Nucleic acid molecule comprising ITR modified asymmetrically to improve the expression rate of the inserted gene and its use.
Patent Information
- Application Number
- BR112025020505
- Authority / Receiving Office
- BR · BR
- Patent Type
- Applications
- Publication Date
- 2026-08-25
Smart Images

Figure 00000000_0000_ABST
Description
1 / 46 Nucleic acid molecule comprising ITR modified asymmetrically to improve gene expression rate. INSERTED AND USED Technical Field
[001] The present disclosure relates to a nucleic acid molecule including a modified ITR, an adeno-associated virus vector including the same and use thereof for gene therapy. Technical Background
[002] An adeno-associated virus (AAV) is a single-stranded DNA virus with a genome size of approximately 4.6 kbp, which is a human parvovirus dependent on a helper vector. The genome consists of ITRs at both ends and two open reading frames (ORFs), rep and cap. The N-terminal region of the genome encodes a rep gene involved in viral replication and viral gene expression, and the C-terminal region encodes a cap gene that encodes a viral capsid protein. ITRs are involved in the replication of an AAV genome and the packaging of AAV particles.
[003] On the other hand, an AAV gene delivery vehicle is safe as a delivery vehicle from a non-pathogenic human virus and has a wide host range without inducing a cellular immune response. In addition, an AAV gene delivery vehicle is capable of delivering genes to undivided cells and dividing cells and, in particular, the expression of a gene delivered by an AAV gene delivery vehicle is characterized by long-term persistence in vivo.
[004] However, due to its inverted terminal repeat (ITR), AAV has a problem with low DNA packaging capacity, because a protein-coding sequence of up to about 4.4 kb can be encapsulated. In addition, there is also the problem of a reduced rate of Petition 870250103897, dated 11 / 13 / 2025, page 13 / 69 2 / 46 Expression of the released gene, due to mutual competition between the two strands, occurs when the gene inserted in the 3'^5' direction and the gene inserted in the 5'^3' direction are expressed in a host cell genome. In addition, the released gene has the potential to cause cancer when inserted into the host cell genome.
[005] Therefore, there is a need to develop an AAV complex as a gene delivery vehicle, with improved DNA packaging capacity, a lower probability of insertion into the chromosome of infected cells, and improved productivity and expression efficiency, due to ITR modification, which is a characteristic of AAVs. Revealing the Invention Technical Problem
[006] One embodiment relates to a nucleic acid molecule comprising a gene expression cassette between a first inverted terminal repeat (ITR) and a second ITR, wherein the gene expression cassette comprises a heterologous polynucleotide sequence, and wherein either of the first ITR and the second ITR comprises at least one nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having at least about 75% sequence identity with a nucleotide sequence of either of the SEQ ID NOs: 1 to 9, or a functional derivative thereof. In the nucleic acid molecule, the nucleotide sequence of either of the first ITR and the second ITR has at least about 95% sequence identity with a nucleotide sequence of either of the SEQ ID NOs: 1 to 9, or a functional derivative thereof.Alternatively, in the nucleic acid molecule, the nucleotide sequence of either the first ITR or the second ITR is selected from any of the SEQ ID NOs: 1 to 9, or a functional derivative thereof. Alternatively, in the nucleic acid molecule... Petition 870250103897, dated 11 / 13 / 2025, p. 14 / 69 3 / 46 Either of the first and second ITR sequences consists of a nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof. The first ITR sequence and the second ITR sequence may be based on an ITR sequence of a virus belonging to the genus Dependovirus of the family Parvoviridae. The first ITR sequence and the second ITR sequence may be based on an ITR sequence of an adeno-associated virus (AAV). The first ITR sequence and the second ITR sequence can each be independently based on an ITR sequence from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.In the nucleic acid molecule, the first ITR is a wild-type AAV ITR, and the second ITR comprises at least one nucleotide sequence or a complementary sequence thereto, the nucleotide sequence of the second ITR having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9, or a functional derivative thereof. Alternatively, in the nucleic acid molecule of claim 1, the first ITR is a wild-type AAV ITR, and the second ITR consists of a nucleotide sequence or a complementary sequence thereto, the nucleotide sequence of the second ITR having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereto.Alternatively, in the nucleic acid molecule, the first ITR is a wild-type AAV ITR, and the second ITR essentially consists of any sequence selected from nucleotide sequences with SEQ ID numbers 1 to 9. Alternatively, in the molecule. Petition 870250103897, dated 11 / 13 / 2025, p. 15 / 69 4 / 46 of nucleic acid, the first ITR is a wild-type AAV ITR, and the second ITR consists essentially of a nucleotide sequence with SEQ ID NO: 1. In the nucleic acid molecule, in either the first and second ITRs, all or part of a stem-loop structure, which is formed by a rep linking element (RBE), regions RBE', A, A', B, B', C, C', and D, may be modified. Alternatively, in the nucleic acid molecule, either the first and second ITRs are modified to not form a stem-loop structure. Alternatively, in the nucleic acid molecule, in either the first and second ITRs, all or part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C', and D, may be deleted. In the nucleic acid molecule, the gene expression cassette may additionally comprise at least one promoter and one polyadenylation sequence.In a nucleic acid molecule, a heterologous polynucleotide sequence can encode a therapeutic gene.
[007] Another embodiment relates to a vector comprising the nucleic acid molecule described immediately above and throughout this disclosure. The vector may be an AAV vector.
[008] Yet another embodiment relates to a composition comprising the vector described in the present invention and a pharmaceutically acceptable carrier. The composition may be for delivering a therapeutic gene for gene therapy. Solution to the Problem
[009] Detailed reference will now be made to the embodiments, which are illustrated in the attached drawings, where similar reference numbers refer to similar elements throughout the document. In this sense, the present embodiments may have different forms and should not be interpreted as limited to the descriptions set out herein. Petition 870250103897, dated 11 / 13 / 2025, p. 16 / 69 5 / 46 invention. Therefore, embodiments are merely described below, with reference to the figures, to explain aspects of the present descriptive report. As used in the present invention, the term and / or includes any and all combinations of at least one of the associated listed items. Expressions such as at least one of, when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.
[010] One embodiment relates to a nucleic acid molecule including a modified inverted terminal repeat.
[011] Another modality is related to a vector including the nucleic acid molecule.
[012] Another modality is related to a cell transformed by the vector.
[013] Another modality is related to a method of releasing a transgene, including administering an effective amount of the vector.
[014] Another modality is related to a gene therapy method, including the administration of an effective amount of the vector.
[015] Another embodiment relates to a method of treating an individual's disease, including administering the effective amount of the vector described in the present invention to an individual who needs it.
[016] Another modality is related to a composition including the vector.
[017] Another modality is related to the use of the vector for gene therapy.
[018] Additional modalities will be presented in part in the following description and, in part, will be apparent from the description or can be learned by practicing the presented modalities of revelation. Petition 870250103897, dated 11 / 13 / 2025, page 17 / 69 6 / 46
[019] One embodiment relates to a nucleic acid molecule including a modified inverted terminal repeat (ITR).
[020] The term nucleic acid molecule, as used in the present invention, is used interchangeably with nucleic acid, nucleotide and polynucleotide. The nucleic acid molecule refers to a polymeric form of phosphate ester or a phosphoester analog thereof of deoxyribonucleoside or ribonucleoside.
[021] In certain embodiments, the nucleic acid molecule includes a first ITR, a gene expression cassette and a second ITR.
[022] In certain embodiments, the nucleic acid molecule includes the gene expression cassette between the first ITR and the second ITR.
[023] In certain modalities, the gene expression cassette can be operationally organized between the first ITR and the second ITR.
[024] In certain embodiments, the gene expression cassette includes a heterologous polynucleotide sequence.
[025] In certain embodiments, the nucleic acid molecule may include an asymmetrically modified ITR.
[026] In certain embodiments, the ITR sequence may be based on an ITR sequence of a virus belonging to the genus Dependovirus of the family Parvoviridae.
[027] In certain modalities, the ITR sequence may be based on an AAV ITR sequence. The AAV ITR sequence is publicly known.
[028] The term adeno-associated virus (AAV), as used in the present invention, refers to a single-stranded DNA virus with a genome size of about 4.6 kbp, which is a human parvovirus dependent on a helper vector. The genome consists of ITRs at both ends and two stages of Petition 870250103897, dated 11 / 13 / 2025, p. 18 / 69 7 / 46 open reading frames (ORFs), rep and cap. The N-terminal region of the genome encodes a rep gene involved in viral replication and viral gene expression, and the C-terminal region encodes a cap gene that encodes a viral capsid protein. ITRs are involved in the replication of an AAV genome and the packaging of AAV particles. The ITR includes a rep linking element (RBE), RBE', A, A', B, B', C, C' and D regions that form a stem-loop structure. The structure of AAV ITRs is well described, for example in Goncalves, MA Virology Journal, 2(1):43 (2005), which is incorporated into the present invention by reference.
[029] In certain embodiments, AAV may include, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, etc., and may also include other AAV serotypes currently known or to be discovered later. AAV may include derivatives of known AAV. Also, or alternatively, AAV may include modified or artificial AAV.
[030] Thus, in certain embodiments, the ITR sequence may be based on an ITR sequence of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. The ITR sequence may be based on an ITR sequence of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9. The first ITR and the second ITR may be based on ITR sequences of the same or different AAV serotypes.
[031] In certain embodiments, the nucleic acid molecule may include a gene expression cassette between a first ITR and a second ITR, wherein the gene expression cassette includes a heterologous polynucleotide sequence, and either the first ITR and the second ITR may include at least one nucleotide sequence or a complementary sequence of Petition 870250103897, dated 11 / 13 / 2025, p. 19 / 69 8 / 46 same, the nucleotide sequence having about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof.
[032] The term functional derivative, as used in the present invention, may mean a derivative that has substantially the same functional properties. The derivative refers to a similar compound obtained by chemically altering a part of the structure of a compound. The derivative may refer to a compound in which a hydrogen atom or a specific atomic group in a compound is replaced with another atom or atomic group. A method for preparing derivatives of a compound while maintaining substantially the same functional properties is known in the art.
[033] The term sequence identity, as used in the present invention, refers to a degree of identity of amino acid or base residues between sequences after alignment of both sequences to maximize matching in a specific comparison region. A percentage of sequence identity can be determined using a known sequence comparison program, and examples thereof include BLASTN (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc) and the like.
[034] The term about, as used in the present invention, is used to include a range of ±10% of a designated numerical value.
[035] In certain embodiments, the present invention describes a nucleic acid molecule comprising a gene expression cassette between a first inverted terminal repeat (ITR) and a second ITR, in Petition 870250103897, dated 11 / 13 / 2025, page 20 / 69 9 / 46 that the gene expression cassette comprises a heterologous polynucleotide sequence, and wherein either the first ITR or the second ITR comprises at least one nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having at least about 75% sequence identity with a nucleotide sequence of either SEQ ID NOs: 1 to 9, or a functional derivative thereof. Alternatively, the nucleotide sequence of either the first ITR or the second ITR has at least about 95% sequence identity with a nucleotide sequence of either SEQ ID NOs: 1 to 9, or a functional derivative thereof. Alternatively, the nucleotide sequence of either the first ITR or the second ITR is selected from either SEQ ID NOs: 1 to 9, or a functional derivative thereof.In certain embodiments, either the first ITR or the second ITR consists of a nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof. In the nucleic acid molecule, the first ITR sequence and the second ITR sequence may be based on an ITR sequence of a virus belonging to the genus Dependovirus of the family Parvoviridae. In the nucleic acid molecule, the first ITR sequence and the second ITR sequence may be based on an ITR sequence of an adeno-associated virus (AAV). In the nucleic acid molecule, the first ITR sequence and the second ITR sequence can each be independently based on an ITR sequence from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.In this sense, the origins of the first ITR sequence and the second ITR sequence could be... Petition 870250103897, dated 11 / 13 / 2025, p. 21 / 69 10 / 46 the same or different.
[036] The sequence with SEQ ID NO: 1 may be based on an ITR sequence from AAV2.
[037] The sequence with SEQ ID NO: 2 may be based on an ITR sequence from AAV1.
[038] The sequence with SEQ ID NO: 3 may be based on an ITR sequence from AAV3.
[039] The sequence with SEQ ID NO: 4 may be based on an ITR sequence from AAV4.
[040] The SEQ ID NO: 5 sequence may be based on an ITR sequence from AAV6.
[041] The sequence with SEQ ID NO: 6 may be based on an ITR sequence from AAV7.
[042] The sequence with SEQ ID NO: 7 may be based on an ITR sequence from AAV5.
[043] The sequence with SEQ ID NO: 8 may be based on an ITR sequence of AAV8.
[044] The SEQ ID NO: 9 sequence may be based on an ITR sequence of AAV9.
[045] In certain embodiments, the SEQ ID NOs: 1 to 9 sequences may have a portion of an AAV ITR sequence omitted. The SEQ ID NOs: 1 to 9 sequences may include a terminal resolution site (trs) sequence and an RBE sequence between the AAV ITR sequences. The SEQ ID NOs: 1 to 9 sequences may have all C, C', B', B, RBE', A' and D sequences omitted after RBE between the AAV ITR sequences.
[046] In certain embodiments, either of the first ITR and the second ITR may consist of a nucleotide sequence or a sequence Petition 870250103897, dated 11 / 13 / 2025, p. 22 / 69 11 / 46 complementary to it, the nucleotide sequence having about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof.
[047] In certain embodiments, the nucleic acid molecule may include an asymmetrically modified ITR. In one embodiment, the nucleic acid molecule may have either a first ITR and a second ITR modified. In another embodiment, the nucleic acid molecule may have a first ITR modified and a second ITR unmodified. In another embodiment, the nucleic acid molecule may have a first ITR unmodified and a second ITR modified. In another embodiment, the nucleic acid molecule may have a 5'-ITR from an unmodified (+) strand of a transgene and a 3'-ITR from a modified (+) strand. In another embodiment, the nucleic acid molecule may have a 5'-ITR from the (-) strand of the transgene modified and a 3'-ITR from an unmodified (-) strand. In other words, the fact that the second ITR is modified may mean that the 3'-ITR from the (+) strand and / or the 5'-ITR from the (-) strand of the transgene are modified.
[048] In certain embodiments, since an AAV vector including a nucleic acid molecule can have higher AAV vector productivity, higher transgene expression rate, and reduced genotoxicity, by including an asymmetrically modified ITR, the AAV complex can be used as an AAV delivery vehicle platform to release multiple genes into target cells. In addition, the AAV vector including a nucleic acid molecule can be used as a delivery vehicle to express a transgene with high efficiency for a short period of time, while suppressing the Petition 870250103897, dated 11 / 13 / 2025, p. 23 / 69 12 / 46 long-term transgene expression in a host cell.
[049] In certain modalities, between the first ITR and the second ITR, the unmodified ITR may be a wild ITR. Between the first ITR and the second ITR, the unmodified ITR may be a wild ITR of AAV.
[050] In certain embodiments, between the first ITR and the second ITR, the unmodified ITR may be a functional derivative having substantially the same functional properties as a wild-type ITR (e.g., wild-type ITR of AAV).
[051] In one embodiment, a first ITR may be a wild-type AAV ITR, and a second ITR may include at least one nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof.
[052] In another embodiment, a first ITR may be a wild-type AAV ITR, and a second ITR may consist of a nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof.
[053] In another embodiment, a first ITR may be a wild-type AAV ITR, and a second ITR may include at least one nucleotide sequence having about 75% or more, about 80% or more, about 85% Petition 870250103897, dated 11 / 13 / 2025, p. 24 / 69 13 / 46 or more, approximately 90% or more, approximately 95% or more, approximately 96% or more, approximately 97% or more, approximately 98% or more, approximately 99% or more, or 100% sequence identity with a nucleotide sequence of any of the SEQ ID Nos: 1 to 9.
[054] In another embodiment, a first ITR may be a wild-type AAV ITR, and a second ITR may consist of a nucleotide sequence having about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9.
[055] In another embodiment, a first ITR may be a wild-type AAV ITR, and a second ITR may include at least one nucleotide sequence from any of the SEQ ID NOs: 1 to 9.
[056] In another embodiment, a first ITR may be a wild-type AAV ITR, and a second ITR may consist of, or consist essentially of, a nucleotide sequence of any of the SEQ ID NOs: 1 to 9.
[057] In another embodiment, the first ITR may be a wild-type AAV ITR, and the second ITR may consist of, or consist essentially of, a nucleotide sequence of SEQ ID NO: 1.
[058] In certain embodiments, in either of the first ITR and second ITR, all or part of a stem-loop structure, which is formed by a rep linking element (RBE), regions RBE', A, A', B, B', C, C' and D, may be modified.
[059] In one embodiment, modification of the stem-loop structure can be selected from an insertion, a deletion, and a replacement. Petition 870250103897, dated 11 / 13 / 2025, p. 25 / 69 14 / 46
[060] In one embodiment, the modification of the stem-loop structure includes modification to include a single stem and a single loop. For example, the modified ITR may include the deletion of a BB' arm so that a CC' arm remains, or the deletion of the CC' arm so that the BB' arm remains.
[061] In one embodiment, the modification of the stem-loop structure includes modification to include a single stem instead of two loops. For example, a modified ITR may include the deletion of a BB' arm and a C-C' arm.
[062] In one embodiment, the modified ITR may include a deletion of a C' region so that a truncated C-loop and a BB' arm remain. Similarly, the modified ITR may include a deletion of a B region so that a truncated B-loop and a CC' arm remain.
[063] In one embodiment, the modified ITR may include a deletion of a base pair in at least one selected portion from a C portion, a C' portion, a B portion, or a B' portion, so that a single arm can be formed, as complementary base pairs occur between a C portion and a B' portion and between a C' portion and a B portion.
[064] In one embodiment, the modified ITR may include a modification (e.g., deletion, substitution, or addition) of 1, 2, 3, 4, 5, or 6 nucleotides in at least one region selected from A' and C, between C and C', between C' and B, between B and B', and between B' and A.
[065] In one embodiment, modification of the stem-loop structure may include modification of the structure of a structural element. Specifically, modification of the structure of a structural element may include altering the height of a stem and / or altering the number of nucleotides in a loop. For example, the height of the Petition 870250103897, dated 11 / 13 / 2025, page 26 / 69 15 / 46 stem can be about 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides or more, or any range of nucleotides contained within it. In another example, the loop can have about 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range of nucleotides contained within it.
[066] In another embodiment, by altering (for example, increasing or decreasing) a distance between two elements (as a non-limiting example, RBE and a hairpin), the functional interaction with a large Rep protein can be altered. For example, the distance can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides or more, or any range of nucleotides contained therein.
[067] In one embodiment, either of the first ITR and the second ITR can be modified so as not to form a stem-loop structure. In another embodiment, the first ITR can be modified so as not to form a stem-loop structure. In another embodiment, the second ITR can be modified so as not to form a stem-loop structure. In another embodiment, the first ITR may not be modified, and the second ITR can be modified so as not to form a stem-loop structure.
[068] The expression modified to not form a stem-loop sequence (hairpin structure) may mean that an ITR structure is modified to exist as an open or free end without forming a stem-loop structure (hairpin structure), due to a modification of an ITR sequence. An AAV vector including a nucleic acid molecule described in the present invention is modified so that neither the first ITR nor the second ITR forms a stem-loop structure (hairpin structure), to suppress the formation of a circular dimer and a circular concatemer in infected cells, and to suppress integration into the host genome, which is observed in AAV. In addition, the productivity of the AAV vector and the rate of Petition 870250103897, dated 11 / 13 / 2025, page 27 / 69 16 / 46 transgene expression can be increased by modification.
[069] In one embodiment, either of the first ITR and the second ITR can be modified to a blunt end. In another embodiment, either of the first ITR and the second ITR can be modified to an adhesive end. In another embodiment, the second ITR can be modified to a blunt end or a sticky end. In another embodiment, the second ITR can be modified to a blunt end. The modification to a blunt end or a sticky end can be performed using a method known to a person skilled in the art.
[070] In one embodiment, in either the first ITR or the second ITR, all or part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C' and D, may be excluded. In another embodiment, in either the first ITR or the second ITR, part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C' and D, may be excluded. In yet another embodiment, either the first ITR or the second ITR may include a trs sequence and an RBE sequence, and may have all sequences C, C', B', B, RBE', A' and D after RBE excluded. In another embodiment, the first ITR may not be modified, and the second ITR may include a trs sequence and an RBE sequence, and may have all sequences C, C', B', B, RBE', A' and D after RBE excluded.
[071] In general, an RNA polymerase generates mRNA having a sequence complementary to a target gene in a promoter region. The process is called transcription, and transcription occurs in the 5' to 3' direction. Meanwhile, when a target gene is inserted into the AAV vector, the gene is inserted in the 5' to 3' and 3' to 5' directions, respectively, relative to the DNA double helix of the AAV vector. Therefore, while transcription of the target gene is in Petition 870250103897, dated 11 / 13 / 2025, page 28 / 69 17 / 46 progress, the transcription of the target gene occurs in both directions due to the double helix structure of the AAV vector DNA, and thus there is a problem that the expression efficiency of the target gene is reduced due to interference. However, the AAV vector including a nucleic acid molecule described in the present invention can enhance the expression efficiency of a target gene by avoiding interference from the double helix structure of the AAV vector DNA during the transcription of a target gene, by modifying the stemloop structure, specifically, by deleting all or part of the stemloop structure.
[072] For example, in an AAV vector including a nucleic acid molecule containing an asymmetrically modified ITR, a first ITR may not be modified, and a second ITR may be modified so as not to form a stem-loop structure. Consequently, the 5'-ITR of the (-) strand of a transgene does not form a hairpin structure, and transcription of the transgene proceeds complementarily to the corresponding strand in the 5' to 3' direction. Meanwhile, on the (+) strand of the transgene, the 3'-ITR does not form a hairpin structure, and transcription of the transgene does not occur on the corresponding strand. That is, since only transcription in the 5' to 3' direction of the released gene proceeds, and a competitor in the 3' to 5' direction is removed, gene expression efficiency can be increased.
[073] In one example, in an AAV vector including multiple transgenes, an AAV complex (pAAV-GC ITR vector) including an asymmetrically modified ITR was prepared by partially modifying a hairpin structure of a second ITR between wild-type AAV ITRs included in the vector. Comparing the prepared AAV complex with an AAV complex in which a hairpin structure is not modified (pAAV-WT ITR vector) and an AAV complex modified so that both ends of a Petition 870250103897, dated 11 / 13 / 2025, page 29 / 69 18 / 46 hairpin structures are symmetrical (pAAV-BC del. ITR vector), the respective productivity, transgene expression rate, and genotoxicity were confirmed. As a result, it was confirmed that the AAV complex including an asymmetrically modified ITR (pAAV-GC ITR vector), compared to the AAV complex without ITR modification (pAAV-WT ITR vector) and the AAV complex including a symmetrically modified ITR (pAAV-BC del. ITR vector), showed significantly increased viral productivity and transgene expression rate, and very low genotoxicity.
[074] In certain embodiments, a nucleic acid molecule described in the present invention may include a first ITR, a gene expression cassette and a second ITR in a 5' to 3' direction.
[075] In certain embodiments, the gene expression cassette may additionally include at least one promoter and a polyadenylation sequence, in addition to a heterologous polynucleotide sequence. The gene expression cassette may include a promoter sequence, a heterologous nucleotide sequence, and a polyadenylation sequence, in the 5' to 3' direction.
[076] In certain embodiments, the gene expression cassette may additionally include post-transcriptional regulatory elements. The gene expression cassette may include a promoter sequence, a heterologous nucleotide sequence, post-transcriptional regulatory elements, and a polyadenylation sequence, in a 5' to 3' direction.
[077] The term promoter, as used in the present invention, refers to a region that regulates gene transcription. The promoter can be operatively linked to a coding sequence of a transgene. The promoter can be a tissue-specific promoter or an inducible promoter. The tissue-specific promoter is not limited in its type, provided that the promoter induces expression. Petition 870250103897, dated 11 / 13 / 2025, page 30 / 69 19 / 46 gene specifically in a specific cell or tissue type in vivo. For tissue-specific promoters, a promoter specific to a target tissue can be appropriately selected so that a corresponding transgene is expressed according to a transgene type. Non-limiting examples of tissue-specific promoters include the liver-specific thyroxine-binding globulin (TBG) promoter, the insulin promoter, the glucagon promoter, the somatostatin promoter, the pancreatic polypeptide (PPY) promoter, the synapsin-1 (Syn) promoter, the creatine kinase (MCK) promoter, the mammalian desmin (DES) promoter, the α-myosin heavy chain (α-MHC) promoter, the cardiac troponin T (cTnT) promoter, the surfactant protein C (SPC) promoter, and the like.
[078] In certain embodiments, the heterologous polynucleotide can encode a transgene.
[079] The term transgene, as used in the present invention, refers to a gene transferred from one organism to another naturally or by various genetic manipulation techniques. The term transgene can be used interchangeably with transferred gene and target gene.
[080] The transgene is not limited to a specific type, as long as it is a gene targeted to be introduced into a host cell. In certain embodiments, since an AAV vector including a nucleic acid molecule has advantages of improved AAV productivity, an improved transgene expression rate, and reduced genotoxicity, regardless of the transgene type, the AAV complex can be used as an AAV delivery vehicle platform to deliver multiple transgenes.
[081] In one embodiment, the transgene may be a therapeutic gene. When the transgene is a therapeutic gene, the AAV vector including a Petition 870250103897, dated 11 / 13 / 2025, p. 31 / 69 The nucleic acid molecule described in the present invention can be used as a gene therapy agent. Therefore, the AAV vector including the nucleic acid molecule can be an AAV vector for gene therapy.
[082] In one embodiment, the transgene may be GFP, luciferase, TP53, RPE65, TPP1, or FVIII, but is not limited to these. When the transgene is TP53, the AAV transgene-releasing complex may be used as a gene therapy agent for anticancer treatment. When the transgene is RPE65, the AAV transgene-releasing complex may be used as a gene therapy agent to treat hereditary retinal diseases (IRDs). When the transgene is TPP1(CLN2), the AAV transgene-releasing complex may be used as a gene therapy agent to treat Batten disease. When the transgene is FVIII, the AAV transgene-releasing complex may be used as a gene therapy agent to treat hemophilia.
[083] In certain forms, the transgene can be derived from a human or an animal.
[084] In certain embodiments, the post-transcriptional regulatory element may include a post-transcriptional regulatory element from the marmot hepatitis virus (WPRE).
[085] In one embodiment, the gene expression cassette may additionally include a gene junction between the promoter and the polynucleotide sequence encoding a transgene.
[086] The term gene junction, as used in the present invention, refers to a sequence that is not defined and is located between the end of a promoter and the beginning of a target gene sequence. Specifically, a promoter is a site where the transcription machinery is intricately linked to regulate genes, and a boundary, between the end of a known promoter sequence and the initial region of a gene whose expression is to be controlled, is Petition 870250103897, dated 11 / 13 / 2025, page 32 / 69 21 / 46 is generally ambiguous. Thus, optimization of the junction may be necessary to build a successful relationship between promoter and gene expression. A sequence of the genetic junction can be appropriately selected by a person skilled in the art according to a method in the art.
[087] Another embodiment relates to a vector including a nucleic acid molecule described in the present invention.
[088] The details of the nucleic acid molecule are as described above.
[089] The term vector refers to any vehicle for the release into host cells and / or cloning of nucleic acid molecules.
[090] In certain modes, the vector may be an AAV vector.
[091] In certain embodiments, alternatively, other types of viruses belonging to the genus Dependovirus of the family Parvoviridae may be used instead of AAV.
[092] The term AAV vector, used in the present invention, can be used interchangeably with AAV complex, AAV delivery vehicle, recombinant AAV and recombinant AAV vector.
[093] The vector can be manipulated to encode selectable markers or reporters that provide means for selection or identification of cells that have incorporated them. Selectable markers or reporters are known in the state of the art. Non-limiting examples of selectable markers include genes that confer resistance to ampicillin, streptavidin, kanamycin, hygromycin, and the like. Non-limiting examples of reporters include luciferase, green fluorescent protein (GFP), and the like.
[094] Another embodiment relates to a cell transformed by a vector described in the present invention.
[095] The vector details are as described above. Petition 870250103897, dated 11 / 13 / 2025, page 33 / 69 22 / 46
[096] In certain forms, the cell can be a host cell.
[097] The term transformation, as used in the present invention, means that the genetic properties of an organism are altered by DNA introduced from outside. Transformation is a phenomenon in which DNA enters a cell and alters hereditary characteristics when DNA, a type of nucleic acid extracted from a cell line of one organism, is injected into a living cell of another cell line. That is, transformation means introducing a gene into a host cell so that it can be expressed in it.
[098] In certain embodiments, a method of transforming a cell line by introducing an AAV complex may be a method known in the state of the art, for example, transient transfection using lipofectamine, etc. microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE-mediated dextran transfection, polybrene-mediated transfection, electroporation, etc., but is not limited to these, and preferably, the lipofectamine 2000 reagent may be used for transformation.
[099] Another embodiment relates to a method of delivering a transgene to an individual, including administering an effective amount of the vector described in the present invention to the individual who needs it.
[100] Yet another embodiment relates to a method of gene therapy, including administering an effective amount of the vector described in the present invention to an individual in need thereof.
[101] Yet another embodiment relates to a method of treating an individual's disease, including administering the effective amount of the vector described in the present invention to the individual who Petition 870250103897, dated 11 / 13 / 2025, page 34 / 69 23 / 46 needs the same.
[102] In the methods of the aforementioned embodiments, specific details of the vector are as described in the present invention. The vector may be an AAV vector (AAV complex).
[103] In certain embodiments, in the methods described in the present invention, the vector may be administered to an individual by itself, or the vector may be formulated in a form manageable for an individual and administered to the individual. In one embodiment, the vector may be administered to an individual in the form of a composition including a vector described in the present invention. For example, the vector may be formulated in a composition including the vector and a pharmaceutically acceptable carrier and administered to an individual.
[104] In certain modalities, the individual may need the expression of a transgene released by the AAV complex. The individual may suffer from or be highly likely to suffer from a disease to which gene therapy is applicable. The individual may suffer from or be highly likely to suffer from a disease that can be treated by the expression of a transgene released by an AAV complex. The individual may be a mammal, such as a human, a cow, a horse, a pig, a dog, a sheep, a goat, or a cat.
[105] The term gene therapy, as used in the present invention, refers to treatment that uses genes to treat or prevent a disease. AAV vectors for delivering therapeutic genes into cells can be used as gene therapy agents. Diseases to which gene therapy can be readily applied include, but are not limited to, diseases caused by defects in a single gene. Non-limiting examples of diseases to which gene therapy is applicable include cancer; cardiovascular disease; genetic diseases such as hereditary retinal dystrophy (IRD), Batten disease, Petition 870250103897, dated 11 / 13 / 2025, page 35 / 69 24 / 46 hemophilia, cystic fibrosis, muscular dystrophy, thalassemia and sickle cell anemia; cranial nervous system disease; infectious disease (acquired immunodeficiency syndrome, etc.); joint disease, etc.
[106] In certain modalities, the cancer may be a cancer in which a cancer suppressor gene is inactivated. In certain other modalities, the cancer may be a KRAS-mutated cancer. In certain modalities, the cancer may be a solid KRAS-mutated cancer. In certain modalities, the cancer may be a KRAS-mutated lung cancer. In certain modalities, when the activity of the cancer suppressor gene is restored, as cancerous cells are removed and normal cells remain, KRAS-mutated lung cancer can be treated. The cancer suppressor gene may be, for example, the sPD-1, VHL, MMAC1, DCC, p53, NF1, WT1, Rb, BRAC1, BRAC2, or RUNX3 genes.
[107] In one modality, lung cancer can be non-small cell lung cancer or small cell lung cancer. Non-small cell lung cancer includes, for example, squamous cell carcinoma, large cell carcinoma, lung adenocarcinoma, and the like.
[108] Therefore, in certain embodiments, an AAV complex described in the present invention can prevent or treat a disease by activating a corresponding gene in a disease caused by a decrease in the activity of a specific gene and, thus, can be used for gene therapy.
[109] The term prevention, as used in the present invention, refers to all actions that suppress or delay the onset of a disease by administering the AAV complex. The term treatment refers to all actions that improve or beneficially alter the symptoms of a disease by administering the AAV complex. Petition 870250103897, dated 11 / 13 / 2025, pp. 36 / 69 25 / 46
[110] In certain embodiments, the method may additionally include the administration of a second active ingredient to the individual. The second active ingredient may be an active ingredient to prevent or treat a disease to be treated. The active ingredient may be administered concomitantly, separately, or sequentially with the AAV complex.
[111] In certain embodiments, the AAV complex may be formulated into an injectable formulation suitable for administration by any suitable route, such as intravenous, intra-arterial, subcutaneous, intradermal, intraperitoneal, intramuscular, intra-articular or intrathecal, and may be administered to an individual. The AAV complex may be administered systemically or locally and may be administered alone or in combination with other pharmaceutically active compounds.
[112] A preferred dosage of the AAV complex may vary depending on the patient's condition and body weight, disease severity, formulation of the therapeutic agent, route and duration of administration, etc., and may be appropriately selected by those skilled in the art. In one embodiment, a dosage of the AAV complex may be from approximately 1.0x10⁶vg / kg to approximately 1.0x10¹⁶vg / kg, approximately 1.0x10⁸vg / kg to approximately 1.0x10¹⁶vg / kg, approximately 1.0x10¹⁰vg / kg to approximately 1.0x10¹⁶vg / kg, approximately 1.0x10¹⁰vg / kg to approximately 1.0x10¹⁴vg / kg, approximately 1.0x10¹²vg / kg to approximately 1.0x10¹⁴vg / kg, for example, approximately 1.0x10¹²vg / kg, approximately 1.0x10¹³vg / kg or approximately 1.0x10¹⁴vg / kg. In one particular form, the dosage of the AAV complex can be approximately 1.0 x 10¹³ g / kg. Administration can be performed once daily, several times daily, once weekly, once every 2 weeks, once every 3 weeks, or once every 4 weeks up to once a year. Petition 870250103897, dated 11 / 13 / 2025, page 37 / 69 26 / 46
[113] Another embodiment relates to a composition including a vector described in the present invention.
[114] Yet another embodiment relates to the use of the vector described in the present invention for gene therapy.
[115] The vector and gene therapy details are described above.
[116] In certain embodiments, the composition may be a gene therapy composition. In certain embodiments, the composition may be a composition for delivering a therapeutic gene for gene therapy. In certain other embodiments, the composition may be a pharmaceutical composition. The composition may additionally include a pharmaceutically acceptable carrier. The carrier may include, for example, an excipient, a diluent, or an auxiliary agent. As a carrier, a suitable carrier may be used to deliver the AAV complex into a living body. Specifically, for the carrier, a suitable carrier for formulation in a parenteral formulation (e.g., an injection formulation) may be selected. For example, for the carrier, a suitable carrier for formulation in an intravenous formulation may be selected. The carrier may be an aqueous solution, such as water or buffered saline solution and the like.
[117] In certain embodiments, the composition may be prepared in any formulation according to a method in the art. The composition may be formulated in a form suitable for delivery of an AAV vector to an individual. In certain embodiments, the composition may be formulated in an aqueous solution, for example, in water or in a buffered saline solution. In certain other embodiments, the composition may be formulated, for example, as a parenteral formulation (e.g., as an injection, for example, for bolus injection or continuous infusion). In one embodiment, the pharmaceutical composition may be formulated as an injectable formulation. Petition 870250103897, dated 11 / 13 / 2025, pp. 38 / 69 27 / 46 suitable for administration via any suitable route, such as intravenous, intra-arterial, subcutaneous, intradermal, intraperitoneal, intramuscular, intra-articular or intrathecal. In a certain embodiment, the composition may be formulated for administration via intravenous injection or subcutaneous injection. In addition, the composition may be prepared as a systemic formulation or a topical formulation. The composition may be supplied as ampoules, pre-filled syringes, small injection containers or a unit dosage form in multidose containers with added preservatives.
[118] In certain embodiments, when the composition is used for gene therapy of a specific disease, the composition may additionally include a second therapeutic agent effective in the prevention or treatment of the disease. The pharmaceutical composition may be a single composition or separate compositions.
[119] The composition may include an effective amount of the vector (e.g., AAV complex). The term effective amount in the context of the described embodiments refers to an amount that is sufficient to bring about a desired preventive or therapeutic effect when administered to an individual in need thereof. The effective amount may be selected by those skilled in the art depending on the cell or individual. The effective amount may be determined according to the severity of the disease, age, weight, health, sex and sensitivity to a therapeutic agent of a patient, time of administration, route of administration, rate of excretion, duration of treatment, factors including therapeutic agents used in combination with or concomitantly with the composition used and other factors well known in the medical field. In one embodiment, the composition may include the AAV complex at a dosage of about 1.0 x 10⁶ vg / kg to about Petition 870250103897, dated 11 / 13 / 2025, pp. 39 / 69 28 / 46 1.0x10¹⁶vg / kg, approximately 1.0x10⁸vg / kg to approximately 1.0x10¹⁶vg / kg, approximately 1.0x10¹⁰vg / kg to approximately 1.0x10¹⁶vg / kg, approximately 1.0x10¹⁰vg / kg to approximately 1.0x10¹⁴vg / kg, approximately 1.0x10¹²vg / kg to approximately 1.0x10¹⁴vg / kg, for example, approximately 1.0x10¹²vg / kg, approximately 1.0x10¹³vg / kg or approximately 1.0x10¹⁴vg / kg. In a certain embodiment, the composition may include the AAV complex at a dosage of approximately 1.0x10¹³vg / kg. The administration can be performed once a day, several times a day, once a week, once every 2 weeks, once every 3 weeks, or once every 4 weeks up to once a year. Advantageous Effects of the Invention
[120] An AAV vector including a nucleic acid molecule described in the present invention has advantages of higher productivity and efficiency of transgene expression and lower genotoxicity, by having an asymmetric ITR in which either of the two ITRs is modified and therefore can be used as an AAV delivery vehicle platform.
[121] Specifically, an AAV vector including a nucleic acid molecule described in the present invention has the following advantages: 1. The AAV vector partially omits a self-replication process in a host cell (or a packaging cell) due to the deletion of any ITR between two ITRs, and thus the packaging efficiency into viral particles is increased within the same production period, and therefore the self-replication efficiency is increased and the productivity of the AAV vector is improved compared to existing AAV complexes. 2. The expression rate (amount of expression) of a transgene is higher than that of a general wild-type (WT) AAV. 3. An AAV WT genome forms a concatemer structure that is essential for transgene recombination within infected cells. Or Petition 870250103897, dated 11 / 13 / 2025, pp. 40 / 69 29 / 46 That is, it has been reported that a transgene is inserted into a chromosome of a host cell forming a concatemer structure in the form of a polymorph in which several identical genomes are linked. On the other hand, since the AAV complex described in the present invention has an asymmetrically modified ITR, it does not form a concatemer structure and thus suppresses the insertion (i.e., recombination) of the transgene into the host chromosome. Thus, there is an advantage of reduced genotoxicity. 4. An AAV complex having an asymmetrically modified ITR is an AAV delivery vehicle platform in which transgene productivity and expression rate are enhanced and genotoxicity is reduced, thus allowing multiple genes to be delivered into target cells using the platform. Brief Description of the Figures
[122] The described features, attributes and advantages of certain modes of revelation will become more evident from the following description, taken together with the attached drawings.
[123] FIG. 1 shows a cleavage map of an adeno-associated virus (AAV) vector according to an example.
[124] FIG. 2 shows a structure of an AAV vector according to an example.
[125] FIG. 3A is a schematic diagram of an AAV vector genome including an asymmetrically modified ITR from Example 1.
[126] FIG. 3B is a schematic diagram of an AAV vector genome including an unmodified symmetric ITR from Comparative Example 1.
[127] FIG. 3C is a schematic diagram of an AAV vector genome including a symmetrically modified ITR from Comparative Example 2.
[128] FIG. 4 shows the Western blot results confirming the Petition 870250103897, dated 11 / 13 / 2025, page 41 / 69 30 / 46 productivity of AAVs from Example 1 (GC), Comparative Example 1 (WT) and Comparative Example 2 (BC-del) for GFP gene expression.
[129] FIG. 5 presents the results of qPCR viral genome quantification confirming the productivity of the AAVs from Example 1 (pAAV-GC), Comparative Example 1 (pAAV-WT) and Comparative Example 2 (pAAV-BC del) for GFP gene expression.
[130] FIG. 6 presents the results of qPCR viral genome quantification confirming the productivity of AAVs from the pAAV-GC vector, the pAAV-WT vector and the pAAV-BC del vector to express several genes (GFP, Luciferase, TP53, RPE65, TPP1 or FVIII).
[131] FIG. 7 presents the results of the confirmation of the expression of a transgene GFP in AAV complexes according to the ITR types (ITR WT, ITR BC del or ITR GC), by Western blot.
[132] FIG. 8 shows the relative expression rates (%) of a transgene in AAV complexes according to ITR types (pAAV-GC, pAAV-BC del or pAAV-WT).
[133] FIG. 9A shows the results of obtaining images of GFP expression using a fluorescence microscope at passages number P3 and P10.
[134] FIG. 9B shows the results of the schematization of Table 4 in which the ratios of cells expressing GFP are quantified.
[135] FIG. 10 shows the results of the schematization of Table 5 in which the relative levels of gene expression in P7 are quantified.
[136] FIG. 11 shows the results of PCR amplification confirming the presence or absence of concatemer formation of a transgene in a host cell. Best Method for Implementing the Invention Petition 870250103897, dated 11 / 13 / 2025, page 42 / 69 31 / 46
[137] The following are preferred examples to aid understanding of the modalities described herein. However, the following examples are provided only to facilitate understanding of the present disclosure, and the content of the present disclosure is not limited by the following examples. EXAMPLES Example 1. Preparation of an adeno-associated virus complex including asymmetrically modified ITR, for GFP gene expression. 1-1. Preparation of recombinant adeno-associated virus vectors into which a GFP gene is introduced.
[138] Recombinant adeno-associated virus (AAV) vectors were prepared into which a GFP gene is introduced. Specifically, in order to clone a chicken beta-actin promoter GFP gene (CBA-GFP), which is cloned into CS4-GFP vectors (Chungbuk National University Tumor Research Center), into AAV2 vectors, PCR amplification was performed using the primers shown in Table 1 below. In this regard, the primers were prepared by synthesizing the restriction enzymes NdeI and HindIII. After treating the amplified CBA-GFP DNA with the restriction enzymes NdeI and HindIII, the amplified CBA-GFP DNA was cloned into an NdeI-HindIII site in a multicloning site (MCS) of an empty wild-type adeno-associated virus (AAV)2 vector using a T4 DNA ligase, to obtain AAV2-CBA-GFP plasmids.Ampicillin resistance genes were removed using BspHI restriction enzyme sites present at both ends of the ampicillin resistance gene of the AAV2-CBAGFP plasmids. A kanamycin resistance gene was inserted at the site where the ampicillin resistance gene was removed. The kanamycin resistance gene was then recombined using PCR primers as shown in Table 1 below. Petition 870250103897, dated 11 / 13 / 2025, p. 43 / 69 32 / 46 [Table 1] Gene SEQ ID NO: Direction Sequence CBA-GFP 10 Forward 5'- gtgtatcatatgccaagtacgcc-3' 11 Reverse 5'- atcgataagcttgatatcaccact-3' Kanamycin 12 Forward 5'- TGTATCCG CTCATGAG AG CTCGGTCATAG CTGTTTCCTG-3' 13 Reverse 5'- GGAI 1 1 IGGTCATGAGCATGCTTAGAAAAACTCATCGAGC3' 1-2. ITR structure modification
[139] Site-directed mutagenesis was induced in order to modify a portion of a hairpin structure of a second ITR between wild-type AAV2 inverted terminal repeats (ITRs) included in the vectors prepared in Example 1-1. Specifically, between the wild-type AAV2 ITRs included in the vector, all or at least one of the sequences C, C', B', B, RBE', A', and D after RBE of the 5'-directing ITR of a GFP gene gene was deleted, using 5' phosphorylation primers from Table 2 below. For example, all sequences C, C', B', B, RBE', A', and D were deleted from RBE of the 5'-directing ITR of the GFP gene gene. Consequently, the second ITR was modified to not form a hairpin structure. As a result, an AAV complex for GFP gene expression was obtained including an asymmetrically modified ITR, in which the first ITR was not modified and the second ITR was modified.The resulting AAV complex includes an asymmetrically modified ITR, in which the first ITR is not modified and the second ITR is modified to consist of a sequence with SEQ ID NO: 1.
[140] The AAV vector including an asymmetrically modified ITR as in Example 1 was named pAAV-GC ITR (abbreviated as pAAV-GC).
[141] FIG. 1 shows a cleavage map of an AAV vector according to an example.
[142] FIG. 2 shows a structure of an AAV vector according to Petition 870250103897, dated 11 / 13 / 2025, pp. 44 / 69 33 / 46 is an example.
[143] FIG. 3A is a schematic diagram of an AAV vector genome including an asymmetrically modified ITR from Example 1. [Table 2] Name SEQ ID NO: Direction Sequence 5'-Phosphorylation 14 Forward 5'-P- cactgactcgctgcgctcggtcgtt-3' 15 Reverse 5'-P- agcgagtcagtgagcgagcgagcgc-3' Example 2. Preparation of an AAV vector including asymmetrically modified ITR for luciferase gene expression.
[144] An AAV complex, including an asymmetrically modified ITR, to express a luciferase gene was prepared in the same manner as in Example 1, except that the luciferase gene (2,387 bp; GenBank accession number M15077.1) was introduced instead of the GFP gene. Example 3. Preparation of an AAV vector including an asymmetrically modified ITR for TP53 gene expression.
[145] An AAV complex, including an asymmetrically modified ITR, to express a TP53 gene was prepared in the same manner as in Example 1, except that the TP53 gene (2,512 bp; GenBank accession number NM_000546.6) was introduced instead of the GFP gene. Example 4. Preparation of an AAV vector including an asymmetrically modified ITR, for RPE65 gene expression.
[146] An AAV complex, including an asymmetrically modified ITR, to express an RPE65 gene was prepared in the same manner as in Example 1, except that the RPE65 gene (2,605 bp; GenBank accession number NM_000329.3) was introduced instead of the GFP gene. Example 5. Preparation of an AAV vector including an asymmetrically modified ITR for TPP1 gene expression. Petition 870250103897, dated 11 / 13 / 2025, pp. 45 / 69 34 / 46
[147] An AAV complex, including an asymmetrically modified ITR, to express a TPP1(CLN2) gene was prepared in the same manner as in Example 1, except that the TPP1(CLN2) gene (1,693 bp; GenBank accession number NM_000391.4) was introduced instead of the GFP gene. Example 6. Preparation of an AAV vector including an asymmetrically modified ITR, for FVIII gene expression.
[148] An AAV complex, including an asymmetrically modified ITR, to express an FVIII gene was prepared in the same manner as in Example 1, except that the FVIII gene (673 bp; GenBank accession number NM_000132.4) was introduced instead of the GFP gene. Comparative Examples Comparative Example 1. Preparation of an AAV complex including symmetrically unmodified ITR, for GFP gene expression.
[149] An AAV complex including an unmodified symmetric ITR was prepared in the same manner as in Example 1-1, except that one clamp structure of the ITR was not modified.
[150] The AAV vector including an unmodified symmetric ITR as in Comparative Example 1 was named pAAV-WT ITR (abbreviated as pAAV-WT).
[151] FIG. 3B is a schematic diagram of an AAV vector genome including unmodified symmetric ITR from Comparative Example 1. Comparative Example 2. Preparation of an AAV complex including symmetrically modified ITR, for GFP gene expression.
[152] An AAV complex to express a GFP gene, including an ITR modified so that both ends are symmetrical to each other, was prepared in the same way as in Example 1-2, except that a C-C'-B'-RBE sequence was deleted from both ends of the ITR. Petition 870250103897, dated 11 / 13 / 2025, pp. 46 / 69 35 / 46 complex of AAV prepared in Example 1-1.
[153] The AAV vector including a symmetrically modified ITR as in Comparative Example 2 was named pAAV-BC del. ITR (abbreviated as pAAV-BC del).
[154] FIG. 3C is a schematic diagram of an AAV vector genome including a symmetrically modified ITR from Comparative Example 2. Comparative Example 3. Preparation of an AAV complex including unmodified symmetric ITR for luciferase gene expression.
[155] An AAV complex to express a luciferase gene, including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that a luciferase gene was introduced instead of a GFP gene. Comparative Example 4. Preparation of an AAV complex including symmetrically modified ITR for luciferase gene expression.
[156] An AAV complex to express a luciferase gene, including a symmetrically modified ITR, was prepared in the same manner as in Comparative Example 2, except that a luciferase gene was introduced instead of a GFP gene. Comparative Example 5. Preparation of an AAV complex including unmodified symmetric ITR, for TP53 gene expression.
[157] An AAV complex to express a TP53 gene, including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that a TP53 gene was introduced instead of a GFP gene. Comparative Example 6. Preparation of an AAV complex including symmetrically modified ITR, for TP53 gene expression. Petition 870250103897, dated 11 / 13 / 2025, pp. 47 / 69 36 / 46
[158] An AAV complex to express a TP53 gene, the AAV complex including a symmetrically modified ITR was prepared in the same manner as in Comparative Example 2, except that a TP53 gene was introduced instead of a GFP gene. Comparative Example 7. Preparation of an AAV complex including unmodified symmetric ITR, for RPE65 gene expression.
[159] An AAV complex to express an RPE65 gene, the AAV complex including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that an RPE65 gene was introduced instead of a GFP gene. Comparative Example 8. Preparation of an AAV complex including symmetrically modified ITR, for RPE65 gene expression.
[160] An AAV complex to express an RPE65 gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that an RPE65 gene was introduced instead of a GFP gene. Comparative Example 9. Preparation of an AAV complex including unmodified symmetrical ITR, for TPP1 gene expression.
[161] An AAV complex to express a TPP1 gene, the AAV complex including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that a TPP1 gene was introduced instead of a GFP gene. Comparative Example 10. Preparation of an AAV complex including symmetrically modified ITR, for TPP1 gene expression.
[162] An AAV complex to express a TPP1 gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that a TPP1 gene was Petition 870250103897, dated 11 / 13 / 2025, pp. 48 / 69 37 / 46 introduced instead of a GFP gene. Comparative Example 11. Preparation of an AAV complex including unmodified symmetric ITR, for expression of the FVIII gene.
[163] An AAV complex to express an FVIII gene, the AAV complex including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that an FVIII gene was introduced instead of a GFP gene. Comparative Example 12. Preparation of an AAV complex including symmetrically modified ITR, for FVIII gene expression.
[164] An AAV complex to express an FVIII gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that an FVIII gene was introduced instead of a GFP gene. Experimental Examples Experimental Example 1. Confirmation of AAV complex productivity.
[165] The productivity of a recombinant AAV complex according to an embodiment was confirmed.
[166] Specifically, the AAV complexes prepared in Examples 1 to 6 and Comparative Examples 1 to 12 were transfected into 293T cells, which are human embryonic kidney cells (HEKs). In this regard, a molar ratio of the HEK293 cell line: REP / CAP plasmid (Agilent): AAV complex was established as 1:1:1, and a commonly used AAV production method in the technique was followed. The AAV produced from the HEK293 lysate was obtained by ultracentrifugation, and then the amounts of viral proteins (VPs) and viral genomes were quantified by Western blot (WB) and qPCR, respectively. #1, #2, and #3 of the qPCR are biological replicas. Petition 870250103897, dated 11 / 13 / 2025, pp. 49 / 69 38 / 46
[167] FIG. 4 presents the Western blot results confirming the AAV productivity of Example 1 (GC), Comparative Example 1 (WT) and Comparative Example 2 (BC-del) for GFP gene expression.
[168] FIG. 5 presents the results of qPCR viral genome quantification confirming AAV productivity of Example 1 (pAAV-GC), Comparative Example 1 (pAAV-WT) and Comparative Example 2 (pAAV-BC del) for GFP gene expression.
[169] FIG. 6 presents the results of qPCR viral genome quantification confirming the productivity of AAV from the pAAV-GC vector, the pAAV-WT vector and the pAAV-BC del vector to express several genes (GFP, Luciferase, TP53, RPE65, TPP1 or FVIII).
[170] As a result, as shown in FIGS. 4 to 6, it was confirmed that the pAAV-GC vector had remarkably high AAV productivity even when several genes were introduced, compared to the pAAVWT vector and the pAAV-BC del vector.
[171] Therefore, it was found that, as the pAAV-GC vector, including the asymmetrically modified ITR, partially omits a self-replication process in the host cell, the packaging efficiency into viral particles increases within the same production period and, therefore, the productivity of the pAAV-GC vector was improved compared to existing AAV delivery vehicles, due to the increased self-replication efficiency. Experimental Example 2. Confirmation of gene expression rate of the AAV complex. 2-1. Confirmation of GFP gene expression rate
[172] An expression rate of a target gene of a recombinant AAV complex was confirmed according to one modality. Petition 870250103897, dated 11 / 13 / 2025, pp. 50 / 69 39 / 46 Specifically, HEK293, a cell line derived from normal fetal kidney, was infected with the same amount of AAV complexes (Example 1, Comparative Example 1, or Comparative Example 2). After 72 hours, the GFP signals expressed by the cells were photographed using an inverted fluorescence microscope. Then, each cell was disrupted to purify the proteins, the samples were loaded onto an SDS page gel, and the GFP gene expression rates were confirmed by Western blotting. The Western blot band intensities were quantified using ImageJ software. The degree of detection of the GFP protein in the sample treated with pAAV-GC vectors having the strongest band intensity was established as 100%, and each gene expression rate was quantified as a relative value. Two biological replicates were used for each group.
[173] FIG. 7 presents the results of the confirmation of the expression of a transgene GFP in AAV complexes according to the ITR types (ITR WT, ITR BC del or ITR GC), by Western blot.
[174] Table 3 shows the results of the quantification of the relative expression rates (%) of the GFP transgene in AAV complexes according to the ITR types. [Table 3] Type of ITR Relative Expression Rate (%) pAAV-WT (Comparative Example 1) 29.52 pAAV-WT (Comparative Example 1) 30.02 pAAV-BC del (Comparative Example 2) 35.85 pAAV-BC del (Comparative Example 2) 43.63 pAAV-GC (Example 1) 97.68 pAAV-GC (Example 1) 100
[175] As a result, as shown in FIG. 7 and Table 3, it was confirmed that the expression rate of the GFP gene was remarkably high when the pAAV-GC vector (Example 1) was used, compared with when the pAAV-WT vector (Comparative Example 1) and the pAAV-BC vector were used. Petition 870250103897, dated 11 / 13 / 2025, pp. 51 / 69 40 / 46 (Comparative Example 2) were used. 2-2. Confirmation of expression rates of various genes
[176] Experiments were performed to confirm the expression rates of several GFP transgenes, luciferase, TP53, RPE65, TPP1 and FVIII using Examples 1 to 6 and Comparative Examples 1 to 12 in the same manner as in Experimental Example 2-1.
[177] For the GFP and luciferase genes, the same cell line used in Experimental Example 2-1 was used. For the TP53, TPP1, RPE65, and FVIII genes, HEK293 cells in which each gene was knocked out using CRISPR / Cas9 (Synthego, USA) were used to eliminate the effects of endogenous genes present exclusively in target cells.
[178] After confirming that endogenous gene expression did not occur in the cell line, the cells were cultured in a 6-well cell culture plate. The concentration of a viral solution was adjusted so that 1.0 X 108 viral particles were treated per 1.0 X 105 cells, and the viral solution was applied to the cells. Two days after treatment with AAV, the proteins expressed from each introduced gene were detected by Western blot (WB). In this regard, the antibodies used were the following: GFP (Invitrogen A-11122), luciferase (Invitrogen PA1-179), TP53 (MA5-14067), TPP1 (PA5-102819), RPE65 (MA1-16578) and FVIII (PA5-104451). The WB band intensities were quantified using ImageJ software. The resulting pAAV-GC band was considered 100%, and the pAAV-WT and pAAV-BC del bands were quantified as relative values. Three biological replicates were used for each group.
[179] Table 4 presents the results of the quantification of the relative expression rates (%) of a transgene in AAV complexes according to the ITR types (pAAV-GC, pAAV-BC del or pAAV-WT). Petition 870250103897, dated 11 / 13 / 2025, pp. 52 / 69 41 / 46
[180] FIG. 8 shows the relative expression rates (%) of a transgene in AAV complexes according to ITR types (pAAV-GC, pAAV-BC del or pAAV-WT). [Table 4] GFP Luciferase TP53 RPE65 TPP1 FVIII pAAV-GC 100 100 100 100 100 100 pAAV-GC 97.7 98.2 97.5 98.4 99.8 98.5 pAAV-GC 99.4 92.4 96.5 98.6 97.1 95.8 pAAV-BC del 35.9 11.4 22.3 7.8 17.4 19.5 pAAV-BC del 37.8 14.5 19.5 8.8 16.6 17.4 pAAV-BC del 43.6 12.7 18.9 7.9 18.9 17.1 pAAV-WT 29.5 4.8 23.4 5.7 21.5 13.8 pAAV-WT 30.1 4.5 11.8 6.8 19.8 11.1 pAAV-WT 28.9 7.4 19.4 4.9 23.5 16.4
[181] As a result, as shown in Table 4 and FIG. 8, the expression rates of all transgenes were approximately 2 times to approximately 10 times higher when the pAAV-GC vector including the asymmetrically modified ITR was used, compared to when the pAAV-WT vector including the unmodified symmetric ITR and the symmetrically modified pAAV-BC del vector were used.
[182] Consequently, the pAAV-GC vector including the asymmetrically modified ITR was found to be usable as a delivery vehicle platform with significantly increased transgenic expression efficiency for delivering multiple transgenes into target cells. Experimental Example 3. Confirmation of AAV complex genotoxicity 3-1. Confirmation of transgene GFP insertion into the host chromosome
[183] An experiment was performed to confirm that a transgene is not recombined with a target cell chromosome when the recombinant AAV complex according to an embodiment is used. Petition 870250103897, dated 11 / 13 / 2025, pp. 53 / 69 42 / 46
[184] Specifically, H460 cells were infected with pAAV-GC (Example 1), pAAV-WT (Comparative Example 1) and pAAV-BC del (Comparative Example 2) carrying a GFP gene, respectively. Cells expressing GFP were isolated and the same number of cells were inoculated into a culture plate. The cells were subcultured by dilution at a rate of 1 / 3 every 3 days, and the genetic transmission of the GFP gene to the next generation was confirmed by monitoring the expression rates of the GFP gene.
[185] FIG. 9A shows the results of obtaining images of GFP expression using a fluorescence microscope at passages number P3 and P10.
[186] Table 5 presents the results of the confirmation of the ratios of cells expressing GFP in cultures with subculture passage numbers from P1 to P10. [Table 5] P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 pAAV-GC (Example 1) 99.000% 32.870% 11.230% 3.760% 1.040% 0.230% 0.014% 0.005% 0.002% 0.001% pAAV-BC del. (Comparative Example 2) 99.000% 33.020% 10.990% 3.880% 1.100% 0.180% 0.190% 0.250% 0.350% 0.530% pAAV-WT ITR (Comparative Example 1) 99.000% 32.960% 11.340% 3.650% 1.080% 0.220% 0.210% 0.310% 0.410% 0.580%
[187] FIG. 9B presents the results of the schematization of Table 4 in which the ratios of cells expressing GFP are quantified.
[188] As a result, as shown in FIGS. 9A and 9B and in Table 5, the expression of GFP, a transgene, was very rarely observed in cells infected with the pAAV-GC vector (Example 1) after P7. On the other hand, it was confirmed that GFP, a transgene, was continuously observed in cells infected with the pAAV-WT vector (Comparative Example 1) or the pAAV-BC del vector (Comparative Example 2). Petition 870250103897, dated 11 / 13 / 2025, pp. 54 / 69 43 / 46
[189] Consequently, it was confirmed that the genotoxicity of the genes transferred to the next generation was significantly reduced in the AAV complex of Example 1 compared to the AAV complexes of Comparative Examples 1 and 2. 3-2. Confirmation of the insertion of multiple transgenes into the host chromosome.
[190] Experiments were performed to confirm the insertion of several GFP transgenes, luciferase, TP53, RPE65, TPP1 and FVIII into a host chromosome using Examples 1 to 6 and Comparative Examples 1 to 12 in the same manner as in Experimental Example 3-1.
[191] For the GFP and luciferase genes, the same cell line used in Experimental Example 3-1 was used. For the TP53, TPP1, RPE65, and FVIII genes, HEK293 cells in which each gene was knocked out using CRISPR / Cas9 (Synthego, USA) were used to eliminate the effects of endogenous genes present exclusively in the target cells.
[192] After confirming that endogenous gene expression did not occur in the cell line, the proteins expressed from each gene introduced by AAV were detected by Western blotting. In this sense, the following antibodies were used: GFP (Invitrogen A-11122), luciferase (Invitrogen PA1179), TP53 (MA5-14067), TPP1 (PA5-102819), RPE65 (MA1-16578) and FVIII (PA5104451). The WB band intensities were quantified using ImageJ software. The resulting pAAV-WT band was considered 100%, and the pAAV-GC and pAAV-BC del bands were quantified as relative values.
[193] Table 6 shows the results (%) of the relative gene expression levels in a subculture passage number P7. [Table 6] GFP Luciferase TP53 RPE65 TPP1 FVIII pAAV-GC 1.4 0 7.4 5.1 2.2 2.4 Petition 870250103897, dated 11 / 13 / 2025, pp. 55 / 69 44 / 46 GFP Luciferase TP53 RPE65 TPP1 FVIII pAAV-BC del 94.7 88.2 92.4 74.1 81.7 95.4 pAAV-WT 100 100 100 100 100 100
[194] FIG. 10 presents the result of the schematization of Table 5 quantifying the relative levels of gene expression in P7.
[195] As a result, as shown in Table 6 and FIG. 10, transgene expression was very rarely observed in cells infected with the pAAV-GC vector in P7. On the other hand, it was confirmed that transgene expression was continuously observed in cells infected with the pAAV-WT vector or the pAAV-BC del vector.
[196] Therefore, it was confirmed that the pAAV-GC vector including an asymmetrically modified ITR had significantly reduced genotoxicity in the transfer of a transgene to the next generation compared to the pAAV-WT vector including an unmodified symmetric ITR and the symmetrically modified pAAV-BC del vector. 3-3. Determining whether the transgene forms concatemers in target cells
[197] An experiment was performed to determine whether a concatemer, found when a transgene is inserted into a host chromosome, is formed when the transgene is released to the host cell using an AAV vector.
[198] Specifically, in P7 of Experimental Example 3-1, DNA was extracted from each of the cells expressing GFP. The extracted DNA was amplified by PCR and subjected to electrophoresis to identify a remnant form of the DNA transferred to the host cell.
[199] FIG. 11 shows the results of PCR amplification confirming the presence or absence of concatemer formation of a transgene in the host cell.
[200] As a result, as shown in FIG. 11, it was confirmed that Petition 870250103897, dated 11 / 13 / 2025, pp. 56 / 69 45 / 46 The pAAV-GC vector (Example 1), in which a hairpin structure was absent in an ITR, failed to form a concatemer, which is a well-known characteristic of AAV vectors. On the other hand, in the cases of the pAAVWT vector (Comparative Example 1) and the pAAV-BC del vector (Comparative Example 2), in which both ITRs have a hairpin structure, transgenes were observed in various polymer forms, such as monomers, dimers, or concatemers.
[201] Consequently, it was confirmed that when pAAV-GC vectors were used, the transgenes did not form a concatemer structure in the host cell and thus integration into the host cell chromosome was suppressed.
[202] Overall, it was observed that the pAAV-GC vector including an asymmetrically modified ITR is suitable as a delivery vehicle for high-efficiency expression of a transgene in a short period of time, while suppressing long-term expression of the transgene in the host cell.
[203] The above description of the present disclosure is for illustrative purposes, and those skilled in the art to which the present disclosure pertains will be able to understand that the examples and embodiments can be easily modified without altering the technical idea or the essential attributes of the disclosure. Therefore, it should be understood that the above examples are not limiting, but illustrative in all respects.
[204] It should be understood that the embodiments described in the present invention should be considered only in a descriptive sense and not for purposes of limitation. Descriptions of attributes or embodiments within each embodiment should typically be considered as available to other similar attributes or aspects in other embodiments. Although one or more Petition 870250103897, dated 11 / 13 / 2025, pp. 57 / 69 46 / 46 modalities have been described with reference to the figures, it will be understood by those skilled in the art that various alterations in form and details may be made without departing from the spirit and scope of the revelation, as defined by the following claims. Petition 870250103897, dated 11 / 13 / 2025, pp. 58 / 69
Claims
1 / 4 CLAIMS 1. Nucleic acid molecule characterized in that it comprises: a gene expression cassette between a first inverted terminal repeat (ITR) and a second ITR, wherein the gene expression cassette comprises a heterologous polynucleotide sequence, and wherein either of the first ITR and the second ITR comprises at least one nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9, or a functional derivative thereof.
2. Nucleic acid molecule, according to claim 1, characterized in that the nucleotide sequence of either of the first ITR and the second ITR has at least about 95% sequence identity with a nucleotide sequence of either of the SEQ ID NOs: 1 to 9, or a functional derivative thereof.
3. Nucleic acid molecule, according to claim 1, characterized in that the nucleotide sequence of either the first ITR and the second ITR is selected from any of the SEQ ID NOs: 1 to 9, or a functional derivative thereof.
4. Nucleic acid molecule according to claim 1, characterized in that either of the first ITR and the second ITR consists of a nucleotide sequence or a complementary sequence thereof, the nucleotide sequence having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9 or a functional derivative thereof. Petition 870250086627, dated 09 / 25 / 2025, pp. 142 / 146 2 / 4 5. Nucleic acid molecule, according to claim 1, characterized in that the first ITR sequence and the second ITR sequence are based on an ITR sequence of a virus belonging to the genus Dependovirus of the family Parvoviridae.
6. Nucleic acid molecule, according to claim 1, characterized in that the first ITR sequence and the second ITR sequence are based on an ITR sequence of an adeno-associated virus (AAV).
7. Nucleic acid molecule, according to claim 1, characterized in that the first ITR sequence and the second ITR sequence are each independently based on an ITR sequence of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
8. Nucleic acid molecule, according to claim 1, characterized in that the first ITR is a wild-type AAV ITR, and the second ITR comprises at least one nucleotide sequence or a complementary sequence thereof, the nucleotide sequence of the second ITR having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID NOs: 1 to 9, or a functional derivative thereof.
9. Nucleic acid molecule, according to claim 1, characterized in that the first ITR is a wild-type AAV ITR, and the second ITR consists of a nucleotide sequence or a complementary sequence thereof, the nucleotide sequence of the second ITR having at least about 75% sequence identity with a nucleotide sequence of any of the SEQ ID Nos: 1 to 9 or a functional derivative thereof.
10. Nucleic acid molecule, according to claim 1, characterized in that the first ITR is a wild-type AAV ITR, and the second ITR consists essentially of any sequence selected from nucleotide sequences of SEQ ID NOs: 1 to 9.
11. Nucleic acid molecule, according to claim 1, characterized in that the first ITR is a wild-type AAV ITR, and the second ITR consists essentially of a nucleotide sequence with SEQ ID NO:
1.
12. Nucleic acid molecule, according to claim 1, characterized in that, in either of the first ITR and the second ITR, all or part of a stem-loop structure, which is formed of a rep linking element (RBE), regions RBE', A, A', B, B', C, C' and D, is modified.
13. Nucleic acid molecule, according to claim 1, characterized in that either of the first ITR and the second ITR is modified so as not to form a stem-loop structure.
14. Nucleic acid molecule, according to claim 1, characterized in that, in either of the first ITR and the second ITR, all or part of a stem-loop structure, which is formed of regions RBE, RBE', A, A', B, B', C, C' and D, is excluded.
15. Nucleic acid molecule, according to claim 1, characterized in that the gene expression cassette further comprises at least one promoter and one polyadenylation sequence. Petition 870250086627, dated 09 / 25 / 2025, pp. 144 / 146 4 / 4 16. Nucleic acid molecule, according to claim 1, characterized in that the heterologous polynucleotide sequence encodes a therapeutic gene.
17. Vector characterized in that it comprises the nucleic acid defined in claim 1.
18. Vector according to claim 17, characterized in that it is an AAV vector.
19. Composition characterized in that it comprises: the vector defined in claim 17; and a pharmaceutically acceptable carrier.
20. Composition, according to claim 19, characterized in that it is for delivering a therapeutic gene for gene therapy. Petition 870250086627, dated 09 / 25 / 2025, pp. 145 / 146