) p. 765, Segment structure of the Brassica napus genome based on comparative analysis with Arabidopsis thaliana, the article: X. Cheng et al., Theoretical Petition 870200043201, dated 03 / 04 / 2020, p. 33 / 68 / 50 Applied Genetics 118 (2009) p. 1121, Development and genetic mapping of microsatellite markers from genome research sequences in Brassica napus, and public information registered in the NCBI, thus analyzing the relationship between markers located in linkage groups and public linkage maps.

[0089] Additionally, it was necessary to modify markers on chromosomes to broaden their use to include all types of Brassica oleracea species, and thus characteristic lines were selected from extensive genetic resources of cabbage, broccoli, and cauliflower. DNAs from these lines were used as templates to identify regions without SNPs and the primers were redesigned.

[0090] These markers were used to perform PCR using nine types of trisomic plants as templates (Figure 1) in which each of chromosomes 1 to 9 identified during the marker development became trisomic. It was confirmed that there was no non-specific amplification of other chromosomes affecting the determination, and then each of the markers was considered as a specific marker for one of the chromosomes.

[0091] Additionally, in order to implement a simpler and more stable multiplex fluorescence probe method, hydrolysis probes with three types of fluorescent dyes including FAM, HEX, and Cy5 were designed. The aim was to design primers and probes so that even if three types of markers were mixed in a reaction solution (i.e., even if six types of primers and three types of probes were mixed), the markers would not interfere with the probes and reproducible results could be obtained. Generally, when multiplex PCR is performed, complicated reactions such as primer dimer formation and annealing of another primer to an amplified DNA fragment occur. Thus, it is difficult to construct a system that stably detects the difference between two and three chromosomes (1.5-fold difference) relative to the crude template DNA. Petition 870200043201, dated 03 / 04 / 2020, page 34 / 68 28 / 50 However, the present inventors have succeeded in designing the markers shown in Tables 1 and 2 as a result of repeated improvement of the marker sequence and intensive studies.

[0092] Additionally, in order to perform a more accurate and stable test, the markers obtained from the nine chromosomes were divided into three groups comprising three markers each (see Example 4 to be described later). [Table 1] - List of primer sequences for PCR Seq ID nome Cromossomo Sequência SeqID—1 BoC1-Fw C1 CTGGCAAATGTAAGCCCTTTCT SeqID—2 BoC1-Rv C1 CTTGTCTTATTACAGCAGATGCATTC SeqID—3 BoC2~Fw C2 CGCCATTGCTTTCTCTCTACTCT SeqID-4 BoC2-Rv C2 GAAGAGGAAGGAC T CGAGGAAG SeqID—5 BoC3~Fw C3 CTTAGGATTCGGGTTCGTTTG SeqID—6 BoC3~Rv C3 GCCGTAAGATTTCAAAGAGACTTC SeqID-7 BoC4~Fw C4 CGTCTCTTGTGGTGGTTGAAG SeqID—8 BoC4-Rv C4 TCAACTTCATCTGCTTGGTAATG SeqID—9 BoC5~Fw C5 AGCACATCATCCCCCATACTT SeqID—10 BoC5-Rv C5 CAGTCTCTCTcTCCTTGATGACG SeqID—11 BoC6~Fw C6 AGGAAGAGGAAAT T GTCAT TCG Seq ID—12 BoC6-Rv C6 GTGACCGTTGCAGCAGATAA SeqID—13 BoC7~Fw C7 AAGAAATTAGCCACAAGTCGTAAATA SeqID—14 BoC7-Rv C7 ACGTGAATGATGGATATTTGATCTC Seq ID—15 BoC8~Fw C8 AAAGCTCGTGAAGCAAATACTACC Seq ID—16 BoC8~Rv C8 GAAGCATACCAGGAGGGAAATAA Seq ID—17 BoC9~Fw C9 GCCATCGCGAATCAAAGATA SeqID—18 BoC9-Rv C9 ATTTGGTATTTTGCAGGCTACAG [Tabela 2] - List of sequência of sondas fluorescentes Seq ID Name Chromosome Sequence Example of fluorescence labeling SeqID-19 BoC1-Prb C1 CACTTGTAAAACATGGGTTTGATCAAAAGA 5-FAM, 3-BHQ1 SeqID-20 BoC2-Prb C2 TCCTCTACTTCCACCCCATCTGCC 5-Cy5, 3-BHQ3 SeqID-21 BoC3-Prb C3 CCGATCTGAAAAGGGAGCTAACGAC 5-HEX, 3-BHQ1 SeqID-22 BoC4-Prb C4 TTGCAGCAAGGAGCTTAGACCACAG 5-HEX, 3-BHQ1 SeqID-23 BoC5-Prb C5 TCTCGAGAAATCTCATCGCTGCTTG 5-HEX, 3-BHQ1 SeqID-24 BoC6-Prb C6 TTCTCAGAGCTGTTCCCTCCTCCAC 5-FAM, 3-BHQ1 SeqID-25 BoC7-Prb 07 TTGCACCACCGTTACCTTTTAACACAA 5'-Cy5, 3-BHQ3 SeqID-26 BoC8-Prb C8 TGTTTTGTTTGGTGGGCAAATCTCTT 5'-Cy5, 3-BHQ3 SeqID-27 BoC9-Prb C9 TGGAGATCTTCCACCTCATCTTGGA 5-FAM, 3-BHQ1

[0093] Figure 2 shows the basic principle associated with relative quantification using real-time PCR.

[0094] When the amount of DNA as a template to be added to the PCR reaction solution is constant, for example in the case of trisomy chromosome 6, the amplification curve of the marker located in Petition 870200043201, dated 03 / 04 / 2020, page 35 / 68 / 50 chromosome 6 increases faster than that of a normal individual. In the case of performing relative quantification, an intersection point between the amplification curve and the threshold line defined with a certain standard defined as a Ct value is compared with the Ct value of each of the markers of other chromosomes, thus achieving the estimation of the number of target chromosomes.

[0095] Figure 3 shows an example of the relative quantification calculation result obtained by performing real-time PCR. In this test, multiplex PCR was performed using the fluorescent probe method with 96 individuals of an F1 variety of broccoli as materials, a chromosome 4 marker, and a chromosome 6 marker. The Roche “LightCycler 480 System II” was used as a real-time PCR machine, and Takara Bio Inc.'s “Premix Ex Taq (Perfect Real Time)” was used as a reaction reagent. In the figure, the X-axis shows the number of individuals and the Y-axis shows the relative quantification of the chromosome 6 marker calculated by the ΔΔί'I method using chromosome 4 marker as a standard.

[0096] Among the 96 individuals tested, 88 individuals of the normal type showed a value around 1, while 5 individuals with trisomy chromosome 6 showed a value around 1.4, and 3 individuals with trisomy chromosome 4 showed a value around 0.7. When the PCR amplification efficiency was assumed to be doubled per cycle, the theoretical values ​​for trisomy chromosome 6 and trisomy chromosome 4 were 1.5 and 0.66, respectively, and thus the actual values ​​were close to these values. Example 2 - Chromosome observation in trisomic broccoli plant

[0097] Among the plants determined to be trisomic by real-time PCR, trisomy chromosome 6, trisomy chromosome 7, and trisomy chromosome 2 were used as materials and the chromosome was observed. Petition 870200043201, dated 03 / 04 / 2020, pages 36 / 68 / 50

[0098] Anthers were removed from broccoli shoots measuring 1 to 2 mm in length and stained with a 1% acetic acid solution in orcein. Chromosomes in the first metaphase (MI stage) of meiosis of pollen mother cells were observed.

[0099] The results were as shown in Figure 4.

[00100] As shown in Figure 4, in the case of the chromosome of the normal individual, nine divalent chromosomes were observed (2n = 18). However, in the case of the chromosomes observed in the trisomic plant, nine divalent chromosomes and one chromosome (indicated by an arrow) were observed (2n+1). Example 3: Detection of variant type in broccoli

[00101] Seeds of the F1 broccoli variety “SBR-48” under development by SAKATA SEED CORPORATION were sown in nursery-type trays. DNA from 445 individuals was extracted from newly emerged cotyledons of germinated seeds and real-time PCR was performed using the SYBR method with specific markers for each chromosome.

[00102] Specifically, primers having the nucleotide sequences shown in SEQ ID NOs: 1 to 18 were used as specific markers for the chromosomes. SYBR Green I (Roche purchaser) as an intercalator was added to the normal PCR reaction solution resulting in a final concentration of 1 / 20000, then PCR was performed. For real-time PCR, Roche's “LightCycler 480 System II” was used. The method used for PCR included incubation at 95°C for 1 minute, followed by 40 cycles of 3-step PCR at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. In the signal measurement with SYBR Green I, a filter with an excitation wavelength of 465 nm and a detection wavelength of 510 nm was used.

[00103] Based on the Ct value obtained by the second derivative method, the relative quantification was calculated by the ΔΔί'I method using the marker Petition 870200043201, dated 03 / 04 / 2020, page 37 / 68 / 50 on chromosome 9 as a pattern.

[00104] The results were as shown in Table 3.

[00105] These results are summarized in Table 3 for each chromosome, and thus it is clear that aneuploids are included at a rate as shown in Table 4.

[00106] In this example, no trisomy of chromosome 3 appeared. However, as shown in Figure 1, trisomy of chromosome 3 appears in rare cases (the phenotypic characteristics of each chromosome trisomy are as shown in Figure 7). Note that the present inventors have separately confirmed that there is no problem with the designed markers including trisomy of chromosome 3. [Table 3-1] Table 3. Results of the aneuploidy test in the F1 variety of broccoli (raw data obtained by PCR based on the SYBR method (value calculated by the ΔΔO method)) Petition 870200043201, dated 03 / 04 / 2020, pages 38 / 68 32 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR 01 02 G3 04 05 06 G7 G8 09 C1 / C9 02 / 09 03 / 09 04 / 09 C5 / C9 G6 / C9 C7 / C9 08 / 09 G9 / G9 Indivíduo no. zlJct zlzlct dzlct ZfzlGt zlzlct zl / lct / l / lGt / l / lct Zl / lCt Resultados 1 0.98 1.06 1.04 1.11 0.95 1.08 0.94 0.96 1.00 Normal 2 1.03 0.98 0.99 1.02 0.98 1.04 0.95 0.91 1.00 Normal 3 0.86 0.96 1.13 1.23 1.04 0.92 1.10 1.18 1.00 Aneuploide (+C4) 4 0.98 1.03 0.97 0.99 1.03 1.03 0.95 0.98 1.00 Normal 5 1.10 1.00 0.94 1.12 0.93 1.07 0.95 0.99 1.00 Normal 6 0.96 0.99 0.95 0.94 0.96 1.03 0.95 0.95 1.00 Norma! 7 1.01 1.05 1.01 1.02 1.00 1.05 0.93 0.96 1.00 Normal 8 1.03 0.99 0.98 1.06 1.00 1.07 0.95 0.94 1.00 Normal 9 1.03 0.96 0.94 1.02 0.96 1.01 0.95 0.95 1.00 Normal 10 1.03 0.93 1.01 0.99 1.01 0.92 1.00 0.98 1.00 Normal 11 0.95 0.98 0.96 0.96 0.94 1.05 0.92 0.90 1.00 Normal 12 1.03 1.01 0.93 1.06 0.94 1.08 0.94 1.09 1.00 Normal 13 1.05 1.05 1.02 1.01 1.04 1.08 0.97 1.10 1.00 Normal 14 1.01 1.04 1.08 1.00 1.03 1.08 0.95 0.96 1.00 Normal 15 1.08 1.08 1.07 1.01 1.08 1.06 0.96 0.96 1.00 Normal 16 1.00 1.02 0.98 1.02 1.00 1.07 0.98 0.95 1.00 Normal 17 0.97 1.02 0.99 1.01 0.96 1.05 0.98 0.98 1.00 Normal 18 1.02 1.03 1.04 1.12 0.99 1.05 0.92 1.00 1.00 Normal 19 1.03 0.98 0.99 1.14 1.00 1.02 0.93 0.92 1.00 Normal 20 1.03 1.04 0.98 1.12 1.03 1.03 0.97 1.02 1.00 Normal 21 1.04 1.06 0.99 1.04 1.03 1.08 0.99 1.03 1.00 Normal 22 1.00 0.94 0.98 1.02 0.99 1.00 1.00 1.01 1.00 Normal 23 0.96 0.97 0.97 1.03 0.98 1.02 0.97 1.02 1.00 Normal 24 0.98 1.03 1.01 0.96 1.01 1.05 0.98 0.98 1.00 Normal 25 0.91 1.00 1.06 1.00 1.00 1.02 0.96 1.00 1.00 Norma! 26 0.92 1.00 1.01 1.02 1.03 1.06 1.00 0.99 1.00 Normal 27 0.99 0.98 0.91 1.03 0.98 0.99 0.92 0.98 1.00 Normal 28 0.97 1.01 0.94 1.01 1.00 1.04 0.92 0.95 1.00 Normal 29 1.04 1.03 0.98 1.10 1.02 1.10 0.95 1.02 1.00 Normal 30 1.00 1.02 1.01 1.05 1.07 1.08 1.02 1.00 1.00 Normal 31 0.97 0.97 0.99 0.97 1.02 0.98 0.95 0.96 1.00 Normal 32 0.90 0.97 0.97 0.98 0.99 1.00 1.41 0.92 1.00 Aneuploide (+C7) 33 0.59 0.90 0.91 0.83 0.92 0.89 1.25 0.90 1.00 Aneuploide (outros) 34 1.01 0.99 0.99 0.99 1.03 1.04 0.93 0.96 1.00 Normal 35 0.95 1.04 1.01 0.98 1.07 0.95 1.09 1.02 1.00 Normal 36 1.43 1.00 0.97 1.05 1.02 1.03 0.96 0.98 1.00 Aneuploide (+G1) 37 0.98 1.00 0.95 0.99 1.05 1.06 0.97 0.91 1.00 Normal 38 1.03 1.02 1.01 1.01 0.99 1.08 0.92 0.95 1.00 Normal 39 1.01 1.00 1.01 1.06 1.00 1.04 0.95 0.99 1.00 Normal 40 1.02 1.02 0.92 1.08 0.99 1.09 0.92 0.98 1.00 Normal 41 0.99 1.02 0.95 1.02 0.98 0.98 0.94 0.92 1.00 Normal 42 1.03 1.05 1.10 1.12 1.12 1.15 1.04 1.02 1.00 Normal 43 1.03 0.98 1.01 1.02 1.03 1.03 0.95 0.94 1.00 Normal 44 1.02 1.03 1.03 1.00 1.05 0.98 1.04 1.05 1.00 Normal 45 0.99 0.98 0.99 0.94 1.00 0.98 0.94 0.90 1.00 Normal 46 1.11 1.11 1.10 1.05 1.03 1.06 1.02 1.05 1.00 Normal 47 0.99 1.02 1.00 1.07 1.03 1.01 1.06 1.07 1.00 Normal 48 0.98 0.97 0.94 1.05 0.99 1.05 0.97 1.00 1.00 Normal 49 1.00 1.00 0.97 0.98 1.01 1.05 0.93 0.91 1.00 Normal 50 1.12 1.10 1.01 1.09 0.93 1.14 0.93 1.00 1.00 Normal 51 1.01 1.02 0.99 1.02 1.00 1.12 0.95 1.00 1.00 Normal 52 1.01 1.00 0.94 1.01 1.01 1.00 0.94 0.94 1.00 Normal 53 1.03 1.05 1.04 1.05 1.04 1.03 1.00 1.00 1.00 Normal 54 0.99 1.03 1.01 0.99 1.08 1.05 0.97 0.96 1.00 Normal 55 1.03 0.98 1.00 1.00 1.03 1.00 1.00 0.94 1.00 Normal 56 0.99 1.02 1.04 1.06 1.03 0.99 1.07 1.05 1.00 Normal 57 1.02 0.99 0.99 0.97 1.02 1.08 0.97 0.93 1.00 Normal 58 1.00 0.98 0.94 0.96 1.02 0.98 0.97 1.01 1.00 Normal 59 0.95 1.11 1.11 1.06 1.05 1.12 1.14 1.08 1.00 Normal 60 1.05 1.02 0.99 1.02 1.05 1.03 1.06 0.97 1.00 Normal 61 1.02 1.05 0.97 0.94 1.03 1.05 1.00 0.97 1.00 Normal 62 1.03 0.98 0.93 1.02 1.05 1.11 0.95 0.94 1.00 Normal 63 1.05 1.02 0.97 1.08 1.03 1.05 0.95 0.96 1.00 Normal 64 1.08 0.96 0.94 1.10 0.98 1.10 0.93 1.00 1.00 Normal. [Table 3-2] Petition 870200043201, dated 03 / 04 / 2020, pages 39 / 68 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR C1 C2 C3 C4 C5 C6 C7 C8 C9 C1 / C9 G2 / G9 C3 / G9 C4 / G9 05 / 09 C6 / C9 C7 / C9 C8 / C9 C9 / G9 Indivíduo no. zlzíct zMct / 1 / lGt zlzíct / Met / Met ZMGt Zl / lGt Resultados 65 1.00 0.98 0.98 1.12 1.02 1.03 0.95 104 1.00 Normal 66 0.92 1.00 1.07 1.10 1.08 0.93 107 107 100 Normal 67 0.95 1.02 1.05 1.00 1.05 0.91 108 1.00 100 Normal 68 0.98 1.00 0.99 0.95 0.98 0.91 0.97 1.01 100 Normal 69 0.99 0.46 1.14 1.11 1.13 0.94 1.23 1.10 1.00 Aneuploide (outros) 70 0.99 0.97 0.95 1.02 1,00 1.03 0.94 0.98 1.00 Normal 71 1.09 1.10 0.95 1.05 1.03 1.11 0.97 1.02 100 Normal 72 1.09 1.04 1.01 1.07 1.12 1.07 0.99 104 100 Normal 73 1.04 0.96 0.95 1.05 1.03 1.07 0.97 100 100 Normal 74 1.00 1.05 1.03 1.09 1.10 108 104 110 1.00 Normal 75 0.99 1.01 0.93 1.11 1.00 101 149 1.01 1.00 Aneuploide (+C7) 76 1.02 1.00 0.97 1.02 0.98 102 0.99 1.01 1.00 Normal 77 1.02 1.01 0.99 1.03 0.99 100 1.01 0.99 1.00 Normal 78 1.01 0.98 0.99 1.02 1.03 1.03 1.02 0.97 100 Normal 79 1.03 1.03 0.98 I.02 1.00 103 0.98 0.96 100 Normal 80 0.91 1.01 1.05 1.02 1.04 0.92 1.07 105 100 Normal 81 0.92 1.00 1.02 0.97 1.08 160 107 0.97 100 Aneuploide (+C6) 82 0.96 0.99 0.99 1.00 1.06 0.97 108 108 1.00 Normal 83 1.05 1.00 0.97 1.09 1.01 1.00 0.99 100 100 Normal 84 1.03 1.03 1.01 1.04 1.10 105 1.00 0.97 1.00 Normal__________ 85 0.61 0.65 0.66 W7O.W 0.67 0 64 0.67 0.68 100 Aneuploide (+C9) 86 0.96 1.01 0.96 1.06 1.00 Í.00 0.98 0.93 1.00 Normal 87 1.03 1.01 0.94 1.05 1.01 1.04 0.97 100 100 Normal 88 1.00 0.95 0 95 1.01 1.00 102 0.95 104 100 Normal 89 0.93 0.92 0.95 1.08 0.94 0.92 0,93 102 1.00 Normal 90 1.00 0.98 1.04 1.01 1.00 104 1.00 105 1.00 Normal 91 1.11 1.12 1 13 1.12 1.14 113 1.10 112 1.00 Normal 92 1.01 1.00 0.95 1.02 0.97 100 0.94 1.00 1.00 Normal 93 1.02 0.91Γ 0.96 0.98 0.99 103 0.97 0.96 100 Normal 94 0.96 0.99 1.01 0.94 0.99 100 0.97 0.98 100 Normal 95 1.00 1.01 0.98 1.00 0.98 0.99 0.96 105 100 Normal 96 1.04 1.07 1.09 0.99 0.99 105 0.98 100 100 Normal 97 1.03 1.00 1.07 1.05 1,08 106 1.02 100 100 Normal__________ 98 1.07 1.14 1.07 1.13 1.05 115 100 105 100 Normal 99 1.03 0.98 0.99 1.01 0.98 0.94 0.97 1,00 1.00 Normal 100 0.96 0.97 1.10 1.08 1.06 0.93 111 109 1,00 Normal 101 0.97 0.98 1.01 0.93 1.03 1.03 1.02 0.96 100 Normal I02 1.03 0.96 1.02 0.96 1.00 0.95 0.96 103 100 Normal 103 1.04 1.00 1.05 0.99 1.01 1.03 102 0 98 100 Normal 104 1.08 1.07 1.01 0.99 1.03 1.02 0.97 0.96 1.00 Normal 105 1.02 1.01 0.98 0.94 0.99 0.98 0.95 0.96 100 Normal 106 0.96 1.00 1.05 1.02 1.07 0.95 1.66 1.04 1.00 Aneuploide (+C7) 107 1.02 1.00 0.96 1.04 1.00 1.00 0.95 100 1.00 Normal 108 1.05 1.05 1.01 0.98 1.00 0.98 1.02 0.98 100 Normal I09 0.99 1.00 0.99 0.98 1.00 1.00 0.94 0.94 100 Normal 110 1.00 1.02 1.07 1.02 1.06 103 0.98 1.01 100 Normal 111 1.05 1.05 1.01 1.11 1.07 105 100 102 100 Normal 112 1.06 1.00 1.00 0.94 0.96 0.98 0.97 101 100 Normal 113 1.03 1.04 1.02 0.94 1.00 0.96 1.02 1,00 1.00 Normal 114 1.05 1.00 0.99 0 94 1.02 1.04 0.95 0.91 1.00 Normal__________ 115 1.01 0.96 0.93 1.00 0.96 105 0.93 0.99 1.00 Normal 116 I.05 1.00 1.02 1.04 1.02 1.02 1.00 106 1.00 Normal 117 1.02 1.01 0.99 1.00 0.99 0.98 100 104 1.00 Normal 118 0.98 1.01 1.01 1.01 0.99 0.96 0.93 0.98 1.00 Normal 119 1.06 1.00 0.99 1.02 1.02 1.02 0.97 105 100 Normal 120 0.99 1.01 1.00 0.99 1.00 1.04 0.95 0.93 1.00 Normal__________ 121 1.04 1.02 1.04 1.14 1.00 1.12 1.00 1.02 1.00 Normal 122 1.03 0.96 0.98 0.94 0.98 0.96 1.04 0,89 1.00 Normal 123 1.01 1.02 1.00 1.02 1.05 1.04 100 100 1.00 Normal 124 1.00 1.00 1.01 0.97 1.00 1.00 0.95 0.96 1.00 Normal 125 0.99 0.98 1.05 0.99 1.00 1.00 0.97 102 1.00 Normal 126 0.97 0.95 1.07 0.96 0.98 0.96 0,94 100 1.00 Normal 127 1.09 1.05 1.00 0.96 1.00 104 102 0.97 1.00 Normal 128 1.00 1.00 1.00 0.99 0.98 1.00 0,94 0.98 1.00 Normal 129 1.00 1.02 0.99 0.94 1.00 1.00 0.97 0.98 1.00 Normal 130 0.98 1.03 1.01 0.99 1.01 1.03 100 0,96 1.00 Normal 131 0.98 1.08 1.07 111 1.08 106 102 104 100 Normal. [Tabela 3-3] Petition 870200043201, dated 03 / 04 / 2020, pp. 40 / 68 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR G1 C2 C3 G4 G5 06 G7 08 09 01 / 09 C2 / G9 C3 / C9 04 / 09 O5 / C9 C6 / C9 C7 / C9 O8 / C9 G9 / C9 Indivíduo no. / 1 / 1 ct / l / lct / l / lct Z / lct / IzICt / 1 / lGt ZlzdCt Resultados 132 1.00 1.00 0.95 1.06 1.00 1.01 0.97 0.92 1.00 Mormal 133 1.04 1.02 1.01 1.14 1.07 1.00 1.01 1.03 1.00 Normal 134 1.03 0.96 0.95 0.99 1.01 0.96 1.02 0.97 1.00 Normal 135 1.11 1.03 1.05 1.07 1.07 1.10 1.05 1.05 1.00 Normal 136 1.03 1.00 0.99 0.97 0.99 0.97 0.99 1.00 1.00 Normal 137 1.07 1.04 1.02 1.07 1.04 1.01 1.02 1.02 1.00 Normal__________ 138 1.08 1.00 1.05 0.98 1.00 0.98 1.02 1.02 1.00 Normal 139 1.04 1.07 1.07 1.01 0.99 0.98 1.05 1.04 1.00 Normal 140’ 1.06 1.07 1.06 1.01 1.02 1.04 1.06 1.07 1.00 Normal 141 1.09 1.07 1.01 1.05 1.08 1.08 1.04 1.01 1.00 Normal 142 1.06 1.09 1.06 1.11 1.06 1.08 1.05 1.02 1.00 Normal 143 1.03 1.08 1.04 1.04 1.04 1.03 1.04 0.98 1.00 Normal 144 1.04 1.03 1.04 1.00 1.03 0.97 1.06 0.99 1.00 Normal 145 1.07 1.11 1.06 1.02 1.10 1.05 1.07 1.01 1.00 Normal 146 1.09 0.51 1.09 1.05 1.03 1.03 1.07 1.03 1.00 Aneuploid (outros) 147 1.03 0.97 0.97 1.03 0.96 0.99 0.95 1.00 1.00 Normal 148 1.14 1.14 1.09 1.08 1.12 1.08 1.10 1.07 1.00 Normal 149 0.95 0.96 1.04 0.99 1.05 0.99 1.05 1.02 1.00 Normal 150 0.98 1.01 1.01 1.02 1.06 1.00 1.05 1.11 1.00 Normal 151 1.05 1.02 1.00 1.08 1.03 1.13 0.97 1.04 1.00 Norma! 152 0.96 1.02 1.05 1.02 1.04 0.98 1.50 1.02 1.00 Aneuploid (+C7) 153' 1.03 1.00 0.93 1.08 0.98 1.06 0.92 0.99 1.00 Normal__________ 154 0.93 1.00 1.01 1.03 1.07 0.93 1.07 1.02 1.00 Normal________ 155 0.94 1.00 1.01 0.98 0.96 1.00 0.97 0.98 1.00 Normal 156 1.01 1.01 1.04 1.04 1.01 0.94 1.01 1.00 1.00 Normal 157 1.02 1.00 0.98 0.96 0.97 0.98 0.95 0.97 1.00 Normal 158 1.11 1.11 1.13 1.08 1.05 1.60 1.11 1.10 1.00 Aneuploid (+C6) 159 0.98 1.02 0.93 1.00 0.95 0.99 0.95 0.94 1.00 Normal 160 1.00 0.99 1.00 0.96 1.00 0.91 0.99 0.97 1.00 Normal 161 1.00 1.02 0.97 0.98 1.37 1.60 0.92 1.00 1.00 Aneuploid (outros) 162 0.97 1.06 1.02 1.05 0.96 1.04 ......1.04 1.04 1.00 Normal 163 1.06 1.05 0.97 1.05 1.00 1.07 0.99 0.98 1.00 Normal 164 1.03 1.11 1.04 1.03 0.98 1,03 1.07 1.02 1.00 Normal 165 0.97 1.01 1.08 1.05 1.02 0,91 1.09 1.00 1.00 Normal 166 0.98 0.97 0.93 0.93 0.93 0.96 0.93 0.92 1.00 Normal 167 1.11 1.13 1.07 1.04 0.90 1.04 0.98 1.02 1.00 Normal 168 1.11 1.11 1.04 1.08 0.87 1.07 1.00 1,00 1.00 Normal 169 0.96 0.96 1.01 0.87 0.92 1.00 0.97 1.00 1.00 Normal 170 0.94 1.11 1.04 0.89 0.90 0.91 1.01 0.95 1.00 Normal 171 0.98 0.98 0.97 1.00 0.96 1.06 1.01 0.97 1.00 Normal 172 1.06 1.10 1.09 1.10 1.09 1.11 1.05 1.05 1.00 Normal 173 1.00 0.97 1.00 1.04 1,05 1.10 0.85 0.95 1.00 Normal 174 1,00 1.05 0.95 1.14 0.99 0,98 1.01 1.05 1.00 Normal 175 0.98 0.96 0.99 0.99 0.96 0.96 0.95 0.93 1.00 Normal 176 1.00 0.98 0.99 0.97 1.00 1.02 0.98 0.95 1.00 Normal 177 1.05 1.03 1.01 1.00 1.06 1.07 1.04 1.06 1.00 Normal 178 1.03 1.02 1.03 0.98 0.89 0.98 0.98 0.98 1,00 Normal 179 0.98 0.96 1.01 0.91 0.97 0.96 0.95 1.04 1.00 Normal 180 1.02 1.00 1.01 0.93 1.00 1.00 0.98 0.97 1.00 Normal 181 1.05 1.07 1.03 1.02 0.96 1.08 0.95 1.00 1.00 Normal__________ 182 1.01 1.01 1.01 0.94 0.97 0.96 1.00 0.96 1.00 Normal 183 1.07 1.02 1.04 1.00 1.00 1.03 1.01 0.99 1.00 Normal 184 0.98 1.04 0.99 1.02 0.96 1.08 0.95 0.96 1.00 Normal 185’ 1.08 1.11 1.06 1.06 1.02 1.11 1.00 1.04 1.00 Normal 186 0.98 1.07 1.05 1.06 0.99 1.06 1.01 1.07 1.00 Normal__________ 187 1.00 1.03 1.03 1.00 1.03 1.06 1.04 1.00 1.00 Normal 188 1.03 1.04 1.01 1.07 1.00 1.01 1.05 1.06 1.00 Normal 189 1.06 0.98 1.00 0.96 0.98 0.92 1.06 0.96 1.00 Normal 190 1.11 1.08 1.09 1.00 0.98 1.05 1.06 1.05 1.00 Normal 191 1.02 1.05 1.04 0.96 1.03 0.95 1.00 1.05 1.00 Normal ______________192 0.99 1.01 1.04 1.00 1.00 0.97 0.97 1.06 1.00 Normal 193 1.10 1.07 1.02 0.96 0.99 1.03 1.02 1.00 1.00 Normal 194 1.03 1.00 1.04 0.99 0.94 1.01 1.07 1.02 1.00 Normal 195 1.03 1.54 1.01 0.93 0.89 1.03 1.02 0.96 1.00 Aneuploide (+C2) 196 0.98 1.00 0.97 0.99 0.99 0.99 1.00 0.93 1.00 Normal 197 1.00 1.04 0.95 1.00 1.00 1.00 0.96 0.94 1.00 Normal 198 1.04 1.05 1.04 1.04 1.02 1.11 0.99 1.03 1.00 Normal. [Table 3-4] Petition 870200043201, dated 03 / 04 / 2020, page 41 / 68 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR C1 02 G3 G4 G5 C6 C7 G8 C9 C1 / C9 C2 / C9 G3 / G9 C4 / G9 C5 / G9 C6 / G9 G7 / G9 C8 / G9 C9 / C9 Indivíduo no. ZZCt ZZct zd / lct zízíct zlzdct ZZct ZlZlGL Zzlct ZZct Resultados 199 1.01 1.02 0.95 0.44 0.89 0.98 0.93 0.90 1.00 Aneuploid (outros) 200 1.02 0.99 0.97 0.91 0.95 0.95 0.99 0.99 1.00 Normal 201 0.94 0.95 0.97 0.91 0.96 0.91 0.90 0.92 1.00 Normal 202 1.06 1.06 1.01 1 03 1.03 1.05 1.02 1.00 1.00 Normal 203 1.02 1.05 1.01 0 92 0.98 0.99 1.01 1.00 1.00 Normal 204 1.04 1.05 1.05 0 98 0.97 1.00 1.02 0.96 1.00 Normal zOo 1.03 1.00 0.95 1.00 1.03 1.05 0.97 1.00 1.00 Normal 206 1.04 1.05 0.99 0 98 1.05 1.03 1.06 1.00 1.00 Normal 207 0.98 1.02 0.97 0 96 0.96 0.97 0.97 0.92 1.00 Normal 208 0.98 1.11 0.99 1.03 1.01 0.97 0.95 1.06 1.00 Normal 209 1.05 1.03 1.00 0.98 1.01 1.00 1.01 0.94 1.00 Normal__________ 210 1.00 1.05 1.07 0.92 0.91 0.98 1.00 1.04 1.00 Normal__________ 211 1.11 1.08 1.12 1.03 1.06 1.01 1.11 1.09 1.00 Normal 212 1.00 1.02 0.99 0.96 1.01 0.96 0.97 0.95 1.00 Normal 213 0.98 1.05 1.01 0.96 1.03 1.01 1.04 0.98 1.00 Normal 214 1.05 1.09 0.99 0.99 1.02 1.00 1.00 0.96 1.00 Normal 215 1.00 0.98 0.97 1.01 1.02 0.96 0.98 1.02 1.00 Normal 216 0.98 1.04 0.97 0.96 1.00 0.98 0.96 1.03 1.00 Normal__________ 217 0.98 1.02 1.00 1.02 1.03 0.94 1.02 0.97 1.00 Normal__________ 218 • 1.03 1.00 1.00 1.02 1.01 0.95 1.00 1.08 1.00 Normal 219 1.13 0.98 0.97 0.99 0.97 0.96 0.95 1.04 1.00 Normal 220 1.01 0.97 0.98 0.92 0.94 0.96 0.93 0.91 1.00 Normal 221 1.11 1.10 1.06 1.03 1.08 1.06 0.98 1.05 1.00 Normal__________ 222 0.98 1.00 1.00 1.00 1.05 0.98 0.95 1.04 1.00 Normal 223 1.03 0.96 0.95 1.05 0.96 0.91 0.97 1.05 1.00 Normal 224 0.97 1.06 0.99 1.02 1.00 1.03 0.97 1.05 1.00 Normal 225 1.03 1.02 1.04 1.11 1.04 1.06 0.94 1.01 1.00 Normal 226 0.98 1.03 0.95 1.00 1.03 1.02 1.02 1.00 1.00 Normal 227 0.99 0.94 0.96 1.03 0.97 0,98 0.97 1.02 1.00 Normal 228 1.00 0.97 0.99 1.08 0.99 0.98 1.01 i.oi 1.00 Normal 229 1.04 0.97 0.99 0.98 0.98 0.94 1.00 1.00 1.00 Normal 230 1.03 1.05 1.10 1.04 1.01 0.98 1.04 1.03 1.00 Normal__________ 231 1.05 1.02 1.04 1.00 0.97 0.98 1.00 1.02 1.00 Normal 232 1.00 0.97 0.95 0.93 0.96 0.94 0.97 1.03 1.00 Normal 233 1.05 1.06 1.04 0.97 1.05 1.05 1.00 0.96 1.00 Normal 234 1.13 1.08 0.99 1.11 1.02 1.00 0.96 1.02 1.00 Normal 235 0.94 0.99 1.04 0.99 1.03 0.99 0.99 0.98 1.00 Normal 236 0.99 1.02 1.01 0.97 1.03 1.00 1.00 0.97 1.00 Normal 237 1.07 1.03 1.00 1.06 1.00 1.10 0.83 0.97 1.00 Normal 238 1.03 1,00 1.01 1.00 1.01 1.00 0.99 0.99 1.00 Normal 239 1.06 1.01 1.02 1.01 0.99 1 00 1.00 1.00 1.00 Normal 240 1.03 1.02 1.04 1.00 0.91 0.96 1.02 1.00 1.00 Normal 241 1.10 1.04 1.05 1.02 0.97 1.03 1.01 1.02 1.00 Normal 242 1.05 1.08 1.12 1.00 1.00 1.10 1.02 1.07 1.00 Normal 243 0.98 0.95 0.99 0.92 0.94 0.95 0.98 0.94 1.00 Normal 244 1.05 1.03 1.04 0.98 1.05 0.98 1.04 1.00 1.00 Normal 245 1.00 1.04 1.07 1.02 1.11 1.40 1.09 1.05 1.00 Aneuploide (+C6) 246 0.98 0.98 1.01 1.00 1.00 0.97 0.97 0.94 1.00 Normal 247 1.00 1.00 1.04 1.01 1.06 1.00 1.03 0.97 1.00 Normal 248 1.00 1.02 0.99 0.96 1.00 1.02 0.97 1.02 1.00 Normal 249 0.95 0.92 0.94 0.97 0.95 0.96 0.95 0.91 1.00 Normal 250 0.96 0.99 1.06 1.05 1.05 0.90 1.07 1.02 1.00 Normal 251 1.03 0.94 1.02 1.00 1.03 1.03 1.00 1.03 1.00 Normal 252 0.96 0.96 0.98 0.96 1.00 1.00 0.95 1.02 1.00 Normal 253 0.98 1.02 1.04 0.96 1.00 0.98 0.96 0.92 1.00 Normal 254 1.05 1.11 1.04 1.00 1.05 1.03 1.04 0.98 1.00 Normal 255 1.08 1.03 1.05 1,09 1.02 1.05 1.00 1.06 1.00 Normal__________ 256 0.98 1.05 1.03 1.02 1.02 1.05 1.03 0.94 1.00 Normal 257 1.01 0.97 0.99 0.98 1.02 1.00 0.97 0.96 1.00 Normal 258 0.97 1.00 0.95 1.00 1.05 1.02 1.04 0.96 1.00 Normal 259 1.00 0.98 0.97 1.12 0.98 1.03 0.95 1.03 1.00 Normal 260 1.01 0.98 0.99 0.98 0.98 1.05 1.00 0.99 1.00 Normal 261 0.98 0.99 0.99 0.94 1.00 0.94 1.01 1.08 1.00 Normal 262 0.96 1.01 0.95 0.96 0.99 0.94 0.99 0.95 1.00 Normal 263 1.03 0.96 0.91 0.92 0.94 0.96 0.93 0.92 1.00 Normal 264 1.05 1.03 1.01 0.98 0.99 0.96 1.06 0.98 1.00 Normal 265 0.98 1.07 0.99 1.05 0.99 1.05 1.01 1.08 1.00 Normal. [Table 3-5] Petition 870200043201, dated 03 / 04 / 2020, page 42 / 68 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR C1 02 C3 C4 C5 C6 C7 C8 C9 C1 / C9 C2 / C9 C3 / C9 C4 / C9 05 / 09 C6 / C9 07 / 09 G8 / C9 G9 / C9 Indivíduo no. zlzlct / WCt Δ zlct zdzjCt zl / ict ZlZlCt Ádct ΔΔ^ zlzlct Resultados 266 0.98 1.00 0.95 0.97 0.96 0.93 0.97 0 97 100 Normal . 267 1.02 1.07 1.05 1.02 1.00 1.04 1.04 1.02 100 Normal 268 0.91 0.99 0.95 1.00 0.97 0.98 1.04 102 100 Normal 269 0.82 1.51 0.95 1.00 0.96 0.91 0.95 0 98 100 Aneuploide (+C2) 270 1.09 111 1.06 1.11 1.12 1.13 1.09 109 100 Normal 271 0.99 1.01 0.99 1.04 1.00 1.00 1.02 102 100 Normal 272 0.99 0.97 0.97 1.01 1.01 1.54 0.97 1.05 100 Aneuploide (+C6) 273 1.01 0.98 0.93 0.92 0.98 1.00 0.93 102 [.00 Normal 274 0.94 0.95 0.93 0.85 0.90 0.93 0.95 0.89 1.00 Normal 275 0.99 0.95 0.96 0.89 0.91 0.94 0.96 0.98 100 Normal 276 0.96 0.98 □.95 1.00 1.00 0.96 0.95 104 100 Normal 277 0.97 1.00 0.98 0.93 0,98 0.95 1.00 103 100 Normal 278 0.93 0.96 1.02 0.94 0.98 0.96 0.97 0.98 1 100 Normal 279 0.96 0.99 0.98 0.93 1.00 0.98 0.95 0.94 100 Normal 280 0.96 1.02 1.02 1.00 1.00 0.98 1.08 108 100 Normal__________ 281 1.00 0.95 0.93 0.96 0.97 0.98 0.97 0.94 in 100 Normal 282 0.96 0.99 0.97 1.00 1.00 0.98 1.02 104 1 100 Normal 283 0.99 0.91 0.90 0.96 0.93 0.92 0.89 0.94 1 100 Normal__________ 284 0.96 0.90 0.92 0.98 0.87 0.97 0.87 0.95 : 100 Normal 285 0.96 0.94 0.95 0.93 0.99 0.96 0.96 0.94 : 100 Normal 286 1.03 0.96 0.97 0.94 1.01 0.96 1.02 0.98 100 Normal 287 0.92 0.98 0.95 0.96 0.98 0.96 1.02 1.08 100 Norma! 288 0.92 0.98 1.10 0.97 0.96 1.00 0.97 104 100 Normal 289 1.00 1.04 0.99 0.96 1.01 0.96 1.03 0.97 100 Normal 290 0.97 1.01 0.97 0.99 1.00 1.02 1.00 100 100 Normal 291 1.02 1.01 1.01 0.96 0.98 1.02 1.03 105 100 Normal 292 0.90 1.01 0.93 0.95 0.98 0.92 1.04 100 100 Normal 293 0.94 0.99 0.93 0 99 0.96 0.99 0.97 0.941 100 Normal 294 0.96 1.00 0.99 1.00 0.99 0.96 1.02 0.96 100 Normal 295 0.98 0.92 0.98 0.93 0.97 0.93 0.95 0.92 100 Normal 296 0.92 0.98 0.94 0.92 0.96 0.96 0.99 0.93 1.00 Normal 297 0.91 1.00 1.04 0.93 1.03 0.91 1.07 1.04 .................100 Normal 298 0.94 1.05 0.97 1.06 0.98 0.95 0.95 100 100 Normal 299 0.98 0.98 0.93 0.94 0.94 0.91 0.95 ...... 0.98 100 Normal 300 0.90 0.95 0.97 0.98 0.99 0.96 1.05 105 100 Normal 301 0.98 0,99 0.99 0,93 0.96 0.93 0.99 0.96 100 Normal 302 0.96 0.96 0.98 0.96 1.00 1,01 1.01 0.98 100 Normal 303 0.95 0.98 1.00 0.92 0.96 0.96 1.00 0.94 100 Normal 304 0.99 1.00 0.93 0.96 0.96 0.98 0.99 0.97 100 Normal 305 0.96 0.96 1.00 1.05 0.98 1.05 0.95 0.99 100 Normal 306 0.92 0.92 0.95 0.92 0.93 0.89 0.94 0.84 1.00 Normal 307 1.00 1.05 0.99 1.02 0.96 1.03 0.99 105 100 Normal 308 0.89 0.91 0.93 0.91 0.98 0.89 0.96 105 100 Normal 309 0.92 0.99 1.00 0.94 0.98 0.96 1.05 104 100 Normal 310 0.58 0.60 .··· 0.60 0.57 .. 0.59 0.57 0.59 ... .0.63. 100 Aneuploide (+C9) 311 0.95 0.94 0.91 0.89 0.93 093 0.95 0.94 100 Normal 312 0.95 0.97 1.02 0.92 0.93 0.96 1.00 0.98 100 Normal 313 0.92 0.94 1.04 1.01 0.98 0.93 1.01 1.01 100 Normal.............................. 314 0.95 1.01 1.01 0.98 0.99 0.96 1.05 108 100 Normal 315 L02 1.00 1.00 0.99 1.00 0.96 1.04 103 100 Normal 316 0.95 0.94 0.97 1.00 1.00 1.00 1.01 108 100 Normal 317 0.98 0.98 0.97 1.02 1.00 1.05 0.92 108 100 Normal 318 0.96 0.99 1.01 0.95 0.97 0.93 1.03 102 100 Normal 319 0.95 0.94 0.94 0.92 0.95 0.94 0.96 0.96 1.00 Normal 320 1.01 0.96 0.96 0.92 0.95 0.94 1.01 0.97 100 Normal 321 0.92 0.90 0.97 □.85 0.95 0.89 1.02 0.96 100 Normal 322 0.99 0.95 0.97 105 0.98 0.99 1.00 106 100 Normal 323 1.03 1.06 1.01 0.93 0.96 1.02 0.97 102 100 Normal 324 1.0C 1.00 0.96 l 0.92 1.01 0.98 1.03 0.99 100 Normal 325 1.03 1.07 1.07 1.03 1.00 0.92 1.12 105 100 Normal 326 0.98 1.02 0.99 0.98 1.00 1.03 101 102 100 Normal 327 0.98 1.04 1.01 1.06 0.97 1.09 . 1.04 104 100 Normal 328 0.99 1.01 0.95 i 1.12 1.03 1.12 0.93 105 1.00 Normal 329 0.98 0.94 0.97 I 0.89 0.87 0.87 0.95 0.98 100 Normal 330 0,99 1.02 0,99 0.97 0.98 0.89 1.09 104 1.00 Normal 331 1.00 1.00 0,98 0.98 0.93 0.98 0.95 102 1.00 Normal 332 1.00 0.97 0.97 0.94 1 .02 0.96 1.07 1.00 1.00 J\J rs rm 1. [Table 3-6] Petition 870200043201, dated 03 / 04 / 2020, page 43 / 68 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR 01 C2 C3 04 05 06 07 C8 C9 C1 / O9 02 / 09 03 / 09 C4 / C9 C5 / C9 C6 / C9 C7 / C9 C8 / C9 C9 / C9 Indivíduo no. Adct dzdCt zlzfct zldot ZZct / l / lct Zdzfct Adot zlzlct Resultados 333 1.03 1.01 1.02 1 05 0.92 1.02 0.92 1.01 100 Normal 334 0.96 1.00 0.99 1.02 0.99 0.96 1.00 1.10 100 Normal 335 0.97 1.11 1,12 1.01 0.97 1.03 1.01 1.11 100 Norma! 336 1.00 1.01 1.01 1.12 1.01 1.05 1.02 1.08 1.00 Normal 337 1.04 0.98 0.99 1.05 0.96 1.05 1.00 0.98 100 Normal 338 0.92 0.94 1.01 1.00 1.00 0.95 1.00 1.03 100 Normal 339 1.01 0.96 1.01 1.06 0.98 0.95 1.03 1.10 100 Normal 340 0 98 0.97 0.94 1.02 0.92 1.05 1.01 0.98 100 Normal 341 0.92 0,97 0.93 0.90 0.94 0.92 1.00 1.00 100 Normal 342 1.06 1.03 1.06 1.02 0.99 0.96 1.07 1.07 100 Normal__________ 343 0.96 0.94 0,97 0.96 1.00 0.94 1.00 1.02 1.00 Normal 344 0.99 0,98 0.97 0.97 1.03 0,95 ..... 0.97 0.99 100 Normal 345 0.94 0,99 0.99 1.06 0.96 0.95 0.93 1.00 100 Normal 346 0.92 1.00 0.96 1.07 0.93 1.03 1.02 1.02 100 Normal 347 1.03 1.00 0,93 1,11 0.97 1.02 0.96 0.96 100 Normal 348 0.97 0.96 0,99 0.97 0.96 1,09 0.92 0.89 100 Normal 349 1.05 0,99 0.97 1.05 101 1.10 1.02 0,95 100 Normal 350 1,01 1,03 1,01 1.06 1.02 0.99 0.98 0.97 100 Normal 351 0.93 0.92 1,01 0.99 0.98 1,01 0.95 1.03 100 Normal__________ 352 1.03 1.11 1.00 1.09 1.00 1.06 0.98 1.05 100 Normal 353 1.05 1.05 0.97 1.06 0.92 1.04 0.94 0,99 100 Normal 354 0.98 1.09 1.03 1.06 1.02 1.01 1.04 1.06 100 Norma! 355 0.94 1.09 0.99 1.04 1.00 1.07 1.02 1,02 100 Normal 356 0.96 0.99 1.01 0.99 1.00 1.01 1.02 1.08 100 Normal 357 0.98 1.01 1.03 1.01 1.00 ...... 0.96 1.05 1.03 100 Normal 358 1.14 1.11 1.01 1.06 0.98 1.10 0.96 1.06 100 Normal 359 1.04 1.00 1.01 1.09 0.98 1.04 0.96 1.04 100 Normal 360 1.02 0.97 0.99 1.02 0.99 1.01 0.93 0.93 1.00 Normal 361 1.02 1.01 1.06 0.97 0.97 1.00 1.02 0.95 100 Normal 362 1.05 1.01 1.01 0.95 0.98 0.94 ...... 0.98 0.93 100 Normal 363 1.02 1.01 1.06 1.02 1.02 1.01 1.00 1.03 100 Normal 364 1.00 1.01 1.08 1.04 0.92 0.90 1.07 1.06 100 Normal 365 0.98 1.00 1.06 0.97 1.02 0.97 1.05 0.94 100 Normal__________ 366 1.05 1.09 1.06 1.01 1.08 0.95 1.09 1.04 100 Normal__________ 367 1.01 1.10 1.06 0.98 1.02 1.53 1.00 1.00 100 Aneuploide (+C6) 368 1.00 0.97 1.02 0.95 0.98 0.99 1.04 0.97 100 Normal 369 1.00 1.00 1.07 1.05 1.01 0.99 1.02 1.03 100 Normal 370 0.99 0.98 0.95 0.98 0.97 1.03 0.94 0.98 1.00 Normal 371 0.96 0.95 0.94 0.96 0.99 1.08 0.90 ã91 100 Norma! 372 1.02 1.04 1.06 0.99 1.04 1.00 0.88 0.99 1.00 Normal 373 0.96 1.01 0.99 0.99 0 99 0.91 1.07 0.99 1.00 Normal 374 0.98 0.99 0.97 0,96 0.96 1.04 0.96 0.94 100 Normal 375 1.02 1.06 1.10 1,02 1.08 0.97 1.10 1.03 100 Normal 376 1.02 1.04 1.01 1.09 1.05 0.99 1.07 1.02 1.00 Normal ____________377 1.30 0.99 1.01 1.00 0.99 1.06 1.01 ........ 0.94 100 Aneuploide (+C1) 378 0.98 0.97 0.95 101 . 1.00 1.13 0.95 0.99 100 Normal 379 0.98 0.95 0.91 0.97 0.96 1.02 0.89 0.92 100 Normal 380 1.00 0.99 0.91 0.99 0.90 0.95 0.89 0.97 100 Normal 381 0.99 0.97 0.97 0.95 0.96 0.92 1.00 0.96 100 Normal 382 0.95 0.91 0.93 0.91 0.94 0.97 0.94 0.91 100 Normal 383 1.02 1.00 0.98 0.97 0.94 0.93 0.98 0.96 100 Normal__________ 384 1.00 1.01 1.01 1.00 1.05 0.93 1.06 100 100 Normal 385 1.01 0.98 1.00 0.96 1.04 1.04 0.99 0,94 100 Normal 386 1.04 1.01 1.01 0.99 1.02 1.04 1.01 0.98 100 Normal 387 0.98 0.97 0.95 0.95 0.99 1.07 0.95 0.91 100 Normal 388 0.99 0.93 0.98 0.98 0.96 0.95 1.02 0.99 100 Normal 389 0.97 1.04 1.00 1.04 1.00 1.09 0.98 0.99 100 Normal__________ 390 1.03 0.97 0.99 1.01 1.00 1.09 0.94 0.99 1.00 Normal 391 1.03 1.60 1.03 1.03 1.07 1.05 1.04 1.06 100 Aneuploide (+C2) 392 0.96 0.95 0.98 0.95 0.98 0,91 0.98 0.93 100 Normal 393 1.01 1.02 1.09 1.05 1.02 0.91 1.07 111 100 Normal 394 1.02 0.99 0.97 0.97 1.02 0.93 0.98 0.95 100 Normal 395 1.02 1.06 0.99 1.05 1.03 1.02 0.98 1.01 100 Normal 396 0.95 1.03 0.98 0.99 1.00 0.93 1.05 1.11 100 Normal 397 1.02 1.04 1,01 1.04 1.01 1.13 1.05 1.02 100 Normal 398 0.94 0.93 0,91 0.91 0.99 1.08 0.90 0.89 100 Normal 399 1.05 0.97 1 O1 1.03 1.03 1.12 1.00 0.97 1.00 Normal. [Table 3-7] Petition 870200043201, dated 03 / 04 / 2020, page 44 / 68 / 50 SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR SYBR C1 02 C3 04 C5 06 C7 C8 C9 C1 / C9 C2 / C9 C3 / G9 C4 / C9 G5 / C9 C6 / C9 G7 / G9 C8 / C9 C9 / G9 ____________________ Indivíduo no. A Act ZlZlCt / 1 / 1ct Zfzíct zdZÍCt A Act zízfct zlzlot -Adet. Resultados 400 1.02 0.95 0.99 1.06 0.98 1.02 1.00 0.99 1.00 Normal__________ 401 1.06 0.98 0.99 1.02 1.06 1.04 0.97 0.99 1.00 Normal 402 0.96 1.03 1.08 0.97 1.02 0.96 1.03 0.99 1.00 Normal 403 1.02 1.01 1.03 1.00 1.02 1.06 1,00 0.94 1.00 Normal 404 1.07 1.06 1.04 1.03 1.01 1.01 1.02 1.01 1.00 Normal__________ 405 1.04 0.94 0.96 0.92 0.96 0.94 0.98 0.99 1.00 Normal 406 1.10 1.09 1.01 1.04 1.05 1.10 1.02 1.05 1.00 Normal 407 1.00 0.99 0.99 0.95 1.04 1.04 1.02 0.97 1.00 Normal 408 1.01 0.98 0.97 1.06 1.02 1.05 1.02 1.09 1.00 Normal__________ 409 1.03 0.99 0.99 1.03 0.94 1.06 0.96 0.97 1.00 Normal 410 1.01 0.97 0.99 0.97 1.00 1.01 0.99 0.96 1.00 Normal__________ 411 1.00 1.02 1.02 1.00 1.02 1Ό4 0.97 0.96 1.00 Normal 412 1.04 0.99 1.06 1.07 1.07 1.09 1.05 1.12 1.00 Normal__________ 413 1.03 1.63 1.02 1.01 1.03 1.05 1.06 1.01 1.00 Aneuploide (+C2) 414 1.01 0.98 0.96 1.00 0.98 1.07 0.93 1.00 1.00 Normal 415 1.04 1.06 1.05 1.03 1.05 0.95 1.01 1.00 1.00 Normal 416 0.99 1.42 0.90 1.01 0.95 0.98 0.90 0.97 1.00 Aneuploide (+C2) 417 1.10 1.03 0.95 1.13 0.99 1.15 0.92 0.98 1.00 Normal 418 1.00 1 03 0.99 1.06 0.97 1.08 0.92 1.00 1.00 Normal__________ 419 0.96 0.95 1.00 0.98 0.98 1.02 0.96 0.91 1.00 Normal 420 1.06 0.93 0.95 1.00 0.96 1.05 0.94 0.87 1.00 Normal 421 0.99 0.93 0.97 1.06 0.95 1.07 0.92 1.00 1.00 Normal__________ 422 0.97 0.97 1.00 1.14 1.02 1.07 0 94 0.99 1.00 Normal__________ 423 0.62 0.63 0.65 0.66 0.65 0.69 0.66 0.66 1.00 Aneuploide (+C9) 424 0.99 0.97 1.01 1.01 1.03 1.05 0.98 0.91 1.00 Normal 425 1.00 1.05 1,01 1.07 1.03 1.12 0.96 1.05 1.00 Normal 426 1.02 0.97 0.97 1.00 1.02 1.04 0.95 0.96 1.00 Normal 427 0.97 1.01 1.06 0.97 1.02 0.87 1.10 1.01 1.00 Normal 428 1.03 1.00 0.96 0.98 0.94 0.99 0.97 0.97 1.00 Normal....................429 1.02 0.99 0.99 0.97 1.02 1.09 0.99 0.99 1.00 Normal 430 1.00 0.97 I 02 1.02 1.01 0.98 1.02 1.01 1.00 Normal 431 0.97 0.98 0.98 0 93 0.95 0.94 0.96 0.94 1.00 Normal__________ 432 1.01 0.44 1.00 0.93 0.96 0.90 0.87 1.01 1.00 Aneuploide (outros) 433 1.01 1.03 0.96 0.99 0.96 0.93 0.96 1.02 1.00 Normal 434 0.98 0.95 0.99 0.91 1.01 0.93 1.05 0.97 1.00 Normal 435 1.02 1.01 0.93 1.01 0.97 1.02 0.96 1.03 1.00 Normal 436 0.97 ........ 0.98 1.01 0.91 0.99 1.01 1.01 1.10 1.00 Normal 437 0.96 0.97 0.99 0.95 1.00 0 99 1.00 0.95 1.00 Normal 438 0.98 0.97 0.97 0.93 0.97 0.98 0.98 0 99 1.00 Normal 439 1.09 1.01 0.98 1.01 0.99 0.99 1.58 1.03 1.00 Aneuploide (+C7) 440 0.95 0.94 1.05 0.98 0.96 0.97 1.01 1.00 1.00 Normal 441 0.93 0.89 0 95 0.88 0.99 0.94 0.96 0.98 1.00 Normal 442 0.99 1.06 0.99 1.06 1.00 1.08 0.98 1.02 1.00 Normal 443 1.02 1.08 1.04 1.06 1.01 1.07 1.00 1.06 1.00 Normal.............. 444 0.93 0.95 1.00 0.93 1.02 0.93 1.07 0.99 1.00 Normal 445 1.00 0 95 1.03 0.91 1.01 0.88 1.02 1.01 1.00 Normal . [Table 4] Table 4 - Aneuploidy test results in the F1 variety of broccoli using the SYBR method (summary)__________________________ Number of plants ratio (%) Normal 418 93.9% Aneuploid (+C1) 2 0.4% Aneuploid (+C2) 5 1.1% Aneuploid (+C3) 0 0.0% Aneuploid (+C4) 1 0.2% Aneuploid (+C5) 0 0.0% Aneuploid (+C6) 5 1.1% Aneuploid (+C7) 5 1.1% Aneuploid (+C8) 0 0.0% Aneuploid (+C9) 3 0.7% Aneuploid (other) 6 1.3% Example 4 Example of Variant Type Detection in Cauliflower

[00107] The seeds of the F1 variety of cauliflower “SCF-30” under Petition 870200043201, dated 03 / 04 / 2020, page 45 / 68 / 50. Development by SAKATA SEED CORPORATION: Seeds were sown in a nursery-type tray. DNA was extracted from newly emerged cotyledons of germinated seeds from 654 individuals, then a real-time PCR was performed using the fluorescence probe method with specific markers for each chromosome.

[00108] Specifically, the above process was carried out as follows.

[00109] DNA was extracted from cauliflower cotyledons in the same manner as in Example 3 described above.

[00110] The PCR test was performed using chromosome-specific markers divided into the following three combinations: • Triplex including the chromosome 6 marker, the chromosome 4 marker, and the chromosome 2 marker; • Triplex including chromosome marker 9, chromosome marker 3, and chromosome marker 8; and • Triplex including chromosome marker 1, chromosome marker 5, and chromosome marker 7.

[00111] As for the chromosome markers used herein, the primers and probes shown in Tables 1 and 2 were used for each of the chromosomes. For example, a primer pair having the sequences shown in SEQ ID NOs: 1 and 2 and a probe having the sequence shown in SEQ ID NO: 19 were used as a marker for chromosome 1.

[00112] With regard to real-time PCR, the same machine as observed in Example 3 was used, and the PCR conditions of incubation at 95°C for 1 minute, followed by 40 cycles of 2-step PCR at 95°C for 15 seconds and 60°C for 45 seconds were used. Filters with excitation wavelengths of 465 nm, 533 nm, 618 nm, and detection wavelengths of 510 nm, 580 nm, and 660 nm were used for the measurement of FAM, HEX, and Cy5 signals, respectively. Petition 870200043201, dated 03 / 04 / 2020, pp. 46 / 68 / 50

[00113] Based on the Ct value obtained by the second derivative method, the relative quantification was calculated by the ΔΔί'I method using the respective chromosome 2, chromosome 8 and chromosome 7 markers as endogenous controls.

[00114] The results were as shown in Table 5.

[00115] These results are summarized in Table 5, and thus it is clear that aneuploids are included in the ratio as shown in Table 6.

[00116] In addition, plants assumed to be aneuploid in this experiment were grown in the field to investigate subsequent phenotypes. Consistent with the case of broccoli, each of the aneuploids exhibited a characteristic appearance (Figure 5) (the phenotypic characteristics of the chromosome trisomies were as shown in Figure 7).

[00117] The results above indicate that, similar to broccoli, aneuploids appear in cauliflower and this method is an effective procedure for detecting these aneuploids in cauliflower. [Table 5-1] Table 5 - Aneuploidy test results in the F1 variety of cauliflower (raw data obtained by multiplex PCR based on the probe method (value calculated by the ΔΔί'Ι method)) Petition 870200043201, dated 03 / 04 / 2020, pages 47 / 68 / 50 C6C4C2 triplex PCR 090308 triplex PCR C1C5C7 triplex PCR 06 04 C2 09 C3 G8 C1 C5 G7 C6 / C2 04 / 02 C2 / C2 C9 / C8 C3 / C8 C8 / C8 C1 / C7 C5 / C7 C7 / C7 Indivíduo no. zlzlct Zlzlot zdzlct dzlct zhdct zldct zLd ot .Zl.zjCt zdzlot Resultados 1 0.98 0.99 1.00 1.00 1.02 1.00 1.04 0.98 1.00 Normal 2 0.99 1.02 1.00 0.94 1.05 1.00 0.96 1.09 1.00 Normal 3 0.75 0.73 1.00 1.11 1.07 1.00 0.94 0.98 1.00 Aneuploid (+C2) 4 0.98 0.94 1.00 1.02 1.06 1.00 1.12 1.09 1.00 Normal 5 1.03 1.02 1.00 0.99 0.89 1.00 078 0.77 1.00 Aneuploid (+C7) 6 0.95 0.97 1.00 0.98 1.03 1.00 1.06 1.11 1.00 Normal 7 0.97 1.02 1.00 1.02 0.88 1.00 1.06 1.05 1.00 Normal 8 0.98 1.01 1.00 1.03 0.96 1.00 0.98 1.00 1.00 Normal 9 0.96 0.96 1.00 1.02 0.97 1.00 0.98 1.00 1.00 Normal 10 0.90 0.96 1.00 1.00 0.93 1.00 1.08 1.13 1.00 Normal 11 1.02 1.03 1.00 0.93 0.93 1.00 0.95 0.94 1.00 Norma! 12 0.93 0.94 1.00 1.04 0.96 1.00 0.97 0.93 1.00 Normal 13 0.93 1.04 1.00 1.09 1.00 1.00 0.91 0.95 1.00 Normal 14 0.98 1.06 1.00 1.03 1.00 1.00 0.98 0.96 1.00 Normal 15 1.01 1.02 1,00 1.03 1.02 1.00 1.09 1.02 1.00 Normal 16 0.95 1,00 1.00 1.02 1.01 1.00 0.96 1.00 1.00 Normal 17 1.09 1.05 1.00 0.98 0.87 1.00 1.03 0.98 1.00 Normal 18 0.99 0.93 1.00 1.01 0.95 1.00 0.96 0.99 1.00 Normal 19 1.05 1.06 1,00 1.05 1.01 1.00 1.03 1.06 1.00 Normal 20 1.06 1.09 1.00 1.05 1.02 1.00 1.03 0.96 1.00 Normal 21 0.94 0.98 1,00 0.88 1.03 1.00 1.13 1.06 1.00 Normal 22 0.90 0.91 1.00 0.98 1.01 1.00 0.98 1.03 1.00 Normal 23 1.06 1.06 1.00 1,03 1.03 1,00 1.06 1,03 1,00 Normal 24 1.11 1.05 1.00 1.01 1.08 1.00 1.01 1.01 1.00 Normal 25 0.97 0.94 1.00 0.96 1.01 1,00 0.98 0,98 1.00 Normal 26 1.02 1.00 1.00 0.89 0.93 1.00 1.24 0.95 1.00 Aneuploide (+C1) 27 0.95 0.95 1.00 1,00 0.93 1.00 1.01 0,98 1.00 Norma! 28 0.97 1.00 1.00 1.09 0.97 1.00 1.03 1.02 1.00 Normal 29 0.96 0.96 1.00 1.00 0.97 1.00 1.06 0,97 1.00 Normal 30 0.96 1.00 1.00 1.07 0.99 1.00 1.01 0.94 1.00 Normal 31 1.12 1.08 1.00 0,96 0.93 1.00 1.04 1.00 1.00 Normal 32 0.96 0.99 1.00 0.98 0.93 1.00 1.04 0.94 1.00 Normal 33 1.01 1.00 1.00 1.02 0.96 1.00 0.96 0.98 1.00 Normal 34 0.94 1,06 1.00 0.99 0.86 1.00 1.12 0,98 1.00 Normal 35 1.01 1.04 1.00 0.98 0.99 1.00 1.03 0,95 1.00 Normal 36 0.93 0.95 1.00 1.00 0.99 1.00 1.01 1.05 1.00 Normal 37 0.99 0.98 1,00 1.04 1,01 1,00 1.01 0.99 1.00 Normal 38 0.96 0.98 1.00 1.00 1.00 1.00 1.10 0.94 1.00 Normal 39 0.97 1.01 1.00 1,04 1,09 1.00 0.88 0.95 1.00 Normal 40 1.03 1.05 1.00 0.98 0.95 1.00 0.92 0.98 1,00 Normal 41 1.05 0.98 1.00 0.96 0.94 1.00 1.03 0.98 1.00 Normal 42 1.03 1.06 1.00 0,96 1,01 1.00 0.92 0.98 1.00 Normal 43 1,03 0.99 1.00 1.04 0,95 1.00 0.98 0.92 1.00 Normal 44 1.06 0.95 1,00 1.00 0,97 1.00 0.97 0,93 1.00 Normal 45 1.02 0.98 1.00 1.00 0.99 1.00 1.03 1.04 1.00 Normal 46 0.93 0.94 1.00 1.00 0.96 1.00 0.89 1.03 1.00 Normal 47 1.01 1.05 1.00 0.98 0.89 1.00 0.92 0.96 1.00 Normal 48 0.92 0.90 1.00 0,94 0,91 1.00 1.01 1.03 1.00 Normal 49 0.98 0.91 1.00 0.98 0.99 1,00 1.13 1.03 1,00 Normal 50 0.93 0.96 1.00 0.96 0.99 1.00 1.01 1.02 1.00 Normal 51 1.00 1.00 1.00 0.95 0.99 1.00 0.95 0.96 1.00 Normal 52 1.02 1.08 1.00 0.96 D.93 1.00 0.96 0.99 1.00 Normal 53 1.01 1.04 1.00 0.94 1.04 1,00 1.01 1.06 1.00 Normal 54 1.01 1.03 1.00 1.02 1.07 1,00 0.96 0.99 1,00 Normal 55 1.12 1.11 1.00 0.98 1,00 1,00 1.02 1,05 1.00 Normal 56 1.03 0.98 1.00 0.99 0.97 1.00 0,93 0,94 1.00 Normal 57 . 0.7.1 071 1.00 1.05 1.09 1.00 0,97 1.01 1.00 Aneuploide (+C2) 58 0.97 1.00 1.00 0.98 1.01 1.00 0.94 0.94 1.00 Normal 59 0.98 0.97 1.00 1.02 1,11 1.00 1,02 1.04 1.00 Normal ao 1.03 1.01 1.00 1.04 1.00 1.00 1.01 1.05 1.00 Normal 61 0.99 1.02 1.00 0.95 0.97 1.00 1.08 1.12 1.00 Normal 62 0.94 0.97 1.00 1.05 1,09 1.00 1.01 1.02 1.00 Normal 63 0.95 1.02 1.00 0.94 0.99 1.00 1.07 1.05 1,00 Normal 64 0.96 1.00 1.00 0.98 1.01 1.00 1.01 1.02 1.00 Normal 65 1.00 1.01 1.00 1.02 1.00 1.00 0.96 0.94 1.00 Normal 66 1.03 0.96 1.00 1.00 1.03 1.00 0.98 0.95 1.00 Normal 67 0.99 1.02 1.00 1.04 1.07 1.00 1,00 0.93 1.00 Normal 68 1.10 1.05 1.00 0.97 0.99 1.00 1.03 0.92 1.00 Normal 69 1.09 1.08 1.00 1.10 1.11 1.00 0.98 1.00 1.00 Normal. [Table 5-2] Petition 870200043201, dated 03 / 04 / 2020, pages 48 / 68 / 50 C6C4C2 triplex PGR G9C3C8 triplex PCR 01C5C7 triplex PCR 06 G4 C2 C9 C3 08 C1 05 07 C6 / C2 C4 / C2 G2 / C2 C9 / C8 C3 / C8 G8 / G8 C1 / C7 C5 / C7 C7 / G7 Indivíduo no. zlzlct ZlzdGt zlzjct zlzlct Jzlot Adct Zljot Zlzlct Resultados 70 0.98 1.02 1.00 1.13 112 100 0.98 101 100 Normal 71 1.01 0.99 1.00 0.99 112 100 104 L06 100 Normal 72 0.93 0.98 1.00 102 109 100 0.96 0.92 100 Normal 73 1.03 1.00 1.00 105 109 100 103 107 LOO Normal 74 1.05 1.09 1.00 0.94 101 1.00 101 102 LOO Normal 75 0.89 0.98 1.00 107 104 100 0.93 I 0.94 LOO Normal 76 0.91 0.98 1.00 102 0.99 100 0.90 0.98 1.00 Normal 77 1.01 0.94 1.00 1.05 109 100 101 0.98 1.00 Normal 78 1.01 1.06 1.00 0.93 0J9 100 0.96 | 101 LOO Normal 79 0.94 0.96 1.00 106 107 100 0.89 | 0.99 LOO Normal 80 1.07 1.05 1.00 0.99 106 100 0.97 0.98 LOO Normal 81 0.73 0.76 loo 1.02 100 100 103 ! 103 LOO Aneuploid (+C2) 82 1.03 1.02 1.00 0.96 101 100 0.99 s 0.99 LOO Normal 83 1.12 1.07 1.00 0.97 112 100 104 107 1.00 Normal 84 0.97 0.94 1.00 103 0.97 100 102 106 LOO Normal 85 0.88 0.90 1.00 104 104 100 106 1.03 1.00 Normal 86 Í.06 1.06 1.00 LOmal 0.97 00 811 LOO 0.94 0.96 1.00 100 100 100 0.97 ιοί LOO Normal 88 1.37 1.04 1.00 0.93 0.89 100 0.89 0.98 LOO 1604 1 (+C 1.03 101 100 0.97 0.95 LOO Normal 90 1.06 1.02 1.00 0.98 0.95 100 0.91 0.99 LOO Normal 91 1.11 101 2 1.00 01 0.9 Normal 92 0.94 0.95 1.00 106 0.99 100 0.97 0.90 LOO Normal 93 0.91 0.98 1.00 104 0.93 100 105 0.91 LOO 1.2 01 54 94 102 100 101 102 LOO Normal 95 0.92 0.94 100 1.00 103 100 0.93 101 LOO Normal 96 1.00 1.04 100 0.97 103 9 LO Normal 1.02 100 1.00 101 100 0.93 0.99 LOO Normal 98 1.01 1.00 100 1.09 0.93 100 0.93 0.90 LOO Normal 99 101 1.09 0.10 0.96 LOO Normal 100 1.01 100 0.98 0.97 LOO Normal 101 1.06 1.05 100 101 0.99 100 180 102 100 102 Normal 1.00 105 1.00 LOO 0.88 0.96 100 Normal 103 0.97 0.99 100 0.97 0.97 100 105 111 100 Normal 104 0.98 1,00 100 101 1.06 100 109 102 100 Normal 105 0.94 LOI 100 0.96 1.03 100 0,93 0.88 1.00 Normal 106 1,02 1.05 loo 101 1.09 100 103 104 100 Normal 107 0.95 0.94 . 100 1.28 110 100 103 108 100 Aneuploide (+C9) 108 0.98 1.00 100 100 0,96 LOO 0.98 110 100 Normal 109 0.94 1.03 1.00 101 107 100 100 108 100 Normal 110 1.00 0.98 100 0.90 103 100 0.96 0.96 100 Normal i 111 0,88 0.91 1.00 0.96 101 100 0.89 0.93 100 Normal 112 1.05 1.02 1.00 0.99 0.97 100 0.97 ιοί 100 Normal 113 0.89 0.90 100 107 101 100 0.94 102 100 Normal 114 0.95 0.94 100 0.97 106 100 107 102 100 Normal 115 1.03 1.04 1.00 0.92 0 93 100 1.05 0.97 LOO Normal 116 0.96 1.00 100 0.95 102 100 0.98 0.99 LOO Normal 117 1 12 1.10 1.00 0.90 1 01 100 0.97 105 LOO Normal 118 0.96 1.00 100 104 101 100 0.92 102 LOO Normal 119 0.88 0.89 1.00 1.07 105 100 1.03 100 LOO Normal 120 0.95 0.94 1.00 0.95 0.95 1,00 100 106 LOO Normal 121 0.91 1.05 100 0.97 107 100 103 1.04 LOO Normal 122 1.11 1.02 100 103 0.96 100 0.92 0.96 LOO Normal 123 1.03 0.98 100 1.00 111 100 0.98 107 1.00 Normal 124 1.02 0.98 LOO 100 111 109 100 1.5 1 2 100 100 100 105 101 LOO 0.96 0.94 LOO Normal 126 1.09 1.11 100 0.94 0.95 LOO 113 103 LOO Normal 127 0.93 1.00 LO1 110 LO Normal 100 101 128 1.32 1.00 100 0.98 101 LOO 1.03 0.91 LOO Aneuploid (+C6) 129 1.01 0.99 100 0.98 0.98 LOO 0.99 105 LOO 130 1.01 1.00 100 0.95 105 LOO 1.01 106 LOO Normal 131 1.01 1.02 100 100 0.88 LOO 0.96 0.94 LOO 01 01 192 141 1.00 1.0 LOO 1.09 112 LOO Normal 133 1.12 1.07 100 102 104 LOO 105 0.99 LOO Normal 134 1.04 1.07 100 103 0.99 LOO 803 0.91. LOO Normal 136 1.04 1.02 100 0.98 0.95 LOO 0.98 0.97 LOO Normal : 137 201 0.94 0.94 0.96 LOO Normal 138 1.00 1.05 100 0.99 101 1.00 0.95 1.03 LOO Normal i 139 1.04 1.04 100 101 106 LOO 110 LO 140 1.11 . 1.00 1.01 0.99 1.00 1.01 1.03 100 Normal. [Table 5-3] Petition 870200043201, dated 03 / 04 / 2020, pp. 49 / 68 / 50 G6G4G2 triplex PGR O9C3GB triplex PCR O1G5C7 triplex PCR C6 04 02 09 03 08 G1 05 G7 C6 / C2 G4 / C2 C2 / C2 C9 / C8 C3 / G8 C8 / C8 C1 / 07 C5 / C7 C7 / C7 Indivíduo no. Zl2íct dzlct zdzdCt ZlzdGt zlzfct zízlct JJot zlzlct zdzdCt Resultados 141 0.94 0.93 1.00 100 1.04 100 0.99 0.96 100 Normal 142 1.04 1.06 1.00 100 1.00 1.00 0.99 103 100 Normal 143 0.99 0.96 1.00 114 104 1.00 0.99 108 100 Normal 144 0.98 1.00 1.00 0.99 0.95 100 0.97 102 1.00 Normal 145 1.06 1.08 1.00 110 101 1.00 0.95 103 1.00 Normal 146 0.92 0.99 1.00 0.98 0.99 1.00 1.05 100 1.00 Normal 147 0.98 0.98 1.00 1.00 104 100 0.95 0.96 100 Normal 148 0.94 | 0.98 1.00 102 101 100 106 106 1.00 Normal 149 0.99 ; 0.92 1.00 0.96 110 100 102 105 100 Normal 150 1.06 1 07 1.00 0.99 1.01 1.00 101 0.93 1.00 Normal 151 1.03 0.98 1.00 1.10 1.09 100 103 1.02 1.00 Normal 152 0.96 1.01 1.00 109 103 100 109 106 100 Normal 153 1.06 1.08 1.00 102 0.95 100 101 102 100 Normal 154 0.98 1.05 1.00 110 109 100 0.96 0.96 1.00 Normal 155 0.99 0.98 1.00 0.95 0.94 100 102 0,98 100 Normal 156 1.04 0.98 1,00 1,03 1.10 100 0.97 0.99 1.00 Normal 157 1.00 1.03 1.00 0.90 0.95 1.00 101 0.94 100 Normal 158 1.06 1.02 1.00 0.99 103 100 0.99 109 100 Normal 159 0.93 0.96 1.00 0.94 0.98 100 0.93 0,94 100 Normal 160 0,98 0.95 1.00 103 1.01 100 101 0.96 100 Normal 161 0.97 0.98 1.00 0.98 1.03 1.00 0.91 0.95 100 Normal 162 1.02 0.98 1.00 105 1.12 100 100 105 100 Normal 163 1.01 1.05 1.00 0.90 0.95 100 106 105 100 Normal 164 0.91 0.92 1.00 0.98 0.98 1.00 0.96 0.96 100 Normal 165 1,03 1.05 1.00 103 1.13 100 0.96 0.92 1.00 Normal 166 0.88 0.94 1.00 1.00 0.93 100 105 0.99 100 Normal 167 0.88 1.00 1,00 0.95 0.97 1.00 101 0.93 100 Normal 168 0.97 1.00 1.00 0.99 0.97 100 0.97 0,92 1.00 Normal 169 0.94 0.92 1.00 0.97 0.89 100 0,96 0.93 1.00 Normal 170 1.03 1.02 1.00 105 101 100 129 0.95 1.00 Aneuploide (+C1) 171 0.98 1.05 1.00 105 1.01 100 109 102 100 Normal 172 0.94 0.98 1.00 0.98 0.96 100 0.97 100 100 Normal 173 1.06 1.24 1,00 100 102 100 109 102 100 Aneuploide (+C4) 174 1.00 1.08 1.00 0.92 0.97 100 1.06 110 100 Normal 175 1,08 1.08 1.00 101 0.99 100 1.04 0.95 100 Normal 176 1.03 1.11 1.00 101 0.94 100 0.99 0.96 100 Normal 177 0,96 1.01 1.00 G.96 0.96 1.00 0.98 1.00 100 Normal 178 1,01 1.05 1.00 C.97 0.95 100 106 1.00 100 Normal 179 0,87 0,96 1.00 100 0.99 100 101 1.02 100 Normal 180 1.08 1.05 1.00 1 02 0.97 1.00 0.98 1.00 100 Normal 181 0.96 1.04 1.00 C.92 1.02 100 0.94 0.93 1.00 Normal 182 1.04 1.08 1.00 110 112 100 0.88 0.96 100 Normal 183 1.04 1.04 1.00 0,99 107 100 111 0.98 1.00 Normal 184 1.03 1.03 1.00 107 1.08 100 1.01 0.99 1.00 Normal 185 0,94 0.94 1.00 0.94 0.97 100 102 100 1.00 Normal 186 1,01 1.00 1.00 0,99 0.97 100 108 1.02 100 Normal 18 / 1.01 0.98 1.00 100 0.94 100 101 105 100 Normal 188 1,12 1.06 1.00 113 110 1.00 0.99 1.03 100 Normal 189 1,04 1.03 1.00 1 00 0.99 100 106 1.02 100 Normal 190 1.04 1.00 1.00 0.96 0.90 100 0.99 0.97 1.00 Normal 191 1.09 1.11 1.00 101 0,96 100 108 101 100 Normal 192 1.10 1.09 1.00 102 0,99 100 100 1.00 100 Normal 193 1.06 1.00 1.00 0.96 0.98 100 0.96 1.00 100 Normal 194 0.99 0.99 1.00 105 0,90 100 107 111 100 Normal 195 0.96 1.07 1,00 0.99 0.94 100 102 103 100 Normal 196 1.09 1.06 100 100 0.95 100 0.99 102 100 Normal 197 0.92 : 0.94 100 0.99 0.96 100 0.9Ί 0.94 1.00 Normal 198 1.05 1.04 100 103 101 100 0.96 0,98 100 Normal 199 0.93 ; 0.98 100 0.94 0.94 1.00 1.02 0.98 100 Normal 200 1.07 1.01 1.00 0.95 0.99 100 100 103 100 Normal 201 1.03 1.03 100 105 101 100 101 104 100 Normal 202 1.01 1,06 1.00 105 0.95 100 1.02 1.11 1.00 Normal 203 1.06 1.10 1.00 101 0.95 100 0.97 1.01 1.00 Normal 204 1.06 1.04 1.00 105 101 100 1.03 100 100 Normal 205 0.95 0.98 100 0.98 0.94 100 0.97 0.95 100 Normal 206 1.06 1.06 100 101 0.97 100 1.03 102 1.00 Normal 207 1.00 1.00 1.00 113 105 1.00 0.98 100 1.00 Normal 208 0.91 0.94 1,00 1 00 1.01 100 102 0.98 100 Normal 209 1.01 0.99 100 0.98 0.95 100 103 102 100 Normal 210 1.06 1.00 100 0.99 107 100 0.93 0.91 100 Normal 211 0.94 0.90 100 0.93 0.97 100 105 100 1.00 Normal. [Table 5-4] Petition 870200043201, dated 03 / 04 / 2020, page 50 / 68 / 50 C6C4C2 triplex PCR G9C3C8 triplex PCR C1C5C7 triplex PCR C6 C4 C2 09 C3 08 Cl C5 C7 C6 / C2 C4 / C2 C2 / C2 C9 / C8 C3 / C8 C8 / C8 C1 / C7 C5 / C7 C7 / C7 Indivíduo no züzlot •dZJCt zlzlct zLdct Zzlct zizict Zlzíct JZct ZMct Resultados 212 1.06 1.05 1.00 1.00 0.98 1,00 1,04 1.08 1.00 Normal 213 1.04 1.03 1.00 1.02. 0,98 1.00 0.97 0.06 1.00 Normal 214 0,94 0.96 1.00 0.95 0.98 1.00 0.96 0.94 1.00 Normal 215 1.01 1.02 1.00 0.96 0.98 1.00 1.02 0.98 1.00 Normal 216 1.09 1.04 1.00 1,00 0.99 1.00 1,05 1.01 1.00 Normal 217 1.03 0.91 1.00 1.00 1.12 1.00 1.05 1.02 1.00 Normal 218 . 1.06 1.06 1.00 092 0.98 1.00 1,06 1.05 1,00 Normal 219 0.99 1.00 1.00 0,96 0.99 1.00 0.96 1.01 1.00 Normal 220 0,92 0.93 1,00 0.98 0.99 1.00 1.03 0.99 1.00 Normal 221 1.06 1.11 1.00 1.05 1.12 1.00 1.00 1.07 1,00 Normal 222 1.10 1.10 1.00 1.00 1.01 1.00 0.96 0.98 1.00 Normal 223 0.99 1.02 1.00 1.03 1.00 1.00 0.93 1.01 1.00 Normal 224 0.96 1.01 1.00 1.01 1.00 1.00 0.99 1.08 1.00 Normal 225 1,01 1.01 1.00 1.08 1.03 1.00 0.96 0.98 1.00 Normal 226 0.96 1.02 1.00 0.97 0.99 1.00 1,12 1,08 1.00 Normal 227 1.12 0.98 1.00 1.02 0.98 1.00 0.95 1.00 1.00 Normal 228 1.41 1.08 1,00 0,94 0.93 1.00 0.91 0.92 1.00 Aneuploide (+C6) 229 1.00 0.99 1.00 0.90 0.98 1,00 1.01 1.01 1.00 Normal 230 0.93 0.89 1.00 0.98 1.01 1.00 1.05 1.02 1.00 Normal 231 1.08 1.-0 1.00 1.00 0.97 1.00 1.06 1.11 1,00 Normal 232 1.01 1.07 1.00 1.03 1.06 1.00 0.96 0.99 1.00 Normal 233 1,03 1.08 1.00 0.94 1.06 1,00 0.93 1.00 1.00 Normal 234 0.97 1.05 1,00 0,96 1.02 1,00 0.97 0,93 1,00 Normal 235 1.07 0.98 1.00 0.90 0.89 1.00 1.12 1.08 1.00 Normal 236 1.03 1.02. Í00 1.02 0.94 1.00 0.95 0.98 1.00 Normal 237 1.03 1.08 :.oo 1.05 1.09 1.00 0.95 1.05 1.00 Normal 238 1.08 1,07 ’.00 1.01 1.06 1.00 0.98 0.98 1.00 Normal 239 0.96 1.02 ROO 1.02 1.09 1.00 1,01 0,98 1,00 Normal 240 1.00 1.05 1,00 1.02 1.00 1.00 1.06 0.92 1.00 Normal 241 0.92 0,96 1.00 1.00 1.09 1.00 0.96 0,99 1.00 Normal 242 0.94 0,99 1.00 0.98 1,01 1.00 1.09 0.98 1.00 Normal 243 0.93 0.94 1.00 1.01 0.97 1.00 1.02 0.99 1.00 Normal 244 0.96 1.00 1.00 1.02 1.01 1.00 0.94 0.98 1.00 Normal 245 1.02 1.05 1.00 0.94 0.96 1.00 1.03 0.92 1.00 Normal 246 0.91 1.01 1.00 1.00 1.13 1.00 0.96 0.94 1.00 Normal 247 1.10 1.08 1.00 0.98 1.01 1.00 1.02 0.97 1.00 Normal 248 0.96 0.96 1.00 1.07 1.03 1.00 1.04 1.10 1.00 Normal 249 0.98 1.02 1.00 0.99 0.98 1.00 1.08 0.98 1.00 Normal 250 1.03 1.00 1.00 1.07 1.00 1.00 1.09 1.11 1.00 Normal 251 1.04 1.09 1.00 0.95 0.91 1.00 1.03 0.97 1.00 Normal 252 0.93 0.92 1.00 1.01 0.95 1.00 0.91 0.90 1.00 Normal 253 0.95 0.94 1.00 1.02 1.02 1.00 1.03 0.99 1.00 Normal 254 1.14 1.09 1.00 0.92 0.85 1.00 1.05 0.97 1.00 Normal 255 0.89 0.89 1.00 1.05 1.13 1.00 1.03 1.00 1.00 Normal 256 1.03 1.08 1.00 0.98 0.97 1.00 1.00 0.99 1.00 Normal . 257 1.05 1.00 1.00 0.99 0.97 1.00 1.07 1.00 1.00 Normal 258 0.93 1.06 1.ÜÜ 1.06 1.02 1.00 0.96 0.95 1.00 Normal 259 1.04 1.C8 1.00 0.98 0.96 1.00 1.06 1.05 1.00 Normal 260 0.98 1.02 1.00 1.05 1.06 1.00 1.03 1.02 1.00 Normal 261 1.00 1.01 1.00 1.01 1.01 1.00 1,03 1.05 1.00 Normal 262 0.8Θ 0.96 1.00 1.02 0.97 1.00 1.01 0.96 1.00 Normal 263 1.03 1.05 1 00 1.10 1.05 1.00 1.03 1.02 1.00 Normal 264 0,94 1.03 1.00 1.04 0.98 1.00 1.03 1.05 1.00 Normal 265 1.02 1.02 1.00 0.96 0.90 1.00 0.94 0.94 1,00 Normal 266 0.91 0.92 1.00 0.96 0.97 1.00 0.98 0.92 1.00 Normal 267 0.91 1.02 1.00 0.96 1.05 1.00 1.01 0.96 1.00 Normal 268 0.96 0.96 1.00 1.04 1.10 1.00 0.96 1.01 1.00 Normal 269 1.01 1,04 1.00 1.03 1.04 1.00 0.98 1.00 1.00 Normal 270 0.98 1.00 1,00 1.10 1,01 1,00 1.04 1.05 1.00 Normal 271 0.94 0.93 1.00 1.00 1.02 1,00 0.89 0.86 1.00 Normal 272 1.02 1.08 1.00 1.01 0.91 1.00 0.93 0.96 1.00 Normal 273 0.94 0.95 1.00 1.00 0.97 1.00 0.93 0.96 1.00 Normal 274 1.02 1.08 1.00 1.10 1.00 1.00 1.03 0,96 1,00 Normal 275 0.98 0.97 1.00 0.92 0,95 1,00 1.01 0.98 1.00 Normal 276 1.03 0.99 1.00 0.98 0.93 1 00 1,01 1.06 1.00 Normal 277 0.98 1.00 1.00 0.99 0 99 1 CO 1.06 1.05 1.00 Normal 278 1.12 1.01 1.00 0.95 0.97 1.00 1.00 0.95 1.00 Normal 279 1.06 0.99 1.00 1.01 1.05 1.00 1.01 1.01 1.00 Normal 280 1.01 1.02 1.00 0.98 0.94 1.00 0.96 0.98 1.00 Normal 281 1.03 1.00 1.00 1.00 0.93 1.00 0.96 1.01 1.00 Normal 282 1.04 0.99 1.00 1.06 1.06 1.00 0.94 0.94 1.00 Normal. [Table 5-5] Petition 870200043201, dated 03 / 04 / 2020, pages 51 / 68 / 50 C6C4G2 triplex PGR C9C3G8 triplex PCR 01C5C7 triplex PCR G6 C4 C2 09 C3 C8 01 05 07 06 / 02 G4 / C2 G2 / C2 09 / 08 03 / 08 08 / 08 01 / 07 05 / 07 C7 / C7 Indivíduo no. zlzíct zlzlct zlZlct zldct zízlct zlzlct JzdCt dzjCt zMct Resultados 283 0.97 0.96 1.00 0.92 0.90 1.00 1.07 1.05 1.00 Normal 284 1.12 1.04 1,00 0.99 0.98 1.00 0.91 0.95 1.00 Normal 285 1.01 0.96 1.00 0.98 0,93 1.00 0.97 0.94 1.00 Normal 2B6 1.05 1.00 1.00 0.96 1.09 1.00 0.88 0.96 1.00 Normal 287 1.06 1.03 1.00 0.89 0.90 1.00 0.98 1.00 1.00 Normal 283 0.89 0.92 1,00 1.02 1.01 1.00 1.06 0.98 1.00 Normal 289 0.89 0.89 1.00 0.97 0.95 1.00 0.95 0.99 1.00 Normal 290 0.94 0.89 1.00 1.04 0.97 1.00 1.02 0.94 1.00 Normal 291 1.03 1,03 1.00 1.01 1.01 1.00 0.98 0.98 1.00 Normal 292 0.96 0.99 1.00 1.01 1.06 1.00 0.88 0.98 1.00 Normal 293 0.91 0,94 1.00 0,97 0.99 1,00 0,98 1.05 1.00 Normal 294 1.06 1.06 1.00 1.07 1.03 1.00 0.95 0.94 1.00 Normal 295 0.94 0.87 1.00 0.95 0.93 1,00 1.08 0.98 1,00 Normal 296 1.06 1.02 1.00 1.04 0.96 1.00 1.00 0.94 1.00 Normal 297 0.98 1.00 1.00 0.94 Õ.87 1.00 1.03 1.07 1.00 Normal 298 1.03 1.00 1.00 1.12 1.09 1.00 1,02 1.02 1.00 Normal 299 0.98 0.96 1.00 1.00 1.05 1.00 0.93 0.96 1.00 Normal 300 0.69 0.75 1.00 0.98 0 99 1.00 1.09 1,07 1.00 Aneuploide (+C2) 301 0.98 0.97 1.00 0.87 0 94 1.00 1.01 1.11 1.00 Normal 302 1,01 1.02 1.00 1.01 0.99 1.00 0.98 0.97 1.00 Normal 303 1.01 1.05 1.00 0,96 1.08 1.00 0.99 1.02 1.00 Normal 304 1,03 1.03 1.00 1.02 0.99 1.00 1.03 1.02 1.00 Normal 305 1.00 0.98 1,00 0.99 1.03 1.00 0.94 0.93 1.00 Normal 306 0.93 0.99 1.00 0,98 1.03 1.00 0.99 1.01 1.00 Normal 307 0.94 0.88 1.00 1.04 1.05 1.00 0.94 1.00 1.00 Normal 308 1.03 1.03 1.00 1.00 0.98 1.00 1.01 0.98 1.00 Normal 309 1.01 1.06 1.00 1.03 1.00 1.00 1.01 0.97 1.00 Normal 310 1.31 1.07 1.00 0.98 1.01 1.00 1.04 1.07 1.00 Aneuploide (+C6) 311 0.98 1.00 1.00 1.01 1.03 1.00 1.07 1.04 1.00 Normal 312 0.94 0.94 1,00 0.97 1.01 1.00 1.01 1,00 1.00 Normal 313 1.07 1.03 1.00 1.04 0.96 1.00 1.04 1.06 1.00 Normal 314 1.06 1.08 1.00 1.02 1.06 1.00 0.96 1.00 1.00 Normal 315 1.03 0.98 1.00 1.00 1.05 1.00 0.99 1,06 1.00 Normal 316 1.00 1.04 1.00 0.96 1.00 1.00 0.95 0.93 1.00 Normal 317 1.06 0.94 1.00 0.96 0.98 1.00 0.91 0.99 1.00 Normal 318 1.01 1.02 1.00 0.96 1.04 1.00 0.95 0.94 1.00 Normal 319 1.00 0.98 1.00 1.03 0.88 1.00 0.96 0.92 1.00 Normal 320 0,95 0.92 1.00 1.07 1.04 1.00 1.03 0.97 1.00 Normal 321 1.07 0.99 1.00 1.00 0,98 1,00 0.98 0.87 1.00 Normal 322 1.03 0.99 1.00 1.08 1.07 1.00 1.00 0.97 1.00 Normal 323 1.05 0.98 1.00 0.98 1Ό8 1.00 0.91 0.96 1.00 Normal 324 0.98 0.92 1.00 1.03 1.04 1.00 1.06 0.99 1.00 Normal 325 1.08 1.04 1.00 1.00 0.95 1.00 0.98 0.98 1.00 Normal 326 0.99 1.02 1.00 1.06 1.02 1.00 1.06 0.94 1.00 Normal 327 0.98 0.97 1.00 0.98 0.99 1.00 0.97 1.00 1.00 Normal 328 1.05 0.98 1.00 1.01 1.11 1.00 1.04 0.97 1,00 Normal 329 1.06 1.01 1.00 1.04 0,98 1.00 0.90 0.98 1.00 Normal 330 1.03 0.99 1.00 1.01 1.03 1.00 0.89 0.94 1,00 Normal 331 0.98 0.97 1.00 1.04 0.95 1.00 0.93 0.98 1.00 Normal 332 1.03 1.01 1.00 0.96 1.04 1.00 0.99 1.01 1.00 Normal 333 1,09 1.00 1.00 1.03 1.07 1.00 1.02 0.96 1.00 Normal 334 1.02 0,99 1.00 0.94 1.07 1.00 0.91 0.98 1,00 Normal 335 0.97 0.98 1.00 0.97 0.90 1.00 0.97 1.02 1.00 Normal 336 0.91 0,96 1 00 0.99 1.02 1.00 0.99 1.00 1.00 Normal 337 1.02 0.98 1 00 1.10 1.05 1.00 1.09 0.99 1.00 Normal 338 0.92 0.93 1.00 1.07 0.89 1.00 0.99 1.04 1.00 Normal 339 0.99 1.03 1.00 0.99 0.97 1.00 1.09 0.96 1.00 Normal 340 1.00 1,07 1.00 1.02 0.99 1.00 0.97 1.00 1.00 Normal 341 1.01 0.98 1.00 1.05 1.01 1.00 0.93 0.86 1.00 Normal 342 0.96 1,04 1.00 0.98 0.90 1.00 0.94 0.95 1.00 Normal 343 1.11 1.08 1.00 0.97 1,02 1.00 0.95 1.00 1.00 Normal 344 0.97 1,01 1.00 0.98 0.93 1.00 1.04 0.99 1.00 Normal 345 0.88 1.03 1.00 1.01 0.90 1.00 1.04 1.03 1.00 Normal 346 0.95 1.07 1.00 0.98 0.90 1.00 1.04 0.97 1.00 Normal 347 0.93 0.92 1.00 1.01 0.95 1.00 1.09 1.10 1.00 Normal 348 0.87 0.91 1.00 1.05 1.00 1.00 0.96 0.98 1.00 Normal 349 0.95 1.01 1.00 1.02 1.00 1.00 0.96 0.98 1.00 Normal 350 0.94 0.91 1.00 0.93 0.99 1.00 1.06 1.08 1.00 Normal 351 0.98 1.03 1.00 0.97 0.96 1.00 0.97 1.02 1.00 Normal 352 0.90 0.96 1.00 1.02 0.97 1.00 0.98 0.96 1.00 Normal 353 1.31 1.07 1.00 1.00 0.92 1.00 1.09 1.08 1.00 Aneuploid (+C6). [Table 5-6] Petition 870200043201, dated 03 / 04 / 2020, pp. 52 / 68 / 50 C6C4C2 triplex PCR C9C3C8 triplex PCR C1C5C7 triplex PCR C6 04 C2 C9 C3 08 Cl C5 C7 C6 / C2 C4 / C2 C2 / C2 C9 / C8 03 / 08 C8 / C8 C1 / G7 C5 / C7 G7 / C7 Indivíduo no. zdzdCt ZlZiCt zlzjct zlzíct JJct zízfct zlzk)t Jdot Jzlot Resultados 354 0.95 1.03 1.00 1.10 1 00 1.00 1.00 105 100 Normal 355 0.95 0.99 1.00 0.96 1.04 1.00 1.04 100 100 Normal 356 1.02 1.03 1.00 0.97 0.88 1.00 1.06 105 100 Normal 357 1.07 1.04 1.00 0.98 1.01 1.00 101 100 100 Normal 358 1.02 1.06 1.00 1.06 1.01 1.00 103 0.92 100 Normal 359 1.02 1.00 1.00 0.97 1.00 1.00 105 111 100 Normal 360 0.97 1.04 1.00 1.05 0.97 1.00 0.95 0.92 100 Normal 361 0.97 0.89 1.00 1.02 0.97 1.00 0.99 0.90 100 Normal 362 1.00 1.02 1.00 1.05 1.04 1.00 109 112 1.00 Normal 363 1.02 1.01 1.00 0.94 0.93 1.00 0.98 0.94 100 Normal 364 1.04 1.05 1.00 0.97 0.98 1.00 101 0.92 100 Normal 365 1.06 1.09 1.00 0.97 1.06 1.00 0.93 0.95 100 Normal 366 0.93 0.98 1.00 1.06 0.96 1.00 113 110 100 Normal 367 0.96 0.99 1.00 1.01 1.02 1.00 1.00 0.98 100 Normal 368 1.05 1.D3 1.00 1.02 0.93 1.00 0.96 0.96 100 Normal 369 0.92 1.01 1.00 1.02 1.12 1.00 1.01 0.96 100 Normal 370 1.01 1.01 1.00 0.95 0.94 1.00 1.09 102 100 Normal 371 0.98 1.01 1.00 0.95 0.96 1.00 0.95 0.94 100 Normal 372 1.02 1.00 1.00 0.90 0.90 1.00 0.96 100 100 Normal 373 1.01 1.03 1.00 0.99 0.93 1.00 0.99 101 100 Normal 374 1.00 1.03 1.00 0,97 0.92 1.00 0.98 0.93 100 Normal 375 108 1.02 1.00 0.97 0.94 1.00 104 1.06 100 Normal 376 1.04 1.08 1.00 0.93 0.91 1.00 107 1.00 100 Normal 377 1.02 1.01 1.00 0.95 0.97 1.00 111 111 100 Normal 378 1.05 1.01 1.00 1.01 1.00 1.00 108 1.06 1.00 Normal 379 1.01 1.03 1.00 0.97 1.05 1.00 1.06 1.03 100 Normal 380 0.93 1.01 1.00 0.98 1.03 1.00 110 102 100 Normal 381 1,45 1.06 1.00 1.00 1.00 1.00 0.93 100 100 Aneuploide (+C6) 382 0.95 0.96 1.00 0.99 0.90 1.00 0,97 1.08 100 Normal 383 1.06 1.01 1,00 0.99 1.01 1.00 0.99 0.96 100 Normal 384 1.07 1.01 1 00 1.00 1.06 1.00 100 100 100 Normal 385 0.94 0.90 1.00 0.98 1.04 1.00 103 104 100 Normal 386 0.97 0.96 1.00 0.93 0.91 1.00 1.01 0.99 100 Normal 387 0.93 1.02 1.00 100 1.01 1.00 0.91 0.94 100 Normal 388 1.02 0.97 1,00 1.00 0.95 1.00 112 100 100 Normal 389 1.04 1.03 1.00 1.02 0.96 1.00 0.93 0.94 100 Normal 390 1.04 1.01 1.00 1.03 1.07 1,00 104 107 1.00 Normal 391 1.02 1.08 1.00 1.05 1.02 1.00 100 0.96 100 Normal 392 0.98 0.91 1.00 1.02 0.92 1.00 105 0.95 100 Normal 393 0.91 0.89 1.00 0.98 1.07 1.00 100 0.94 100 Normal 394 0.99 1.02 1.00 1.02 1.01 1.00 127 105 1.00 Aneuploide (+C1) 395 0.90 1.00 1.00 0.98 1.02 1.00 100 102 100 Normal 396 0.93 0.99 1.00 1.04 1.05 1.00 102 0.98 100 Normal 397 1.04 0.98 1.00 1.01 0.97 1.00 103 0.98 100 Normal 398 0.97 0.96 1.00 1.00 1.00 1.00 1.30 108 100 Aneuploide (+C1) 399 0.97 0.97 1.00 1.06 1.10 1.00 103 1.08 100 Normal 400 0.96 1.00 1.00 1.06 0.97 1.00 100 0.98 100 Normal 401 0.97 1.01 1.00 1.01 1.00 1.00 . 104 103 100 Normal 402 0.99 0.96 1.00 0.90 0.97 1.00 0.95 0.38 100 Normal 403 1.00 1,03 1.00 1.05 0.96 1.00 109 113 100 Normal 404 1.14 1.08 1.00 0.99 0.96 1.00 0.95 0.98 100 Normal 405 1.10 0.96 1.00 1.04 0.97 1.00 0.95 100 100 Normal 406 0.97 1.02 1.00 1.03 1.07 1.00 107 100 100 Normal 407 0.93 1.01 1.00 1.00 1.00 1.00 104 0.95 100 Normal 408 0.93 0.89 1.00 1.01 1.01 1.00 100 0.99 100 Normal 409 1.01 0.95 1.00 0.99 0.97 1.00 0.97 0.94 100 Normal 410 1.04 1.03 1.00 0.99 0.98 1.00 0.96 100 1 00 Normal 411 1.02 1.02 1.00 0.93 0.90 1.00 0.96 1.00 1 00 Normal 412 1.00 1.01 1.00 0.96 0,93 1.00 101 1.01 100 Normal 413 0.96 1.03 1.00 1.03 1.08 1.00 1.04 0.98 100 Normal 414 1.02 0.98 1.00 1.01 1.07 1.00 100 103 100 Normal 415 □.99 0.98 1.00 1.01 1.07 1.00 104 109 100 Normal 416 1.07 1.02 1.00 1.04 1.13 1.00 101 0.97 100 Normal 417 0.99 1.03 1.00 1.04 1.01 1.00 0.95 100 100 Normal 418 1.01 1.01 1.00 1.03 1.08 1.00 0.99 0.98 100 Normal__________ 419 0.99 1.04 1.00 1.01 1.03 1.00 0.98 101 100 Normal 420 1,01 0.99 1.00 0.99 0,98 1.00 0.92 0.96 100 Normal 421 0.95 0.94 1.00 0.98 0.94 1.00 0.97 100 100 Normal 422 0.88 0.91 1.00 1.01 1.00 100 0.94 100 100 Normal 423 1.00 1.02 1.00 0.95 1.00 1.00 0.97 0.98 100 Normal 424 1.03 0.99 1.00 0.99 1.04 1.00 1.04 1.07 1.00 Normal. [Table 5-7] Petition 870200043201, dated 03 / 04 / 2020, page 53 / 68 / 50 C6C4C2 triplex PCR C9C3C8 triplex PCR C1C5C7 triplex PCR 06 C4 02 09 G3 C8 01 05 07 C6 / C2 C4 / C2 C2 / C2 C9 / C8 03 / 08 08 / 08 Cl / 07 C5 / C7 C7 / C7 Indivíduo no. zlzíct Jzlct Jzlct zfjot zl / jot ZlJOt JJct JJct zdZÍCt Resultados 425 0.96 0.92 1.00 0.97 1,00 1.00 1.01 0.97 1.00 Norma! 426 1.08 1.02 1.00 1.04 1.00 1.00 0.95 0.98 1.00 Normal 427 1.05 1.05 1.00 1.05 1.03 1.00 0.92 0.96 1.00 Normal 428 1.00 1.01 1.00 1.05 1.02 1.00 0.92 0.94 too Normal 429 0.93 0.98 1.00 1.02 1.04 1.00 1.08 0.98 1.00 Norma! 430 1.03 1,01 1,00 0.97 0.93 I.00 L0Í I.03 too Normal 431 0.92 0,98 1.00 1.03 1,00 1.00 1.05 1.13 too Normal 432 0.97 1.06 1.00 0.99 0.90 1.00 1.03 0.99 too Normal 433 1.04 0,95 1.00 1.02 1.03 1.00 1.00 0.99 too Normal 434 . 1.00 1.03 1.00 1.00 1.04 1.00 0.95 0.98 too Normal 435 1.05 0.99 1.00 1.00 1.07 1.00 1.05 0.99 too Normal 436 0,98 0.97 1.00 1.03 0.94 1.00 1.02 0.98 too Normal 437 0.99 1.07 1.00 0.95 0.99 1.00 . 0.76 0.73 too Aneuploide (+07) 438 1.07 1.01 1.00 1.03 1.02 1.00 0,95 1.00 too Normal 439 1.06 1.01 1.00 1.02 0.88 1.00 1,00 1.05 too Normal 440 0.93 0.96 1.00 0.97 0.97 1.00 0.68 0.93 too Aneuploide (outros) 441 1.03 1.01 1.00 0.92 0.92 1.00 1.11 1.06 1.00 Normal 442 1.03 1.08 1.00 0.95 1,00 1.00 0,93 0,96 1.00 Normal 443 0.95 0.92 1.00 0.95 1,03 1.00 1.02 1.11 1.00 Normal 444 0.93 0.91 1.00 1.00 0.96 1.00 0.99 0.99 too Normal 445 0.99 1.01 1.00 . Í.01 0.97 1.00 1.04 0.98 too Normal 446 0.95 0.96 1.00 1.01 0.97 1.00 1.09 0.98 1.00 Normal 447 1.00 0.99 1.00 1.13 1.05 1.00 1.10 1.03 too Normal 448 0.99 1.00 1.00 0.99 0.93 1.00 0.97 1.04 too Normal 449 1.04 0.94 1.00 1.07 1.04 1.00 1.08 1.02 too Norma! 450 1.02 1.01 1.00 1.02 1.02 1.00 0.92 0.98 1.00 Norma! 4o 1 1,00 1.06 1.00 1.02 1.00 1.00 0.99 0.96 too Norma! *52 1.08 1.01 1.00 1.01 1.02 1.00 0.95 0.95 too Normal 403 1.09 1.05 1.00 1.07 1.10 1,00 : 0.98 0.96 too Norma! 4o4 0.97 1.01 1.00 0.94 0.90 1.00 0.97 1.00 1.00 Norma! 455 1,04 0.98 1.00 1.07 1.09 1.00 1,01 0.98 1.00 Normal 456 0.96 0.91 1.00 1.03 1.06 1.00 1.04 0.94 1.00 Norma! 457 1.02 1.01 1.00 1.02 1.01 1.00 1.08 1.04 too Norma! 458 0.99 1.04 1.00 0,94 0.94 1.00 0,98 0.97 too Norma! 459 0.92 0.96 1.00 1.01 0.99 1.00 0,96 0 96 too Normal 460 0.97 0.98 1.00 0.99 0.95 1.00 1.04 1.00 1.00 Normal 461 . 0.96 0.93 1 00 1.00 1.00 1.00 0.97 0 91 too Normal 462 1.00 0,97 1.00 0,93 1.04- 1.00 □.94 1.00 too Normal 463 0.99 1.02 1.00 1.03 1.01 1.00 1.01 0.95 too Norma! 464 1.01 1.04 1.00 0.99 0.95 1.00 1.02 0.97 too Normal 465 0.99 1.01 1.00 1.01 1,00 1.00 0.90 0.98 too Normal 466 0.88 0.94 1.00 1.02 1,08 1.00 0.99 1,05 too Normal 467 0.97 0.94 1.00 1.01 1.09 1.00 1.03 1.05 too Normal 468 1.04 1.01 1.00 1.02 ’ 1.00 1.00 0.98 1.04 too Normal 469 1.04 1.07 1.00 1.02 1.10 1.00 .1.03 1,11 too Normal 470 0.95 0.96 1.00 1.02 1.02 1,00 0.97 1.02 too Normal 471 0.98 0.94 1.00 0.99 1.04 1.00 1.01 1.01 too Normal 472 0,97 0.98 1.00 1.04 1.01 1,00 1.05 1.02 too Normal 473 1.07 1.03 1.00 1.02 1.05 1,00 1.08 1.11 too Normal 474 0.93 0.96 1.00 0.95 1.03 1,00 1.05 too too Normal 475 0.97 0.94 1.00 1.07 1.02 1,00 1.01 1.00 too Normal 476 0.99 0.98 1.00 0.89 0.93 1.00 0.99 1.02 too Norma! 477 0.95 0.98 1.00 1,04 1.04 1.00 0,93 0.94 too Normal 478 1.07 1.05 1.00 1.04 1.09 1,00 1.06 1.08 too Normal 479 0.94 0.99 1.00 0.97 1.09 1.00 0.96 0.98 too Normal 480 1.11 1.03 1.00 0.96 1,00 1,00 • 0.97 1.02 too Normal 481 1.01 1.02 1.00 1.03 1.04 1,00 1.01 0,98 too Norma! 482 0.99 1.05 1.00 1.05 1.05 1.00 0.98 I 1.00 too Normal 483 0,98 0.94 1.00 1.02 1.10 1.00 0.99 0.93 too Normal 484 0.97 1.01 1.00 0.95 0.92 1.00 0.92 | 0.88 1.00 Normal 485 0.97 1.00 1.00 1.06 1.02 . 1.00 1.03 0,97 1.00 Normal 486 0.99 1.03 1.00 1.02 1.11 1,00 1,04 5 1.00 too Normal 487 1.05 1.06 1.00 0,97 1.04 1,00 1.08 1.14 too Normal 488 1.04 1.01 1.00 0.95 0.96 1.00 1.07 1.01 too Normal 489 0.95 0.98 1.00 0.99 1.02 1,00 1.02 0.94 too Normal 490 0.99 0.98 1.00 0.98 1.12 1.00 1.09 1.06 too Normal 491 1.01 0.99 1,00 0.96 1.02 1.00 0.98 too I.00 Normal 492 0.96 1.04 1.00 1.01 0.97 1.00 0.98 1.03 too Normal 493 1.06 1.08 1.00 0.99 1.10 1.00 1.06 1.05 too Normal 494 1.04 1.04 1.00 0.95 1.01 1.00 1.01 1.05 too Normal 495 1.04 1.01 1.00 1.02 1.05 1.00 1.09 1.06 1.00 Normal. [Table 5-8] Petition 870200043201, dated 03 / 04 / 2020, pages 54 / 68 / 50 G6G4G2 triplex PCR G9G3G8 triplex PCR G1C5C7 triplex PCR C6 C4 G2 C9 C3 C8 C1 C5 G7 C6 / C2 G4 / C2 C2 / C2 C9 / C8 C3 / C8 C8 / C8 C1 / C7 C5 / C7 G7 / C7 Individual no. Zízdct zJZct dzfct zJzíct zlzlct zdzlct zldct zLdct zlzíct Resultados 496 0.91 0.89 í.00 Í.01 1.01 1.00 0.94 0.94 1.00 Normal 497 1.11 1.10 1.00 1.06 1.03 1.00 0.94 0.97 1.00 Normal 498 0.95 0.96 1.00 1.06 1.08 1.00 0.97 1.00 1.00 Normal 499 1.02 0.98 1.00 1.04 1.03 1.00 0.99 0.98 1.00 Normal 500 1.09 1.06 1.00 1.00 1.04 1.00 0.95 1.02 1.00 Normal 501 1.08 1.05 1.00 0.96 1.01 1.00 0.98 1.00 1.00 Normal 502 0.98 0.96 1.00 0.95 1.00 1.00 1.06 1.11 1.00 Normal 503 0.90 0.95 1.00 0.98 1.04 1.00 0.95 0.99 1.00 Normal 504 0.97 0.98 1.00 0.99 1.09 1.00 0.90 0.96 1.00 Normal 505 0.98 0.96 1.00 0.99 1.10 1.00 0.93 1.05 1.00 Normal 506 0.95 0.91 1.00 0.96 0.99 í.00 0.98 0.92 1.00 Normal 507 1.02 0.98 1.00 1.03 1.07 1.00 1.04 0.96 í.00 Normal 508 1.00 0.94 1.00 0.94 0.99 1.00 0.99 1.02 1.00 Normal 509 0.99 1.03 1.00 0.97 1.05 1.00 0.98 0.66 1.00 Aneuploide (outros) 510 0.68 0.71 1.00 1.02 1.04 1.00 0.98 1.00 1.00 Aneuploide (+C2) 511 0.99 0,95 1,00 0.95' 0.97 1.00 0.95 1.02 1.00 Normal 512 1.04 1.03 1.00 1.00 1.13 1,00 1.03 1,08 1.00 Normal 513 1.00 1.04 1.00 0.95 0.98 1.00 0.96 1.00 too Normal 514 0.96 0.96 1.00 0.95 0.94 1.00 0.92 0.96 too Normal 515 1,08 1.03 1.00 1.04 1.03 1.00 0.95 1.05 1.00 Normal 516 1.02 1.08 1.00 0.90 1.05 1.00 1.00 1.01 1.00 Normal 517 1.05 0.96 1.00 1.01 0.90 1.00 0.97 0.96 1.00 Normal 518 0.94 0.97 1.00 0.95 0.92 1.00 0.90 0.93 1.00 Normal 519 1.02 1.07 1.00 1.01 0,92 1,00 0.97 0.95 too Normal 520 1.04 1.03 1.00 1.14 1.07 1.00 0.99 1.05 1.00 Normal 521 1.01 1 03 1.00 1.00 0.95 1.00 0.99 1.05 too Normal 522 1.09 1 01 1.00 0.99 0.92 1.00 0.95 0.98 1,00 Normal 523 0.99 1.01 1.00 1.04 1.05 1.00 1.03 0.98 too Normal 524 1.07 1.09 1.00 1.02 0.95 1.00 1.04 1.02 too Normal 525 1.07 1.08 1.00 1.03 0.96 1.00 1.03 1.01 too Normal 526 1.04 0.98 1.00 0.99 1.01 1 00 1.04 1.02 too Normal 527 ' 0.99 1.02 1.00 0.93 0.95 1.00 0.91 0.99 too Normal 528 1.02 0,98 1.00 0.B7 0.95 1.00 I.03 1.05 too Normal 529 0.96 0.95 1.00 0.96 0.91 1,00 0.98 0.89 1.00 Normal 530 1 07 1.06 1.00 1.02 1.00 1.00 1.06 1.09 1.00 Normal 531 0.97 0.95 1.00 1,01 0.93 1.00 0.94 0.98 too Normal 532 1.05 1.06 1.00 1.02 0.97 1.00 0.98 1.03 too Normal 533 0.97 1.04 1.00 0.96 0.95 1.00 1.02 0.98 too Normal 534 1.01 1.01 1.00 1.07 0.95 1.00 0,97 0.99 1.00 Normal 535 0.93 0.94 1.00 1.07 1.00 1.00 0.90 0.96 too Normal 536 0.97 1.01 1.00 1.01 1.01· 1.00 1.00 1.00 too Normal 537 0,95 0.93 1,00 1.06 1.03 1.00 0.97 0.96 1.00 Normal 538 1.04 102 1.00 0.97 1.00 1.00 0.90 0.92 1.00 Normal 539 1.00 1.03 1.00 1.01 0.89 1.00 1.04 1.09 1.00 Normal 540 0.99 1.01 1.00 0.95 0,96 1,00 0.91 1,00 1.00 Normal 541 1.03 1.01 1.00 0.99 0.99 1,00 1.04 1.04 1.00 Normal 542 1.02 0.97 1.00 1.03 1.01 1.00 1.00 1.03 too Normal 543 1.08 1.04 1.00 0.97 1.00 1.00 0.93 0.95 too Normal 544 0.91 0.92 1.00 0.97 0.95 1.00 1.01 1,03 100 Normal 545 1.02 0.96 1.00 1.02 1.14 1.0Ü 0.93 0.94 too Normal 546 1.02 0.98 1.00 0.95 0.94 1.00 1.04 1.05 1.00 Normal 547 0.94 1.01 1.00 0.93 0.98 1.00 0.99 1.05 too Normal 548 0.99 1.01 1.00 0.94 1.02 1.00 0.94 0.99 1.00 Normal 549 0.95 0.98 1.00 0.97 0.99 1.00 0.99 0.96 too Normal 550 0.99 1.00 1,00 0.98 0.97 1.00 0.98 0.97 1.00 Normal 551 1.10 1,03 1,00 1.02 1.00 1.00 0.97 0.97 too Normal 552 1.04 1.01 1.00 0,99 1.12 1.00 1.01 1.02 too Normal 553 1.41 1.10 1.00 1.01 1.00 1.00 1,03 1,10 1,00 Aneuploide (+C6) ' 554 1.04 1.03 1.00 0.93 1.01 1.00 0.95 0,99 1,00 Normal 555 1.02 1.00 1.00 1.04 1.05 1.00 0.98 0.99 too Normal 556 1.03 1.01 1.00 0,99 1.04 1.00 0.99 1.00 1.00 Normal 557 0.99 1.02 L00 I.02 1.07 1.00 0.95 0.84 too Normal 558 0.93 0.96 1.00 1.02 1,01 1.00 0.93 0.95 1.00 Normal 559 1.02 1.05 1.00 1,05 1,05 1.00 1,03 0,98 too Normal 560 1.02 1.05 1.00 1,05 1.10 1.00 1,03 1,01 too Normal 561 1.07 1.03 1.00 0.99 tot 1.00 0.98 0.98 too Normal 562 0.96 0,93 1.00 0.97 1.03 1.00 0,98 0.94 too Normal 563 0.93 0.96 1.00 1.04 1.14 1.00 0.93 0.98 1.00 Normal 564 1.13 1.09 1 .Oü 1 .04 1.03 1 .oo 1 .04 1 .08 1 .oo Normal. [Table 6] Table 6 - Results of the aneuploidy test in the F1 variety of cauliflower using the TaqMan method (summary) Number of plants ratio (%) Normal 542 96.1% Petition 870200043201, dated 03 / 04 / 2020, pages 55 / 68 / 50 aneuploid (+C1) 4 0.7% aneuploid (+C2) 5 0.9% aneuploid (+C3) 0 0.0% aneuploid (+C4) 1 0.2% aneuploid (+C5) 0 0.0% aneuploid (+C6) 7 1.2% aneuploid (+C7) 2 0.4% aneuploid (+C8) 0 0.0% aneuploid (+C9) 1 0.2% other aneuploid 2 0.4 Example 5: Example of Detection and Variant Types in Cabbage

[00118] Individuals exhibiting morphology differing from normal appearance at harvest stage were selected from the breeding field of the F1 cabbage variety “SCB-81” under development by SAKATA SEED CORPORATION. DNA was extracted from mature leaves of each plant and aneuploid analysis was performed in the same manner as in Example 4 above.

[00119] The results were as shown in Table 7.

[00120] As a result, all trisomic plants, other than chromosome 3, were detected, and it was revealed that chromosome aneuploidy also caused most variant type individuals in cabbage.

[00121] These facts demonstrate that the method of the present invention is effective for analyzing variant type individuals not only of broccoli and cauliflower, but also cabbage.

[00122] Figure 6 shows the appearance of various aneuploids (phenotypic characteristics of chromosome trisomies were as shown in Figure 7). As shown in Figure 6 and Table 7, in addition to typical trisomies, there were also individuals in whom aneuploidy occurred in a plurality of chromosomes. [Table 7] Table 7 - Aneuploidy test results in the F1 variety of cabbage (raw data obtained by multiplex PCR based on the fluorescent probe method (value calculated by the ΔΔO method)) Petition 870200043201, dated 03 / 04 / 2020, pages 56 / 68 / 50 C6C4C2 triplex POR C9C3C8 triplex PCR C1C5C7 triplex PCR C6 G4 G2 G9 03 G8 C1 G5 G7 C6 / C2 C4 / C2 C2 / C2 G9 / G8 O3 / G8 C8 / G8 01 / 07 05 / 07 G7 / C7 Indivíduo no. ZlZfCt ZLdct zlzíct XMCt ZfzdCt Λ / Jct ^dzíct zLdot zlzlct Resultados 1 1.03 1.03 1.00 0.95 0.95 1.00 1.04 1.03 1.00 Normal 2 0.96 0.98 1.00 0.99 1.03 1.00 1.02 0.95 1.00 Normal 3 1.04 1.03 1.00 0.97 1.02 1.00 1.00 1.05 1.00 Normal 4 0.96 0.96 1.00 1.04 0.94 1.00 0.94 0.97 1.00 Normal 5 1.07 1.03 1.00 1.02 1.03 1.00 1.02 1.01 1.00 Normal 6 0.94 0.97 1.00 1.04 1.02 1.00 0.99 1.00 1.00 Normal 7 1.32 0.99 1.00 0.99 0.96 1.00 1.07 1.03 1.00 Aneuploid (+C6) 8 1.05 1.01 1.00 1.04 0.95 1.00 0.75 0.76 1.00 Aneuploid (+C7) 9 1.34 0.97 1.00 1.05 1.03 1.00 1.04 1.05 1.00 Aneuploid (+C6) 10 1.02 1.38 1.00 1.01 1.03 1.00 1.05 0.99 1.00 Aneuploid (+C4) 11 0.99 0.98 1.00 1.03 1.05 1.00 1.32 1.07 1.00 Aneuploid (+C1) 12 0.71 0.72 1.00 1.01 0.96 1.00 0.98 0.99 100 Aneuploid (+C2) 13 0.75 1.00 0.95 1.04 1.00 1.30 1.03 100 Aneuploid (+C1+C2) 14 0.93 0.97 1,00 1.00 0.89 1.00 1.04 1.30 100 Aneuploide (+C5) 15 0.72 0.72 1.00 1.00 0.95 1.00 1.00 0.99 100 Aneuploide (+C2) 16 1.35 0.95 1.00 1.00 1.09 1.00 1.02 1.02 100 Aneuploide (+C6) 17 0.96 0.98 1.00 0.74 0.79 1.00 1.03 1.02 1.00 Aneuploide (+C8) 18 1.02 0.98 1.00 1.28 1.02 1.00 1,00 1.03 100 Aneuploide (+09) 19 0.75 0.74 1.00 1.00 0.96 1.00 1.04 1.03 1.00 Aneuploide (+C2) 20 0.93 1.05 1.00 0.97 0.91 1.00 0.79 0.79 100 Aneuploide (+C7) 21 0,97 1.00 1.00 1.01 1.07 1.00 1.30 1.05 100 Aneuploide (+G1) 22 0.76 0.78 1.00 1.02 0.96 1.00 1.04 0.99 100 Aneuploide (+G2) 23 1.31 1.05 1.00 0.97 0.92 1.00 1.07 1.06 100 Aneuploide (+C6) 24 1.10 1.04 1.00 1.01 1.00 1,00 0.76 0.77 100 Aneuploide (+C7) 25 1.02 0.97 1.00 0.76 0.80 1.00 1.24 0.99 100 Aneuploide (+O1+C8) 26 1.39 1.08 1.00 1.02 1.02 1.00 1.04 0.99 100 Aneuploide (+C6) 27 0.98 0.96 1.00 1.02 1.06 1.00 1.31 1.06 1.00 Aneuploide (+01) 28 0.76 0.72 1.00 1.00 0.92 1.00 1.01 0.99 1.00 Aneuploide (+02) 29 0.98 1.01 1.00 0.78 0.81 1.00 1.04 1.07 1.00 Aneuploid (+C8) 30 0.77 0.73 1.00 1.04 0.98 1.00 1.01 0.99 1.00 Aneuploid (+C2) 31 0.95 0.98 1.00 1.02 0.95 1.00 1.38 1.01 100 Aneuploid (+C1) 32 0.93 1.04 1.00 0.96 0.88 1.00 1.07 1.31 1.00 Aneuploid (+C5) 33 0.97 1.03 1.00 0.75 0.73 1.00 1.04 1.30 100 Aneuploid (+G5,+C8) 34 0.99 0.92 1.00 0.73 0.82 1.00 1.28 1.04 100 Aneuploid (+01,+08) 35 0.93 0.91 1.00 1.26 1.08 1.00 1.04 0.96 100 Aneuploid (+09) 36 1.04 1.35 1.00 1.03 0.95 1.00 1.02 1.01 100 Aneuploid (+C4) 37 1.09 1.37 1.00 0.95 0.97 1.00 0.98 0.95 100 Aneuploid (+C4). Petition 870200043201, dated 03 / 04 / 2020, pages 57 / 68

Claims

1 / 2 CLAIMS 1. A method for detecting an aneuploidy in a Brassica oleracea plant, characterized in that it comprises: providing two or more pairs of DNA primers wherein each primer pair is specific for distinct chromosomes selected from 1 to 9 of the Brassica oleracea plant; performing real-time PCR using DNA extracted from a sample derived from the Brassica oleracea plant to be tested as a template and the two or more pairs of DNA primers; and detecting chromosomal aneuploidy from a relative difference between the amplification values ​​obtained by the two or more pairs of DNA primers, wherein the two or more pairs of DNA primers comprise a nucleotide sequence selected from the group consisting of SEQ ID Nos: 1 to 18.

2. Method according to claim 1, characterized in that it further comprises determining whether a plant to be tested is an aneuploid for one of its chromosomes using two or more pairs of DNA primers specific for each of chromosomes 1 to 9 of the plant Brassica oleracea.

3. Method according to claim 1, characterized in that (i) each pair of DNA primers is specific for one of the chromosomal DNAs of the plant Brassica oleracea and produces an amplification product by real-time PCR reaction when the chromosomal DNA is present; and (ii) further comprising a probe that is specific for chromosomal DNA identical to any of the chromosomal DNAs described in (i) and can detect an amplification product by real-time PCR reaction based on the pair of primers described in (i) wherein the two or more pairs of DNA primers Petition 870260052357, dated 01 / 06 / 2026, p. 10 / 13 2 / 2 comprise a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 18 and one or more probes comprise a nucleotide sequence selected from the group consisting of SEQ ID NOs: 19 to 27.

4. Method according to claim 1, characterized in that the method uses an intercalator that binds to double-stranded DNA synthesized by a PCR reaction and emits fluorescence, or uses a probe modified with a fluorescent dye so as to emit fluorescence by a PCR elongation reaction.

5. Method according to claim 1, characterized in that the method uses an increase in the fluorescence signal obtained by real-time PCR as an index to detect chromosome aneuploidy.

6. Method according to claim 3, characterized in that the probe is modified with a fluorescent dye so as to emit fluorescence by a PCR elongation reaction.

7. Method according to claim 1, characterized in that the two or more pairs of DNA primers comprise at least three pairs of DNA primers that are specific for at least three distinct chromosomes from chromosomes 1 to 9 of the plant Brassica oleracea. Petition 870260052357, dated 01 / 06 / 2026, page 11 / 13