Method to increase the size of soybean seeds

Description

1 / 45 METHOD TO INCREASE THE SIZE OF SOYBEAN SEEDS

[001] This application claims priority to Chinese patent application CN202310304497.5, filed on March 23, 2023, which is incorporated herein by reference in its entirety. FIELD OF APPLICATION

[002] This disclosure pertains to the field of biotechnology and relates specifically to a method for gene editing in soybeans. In particular, this disclosure relates to a mutant microRNA396 (miR396) produced by a Cas12i gene editing technology and the use of the mutant miR396 to increase the size of soybean seeds. BACKGROUND

[003] Soybeans are an important source of fats and proteins for humans, as well as being an important source of vegetable oils and vegetable proteins. Soybeans are one of the most important commercial crops in the world. Soybeans are widely used in the production of derived products and animal feed due to their advantages, such as complete nutrition and high protein content. However, due to low soybean production and the low economic return of soybean cultivation for farmers in China, the soybean cultivation area remains limited in China, with a total production of only 20 million tons. As a result, 80% or more of China's soybeans depend on imports, which represents a serious threat to national food security.

[004] MicroRNAs (miRNAs) are a class of small, non-coding, single-stranded RNA molecules. miRNAs can bind to target gene mRNAs via base pairing, thus regulating the target genes. During plant growth, plant miRNAs play critical roles in regulating meristematic tissue characteristics, leaf polarity, flowering patterns, etc. Plant miR396 is a small, non-coding, single-stranded, highly conserved RNA molecule, 20 to 24 nucleotides long, that can regulate the expression of a growth regulatory factor (GRF). Petition 870260079460, dated 07 / 08 / 2026, p. 5 / 51 2 / 45 for a target gene. Studies have shown that miR396 can regulate tillering, grain type, and ear type of a crop, affecting crop yield.

[005] When used for crop breeding, CRISPR (clustered regularly interspaced short palindromic repeats) / Cas gene editing technology offers advantages such as the absence of transgenic components, a short reproductive cycle, and targeted modification of plant characteristics. The CRISPR / Cas Type V system is a recently discovered CRISPR system. The CRISPR / Cas Type V system has a 5'-TTN motif and can cleave a sticky end of a target sequence, such as Cpf1, C2c1, CasX, and CasY. However, the different CRISPR / Cas systems currently available have distinct advantages and disadvantages. Cas12i is also a CRISPR / Cas Type V system. The Chinese patent (CN111757889B, publication date: May 25, 2021) discloses a Cas Type V enzyme (Cas12f.4). In this disclosure, Cas12f.4 is defined as Cas12i. The efficiency of Cas12i for gene editing in eukaryotic cells still needs improvement.

[006] In this disclosure, soybean miR396 family genes are edited directly via Cas12i optimized to develop large-seeded, high-yielding soybean germplasm resources. CONTENT OF THE INVENTION

[007] One objective of this disclosure is to provide a miR396 mutant and a use of the miR396 mutant to increase soybean seed size, increase soybean seed weight, increase the number of seeds per soybean plant, or improve soybean yield.

[008] In one aspect, the present disclosure provides a mutant miR396, wherein the mutant miR396 undergoes a base mutation relative to the parental miR396; the parental miR396 is a wild-type (WT) miR396 derived from soybeans; and the miR396 is selected from one or more of the miR396a, miR396b, miR396c, miR396d, miR396f, and miR396i.

[009] In one embodiment, the miR396 includes miR396a, miR396c, and miR396d.

[0010] In one embodiment, the miR396 includes miR396a, miR396c, miR396d, and miR396f.

[0011] In one embodiment, the miR396 includes miR396c, miR396d and miR396f. Petition 870260079460, dated 07 / 08 / 2026, p. 6 / 51 3 / 45

[0012] In one embodiment, the miR396 includes miR396a, miR396b, miR396c, miR396d and miR396f.

[0013] In one embodiment, the miR396 includes miR396a, miR396c and miR396i.

[0014] In one embodiment, the miR396 includes the miR396a, the miR396d, and the miR396f.

[0015] In one embodiment, the miR396 includes the miR396a, the miR396b, the miR396c, and the miR396d.

[0016] In one embodiment, the miR396 includes the miR396a, the miR396c, the miR396f, and the miR396i.

[0017] In one embodiment, the miR396 includes the miR396b, the miR396c, the miR396d, the miR396f and the miR396i.

[0018] In one embodiment, the mutant miR396 is selected from any one or more of the following items (i) to (ix): (i) miR396a, miR396c and miR396d that undergo a base mutation in relation to the parental miR396; (ii) miR396a, miR396c, miR396d and miR396f that have undergone a base mutation in relation to the parental miR396; (iii) miR396c, miR396d and miR396f that have undergone a base mutation in relation to the parental miR396; (iv) miR396a, miR396b, miR396c, miR396d and miR396f that have undergone a base mutation in relation to the parental miR396; (v) miR396a, miR396c and miR396i that have undergone a base mutation in relation to the parental miR396; (vi) miR396a, miR396d and miR396f that have undergone a base mutation in relation to the parental miR396; (vii) miR396a, miR396b, miR396c and miR396d that have undergone a base mutation in relation to the parental miR396; (viii) miR396a, miR396c, miR396f and miR396i that have undergone a base mutation relative to the parental miR396; and (ix) miR396b, miR396c, miR396d, miR396f and miR396i that have undergone a base mutation relative to the parental miR396. Petition 870260079460, dated 07 / 08 / 2026, page 7 / 51 4 / 45

[0019] In one example, the mutant miR396 is able to improve seed size, seed weight, number of seeds per plant, or soybean yield.

[0020] In one embodiment, base mutation includes the deletion of a base, the insertion of a base, or the substitution of a base.

[0021] In one embodiment, the parental miR396 is miR396 WT derived from soy. In one embodiment, the soy is Zhonghuang 302.

[0022] In one embodiment, the parental miR396a is derived from soy and has a sequence identity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with a sequence shown in SEQ ID No. 2.

[0023] In a specific embodiment, a sequence of the parental miR396a is shown in SEQ ID No. 2.

[0024] In one embodiment, the parental miR396b is derived from soy and has a sequence identity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the sequence shown in SEQ ID No. 3.

[0025] In a specific embodiment, a sequence of the parental miR396b is shown in SEQ ID No. 3.

[0026] In one embodiment, the parental miR396c is derived from soy and has a sequence identity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the sequence shown in SEQ ID No. 4.

[0027] In a specific embodiment, a sequence of the parental miR396c is shown in SEQ ID No. 4.

[0028] In one embodiment, the parental miR396d is derived from soy and has a sequence identity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, Petition 870260079460, dated 07 / 08 / 2026, page 8 / 51 5 / 45 at least 96%, at least 97%, at least 98%, or at least 99% with a sequence shown in SEQ ID No. 5.

[0029] In a specific embodiment, a sequence of the parental miR396d is shown in SEQ ID No. 5.

[0030] In one embodiment, the parental miR396f is derived from soy and has a sequence identity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the sequence shown in SEQ ID No. 6.

[0031] In a specific embodiment, a sequence of the parental miR396f is shown in SEQ ID No. 6.

[0032] In one embodiment, the parental miR396i is derived from soy and has a sequence identity of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the sequence shown in SEQ ID No. 7.

[0033] In a specific embodiment, a sequence of the parental miR396i is shown in SEQ ID No. 7.

[0034] In one embodiment, miR396a undergoes a base mutation relative to miR396a WT, miR396b undergoes a base mutation relative to miR396b WT, miR396c undergoes a base mutation relative to miR396c WT, miR396d undergoes a base mutation relative to miR396d WT, miR396f undergoes a base mutation relative to miR396f WT, and miR396i undergoes a base mutation relative to miR396i WT.

[0035] In one embodiment, the mutant miR396a undergoes a base deletion relative to the sequence shown in SEQ ID No. 2; the mutant miR396b undergoes a base deletion relative to the sequence shown in SEQ ID No. 3; the mutant miR396c undergoes a base deletion relative to the sequence shown in SEQ ID No. 4; the mutant miR396d undergoes a base deletion relative to the sequence shown in SEQ ID No. 5; the mutant miR396f undergoes a base deletion relative to the sequence shown in Petition 870260079460, dated 07 / 08 / 2026, page 9 / 51 6 / 45 SEQ ID No. 6; and the mutant miR396i suffers a base deletion relative to the sequence shown in SEQ ID No. 7.

[0036] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has deletions of bases 229 to 233 relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions of 229a to 230a bases relative to the sequence shown in SEQ ID No. 4; and the sequence of the parental miR396d is shown in SEQ ID No. 5, and the mutant miR396d has deletions of 19a to 29a bases relative to the sequence shown in SEQ ID No. 5.

[0037] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has a deletion of 229 bases relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions of 230 to 255 bases relative to the sequence shown in SEQ ID No. 4; the sequence of the parental miR396c is shown in SEQ ID No. 5, and the sequence of the mutant miR396d has deletions of 19 to 29 bases relative to the sequence shown in SEQ ID No. 5; the sequence of the parental miR396d is shown in SEQ ID No. 5, and the mutant miR396d has deletions of 19 to 29 bases relative to the sequence shown in SEQ ID No. 5; The sequence of the parental miR396f is shown in SEQ ID No. 6, and the mutant miR396f has a deletion of 265 bases compared to the sequence shown in SEQ ID No. 6.

[0038] In one embodiment, the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions of 228th to 253rd bases relative to the sequence shown in SEQ ID No. 4; the sequence of the parental miR396d is shown in SEQ ID No. 5, and the mutant miR396d has a deletion of 19th base relative to the sequence shown in SEQ ID No. 5; and the sequence of the parental miR396f is shown in SEQ ID No. 6, and the mutant miR396f has deletions of 264th to 265th bases relative to the sequence shown in SEQ ID No. 6.

[0039] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has a deletion of one 229a base relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396b is shown in Petition 870260079460, dated 07 / 08 / 2026, page 10 / 51 7 / 45 SEQ ID No. 3, and the mutant miR396b has deletions of 30 to 100 bases relative to the sequence shown in SEQ ID No. 3; the parental miR396c sequence is shown in SEQ ID No. 4, and the mutant miR396c has a deletion of 229 bases relative to the sequence shown in SEQ ID No. 4; the parental miR396d sequence is shown in SEQ ID No. 5, and the mutant miR396d has deletions of 18 to 26 bases relative to the sequence shown in SEQ ID No. 5; and the parental miR396f sequence is shown in SEQ ID No. 6, and the mutant miR396f has deletions of 264 to 265 bases relative to the sequence shown in SEQ ID No. 6.

[0040] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has deletions of 229 to 233 bases relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions of 228 to 253 bases relative to the sequence shown in SEQ ID No. 4; and the sequence of the parental miR396i is shown in SEQ ID No. 7, and the mutant miR396i has deletions of 200 to 201 bases relative to the sequence shown in SEQ ID No. 5.

[0041] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has a deletion of 229th base relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396d is shown in SEQ ID No. 5, and the mutant miR396i has a deletion of 229th base relative to the sequence shown in SEQ ID No. 5; and the mutant miR396d has deletions of 19 to 29 bases relative to the sequence shown in SEQ ID No. 5; and the sequence of the parental miR396f is shown in SEQ ID No. 6, and the mutant miR396f has a deletion of 265 bases relative to the sequence shown in SEQ ID No. 6.

[0042] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has deletions of bases 229 to 233 relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396b is shown in SEQ ID No. 3, and the mutant miR396b has a deletion of a 29th base relative to the sequence shown in SEQ ID No. 3; the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions of 229 to 230 bases relative to the sequence shown in SEQ ID No. 4; and the sequence of the parental miR396d is shown Petition 870260079460, dated 07 / 08 / 2026, page 11 / 51 8 / 45 in SEQ ID No. 5, and the mutant miR396d has deletions of 19 to 29 bases compared to the sequence shown in SEQ ID No. 5.

[0043] In one embodiment, the sequence of the parental miR396a is shown in SEQ ID No. 2, and the mutant miR396a has deletions from bases 229 to 233 relative to the sequence shown in SEQ ID No. 2; the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions from bases 228 to 253 relative to the sequence shown in SEQ ID No. 4; the sequence of the parental miR396f is shown in SEQ ID No. 6, and the mutant miR396f has a deletion of base 265 relative to the sequence shown in SEQ ID No. 6; The parental miR396i sequence is shown in SEQ ID No. 7, and the mutant miR396i has deletions of 20Qa to 201a bases relative to the sequence shown in SEQ ID No. 7.

[0044] In one embodiment, the sequence of the parental miR396b is shown in SEQ ID No. 3, and the mutant miR396b has deletions from the 29th to the 31st base relative to the sequence shown in SEQ ID No. 3; the sequence of the parental miR396c is shown in SEQ ID No. 4, and the mutant miR396c has deletions from 229 to 230 bases relative to the sequence shown in SEQ ID No. 4; the sequence of the parental miR396d is shown in SEQ ID No. 5, and the mutant miR396d has deletions from the 18th to the 26th base relative to the sequence shown in SEQ ID No. 5; The parental miR396f sequence is shown in SEQ ID No. 6, and the mutant miR396f has deletions from the 264th to the 265th base relative to the sequence shown in SEQ ID No. 6; and the parental miR396i sequence is shown in SEQ ID No. 7, and the mutant miR396i has deletions from 200 to 201 bases relative to the sequence shown in SEQ ID No. 7.

[0045] In another aspect, the present disclosure also provides a vector that carries the mutant miR396.

[0046] In one embodiment, the vector includes an expression vector, a transport vector, and an integration vector.

[0047] In one embodiment, the vector is a viral vector (such as a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated virus (AAV) vector, and a herpes simplex virus vector) and may also be a plasmid, a virus, a cosmid, a phage, etc., which are well known to experts in the field. Petition 870260079460, dated 07 / 08 / 2026, page 12 / 51 9 / 45

[0048] In one embodiment, the vector may also include at least one origin of replication to achieve self-replication.

[0049] In one specific embodiment, the vector is a plasmid.

[0050] In one form, the vector also includes an expression regulator element.

[0051] In another aspect, the present disclosure provides a host cell that carries the mutant miR396 or vector.

[0052] In one embodiment, the host cell is a eukaryotic cell, such as a yeast cell, an animal cell, or a plant cell.

[0053] In one embodiment, the plant includes an angiosperm and a gymnosperm.

[0054] In one embodiment, the plant includes a monocotyledonous plant and a dicotyledonous plant.

[0055] In one embodiment, the plant includes a herbaceous plant and a woody plant.

[0056] In one embodiment, the plant includes soybean, Arabidopsis thaliana, tobacco, rice, maize, sorghum, barley, wheat, millet, tomato, potato, quinoa, lettuce, rapeseed, Brassica rapa, and strawberry.

[0057] In one embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

[0058] In another aspect, the present disclosure provides a gene-editing reagent, wherein the gene-editing reagent is capable of causing the generation of the mutant miR396 in soybean; the gene-editing reagent includes Cas12i and guide RNA (gRNA); the gRNA includes a support region for binding to Cas12i and a guide sequence for hybridization with a target sequence; and the gRNA targets miR396 in soybean.

[0059] In one embodiment, an amino acid sequence of Cas12i undergoes mutation at the 369th and 433rd amino acids relative to a sequence shown in SEQ ID No. 1.

[0060] In one embodiment, Cas12i is produced by mutation of a 369th amino acid at R and a 433rd amino acid at R based on the sequence shown in SEQ ID No. 1.

[0061] In one embodiment, the amino acid sequence of Cas12i undergoes mutations of the 7th, 233rd, 267th, 369th, and 433rd amino acids relative to the sequence shown in SEQ ID No. 1. Petition 870260079460, dated 07 / 08 / 2026, p. 13 / 51 10 / 45

[0062] In one embodiment, Cas12i is produced by mutation of a 7th amino acid in R, a 233rd amino acid in R, a 267th amino acid in R, a 369th amino acid in R, and a 433rd amino acid in R based on the sequence shown in SEQ ID No. 1.

[0063] In another aspect, the present disclosure provides a use of the mutant miR396, vector, host cell or gene editing reagent in the preparation of soybeans with improved seed size, seed weight, number of seeds per plant or yield; or in the preparation of a reagent or kit for producing soybeans with improved seed size, seed weight, number of seeds per plant or yield.

[0064] In another aspect, the present disclosure provides a method for producing soybeans with improved seed size, seed weight, number of seeds per plant, or yield, including the following steps: (a) introduction of the mutant miR396 into a soybean cell, a soybean seed, soybean tissue, or a soybean part; and (b) regenerating a soybean plant from a soybean cell, a soybean seed, soybean tissue, or a soybean part produced in step (a).

[0065] In one embodiment, improved seed size means that the seed size of the soybean carrying the miR396 mutant is at least 3%, preferably 5%, preferably 8%, preferably 10%, preferably 15%, preferably 20%, preferably 30%, preferably 40%, preferably 50%, preferably 60%, preferably 80% and preferably 100% larger than the seed size of the parental soybean (carrying miR396 WT).

[0066] In one embodiment, improved seed weight means that the weight of a single seed, the weight of one hundred seeds, or the weight of one thousand seeds of the soybean carrying the miR396 mutant is at least 5%, preferably 10%, preferably 12%, preferably 13%, preferably 15%, preferably 20%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, and preferably 100% greater than the weight of a single seed. Petition 870260079460, dated 07 / 08 / 2026, page 14 / 51 11 / 45 seed, the weight of one hundred seeds or the weight of one thousand seeds of the parental soybean (carrying miR396 WT).

[0067] In one embodiment, the enhanced number of seeds per plant means that a number of seeds per plant of soybean carrying the miR396 mutant is at least 3%, preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50% and preferably 100% greater than a number of seeds per plant of parental soybean (carrying miR396 WT).

[0068] In one embodiment, enhanced yield means that the yield, yield per plant or yield per mu of the miR396 mutant carrier soybean is at least 5%, preferably 10%, preferably 15%, preferably 20%, preferably 21%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, preferably 60% and preferably 100% higher than the yield, yield per plant or yield per mu of the parental soybean (miR396 WT carrier).

[0069] In one embodiment, the introduction of the mutant miR396 includes a mutation step of the endogenous miR396 from soybeans to introduce the mutant miR396.

[0070] In one embodiment, a mode of mutation introduction includes natural variation, physical mutagenesis (such as ultraviolet-induced mutagenesis, X-ray-induced mutagenesis, or Y-ray-induced mutagenesis), chemical mutagenesis (such as nitrous acid, hydroxylamine, ethyl methanesulfonate (EMS), and nitrosoguanidine), biological mutagenesis (such as virus- or bacteria-mediated mutagenesis), and gene editing.

[0071] In one embodiment, the mutant miR396 is introduced into the soybean cell, soybean seed, soybean tissue, or soybean part via gene editing.

[0072] In one embodiment, the method includes the following steps: (1) introduction of an expression vector with a gene editing tool into a soybean cell, a soybean seed, a soybean tissue or a soybean part; (2) allow the gene editing tool to act on endogenous miR396 in soybeans to induce a mutation; Petition 870260079460, dated 07 / 08 / 2026, p. 15 / 51 12 / 45 (3) select a mutant soybean cell, soybean seed, soybean tissue, soybean part or soybean grain; and (4) isolate the gene editing tool.

[0073] In one embodiment, the gene editing tool includes CRISPR, transcription activator-like effector nuclease (TALEN), and zinc finger nuclease (ZFN).

[0074] In one embodiment, the gene editing tool is Cas12i.

[0075] In one specific embodiment, gene editing is conducted with Cas12i in the soybean cell, soybean seed, soybean tissue, or soybean part.

[0076] In one embodiment, an amino acid sequence of Cas12i undergoes mutation at the 369th and 433rd amino acids relative to a sequence shown in SEQ ID No. 1.

[0077] In one embodiment, Cas12i is produced by a mutation of the 369th amino acid in R and the 433rd amino acid in R based on the sequence shown in SEQ ID No. 1.

[0078] In one embodiment, the amino acid sequence of Cas12i undergoes mutations of the 7th, 233rd, 267th, 369th, and 433rd amino acids relative to the sequence shown in SEQ ID No. 1.

[0079] In one embodiment, Cas12i is produced by mutation of a 7th amino acid in R, a 233rd amino acid in R, a 267th amino acid in R, a 369th amino acid in R, and a 433rd amino acid in R based on the sequence shown in SEQ ID No. 1.

[0080] In one embodiment, the Cas12i protein is bound to one or more nuclear localization signal (NLS) sequences. In one embodiment, the NLS sequence is bound to an N-terminus and / or a C-terminus of the protein.

[0081] In one embodiment, the introduction of the mutant miR396 includes a step to enable the mutant miR396 to be expressed in the soybean cell, soybean seed, soybean tissue, soybean part, or soybean.

[0082] In one embodiment, gene editing further includes a step of delivering Cas12i to the soybean cell, soybean seed, soybean tissue, soybean part, or soybean.

[0083] In another aspect, the present disclosure also provides a method for soybean gene editing, including the following steps: Petition 870260079460, dated 07 / 08 / 2026, p. 16 / 51 13 / 45 (a) perform gene editing with Cas12i and gRNA in a soybean cell, a soybean seed, a soybean tissue, or a soybean part to produce a gene-edited soybean cell, a soybean seed, a soybean tissue, or a soybean part, wherein the gRNA includes a support region for binding to Cas12i and a guide sequence for hybridization with a target sequence, and the gRNA targets miR396 in soybean; and (b) regenerate a soybean plant from the gene-edited soybean cell, soybean seed, soybean tissue, or soybean part obtained in step (a).

[0084] In one embodiment, an amino acid sequence of Cas12i undergoes mutation in the 369th and 433rd amino acids relative to a sequence shown in SEQ ID No. 1. Preferably, the 369th amino acid undergoes mutation to arginine (Arg, R), and the 433rd amino acid undergoes mutation to arginine (Arg, R).

[0085] In one embodiment, the amino acid sequence of Cas12i undergoes mutation in the 7th, 233rd, 267th, 369th, and 433rd amino acids relative to the sequence shown in SEQ ID No. 1. Preferably, the seventh amino acid is transformed into arginine (Arg, R), the 233rd amino acid is transformed into arginine (Arg, R), the 267th amino acid is transformed into arginine (Arg, R), the 369th amino acid is transformed into arginine (Arg, R), and the 433rd amino acid is transformed into arginine (Arg, R).

[0086] In a specific embodiment, Cas12i is mutant Cas12i (or optimized Cas12i), which is a mutant protein produced by mutations in the 369th and 433rd amino acids (both are transformed into R) or a mutant protein produced by mutations in the 7th, 233rd, 267th, 369th, and 433rd amino acids (all are transformed into R) based on SEQ ID No. 1. The mutant Cas12i protein exhibits significantly improved editing activity compared to the WT Cas12i shown in SEQ ID No. 1.

[0087] In one embodiment, the gRNA includes a first segment and a second segment. The first segment is also called the support region, protein-binding segment, protein-binding sequence, or direct repeat (DR). The second segment is also called the directed targeting sequence. Petition 870260079460, dated 07 / 08 / 2026, page 17 / 51 14 / 45 to nucleic acid, nucleic acid-directed targeting segment, or target sequence-directed targeting sequence.

[0088] The first segment, the support region, the protein-binding segment, the protein-binding sequence, or the gRNA DR can interact with the Cas12i protein of the present publication to produce a Cas12i protein-gRNA complex. The gRNA of the present publication directs the interacting Cas12i protein to a specific nucleotide sequence in a target nucleic acid under the action of the nucleic acid-directed targeting sequence.

[0089] The nucleic acid targeting sequence or nucleic acid targeting segment of the present disclosure includes a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the nucleic acid targeting sequence or nucleic acid targeting segment of the present disclosure can interact with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the nucleic acid targeting sequence or nucleic acid targeting segment can be altered or modified to hybridize with any desired sequence in the target nucleic acid.

[0090] Preferably, the gRNA includes a first segment and a second segment in a direction from the 5' terminal to the 3' terminal.

[0091] In this disclosure, the second segment can also be understood as a guide sequence for hybridization with a target sequence.

[0092] In a specific embodiment, a guide sequence directed to the gRNA target sequence is shown in any of the SEQ ID No. 8-11.

[0093] In a specific embodiment, the gRNA DR is shown in SEQ ID No. 12.

[0094] In other embodiments, the gRNA DR can also be produced by deleting, replacing, or adding a base based on SEQ ID No. 12, provided that the ability to bind to Cas12i can be guaranteed, such as agagaaugugugcauagucaacac, agagaaugugugcauagucuacacac, Petition 870260079460, dated 07 / 08 / 2026, p. 18 / 51 15 / 45 agagaaugugugcauaguccacac or agagaaugugugcauagucgacac registered in the Chinese patent application (CN113337502A).

[0095] In one embodiment, a nucleic acid sequence encoding the Cas12i protein and a nucleic acid encoding gRNA are artificially synthesized.

[0096] In one embodiment, the gene editing method of the present disclosure includes a delivery step of Cas12i and gRNA to the soybean cell, soybean seed, soybean tissue, soybean part, or soybean.

[0097] Release can be carried out by any method known in the art. This method includes, but is not limited to, transformation, transfection, electroporation, lipofection, microinjection, cell sonication, gene gun, calcium phosphate-mediated transfection, cationic transfection, lipofectin transfection, dendritic transfection, heat shock transfection, nucleofection, magnetofection, lipofection, puncture transfection, optical transfection, reagent-enhanced nucleic acid ingestion, and delivery via a liposome, an immunoliposome, a viral particle, a vector, a viral vector, an artificial virus, etc.

[0098] In some embodiments, one or more AAV vectors, lentiviral vectors, nanoparticles, or a combination thereof are used to deliver one or more components of Cas12i and gRNA.

[0099] In one embodiment, Cas12i and gRNA are delivered to the soybean cell, soybean seed, soybean tissue, soybean part, or soybean via Agrobacterium-mediated transformation.

[00100] The gRNA targets miR396 in the soybean cell and directs the Cas12i protein to target a specific genomic locus to modify, edit, or cleave a target sequence, thereby mutating miR396.

[00101] In one embodiment, the method includes a step of introducing the mutant miR396 into the soybean cell, soybean seed, soybean tissue, or soybean part.

[00102] In another aspect, the present disclosure also provides a method for producing soybeans with improved seed size, seed weight, number of seeds per plant, or yield, including a step of hybridizing a soybean seed or a soybean plant prepared by the method with another soybean variety to Petition 870260079460, dated 07 / 08 / 2026, p. 19 / 51 16 / 45 to produce soybeans with improved seed size, seed weight, number of seeds per plant, or yield. Terms and definitions

[00103] Unless defined otherwise, the technical and scientific terms used in this document have the same meanings commonly understood by those with common skill in the field.

[00104] The terms polynucleotide, nucleotide sequence, nucleic acid sequence, nucleic acid molecule, and nucleic acid may be used interchangeably and include DNA, RNA, or a hybrid thereof, which may be double-stranded or single-stranded.

[00105] The terms protein, polypeptide, and peptide may be used interchangeably in this disclosure and refer to a polymer of amino acid residues, including a polymer in which one or more amino acid residues are chemical analogues of a natural amino acid residue. The protein and polypeptide of this disclosure may be produced by recombination or chemical synthesis. The term mutant protein or mutated protein refers to a protein that is produced by the substitution, insertion, deletion, and / or addition of one or more amino acid residues based on an amino acid sequence of an original protein.

[00106] The term amino acid refers to a carboxylic acid containing an amino acid. Each of the various proteins in organisms is composed of 20 essential amino acids.

[00107] The term encoding refers to an inherent characteristic of a specific nucleotide sequence in a polynucleotide, such as a cDNA or mRNA gene, that serves as a template for the synthesis of a defined nucleotide sequence (namely, rRNA, tRNA, and mRNA) or a defined amino acid sequence and the synthesis of other polymers and macromolecules in a biological process of a biological characteristic. Therefore, if the transcription and translation of the mRNA corresponding to a gene produce a protein in a cell or other biological system, the gene encodes the protein. Petition 870260079460, dated 07 / 08 / 2026, p. 20 / 51 17 / 45

[00108] As used in this document, the term identity refers to the sequence correspondence between two polypeptides or between two nucleic acids. When specified positions in two sequences to be compared are occupied by the same base or amino acid monomer subunit (for example, a specified position in each of the two DNA molecules is occupied by adenine, or a specified position in each of the two polypeptides is occupied by lysine), the molecules are positionally identical. The percentage of identity between two sequences is a function of the number of corresponding positions shared by the two sequences / number of positions compared χ² 100. For example, if 6 out of 10 positions in one of the two sequences correspond to corresponding positions in the other of the two sequences, then the two sequences have a 60% identity. For example, the DNA sequences CTGACT and CAGGTT have a 50% identity (3 out of 6 positions are corresponding).In general, the comparison is conducted by aligning two sequences to produce maximum identity. This alignment can be achieved using, for example, a method by Needleman et al. (1970) J. Mol. Biol. 48: 443-453, which can be conveniently implemented by a computer program, such as the Align program (DNAstar, Inc.). The percentage of identity between two amino acid sequences can also be determined using an algorithm by E. Meyers and W. Miller (Comput. Appl Biosci, 4: 11-17 (1988)) integrated into the ALIGN program (version 2.0), a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percentage of identity between two amino acid sequences can be determined using an algorithm by Needleman and Wunsch (J MoI Biol. 48: 444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.(com), a Blossum 62 matrix or a PAM250 matrix, a gap weight of 16, 14, 12, 10, 8, 6 or 4 and a length weight of 1, 2, 3, 4, 5 or 6.

[00109] As used in this document, the term regulatory element, also known as regulatory element, is intended to include a promoter, a termination sequence, a leader sequence, a polyadenylation sequence, a signal peptide coding region, a marker gene, an enhancer, a Petition 870260079460, dated 07 / 08 / 2026, page 21 / 51 18 / 45 internal ribosome entry site (IRES) and other expression control elements (e.g., a transcriptional termination signal, such as a polyadenylation signal and a poly-U sequence), and a detailed description can be found in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY' 185, Academic Press, San Diego, California (1990). In some cases, a regulatory element includes sequences that direct the constitutive expression of a nucleotide sequence in many types of host cells and sequences that direct the expression of the nucleotide sequence only in some host cells (such as a tissue-specific regulatory sequence). A tissue-specific promoter may primarily direct expression in a desired tissue of interest, such as muscles, neurons, bones, skin, blood, specific organs (such as liver and pancreas), or specific cell types (such as lymphocytes).In some cases, a regulatory element may also direct expression in a time-dependent manner (such as in a cell cycle- or developmental stage-dependent manner), which may or may not be tissue- or cell-type-specific. In some cases, the term regulatory element encompasses enhancer elements, such as WPRE; CMV enhancer; R-U5' fragment in HTLV-I LTR (Mol. Cell. Biol., Vol 8 (1): 466-472, 1988); SV40 enhancer; and an intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78 (3): 1527-31, 1981).

[00110] As used in this document, the term promoter has the meaning well known to experts in the field and refers to a non-coding nucleotide sequence that is located upstream of a gene and can promote the expression of a downstream gene.A constitutive promoter is a nucleotide sequence that will result in the generation of a gene product in a cell under most or all physiological conditions of the cell after the promoter is operationally linked to a polynucleotide that encodes or defines the gene product. An inducible promoter is a nucleotide sequence that will cause the generation of a gene product in a cell only when there is a corresponding inducer in the cell after the promoter is operationally linked to a polynucleotide that encodes or defines the gene product. A tissue-specific promoter is a sequence of... Petition 870260079460, dated 07 / 08 / 2026, page 22 / 51 19 / 45 nucleotides that will cause the generation of a gene product in a cell basically only when the cell is a tissue type cell corresponding to the promoter after the promoter is operationally linked to a polynucleotide that encodes or defines the gene product.

[00111] The term nuclear localization signal or nuclear localization sequence (NLS) is an amino acid sequence that marks a protein for import into a nucleus via nuclear transport; that is, a protein with an NLS is transported into a nucleus. Typically, the NLS includes positively charged Lys or Arg residues that are exposed on a protein surface. Examples of NLS include, among others, the SV40 large T antigen, EGL-13, c-Myc, and the TUS protein.

[00112] As used in this document, the term operationally linked means that a nucleotide sequence of interest is linked to one or more regulatory elements in a way that allows expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). WT

[00113] As used in this document, the term WT has the meaning commonly understood by experts in the field and indicates a typical form of an organism, a strain or a gene, or a characteristic to distinguish the organism, strain or gene in nature from a mutant or variant form thereof, which can be isolated from a natural source and is not intentionally modified artificially. Vector

[00114] The term vector refers to a nucleic acid that can release another nucleic acid attached to it. A vector includes, among others, a single-stranded, double-stranded, or partially double-stranded nucleic acid; a nucleic acid with one or more free ends or without free ends (such as circular); DNA, RNA, or a nucleic acid of both; and other miscellaneous polynucleotides known in the art. A vector can be introduced into a host cell by transformation, transduction, or transfection, so that an element of genetic material carried by the vector can be expressed in the host cell. A vector can be introduced into a cell Petition 870260079460, dated 07 / 08 / 2026, page 23 / 51 20 / 45 host to produce a transcript, a protein, or a peptide, including the protein, fusion protein, isolated nucleic acid, etc. (e.g., a CRISPR transcript, such as a nucleic acid transcript, a protein, or an enzyme) described in this document. A vector may include a variety of elements to control expression, including, but not limited to, a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selection element, and a reporter gene. A vector may also include an origin of replication.

[00115] One type of vector is the plasmid, which refers to a circular loop of double-stranded DNA into which an additional fragment of DNA can be inserted, for example, by a standard molecular cloning technique.

[00116] Another type of vector is the viral vector, in which a DNA or RNA sequence derived from a virus is present in a vector to package a virus (such as a retrovirus, a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and AAV). A viral vector also includes a polynucleotide carried by a virus for transfection into a host cell. Some vectors (e.g., bacterial vectors with bacterial origins of replication and mammalian episomal vectors) can replicate autonomously in a host cell into which these vectors are introduced.

[00117] Other vectors (such as non-episomal mammalian vectors) will be integrated into a host cell genome after being introduced into the host cell and will therefore be replicated with the host cell genome. In addition, some vectors can direct the expression of genes operationally linked to them. These vectors are referred to here as expression vectors. Host cell

[00118] As used in this document, the term host cell refers to a cell that can be introduced with a vector, including, but not limited to, a prokaryotic cell, such as Escherichia coli or Bacillus subtilis, and a eukaryotic cell, such as a microbial cell, a fungal cell, an animal cell, and a plant cell. Petition 870260079460, dated 07 / 08 / 2026, page 24 / 51 21 / 45

[00119] Experts in the field will understand that the design of an expression vector may depend on factors such as the selection of a host cell to be transformed and a desired level of expression. Animal

[00120] For example, the animal may be a mammal, such as bovine, equine, ovine, swine, canine, feline, leporid, rodent (such as mouse or rat), non-human primate (such as monkey or cynomolgus ape) or human. In some modalities, the subject (such as a human being) suffers from a disorder (such as a disorder caused by a genetic defect associated with a disease). Plant

[00121] The term plant should be understood as any differentiated multicellular organism capable of performing photosynthesis, including: any cultivated plant at a mature or developmental stage, especially monocotyledonous or dicotyledonous plants;Vegetable crops, including artichoke, turnip, arugula, leek, asparagus, lettuce (such as iceberg lettuce, romaine lettuce, and curly lettuce), bok choy, malanga, melons (such as cantaloupe melon, watermelon, crenshaw melon, honeydew melon, and cantaloupe melon), rapeseed crops (such as Brussels sprouts, cabbage, cauliflower, broccoli, borecole, kale, Chinese cabbage, and bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpea, parsnip, chicory, bell pepper, potato, gourd (such as pumpkin, cucumber, zucchini, squash, and squash), radish, dried onion, rutabaga, purple eggplant (also known as eggplant), salsify, lettuce, shallot, endive, garlic, spinach, green onion, cushaw, leafy greens, Beta vulgaris (sugar beet and beetroot). forage grass), sweet potato, chard, wasabi, tomato, turnip and spices;Fruits and / or vines, such as apple, apricot, cherry, nectarine, peach, pear, plum, prune, cherry, quince, almond, chestnut, hazelnut, pecan, pistachio, walnut, citrus fruits, blueberry, blackberry, mulberry, currant, wild blackberry, raspberry, strawberry, blackberry, grape, avocado, banana, kiwi, persimmon, pomegranate, pineapple, tropical fruits, pome, melon, mango, papaya and lychee; field crops, such as clover, Medicago, evening primrose, meadow foam, maize / corn (forage maize, sweet maize and popcorn), hops, jojoba, peanut, rice, safflower, small grain crops (barley, oats, rye, wheat, etc.), sorghum, tobacco; Petition 870260079460, dated 07 / 08 / 2026, page 25 / 51 22 / 45 tobacco, etc.), sorghum, tobacco, kapok, Fabaceae plants (beans, lentils, peas and soybeans), oilseed plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor bean, cocoa and peanut), Arabidopsis, fibrous plants (cotton, flax, hemp and jute), Lauraceae (cinnamon and camphor) or a plant such as coffee, sugar cane, tea and natural rubber plants; and / or bedding plants, such as a flowering plant, a cactus, a succulent plant and / or an ornamental plant, and trees, such as forests (broad-leaved and evergreen trees, such as conifers), fruit trees, ornamental trees, nut trees, shrubs and other seedlings.

[00122] The term plant tissue or plant part includes a plant cell, a protoplast, a plant tissue culture, a plant callus, a piece of plant, a plant embryo, pollen, an ovule, a seed, a leaf, a stem, a flower, a branch, a seedling, a fruit, a pit, an ear of corn, a root, a root tip, an anther, etc.

[00123] The term plant cell should be understood as any cell derived from or found in a plant and can produce, for example, undifferentiated tissues such as calluses, differentiated tissues such as embryos, constituent parts of a plant, plants or seeds. Gene editing

[00124] Gene editing technology includes CRISPR technology, TALEN technology, and ZFN technology. CRISPR technology refers to clustered regularly spaced short palindromic repeats originating from the immune system of microorganisms. A gene editing tool includes gRNA and a Cas protein (such as Cas9, Cpf1, Cas12b, and Cas12i). A TALEN gene editing tool refers to a restriction enzyme capable of cleaving a specific DNA sequence, which includes a TAL effector DNA binding domain and a DNA cleavage domain. A ZFN gene editing tool refers to a restriction enzyme capable of cleaving a specific DNA sequence, which includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to experts in the field that an intracellular genome can be edited by constructing nucleotides that encode a gene editing tool and other elements. Petition 870260079460, dated 07 / 08 / 2026, page 26 / 51 23 / 45 regulators in a suitable vector and then by transforming the vector into a cell, where one type of editing includes gene knockout, insertion, and base editing. CRISPR System

[00125] As used in this document, the terms CRISPR-Cas system and CRISPR system may be used interchangeably and have the meaning commonly understood by experts in the field. The CRISPR-Cas system or the CRISPR system generally includes a transcription product or other elements related to the expression of a Cas gene, or a transcription product or other elements capable of directing the activity of the Cas gene. Cas Protein

[00126] A Cas protein or CRISPR-associated protein refers to a nuclease suitable for a CRISPR system. Preferably, the Cas protein is a CRISPR enzyme, including, but not limited to: a Cas9 protein, a Cas12 protein, a Cas13 protein, a Cas14 protein, a Csm1 protein, and an FDK1 protein. Cas proteins can exhibit varied structures depending on their origins, such as SpCas9 derived from Streptococcus pyogenes and SaCas9 derived from Staphylococcus aureus. Cas proteins can also be classified based on structural characteristics (such as domains). For example, the Cas12 family may include Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12i, etc. The Cas protein may be double-stranded or single-stranded, or it may lack cleavage activity. The Cas protein of this disclosure may be WT or a mutant thereof. A mutant type of mutation may include amino acid substitution, replacement, or deletion.The mutant may or may not alter the enzymatic cleavage activity of the Cas protein. Experts in the field know that a variety of Cas proteins with nucleic acid cleavage activities have been reported in the literature. All known proteins or their modified variants may perform the function of the present disclosure, which is incorporated into the scope of protection of the present disclosure by reference.

[00127] It is clear to experts in the field that the structure of a protein can be altered without negatively affecting the protein's activity and functionality. Petition 870260079460, dated 07 / 08 / 2026, p. 27 / 51 24 / 45 For example, one or more conservative amino acid substitutions can be introduced into a protein's amino acid sequence without negatively affecting the activity and / or three-dimensional structure of the protein molecule. Experts in the field are familiar with examples and implementations of conservative amino acid substitutions. Specifically, an amino acid residue can be replaced by another amino acid residue that belongs to the same group as the amino acid residue being replaced. That is, a nonpolar amino acid residue can be replaced by another nonpolar amino acid residue; an uncharged polar amino acid residue can be replaced by another uncharged polar amino acid residue; a basic amino acid residue can be replaced by another basic amino acid residue; and an acidic amino acid residue can be replaced by another acidic amino acid residue.These substituted amino acid residues may or may not be encoded by genetic codes. Provided that the substitution does not result in loss of the biological activity of a protein, a conservative substitution in which one amino acid is replaced by another amino acid belonging to the same group falls within the scope of this disclosure. Therefore, an amino acid sequence of the protein of this disclosure may include one or more conservative substitutions, and these conservative substitutions may preferably be generated according to Table 1. In addition, this disclosure covers a protein with one or more non-conservative substitutions, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of this disclosure.

[00128] Conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues. Non-essential amino acid residues are amino acid residues that can be altered (deleted or replaced) without altering biological activity, while essential amino acid residues are required for biological activity. A conservative amino acid substitution refers to a substitution in which an amino acid residue is replaced by an amino acid residue with a similar side chain. An amino acid substitution can be made at a non-essential region. Petition 870260079460, dated 07 / 08 / 2026, p. 28 / 51 25 / 45 conservative mutant Cas protein. In general, this substitution is not made at a conservative amino acid residue or at an amino acid residue located in a conservative motif because that residue is necessary for the protein's activity. However, experts in the field should understand that a functional variant may have few conservative or non-conservative variations in conservative regions.

[00129] Table 1 Initial Residue Representative Substitution Substitution Ala(A) Val; Leu; Ile Val Arg(R) Lys;Gln;Asn Lys Asn(N) Gln;His;Lys;Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro;Ala Ala His(H) Asn;Gln;Lys;Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile;Val;Met;Ala;Phe Ile Lys(K) Arg;Gln;Asn Arg Met(M) Leu;Phe;Ile Leu Phe(F) Leu;Val;Ile;Ala;Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr;Phe Tyr Tyr(Y) Trp;Phe;Thr;Ser Phe Val(V) Ile;Leu;Met;Phe;Ala Leu

[00130] It is well known in the art that one or more amino acid residues can be altered (substituted, deleted, truncated, or inserted) at an N-terminus and / or C-terminus of a protein with the functional activity of the protein still maintained. Therefore, a protein produced by altering one or more amino acid residues at an N-terminus and / or C-terminus of the Cas protein, while maintaining the desired functional activity, also falls within the scope of this disclosure. This change may include a change introduced by a modern molecular method, such as polymerase chain reaction (PCR), and the method includes PCR amplification that alters or extends a protein coding sequence by introducing a sequence Petition 870260079460, dated 07 / 08 / 2026, p. 29 / 51 26 / 45 amino acid coding in an oligonucleotide used for PCR amplification.

[00131] It should be recognized that a protein can be altered in various ways, including substitution, deletion, truncation, and insertion of amino acids, and the methods for these operations are generally known in the art. For example, variants of the protein's amino acid sequence can be prepared through DNA mutations. They can also be achieved through other forms of mutagenesis and / or through directed evolution. For example, known methods of mutagenesis, recombination, and / or shuffling can be used in combination with the related screening method to achieve the substitution, deletion, and / or insertion of one or more amino acids.

[00132] Subject matter experts may understand that these small amino acid changes in the Cas protein of the present disclosure may be naturally occurring (e.g., natural mutations) or may be induced (e.g., using r-DNA technology) without affecting the protein’s function or activity. If these mutations occur in a catalytic domain, an active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations present are not near a catalytic domain, an active site, or other functional domains, minimal impact can be expected.

[00133] Experts in the field can identify the essential amino acids of the mutant Cas protein of the present disclosure according to a method known in the field, such as site-directed mutagenesis, protein evolution, or bioinformatics analysis. The catalytic domain, the active site, or other functional domains of the protein can also be determined by physical analysis of a structure. For example, it can be determined by a technique such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling in combination with a putative amino acid mutation at a key site.

[00134] In this disclosure, an amino acid residue may be represented by a single letter or three letters, such as alanine (Ala, A), valine (Val, V), glycine (Gly, G), Petition 870260079460, dated 07 / 08 / 2026, page 30 / 51 27 / 45 leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H) and arginine (Arg, R).

[00135] The term AxxB means that an amino acid A at position xx is transformed into an amino acid B, that is, the amino acid A at position xx of an N-terminus is transformed into amino acid B, unless otherwise specified. For example, N369R indicates that the N at position 369 is transformed into R. When there are simultaneous mutations at a plurality of amino acid sites, the mutations can be expressed in a form such as N369R, S433R, or N369R / S433R. For example, N369R and S433R mean that the 369th N mutates to R and the 433rd N mutates to R.

[00136] A specific amino acid position (number) in the protein of this disclosure is determined by aligning an amino acid sequence of the target protein with SEQ ID No. 1 using a standard sequence alignment tool. For example, the Smith-Waterman algorithm or the CLUSTALW2 algorithm is used to align two sequences, and the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. In the ClustalW2(1.82) algorithm, the standard parameters are preferably adopted: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; final protein / DNA gap = -1; and protein / DNAGAPDIST = 4. The AlignX program (part of the vectorNTI group) can preferably be used to align an amino acid sequence of the protein from this disclosure with SEQ ID No. 1 under appropriate standard parameters for multiple alignment (gap opening penalty: 10; and gap extension penalty: 0.05) to determine the position of a specific amino acid in the protein. Petition 870260079460, dated 07 / 08 / 2026, page 31 / 51 28 / 45

[00137] Experts in the field can use common software in the field, such as Clustal Omega, to compare and align an amino acid sequence of any parental Cas protein with SEQ ID No. 1 to obtain sequence identity, in order to obtain an amino acid site in the parental Cas protein that corresponds to an amino acid site defined based on SEQ ID No. 1 in this application.

[00138] A biological function of the Cas protein includes, among others, gRNA binding activity, endonuclease activity, and binding activity to a specific site of a target sequence and cleavage of the target sequence under gRNA guidance, including, among others, Cis cleavage activity and Trans cleavage activity.

[00139] In this disclosure, the mutant Cas protein may also be referred to as the mutated Cas protein, optimized Cas protein, or variant Cas protein. gRNA

[00140] As used in this document, the terms gRNA, mature crRNA, and guide sequence may be used interchangeably and have the meaning commonly understood by experts in the field. In general, gRNA may include DR and a guide sequence, or is essentially composed of, or is composed of, DR and a guide sequence.

[00141] In some cases, the guide sequence can be any polynucleotide sequence that exhibits sufficient complementarity with a target sequence to hybridize with the target sequence and guide the specific binding of a CRISPR / Cas complex to the target sequence. In one embodiment, under optimal alignment, a degree of complementarity between a guide sequence and a corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the competence of people with common knowledge in the field. For example, there are commercially available published alignment algorithms and programs, including, among others, Smith-Waterman, Bowtie, Geneious, Biopython, and SeqMan in ClustalW and Matlab. Target sequence Petition 870260079460, dated 07 / 08 / 2026, p. 32 / 51 29 / 45

[00142] A target sequence refers to a polynucleotide directed by a guide sequence in gRNA, as a sequence complementary to the guide sequence. Hybridization between a target sequence and a guide sequence will promote the generation of a CRISPR / Cas complex (including a Cas protein and gRNA). Complete complementarity is not required, as long as there is sufficient complementarity to cause hybridization and promote the generation of a CRISPR / Cas complex.

[00143] A target sequence can include any polynucleotide, such as DNA or RNA. In some cases, a target sequence is located inside or outside a cell. In some cases, a target sequence is located in the nucleus or cytoplasm of a cell. In some cases, a target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or a chloroplast. A sequence or template that can be recombined at a target gene locus with a target sequence is called an editing template, editing polynucleotide, or editing sequence. In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, recombination refers to homologous recombination.

[00144] In the present disclosure, the target sequence, target polynucleotide, or target nucleic acid can be any polynucleotide endogenous or exogenous to a cell (such as a eukaryotic cell). For example, the target polynucleotide could be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide could be a sequence that codes for a gene product (such as a protein) or a non-coding sequence (such as a regulatory polynucleotide or junk DNA). In some cases, the target sequence must be related to a protospacer adjacent motif (PAM). miR396

[00145] miR396 is a highly conserved endogenous small single-stranded non-coding RNA molecule, 20 to 24 nucleotides in length. The plant miR396 family undergoes minimal sequence variation over long-term biological evolution and is highly conserved. miR396 can bind to GRF mRNA for a target gene via base pairing to regulate GRF expression, thereby affecting the growth and development of various plant organs. Petition 870260079460, dated 07 / 08 / 2026, p. 33 / 51 30 / 45

[00146] Several miR396s (miR396a / b / c / d / e / f / g / h / i / j / k) have been found in soybeans. These miR396s are identified from sequencing data. The functions of these miR396s have not been verified by related studies.

[00147] In one embodiment, a miR396a sequence from soybean is shown in SEQ ID No. 2, a miR396b sequence from soybean is shown in SEQ ID No. 3, a miR396c sequence from soybean is shown in SEQ ID No. 4, a miR396d sequence from soybean is shown in SEQ ID No. 5, a miR396f sequence from soybean is shown in SEQ ID No. 6, and a miR396i sequence from soybean is shown in SEQ ID No. 7.

[00148] The sequences involved in this disclosure are as follows.

[00149] Table 2 Sequence Number (Identification Number SEQ) Sequence Description 1 Amino acid sequence of WT Cas12i 2 Nucleotide sequence of GmmiR396a 3 Nucleotide sequence of GmmiR396b 4 Nucleotide sequence of GmmiR396c 5 Nucleotide sequence of GmmiR396d 6 Nucleotide sequence of GmmiR396f 7 Nucleotide sequence of GmmiR396i 8 Guide sequence 1 of gRNA 9 Guide sequence 2 of gRNA 10 Guide sequence 3 of gRNA 11 Guide sequence 4 of gRNA 12 DR sequence of gRNA Main advantages of this disclosure:

[00150] In this disclosure, miR396 is subjected to targeted editing using Cas12i gene editing technology. It was found that when miR396a, miR396b, miR396c, miR396d, miR396f, or miR396i in soybeans undergo a base mutation, the soybeans have improved seed size and yield. DESCRIPTION OF THE DRAWINGS

[00151] FIG. 1 shows the validation of the editing efficiencies of Cas12i proteins, with 1 being for Cas12i WT and 2 being for a Cas12i protein with a combined mutation of N369R and S433R. Petition 870260079460, dated 07 / 08 / 2026, p. 34 / 51 31 / 45

[00152] FIG. 2 shows the comparison of seed sizes between an edited acdf plant and WT soybean (Zhonghuang 302, WT) in part A, the comparison of seed sizes between an edited abcdf plant and WT soybean (Zhonghuang 302, WT) in part B, the comparison of seed sizes between an edited acd plant and WT soybean (Zhonghuang 302, ZH302) in part C, and the comparison of seed sizes between an edited cdf plant and WT soybean (Zhonghuang 302, ZH302) in part D.

[00153] FIG. 3 shows the comparison of the length of the seeds of an edited acd plant and an edited cdf plant with WT soybean (Zhonghuang 302, ZH302) in part A, the comparison of the width of the seeds of an edited acd plant and an edited cdf plant with WT soybean (Zhonghuang 302, ZH302) in part B, and the comparison of the thickness of the seeds of an edited acd plant and an edited cdf plant with WT soybean (Zhonghuang 302, ZH302) in part C.

[00154] FIG. 4 shows the comparison of seed sizes between an edited aci plant and WT soybean (Zhonghuang 302, ZH302) in part A, the comparison of seed sizes between an edited adf plant and WT soybean (Zhonghuang 302, ZH302) in part B, the comparison of seed sizes between an edited acbd plant and WT soybean (Zhonghuang 302, ZH302) in part C, the comparison of seed sizes between an edited acfi plant and WT soybean (Zhonghuang 302, ZH302) in part D, and the comparison of seed sizes between an edited bcdfi plant and WT soybean (Zhonghuang 302, ZH302) in part E.

[00155] FIG. 5 shows the comparison of seed lengths of edited plants aci, adf, abcd, acfi and bcdfi with WT soybean (Zhonghuang 302, ZH302) in part A, the comparison of seed widths of edited plants aci, adf, abcd, acfi and bcdfi with WT soybean (Zhonghuang 302, ZH302) in part B, and the comparison of seed thicknesses of edited plants aci, adf, abcd, acfi and bcdfi with WT soybean (Zhonghuang 302, ZH302) in part C. SPECIFIC IMPLEMENTATIONS

[00156] The present disclosure will be explained in more detail below along with an example. The following example is only a preferred example of Petition 870260079460, dated 07 / 08 / 2026, p. 35 / 51 32 / 45 present disclosure and is not intended to limit this disclosure in other forms. Any technical team familiar with the profession may use the technical content disclosed above to derive equivalent examples through equivalent modifications. Any simple modification or equivalent alteration made to the following example, in accordance with the technical essence of this disclosure, without departing from the content of the solutions in this disclosure, shall fall within the scope of protection of this disclosure. Example 1: Acquisition of Cas12i mutant proteins (N369R and S433R) and Cas12i (S7R, D233R, D267R, N369R and S433R) and validation of their editing activities.

[00157] Candidates performed site-directed mutagenesis on potential Cas12i3 amino acids for binding to a target sequence using a bioinformatics method. An amino acid sequence of WT Cas12i was shown in SEQ ID No. 1. A method for site-directed mutagenesis was a common method in the technique. In this example, Cas protein variants were produced via PCR-based site-directed mutagenesis. A specific method was as follows: A DNA sequence for the Cas12i3 protein was designed as two parts with a mutation site as the center, and two primer pairs were designed to amplify the two parts of the DNA sequence, respectively. A sequence to be mutated was introduced into the primers. Finally, two amplified fragments were loaded into a pcDNA3.3-eGFP vector via Gibson cloning.A combination of mutations was constructed by splitting the Cas12i3 protein DNA into a plurality of fragments and then performing PCR and Gibson cloning. A fragment amplification kit was the Trans Start Fast Pfu DNA Polymerase (including 2.5 mM dNTPs), and a specific experimental procedure is detailed in the instructions. A gel retrieval kit was the FastPure® Gel DNA Extraction Mini Kit, and a specific experimental procedure is detailed in the instructions. A kit for vector construction was the pEASY-Basic Seamless Cloning and Assembly Kit (CU201-03), and a specific experimental procedure is detailed in the instructions. The mutant amino acid sites involved in this example and the primer sequences adopted accordingly are listed in the table below. Petition 870260079460, dated 07 / 08 / 2026, page 36 / 51 33 / 45

[00158] Table 3 Primer Name Primer Sequence Amino Acid Mutation Type (N-terminal amino acid site in SEQ ID No. 1) 13-H6-F CGGCIIIAACAGGAAGTACAACGTGGTCGCCGAGCT GTACAA N369R 13-H6-R TTGTACTTCCTGTTAAAGCCGATGTGCTGGCTTGATC 13-H9-F CGGIIIAACCAGCGGGAGGAGAAGCTGCTGCGGATC S433R 13-H9-R TCCTCCCGCTGGTTAAACCGGGCCACCCTGCCCCCC

[00159] In this example, a Cas12i mutant protein with both mutations N369R and S433R were produced via site-directed mutagenesis. Compared to SEQ ID No. 1, in an amino acid sequence of the mutant protein, the N at position 369 was transformed into R and the S at position 433 was transformed into R.

[00160] To verify the gene-editing activity of the Cas12i mutant protein in an animal cell, the following target was designed for the FUT8 gene in Chinese hamster ovary (CHO) cells: FUT8-Cas-XX-g3: TTC CAGCCAAGGTTGTGGACGGATCA, wherein an italicized region was a PAM sequence and an underlined region was a targeting region. A pcDNA3 vector was modified to carry an enhanced green fluorescent protein (EGFP) and a PuroR resistance gene. An SV40 NLS-Cas-XX fusion protein was inserted via XbaI and PstI enzymatic cleavage sites, and a U6 promoter and gRNA sequence were inserted via an Mfe1 enzymatic cleavage site. A CMV promoter was used to initiate the expression of an SV40 NLS-Cas-XX-NLS-GFP fusion protein. A Cas-XX-NLS protein was linked to a green fluorescent protein (GFP) via a T2A linker peptide.An EF-Iα promoter was used to initiate the expression of a puromycin resistance gene. Plating: When grown to 70%–80% confluence, CHO cells were collected and inoculated into a 12-well plate at 8 * 10Λ4 cells / well. Transfection: 24 hours after plating, a. Petition 870260079460, dated 07 / 08 / 2026, page 37 / 51 Transfection 34 / 45 was performed as follows: 6.25 μL of a Hieff Trans™ liposomal nucleic acid transfection reagent was added to 100 μL of opti-MEM, and thorough mixing was performed. 2.5 μg of a plasmid was added to 100 μL of opti-MEM, and thorough mixing was performed. A diluted Hieff Trans™ liposomal nucleic acid transfection reagent was thoroughly mixed with a diluted plasmid, and incubation was conducted at room temperature for 20 minutes. A mixed solution produced after incubation was added to a cell-containing medium for transfection. Puromycin addition for screening: After transfection was performed for 24 hours, puromycin was added at a final concentration of 10 μg / mL. After treatment with puromycin was conducted for 24 hours, the culture was carried out for another 24 hours in a normal medium.

[00161] DNA was extracted, and a region near an editing region was amplified by PCR and sent for hiTOM sequencing: Cells were digested with trypsin, then collected and subjected to genomic DNA extraction by a cell / tissue genomic DNA extraction kit (Bioteke). A region near a target in the genomic DNA was amplified. A PCR product was subjected to hiTOM sequencing. Sequencing data analysis: The types and proportions of sequences within a 15 nt range upstream and 10 nt downstream of a target were counted, and sequences with a single nucleotide variant (SNV) frequency greater than or equal to 1% or a non-SNV mutation frequency greater than or equal to 0.06% among sequences were counted to obtain Cas-XX protein editing efficiencies for the target.A target sequence for the FUT8 gene in CHO cells was as follows: FUT8Cas-XX-g3: TTCCAGCCAAGGTTGTGGACGGGATCA, where an italicized region was a PAM sequence and an underlined region was a target region. The gRNA sequence was as follows: AGAGAAUGUGUGCAUAGUCAaCACCAGCCAAGGUUGUGGACGGAUCA, where an underlined region was a targeting region and the remaining region was a DR region.

[00162] The results were shown in FIG. 1. Compared to the Cas12i WT protein, the Cas12i protein with the combined N369R / S433R mutation demonstrated Petition 870260079460, dated 07 / 08 / 2026, p. 38 / 51 35 / 45 a significantly improved editing efficiency, which was almost twice the editing efficiency of the Cas12i WT protein. The editing types for the target gene included a base deletion, a base insertion, a base replacement, etc.

[00163] The acquisition and validation of the editing activity of the mutant Cas12i protein (S7R, D233R, D267R, N369R and S433R) were carried out with reference to Chinese patent application CN116004573A. In comparison with SEQ ID No. 1, in an amino acid sequence of the Cas12i mutant protein (S7R, D233R, D267R, N369R, and S433R), S at position 7 was transformed into R, D at position 233 was transformed into R, D at position 267 was transformed into R, N at position 369 was transformed into R, and S at position 433 was transformed into R. The Cas12i mutant protein (S7R, D233R, D267R, N369R, and S433R) showed significantly higher editing efficiency than the WT Cas12i protein. Example 2: Production of large seeds and high-yielding soybeans using a Cas12i-based CRISPR gene-editing technology (N369R and S433R) 1. Construction of a gene editing vector

[00164] The soybean genome includes 9 miR396 genes (miR396a / b / c / d / e / f / h / i / j). Sequence analysis shows that miR396a and miR396i have similar sequences, and miR396b, miR396c, miR396d, and miR396f have similar sequences. The members of the soybean miR396 family (GmmiR396), miR396a, miR396b, miR396c, miR396d, miR396f, and miR396i, have nucleotide sequences shown in SEQ ID No. 2-7, respectively.

[00165] The GmmiR396 sequences from soybean were selected to design gRNAs. The guide sequences for the designed gRNAs were as follows.

[00166] Table 4 gRNA Sequence (5'-3') PAM(5'-3') Target gene gRNAI GGATGCAGTTCAAGAAAGCTGTGGG (SEQ ID No. 8) III GmmiR396a (GmmiR396i cannot be targeted) Petition 870260079460, dated 07 / 08 / 2026, pp. 39 / 51 36 / 45 gRNA2 AGAAGTTCAAGAAAGCTGTGG(SEQ ID No. 9) ATA GmmiR396b / c / d / f

[00167] DR for the gRNAs above was agagaaugugugcauagucacac (5' to 3', SEQ ID No. 12). Each of the gRNAs included the DR and a respective guide sequence sequentially from 5' to 3'.

[00168] The annealing primers were designed based on the target. After primer annealing, the gene-editing backbone vector was assembled via T5 exonuclease-mediated homologous recombination. The gene-editing vector contained a Cas12i protein (N369R and S433R) and gRNA. 2. Acquisition of a recombinant strain 1) Transformation into Escherichia coli

[00169] The gene-editing vector obtained in step 1 was transformed into Escherichia coli, and the transformed Escherichia coli was subjected to bacterial solution PCR. An amplification product with a correct PCR band size was selected for sequencing. The Escherichia coli with a correct sequencing result was a recombinant Escherichia coli strain carrying the gene-editing vector. 2) Transformation into Agrobacterium

[00170] The recombinant Escherichia coli strain carrying the gene-editing vector obtained in step 1) was cultured. Then, the plasmid DNA was extracted, added to competent Agrobacterium cells, and placed in an ice bath for 5 minutes, in liquid nitrogen for 5 minutes, in a water bath at 37 °C for 5 minutes, and in ice for 5 minutes.

[00171] A centrifuge tube was removed, 700 μL of a medium (without antibiotic) was added and the shake culture was conducted at 28°C for 2 h 4 h.

[00172] A resulting bacterial solution was collected and coated onto a medium plate, including a corresponding antibiotic, and cultured in an inverted manner in an incubator. After approximately 2 days of culture, colonies could be observed. The colonies were subjected to PCR according to the method in step 1). A product of Petition 870260079460, dated 07 / 08 / 2026, pages 40 / 51 Amplification 37 / 45 was sequenced. The Agrobacterium with a correct sequencing result was a recombinant Agrobacterium strain carrying the gene editing vector. 3. Genetic transformation of plants 1) Sterilization of soybean seeds

[00173] Selected soybean seeds (Zhonghuang 302) were placed in a Petri dish in a dryer, 10 ml of concentrated hydrochloric acid were slowly added along one wall to a beaker containing 150 ml of sodium hypochlorite in the dryer, and the dryer lid was quickly closed. Sterilization was conducted for 16 hours with a chlorine gas generated from the sodium hypochlorite and concentrated hydrochloric acid. 2) Seed germination

[00174] The sterilized seeds obtained in step 1) were placed in a medium with the hilum facing down and incubated for 24 hours at 22°C in the dark. 3) Preparation of an Agrobacterium suspension

[00175] A bacterial solution stored in a freezer at -80°C was removed, seeded onto a YEP plate containing antibiotic, and cultured at 28°C for 2 days. Colonies were harvested and inoculated into 5 mL of YEP liquid medium in a 50 mL centrifuge tube and cultured overnight at 28°C under agitation. 300 μL of the resulting bacterial solution were removed and added to 250 mL of YEP liquid medium and cultured overnight until the ODg was approximately 0.3 to 0.4. Centrifugation was performed at 4,000 rpm for 10 minutes. Dilution was performed with an infection solution to an ODg of approximately 0.3 to 0.4 for later use. 4) Scraping of the cotyledonary node, infection, and co-culture.

[00176] 1 d after seed germination in step 2), a portion of a hypocotyl was cut, two cotyledons were separated, half of a cotyledon retaining a cotyledonary node was pinched, two true leaves were removed, and 2 to 3 incisions were made at a growing point. The cut seeds were placed in an infection solution. 5) Recovery culture Petition 870260079460, dated 07 / 08 / 2026, pages 41 / 51 38 / 45

[00177] An explant obtained after co-culture was placed in a recovery medium and exposed to light. The recovery culture was conducted at approximately 28°C for 5 to 7 days. 6) Screening culture

[00178] A portion of a hypocotyl was cut from a cotyledon after recovery, a resulting explant was inserted into a screening medium, and screening was then conducted at approximately 28°C under light. Subculture was performed once every 10 days, for a total of 2 times. 7) Shoot elongation culture

[00179] Yellow leaves were removed from a selected explant, and a surface medium and rotten leaves were lightly tapped every 10 to 15 days. A lower surface of a cotyledonary node was cut, and a treated cotyledonary node was inserted into an elongation medium (S5 medium) and grown at 28°C under light. 8) Rooting and transplanting seedlings

[00180] Seedlings that grew 3 to 4 cm during an elongation period were collected and placed in rooting soil for rooting until at least three roots about 1 cm long and three green leaves grew. Then, the rooted plants were transplanted into a culture chamber with artificial light to exercise. After about two weeks, when new leaves had grown, the resulting plants were transferred to an artificial climate chamber at 28°C and continued to be cultivated. 4. Detection and phenotypic observation of transformed soybean plants

[00181] Edited seedlings were detected and selected from transformed E0 seedlings by PCR and sequencing. With WT soybean (Zhonghuang 302) as a control, phenotypic changes were observed. A mutant population was expanded through 2 to 3 generations of self-crossing-based propagation to produce homozygous edited seedlings free of exogenous gene insertion. 5. Results

[00182] The edited seedlings or edited plants above were generated through gene editing with Zhonghuang 302 as the parent. Petition 870260079460, dated 07 / 08 / 2026, pages 42 / 51 39 / 45

[00183] One type of edited soybean with the above gene was the following: Edited acd plant: The edited acd plant underwent mutations in miR396a, miR396c, and miR396d compared to the WT soybean (Zhonghuang 302), but presented consistent miR396b, miR396f, and miR396i with the unmutated WT soybean. In the edited acd plant, miR396a underwent deletions of 229a to 233a bases (5 bases in total) relative to a sequence shown in SEQ ID No. 2, miR396c underwent deletions of 229a to 230a CT bases (2 bases in total) relative to a sequence shown in SEQ ID No. 4, and miR396d underwent deletions of 19a to 29a bases (11 bases in total) relative to a sequence shown in SEQ ID No. 5.

[00184] Edited plant acdf: The edited plant acdf suffered mutations in miR396a, miR396c, miR396d and miR396f compared to WT soybean (Zhonghuang 302), but presented miR396b and miR396i consistent with WT soybean without mutations. In the edited plant (acdf), miR396a suffered a deletion of 229th base C relative to the sequence shown in SEQ ID No. 2, miR396c suffered deletions of 230th to 255th bases (26 bases in total) relative to the sequence shown in SEQ ID No. 4, miR396d suffered deletions of 19th to 29th bases (11 bases in total) relative to the sequence shown in SEQ ID No. 5, and miR396f suffered a deletion of 265th base T relative to a sequence shown in SEQ ID No. 6.

[00185] Edited CDF plant: The edited cdf plant underwent mutation in miR396c, miR396d, and miR396f compared to WT soybean (Zhonghuang 302), but presented miR396a, miR396b, and miR396i consistent with WT soybean without mutations. In the edited cdf plant, miR396c underwent deletions of 228 to 253 bases (26 bases in total) relative to the sequence shown in SEQ ID No. 4, miR396d underwent a deletion of a 19th C base relative to the sequence shown in SEQ ID No. 5, and miR396f underwent deletions of 264 to 265 bases (2 bases in total) relative to the sequence shown in SEQ ID No. 6.

[00186] Edited plant abcdf: The edited plant abcdf underwent mutations in miR396a, miR396b, miR396c, miR396d, and miR396f compared to WT soybean (Zhonghuang 302), but presented miR396i consistent with WT soybean without mutations. In the edited plant abcdf, miR396a underwent a 229a base C deletion relative to the sequence. Petition 870260079460, dated 07 / 08 / 2026, pp. 43 / 51 40 / 45 shown in SEQ ID No. 2, the miR396b suffered deletions of 30aa to 100a bases (71 bases in total) relative to the sequence shown in SEQ ID No. 3, the miR396c suffered a deletion of 229a base C relative to the sequence shown in SEQ ID No. 4, the miR396d suffered deletions from the 18th to the 26th base (9 bases in total) relative to the sequence shown in SEQ ID No. 5, and the miR396f suffered deletions from the 264th to the 265th base (2 bases in total) relative to the sequence shown in SEQ ID No. 6.

[00187] Productivity per plant, number of seeds per plant, and weight of one hundred seeds of WT soybean plants and edited soybean plants grown in Hubei were measured, and the average values ​​of these results were as follows.

[00188] Table 5 Type of edition Yield per plant (g) Number of seeds per plant Weight of one hundred seeds (g) WT (Zhonghuang 302) 37.0 190 19.5 acd 29.9 140.0 21.4 acdf 51.8 235.4 22.0 cdf 27.5 135.9 20.2 abcdf 44.8 203.1 22.1

[00189] It can be observed that, in comparison with the WT soybean plant (Zhonghuang 302), the modified soybean plants acd and cdf have a yield per plant and a number of seeds per plant that do not increase, the modified soybean plants acd and cdf have an increased hundred seed weight, and the modified soybean plants acdf and abcdf have a yield per plant, a number of seeds per plant and a hundred seed weight that are significantly improved.

[00190] The comparison of seed sizes of the modified soybean plants acd, acdf, cdf, and abcdf with WT soybean (Zhonghuang 302) is shown in Figure 2. The seed diameter of the edited soybean plant acdf is about 10.8% larger than the seed diameter of WT soybean, the seed diameter of the edited soybean plant abcdf is about 15.3% larger than the seed diameter of WT soybean, and the seed sizes of the edited soybean plants acd and cdf are significantly larger than the seed size of WT soybean.

[00191] The comparison of the lengths, widths, and thicknesses of the seeds of the edited acd and cdf soybean plants with the WT soybean (Zhonghuang 302) is shown in Petition 870260079460, dated 07 / 08 / 2026, pages 44 / 51 41 / 45 Figure 3. Compared to WT soybeans, the edited acd and cdf soybean plants have significantly increased seed length, seed width, and seed thickness.

[00192] Therefore, compared with WT soybean (Zhonghuang 302), the edited soybean plants acd, acdf, cdf and abcdf have increased seed size. Example 3: Production of large seeds and high-yielding soybeans using a Cas12i-based CRISPR gene-editing technology (S7R, D233R, D267R, N369R, and S433R) 1. Construction of a gene editing vector

[00193] The GmmiR396 sequences from soybeans were selected to design gRNAs. The guide sequences for the designed gRNAs were as follows.

[00194] Table 6 gRNA Sequence (5'-3') PAM(5'-3') Target gene gRNA3 GTATTCTTCCACAGCIIICII GA(SEQ ID No.10) III GmmiR396a / i gRNA4 CIIIICCACAGCII ICTTGAACT(SEQ ID No.11) ATG GmmiR396b / c / d / f

[00195] The DR for the gRNAs above was agagaaugugugcauagucacac (5' to 3', SEQ ID No. 12). Each of the gRNAs included a DR and a respective guide sequence sequentially from 5' to 3'.

[00196] A mutant Cas12i protein (S7R, D233R, D267R, N369R and S433R) and gRNAs 3-4 were adopted. Edited seedlings were prepared according to the method of Example 2. With WT soybean (Zhonghuang 302) as a control, phenotypic changes were observed. A mutant population was then expanded through 2 to 3 generations of self-crossing-based propagation to produce homozygous edited seedlings free of exogenous gene insertion.

[00197] The edited seedlings or edited plants above were generated through gene editing with Zhonghuang 302 as the parent.

[00198] One type of edited soybean with the above gene was the following: Petition 870260079460, dated 07 / 08 / 2026, pages 45 / 51 42 / 45 Edited plant aci: the edited plant aci suffered mutations in miR396a, miR396c, and miR396i compared to the WT soybean (Zhonghuang 302), but presented consistent miR396b, miR396d, and miR396f with the mutation-free WT soybean. In the edited plant aci, miR396a suffered deletions from bases 229a to 233a (5 bases in total) relative to a sequence shown in SEQ ID No. 2, miR396c suffered deletions from bases 228a to 253a (26 bases in total) relative to a sequence shown in SEQ ID No. 4, and miR396i suffered deletions from bases 200a to 201a (2 bases in total) relative to a sequence shown in SEQ ID No. 7.

[00199] Edited plant adf: The edited plant adf suffered mutations in miR396a, miR396d, and miR396f compared to WT soybean (Zhonghuang 302), but presented miR396b, miR396c, and miR396i consistent with WT soybean without mutations. In the edited plant adf, miR396a suffered a 229a base C deletion relative to the sequence shown in SEQ ID No. 2, miR396d suffered 19a to 29a base CT deletions (11 bases in total) relative to a sequence shown in SEQ ID No. 5, and miR396f suffered a 265a base T deletion relative to a sequence shown in SEQ ID No. 6.

[00200] Edited plant abcd: The edited plant abcd suffered mutations in miR396a, miR396b, miR396c, and miR396d compared to WT soybean (Zhonghuang 302), but presented miR396f and miR396i consistent with WT soybean without mutations. In the edited plant abcd, miR396a suffered deletions from bases 229 to 233 (5 bases in total) in relation to the sequence shown in SEQ ID No.2, miR396b suffered a deletion of the 29th base (1 base in total) relative to the sequence shown in SEQ ID No. 3, miR396c suffered deletions of the 229th to 230th bases (2 bases in total) relative to the sequence shown in SEQ ID No. 4, and miR396d suffered deletions of the 19th to 29th bases (11 bases in total) relative to the sequence shown in SEQ ID No. 5.

[00201] Edited plant ACFI: The edited plant ACFI exhibited mutations in miR396a, miR396c, miR396f, and miR396i compared to WT soybean (Zhonghuang 302), but presented miR396b and miR396d consistent with WT soybean without mutations. In the edited plant ACFI, miR396a exhibited deletions from bases 229 to 233 (5 bases in total) relative to the sequence shown in SEQ ID No. 2, miR396c exhibited deletions from bases 228 to 253 (26 bases in total) relative to the sequence shown in SEQ ID No. 4, the Petition 870260079460, dated 07 / 08 / 2026, pages 46 / 51 43 / 45 miR396f suffered a deletion of a 265a base T relative to the sequence shown in SEQ ID No. 6, and miR396i suffered deletions from the 20Qa to the 201a bases (2 bases in total) relative to the sequence shown in SEQ ID No. 7.

[00202] Edited plant Bcdfi: The edited plant bcdfi suffered mutations in miR396b, miR396c, miR396d, miR396f and miR396i compared to WT soybean (Zhonghuang 302), but presented miR396a consistent with WT soybean without mutations. In the edited bcdfi plant, miR396b suffered deletions from the 29th to the 31st base (3 bases in total) relative to the sequence shown in SEQ ID No. 3, miR396c suffered deletions from the 229th to the 23Qa base (2 bases in total) relative to the sequence shown in SEQ ID No. 4, miR396d suffered deletions from the 18th to the 26th base (9 bases in total) relative to the sequence shown in SEQ ID No. 5, miR396f suffered deletions from the 264th to the 265th base (2 bases in total) relative to the sequence shown in SEQ ID No. 6, and miR396i suffered deletions from the 20Qa to the 201st base (2 bases in total) relative to the sequence shown in SEQ ID No. 7.

[00203] The yields per plant and the weights of one hundred seeds of WT soybean plants and edited soybean plants grown in Hainan were measured, and the average values ​​of these results were as follows.

[00204] Table 7 Type of edition Yield per plant (g) Weight of one hundred seeds WT (Zhonghuang 302) 18.5 19.2 aci 20.8 20.5 adf 22.6 20.8 abed 24.0 21.5 acfi 20.8 20.3 bcdfi 25.2 22.1

[00205] It can be observed that, in comparison with the WT soybean plant (Zhonghuang 302), the modified soybean plants aci, adf, abcd, acfi and bcdfi have an improved yield per plant and weight of one hundred seeds.

[00206] The comparison of seed sizes of the modified soybean plants aci, adf, abcd, acfi, and bcdfi with WT soybean (Zhonghuang 302) is shown in Figures 4 and 5. Compared to WT soybean, the edited soybean plants aci, adf, abcd, acfi, and bcdfi Petition 870260079460, dated 07 / 08 / 2026, pages 47 / 51 44 / 45 varieties have a seed size, seed length, seed width, and seed thickness that increase significantly.

[00207] Compared to WT soybeans (Zhonghuang 302), the edited soybean plants aci, adf, abcd, acfi and bcdfi have improved seed size, hundred-seed weight and yield.

[00208] The edit types of the edited plants are summarized in the table below. The edit types in the following table refer to bases deleted in miR396a relative to the sequence shown in SEQ ID No. 2, bases deleted in miR396b relative to the sequence shown in SEQ ID No. 3, bases deleted in miR396c relative to the sequence shown in SEQ ID No. 4, bases deleted in miR396d relative to the sequence shown in SEQ ID No. 5, bases deleted in miR396f relative to the sequence shown in SEQ ID No. 6, and bases deleted in miR396i relative to the sequence shown in SEQ ID No. 7 in edited plants. WT refers to an edited plant in which miR396a, miR396b, miR396c, miR396d, miR396f, or miR396i is WT and does not undergo any mutation or base deletion.

[00209] Table 8 Edited plant Editing type miR396a miR396b miR396c miR396d miR396f miR396i acd 229a to 233a WT 229a to 230a 19a to 29a WT WT aedf 229a WT 230a to 255a 19a to 29a 265a WT cdf WT WT 228a to 253a 19a 264a to 265a WT abedf 229a 30a to 100a 229a 18a to 26a 264a to 265a WT aci 229a to 233a WT 228a to 253a WT WT 200a to 201a adf 229a WT IR 19a to 29a 265° WT abed 229a to 233a 29a 229a to 230a 19a to 29a WT WT acfi 229a to 233a WT 228a to 253a WT 265a 200a to 201a bcdfi WT 29th to 31st 229th to 230th 18th to 26th 264th to 265th 200th to 201st

[00210] The manifestations of edited plant characteristics (+ indicates that an edited plant undergoes a significant increase / improvement in a characteristic in contrast to the WT) are shown in the table below.

[00211] Table 9 Petition 870260079460, dated 07 / 08 / 2026, pages 48 / 51 45 / 45 Edited plant Seed size Yield per plant (g) Number of seeds per plant Weight of one hundred seeds (g) acd + + aedf + + + + cdf + + abedf + + + + aci + + + adf + + + abed + + + acfi + + + bcdfi + + +

[00212] Furthermore, the mutant Cas12i protein (N369R and S433R) and the mutant Cas12i protein (S7R, D233R, D267R, N369R and S433R) are compared with the WT Cas12i protein for miR396-targeted editing efficiency. The results show that the editing efficiency of the WT Cas12i protein in soybean is only 1% to 2%, while the editing efficiencies of the mutant Cas12i protein (N369R and S433R) and the mutant Cas12i protein (S7R, D233R, D267R, N369R and S433R) in soybean exceed 10%.

[00213] Although the specific implementations of this disclosure have been described in detail, those skilled in the art will understand that various modifications and alterations may be made to the details in accordance with all published teachings, and such modifications and alterations are all within the scope of protection of this disclosure. The complete content of this disclosure is defined by the appended claims and any equivalents. Petition 870260079460, dated 07 / 08 / 2026, pages 49 / 51

Claims

1 / 5 CLAIMS 1. A MUTANT MICRORNA396 (miR396), characterized in that the mutant miR396 has a base mutation relative to the parental miR396; the parental miR396 is the wild-type (WT) miR396 derived from soybean; the miR396 is selected from one or more of miR396a, miR396b, miR396c, miR396d, miR396f, and miR396i; and the mutant miR396 is capable of improving seed size, seed weight, number of seeds per plant, or soybean yield.

2. The MUTANT MIR396, according to claim 1, characterized in that the mutant miR396 has a base deletion relative to the parental miR396; the parental miR396 is the WT miR396 derived from soybean; the miR396 may be selected from any of the following (1) to (9): (1) the miR396 comprises the miR396a, the miR396c and the miR396d; (2) the miR396 comprises the miR396a, the miR396c, the miR396d and the miR396f; (3) the miR396 comprises the miR396c, the miR396d and the miR396f; (4) the miR396 comprises the miR396a, the miR396b, the miR396c, the miR396d and the miR396f; (5) the miR396 comprises the miR396a, the miR396c and the miR396i; (6) the miR396 comprises the miR396a, the miR396d and the miR396f; (7) the miR396 comprises the miR396a, the miR396b, the miR396c and the miR396d; (8) miR396 comprises miR396a, miR396c, miR396f and miR396i; and (9) miR396 comprises miR396b, miR396c, miR396d, miR396f and miR396i; and preferably, the miR396 mutant is selected from any one or more of the following (i) to (ix): (i) miR396a mutant subjected to a base deletion with respect to the sequence shown in SEQ ID No. 2; miR396b mutant subjected to a base deletion with respect to the sequence shown in SEQ ID No. 3; miR396c mutant subjected to a base deletion with respect to the sequence shown in SEQ ID No. 4; miR396d mutant subjected to a deletion Petition 870250070029, dated 06 / 08 / 2025, p. 52 / 126 2 / 5 base deletion relative to the sequence shown in SEQ ID No. 5; and the miR396f mutant subjected to a base deletion relative to the sequence shown in SEQ ID No. 6; (ii) the miR396b mutant subjected to a base deletion relative to the sequence shown in SEQ ID No.3; the base-deletion mutant miR396c relative to the sequence shown in SEQ ID No. 4; the base-deletion mutant miR396d relative to the sequence shown in SEQ ID No. 5; the base-deletion mutant miR396f relative to the sequence shown in SEQ ID No. 6; and the base-deletion mutant miR396i relative to the sequence shown in SEQ ID No. 7; (iii) the base-deletion mutant miR396a relative to the sequence shown in SEQ ID No. 2; the base-deletion mutant miR396c relative to the sequence shown in SEQ ID No. 4; and the base-deletion mutant miR396d relative to the sequence shown in SEQ ID No. 5; (iv) the base-deletion mutant miR396a relative to the sequence shown in SEQ ID No. 2; the miR396c mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 4; the miR396d mutant subjected to base deletion relative to the sequence shown in SEQ ID No.5; and the miR396f mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 6; (v) the miR396c mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 4; the miR396d mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 5; and the miR396f mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 6; (vi) the miR396a mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 2; the miR396c mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 4; and the miR396i mutant subjected to base deletion relative to the sequence shown in SEQ ID Petition 870250070029, dated 06 / 08 / 2025, page. 53 / 126 3 / 5 No. 7; (vii) the miR396a mutant subjected to base deletion relative to the sequence shown in SEQ ID No. 2; the miR396d mutant subjected to base deletion relative to the sequence shown in SEQ ID No.5; and the base-deletion mutant miR396f relative to the sequence shown in SEQ ID No. 6; (viii) the base-deletion mutant miR396a relative to the sequence shown in SEQ ID No. 2; the base-deletion mutant miR396b relative to the sequence shown in SEQ ID No. 3; the base-deletion mutant miR396c relative to the sequence shown in SEQ ID No. 4; and the base-deletion mutant miR396d relative to the sequence shown in SEQ ID No. 5; and (ix) the base-deletion mutant miR396a relative to the sequence shown in SEQ ID No. 2; the base-deletion mutant miR396c relative to the sequence shown in SEQ ID No. 4; the base-deletion mutant miR396f relative to the sequence shown in SEQ ID No. 6; and the mutant miR396i subjected to base deletion relative to the sequence shown in SEQ ID No. 7.3.A gene-editing reagent, characterized in that the gene-editing reagent is capable of causing the generation of the miR396 mutant according to any of claims 1 to 2 in soybean; the gene-editing reagent comprises Cas12i and guide RNA (gRNA); the gRNA comprises a support region for binding to Cas12i and a guide sequence for hybridization with a target sequence; the gRNA targets miR396 in soybean; and preferably, an amino acid sequence of Cas12i is mutated at the 369th and 433rd amino acids relative to the sequence shown in SEQ ID No. 1; or the Cas12i amino acid sequence undergoes mutation in amino acids 7, 233, 267, 369, and 433 relative to the sequence shown in SEQ ID No.

1.

4. A USE OF THE MUTANT MIR396, according to any of claims 1 to 2, or of the gene-editing reagent according to Petition 870250070029, dated 06 / 08 / 2025, p.54 / 126 4 / 5 claim 3, characterized by being used in the preparation of soybeans with improved seed size, seed weight, number of seeds per plant or yield; or in the preparation of a reagent or kit for producing soybeans with improved seed size, seed weight, number of seeds per plant or yield.

5. A METHOD for producing soybeans with improved seed size, seed weight, number of seeds per plant or yield, characterized by comprising the following steps: (a) introducing the miR396 mutant according to any of claims 1 to 2 into a soybean cell, a soybean seed, a soybean tissue or a soybean part; and (b) regenerating a soybean plant from a soybean cell, a soybean seed, a soybean tissue or a soybean part produced in step (a). 6.The METHOD, according to claim 5, characterized by the introduction of the miR396 mutant according to any one of claims 1 to 2 comprising a mutation step of the endogenous soybean miR396 to introduce the miR396 mutant; and preferably, the mutant miR396 is introduced into the soybean cell, soybean seed, soybean tissue or soybean part by means of gene editing.

7. The METHOD, according to claim 6, characterized by gene editing being conducted with Cas12i in the soybean cell, soybean seed, soybean tissue or soybean part; and preferably, a Cas12i amino acid sequence is mutated at the 369th and 433rd amino acids relative to the sequence shown in SEQ ID No. 1; or the Cas12i amino acid sequence undergoes mutations in amino acids 7, 233, 267, 369, and 433 relative to the sequence shown in SEQ ID No.

1. 8.A METHOD for soybean gene editing, characterized by comprising the following steps: (a) performing gene editing with Cas12i and gRNA in a soybean cell, a soybean seed, a soybean tissue or a soybean part to produce a gene-edited soybean cell, a soybean seed, a soybean tissue or a soybean part, wherein the gRNA comprises a support region for Cas12i binding and a guide sequence for hybridization with a target sequence, and the gRNA targets miR396 in soybean; and (b) regeneration of a soybean plant from a gene-edited soybean cell, soybean seed, soybean tissue or part of soybean obtained in step (a), wherein, preferably, an amino acid sequence of Cas12i is mutated at amino acids 369 and 433 relative to the sequence shown in SEQ ID No.1; or the Cas12i amino acid sequence undergoes mutation in amino acids 7, 233, 267, 369, and 433 relative to the sequence shown in SEQ ID No.

1.

9. THE METHOD, according to claim 8, characterized in that the guide sequence for hybridization with the target sequence in the gRNA is shown in any of SEQ ID Nos. 8-11.

10. A METHOD for producing soybeans with improved seed size, seed weight, number of seeds per plant, or yield, characterized by comprising a hybridization step of a soybean seed or a soybean plant prepared by the method according to any of claims 5-9 with another soybean variety to produce soybeans with improved seed size, seed weight, number of seeds per plant, or yield. Petition 870250070029, dated 06 / 08 / 2025, p. 56 / 126.

Images