SOYBEAN PLANT, SOYBEAN PLANT EVALUATION METHOD, AND SOYBEAN PLANT SELECTION METHOD

Abstract

The purpose of the present invention is to provide a soybean plant exhibiting resistance to soybean rust without introducing a conventionally known resistant gene. A soybean plant exhibiting resistance to soybean rust according to the present invention includes a homozygous SSI2A gene mutation. The SSI2A gene mutation reduces the amount or function of an expression product of the SSI2A gene.

Description

1 / 34 SOYBEAN PLANT, SOYBEAN PLANT EVALUATION METHOD, AND SOYBEAN PLANT SELECTION METHOD Technical field

[0001] The present invention relates to a soybean plant, a method for evaluating a soybean plant and a method for selecting a soybean plant. State of the art

[0002] Soybean rust is the most significant disease of soybean plants prevalent in both North and South America. Currently, soybean rust control is primarily achieved through fungicide spraying on soybean plants. Furthermore, the development of resistant varieties through the introduction of soybean rust resistance genes possessed by resistant soybean lines into soybean plants is also being advanced (e.g., Non-patent Literature 1 and 2). On the other hand, fungicides are expensive, and fungicide-resistant strains have emerged. Currently known resistance genes are specific to races of the rust fungus, and innovative strains have emerged, making it impossible to address a wide variety of rust fungus races.

[0003] In soybean plants, there is a gene that encodes the stearoyl-acyl-desaturase transporter protein (SACPD), which catalyzes the synthesis of oleic acid (18:1), and five genes of the SACPD family, SACPD-A, SACPD-B, SACPD-C, SACPD-D, and SACPD-E, have been identified (e.g., Non-patent Literature 3 and 4). Among them, SACPD-A and SACPD-B are also called SSI2A and SSI2B, respectively, and exhibit very high homology. It is known Petition 870250086784, dated 09 / 25 / 2025, page 10 / 45 2 / 34 that, in soybean plants, when the expression levels of the SACPD-A and SACPD-B genes are reduced, resistance is exhibited against bacterial late blight of soybean caused by the pathogen Pseudomonas syringae pv. glycinea and stem rot caused by the pathogen Phytophthora sojae (e.g., Non-patent Literature 3). However, it has not been specifically clarified which genes other than the known resistance genes are involved in conferring resistance to soybean rust. Citation list Non-patent literature

[0004] [Non-patent literature 1]: Godoy et al., “Asian soybean rust in Brazil: past, present, and future, Pesqui. Agropec. Bras., 2016; 51: 407 - 421.

[0005] [Non-patent literature 2]: Yamanaka et al., “Soybean Breeding Materials Useful for soybean rust resistance in Brazil, JARQ 45(4) 385 - 395 (2011).

[0006] [Non-patent literature 3]: Kachroo et al., “An Oleic Acid-Mediated Pathway Induces Constitutive Defense Signaling and Enhanced Resistance to Multiple Pathogens in Soybean, Molecular Plant-Microbe Interactions, vol. 21, no. 5, 2008, 564 - 575.

[0007] [Non-patent Literature 4]: Naoufal Lakhssassi et al., “Soybean TILLING-by-Sequencing+ reveals the role of novel GmSACPD members in unsaturated fatty acid biosynthesis while maintaining healthy nodules”, Journal of Experimental Botany, Volume 71, Issue 22, December 31, 2020, Pages 6969 - 6987. Petition 870250086784, dated 09 / 25 / 2025, p. 11 / 45 3 / 34 Summary of the invention Technical problem

[0008] One object of the present invention is to provide a soybean plant that exhibits resistance to soybean rust without introducing known resistance genes. Furthermore, another object of the present invention is to provide a method for evaluating a soybean plant that exhibits resistance to soybean rust without introducing known resistance genes, and a method for selecting a soybean plant that exhibits resistance to soybean rust. Solution to the problem

[0009] The present inventors, as a result of extensive studies, have discovered that a soybean plant containing a mutation of the SSI2A gene exhibits resistance to soybean rust, thus completing the present invention.

[0010] That is, the present invention relates to, for example, the following inventions.

[0011] [1] A soybean plant that exhibits resistance to soybean rust,

[0012] in which the soybean plant comprises a homozygous SSI2A gene mutation, and

[0013] where the SSI2A gene mutation is a mutation that reduces the quantity or function of an SSI2A gene expression product.

[0014] [2] The soybean plant according to [1], in which a function of producing oleic acid from stearic acid is reduced.

[0015] [3] The soybean plant according to [1] or [2], in which the SSI2A gene mutation described above comprises a Petition 870250086784, dated 09 / 25 / 2025, p. 12 / 45 4 / 34 mutation in which an amino acid residue corresponding to the 215th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an arginine residue, and / or a mutation in which an amino acid residue corresponding to the 186th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an aspartic acid residue.

[0016] [4] The soybean plant according to any one of [1] to [3], which does not contain a mutation of the SSI2B gene.

[0017] [5] A method for evaluating a soybean plant that exhibits resistance to soybean rust, comprising:

[0018] to assess that a soybean plant is a soybean plant that exhibits resistance to soybean rust when the soybean plant comprises a homozygous SSI2A gene mutation,

[0019] where the SSI2A gene mutation is a mutation that reduces the quantity or function of an SSI2A gene expression product.

[0020] [6] The evaluation method according to [5], in which a function of the soybean plant to produce oleic acid from stearic acid is reduced.

[0021] [7] The assessment method according to [5] or [6], wherein the SSI2A gene mutation described above comprises a mutation in which an amino acid residue corresponding to the 215th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an arginine residue, and / or a mutation in which an amino acid residue corresponding to the 186th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an aspartic acid residue. Petition 870250086784, dated 09 / 25 / 2025, page 13 / 45 5 / 34

[0022] [8] A method for producing a soybean plant, comprising: selection of a soybean plant that exhibits resistance to soybean rust by means of the evaluation method according to [5] to [7].

[0023] [9] A selection method for a soybean plant exhibiting resistance to soybean rust, comprising:

[0024] a selection step to select a soybean plant comprising a homozygous SSI2A gene mutation from soybean plants,

[0025] wherein the SSI2A gene mutation is a mutation that reduces the quantity or function of an SSI2A gene expression product. Advantageous effects of the invention

[0026] According to the present invention, it is possible to provide a soybean plant that exhibits resistance to soybean rust without introducing known resistance genes. Furthermore, according to the present invention, it is possible to provide a method for evaluating a soybean plant that exhibits resistance to soybean rust and a method for selecting a soybean plant that exhibits resistance to soybean rust.

[0027] Furthermore, as described in the non-patent literature 3, it is known that mutations in the SSI2 gene, including the SSI2A gene, induce a broad-spectrum resistance response involving salicylic acid. Therefore, according to the present invention, since a soybean rust resistance gene specific to soybean rust races is not introduced, it is considered unlikely that innovative strains will emerge and control of various soybean rust races is expected. Petition 870250086784, dated 09 / 25 / 2025, page 14 / 45 6 / 34 Brief description of the figures

[0028] FIG. 1 is a graph showing the results of the evaluation of soybean rust resistance (measurement of lesion area) and genotype analysis of soybean plants homozygous for a mutation in which the 215th glycine residue is replaced by an arginine residue (SSI2A G215R homozygous mutant soybean plants) in Example 1.

[0029] FIG. 2 shows images comparing a leaf (B) from a soybean plant containing a homozygous SSI2A gene mutation (which exhibits resistance to soybean rust, homozygous mutant soybean plant SSI2A G215R) with a leaf (A) from a soybean plant not containing the SSI2A gene mutation (which does not exhibit resistance to soybean rust) in Example 1.

[0030] FIG. 3 is a graph showing the results of the analysis of the expression level of the SSI2A gene in a homozygous mutant SSI2A G215R soybean plant in Example 2.

[0031] FIG. 4 illustrates graphs showing the level of stearic acid accumulation (A) in the leaves of the homozygous mutant soybean plant SSI2A G215R and the level of oleic acid accumulation (B) in the leaves of the soybean plant in Example 3.

[0032] FIG. 5 is a graph showing the results of the evaluation of soybean rust resistance (measurement of lesion area) and genotype analysis of a soybean plant homozygous for a mutation in which the 186th glycine residue is replaced by an aspartic acid residue (homozygous mutant soybean plant SSI2A G186D) in Example 4.

[0033] FIG. 6 illustrates the views showing the results of predicting a three-dimensional structure of Petition 870250086784, dated 09 / 25 / 2025, page 15 / 45 7 / 34 SSI2A of soybean using Alpha-Fold2 in Example 5. Description of the modalities

[0034] Hereafter, one embodiment of the present invention will be described in detail. The present invention is not limited to the following embodiment.

[0035] [Soybean plant]

[0036] The soybean plant according to the present embodiment contains a homozygous SSI2A gene mutation. The SSI2A gene mutation described above is a mutation that reduces the quantity or function of an SSI2A gene expression product. The soybean plant according to the present embodiment exhibits resistance to soybean rust because it contains a homozygous SSI2A gene mutation that reduces the quantity or function of an SSI2A gene expression product.

[0037] A soybean plant means soybean (Glycine max (L.) Merr.). In this descriptive report, unless otherwise specified, “plant” includes the whole plant, plant cells, plant protoplasts, plant calluses or parts of a plant such as embryos, pollen, ovules, gametes, seeds, leaves, flowers, branches, fruits, stems, roots and anthers.

[0038] Soybean rust produces numerous lesions of approximately 1 mm on the leaves after infection, accelerates leaf drop, and leads to incomplete seed formation. The soybean rust pathogen is a filamentous fungus belonging to the phylum Basidiomycota, known as Phakopsora pachyrhizi.

[0039] In this descriptive report, SSI2A (Glyma. 07G207200) means stearoyl carrier protein. Petition 870250086784, dated 09 / 25 / 2025, page 16 / 45 8 / 34 acyl desaturase-A (SACPD-A) from the Enrei soybean plant. The SSI2A protein from the Enrei soybean plant is a protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

[0040] In this descriptive report, gene means a region of DNA that includes a region (transcription region) transcribed into an RNA molecule (e.g., mRNA) within a cell. That is, a gene may include not only the transcription region but also regulatory regions and untranslated regions (5' UTR, 3' UTR) existing upstream or downstream of the transcription region, or it may consist only of the transcription region. The transcription region may be an open reading frame (ORF) that includes not only exons but also introns, or it may be so-called cDNA. Specific examples of cDNA from the SSI2A gene include DNA containing the nucleotide sequence represented by SEQ ID NO: 2 (Glyma. 07G207200), and specific examples from the SSI2A gene include DNA containing the nucleotide sequence represented by SEQ ID NO: 8.

[0041] Regulatory regions can be, for example, transcriptional regulatory regions or translational regulatory regions. Examples of transcriptional regulatory regions include promoters, enhancers, and silencers. Examples of translational regulatory regions include ribosome-binding regions.

[0042] A soybean plant that exhibits resistance to soybean rust contains a homozygous SSI2A gene mutation (hereinafter simply referred to as the SSI2A gene mutation), that is, a soybean plant that exhibits resistance to Petition 870250086784, dated 09 / 25 / 2025, p. 17 / 45 9 / 34 soybean rust contains a homozygous mutant SSI2A gene. The homozygous SSI2A gene mutation (i.e., the mutation in the homozygous mutant SSI2A gene) can be any homozygous mutation that reduces the quantity or function of an expression product of the SSI2A gene. An expression product can be mRNA transcribed from the SSI2A gene or a protein translated by the mRNA transcribed from the SSI2A gene (i.e., the protein encoded by the SSI2A gene).

[0043] Here, “mutation” in this descriptive report means a mutation in the SSI2A gene that reduces the amount or function of an expression product of the SSI2A gene. A mutation in the SSI2A gene in a soybean plant exhibiting resistance to soybean rust means, for example, that the SSI2A gene or the protein it encodes differs from the wild-type SSI2A gene in a wild-type soybean plant or the wild-type SSI2A protein it encodes (i.e., stearoyl-acyl desaturase-A carrier protein) by at least one nucleotide or amino acid residue. In addition, a mutation may be a substitution, insertion, addition, or deletion of a nucleotide or amino acid residue.

[0044] A reduction in the quantity or function of an SSI2A gene expression product may be a reduction in the quantity or function of the expression product compared to a wild-type soybean plant, and includes, for example, (1) the function of the expression product remains the same or is improved, but the quantity of the expression product is reduced; (2) the quantity of the expression product remains the same or is improved, but the function of the expression product is reduced; (3) both the function and the Petition 870250086784, dated 09 / 25 / 2025, page 18 / 45 10 / 34 quantity of the expression product is reduced. Here, in case (1), it is preferable that the function of the expression product remain the same, but the quantity of the expression product be reduced; in case (2), it is preferable that the quantity of the expression product remain the same, but the function of the expression product be reduced. A reduction in the quantity or function of an expression product of the SSI2A gene is not particularly limited, but may be, for example, a reduction of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more compared to a wild-type soybean plant, and may be a reduction of 60% or less, 70% or less, 80% or less, 90% or less, 95% or less, or 100% or less.

[0045] The quantity of a gene expression product SSI2A can be the amount of mRNA or protein, and can be measured by methods known to those skilled in the technique, for example, reverse transcription polymerase chain reaction (RT-PCR), Northern blotting, ELISA, radioimmunoassay, and Western blotting.

[0046] The function of an SSI2A gene expression product may be the function of a protein, particularly the function of catalyzing the synthesis of oleic acid (18:1). The function of an SSI2A gene expression product can be analyzed, for example, by measuring the function of stearic acid (18:0) production into oleic acid (18:1), and can be analyzed by measuring the accumulation of stearic acid (18:0) and / or oleic acid (18:1) contained in the soybean plant according to the present embodiment (e.g., leaves) using gas chromatography-mass spectrometry. Petition 870250086784, dated 09 / 25 / 2025, page 19 / 45 11 / 34

[0047] A mutation in the SSI2A gene can exist in the SSI2A gene and can be located in a regulatory region of the SSI2A gene, in a transcription region, or in an untranslated region, or it can exist in two or more selected regions of the regulatory region, transcription region, and untranslated region. In the soybean plant, according to the present embodiment, when the mutation exists only in the regulatory region of the SSI2A gene, the amount of expression product of the soybean plant may be reduced compared to a wild-type soybean plant; when the mutation exists only in the transcription region of the SSI2A gene, the function of the expression product of the soybean plant may be reduced compared to a wild-type soybean plant. Examples of the regulatory region, transcription region, and untranslated region include those described above.

[0048] The SSI2A gene mutation is not particularly limited, provided it is a mutation that reduces the quantity or function of an SSI2A gene expression product, and can be adequately performed by qualified professionals in the field, depending on the purpose. For example, when the SSI2A gene mutation is located in a transcription region (ORF or cDNA), it can be a substitution, insertion, or addition of one or more nucleotides, two or more nucleotides, three or more nucleotides, four or more nucleotides, five or more nucleotides, one to three nucleotides, one to five nucleotides, or two to three nucleotides. It can also be a deletion of part or all of the transcription region, for example, a deletion of one to three nucleotides, one to ten nucleotides, ten or more Petition 870250086784, dated 09 / 25 / 2025, page 20 / 45 12 / 34 nucleotides, 50 or more nucleotides, 100 or more nucleotides, 500 or more nucleotides, or 1000 or more nucleotides. Furthermore, the SSI2A gene mutation can be, for example, a substitution, insertion, addition, and / or deletion of 1209 or fewer nucleotides, 1000 or fewer nucleotides, 500 or fewer nucleotides, 100 or fewer nucleotides, 50 or fewer nucleotides, ten or fewer nucleotides, or five or fewer nucleotides.

[0049] A mutation in the SSI2A gene, when it is a mutation of two or more nucleotides, can involve consecutive nucleotides undergoing mutation, non-consecutive nucleotides undergoing mutation, or a combination thereof. When the SSI2A gene mutation is a deletion of consecutive nucleotides, it can be a mutation involving a deletion of all or part of the transcription region, regulatory region, and / or untranslated region. More specifically, for example, it can be a deletion of a promoter, enhancer, silencer, ribosome-binding region, 5' UTR, 3' UTR, or an exon or intron of the ORF in the SSI2A gene. Furthermore, when the SSI2A gene mutation is a consecutive nucleotide mutation, the SSI2A gene mutation can originate from the N-terminal side or the C-terminal side of the expression product (protein) encoded by the SSI2A gene.

[0050] It is known that the SSI2 family gene (SACPD) requires the coordination of two iron ions to exhibit its activity (Naoufal Lakhssassi, et al., Plant Physiology, Volume 174, Issue 3, July 2017, 1531-1543). Therefore, a mutation in the SSI2A gene may involve a mutation of an amino acid residue in a region of the protein. Petition 870250086784, dated 09 / 25 / 2025, page 21 / 45 13 / 34 encoded by the SSI2A gene (SEQ ID NO: 1) which is involved in the coordination of iron ions. In this case, it is preferable that the mutation makes the coordination of iron ions impossible or difficult. For example, it could be a substitution, insertion, addition, and / or deletion of an amino acid residue in the region involved in the coordination of iron ions, and in the case of a substitution, it could be a non-conservative substitution. A “non-conservative substitution” means an amino acid substitution mutation in which the chemical properties (e.g., hydrophobicity, hydrophilicity, ionic charge, polarity, non-polarity, acidity, and basicity) differ between the amino acid before the substitution and the amino acid after the substitution.

[0051] In soybean SACPD-C, iron ion ligands and bridging ligands have been predicted (Naoufal Lakhssassi, et al., Plant Physiology, Volume 174, Issue 3, July 2017, 1531-1543). FIG. 6 shows the SSI2A region involved in iron ion coordination, estimated based on the amino acid sequence and three-dimensional structure of soybean SACPD-C. Therefore, the amino acid residues of the protein encoded by the SSI2A gene (SEQ ID NO: 1) that are involved in iron ion coordination are predicted based on soybean SACPD-C, with the iron ion ligands being the 144th, 185th, 235th, and 271st amino acid residues, and the bridging ligands being the 182nd and 268th amino acid residues. Therefore, it is considered that a mutation in the amino acid residues described above or in their neighboring amino acid residues in the SSI2A gene can lead to a reduction in the function of the SSI2A gene. Petition 870250086784, dated 09 / 25 / 2025, page 22 / 45 14 / 34

[0052] The SSI2A gene mutation may include a mutation of one or more amino acid residues selected from the group consisting of the amino acid residue corresponding to the 144th glutamic acid residue, the amino acid residue corresponding to the 185th histidine residue, the amino acid residue corresponding to the 235th glutamic acid residue, the amino acid residue corresponding to the 271st histidine residue, the amino acid residue corresponding to the 182nd glutamic acid residue, the amino acid residue corresponding to the 268th glutamic acid residue, the amino acid residue corresponding to the 215th glycine residue, and the amino acid residue corresponding to the 186th glycine residue of the protein encoded by the SSI2A gene (SEQ ID NO: 1), and may be, for example, a non-conservative substitution of one or more of the above amino acid residues.Here, the amino acid residue corresponding to the 144th glycine residue of SEQ ID NO: 1” means the amino acid residue in the target protein amino acid sequence that is in a position corresponding to the 144th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 when an alignment is performed between the target protein amino acid sequence and the amino acid sequence of SEQ ID NO: 1. The same applies to the other amino acid residues.

[0053] Examples of non-conservative substitutions for a glutamic acid residue include substitution with a lysine residue, phenylalanine residue, valine residue, proline residue, glycine residue, alanine residue, or serine residue. Examples of non-conservative substitutions Petition 870250086784, dated 09 / 25 / 2025, p. 23 / 45 15 / 34 Conservative substitutions for a histidine residue include substitution with a phenylalanine residue, valine residue, glycine residue, alanine residue, serine residue, asparagine residue, glutamine residue, or lysine residue. Examples of non-conservative substitutions for a glycine residue include substitution with a phenylalanine residue, proline residue, tryptophan residue, glutamic acid residue, asparagine residue, lysine residue, arginine residue, or serine residue.

[0054] The SSI2A gene mutation may include a mutation in which the amino acid residue corresponding to the 215th glycine residue of the protein encoded by the SSI2A gene (SEQ ID NO: 1) is replaced by an arginine residue, and may be a mutation in which the amino acid residue corresponding to the 215th glycine residue of the protein encoded by the SSI2A gene (SEQ ID NO: 1) is replaced by an arginine residue. Here, “the amino acid residue corresponding to the 215th glycine residue of SEQ ID NO: 1” means the amino acid residue in the amino acid sequence of the target protein that is in a position corresponding to the 215th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 when an alignment is performed between the amino acid sequence of the target protein and the amino acid sequence of SEQ ID NO: 1.

[0055] The SSI2A gene mutation may include a mutation in which the amino acid residue corresponding to the 186th glycine residue of the protein encoded by the SSI2A gene (SEQ ID NO: 1) is replaced by an acid residue. Petition 870250086784, dated 09 / 25 / 2025, p. 24 / 45 16 / 34 aspartic, and it may be a mutation in which the amino acid residue corresponding to the 186th glycine residue of the protein encoded by the SSI2A gene (SEQ ID NO: 1) is replaced by an aspartic acid residue.

[0056] The inclusion of a mutation in the SSI2A gene can be analyzed, for example, by the method shown in the examples described below. More specific examples include a method of extracting DNA from a soybean plant according to conventional methods and performing DNA sequence analysis.

[0057] The soybean plant according to the present embodiment may not contain a mutation of the SSI2B gene.

[0058] In this descriptive report, SSI2B (Glyma. 02G138100) means stearoylacyl desaturase-B transporter protein (SACPD-B) from the Enrei variety soybean plant. The SSI2B protein from the Enrei variety soybean plant is a protein consisting of the amino acid sequence represented by SEQ ID NO: 3.

[0059] “Not containing a mutation in the SSI2B gene” means that the nucleotide sequence of the SSI2B gene is identical to that of a wild-type soybean plant, or that the amino acid sequence of the protein encoded by the SSI2B gene is identical to that of a wild-type soybean plant. The analysis of not containing a mutation in the SSI2B gene can be performed using the same method as the analysis of containing a mutation in the SSI2A gene described above.

[0060] Specific examples of the SSI2B gene cDNA include DNA containing the nucleotide sequence represented by SEQ ID NO: 4, and specific examples of Petition 870250086784, dated 09 / 25 / 2025, page 25 / 45 17 / 34 gene SSI2B includes DNA containing the nucleotide sequence represented by SEQ ID NO: 9.

[0061] As described above, it is known that a reduction in the expression levels of the SSI2A and SSI2B genes allows soybean plants to exhibit resistance to specific pathogens. However, it is not known that only a mutation that reduces the quantity or function of an expression product of the SSI2A gene confers resistance to the soybean rust pathogen. When the soybean plant according to the present embodiment does not contain an SSI2B gene mutation, the effects of the present invention are more significantly exhibited. Furthermore, when the soybean plant according to the present embodiment does not contain the SSI2B gene mutation described above, growth inhibition is reduced compared to a soybean plant that contains a mutation reducing the quantity or function of the expression products of both the SSI2A and SSI2B genes.

[0062] Whether a soybean plant exhibits resistance to soybean rust can be determined by methods commonly used by a specialist in the field, for example, by the method described in the examples below. More specific examples include a method of artificially infecting a soybean plant with the soybean rust pathogen and assessing whether there is resistance if the lesion area is smaller compared to a similarly infected susceptible soybean plant with the soybean rust pathogen, or whether there is no resistance (susceptible) if the lesion area is equivalent.

[0063] If a soybean plant exhibits resistance to soybean rust, it can be judged as indicative of Petition 870250086784, dated 09 / 25 / 2025, page 26 / 45 18 / 34 resistance to soybean rust is indicated when the area of ​​soybean rust lesions is 0% or more and less than 50%. If a soybean plant exhibits resistance to soybean rust, it can be judged as indicative of resistance to soybean rust when the area of ​​soybean rust lesions is 40% or less, 30% or less, or 20% or less.

[0064] [Method for evaluating soybean plants that exhibit resistance to soybean rust]

[0065] The method for evaluating a soybean plant exhibiting resistance to soybean rust according to the present embodiment (hereinafter also referred to as “the evaluation method according to the present embodiment”) includes evaluating that a soybean plant is a soybean plant exhibiting resistance to soybean rust when it contains a homozygous SSI2A gene mutation. The SSI2A gene mutation described above is a mutation that reduces the amount or function of an expression product of the SSI2A gene. The SSI2A gene mutation is as described above.

[0066] The evaluation method according to the present embodiment, since the soybean plant according to the present embodiment exhibits resistance to soybean rust, can determine that a soybean exhibits resistance to soybean rust when it contains a homozygous SSI2A gene mutation that reduces the amount or function of an SSI2A gene expression product.

[0067] In the evaluation method according to the present modality, when evaluating that a soybean plant exhibits resistance to soybean rust, it may be the case, for example, that the area of ​​the soybean rust lesion is 0% or more and less Petition 870250086784, dated 09 / 25 / 2025, p. 27 / 45 19 / 34 of 50% when the soybean plant is artificially infected with the soybean rust pathogen. Assessing that the soybean plant exhibits resistance to soybean rust may be the case if the area of ​​soybean rust lesions is 40% or less, 30% or less, or 20% or less when the soybean plant is artificially infected with the soybean rust pathogen.

[0068] The evaluation method according to the present embodiment may also include verification, prior to evaluation, that a homozygous SSI2A gene mutation is present. Verifying that a homozygous SSI2A gene mutation is present may involve verifying the SSI2A gene genotype. Verification of the SSI2A gene genotype may be performed by known methods, for example, by a method using sequence analysis, a method based on the presence or absence of restriction enzyme recognition sequences, or a method using a DNA probe.

[0069] [Method for producing soybean plants]

[0070] As described above, the evaluation method according to the present embodiment can determine a soybean plant that exhibits resistance to soybean rust. Therefore, the evaluation method according to the present embodiment can also be a method for producing a soybean plant, including selection for a soybean plant that exhibits resistance to soybean rust. In the method for producing a soybean plant according to the present embodiment, it is possible to apply the evaluation method described above according to the present embodiment without limitation.

[0071] The selection of the production method according to the present modality is carried out based on the results of Petition 870250086784, dated 09 / 25 / 2025, page 28 / 45 20 / 34 evaluation of the evaluation method of a soybean plant exhibiting resistance to soybean rust described above. The selection target in the evaluation method according to the present embodiment is not particularly limited, provided it is a soybean plant, but may be, for example, a mutant library of soybean plants with randomly introduced mutations. Specific examples of mutant libraries include a mutant library produced by Tsuda et al. (“Construction of a high-density mutant library in soybean and development of a mutant retrieval method using amplicon sequencing, BMC Genomics 16, 1014 (2015)).

[0072] The selection in the production method according to the present embodiment may be carried out only once or a plurality of times. A plurality of times is not particularly limited, but may be two or more times, three or more times, four or more times, five or more times, ten or more times, 50 or more times, or 100 or more times.

[0073] When selection in the production method according to the present embodiment is carried out a plurality of times, it may include selection for a soybean plant that exhibits resistance to soybean rust by the evaluation method according to the present embodiment, as well as selection for a soybean plant that exhibits other characteristics. Examples of other characteristics include pest resistance characteristics, stress tolerance characteristics, characteristics that are not subject to growth inhibition, characteristics that are subject to growth inhibition, and characteristics that show Petition 870250086784, dated 09 / 25 / 2025, page 29 / 45 21 / 34 morphological changes, such as cell death or yellowing of the leaves.

[0074] The production method according to the present embodiment may include the selection of a soybean plant evaluated for exhibiting resistance to soybean rust.

[0075] The production method according to this embodiment may include crossbreeding. By including crossbreeding in the production method according to this embodiment, it is possible to obtain a soybean plant with superior characteristics.

[0076] The cross may include crossing a soybean plant homozygous for a mutation in the SSI2A gene with a soybean plant homozygous for a mutation in the SSI2A gene, crossing a soybean plant heterozygous for a mutation in the SSI2A gene with a soybean plant heterozygous for a mutation in the SSI2A gene, crossing a soybean plant homozygous for a mutation in the SSI2A gene with a soybean plant heterozygous for a mutation in the SSI2A gene, crossing a soybean plant not containing a mutation in the SSI2A gene with a soybean plant heterozygous for a mutation in the SSI2A gene, or crossing a soybean plant not containing a mutation in the SSI2A gene with a soybean plant homozygous for a mutation in the SSI2A gene.

[0077] When the production method according to the present embodiment includes crossbreeding, the crossbred plants may be crossed again, and a soybean plant evaluated to exhibit resistance to soybean rust may be selected and subsequently crossed.

[0078] The production method according to this Petition 870250086784, dated 09 / 25 / 2025, pp. 30 / 45 22 / 34 modality may involve introducing a mutation into a soybean plant that does not contain a mutation in the SSI2A gene. The mutation to be introduced may be introduced into the SSI2A gene, or a random mutation may be introduced into the soybean plant.

[0079] The introduction of a mutation into the SSI2A gene is not particularly limited, but examples of it include methods that use zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and CRISPR / Cas9.

[0080] In introducing a random mutation into a soybean plant, it is sufficient to induce a random mutation in the soybean plant, which can be a physical treatment, a chemical treatment, or a combination of these treatments. Examples of physical treatments include X-ray treatment and gamma ray treatment. As for chemical treatments, for example, a mutation-inducing substance can come into contact with a soybean plant, a soybean plant can be immersed in a mutation-inducing substance, or a mutation-inducing substance can be sprayed or applied to a soybean plant. The mutation-inducing substance is not particularly limited, but examples include methyl methanesulfonate (EMS) and diepoxybutane (DEB).

[0081] When the production method according to the present embodiment does not include the step of introducing a mutant, a pre-prepared library of soybean plant mutants can be used as a selection target. Specific examples of the soybean plant mutant library include those described above. Petition 870250086784, dated 09 / 25 / 2025, page 31 / 45 23 / 34

[0082] [Selection method for soybean plants exhibiting resistance to soybean rust]

[0083] The selection method for a soybean plant exhibiting resistance to soybean rust according to the present embodiment (hereinafter also referred to as “the selection method according to the present embodiment”) includes a selection step for selecting a soybean plant containing a homozygous SSI2A gene mutation. The SSI2A gene mutation described above is a mutation that reduces the amount or function of an expression product of the SSI2A gene. The SSI2A gene mutation is as described above.

[0084] The selection step includes selecting a soybean plant containing a homozygous mutation that reduces the amount or function of an expression product of the SSI2A gene. The selection step may also include verifying that a homozygous SSI2A gene mutation is present. Verification that a homozygous SSI2A gene mutation is present can be verified by the SSI2A gene genotype. The method for verifying the SSI2A gene genotype is as described above.

[0085] The selection target is not particularly limited, as long as it is a soybean plant, but could be, for example, a mutant library of soybean plants. As an example of a mutant library of soybean plants, one could use a mutant library produced by Tsuda et al. or one obtained by producing a mutant library using the mutation induction step described below. Furthermore, it could be a mutant library obtained after selection of Petition 870250086784, dated 09 / 25 / 2025, page 32 / 45 24 / 34 soybean plants exhibiting other traits besides selecting soybean plants containing a homozygous mutation that reduces the amount or function of an expression product of the SSI2A gene. Examples of other traits include those described above.

[0086] The selection step can be performed only once or a plurality of times. The plurality of times is not particularly limited, but can be two or more times, three or more times, four or more times, five or more times, ten or more times, 50 or more times, or 100 or more times.

[0087] The selection method according to the present embodiment may also include a mutation induction step to induce a random mutation in the soybean plant prior to the selection step.

[0088] The mutation induction step may be sufficient to induce a random mutation in the soybean plant, and may be a physical treatment, a chemical treatment, or a combination of these treatments. The physical and chemical treatments are as described above. Examples

[0089] Hereafter, the present invention will be described in more detail based on examples. However, the present invention is not limited to the following examples.

[0090] [Example 1: Evaluation of soybean rust resistance (1)]

[0091] <1. Mutant library of soybean plants>

[0092] For the selection of soybean plants that exhibit resistance to soybean rust, a mutant library Petition 870250086784, dated 09 / 25 / 2025, pp. 33 / 45 The 25 / 34 mutation produced by Tsuda et al. was used. More specifically, the mutant library of soybean plants was obtained by subjecting seeds of the Enrei variety soybean plant to a mutagenic treatment with 0.35% EMS (ethyl methanesulfonate) to obtain M1 soybean plants, followed by subjecting the M2 seeds obtained from the M1 soybean plants to a mutagenic treatment again with 0.35% EMS.

[0093] <2. Cultivation of soybean plants>

[0094] From the mutant library described in item 1 above, 40 seeds were randomly extracted. The 40 extracted dry seeds were conditioned under humid and low temperature conditions (100 %, 4 °C, 2 days) and then sown in cell trays. The sown seeds were cultivated for 16 days under conditions of 27 °C and a 12-hour photoperiod (red LED), and the first true leaves were inoculated with the soybean rust pathogen.

[0095] <3. Selection for soybean plants exhibiting resistance to the soybean rust pathogen>

[0096] The soybean rust pathogen used was a strain collected from kudzu in Itami City, Hyogo Prefecture. For each of the first true leaves obtained in item 2 above, spores (1 χ 105 spores / mL) suspended in sterile water containing 0.01% Silwet L77 (manufactured by Bio Medical Science Inc.) were sprayed to inoculate the soybean rust pathogen, and the inoculated first true leaves were left static for 3 weeks under conditions of 22°C to 23°C, 100% humidity, and a 12-hour photoperiod (fluorescent light). The spores Petition 870250086784, dated 09 / 25 / 2025, pages 34 / 45 26 / 34 spore-forming leaves on the first true leaves of soybean plants 3 weeks after inoculation with the soybean rust pathogen were collected and suspended in sterile water containing 0.01% Silwet L77. Moistened paper towels were placed in a plastic box measuring 25 cm long, 36 cm wide, and 5 cm high, and the soybean plant leaves were cut and arranged with the underside facing upwards. A spore suspension adjusted to 1 χ¹⁰⁵ spores / mL was sprayed at 5 mL per box, sealed with a plastic lid, and left static for 15 days under conditions of 22 °C to 23 °C and a 12-hour photoperiod (fluorescent light). Resistance to soybean rust was evaluated by measuring the area of ​​the lesion formed on the underside of the leaves 15 days after inoculation. In addition, the genotype of the soybean plants subjected to the above-described evaluation was analyzed. The results of the genotype analysis and resistance assessment (measurement of lesion area) are shown in FIG.Figure 1 shows images comparing a leaf from a soybean plant exhibiting resistance and a leaf from a soybean plant not exhibiting resistance, both of which were evaluated and compared.

[0097] The horizontal axis of FIG. 1 represents the lesion area in relation to the total area of ​​the leaves subjected to the soybean rust resistance evaluation. A soybean plant with a lesion area smaller than 50% was evaluated as a soybean plant exhibiting resistance to soybean rust.

[0098] In addition, the genotype of the soybean plants was analyzed according to the following procedure. 100 mg of soybean plant leaves were ground in liquid nitrogen. Petition 870250086784, dated 09 / 25 / 2025, pages 35 / 45 27 / 34 and the DNA was extracted using the DNeasy Plant Mini Kit (manufactured by Qiagen). The SSI2A genomic region was amplified using an SSI2A-F primer and an SSI2AR primer, and after removal of unreacted primers and dNTPs with ExoSAP-IT Express treatment (Applied Biosystems), the genotype was analyzed by Sanger sequencing using a Seq-F4 primer. Each primer is shown in Table 1 below.

[0099] [Table 1] Initiator Name Sequence (5' ^ 3') SEQ ID NO Initiator SSI2A-F TTGAACCAACCACAGAAGAACTAAA 5 Initiator SSI2A-R TAAACAGGAAAAGACAGGTGTATCC 6 Initiator Seq- F4 CCAGATGATTACTTTGTTGTTC 7

[0100] As shown in FIG. 1, soybean plants homozygous for a mutation in which the 215th glycine residue is replaced by an arginine residue in an expression product (protein) of the SSI2A gene (hereinafter referred to as “SSI2A G215R homozygous mutant soybean plants”) have been confirmed to exhibit resistance to soybean rust with a lesion area of ​​less than 50% (“homozygous” in FIG. 1). Soybean plants heterozygous for a mutation in which the 215th glycine residue is replaced by an arginine residue in an expression product (protein) of the SSI2A gene (“heterozygous” in FIG. 1) or soybean plants not containing the SSI2A gene mutation, a Petition 870250086784, dated 09 / 25 / 2025, pages 36 / 45 28 / 34 Saber, soybean plants derived from Enrei variety soybean plants that do not contain the SSI2A gene mutation, but contain other genetic mutations (“Enrei type” in FIG. 1) were confirmed to exhibit susceptibility to soybean rust with a lesion area of ​​50% or more.

[0101] Furthermore, as shown in FIG. 2, the leaf of the homozygous mutant soybean plant SSI2A G215R (FIG. 2(B)) was confirmed to have fewer soybean rust lesions and a smaller lesion area compared to the leaf of the soybean plant not containing the mutation in the SSI2A gene (FIG. 2(A)) in the expression product (protein) of the SSI2A gene.

[0102] [Example 2: Analysis of SSI2A gene expression in homozygous SSI2A mutant soybean plants]

[0103] The expression level of the SSI2A gene was analyzed according to the following procedure in homozygous SSI2A G215R mutant soybean plants produced in Example 1.

[0104] Dried seeds of homozygous SSI2A G215R mutant soybean plants were conditioned under humid, low-temperature conditions (100%, 4°C, 2 days) and then sown in cell trays. The sown seeds were incubated for 16 days under 27°C and a 12-hour photoperiod (red LED), and the first true leaves were subjected to analysis of SSI2A gene expression levels. 100 mg of leaves were milled in liquid nitrogen, and RNA was extracted using NucleoSpin (trademark) RNA Plant and Fungi (manufactured by Takara Bio Inc.). cDNA was synthesized from the extracted RNA (400 ng) using ReverTra Ace (trademark) qPCR RT Master Mix with gDNA remover (manufactured by Toyobo Co., Petition 870250086784, dated 09 / 25 / 2025, pages 37 / 45 29 / 34 Ltd.), and Ct values ​​were calculated using Thermal Cycler Dice (registered trademark) Real Time System III (Takara Bio Inc.) with the SSI2A primer and soybean actin primer shown in Table 2 below. The gene expression level of SSI2A was quantified by the comparative Ct method, using soybean actin as a reference. The results are shown in FIG. 3.

[0105] [Table 2] Sequence (5' ^ 3') SEQ ID NO SSI2A Primer CAACCTGTTTGATAACTACTCTGCC 10 CAGCCCACAAACGTATTCC 11 Soybean actin primer GAGCTATGAATTGCCTGATGG 12 CGTTTCATGAATTCCAGTAGC 13

[0106] As shown in FIG. 3, the gene expression level of SSI2A in the leaves of homozygous SSI2A mutant soybean plants G215R (homozygous SSI2A mutant type) did not show a significant difference compared to soybean plants not containing the SSI2A gene mutation, namely, soybean plants derived from Enrei variety soybean plants that do not contain the SSI2A gene mutation but contain other genetic mutations (Enrei type) and wild-type Enrei variety soybean plants (Enrei).

[0107] [Example 3: Analysis of fatty acid content in homozygous SSI2A mutant soybean plants]

[0108] SSI2A is a fatty acid desaturase that catalyzes a reaction producing oleic acid (18:1) from stearic acid (18:0). It is known that in soybean plants where the function is lost due to suppression of Petition 870250086784, dated 09 / 25 / 2025, pages 38 / 45 30 / 34 expression of the SSI2A gene, the accumulation of stearic acid increases while the accumulation of oleic acid decreases (Non-patent literature 3). The content of fatty acids accumulated in the leaves of homozygous SSI2A G215R mutant soybean plants produced in Example 1 was analyzed according to the following procedure.

[0109] Dried seeds of the homozygous mutant soybean plant SSI2A G215R were conditioned under humid, low-temperature conditions (100%, 4°C, 2 days) and then sown in cell trays. The sown seeds were incubated for 16 days under conditions of 27°C and a 12-hour photoperiod (red LED), and the first true leaves were subjected to fatty acid content analysis. The true soybean leaves were frozen and ground in liquid nitrogen. After evaporation of the liquid nitrogen, a mixture of chloroform, methanol, and water containing methyl heptadecanoate as an internal standard was added to the ground true soybean leaves, and the lipid-containing chloroform layer was collected according to the Bligh-Dyer method. Subsequently, an organic solvent was evaporated in a vacuum dryer, and the lipid fraction was concentrated.Using this method, the fatty acid content in the leaves of homozygous mutant soybean plants SSI2A G215R (homozygous mutant type SSI2A) was quantified, as well as soybean plants not containing the SSI2A gene mutation, namely, soybean plants derived from Enrei variety soybean plants that contain no SSI2A gene mutation but contain other genetic mutations (Enrei type), and wild-type Enrei variety soybean plants. Petition 870250086784, dated 09 / 25 / 2025, pages 39 / 45 31 / 34 (Enrei).

[0110] The concentrated fraction was methyl esterified using a fatty acid methylation kit (manufactured by Nacalai Tesque, Inc.) and the methyl esterified sample was analyzed by gas chromatography-mass spectrometry (GC-MS). Specifically, a system combining an Agilent 7890A gas chromatography system and an Agilent 5975C mass selective detector with a column was used. DB-5MS (30 m long, 0.25 mm internal diameter, 0.25 μm film thickness). Helium gas (flow rate: 1 mL / min) was used as the carrier gas for the analysis, and 1 μL of the methyl esterified sample was injected in a 20:1 ratio. The temperature program of an oven... GC was increased from 120 °C to 240 °C over 40 minutes. The analysis data were processed using Agilent MSD ChemStation software, and the fatty acids present in the sample were quantified by applying the internal standard method based on the peak areas of the measured components. The results are shown in FIG. 4.

[0111] As shown in FIG. 4, in the homozygous SSI2A mutant type (G215R in FIG. 4), stearic acid accumulation increased significantly at a 5% level compared to the Enrei type (G215 in FIG. 4) and Enrei type (WT in FIG. 4) (FIG. 4(A)). Although there was no significant difference in oleic acid accumulation between the homozygous SSI2A mutant type (G215R in FIG. 4), the Enrei type (G215 in FIG. 4), and Enrei type (WT in FIG. 4), a trend toward decreasing oleic acid accumulation was observed in the homozygous SSI2A mutant (G215R in FIG. 4) (FIG. 4(B)). Based Petition 870250086784, dated 09 / 25 / 2025, pages 40 / 45 32 / 34 in the above, it is considered that the G215R mutation is a mutation that results in the loss of SSI2A function.

[0112] [Example 4: Evaluation of soybean rust resistance (2)]

[0113] Soybean rust resistance was evaluated using the same method as in Example 1, and the genotype of a soybean plant subjected to the evaluation described above was analyzed.

[0114] As a result of evaluating soybean rust resistance and analyzing the genotype of soybean plants, soybean plants homozygous for a mutation in which the 186th glycine residue is replaced by an aspartic acid residue in the expression product (protein) of the SSI2A gene (hereinafter referred to as the homozygous SSI2A G186D mutant soybean plants) were obtained. Furthermore, in the homozygous SSI2A G186D mutant soybean plants, as shown in FIG. 5, it was confirmed that most soybean plants had a lesion area smaller than 50% and exhibited resistance to soybean rust ("homozygous" in FIG. 5). On the other hand, in soybean plants not containing the mutation in the gene In SSI2A (Enrei type” in FIG. 5) and in wild-type Enrei soybean plants (Enrei” in FIG. 5), it was confirmed that most soybean plants had a lesion area of ​​50% or more and exhibited susceptibility to soybean rust.

[0115] [Example 5: Effect of amino acid substitutions in SSI2A]

[0116] The effect of amino acid substitutions was estimated from a predicted three-dimensional structure. Petition 870250086784, dated 09 / 25 / 2025, pages 41 / 45 33 / 34 of the SSI2A protein. SSI2 requires the coordination of two iron ions for its activity, and iron ion ligands and bridge ligands have been predicted in SACPD-C, one of the soybean SSI2 variants (Naoufal Lakhssassi, et al., Plant Physiology, Volume 174, Issue 3, July 2017, 1531 - 1543). The three-dimensional structure of soybean SSI2A was predicted by inserting the amino acid sequence of SEQ ID NO: 1 into Alpha-Fold2 (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb). The predicted three-dimensional structure of soybean SSI2A is shown in FIG. 6. FIG. 6 and Table 3 show the amino acid residues of the iron ion ligands and bridge ligands, which are required for activity, as predicted based on the literature described above on SACPD-C (right panel of FIG. 6).

[0117] Since the 186th glycine residue is located in the immediate vicinity where iron ions are coordinated, it is considered highly likely that its mutation affects the coordination of iron ions and, consequently, the activity of SSI2A. Furthermore, based on the results of Examples 1 to 5, it is considered that soybean plants homozygous for a mutation that reduces the function of the SSI2A gene exhibit resistance to soybean rust, similarly to homozygous SSI2A G215R mutant soybean plants and homozygous SSI2A G186D mutant soybean plants. Furthermore, from this, it is considered that soybean plants homozygous for a mutation that reduces the amount of an expression product of the SSI2A gene similarly exhibit resistance to soybean rust. Petition 870250086784, dated 09 / 25 / 2025, pp. 42 / 45 34 / 34

[0118] [Table 3] Iron ion ligands E144 144° Glutamic acid H185 185° Histidine E235 235° Glutamic acid H271 271° Histidine Bridge ligands E182 182° Glutamic acid E268 268° Glutamic acid Mutation analyzed in Example 5 G186D 186° Histidine G215R 215° Histidine Petition 870250086784, dated 09 / 25 / 2025, pages 43 / 45

Claims

1 / 3 CLAIMS 1. A soybean plant exhibiting resistance to soybean rust characterized in that: the soybean plant comprises a homozygous SSI2A gene mutation, and wherein the SSI2A gene mutation is a mutation that reduces the amount or function of an SSI2A gene expression product.

2. Soybean plant, according to claim 1, characterized in that a function of producing oleic acid from stearic acid is reduced.

3. Soybean plant, according to claim 1, characterized in that the SSI2A gene mutation comprises a mutation in which an amino acid residue corresponding to the 215th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an arginine residue, and / or a mutation in which an amino acid residue corresponding to the 186th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an aspartic acid residue.

4. Soybean plant, according to any one of claims 1 to 3, characterized in that it does not contain a mutation of the SSI2B gene.

5. Method for evaluating a soybean plant exhibiting resistance to soybean rust characterized in that it comprises: evaluating that a soybean plant is a soybean plant exhibiting resistance to soybean rust when the soybean plant comprises a homozygous SSI2A gene mutation, Petition 870250079616, dated 05 / 09 / 2025, page 57 / 71 2 / 3, wherein the SSI2A gene mutation is a mutation that reduces the quantity or function of an SSI2A gene expression product.

6. Evaluation method according to claim 5, characterized in that a function of the soybean plant in producing oleic acid from stearic acid is reduced.

7. Evaluation method, according to claim 5, characterized in that the SSI2A gene mutation comprises a mutation in which an amino acid residue corresponding to the 215th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an arginine residue, and / or a mutation in which an amino acid residue corresponding to the 186th glycine residue of the amino acid sequence represented by SEQ ID NO: 1 is replaced by an aspartic acid residue.

8. A method for producing a soybean plant, characterized in that it comprises: selecting a soybean plant that exhibits resistance to soybean rust by means of the evaluation method as defined in any one of claims 5 to 7.

9. Selection method for a soybean plant exhibiting resistance to soybean rust characterized in that it comprises: a selection step for selecting a soybean plant comprising a homozygous SSI2A gene mutation in soybean plants, wherein the SSI2A gene mutation is a mutation that reduces the quantity or function of an expression product of the SSI2A gene. Petition 870250079616, dated 05 / 09 / 2025, page 58 / 71 3 / 3

Images