RNA enzyme-based nucleic acid manipulation system and its use

Description

"RNA ENZYME-BASED NUCLEIC ACID MANIPULATION SYSTEM AND ITS USE" CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present invention claims priority over Chinese patent application 202310424082.1, filed on April 19, 2023, and entitled "RIBOZYME RNA-BASED NUCLEIC ACID MANIPULATION SYSTEM AND USE THEREOF", and international patent application PCT / CN2023 / 101437, filed on June 20, 2023, and entitled "RIBOZYME RNA-BASED NUCLEIC ACID MANIPULATION SYSTEM AND USE THEREOF", which are incorporated herein by reference in their entirety, including the appendix. TECHNICAL FIELD

[0002] The present invention belongs to the field of biotechnology, and relates specifically to a ribozyme-based RNA DEAR nucleic acid manipulation system and its use, and more specifically to a programmable DEAR nucleic acid manipulation system with broad-spectrum cleavage capabilities for RNA and DNA, as well as gene editing capabilities. BACKGROUND OF THE TECHNIQUE

[0003] Currently, the gene-editing technologies commonly used in China are all developed based on RNA-guided CRISPR-Cas nucleases, whose main patents are owned by European and American countries. China does not have sufficient original innovation in gene-editing technologies and lacks essential patents.

[0004] However, there are still some problems with the system CRISPR-Cas. First, the CRISPR-Cas system has an off-target effect, and editing by the Cas protein in non-target regions can cause uncontrollable harmful variations. Second, the Petition 870250086925, dated 09 / 25 / 2025, page 101 / 225 2 / 85 The CRISPR-Cas system has the problem of excessively large protein sizes. The protein sizes of the molecules of the most commonly used CRISPR-Cas editing tools currently, SpyCas9 and AsCas12a, exceed 1300 amino acids. Excessively large molecular weights affect the transfection effectiveness of CRISPR-Cas system tools. Furthermore, the CRISPR-Cas system can potentially cause immune responses. The SpyCas9 and AsCas12a proteins currently used are derived from pathogenic bacteria to which humans have been exposed, which can trigger immune responses in the human body.

[0005] Consequently, the CRISPR-Cas nuclease system is limited by the shortcomings of its protein elements. If a new generation of nucleic acid targeting manipulation technology can be developed that is entirely RNA-based and simultaneously possesses specific genetic sequence targeting and catalytic activity, it is expected to overcome the limitations of applying protease-based gene editing systems. SUMMARY OF THE INVENTION Problems to be solved by the invention

[0006] Based on the various problems with the nuclease system In the prior art, CRISPR-Cas, the objective of the present invention is to provide a ribozyme-based DEAR nucleic acid manipulation system and apply it to targeted modification (e.g., cleavage) of nucleic acids (DNA and RNA). Solutions to solve the problems

[0007] A first aspect of the present invention provides a DEAR nucleic acid manipulation system, wherein the DEAR nucleic acid manipulation system comprises an RNA molecule derived from a bacterial intron of group IIC, and the RNA molecule comprises a target recognition site that... Petition 870250086925, dated 09 / 25 / 2025, page 102 / 225 3 / 85 hybridized with a target sequence in a target nucleic acid.

[0008] In some embodiments, the DEAR nucleic acid manipulation system comprises at least one of Domain I, Domain II, Domain III, Domain IV, Domain V, and Domain VI.

[0009] In some preferred embodiments, the DEAR nucleic acid manipulation system comprises at least Domain I, Domain II, Domain III, and Domain V.

[0010] In some specific embodiments, the intron of group IIC consists of Domains I to VI, in which each domain is in the form of a rod-handle structure and separated from the others, and the target recognition site is located in the upper handle region of Domain I.

[0011] In some embodiments, the DEAR nucleic acid handling system is in the range of 100 to 5660 nt, preferably 124 to 3897 nt, in length.

[0012] In some embodiments, Domain I comprises 2 to 6 hairpin / stem-loop structures in the range of 50 to 400 nt in length, and preferably Domain I comprises 3 to 5 hairpin / stem-loop structures in the range of 65 to 384 nt in length.

[0013] In some embodiments, Domain II comprises 1 to 4 hairpin / stem-loop structures in the range of 10 to 300 nt in length, and preferably Domain II comprises 1 to 3 hairpin / stem-loop structures in the range of 10 to 218 nt in length.

[0014] In some embodiments, Domain III comprises 1 to 3 hairpin / stem-loop structures in the range of 10 to 200 nt in length, and preferably Domain III comprises 1 to 2 hairpin / stem-loop structures in the range of 10 to 140 nt in length. Petition 870250086925, dated 09 / 25 / 2025, page 103 / 225 4 / 85

[0015] In some embodiments, Domain IV comprises 0 to 4 hairpin / stem-loop structures in the range of 0 to 4500 nt in length, and preferably Domain IV comprises 0 to 4 hairpin / stem-loop structures in the range of 0 to 3000 nt in length.

[0016] In some embodiments, Domain V comprises 1 hairpin / stem-loop structure in the range of 20 to 60 nt in length, and preferably Domain V comprises 1 hairpin / stem-loop structure in the range of 29 to 43 nt in length.

[0017] In some embodiments, Domain VI comprises 1 hairpin / stem-loop structure in the range of 10 to 200 nt in length, and preferably Domain VI comprises 1 hairpin / stem-loop structure in the range of 10 to 112 nt in length.

[0018] In some embodiments, the group IIC intron is a group IIC intron in which an open reading frame encoding an intron-encoded protein is present or absent in Domain IV.

[0019] In some optional embodiments, the open reading frame encoding an intron-encoded protein is 0 to 4000 nt long.

[0020] In some modes, the target reconnaissance site is located in Domain I.

[0021] In some embodiments, the nucleotide sequence of the RNA molecule is selected from any of the following: (i) the nucleotide sequence comprises a nucleotide sequence as set out in any of the sequences SEQ ID NOs: 1 to 9 and 56; (ii) the nucleotide sequence comprises a nucleotide sequence that is the reverse complement of a sequence as set out in any of the sequences SEQ ID NOs: 1 to 9 and 56; (iii) the nucleotide sequence comprises the reverse complement of Petition 870250086925, dated 09 / 25 / 2025, page 104 / 225 5 / 85 a sequence that is capable of hybridizing with the nucleotide sequence as set out in (i) or (ii) under high rigor hybridization conditions or very high rigor hybridization conditions; and (iv) the nucleotide sequence comprises a sequence with at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98% and even more preferably at least 99%, sequence identity with the nucleotide sequence as set out in (i) or (ii).

[0022] In some embodiments, the target recognition site has a length of 6 nucleotides.

[0023] In some preferred embodiments, the target recognition site is programmable to hybridize with a different target sequence.

[0024] In some forms, the target nucleic acid is DNA or RNA.

[0025] In some embodiments, the main cleavage site of the DEAR nucleic acid manipulation system is 0 to 1 nt downstream of the 3' end of the target sequence in the target nucleic acid.

[0026] A second aspect of the present invention provides an isolated polynucleotide, wherein the polynucleotide comprises a nucleotide sequence that encodes the DEAR nucleic acid manipulation system according to the first aspect of the present invention.

[0027] A third aspect of the present invention provides a nucleic acid construct, wherein the nucleic acid construct comprises the isolated polynucleotide according to the second aspect of the present invention.

[0028] A fourth aspect of the present invention provides a vector, wherein the vector comprises the isolated polynucleotide according to the second aspect of the present invention or the nucleic acid construct. Petition 870250086925, dated 09 / 25 / 2025, pp. 105 / 225 6 / 85 according to the third aspect of the present invention.

[0029] A fifth aspect of the present invention provides a cell, wherein the cell comprises the DEAR nucleic acid manipulation system according to the first aspect of the present invention, the isolated polynucleotide according to the second aspect of the present invention, the nucleic acid construct according to the third aspect of the present invention or the vector according to the fourth aspect of the present invention.

[0030] A sixth aspect of the present invention provides a reagent or kit, wherein the reagent or kit comprises the DEAR nucleic acid manipulation system according to the first aspect of the present invention, the isolated polynucleotide according to the second aspect of the present invention, the nucleic acid construct according to the third aspect of the present invention, the vector according to the fourth aspect of the present invention or the cell according to the fifth aspect of the present invention.

[0031] A seventh aspect of the present invention provides a pharmaceutical composition, wherein the pharmaceutical composition comprises the DEAR nucleic acid handling system according to the first aspect of the present invention, the isolated polynucleotide according to the second aspect of the present invention, the nucleic acid construct according to the third aspect of the present invention, the vector according to the fourth aspect of the present invention or the cell according to the fifth aspect of the present invention; and optionally a pharmaceutically acceptable carrier.

[0032] An eighth aspect of the present invention provides a method for modifying a target nucleic acid comprising the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system according to the first aspect of the present invention, the isolated polynucleotide according to the second aspect of Petition 870250086925, dated 09 / 25 / 2025, p. 106 / 225 7 / 85 present invention, the nucleic acid construct according to the third aspect of the present invention, the vector according to the fourth aspect of the present invention, the cell according to the fifth aspect of the present invention, or the reagent or kit according to the sixth aspect of the present invention.

[0033] The use of the DEAR nucleic acid manipulation system according to the first aspect of the present invention, the isolated polynucleotide according to the second aspect of the present invention, the nucleic acid construct according to the third aspect of the present invention, the vector according to the fourth aspect of the present invention or the cell according to the fifth aspect of the present invention is provided in modifying a target nucleic acid or in preparing a reagent or kit for modifying a target nucleic acid. Effects of the invention

[0034] The ribozyme-based RNA DEAR nucleic acid manipulation system provided by the present invention is based on an RNA molecule derived from a bacterial intron of group IIC, avoiding the problems with the CRISPR-Cas system such as the large size of protein molecules affecting transfection efficacy and the potential immunogenicity caused by Cas proteins. The ribozyme-based RNA DEAR nucleic acid manipulation system provided by the present invention can achieve DNA and RNA cleavage, and also has the ability to cleave DNA in E. coli and mammalian eukaryotic cells. BRIEF DESCRIPTION OF THE FIGURES

[0035] FIGS. 1A to 1J: illustration of the secondary structures of DEAR1 to DEAR10. FIGS. 1A to 1J illustrate the results of the secondary structure prediction for DEAR1 to DEAR10, respectively. The prediction is performed using RNAfold. Domains I to VI and the TRS have all been marked in the figure. Petition 870250086925, dated 09 / 25 / 2025, p. 107 / 225 8 / 85

[0036] FIGS. 1K to 1M: Primary sequence and secondary structure features of group IIC introns. The RNAs of group IIC introns in the database (http: / / webapps2.ucalgary.ca / ~groupii / ) are modeled by the LocRNAA software. Domains I to VI have been marked in the figure, corresponding to the primary sequence and secondary structure features of Domain I, three primary sequence and secondary structure features of Domains II to III (Models 1 to 3), and the primary sequence and secondary structure features of Domains V to VI in group IIC introns, respectively.

[0037] FIG. 2A: Identification of RNA molecule masses of ribozymes DEAR1 to DEAR9.

[0038] FIG. 2B: identification of the mass of the RNA molecule of DEAR10 ribozymes.

[0039] FIG. 3: verification of RNA cleavage activities of RNA molecules from ribozymes DEAR1 to DEAR9.

[0040] FIG. 4: verification of the cleavage activities of RNA molecules from ribozymes DEAR1 to DEAR6 on unpaired RNA substrates.

[0041] FIG. 5: verification of the cleavage activities of DNAfs from RNA molecules of ribozymes DEAR1 to DEAR6.

[0042] FIG. 6: Comparison of the cleavage of paired and unpaired DNA substrates by RNA molecules of ribozymes DEAR1 to DEAR6.

[0043] FIG. 7: verification of the cleavage sites of the RNA molecules of ribozymes DEAR1 to DEAR6.

[0044] FIG. 8: results of the optimization of reaction conditions for the DEAR1 ribozyme RNA molecule.

[0045] FIG. 9: curves of the efficiency of optimizing the reaction conditions for the DEAR1 ribozyme RNA molecule.

[0046] FIG. 10: Comparison of DNA cleavage activities of Petition 870250086925, dated 09 / 25 / 2025, p. 108 / 225 9 / 85 DEAR1 and RNA-guided nuclease proteins.

[0047] FIG. 11: verification of the plasmid cleavage activity of the DEAR1 ribozyme RNA molecule.

[0048] FIG. 12: verification of plasmid cleavage activity of RNA molecules from DEAR1 to DEAR3 ribozymes in E. coli.

[0049] FIG. 13: Further verification of the plasmid cleavage activity of the DEAR1 ribozyme RNA molecule in E. coli.

[0050] FIG. 14: verification of plasmid cleavage activities of RNA molecules from DEAR4 to DEAR9 ribozymes in bacteria.

[0051] FIG. 15: verification of DNA cleavage activities of RNA molecules from ribozymes DEAR1 to DEAR6 with a reprogrammed TRS region.

[0052] FIG. 16: Schematic diagrams of the survival of cells that are stably transfected with the DEAR1 stable transfection plasmid and the DEAR-NT stable transfection plasmid in Example 9.

[0053] FIGS. 17A and 17B show schematic diagrams of the analysis of the sequencing results from Example 9.

[0054] FIG. 18: verification of RNA cleavage activity of DEAR10.

[0055] FIG. 19: verification of the cleavage activity of sfDNA DEAR10.

[0056] FIG. 20: Comparison of the cleavage of paired and unpaired DNA substrates by DEAR10.

[0057] FIG. 21: verification of the cleavage activity of sfDNA DEAR10 with a reprogrammed TRS region.

[0058] FIG. 22: verification of cleavage activities of plasmids from DEAR1 to DEAR6 and DEAR10.

[0059] FIG. 23: DEAR toxicity test on E. coli. Petition 870250086925, dated 09 / 25 / 2025, p. 109 / 225 10 / 85

[0060] FIG. 24: verification of DEAR cleavage activity in Genomic DNA of mammalian cells, wherein FIG. 24A shows a schematic diagram of a verification system to check the cleavage activity of DEAR in the genome of mammalian cells and FIG. 24B shows the survival of DEAR-edited mammalian cells under resistance screening.

[0061] FIGS. 25A to 25C: detection of the DEAR editing pattern in mammalian cells, wherein FIG. 25A shows the detection of the DEAR1 editing pattern in three target sites, FIG. 25B shows the detection of the DEAR1 editing pattern throughout the target sequence and FIG. 25C shows the detection of DEAR1 editing in sequences upstream and downstream of the target site. DETAILED DESCRIPTION OF THE MODALITIES

[0062] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless expressly defined otherwise herein, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention pertains.

[0063] In this descriptive report, the numerical range expressed as numerical value A to numerical value B refers to the range containing the extreme numerical values ​​A and B.

[0064] In this descriptive report, the use of substantially or essentially means that the standard deviation relative to the theoretical model or theoretical data is within the range of 5%, preferably 3% and more preferably 1%.

[0065] In this descriptive report, the meaning expressed by may include both the situation of carrying out a certain treatment and the situation of not carrying out a certain treatment.

[0066] In this descriptive report, optional or optionally Petition 870250086925, dated 09 / 25 / 2025, page 110 / 225 11 / 85 means that the event or circumstance described below may or may not occur, and that the description includes cases where the event occurs and cases where it does not occur.

[0067] In this descriptive report, reference to some specific / preferred embodiments, other specific / preferred embodiments, embodiments, etc. means that the specific elements (e.g., characteristics, structures, natures and / or properties) described in connection with the embodiment are included in at least one of the embodiments described in this document, and may or may not be present in other embodiments. Furthermore, it is understood that the elements may be combined in various embodiments in any suitable manner.

[0068] In the present invention, the terms comprising, having and any variations thereof are intended to cover a non-exclusive inclusion. For example, a process, a method, a device, a product or an apparatus that includes a series of steps is not limited to the listed steps or modules, but may also optionally include unlisted steps or other steps inherent to such process, method, product or apparatus.

[0069] In the present invention, reference to a plurality of means two or more. And / or describes an association relationship between associated objects and means that three relationships can exist. For example, A and / or B can represent the following three cases: only A exists, both A and B exist, and only B exists. The character / generally represents an or relationship between the associated objects.

[0070] In this descriptive report, the terms polynucleotide and nucleic acid, used interchangeably, refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, this term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, Petition 870250086925, dated 09 / 25 / 2025, p. 111 / 225 12 / 85 DNA-RNA hybrids, or a polymer comprising purine bases and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases.

[0071] In this technical field, G, C, A, T, and U generally represent the bases guanine, cytosine, adenine, thymine, and uracil, respectively. However, it is also commonly known in this field that each of G, C, A, T, and U generally represents a nucleotide containing guanine, cytosine, adenine, thymine, and uracil as a base, respectively, which is a common way of representing deoxyribonucleic acid sequences and / or ribonucleic acid sequences. Therefore, in the context of the present invention, the meanings represented by G, C, A, T, and U include the various possible situations described above. However, it is understood that the terms ribonucleotide or nucleotide can also refer to a modified nucleotide or an alternative substitution unit.An expert in the technique will understand that guanine, cytosine, adenine, and uracil can be replaced by other units without substantially altering the base-pairing properties of an oligonucleotide (including a nucleotide having such a substitution unit).

[0072] In this descriptive report, the term nucleic acid manipulation includes the ligation, strand cutting, or cleavage (i.e., cutting) of both strands of a nucleic acid, or includes the modification or editing of nucleic acids. Nucleic acid manipulation can silence, activate, or regulate (increase or decrease) the expression of RNA or nucleic acid-encoded polypeptide.

[0073] In this descriptive report, hybridizable or complementary or substantially complementary means that a nucleic acid (e.g., RNA or DNA) comprises a nucleotide sequence that enables the nucleic acid to bind non-covalently (or Petition 870250086925, dated 09 / 25 / 2025, p. 112 / 225 13 / 85 that is, form Watson-Crick base pairs and / or G / U base pairs), anneale, or hybridize with another nucleic acid in a specific sequence and antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid) under appropriate temperature and ionic strength conditions of the solution, in vitro and / or in vivo. The standard Watson-Crick base pairing includes: adenine (A) with thymine (T) pairing, adenine (A) with uracil (U) pairing, and guanine (G) with cytosine (C) pairing. Furthermore, for hybridization between two RNA molecules (e.g., dsRNA) and for hybridization of a DNA molecule with an RNA molecule (e.g., when a target nucleic acid base of DNA or RNA pairs with the target recognition site of the DEAR nucleic acid manipulation system), guanine (G) can also pair with uracil (U).For example, in the case of base pairing of a tRNA anticodon with a codon in mRNA, the G / U base pairing is responsible, at least in part, for the degeneracy of the genetic code.

[0074] The hybridization and washing conditions are well known and are illustrated in Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), in particular in Chapter 11 and Table 11.1 in the reference; and in Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The rigor of the hybridization is determined by the temperature and ionic strength conditions.

[0075] In the present invention, moderate rigor conditions, moderate-high rigor conditions, high rigor conditions, or very high rigor conditions describe the conditions for nucleic acid hybridization and washing. For guidance on how to perform hybridization reactions, see Current Protocols in Molecular Petition 870250086925, dated 09 / 25 / 2025, p. 113 / 225 14 / 85 Biology, John Wiley & Sons, NY (1989), 6.3.1 to 6.3.6, which is incorporated herein by reference. Both aqueous and non-aqueous methods are described in this reference, and either can be used.For example, specific hybridization conditions are as follows: (1) low rigor hybridization conditions involve hybridization in sodium chloride / sodium citrate (SSC) 6* at about 45°C, followed by two washes at a temperature of at least 50°C in SSC 0.2* and 0.1% SDS (for low rigor conditions, the washing temperature may be increased to 55°C); (2) moderate rigor hybridization conditions involve hybridization in SSC 6* at about 45°C, followed by one or more washes at 60°C in SSC 0.2* and 0.1% SDS; (3) high rigor hybridization conditions involve hybridization in SSC 6* at about 45°C, followed by one or more washes at 65°C in SSC 0.2* and 0.1% SDS; and preferably, (4) very high rigor hybridization conditions involve hybridization in 0.5 M sodium phosphate and 7% SDS at 65°C, followed by one or more washes at 65°C in 0.2* SSC and 1% SDS.

[0076] Hybridization requires that two nucleic acids contain complementary sequences, but base mismatches are possible. The appropriate conditions for hybridization between two nucleic acids depend on the lengths and degree of complementarity of the nucleic acids, which are well-known variables in the technique.

[0077] In the present invention, a DNA sequence encoding a specific RNA is a nucleotide sequence of DNA that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein (such that both DNA and mRNA encode a protein), or an RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), non-coding RNA (ncRNA), the acid manipulation system Petition 870250086925, dated 09 / 25 / 2025, pp. 114 / 225 15 / 85 DEAR nucleic acids provided by the present invention, etc.).

[0078] In the present invention, the terms naturally occurring or unmodified or wild type, as applied to a nucleic acid, a polypeptide, a cell or an organism, refer to a nucleic acid, a polypeptide, a cell or an organism that is found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism and can be isolated from a source in nature is naturally occurring.

[0079] In the present invention, recombinant means that a specific nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and / or ligation steps, which generate constructs with coding sequences or structural non-coding sequences that are distinguishable from those in endogenous nucleic acids present in natural systems. A DNA sequence encoding a polypeptide can be assembled from cDNA fragments or a series of synthetic oligonucleotides to provide a synthetic nucleic acid capable of being expressed by recombinant transcription units contained in cells or cell-free transcription and translation systems. Genomic DNA containing related sequences can also be used in the formation of recombinant genes or transcription units.Untranslated DNA sequences may be present at the 5' or 3' end of the open reading frame, where such sequences do not interfere with the manipulation or expression of the coding region and may, in fact, function through various mechanisms to regulate the production of the desired product (see DNA regulatory sequence). Alternatively, DNA sequences encoding untranslated RNA (e.g., the DEAR nucleic acid manipulation system provided by the present invention) may also be considered recombinant. Thus, for example, the term nucleic acid. Petition 870250086925, dated 09 / 25 / 2025, pp. 115 / 225 16 / 85 recombinant refers to a non-naturally occurring polynucleotide or nucleic acid, for example a polynucleotide or nucleic acid prepared by human intervention from an artificial combination of two otherwise separate sequence segments. Such artificial combinations are often achieved through chemical synthesis or by manual manipulation of isolated nucleic acid segments (e.g., by genetic engineering techniques). This procedure is typically performed to replace codons with those encoding the same amino acids, conserved amino acids, or non-conserved amino acids. Alternatively, this procedure is performed to link nucleic acid segments to the desired function, so as to produce the desired combination of functions.Such artificial combinations are often achieved through chemical synthesis or by manually manipulating isolated segments of nucleic acids (for example, through genetic engineering techniques).

[0080] As used in this document, the term isolate designates a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance; (2) any substance including, but not limited to, any enzyme, mutant, nucleic acid, protein, peptide, or cofactor, from which one or more or all of the naturally associated components have been removed and with which they are inherently related; (3) any substance modified by artificial means from a substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell, multiple copies of a gene encoding the substance, and use of a stronger promoter than that naturally associated with the gene). Petition 870250086925, dated 09 / 25 / 2025, pp. 116 / 225 17 / 85 which encodes the substance).

[0081] As used in the present invention, the expression nucleic acid construct comprises a polynucleotide encoding a polypeptide, a domain, or a module operationally linked to a suitable regulatory sequence that is required for the expression of the polynucleotide in a selected cell or strain. In the present invention, transcriptional regulatory elements include promoters and, based on this, may further include elements such as enhancers, silencers, and isolators.

[0082] The term vector refers to a genetic element, such as a plasmid, cosmid, bacmid, phage, or virus, to which another genetic sequence or element (DNA or RNA) can be attached. The vector can be a replicon, resulting in the replication of the attached sequence or element. An expression vector is a vector that facilitates the expression of a nucleic acid or nucleic acid sequence encoding a polypeptide in a host cell or organism.

[0083] In the present invention, the terms recombinant expression vector or DNA construct are used interchangeably herein to refer to a DNA molecule comprising a vector and an insert. Recombinant expression vectors are typically produced for the purpose of expressing and / or propagating one or more inserts, or for the purpose of constructing other recombinant nucleotide sequences. The one or more inserts may or may not be operationally linked to a promoter sequence, and may or may not be operationally linked to a regulatory DNA sequence.

[0084] As used in this document, the term operationally linked refers to a nucleic acid sequence that is placed in a functional relationship with another nucleic acid sequence. Petition 870250086925, dated 09 / 25 / 2025, pp. 117 / 225 18 / 85 nucleic acid. Examples of nucleic acid sequences that can be operationally linked include, but are not limited to, promoters, terminators, enhancers or activators of transcription and heterologous genes, which, when transcribed and, if appropriate, translated, produce functional products such as proteins, ribozymes or RNA molecules.

[0085] The term derived from, as used in this document, refers to the origin or source, and may include naturally occurring, recombinant, unpurified or purified molecules. A nucleic acid derived from the original nucleic acid may comprise part or all of the parent nucleic acid, and may be a fragment or a variant of the original nucleic acid.

[0086] In the present invention, the term ribozyme refers to an RNA molecule capable of catalyzing a specific biochemical reaction. Common examples of such reactions include RNA and DNA cleavage or ligation, modifications, etc.

[0087] In the present invention, a target nucleic acid is a polynucleotide (e.g., DNA such as genomic DNA, RNA, etc.) comprising a site (target site or target sequence) targeted by the DEAR nucleic acid manipulation system provided by the present invention. The target sequence is a sequence with which the target recognition site of the DEAR nucleic acid manipulation system will hybridize. For example, the target site (or target sequence) in the target nucleic acid, 5'-UGUCUU-3' or 5'-TGTCTT-3', is targeted by (or linked to, hybridized with, or complementary to) the sequence 5'-AAGACA-3'. Suitable hybridization conditions include the physiological conditions normally present in cells.

[0088] In the present invention, cleavage means the cleavage of the covalent backbone of a target nucleic acid molecule (e.g., RNA or DNA). Cleavage of both single and double strands is possible. Petition 870250086925, dated 09 / 25 / 2025, pp. 118 / 225 19 / 85 double strands, and double-strand cleavage can occur as a result of two distinct single-strand cleavage events. A major cleavage site refers to the DNA / RNA cleavage site corresponding to the cleavage product with a distinct band. A minor cleavage site refers to the DNA / RNA cleavage site corresponding to the cleavage product with a non-distinct band.

[0089] In the present invention, stem-loop, also known as hair clip, hair clip loop, stem-loop structure or stem-loop / hair clip structure, refers to a secondary structure formed by a single-stranded oligonucleotide when complementary bases in the first part of a linear chain hybridize with bases in the second part of the same chain.

[0090] The technical solutions of the present invention are described specifically below.

[0091] In the present invention, a ribozyme-based DEAR nucleic acid manipulation system has been constructed using a bacterial group II intron element. Group II introns consist of two parts: a ribozyme RNA and an intron-encoded protein (IEP), wherein the ribozyme RNA can catalyze autosplicing and maturation of the primary transcript, while the IEP protein plays an auxiliary role. The ribozyme RNA portion comprises six domains, I to VI. Domain I, the largest of all domains, plays an important stabilizing role in the formation of the overall intron structure and contains an exon-binding site (EBS) for exon binding. Domains II and III also participate in the formation of the ribozyme structure. Domain IV contains an open reading frame (ORF), which encodes the IEP protein. Domain V serves as the catalytic center of ribozyme RNA, while Domain VI plays an auxiliary catalytic role.Based on the characteristics of the primary sequence and secondary structure of RNA, the introns of... Petition 870250086925, dated 09 / 25 / 2025, pp. 119 / 225 20 / 85 Group II can be classified into classes A, B, and C, among which class C is considered the oldest class of introns (DM Simon et al., Group II introns in eubacteria and archaea: ORF-less introns and new varieties., RNA, 14, 1704 to 1713 (2008); AM Lambowitz, S. Zimmerly, Mobile group II introns., Annu. Rev. Genet., 38, 1 to 35 (2004); and JS Rest, DP Mindell, Retroids in archaea: phylogeny and lateral origins., Mol Biol.

[0092] In the present invention, it has been discovered that by using an EBS of a group IIC intron and its adjacent sequences as a substrate recognition element (referred to in the present invention as the target recognition site (TRS)) of the target nucleic acid for a ribozyme, the programmability of the TRS has been discovered and demonstrated, with the target nucleic acid (RNA or DNA) being hydrolytically cleaved by Domain V of the ribozyme RNA intron. Therefore, in the present invention, the system constructed based on a group IIC intron derived from bacteria in which an open reading frame encoding an intron-encoded protein is present or absent in Domain IV, and with programmable nucleic acid cleavage and recognition capabilities, is referred to as a ribozyme-based RNA DEAR (Dr) nucleic acid manipulation system or a ribozyme-based RNA HYER (Hr) nucleic acid manipulation system. <Sistema de manipulação de ácidos nucleicos DEAR>

[0093] In some embodiments of the present invention, a ribozyme-based DEAR nucleic acid manipulation system is provided comprising an RNA molecule (isolated) derived from a bacterial group IIC intron, wherein the RNA molecule comprises a target recognition site that hybridizes with a target sequence in a target nucleic acid.

[0094] In some embodiments of the present invention, the system Petition 870250086925, dated 09 / 25 / 2025, pages 120 / 225 21 / 85 of nucleic acid manipulation DEAR comprises at least one of Domain I, Domain II, Domain III, Domain IV, Domain V, and Domain VI.

[0095] In some preferred embodiments, the DEAR nucleic acid manipulation system comprises at least Domain I, Domain II, Domain III, and Domain V.

[0096] In some specific embodiments of the present invention, the DEAR nucleic acid manipulation system contains 6 domains (i.e., Domain I, Domain II, Domain III, Domain IV, Domain V and Domain VI; and the 6 domains may also be represented as Domains I to VI or simply D1 to D6) in the range of 100 to 5660 nt, and preferably 124 to 3897 nt, in length.

[0097] In some specific embodiments of the present invention, Domain I comprises 2 to 6 stem-loop / hairpin structures in the range of 50 to 400 nt in length and a TRS sequence responsible for substrate recognition, and preferably 3 to 5 stem-loop / hairpin structures in the range of 65 to 384 nt in length; Domain II comprises 1 to 4 stem-loop / hairpin structures in the range of 10 to 300 nt in length, and preferably 1 to 3 stem-loop / hairpin structures in the range of 10 to 218 nt in length; Domain III comprises 1 to 3 stem-loop / hairpin structures in the range of 10 to 200 nt in length, and preferably 1 to 2 stem-loop / hairpin structures in the range of 10 to 140 nt in length;Domain IV comprises 0 to 4 stem-loop / hairpin structures in the range of 0 to 4500 nt in length, and a region of 0 to 4000 nt as an open readout frame encoding an IEP, and preferably 0 to 4 stem-loop / hairpin structures in the range of 0 to 3000 nt in length; Domain V comprises 1 stem-loop / hairpin structure in the range of 20 to 60 nt in length, and preferably 1; Petition 870250086925, dated 09 / 25 / 2025, pp. 121 / 225 22 / 85 stem-loop / hairpin structure in the range of 29 to 43 nt in length, comprising a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure in the range of 10 to 200 nt in length, and preferably 1 stem-loop / hairpin structure in the range of 10 to 112 nt in length.

[0098] The primary sequence and secondary structure characteristics of RNA molecules derived from group IIC introns are shown in FIGS. 1K to 1M.

[0099] In some embodiments of the present invention, the group IIC intron is a group IIC intron in which an open-read frame encoding an IEP is absent in Domain IV.

[0100] In some embodiments of the present invention, the intron of group IIC is an intron of group IIC in which an open-read frame encoding an IEP is present in Domain IV. In some more specific embodiments, in the intron of group IIC in which an open-read frame encoding an IEP is present, the open-read frame encoding an IEP is deleted.

[0101] The DEAR nucleic acid manipulation system provided by the present invention functions as an endonuclease, catalyzing the cleavage of nucleic acids at a specific sequence in the targeted nucleic acid (e.g., DNA or RNA). As will be detailed further below, the sequence specificity is provided by the target recognition site in the DEAR nucleic acid manipulation system, which hybridizes with the target sequence in the target nucleic acid. Thus, the DEAR nucleic acid manipulation system binds to the target nucleic acid by hybridizing the target recognition site with the target sequence in the target nucleic acid. In other words, the location at which the specific binding (and / or cleavage) of the target nucleic acid occurs is determined by the complementarity of the base pairing of the target recognition site with the nucleic acid. Petition 870250086925, dated 09 / 25 / 2025, pp. 122 / 225 23 / 85 target nucleic acid.

[0102] In some specific embodiments, the main cleavage site of the DEAR nucleic acid manipulation system is 0 to 1 nt downstream of the 3' end of the target sequence in the target nucleic acid, that is, the main cleavage site is located 0 to 1 nt downstream of the 3' end of the region paired with the target recognition site in the target nucleic acid.

[0103] In some embodiments of the present invention, the nucleotide sequence of the RNA molecule of the DEAR nucleic acid manipulation system is selected from any of the following: (i) the nucleotide sequence comprises a nucleotide sequence as set out in any of the sequences SEQ ID NOs: 1 to 9 and 56; (ii) the nucleotide sequence comprises a nucleotide sequence that is the reverse complement of a sequence as set out in any of the sequences SEQ ID NOs: 1 to 9 and 56; (iii) the nucleotide sequence comprises the reverse complement of a sequence that is capable of hybridizing with the nucleotide sequence as set out in (i) or (ii) under high rigor hybridization conditions or very high rigor hybridization conditions; and (iv) the nucleotide sequence comprises a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98% and even more preferably at least 99%, sequence identity with the nucleotide sequence as set out in (i) or (ii). SEQ IDs 1 to 9 and 56 are shown below: SEQ ID NO: RNA sequence (5'-3') Petition 870250086925, dated 09 / 25 / 2025, pp. 123 / 225 24 / 85 1 GUGCGCUCGGCAUGGGUGAAAGUC- CCGAACUGCGGAAGGCAGAAGUAG- CAGUUAGCUUAACGCAAGGGUCCGUGGUGAGCGCGGAAU CUGAAGGAAGCGGGCGGCAAACUUCCGGUCUGAGGAACA- CGAACUUCAUUAAAGG- CUAGGUAUCAUUGGAAUGUUGC NNNNNNAAACAAAGUCC UUUCUGCCGAAGGUUACAGAGUAAUAUGAAGCAGAU- GAUGGAAGGAAGAAAGAUUGUACU- CUUACCCGAGGAGGGUCUGAUGGAUACGUGAAGUGCGCUUC AUAACCUACUUAGUAUAGUACU GAACCAUCAGAGAUCA- GCAGAGGUCUA- GUACGAAUCGGUUAGAACGAUUCGGAAGGACUGAACAAUC AAGAGAAAUAUGCCCUUGGCAUUCAGUACGAUCAUGAA- CACAGAAAACAUGGGUACCUUC- CCAAGAGAAAAGGAAAACGGUGUAUCCCGUGGGAAUUUUGG AGGGUGGAGUGAGUGACGGCAUGGCAUAAGAAAGAUCA- CUAUUUACGGAAGGAAGCUUGCGU- CAUUAUCUUGAUUGAACCGCCGUAUACGGAACCGUACGUAC GGUGGUGUGAGAGGACGGAGGUUAAUCACCUCCUCCUA- CUCGAU 2 GUACGACGGGCAUGUCGUACAUCUGAGGUGCAAGUCCUCUGUGGACACCUGCUACCGGU- GAACCCAAUAGCGACUCCCAAGCCUGACUAUCGCGAGGUAA CGGGGAGAGGAAGGGUAGCGAAAUCGGCUCUACGAA- CAGAAACGUGUAUAUUAAGG- CGUAUAUAGUGGAUGGGGGCNNNNNCUUAAGUCCAA AAAGGUAGUCGUAAUCUAUGGCGUAAAUCACGAGA- GUAAACGAGGAAAGAUGUACGACUUA- UCCCGUGAGGUCUCAUGAGCGUCAAGUAGACGUAGUAAUAA Petition 870250086925, dated 09 / 25 / 2025, pp. 124 / 225 25 / 85 CGAAUCAUGAGAGUCAGCCGAGGUCAUAUGUAGUGAA- GUUUCUGUAAUGGAAACGGAG- CGAAGGACCGAACGAUUAUAAUAUGUAUCCCUAUCUACUGAU UUGUCUGCCCUAAACACCUGGUCUGUAAAUGACGGUACUCG- CAGAACGUAUGCUGAAAAGGG- CUGCUCACAAAUAUAGGACGCACAAGCGGAAACGAAAUCAU AUAUAGGUAGGUUGGGGAAACAAAAAAGUGUUCUCGCCAAA- GUUUAGUUGAACCCCGUGUG- CCGAACGGCACGCACGGUGUGUGAGGGACUAUCAAUUA GUCCCUACUCCGAU 3 GUAUGCCCGGCAUGGGCGAUAGCUUUAGGUGUAAGUCCCGAACAGGGGUUGGCAACACCAA- CUGUUAGCCAAGAGCAAGGGUCUCCAUCGUGAGGGGAAU CUGAAAAGCUGGAGCAAAUUCCCGAAGGUACACAUUCGAGGCU- GUUAUAUUCGGGCAAGAGACUGCNNNNNAGUCAAAGCCCUAU GUUGCCAAGGGAUAUAGCAGUAAAUUGUGGCAGGUACAUGGGAUGGAAAGUUAUCGCUCUUAUC- CGGGGAGGUCUGUCGAUCCGGUAAUGGUAAGGAAGUCCUU AACAAUACCAACCCGCAUCGUGAGGUGUCGGUCGUGAGUCGGAGAAGUCAGCAGAGGCCAUA- GUACUCCUAACGAGGAAGGGCCGAAGGUCAGGCAGGCAGACUAA GAACGGUGCGUUCGAGAGAAUUUGCUGUAUACAGAGACCUAU- CUAUAAAGAGGGAGUGGUGAAGCCCAAUGGCUUAUAGAAGG GCUGAGAAUUCUCCGGCACAAUACCCGGAAAAUCUUAAUAUAUAU- CUUAAUUCGCUGAGUAAUAU- GUUAACCCUGGCCAACCGCGGAUGCGGAUGCGGACCCCGAUUGCC Petition 870250086925, dated 09 / 25 / 2025, pp. 125 / 225 26 / 85 GGUGGUGUGGGAGGGUCGGCGGAGAUAUCUCCG- CCCCCUAUCCCAAU 4 GUGCCCAGCAUGGGCCAAUCUUGGAGGUGAAGUC- CUCCCGUAAGUUGAUCACAG- CGAACGAAGCGAAGCCCAACUGCAGGGCGACUGAGUGAGUGAGUGAGAGGUGAGUGGGGCGAGU CAAGAAUCGGAUAGAAGGCGGUG- CCGACCAGGGCGAGCGGCNNNNNNNNCCGCGAAGCUCUCGU GAUCAAGGGUCAGGCGGCGUAGAUCCGGCGUUGUGCAGU- GAAGGAUUGCGUUCUUACCUG- CCGGAGCGAGAAGCUAGCAGGUAGUAGUUGGCGG- CAUGGCCGGAGGGCUGGAAGCU- GUUGGCGAAGGACCAAAGGAGCAGAAGGGCAACUGCCU GACCAUCCGAAAUGGAUAUGCUUCAGAUGCCGA- UACGGGGCUCGUAGGUAGAAAAAA CAGGUGAAGCCUGAAAUACUUGUGACAGCGAAGAACCAGAU CGGCCGGGUUGGGGACAGGCGAGUCCAGGCGUCAU- CAACCGUUUCAACCGCCCGGUGCCGGACCCGCAUGCCGGGU5 GUGGCCCCGGCAUGUACAUGACUAUAGGGUGUAAGUC- CCGAACCCCGAAGACAGAA- GUAGGUUAGCCAAGAGCAAGGGUCCGUGGUCGCGCG GAAUCUGAAGGAAGCUGGAGGCAACACCGGUCCGAACGACCAUAUAGAGAGAUAGGUAGUAGAU NGCAUCAGUAGAU Petition 870250086925, dated 09 / 25 / 2025, pp. 126 / 225 27 / 85 UUUCUGUCGAAGGUCAUAUCGAGUAAAUGAGGCGGAUA- GAUGGUGUGAAAAGUGCAUGUA- CUUACCCGGGGAGGUCUGGCGGAUAUGUGAAGUACUCUUC AUAACCUACUUAGUGAUAAGUAGCUGAACCGUCAGAAGUCAGCAGAGGUCAUAGUAUUA- GUUGGUCUAGAACAAAGAAGGACCGAACAAUUAGAGA GAAUAG CCCUUGGUAUUCAGUGACAUGAAUGACACA- GAAAACGUAGUACCUCACUUGAGGG- GAGGAAGCGGUGAAUCCCCGUGGGAGACCUCUUGGAGGGUG GAGUGACCACUGGCAUAAAAGACAGCUAUCACGGAAGUUAUAAAGACUUGCGU- CAAUUAUCUAAUUGAACCGCCGUAUACGGAACCGUACGUA CGGUGGUGUGAGGACGGGGAGUUAAUCGCUCCCUCCUACUCGAU 6 GUGUGCCCAGUAUGGGCAUCUUUUGUUUAC- CGAAAGGUAAUAUAUAUCUAGAGGGUG- CAAGUCCCUUAUGGGCAGGGGUAACGCCUUGAACCAUUAGU AAGCCGCAAGGGUGGUGAUCGUGAGGUCACAUCU- GAAGAAAGCGGGACUACAAAACCCGGUA- CUGACGAACAGGAACCGUAUACAGAGGGCAUUUAUUGCAUGGG UAAGCAACCNNNNNUUGUAAAGCCCUAAGAAUACCAAAGUGGCAUUUAUGUUAGUAGAUACGGCA- GGGAUCGGGGAAAGAAGAUGCUCUUACCUGGGGAGGUCU CCAGUACCACGUGUUUGUACAGGGAAGAGUCCAGAGGUCAUAGUACCUAAGGGAAACGA- GUUGCAGCGAAACUGCAUAGGUCUCACAAUUAGGAAGGAC CGAACGUAUCCCUUUCAAAAUUCGCAUAGGAACCAACUUGUGUAGCCUAUUAACU- AGAAGAUAGUGCCAAGGGUGAAAAGCUUUGGUGUGAUGG Petition 870250086925, dated 09 / 25 / 2025, pp. 127 / 225 28 / 85 UUUACGAACCGCCUUAACGAGACCCUACGUCGUGGU- GUGAGGGGUGCACUUCGU- CAUUUGAGGCGGAGCCAUCCAUCGAU 7 GUGUGCCCUGAAUGGCAAAUAUAUAGUUCUUU- CAAAUAGAAUC CAGAGAGUGAAAGUCU- CUUAUGCGCCUCUUAAAUUGAGGAAGCAUUAGCAAGUCGCA AGGUGGUUUGUCGUGAGAAUUGCACUGAGUAGCAGU- CUGCAAAGGUCGGUACUGUACGUA- CAGAAACUGUAUAUAGGAGGCAUGAUAUCGGGUGAGGUAG CNNNNNNUACUAAAGCCCCCAAGAUUACAAACCAUUCAUCAU- GUAGAUGCAGCGAUUGAC- CGAAGGAUAUUUGUCUUACCGGGGAGGUCUUGUAUGGG UUGACUAAGAUUGGCGCGACAAUCGAAGCAACAAUUC- CCGAAAGCAAUAGGGAGUUU- CAAUAGAAGUCAGCAGGUCAUAUGUAUCGA GCCGAAGUAAAAUCGGACGGUCUCACAAGCCAGCGAAGGA- CUGAAUGUUAAGUCGUUU- CUAAUGCAAUAAGGAGCUUUAAGCUUCGCCGCUUAGCAGCCU UGUUAAAAAAGAACAAAGUGCAAUUGGUGAAAAGAG- CGAUUGUACUCAUGCUUAACAAAC- CGCCGUGUACGAGACCCAUACGCACGGUGUGUGAGGGC ACUCCCCACCUGUUCAUCAUGGUGGCGUGUCCACUCGAU 8 GUGGCCCCAGCAUGUGCAUAGCCUAGCGGUGAAAAGUC- CGUUGUGGGCCAGGUAGCGGGAC- CACUAGUCGAAGGCAAGGGUCCAUCGUGUGGAAUC UGAAGGAAGCCCAAGGCAAAGUCCCGGUCCGGUCGAUCGUGAGGGAUC UGAAGGAAGCCCAAGGCAAAGUCCCGGUCCGAUGAA- CAAGAACCAGAUAUAAGGCUAAGU- GAAGUGGACGAGUUUGCNNNNNNAAAACGAAGUCCAACAGCU Petition 870250086925, dated 09 / 25 / 2025, pp. 128 / 225 29 / 85 ACCUGACUUCACGGAGUAGAUCUGGCGGAUAGAUGGGA- UGAAAGUUAUUGCACUUACCUG- GGAGAUCAAGAAUAUGCUAUGGCAACCCAUCAGC AAUGUAUGGCU GAAUCUG CAGAAGUCAUG CAGAAGUCAUGA- AGACAUGAGUAGAU GAAUCUU GAAAGAUGCGAAG GGAUACGGAAAAGGCAUACACUCGACUGAAGGUUUC- CUACAUGAAGAUAAGGGAGAG- CCCGAAAAUAUGUACCAAGCCCUAGUAUAACUUCUAUC UGAAAGAGGAGAAACGAUGUGAAGGGUCUUACCGAUGUACAU- CAACACAU GAAUGGUACGUACGGUGGUGCGGAAGGACGGAAUAAAU UAAUUAUCUACCCUCCUACUCGAU 9 GUGCCCCGGCAUGCGUAUGACUAUAGGGUGCAAGUC- CCGAACCCCGAAGACAGAA- GUAGGUUAGCCAAGAGCAAGGGUGUCCGUGGCGACGCG GAAUCUGAAGGAAGGAGGAGGCAAAACACCGGUCCGAGGAACGAAUCUCAUAUAAGG- CUAGGUAUGAUGGAUGAGUUUGC NNNNNAACAAAGUCC UUUCUGGAAGGUCAUAUCGAGUAAAUGAGGCGGAAUAGAUGGUGUGAAAGUGCAUACG- CUUACCCGGGGAGGAACCUUGGAAACCUACUAGGUACCCUUCAACCUACUACUACCUAUCAUUCAUUCAUUGAACCGCCGUACGGAAC Petition 870250086925, dated 09 / 25 / 2025, p. 129 / 225 30 / 8556GUGUGCCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUGUCCGUGGCGACAUG GAAUCUGAAGGAAGCGGACGGCAAACCUUCGGUCUGAGGAACACGAACUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCNNNNNNAAACAAA GUCCUUUCUGCCAAAGUUGGUACAGAGUAAAUGAAGCAGAUUGAUGAAGGGAAAGACUGCAUUCUUACCCGGGGAGGUCUGAUCGAAACGCCAAG CACUCUUGGUAACCCAUUCAGCAAUGGAUGGCUGAACGGUCAGAAGUCAGCAGAAGUCAUAGUACCCUGCAUACUCGAGAAUGUAAGGGGAAGGACG GAACAAUUAAGUUCGCUUAAUUGAACCGCCGUAUACCGAACGGUACGUACGGUGGUGUGAGAGGACGGGGGUUAGUCGCUCCCUUCUACUCUAU where NNNNNN is the target recognition site, where N is A, U, G or C.

[0104] In some specific embodiments, the DEAR nucleic acid manipulation system comprises an RNA molecule, wherein the nucleotide sequence of the RNA molecule is a nucleotide sequence as set out in any of the sequences SEQ ID NOs: 1 to 9 and 56.

[0105] In some preferred embodiments, the DEAR nucleic acid manipulation system comprises an RNA molecule, wherein the nucleotide sequence of the RNA molecule is a nucleotide sequence as set out in any of the sequences SEQ ID NOs: 1 to 6 and 56.

[0106] In some more preferred embodiments, the DEAR nucleic acid manipulation system comprises an RNA molecule, wherein the nucleotide sequence of the RNA molecule is a nucleotide sequence as set out in any sequence of SEQ ID NOs: 1 to 3, 5 and 56. Petition 870250086925, dated 09 / 25 / 2025, pp. 130 / 225 31 / 85 (Target reconnaissance site)

[0107] In some embodiments, the target recognition site of the DEAR nucleic acid manipulation system is a nucleotide sequence that is complementary to a sequence in a target nucleic acid (target sequence). In other words, the target recognition site of the DEAR nucleic acid manipulation system can interact with the target nucleic acid (e.g., DNA or RNA) in a sequence-specific manner through hybridization (i.e., base pairing). The target recognition site can be modified (e.g., by genetic engineering) / designed to hybridize with any desired target sequence in a target nucleic acid (e.g., a prokaryotic target nucleic acid, a eukaryotic target nucleic acid, or an isolated target nucleic acid).

[0108] In some embodiments, the target recognition site is programmable in the sense that it can be designed or manipulated in order to recognize and bind to a different target sequence.

[0109] In some embodiments, the complementarity percentage between the target recognition site and the target nucleic acid sequence is 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the target recognition site and the target nucleic acid sequence is 80% or more (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the target recognition site and the target nucleic acid sequence is 90% or more (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the target recognition site and the target nucleic acid sequence is 90% or more. Petition 870250086925, dated 09 / 25 / 2025, pp. 131 / 225 32 / 85 target nucleic acid is 100%.

[0110] In some embodiments, the target recognition site has a length of 6 nucleotides (nt). In some specific embodiments, the target recognition site sequence is N1N2N3N4N5N6, in which Ni to N6 are A, G, C, or U, respectively.

[0111] In some embodiments, at least any four nucleotides in the target recognition site of the DEAR nucleic acid manipulation system are complementary to the target nucleic acid sequence. In some preferred embodiments, at least any five nucleotides in the target recognition site of the DEAR nucleic acid manipulation system are complementary to the target nucleic acid sequence. In some more preferred embodiments, 6 nucleotides in the target recognition site of the DEAR nucleic acid manipulation system are complementary to the target nucleic acid sequence.

[0112] In some specific modes, the target recognition site sequence is selected from, but not limited to: (a) AAGACA; (b) UAGGCA; (c) CAGACA; (d) AAUGAA; (e) AUAACA; (f) ACAUCA; (g) CACUCA; and (h) AUUACA.

[0113] In some specific embodiments, the DEAR nucleic acid manipulation system comprises an RNA molecule, wherein the nucleotide sequence of the RNA molecule is a nucleotide sequence as set out in any of the sequences SEQ ID NOs: 10 to 18 and 57. Petition 870250086925, dated 09 / 25 / 2025, pp. 132 / 225 33 / 85 In some specific modes, the target recognition site sequence is (i) CGAUAG. (Target nucleic acid)

[0114] In the present invention, the DEAR nucleic acid manipulation system can bind to, and cleave, a target nucleic acid. In the present invention, the target nucleic acid can be any nucleic acid (e.g., DNA or RNA), can be any type of nucleic acid (e.g., chromosomal (genomic) DNA, chromosome-derived DNA, plasmid DNA, viral DNA, extracellular DNA, intracellular DNA, mitochondrial DNA, chloroplast DNA, linear DNA, circular DNA, etc.) and can be derived from any organism (e.g., provided that the DEAR nucleic acid manipulation system comprises a nucleotide sequence that hybridizes with a target sequence in the target nucleic acid, such that the target nucleic acid can be targeted).

[0115] In particular, in the present invention, the target nucleic acid can be DNA or RNA. In some exemplary embodiments, the target nucleic acid is selected from: mRNA, rRNA, tRNA, non-coding RNA (ncRNA), long non-coding RNA (nclRNA) and microRNA (miRNA). In some exemplary embodiments, the target nucleic acid is viral DNA or plasmid DNA. The target nucleic acid can be located anywhere, for example, outside a cell in vitro, inside a cell in vitro, inside a cell in vivo or inside a cell ex vivo. <biomateriais> (Isolated polynucleotide)

[0116] In some embodiments of the present invention, an isolated polynucleotide is provided in which the polynucleotide comprises a nucleotide sequence that encodes the DEAR nucleic acid manipulation system of the present invention. Petition 870250086925, dated 09 / 25 / 2025, pp. 133 / 225 34 / 85 (Nucleic acid construct)

[0117] In some embodiments of the present invention, a nucleic acid construct is provided, wherein the nucleic acid construct comprises the isolated polynucleotide of the present invention.

[0118] In some optional embodiments, the polynucleotide is operationally linked to one or more regulatory sequences, which are nucleotide sequences comprising a promoter and / or a ribosome binding site, and directs gene expression of the DEAR nucleic acid manipulation system in a host cell. (Vector)

[0119] In some embodiments of the present invention, a vector is provided, wherein the vector comprises the isolated polynucleotide of the present invention or the nucleic acid construct of the present invention.

[0120] In some specific embodiments, the vector is a recombinant expression vector.

[0121] Suitable recombinant expression vectors include viral expression vectors (e.g., viral vectors based on the following viruses: vaccinia virus, poliovirus, adenovirus, adeno-associated viruses, SV40, herpes simplex virus and human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, splenic necrosis virus and retrovirus-derived vectors such as Rous sarcoma virus and Harvey sarcoma virus), avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and mammary tumor virus), etc.). (Cell)

[0122] In some embodiments of the present invention, the present invention provides a cell comprising the DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present Petition 870250086925, dated 09 / 25 / 2025, pp. 134 / 225 35 / 85 invention or the vector of the present invention.

[0123] The cell can be of a variety of cell types, including, for example, in vitro cells, in vivo cells, ex vivo cells, primary cells, cancer cells, animal cells, plant cells, algal cells, fungal cells, etc.

[0124] In some embodiments, the cell is a recipient of the DEAR nucleic acid manipulation system, isolated polynucleotide, nucleic acid construct, or vector provided by the present invention, and may also be referred to as a host cell or target cell. The host cell or target cell may be a recipient of the DEAR nucleic acid manipulation system, isolated polynucleotide, nucleic acid construct, or vector provided by the present invention.

[0125] In some specific embodiments, non-limiting examples of cells include: prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, cells of unicellular eukaryotic organisms, protozoan cells, plant cells, algal cells, fungal cells, animal cells, invertebrate cells, vertebrate cells, mammalian cells (e.g., ungulates, rodents, non-human primates, humans, felines, canines, etc.), etc. In some cases, the cell is a cell that is not derived from a natural organism (e.g., the cell may be a synthetic cell, also known as an artificial cell).

[0126] Depending on the host / vector system used, any one of several suitable transcriptional and / or translational control elements may be used in the recombinant expression vector, including constitutive and inducible promoters, transcriptional enhancer elements, transcription terminators, etc.

[0127] Methods for introducing nucleic acids into host cells are known in the art, and any convenient method can be used to introduce a nucleic acid (for example, the vector of Petition 870250086925, dated 09 / 25 / 2025, pages 135 / 225 36 / 85 recombinant expression, isolated polynucleotide, nucleic acid construct or nucleic acid manipulation system (DEAR) provided by the present invention) in cells. Suitable methods include, for example, viral infection, transfection, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, direct microinjection, nanoparticle-mediated nucleic acid delivery, etc. <Reagente, kit e composição farmacêutica>

[0128] In some embodiments of the present invention, the present invention provides a reagent or kit comprising the DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, the vector of the present invention or the cell of the present invention.

[0129] In some embodiments of the present invention, the present invention provides a pharmaceutical composition comprising the DEAR nucleic acid handling system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, the vector of the present invention or the cell of the present invention, and optionally a pharmaceutically acceptable carrier. <Método e uso da modificação do ácido nucleico alvo>

[0130] The present invention provides a method for modifying a target nucleic acid, comprising the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, the vector of the present invention, the cell of the present invention or the reagent or kit of the Petition 870250086925, dated 09 / 25 / 2025, pp. 136 / 225 37 / 85 present invention. In some embodiments, contact results in modification of the target nucleic acid by the DEAR nucleic acid manipulation system.

[0131] The present invention provides the use of the DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, the vector of the present invention or the cell of the present invention in modifying a target nucleic acid or in preparing a reagent or kit for modifying a target nucleic acid.

[0132] In some specific modalities, the modification is the cleavage of the target nucleic acid. In some specific modalities, the target nucleic acid is selected from among: DNA, RNA, genomic DNA, and extrachromosomal DNA.

[0133] In some specific modalities, contact occurs in vitro or in vivo. In some specific modalities, contact occurs inside or outside the cell.

[0134] In some specific forms, the cell is either a eukaryotic cell or a prokaryotic cell.

[0135] In some more specific embodiments, the cell is selected from among: plant cells, fungal cells, mammalian cells, reptile cells, insect cells, avian cells, fish cells, parasite cells, arthropod cells, invertebrate cells, vertebrate cells, rodent cells, mouse cells, rat cells, primate cells, non-human primate cells and human cells.

[0136] In some more specific modalities, contact results in genome editing.

[0137] In some modalities, contact involves the introduction of the DEAR nucleic acid manipulation system into the cell. EXAMPLES Petition 870250086925, dated 09 / 25 / 2025, pp. 137 / 225 38 / 85

[0138] The present invention will be described in more detail below in connection with the Detailed Description of Embodiments, and the examples provided are only for illustrative purposes of the present invention and are not intended to limit its scope. The examples provided below may serve as a guide for future improvements by those with common knowledge of the art, and do not in any way constitute a limitation to the present invention.

[0139] Unless otherwise specified, the experimental methods in the following examples are all conventional methods and carried out in accordance with the techniques or conditions described in the literature of the art, or in accordance with the product instructions. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available. Example 1. Screening of RNA sequences of group IIC introns

[0140] To screen group IIC introns, 92 group IIC introns from public databases were used in this example, and sequence and structure covariance models were individually constructed for the RNA sequences of the conserved Domains I to III and V to VI. In addition, a hidden Markov model was also constructed for the amino acid sequence features of the potentially existing IEP protein. Generally, the lengths of group IIC introns do not exceed 4000 nt. Therefore, in this example, an identification window of 4000 bp was defined. Potential group IIC introns needed to be within the 4000 bp range and simultaneously meet the high-confidence criteria for Domains I to III and V to VI. If an IEP protein was not identified in Domain IV, the intron from group IIC was considered an ORF-free group IIC intron.

[0141] Based on the multiple covariance models described above, 5684 group IIC introns were identified in this example. Petition 870250086925, dated 09 / 25 / 2025, pp. 138 / 225 39 / 85 global metagenomic dataset. An active group IIC intron must have multiple highly similar copies in the genome of the same strain. Therefore, in this example, highly similar group IIC candidate introns in metagenomes of the same genus were grouped, and a total of 469 potentially active group IIC introns with multiple copies were identified.

[0142] To screen stable ORF-free ribozymes, in this example, candidate introns from group IIC (GII-C introns) were sorted according to the predicted thermal stability of their secondary structures. In addition, in this example, RNA secondary structure prediction was also used to further screen candidate introns from group IIC with conserved secondary structures in the target recognition site (TRS).

[0143] Furthermore, based on the literature, an intron from group IIC, an intron from Oceanobacillus iheyensis (Oi), containing an ORF (N. Toor, KS Keating, SD Taylor, AM Pyle, Crystal structure of a self-spliced ​​​​group II intron., Science, 320, 77 to 82 (2008).), was obtained, and its ORF region was deleted to obtain DEAR10 with the sequence as set out in SEQ ID NO: 57 below.

[0144] Finally, DEAR1 to DEAR10 were selected as the DEAR nucleic acid manipulation system, and their substrate cleavage activities were verified. The secondary structure predictions for the selected DEAR1 to DEAR10 (RNA secondary structures were predicted using the RNAfold web server: http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and their domain annotations are shown in FIGS. 1A to 1J. As can be observed, the secondary structures of DEAR1 to DEAR10 are relatively similar, all comprising Domains I to VI, in which each domain is in the form of a stem-loop structure and naturally separated from each other, and the programmable TRS region. Petition 870250086925, dated 09 / 25 / 2025, pp. 139 / 225 40 / 85 is located in the upper loop region of Domain I for recognizing nucleic acid substrates. The sequences DEAR1 to DEAR10 are shown in Table 1 below, where the underlined and bold portion is the TRS. Table 1: ID Sequence of RNA (5'-3') DEA GUGGCCUCGGCAUGGGUGAUCUCUAGGGGUGAAAGUC- R1 CUAGGUAUCAUUGGAUGAGUUUGC AAGACAAAACAAAGUCC UUUCUGCCGAAGGUGAUACAGAGUAAAUGAAGCAGAUA- GAUGGAAGGAAAGAUUGUACU- CUUACCCGAGGAGGUCUGAUACGUGAGUGGCUUCUCUCAUACUAACUAACUACUUA GAACCAUCAAGUCAGCAGAGGUCAUA- GUACGAAUCGGUCUAGAACGAUUCGGAAGGACUGAACAAUC AAGAGAAAAUAGCCCUUGCAUCAGUACGUCAUGAUGAA- CACAGAAAACAUGGUACCUC- CCAAGAAAGGAAACGGUGAUCCCGUGGGAAUCUUU AGGGUGGAGUGACGACUGGCAUAAGAAGAUCAG- CUAUUUACGGAAGGAAGCUUGCGU- CAUUAUCUUGAUGAACCGCCGUAUACGGAACCGUACGUACGUAC- CUCGAU (SEQ ID NO: 10) GUACGACGGGCAUGUACAUCUGAGGUGCAAGCUCU- R2 GUGGACACCUGCUACCGGU- GAACCCAAUAGCGACUCCCAAGCCUGACUAUCGCGAGGUAA Petition 870250086925, dated 09 / 25 / 2025, p. 140 / 225 41 / 85 CGGGGAGAGGAAGGGAUAGCGAAAUCGUGGCUCUACGAA- CAGAAACGUGAUAUUAAGG- CGUAUAUAGUGGAUGAGGGGGCUAGGCACUCUAAAGUCCAA AAAGGUAGUCGUAAUCUAUGUGCGUAAAUCACGAGA- GUAAACGAGGAAAGAUGUACGACUUA- UCCCGUGAGGUCUCAUGAGCGUCAAGUAGACGUAGUAAUAA CGAAUCAUGAGAAGUCAGCCGAGGUCAUAGUAGUGAUGAAGUUUCUGUAAUGGAAACGGAG- CGAAGGACCGAACGAUUAAAUGAUACCCUAUCUAACUGAUU UUGUCUGCCCUAACACCUGGUCUGAAAUGACGGUACUCG- CAGAACGUAUGCUGAAAGAGG- CUGCUCACAAAUAUAGGACGGCACAAGCGGAACGAAAUCAU AUAUAGGUAGGUGUGGGAACAAAAAAAGUGUUCUCGCCAAA- GUUUAGUUGAACCGCCGUGUG- CCGAACGGCACGCACGGUGGUGUGAGAGGGACUAUCAAUUA GUCCCUACUCGAU (SEQ ID NO: 11;Streptococcus azizii) DEA GUAUGCCCGGCAUGGGCGAUAGCUUUAGGGUGAAAGUC- R3 CCGAACAGGGGUUGGCAACACCAA- CUGUUAGCCAAGCAAGGGUGUCCAUCGUGAGGUGGAAU CUGAAAGAAGCUGGAGGCAAAUUCCCGACCAGGACCAGGAGCAUGCAAA GUUAUAUUCGGGCAAGACUGCCAGACAAGUCAAAGCCCUAU GUUGCCAAGGGAUAUAGCAGUAAAUGUGGCAGGUACAUGGGAUGAAAGUUAUCGCUCUUAUC- CGGGGAGGUCUGUCGAUCCGGUAAUGGUAAAGGAAGCCUAU AACAAUACCAACCCGCAUCGUGAGGUGUCGGCUGAGUCGGCAGAAGUCAGCAGGCCAUA- GUACUCCUAACGAGGAAGGGCCGAAGGUCAGGGCAGACUAA; Petition 870250086925, of 25 / 09 / 2025, p. 141 / 225 42 / 85 GAACGGUGCGUUCGAGAGAAUUUGCUGAUAGCAGUUGUCU- CUGAAACAGAGACCUAU- CUAUAAGAGGGAGUGGUGAAGCCACAAUGGCUUAUAGAAGG GCUGAGAAUUCUCCGGCACAAUACCCGAAAAUCUUAAU- CUUAAUCGCUGAGUAAUCA- GUUAACCCUGGCCAACCGCCGGAUGCGGACCCGCAUGUCC GGUGGUGUGGGAGGGUCGGCGGAGAUUAUCUCCG- CCCCCUAUCCCAAU (SEQ ID NO: 12;Desulfotomaculum_H ferrireducens) DEA GUGCCCAGCAUGGGCCAAUCUUGGAGGUGAAAGUC- R4 CUCCCGUAAGUUGAUCAG- CGAACGAAGCGAAGCCACUGCAUGGGGCGAAGAUCGAUGCGAGUGC-CA CCGACCAGGGCGAGCCGGCAAUGAACCGCGAAGCUCUCGU GAUCAAGGGUCAGGCGGCGUAUCCGGCGGUUGUGCAGU- GAAGGAUUGCGUUCUUACCUG- CAUGGCCGGAGAGGCUGGAAGCU- GUUGGCGAAGGACCAAAGGAGCAGAAGGGCAAGUGCCU GACCAUCCAAUGGAUAUGCUUCAGAUGCCCGGA- UACGGGGCCUUACGAAAGUGCAG- CAGGUGAAGCCUGAAAAUACUUGUGACCAUGCGAAGAA CGGCCGGGUUGGGGACAGGCGAGUCCAGGCGUCAU- CAACCGUUUCAACCGCCCGGUGCCGCCCCAUGCCGGGU GGUGUGGCAGGGGACCGGUCAGUUACUGACCG- CCCCUAUGCCGAU- CCCCUAUGCCGAU- CCCCUAUGCCGAU- CCCCUAUGCCGAU (SEQ ID 13; Petition 870250086925, dated 09 / 25 / 2025, p. 142 / 225 43 / 85 DEA GUGCGCCCGGCAUGUACAUGAACUAUAGGGUGUAAGUC- R5 CCGAACCCCGAAGACAGAA- GUAGAGGUUAGCCAAGAGCAAGGGUCCGUGGUGACGCG GAAUCUGAAGGAAGCUGGAGCAAAACACCGGUCCGAGGA- ACACGAACCUCAUAUAAGG- CUAGGUAUGAUU GAGUGAGUUUGC AUAACAAAACAAAGCUC UUUCUGUCGAAGGUCAUAUCGAGUAAAUGAGGCGGAUA- GAUGGUGAAAGUGCAUGUA- CUUACCCGGGAGGUCUGGCGGAUAUGUGAAGUACUCUUC AUAACCUACUUAGUGAUAAGUAGCUGAACCGUCAGAAGUCA- GCAGAGGUCAUAGUAUUA- GUUGGUCUAGAACAACUAAGAAGGACCGAACAAUUAAGAGA GAAUAG CCCUUGGUAUUCAGUGAGUCAUGAUGAACACA- GAAAACGUAGUACCUCACUUGAGG- GAGGAAGCGGUGAAUCCCGUGGGACCUCUUGGAGGGUG GAGUGACCACUGGCAUAAAGAGAACAGCUAUUCACGGAA- SEQ ID NO: 14;Bacillus_O smithii) DEA GUGUGCCCAGUAUGGCAUCUUUUGUUUAC- R6 CGAAAGGUAAAAUAUUAAUCUAGAGGGUG- CAAGUCCCUUAUGGGCAGGGGUAACGCCUUGAACCAUUAGU AAGCCGCCAAGGGUGGUGAUCGUGAGCAUUAGU GAAGAAAGCGGGACUACAACCCGGUA- CUGACGAACAGGAACCGUACAGAGGCAUUUAUGCAUGGG UAAGCAACCACAUCAUGUAAAGCCCUAAGAAUACCAAAA- GUGCAUUUAUGUAGAGCGCCA- GGGAUCGGGGAAGAACUGAUGAUGCAUGCUGGAAAA- Petition 870250086925, of 25 / 09 / 2025, p. 143 / 225 44 / 85 CCAGUACCACGUUGUUACAGGAGAAGGCAGAGGU- CAUAGUACCUAAGGGAAACGA- GUUGCAGCGAAACUGCAUAGGUCUCACAAUUAGGAAAAGGAC AGAAGAUAGUGCCAAGGGUGAAAAGAGCUUGGUGUGAUGG UUUACGAACCGCCGUAUACGAGACCGUACGUGCGGUGGGGGGGUGCACUUCAU- CAUUUGAUGGCGGAGCCAUCCACUCGAU (SEQ ID NO: 15;Leeuwenhoekiella) DEA GUGUGCCCUGAAUGGCAAAUAUAGUUCUUU- R7 CAAAUAGAAUAAUC CAGAGAGUGAAAGUCU- CUUAUGCCUCUUAAAUUGAGGAAGCAUUAGCAAGUCGCA AGGUGGUUUGUCGUGAGAUAUGCACUGAAGUAAGCGAAGGAAGGAGUACGUACGUACCUACUAGCA CAGAAACUGUAUAUAGAGGCAUGAUGAAUCGGGUGAGGUAG CACAUCAUACUAAAGCCCCAAGAUUACAAACCAUUCAUCAU- GUAGAUGCAGCAGCGAUUGAC- CGAAGGAUAUUUGUCUUACCGGGGGAGGUCUGUUGAUAGG UUGAAAGACAUGAUGAGCAUGCAGCAUGAUGA CCGAAAGCAAUAGGGAGUUU- CAAUAGAAGUCAGCAGAGGUCAUAGUAGUUGGUAGUUACGA GCCGAAGAUAAAUCGGACGCUCACAAGCCAGGAAGGA- CUGAAUGUUAAGUCGUUU- CUAAUGCAAUAAGGAGCUUAAAGCUUCGCGCCUAGCAGCCCU UGUUAUAAAAGAAACAAAGUGCAAUGGUGAAAAGAG- CGAUUGUACUCAUGCUUAACAAAC- CGCCGUGUACGAGACCCAUACGCACGGUGGUGUGAGGGC ACUCCCCACCUGUUCAUUCAGGUGGGGCUGUCCACUCGAU; Petition 870250086925, of 25 / 09 / 2025, p. 144 / 225 45 / 85 (SEQ ID NO: 16; PALSA-967 sp003151745) DEA GUGCCCAGCAUGUGCAAUAGCUAAGCGGUGAAAGUC- R8 UGAAGGAAGCCCAAGGCAAAGUCCCGGUCCGAUGAACAAGAACCAGAAUAUAAGGCUAAGU- GAAGUGGACGAGUUUGCCACUCAAAACGAAGUCCAACAGCU ACCUGAACUCCACGGAGUAGAUCUGGCGGAUAGAUGGAAUGUUUGCACUUACCUG- GGGAUCUCAAGAAUGCUAUUGAGGCAACCCAUACAGC AAUGUAUGGCU GAAUCUU GAGAAGUCAG CAGAAGAUAGUACUCAUU GAGAGAUGAGGAAG- GACU GAACAACAAGGUUUC GAAUCUU GAAAGAUGCGAAG GGAUACGGAAAAGGCAUACCUUCGACUAAGGUUACAUGAAGAUAAGGGAGAG- CCCGAAAAUAAUGUACCAAGGCCUAGUAUAACUUCUAUC UGAAAGAGGGAAACGAUACAUACAUACAUCAACCUGUUGAACCGCCAGGAGUAGAUGAGUAGAUGAGUAGGUAC- UAAUUAUCUACCUCCUACUCGAU (SEQ ID NO: 17; Petrotoga mobilis) DEA GUGCCCCGGCAUGCGUAUGAACUAUAGGGGUCAAGUC- R9 ACACGAAUCAUAUAAGG- CUAGGUAUGAUGGAUGAGUUUGC AUUACAAAACAAAGUCC Petition 870250086925, dated 25 / 09 / 2025, p. 145 / 225 46 / 85 UUUCUGUCGAAGGUCAUAUCGAGUAAUGAGCGGAUAAGAUGGUGUAAAGUGCAUACG- CUUACCCGGGGAGGUCUGAUGGAAACGUGAAGUACCCUUCA UACCUACUUGGUGACAAGUAGCUGAACCAUGAUCAGAAGUCAGGAGGUCAUAGUACGAAA- CUUUGCGUUAUUCAUCUUAAUUGAACCGCGUUACGGAAC CGUACGUACGGUGUGUGAGAGGUCGGGAGUUAAUAUCACUCCCUCCCUCUCGAU (SEQ ID NO: 18; Lysinibacillus sphaericus_B) DEA R10 GUGUGCCCGGCAUGGUGCAGUCUAUAUAGGGUGUGAGAGUCCGGAACUGUGAAAGCAGAGUAA- CAGUUAGCCUAACGCAAGGGUCUCCGUGGCGACAUG GAAUCUGAAGGAAGCGACGGCAAACCUUCGUGUCUGAGGAACGAACUUCAUAUAUGAGG- CUAGGUAUCAAAUGGAUGAGUUUGCAUAACAAAACAAA GUCCUUUCUGCCAAAGUUGGUACAGAGUAAUGAAGCAGAUUGAUGAAGGAAAAGACUGCAUUCUUAACCCGGGGAGGUCUGAUCGAAACGCCAAG CACUCUUGGUAACCCAUCAGCAAUGGAUGGCUGAACGGUCAGAAGUCAGCAGAAGUCAUAGUACCCUGCAUACUCGAGAAUGUAAGGGAAGGACG GAACAAUUAAGUUCCCUUAAUUGAACCGCCGUAUACCGGAACGGUACGGUGUGAGGAGGACGGGGGUUAGUCGCUCCCUUCUACUCUAU (SEQ ID NO: 57; Oceanobacillus iheyensis)

[0145] With reference to FIGS. 1A to 1J, the secondary structures of DEAR1 to DEAR10 are as follows:

[0146] DEAR1 contains 6 domains (Domains I to VI). Domain I comprises 4 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; the Petition 870250086925, dated 09 / 25 / 2025, pp. 146 / 225 47 / 85 Domain IV comprises 2 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0147] DEAR2 contains 6 domains (Domains I to VI). Domain I comprises 3 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 1 stem-loop / hairpin structure; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 4 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0148] DEAR3 contains 6 domains (Domains I to VI). Domain I comprises 4 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 4 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0149] DEAR4 contains 6 domains (Domains I to VI). Domain I comprises 6 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 3 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 3 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 Petition 870250086925, dated 09 / 25 / 2025, pp. 147 / 225 48 / 85 rod-handle / hair clip structure.

[0150] DEAR5 contains 6 domains (Domains I to VI). Domain I comprises 4 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 2 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0151] DEAR6 contains 6 domains (Domains I to VI). Domain I comprises 6 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 1 stem-loop / hairpin structure; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 3 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0152] DEAR7 contains 6 domains (Domains I to VI). Domain I comprises 4 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 2 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0153] DEAR8 contains 6 domains (Domains I to VI). Domain I comprises 5 stem-loop / hairpin structures and one Petition 870250086925, dated 09 / 25 / 2025, pp. 148 / 225 49 / 85 TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 3 stem-loop / hairpin structures; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0154] DEAR9 contains 6 domains (Domains I to VI). Domain I comprises 4 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 1 stem-loop / hairpin structure; Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0155] DEAR10 contains 6 domains (Domains I to VI). Domain I comprises 4 stem-loop / hairpin structures and a TRS sequence responsible for substrate recognition; Domain II comprises 2 stem-loop / hairpin structures; Domain III comprises 1 stem-loop / hairpin structure; Domain IV comprises 1 stem-loop / hairpin structure and a 1260 nt ORF region (deleted in DEAR10); Domain V comprises 1 stem-loop / hairpin structure, which includes a catalytic core; and Domain VI comprises 1 stem-loop / hairpin structure.

[0156] The nucleotides corresponding to D1 to D6 in DEAR1 to DEAR10 are shown below: DEAR1 D1: 1-266, D2: 267-339, D3: 340-385, D4: 386-562, D5: 563-596, D6: Petition 870250086925, dated 09 / 25 / 2025, pp. 149 / 225 50 / 85 597-633, and TRS: 181-186 DEAR2 D1: 1-267, D2: 268-318, D3: 319-375, D4: 376-562, D5: 563-596, D6: 590-621, e TRS: 181-186 Ou DEAR2 D1: 1-267, D2: 268-321, D3: 322-375, D4: 376-555, D5: 556-589, D6: 590-621, e TRS: 181-186 DEAR3 D1: 1-266, D2: 267-350, D3: 351-390, D4: 391-572, D5: 573-606, D6: 607-647, e TRS: 181-186 Ou DEAR3 D1: 1-266, D2: 267-353, D3: 354-388, D4: 389-572, D5: 573-606, D6: 607-647, e TRS: 181-186 DEAR4 D1: 1-262, D2: 263-318, D3: 319-379, D4: 380-573, D5: 574-607, D6: 608-650, e TRS: 179-184 DEAR5 D1: 1-266, D2: 267-342, D3: 343-385, D4: 386-569, D5: 570-603, D6: 604-640, e TRS: 181-186 Ou DEAR5 Petição 870250086925, de 25 / 09 / 2025, pág. 150 / 225 51 / 85 D1: 1-266, D2: 267-339, D3: 340-385, D4: 386-569, D5: 570-603, D6: 604-640, e TRS:181–186 DEAR6 D1: 1–299, D2: 300–342, D3: 343–411, D4: 412–515, D5: 516–550, D6: 551–595, e TRS: 214–219 Ou DEAR6 D1: 1–299, D2: 300–339, D3: 340–411, D4: 412–515, D5: 516–550, D6: 551–595, e TRS: 214–219 DEAR7 D1: 1–290, D2: 291–380, D3: 381–448, D4: 449–561, D5: 562–596, D6: 597–644, e TRS: 206–211 Ou DEAR7 D1: 1–290, D2: 291–377, D3: 378–449, D4: 450–561, D5: 562–596, D6: 597–644, e TRS: 206–211 DEAR8 D1: 1–267, D2: 268–338, D3: 339–375, D4: 376–613, D5: 614–594, D6: 595–636, e TRS: 180–185 Ou DEAR8 D1: 1–267, D2: 268–335, D3: 336–375, D4: 376–559, D5: 560–593, D6: 594–636, e TRS: 180–185 Petition 870250086925, dated 09 / 25 / 2025, p. 151 / 225 52 / 85 DEAR9 (without Domain D4, represented by ---) D1: 1-266, D2: 267-342, D3: 343-380, D4: ---, D5: 381-415, D6: 416-451, and TRS: 181-186 Or DEAR9 (without Domain D4, represented by ---) D1: 1-266, D2: 267-339, D3: 340-380, D4: ---, D5: 381-414, D6: 415-451, and TRS: 181-186 DEAR10 D1: 1-266, D2: 267-339, D3: 340-388, D4: 389-408, D5: 409-442, D6: 443-479, and TRS: 181-186

[0157] Illustratively, Domain I (D1) in DEAR1 corresponds to nucleotide 1 to nucleotide 266 of the DEAR1 nucleotide sequence (SEQ ID NO: 1).

[0158] It should be noted that, for the division of domains of the primary sequences described above, the position of each domain was determined by a three-dimensional structure for DEAR1, DEAR2, DEAR3, DEAR5 and DEAR6, and the position of each domain was confirmed by performing sequence alignment with DEAR1, DEAR2, DEAR3, DEAR5 and DEAR6 using Clustal (F. Sievers et al., Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega., Mol. Syst. Biol. 7, 539 (2011). doi:10.1038 / msb.2011.75) for the remaining DEARs (DEAR4 and DEAR7 to DEAR10). Due to the plasticity of the RNA structure, there was a degree of deviation in the sequence boundaries of each domain (e.g., approximately -20-+20 nt). Furthermore, the division of the secondary domain boundaries was the same as that of the primary structure. The prediction of the secondary structure was performed using the RNAfold method (R. Lorenz et al., Petition 870250086925, dated 09 / 25 / 2025, pp. 152 / 225 53 / 85 ViennRNAA Package 2.0. Algorithms, Mol. Biol., 6, 26 (2011). doi:10.1186 / 1748-7188-6-26). Due to the dynamic nature of RNA structure, each RNA domain can exhibit a deviation of 0 to 5 stem-loop / hairpin structures.

[0159] Therefore, there may be different splitting modes for the nucleotide positions corresponding to D1 to D6 in DEAR1 to DEAR10 above. Furthermore, for example, in the secondary structure prediction of DEAR9, Domain IV contains 1 stem-loop / hairpin structure; however, the corresponding primary sequence is absent in the primary structure, as confirmed by sequence alignment with DEAR1, DEAR2, DEAR3, DEAR5 and DEAR6 using Clustal, which is also reasonable. Example 2. RNA preparation method

[0160] The corresponding DNA sequences from DEAR1 to DEAR10 cells screened in Example 1 were first synthesized, and the T7 promoter (TAATACGACTCACTATA; SEQ ID NO: 19) was added upstream of each DEAR via PCR. The PCR amplification product was purified using magnetic DNA purification beads (VAHTS DNA Clean Beads, Vazyme, Cat. No. N411-01), and the purified product was used as a template for in vitro transcription (IVT). The in vitro transcription reaction was carried out in 30 mM Tris pH 8.1, 25 mM MgCl2, 0.01% Triton X-100, 2 mM spermidine, and 5 mM DTT, where each NTP was added at 5 mM. RNAse inhibitor (Promega, Cat. No. N2111) and T7 RNA polymerase (NEB, Cat. No. M0251S) were added according to the reagent suppliers' instructions. After 4 hours of reaction at 37°C, digestion with DNase I (Promega, Cat. No. M6101) and digestion with proteinase K (Beyotime, Cat. No. ST533) were carried out sequentially to remove the template DNA and proteins.Next, the transcription product was washed and concentrated using a concentrator with a cut-off point. Petition 870250086925, dated 09 / 25 / 2025, pp. 153 / 225 54 / 85 molecular weight of 100 kDa. Electrophoresis was performed using 8% urea-PAGE to detect RNA mass. Specific results are shown in FIGS. 2A and 2B. As can be seen, RNAs from 10 ribozymes were successfully prepared. When compared with RNAs of known lengths, the size of each ribozyme RNA was found to correspond to its theoretical length. Example 3. In vitro cleavage of single-stranded RNAs, single-stranded DNAs, and plasmids using DEAR nucleic acid manipulation systems. 1. In vitro cleavage of single-stranded RNAs using DEAR nucleic acid manipulation systems

[0161] Single-stranded RNA (ssRNA) substrates with corresponding DEAR target sequences (where the underlined and bold part is the target sequence recognized by DEAR) were synthesized according to the sequences shown in Table 2 below, each single-stranded RNA substrate being labeled with -Cy5 at its 3' end. Each DEAR (1.5 μM) was individually incubated with the corresponding single-stranded RNA substrate (100 nM) under conditions of NH4Cl 500 mM, MgCk 125 mM, MOPS 40 mM pH 7.5 and 50°C for 1 h. After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned in a fluorescence imager. The results are shown in FIG. 3. As shown in FIG. Figure 3 shows that the RNA scavage products are located at the bottom, and it can be observed that DEAR1 to DEAR9 are able to cleave single-stranded RNA. In FIG. 3, I represents the input RNA sc and C represents the cleavage product. Table 2: ID No. SEQ ID NO: Sequences (5'-3', in which the underlined and bold parts are the Petition 870250086925, dated 09 / 25 / 2025, pp. 154 / 225 55 / 85 target sequence) RNA-DEAR1 SEQ ID NO: 20 ACCAAAUGUCUUAGCGGAUCGGAU RNA-DEAR2 SEQ ID NO: 21 GAGAAAUGCCUACAACACACCACC RNA-DEAR3 SEQ ID NO: 22 GUAACAUGUCUGCAAAACCUCCAA RNA-DEAR4 SEQ ID NO: 23 GGAGGCUUCAUUAACGGCAACAGA RNA-DEAR5 SEQ ID NO: 24 ACCCACUGUUAUCCGACGACGAGC RNA-DEAR6 SEQ ID NO: 25 CUUCACUGAUGUACAACCAAGAGA RNA-DEAR7 SEQ ID NO: 25 CUUCACUGAUGUACAACCAAGAGA RNA-DEAR8 SEQ ID NO: 27 GUAACAUGAGUG CAAAACCUCCAA RNA-DEAR9 SEQ ID NO: 28 ACCCACUGUAAUCCGACGACGAGC 2. Verification of target regions of RNAfs for handling systems of nucleic acids DEAR

[0162] DEAR1 to DEAR6 (each 1.5 μM) were individually incubated with the corresponding single-stranded RNA substrate (100 nM) that cannot pair with the TRS region (the substrate used for DEAR1 was the sequence as established in SEQ ID NO: 21, the substrate used for DEAR2 was the sequence as established in SEQ ID NO: 23, the substrate used for DEAR3 was the sequence as established in SEQ ID NO: 23, the substrate used for DEAR4 was the sequence as established in SEQ ID NO: 22, the substrate used for DEAR5 was the sequence as established in SEQ ID NO: 21 and the substrate used for DEAR6 was the sequence as established in SEQ ID NO: 23) under conditions of 10 mM KCl, 50 mM MgCk, 40 mM MOPS, pH 7.5 and 37°C. Samples were taken at specific points in time (0 min, 5 min, 10 min, 30 min, 60 min, and 120 min).After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned using a fluorescence imager. The results of the gel images are shown in FIG. 4. As shown in FIG. 4, the cleavage products of ssRNA are located below the substrates, and when the... Petition 870250086925, dated 09 / 25 / 2025, pages 155 / 225 56 / 85 substrate cannot pair with the TRS region, therefore it cannot be cleaved. 3. In vitro cleavage of single-stranded DNAs using DEAR nucleic acid manipulation systems.

[0163] Single-stranded DNA (ssDNA) substrates with the corresponding target sequences for DEAR1 to DEAR6 (where the underlined and bold part is the target sequence recognized by DEAR) were individually synthesized according to the sequences shown in Table 3 below, and were labeled with -Cy5 at the 3' end. Subsequently, each DEAR (1.5 μM) was incubated with the corresponding single-stranded DNA substrate (100 nM) under conditions of NH4Cl 500 mM, MgCk 125 mM, MOPS 40 mM pH 7.5 and 50°C. Samples were taken at specific time points (0 min, 5 min, 10 min, 20 min, 40 min, 60 min and 120 min, shown as 0 to 2 h in the figure). After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned using a fluorescence imager. The results of the gel images and the efficacy curve are shown in FIG. 5. As shown in FIG.5, the products of cleavage of sfDNA are located below the substrates and it can be observed that DEAR1 to DEAR6 are able to cleave single-stranded DNA. Table 3: ID SEQ ID NO: Sequences (5'-3', where the underlined and bold part is the target sequence) 5X- DEAR1 SEQ ID NO: 29 TAGAGAACTT TGTCTT TGTCTT TGTCTT TGTCTT TGTCII IIIACTGGGTAGTGCG- TAGG 5X- DEAR2 SEQ ID NO: 30 TAGAGAACTT TGCCTA TGCCTA TGCCTA TGCCTA TGCCTA mACTGGGTAGTGCG- TAGG Petition 870250086925, dated 09 / 25 / 2025, pp. 156 / 225 57 / 85 5X- DEAR3 SEQ ID NO: 31 TAGAGAACTT TGTCTG TGTCTG TGTCTG TGTCTG TGTCTG IIIACTGGGTAGTGCG- TAGG TGTTAT TGTTAT TGTTAT TGTTAT TGTTAT mACTGGGTAGTGCG- TAGG 5X- DEAR6 SEQ ID NO: 34 TAGAGAACTT TGATGT TGATGT TGATGT TGATGT TGATGT H TACTGGGTAGTGCG- TAGG 4. Verification of target regions of DNAfs for DEAR nucleic acid manipulation systems

[0164] DEAR1 to DEAR6 (1.5 μM) were each individually incubated with the corresponding single-stranded DNA substrate (100 nM) that may or may not pair with the TRS region (the substrates used for DEAR1 were the sequences as established in SEQ ID NO: 29 and SEQ ID NO: 30, respectively; the substrates used for DEAR2 were the sequences as established in SEQ ID NO: 30 and SEQ ID NO: 32, respectively; the substrates used for DEAR3 were the sequences as established in SEQ ID NO: 31 and SEQ ID NO: 32, respectively; the substrates used for DEAR4 were the sequences as established in SEQ ID NO: 32 and SEQ ID NO: 31, respectively; the substrates used for DEAR5 were the sequences as established in SEQ ID NO: 33 and SEQ ID NO: 30, respectively;and the substrates used for DEAR6 were the sequences as established in SEQ ID NO: 34 and SEQ ID NO: 32, respectively) under conditions of NH4Cl 500 mM, MgCl2 125 mM, MOPS 40 mM pH 7.5 and 50°C for 1 h. After the reaction had; Petition 870250086925, dated 09 / 25 / 2025, pages 157 / 225 After the 58 / 85 stage was completed, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned using a fluorescence imager. The results of the gel images are shown in FIG. 6. As shown in FIG. 6, where T represents the paired substrate, T* represents the cleavage product of the paired substrate, N represents the unpaired substrate, N* represents the cleavage product of the unpaired substrate, and M represents the marker, the cleavage products of the ssDNA are located below the substrates. It can be seen that DEAR1 to DEAR6 can cleave single-stranded DNA, and when the substrate cannot pair with the TRS region, it cannot be cleaved. 5. Verification of DNA cleavage sites for DEAR nucleic acid manipulation systems

[0165] Single-stranded DNA (ssDNA) substrates with corresponding target sequences for DEAR1 to DEAR6 (where the underlined and bold part is the target sequence recognized by DEAR) were synthesized according to the sequences shown in Table 4 below, having been labeled with -Cy5 at the 3' end. Subsequently, each DEAR (1.5 μM) was incubated with the corresponding single-stranded DNA substrate (100 nM) under conditions of NH4Cl 500 mM, MgCl2 125 mM, MOPS 40 mM pH 7.5 and 50°C for 24 h. After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned in a fluorescence imager. The gel images are shown in FIG. 7. As shown in FIG.7, in which the larger triangle represents the primary cleavage site, the smaller triangle represents the secondary cleavage site, I represents the input substrate, Dr1 to Dr6 represent the corresponding cleavage products from DEAR1 to DEAR6, L represents the ladder produced by random digestion of ssDNA using DNase I (Promega, Cat. No. M6101) to indicate the product length, and M. Petition 870250086925, dated 09 / 25 / 2025, pages 158 / 225 59 / 85 represents the marker; the cleavage products of the ssDNA are located below the substrates, and it can be observed that the main cleavage site is located 0 to 1 nt downstream of the 3' end of the region paired with the TRS. Table 4: ID SEQ ID NO: Sequences (5'-3', where the underlined and bold part is the target sequence) 1X-DEAR1 SEQ ID NO: 35 ACCAAATGTCTTAGCGGATCGGAT 1X-DEAR2 SEQ ID NO: 36 GAGAAATGCCTACAACACACCACC 1X-DEAR3 SEQ ID NO: 37 GTAACATGTCTGCAAAACCTCCAA 1X-DEAR4 SEQ ID NO: 38 GGAGGCTTCATTAACGGCAACAGA 1X-DEAR5 SEQ ID NO: 39 ACCCACTGTTATCCGACGACGAGC 1X-DEAR6 SEQ ID NO: 40 CTTCACTGATGTACAACCAAGAGA 6. Optimization of DNA cleavage conditions for DEAR1

[0166] DEAR1 (1.5 μM) was incubated with the single-stranded DNA substrate 1X-DEAR1 (SEQ ID NO: 35; 100 nM) under conditions of various concentrations of monovalent and divalent ions and different temperatures. Samples were taken at specific time points (0 min, 5 min, 10 min, 20 min, 40 min, 1 h, 2 h, 4 h, 8 h, 12 h, and 24 h). After the reaction was complete, urea-PAGE electrophoresis was performed, and the fluorescence signals from the gel were scanned using a fluorescence imager. The results of the gel images and the efficacy curves are shown in FIGS. 8 and 9. As shown in FIGS. 8 to 9, the DNA cleavage products are located below the substrate, and it can be observed that DEAR1 prefers K+ and that the lower the concentration, the greater its activity, which is different from the previously reported group II introns (N. Toor, KS Keating, SD Taylor, AM Pyle, Crystal structure of a self-spliced ​​​​group II intron., Science, 320, 77 to 82 (2008) and C. Quiroga, P.H. Roy, D. Centron, Insertions of group II S.ma.I2 class C introns at attC integron sites, Microbiology (Reading). Petition 870250086925, dated 09 / 25 / 2025, pp. 159 / 225 60 / 85 154, 1341 to 1353 (2008)). Furthermore, DEAR1 is more active at higher Mg2+ concentrations. It is active between 25 and 50°C, and the activity is relatively high at a temperature of 37 to 42°C. Specific reaction conditions: FIG. 8A: KCl 150 mM, MgCk 10 / 50 / 125 mM, MOPS 40 mM, 7.5 and 37°C; FIG. 8B: KCl 10 / 150 / 500 mM, MgCb 50 mM, MOPS 40 mM, 7.5 and 37°C; FIG. 8C: NH4Cl 10 / 150 / 500 mM, MgCk 50 mM, MOPS 40 mM, 7.5 and 37°C; FIG. 8D: 10 / 150 / 500 mM NaCl, 50 mM MgCb, 40 mM MOPS 7.5 and 37°C; and FIG. 8E: 10 mM KCl, 50 mM MgCk, 40 mM MOPS 7.5 and 25 / 37 / 42 / 50 / 60°C. 7. Comparison of the DNA cleavage efficiency of DEAR1 and RNA-guided proteases

[0167] DEAR1 (1.5 μM) was incubated with 1X-DEAR1 single-stranded DNA substrate (SEQ ID NO: 35; 100 nM) under conditions of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS, pH 7.5 and 37°C. Samples were taken at specific time points (0 min, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h and 16 h). For the CRISPR-Cas nuclease systems used, the reaction systems were prepared at an RNP:DNA ratio of 15:1, according to the methods described in A. Sun et al., The compact Caspi (Cas12l) 'bracelet' provides a unique structural platform for DNA manipulation., Cell Res., 33, 229-244 (2023), CA Tsuchida et al., Chimeric CRISPR-CasX enzymes and guide RNAs for enhanced genome editing activity., Mol. Cell, 82, 1199-1209-1196 (2022) and M. Jinek et al., A programmable double RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816-821 (2012). Samples were taken at specific points in time (0 min, 10 min, 30 min, 1 h, 2 h, 4 h, 8 h and 16 h).After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned using a fluorescence imager. The results of the gel images and the efficacy curve are shown in FIG. 10. As shown in FIG. 10, the DNA cleavage products are located. Petition 870250086925, dated 09 / 25 / 2025, pp. 160 / 225 61 / 85 below the substrate, and it can be observed that the cleavage efficiency of DEAR1 is close to that of SpyCas9 and AbCasπ1, and superior to that of PlmCasX. 8. In vitro cleavage of plasmids by a DEAR nucleic acid manipulation system

[0168] A plasmid containing the corresponding target sequence for DEAR1 (TGTCTTAAGACA; SEQ ID NO: 41) was designed and synthesized (using the commercially available pUC19 plasmid from Addgene (Plasmid #50005) as a backbone). DEAR1 (1.5 μM) was incubated with the plasmid substrate (0.03 μM) under conditions of 150 mM KCl, 10 mM MgCl2, 40 mM MOPS, pH 7.5, and 37°C. Samples were taken at specific time points (0 h, 3 h, 8 h, and 24 h). After the reaction was complete, agarose gel electrophoresis was performed, and the gel image was obtained by taking a photograph in an ultraviolet imager. The results are shown in FIG. 11, where L represents the EcoRI-treated plasmid (NEB, Cat. No. R0101V) in a linear double-stranded state; OC represents the Nt.BspQI-treated plasmid (NEB, Cat. No.R0644S) in an open circular state; SC represents the untreated plasmid in a supercoiled state, and 0, 3, 8, and 24 represent the time for the plasmid to be cleaved with DEAR1 (in hours). With reference to FIG. 11, the substrate plasmids exist in a supercoiled state, and the products resulting from the cleavage reaction appear in an open circular state, located above the substrate. It can be observed that DEAR1 is able to cleave the plasmid. 9. In vitro cleavage of single-stranded RNAs by DEAR10

[0169] RNA substrate sequence (RNA-DEAR10) used in this experiment: ACCCACUGUUAUCCGACGACGAGC (same as RNA-DEAR5, SEQ ID NO: 24)

[0170] RNA from DEAR10 (1.5 μM) was incubated with the substrate of Petition 870250086925, dated 09 / 25 / 2025, pp. 161 / 225 62 / 85 Single-stranded RNA (100 nM, SEQ ID NO: 24) was cleavage under conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS, pH 7.5, and 50°C for 1 h. After the reaction was complete, urea-PAGE electrophoresis was performed, and the fluorescence signals from the gel were scanned using a fluorescence imager. The results are shown in FIG. 18. As shown in FIG. 18, the product of cleavage of ssRNA is located at the bottom, and it can be observed that DEAR10 is able to cleave single-stranded RNA. 10. In vitro cleavage of single-stranded DNAs by DEAR10

[0171] DNA substrate sequence (5X-DEAR10) used in this experiment: TAGAGAACTT TGTTAT TTTACTGGGTAGTGCGTAGG (same as 5X-DEAR5, SEQ ID NO: 33)

[0172] RNA from DEAR10 (1.5 μM) was incubated with the substrate of Single-stranded DNA (100 nM, SEQ ID NO: 33) was cleaved under conditions of 500 mM NH4Cl, 125 mM MgCb, 40 mM MOPS, pH 7.5, and 50°C. Samples were taken at specific time points (0 min, 5 min, 10 min, 20 min, 40 min, 60 min, and 120 min, shown as 0 to 2 h in the figure). After the reaction was complete, urea-PAGE electrophoresis was performed, and the fluorescence signals from the gel were scanned using a fluorescence imager. The gel image results are shown in FIG. 19. As shown in FIG. 19, the cleavage products of the ssDNA are located below the substrate, and it can be observed that DEAR10 is able to cleave single-stranded DNA. 11. Verification of DNAfs target regions for DEAR10

[0173] DEAR10 (1.5 μM) was incubated individually with the corresponding single-stranded DNA substrate (100 nM) that may or may not pair with its TRS region (the sequences as established in SEQ ID NO: 33 and SEQ ID NO: 30, respectively) under conditions of NH4Cl 500 mM, MgCb 125 mM, MOPS 40 mM pH 7.5 and 50°C Petition 870250086925, dated 09 / 25 / 2025, pp. 162 / 225 63 / 85 for 1 h. After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned using a fluorescence imager. The gel image results are shown in FIG. 20, in which the cleavage products of ssDNA are located below the substrates. It can be observed that DEAR10 can cleave single-stranded DNA, and when the substrate cannot pair with the TRS region, it cannot be cleaved. Example 4. Plasmid interference in E. coli cells 1. Construction of target plasmids

[0174] An expression-inducible plasmid for the ccdB toxin gene (Addgene, plasmid ID: 69056) containing the corresponding target sequences for DEAR1 to DEAR3 at the plasmid replication origin (ori) was used as the target plasmid. 2. Construction of DEAR expression plasmids

[0175] In the DEAR expression plasmids, the J23119 promoter (with the specific sequence (SEQ ID NO: 42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) was used to drive the expression of each DEAR sequence. The construction method was as follows: the J23119 promoter was ligated to each of DEAR1 to DEAR3. Then, the sequences of DEAR1 to DEAR3, each ligated to the J23119 promoter, were individually inserted into the pCDFDuet1 plasmid vector (Novagen, Cat. No. 71340-3) via homologous recombination, thus individually replacing the complete sequence of the 410 to 3765 region of this plasmid. 3. Construction of the CRISPR-Cas nuclease system

[0176] In CRISPR-Cas nuclease expression plasmids, the Trc promoter (with the specific sequence (SEQ ID NO: 43): TTGACAATTAATCATCCGGCTCGTATAATG) was used to drive the expression of Cas9 nuclease, while the J23119 promoter (with the specific sequence as above) was used to drive the expression of Petition 870250086925, dated 09 / 25 / 2025, pp. 163 / 225 64 / 85 corresponding guide RNA sequence (sgRNA, single guide RNA). The sgRNA expressed in the positive control group (marked CP in FIG. 12, i.e., the CP group) contained a 20-base target sequence (with the specific sequence (SEQ ID NO: 44): GCGATAAGTCGTGTCTTACC), and the target plasmid was cleaved as guided by the sgRNA. The sgRNA expressed in the negative control group (marked CN in FIG. 12, i.e., the CN control group) did not contain a 20-base target sequence, and the target plasmid could not be cleaved. The construction method was as follows: the Trc promoter was ligated to the Cas9 sequence, followed by the J23119 promoter and sgRNA. Next, the entire Trc-Cas9J23119-sgRNA sequence was inserted into the pCDFDuet1 plasmid vector (Novagen, Cat. No. 71340-3) via homologous recombination, thus replacing the complete sequence of the 410 to 3765 region of this plasmid. 4. Detection of plasmid interference in E. coli cells

[0177] The target plasmid from Step 1 was countertransformed into the E. coli strain BW25141 (CGSC, Strain Accession No.: 7635) with the different expression plasmids constructed in Steps 2 and 3 (the DEAR1 to DEAR3 expression plasmids and the CRISPR-Cas nuclease system expression plasmids), respectively. After a certain period of cultivation, bacterial culture samples were taken and individually cultured on plates containing a ccdB inducer (10 mM arabinose; Sangon, Cat. No. A610071) and plates containing the antibiotic (ampicillin) against which the target plasmid was resistant. With reference to FIG. In group 12A, when the bacteria contained only the target plasmid, they were able to survive on ampicillin plates and form colonies, whereas they failed to grow on expression plates with ccdB induction (the CB group), which was essentially consistent with the survival / death situation of bacterial colonies where the plasmid of Petition 870250086925, dated 09 / 25 / 2025, pp. 164 / 225 65 / 85 transformed expression did not mediate cleavage of the target plasmid (the CN group, in which Cas9 was expressed and ccdB was not cleaved). When the expression plasmid mediated cleavage of the target plasmid (in the CP group, Cas9 was expressed to cleave ccdB, and in the DEAR1 to DEAR3 groups, the corresponding intronic RNA sequences were expressed respectively), the ccdB toxin gene could not be expressed normally, allowing bacteria to survive on ccdB-induced expression plaques; however, bacteria died on ampicillin plaques due to loss of ampicillin resistance caused by cleavage of the target plasmid. The results of bacterial plaque scattering and analysis of ccdB gene expression levels show that DEAR1 to DEAR3 can mediate plasmid cleavage in E. coli cells. 5. Further verification of DEAR1-mediated plasmid interference in E. coli cells.

[0178] Using primers GGATGAGTTTGCAAACAAAGTCCTTTCTGCCG (SEQ ID NO:45) and AGGACTTTGTTTGCAAACTCATCCAATGATACCTAGC (SEQ ID NO:46), the DEAR1 expression plasmid was subjected to PCR. A mutant ΔTRS expression plasmid was constructed via homologous recombination, designated as Dr1_ΔTRS (an expression plasmid with a deletion of the 6-nucleotide TRS sequence in DEAR1), having served as one of the expression plasmids.

[0179] For the plasmid used in the CN group in Step 3, the following primers were used: AGTACAGCATCGGCCTGGCCATCGGCACCAACTCTGTGG (SEQ ID NO:47); and GGCCAGGCCGATGCTGTACTTCTTGTCAGAACCGTGGTGA (SEQ ID NO:48) for PCR. The PCR product was subsequently subjected to PCR using the primers: CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID Petition 870250086925, dated 09 / 25 / 2025, pp. 165 / 225 66 / 85 NO:49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO:50). A dCas9 expression plasmid (with both mutated and inactivated Cas9 enzymatic cleavage active site) was constructed via homologous recombination, designated as dCas9, which served as one of the expression plasmids.

[0180] For the plasmid used in the CP group in Step 3, the following primers were used: CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO:49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO:50) for PCR. An nCas9 expression plasmid (with 1 active H840 Cas9 cleavage site mutated and inactivated) was constructed through homologous recombination, designated as nCas9, which served as one of the expression plasmids.

[0181] The plasmid used in the CP group in Step 3 was used without modification as the wtCas9 expression plasmid. The target plasmid constructed in Step 1 was countertransformed into the E. coli strain BW25141 (CGSC, Strain Accession No.: 7635) with the different expression plasmids above (dCas9, nCas9, wtCas9, Dr1_ΔTRS and the DEAR1 expression plasmid used in Step 2), respectively. After cultivation for a specified period, bacterial culture samples were taken and cultured on plates containing the antibiotic (ampicillin) against which the target plasmid was resistant. With reference to FIG. 13, when the bacteria contained only the target plasmid, they were able to survive on the ampicillin plates and colonies formed (blank group), which was essentially consistent with the survival / death situation of bacterial colonies in which Dr1_ΔTRS (DEAR expression plasmid lacking TRS) or the dCas9 expression plasmid were transformed.The DEAR1 expression plasmid mediated the cleavage of the target plasmid, which was essentially consistent with the results from the plasmids of... Petition 870250086925, dated 09 / 25 / 2025, pp. 166 / 225 67 / 85 expression of nCas9 and wtCas9; consequently, the bacteria died on the ampicillin plaques due to loss of ampicillin resistance caused by cleavage of the target plasmid. The results of bacterial plaque scattering and analysis of AmpR gene expression levels show that DEAR1 can mediate TRS-guided plasmid cleavage in E. coli cells. Example 5. Detection of plasmid interference by DEAR4 to DEAR9 in E. coli cells. 1. Construction of target plasmids

[0182] A ccdB toxin gene-inducible expression plasmid (Addgene, plasmid ID: 69056), containing the corresponding intronic RNA target sequences for DEAR1 and DEAR4 to DEAR9 at the plasmid's origin of replication (ori), was used as the target plasmid. 2. Construction of other DEAR expression plasmids

[0183] The method was essentially the same as in Example 4. In the DEAR expression plasmids, the J23119 promoter (with the specific sequence (SEQ ID NO: 42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) was used to drive the expression of each DEAR sequence. The construction method was as follows: The J23119 promoter was ligated to each of Dr1_ / \TRS, DEAR1, and DEAR4 to DEAR9 (where Dr1_ATRS and DEAR1 were the same as in Example 4). Then, the sequences of Dr1_ATRS, DEAR1, and DEAR4 to DEAR9, each ligated to the J23119 promoter, were individually inserted into the pCDFDuet1 plasmid vector (Novagen, Cat. No. 71340-3) via homologous recombination, thus individually replacing the complete sequence of the 410 to 3765 region of this plasmid. 3. Detection of plasmid interference in E. coli cells

[0184] The method was essentially the same as in Example 4. The target plasmid in Step 1 was countertransformed into the E. coli strain BW25141 (CGSC, Strain Accession No.: 7635) with plasmids of Petition 870250086925, dated 09 / 25 / 2025, pp. 167 / 225 68 / 85 different expression plasmids (Dr1_ATRS, DEAR1 and DEAR4 to DEAR9 expression plasmids) were constructed in Step 2, respectively. After cultivation for a certain period, bacterial culture samples were taken and cultured on plates containing the antibiotic (ampicillin) against which the target plasmid was resistant. With reference to FIG. 14, bacterial colonies survived when the transformed expression plasmid did not mediate the cleavage of the target plasmid (Dr1_ / \TRS, DEAR4, DEAR6, DEAR7, DEAR8 and DEAR9 groups expressing the corresponding intronic RNA sequences, respectively). The expression plasmid mediated the cleavage of the target plasmid (DEAR1 and DEAR5 groups expressing the corresponding intronic RNA sequences, respectively); Consequently, the bacteria died on the ampicillin plates due to loss of resistance to ampicillin caused by cleavage of the target plasmid.Results from plaque scattering and analysis of Amp gene expression levels show that DEAR1 and DEAR5 are able to mediate plasmid cleavage in E. coli cells, while DEAR4, DEAR6, DEAR7, DEAR8, and DEAR9 do not show any plasmid cleavage activity in E. coli cells. Example 6. In vitro cleavage of plasmids by a DEAR nucleic acid manipulation system.

[0185] An inducible expression plasmid for the ccdB toxin gene (Addgene, Plasmid ID: 69056) containing the corresponding salvo sequences for DEAR1 to DEAR6 and DEAR10 was used as a plasmid substrate for the in vitro cleavage experiment. DEAR1 to DEAR6 and DEAR10 (1.5 μM) were individually incubated with the plasmid substrate (0.03 μM) under conditions of 150 mM KCl, 10 mM MgCb, 40 mM MOPS, pH 7.5, and 37°C. Samples were taken at specific time points (0 h, 3 h, 8 h, and 24 h). After the reaction was complete, agarose gel electrophoresis was performed, and the gel image was... Petition 870250086925, dated 09 / 25 / 2025, pages 168 / 225 69 / 85 obtained by taking a photograph in an ultraviolet imager. The results are shown in FIG. 22, in which L represents the plasmid treated with EcoRI (NEB, Cat. No. R0101V) in a linear double-stranded state; OC represents the plasmid treated with Nt.BspQI (NEB, Cat. No. R0644S) in an open circular state; SC represents the untreated plasmid in a supercoiled state and 0, 3, 8 and 24 represent the time for the plasmid to be cleaved with DEAR (in hours). With reference to FIG. 22, the substrate plasmids exist in a supercoiled state and the products resulting from the cleavage reaction appear in an open circular state, located above the substrates. It can be observed that DEAR1 to DEAR6 and DEAR10 are able to cleave the plasmid. Example 7. Toxicity testing of the DEAR nucleic acid handling system in E. coli.

[0186] To eliminate the influence of the DEAR nucleic acid manipulation system itself on the growth rate of E. coli, turbidimetry was used to determine the growth curve of E. coli in this example. 50 ng of each blank, dCas9, Cas9, Dr1_ATRS, and DEAR1 expression plasmids (as in Example 4) were individually taken and chemically transformed into competent BW25141 E. coli cells. The plasmid was added to the suspension of competent cells, the mixture was mixed uniformly and incubated for 30 min on ice, placed in a water bath at 42°C for 60 min and in an ice bath for 2 min. 1 mL of LB liquid medium was added and the mixture was cultured for resuscitation at 37°C on a constant temperature shaker at 220 rpm for 1 h. After resuscitation, the cells were plated on LB plates containing streptomycin (50 ng / mL) and cultured inverted at 37 °C in a constant temperature incubator for 16 h.Individual colonies were removed from the plates and transferred to 1 mL of liquid LB medium, and the mixture was... Petition 870250086925, dated 09 / 25 / 2025, pp. 169 / 225 70 / 85 culture was cultivated at 37°C in a constant temperature shaker at 220 rpm for approximately 3 to 6 h. Two μL of bacterial culture were aspirated at a time, and the OD600 value was measured using a Nanodrop One microvolume spectrophotometer until it reached 0.5 to 0.6. One OD of bacterial culture (OD600 = 0.6) was aspirated and transferred to 100 mL of liquid LB medium, and the mixture was cultured at 37°C in a constant temperature shaker at 220 rpm. At 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 h of culture, 2 μL of bacterial culture were aspirated and the OD600 value was measured using a Nanodrop One microvolume spectrophotometer. Using the time points as abscissas and the OD600 values ​​as ordinates, the bacterial growth curve was plotted using GraphPad 6.0. As shown in FIG. 23, the expression of Dr1_ATRS and DEAR1 has little influence on the growth of E. coli. Example 8. Cleavage of new DNA sites by DEARs with reprogrammed TRS.

[0187] A single-stranded DNA substrate with a novel DEAR target sequence (in which the underlined and bold portion is the target sequence recognized by DEAR) was synthesized according to the sequence shown in Table 5 below, having been labeled with -Cy5 at the 3' end. DEAR1 to DEAR6 with the TRS sequence altered to CGAUAG (1.5 μM) were each incubated with this single-stranded DNA substrate (100 nM) under conditions of 50 mM MgCl2, 10 mM KCl, 40 mM MOPS pH 7.5 and 37°C for 8 h. After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned in a fluorescence imager. The results are shown in FIG. 15. As shown in FIG. In Figure 15, the products of ssDNA cleavage are located below the substrate, and it can be observed that DEAR1 to DEAR6 are able to cleave the new single-stranded DNA. In FIG. 15, I represents the ssDNA entry substrate, and Dr1* to Dr6* represent the corresponding products of Petition 870250086925, dated 09 / 25 / 2025, pp. 170 / 225 71 / 85 DNA cleavage by DEAR1 to DEAR6 with altered TRS. Table 5: ID SEQ ID NO.: Sequences (5'-3', where the underlined and bold part is the target sequence) Re-DEAR SEQ ID NO: 51 ACCAAACTATCGAGCGGATCGGAT

[0188] DEAR10 with a reprogrammed TRS (1.5 μM), with the TRS sequence altered to CGAUAG in DEAR10, was incubated with single-stranded DNA substrate with the corresponding new target sequence (100 nM, SEQ ID NO: 51) under conditions of 50 mM MgCbCl, 10 mM KCl, 40 mM MOPS, pH 7.5 and 37°C for 8 h. After the reaction was complete, urea-PAGE electrophoresis was performed and the fluorescence signals from the gel were scanned in a fluorescence imager. The results are shown in FIG. 21. As shown in FIG. 21, the cleavage product of the ssDNA is located below the substrate and it can be observed that DEAR10 with a reprogrammed TRS is able to cleave the new single-stranded DNA. In FIG. 21, I represents the entry substrate of ssDNA and Dr10* represents the cleavage product of ssDNA by DEAR10 with the altered TRS. Example 9. Cleavage of genomic DNA in mammalian cells 1 1. Construction of stable transfection plasmids

[0189] The stable transfection plasmid of the target sequence of DEAR1 and the stable DEAR transfection plasmid were constructed using the PiggyBac™ Transposon Vector System (from System Biosciences). (1) Construction of the stable transfection plasmid of the DEAR1 target sequence: the puromycin resistance gene sequence with a frameshift (PuroR), with the DEAR1 target sequence at the 5' terminus Petition 870250086925, dated 09 / 25 / 2025, pp. 171 / 225 72 / 85 (GCTAGCGCCACCATGTCCGGTAGCGGTGGCTCAAGCGGAAGCTGTCTTAAGACATTCTTGCGGAAGTGGGTCTGGCTCAGGAGGTGTCTTAAGACAGTCCGGTTCA AGTGGAAGTTCAAGTGGAAGTGTCTTAAGACATTCTTGTGGAGGTTCCTCTGGTAGTaccgagtacaagcccacggtgcgcctcgccacccgcg acgacgtccccagggccgtacgcaccc tcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggt gtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccg cgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggagtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgct ccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccg aaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgataa (SEQ ID NO: 52, em que as letras maiúsculas são a sequência-alvo de DEAR1;The bold and underlined letters are the sites that DEAR1 can specifically recognize and cleave, whose sense and antisense strands can be cleaved by DEAR1, resulting in a double-strand break; and the lowercase letters are the PuroR gene)) was inserted into the XbaI cleavage site within the multiple cloning site of the PB513B-1 plasmid of the PiggyBac dual promoter through homologous recombination, and the blasticidin resistance gene (Blasticidin S-deaminase) (atggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatct tcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggg gcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccc tctggttatgtgtgggagggctaa (SEQ ID NO: 53)) was inserted between the sites; Petition 870250086925, dated 09 / 25 / 2025, pp. 172 / 225 73 / 85 of NcoI and Sail cleavage through homologous recombination. (2) Construction of the stable transfection plasmid of DEAR: the sequence of DEAR1 oriented by the U6 promoter and terminated with the signal (AGACTAGACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTGAGGGCCTATTTCCCATGATTCCTTCATATTTCAGGGGGCCTATTGGATTCCTTCATTTTCAGTAGGGTAGTAGTAGTAGGTAGGGCTACATGGCTCACTGGGCTCTGCTGCTGCCTTTTGCTCACAT AGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTT TTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATTTATCTTGGAAGGAGGAGGACCAAGCGACCGGCCGTT AATCTCTAGGGTGAAAGTCCCGAACTGCGAAGGCAGAAGTAGCAGTTAGCTTAACGCAAGGGTGTCCGTGGTGACGCGGAATCTGAAGGAAGCGGGCGGCAAACTT CCGGTCTGAGGAACACGAACTTCATATAAGGCTAGGTATCATTGGATGAGTTTGCAAGACAAAACAAAGTCAGCTTTGGAGGAGGAGGAGGAGGAGGAATCTGAAGGAAGCGGCGGCAAACTT AGATAGATGGAAGGAAAGATTGTACTCTTACCCGAGGAGGTCTGGGATACGTGAAGTGCGCTTCATAACCTACTTAGTGATAAGTAACTGAACCATCAGAAGTCAGC AGAGGTCATAGTACGAATCGGTCTAGAACGATTCGGAAGGACTGAACAATCAAGAGAAAATAGCCTTGTACTCTCACCGATCGATCGATCGAGGAATGAATCG CTCCCAAGAGAAAGGAAACGGTGAATCCCGTGGGAATCTTTTTGGAGGGTGGAGTGACGACTGGCATAAGAAGATCAGCTATTTACGGAAGGAAGCTTGCGTCATTA Petition 870250086925, dated 09 / 25 / 2025, pp. 173 / 225 74 / 85 TCTTGATTGAACCGCCGTATACGGAACCGTACGTACGGTGGTGTGAGAGGACGGAGGTTAATCACCTCCTCCTACTCGATttttttttggtaccgacattgattattgactagtcatgtctg (SEQ ID NO: 54, where uppercase, bold, and underlined letters are the U6 promoter sequence; uppercase, non-bold, and non-underlined letters are the corresponding DNA sequence of DEAR1;and lowercase letters are the transcription termination signal and the skeleton sequence of the partial vector)), or the sequence of DEARNT driven by the U6 promoter and terminated with the signal TTTTTTTT (AGACTAGACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTGAGGGCCTATTTCCCATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAG AGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATATTTTGATTTAGTTGATTGATTGTTGTTGACTGACTGAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATATTTTGATTGATTGATTGATTGTTGATTGACTGACTGCTGTTAGAG TTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGACGGGCATGTCGTA CATCTGAGGTGCAAGTCCTCTGTGGACACCTGCTACCGGTGAACCCAATAGCGACTCCCAAGCCCTGACTGACCGGAGGAGGAGAGGAGAGGAGGAGGAGGACTCTGTGGACACCTGCTACCGGAGAGGAGAGGAGGAGGAGATCCT GTGGCTCTACGAACAGAAACGTGATATTAAGGCGTATATAGTGGATGAGGGGGCTAGGCACTCTAAAGTCCAAAAAGGTAGTCGTAATCTATGTGCGTAAATCACGA GAGTAAACGAGGAAAGATGTACGACTTACCCCGTGAGGTCATGAGCGTCAAGTAGACGTAGTAATAGAGAGGACCATCAGTCGAGTCGAGTAGTAGTAGGACTAG GAAGTTTCTGTAATGGAAACGGAGCGAAGGACCGAACGATTAAATGATACCCTATCTAACTGATTTTGTGCCCTAACACCTGGTCTGAAATGACGGTACTCGCA; Petition 870250086925, dated 09 / 25 / 2025, pp. 174 / 225 75 / 85 GAACGTATGCTGAAAGAGGCTGCTCACAAATATAGGACGGCACAAGCGGAACGAAATCATATATAGGTAGGTGTGGGAACAAAAAAAGTGTTCTCGCCAAAGTTTAG TTGAACCGCCGTGTGCCGAACGGCACGCACGGTGGTGTGAGAGGGACTATCAATTAGTCCCTACTCGATttttttttggtaccgacattgattattgactagtcatgtctg (SEQ ID NO: 55, where the uppercase, bold, underlined letters are the U6 promoter sequence; the uppercase, non-bold, non-underlined letters are the DEAR-NT sequence (the corresponding DNA sequence of DEAR2); the hygromycin resistance gene (HygBR) (atgggtaaaaagcctgaactcaccgcgacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtttccgacctgatgcagctctcggagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatcggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggaattcagcga gagcctgacctattgcatctcccgccgtgcacagggtgtcacgttgcaagacctgcctgaaaccgaactgcccgctgttctgcagccggtcgcggaggcaatggatgcgatcgctgcgg ccgatcttagccagacgagcgggttcggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgcgattgctgatccccatgtgtatcactggcaaactgtgatggacg acaccgtcagtgcgtccgtcgcgcaggctctcgatgagctgatgctttgggccgaggactgccccgaagtccggcacctcgtgcacgcggatttcggctccaacaatgtcctgacggacaatggc cgcataacagcggtcattgactggagcgaggcgatgttcggggattcccaatacgaggtcgccaacatcttcttctggaggccgtggttggcttgtatggagcagcagacgcgctacttcgagcgga ggcatccggagcttgcaggatcgccgcggctccgggcgtatatgctccgcattggtcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggcgcagggtcgatgcgac gcaatcgtccgatccggagccgggactgtcgggcgtacacaaatcgcccgcagaagcgcggccgtctggaccgatggctgtgtagaagtactcgccgatagtggaaaccgacgccccagcactcg Petição 870250086925, de 25 / 09 / 2025, pág. 175 / 225 76 / 85 tccgagggcaaaggaataa (SEQ ID NO: 26)) was individually inserted between the NcoI and SalI cleavage sites via homologous recombination to individually obtain the DEAR1 stable transfection plasmid and the DEAR-NT stable transfection plasmid. 2. Stable transfection with a plasmid of the target sequence of DEAR and DEAR plasmid, and enrichment mediated by resistance screening.

[0190] HEK-293T cells (ATCC CRL-11268) were cultured in DMEM medium with high glucose content, containing 10% fetal bovine serum at 37°C and 5% CO2, until they reached the logarithmic phase. The cells were digested with 0.25% trypsin, then washed twice with PBS (pH 7.0 to 7.2) and resuspended in Opti-MEM™ medium (Gibco, Cat. No. 31985070), with the cell density adjusted to 5 χ 104 cells^L. Two μg of Integration PB transposase plasmid (System Biosciences) and two μg of stable transfection plasmid of the DEAR1 target sequence were added to 20 μL of cell suspension, and the mixed cell suspension was subjected to electroporation at 450 V (Celetrix Biotechnologies, model: LE+). The electroporated cells were added to DMEM medium with high glucose content and containing 10% fetal bovine serum. 24 h after electroporation, the medium was replaced with a medium containing blasticidin at 10 μg / mL.Antibiotic resistance screening was performed over a one-week period, during which cells were passed based on their growth status. Once the cell state stabilized, a stable transfection cell line containing the DEAR1 target sequence was obtained. Similarly, the stable transfection cell line containing the DEAR1 target sequence was electroporated with 2 μg of Integration PB (System Biosciences) transposase plasmid and 2 μg of DEAR stable transfection plasmid (either the DEAR1 stable transfection plasmid or the DEAR-NT stable transfection plasmid). 24 h after electroporation... Petition 870250086925, dated 09 / 25 / 2025, pp. 176 / 225 77 / 85 the medium was replaced with a medium containing hygromycin B at 50 μg / mL. Antibiotic resistance screening was performed for one week, during which cells were passed based on their growth status. Once the cell status stabilized, the medium was replaced with a medium containing puromycin at 10 μg / mL. Antibiotic resistance screening was performed for one week.

[0191] For the stable transfection cell line containing the DEAR1 target sequence, there was no resistance to puromycin, since the PuroR gene integrated into the cells underwent a frameshift and failed to express the functional protein. DEAR1 (the stable transfection plasmid of DEAR1) was able to cleave the DEAR1 target sequence to induce double-strand breaks in the DNA, and the insertion or deletion mutations introduced during the repair of these breaks were able to restore the frameshifted PuroR gene to allow it to express normally, resulting in cell survival under puromycin screening. In contrast, DEARNT (the stable transfection plasmid of DEAR-NT) failed to cleave the DEAR1 target sequence, and the cells failed to express the functional PuroR gene, resulting in cell death under puromycin screening. As shown in FIG.16, cells stably transfected with DEAR1 (the stable transfection plasmid for DEAR1) survived, while cells stably transfected with DEAR-NT (the stable transfection plasmid for DEARNT) died. 3. Verification of genomic DNA cleavage in mammalian cells by DEAR1 through next-generation sequencing

[0192] For the surviving cells (stablely transfected with DEAR1, i.e., the stable DEAR1 transfection plasmid) in FIG. 16, the genome was extracted and a next-generation sequencing library was constructed for the DEAR1 target sequence. Petition 870250086925, dated 09 / 25 / 2025, pp. 177 / 225 78 / 85 using the TIANSeq Fast DNA Library Kit (Illumina). Next-generation sequencing was performed by Novogene. The next-generation sequencing data were analyzed online using the CRISPRsso2 web page. The results are shown in FIG. 17A, in which 47.14% of the reads were mutated. FIG. 17B shows a graph of the alignment of read sequences near the first and second cleavage sites in the DEAR1 target sequence, in which both insertion and deletion mutations occurred near the DEAR1 cleavage site (the position indicated by the dashed line in the figure). The sequencing data indicate that DEAR1 has the activity of specifically cleaving double-stranded genomic DNA in mammalian cells. Example 10. Cleavage of genomic DNA in mammalian cells - 2 1. Construction of stable transfection plasmids

[0193] The target sequence stable transfection plasmid of DEAR1 and the stable DEAR transfection plasmid were constructed using the PiggyBac™ Transposon Vector System (from System Biosciences). (1) Construction of the stable transfection plasmid of the DEAR1 target sequence: the puromycin resistance gene sequence with frameshift (PuroR), with the DEAR1 target sequence at the N-terminal (GCTAGCGCCACCATGTCCGGTAGCGGTGGCTCAAGCGGAAGCTGTCTTAAGACATTCTTGCGGAAGTGGGTCTGGCTCAGGAGGTGTCTTAAGACAGTCCGGTTCA AGTGGAAGTTCAAGTGGAAGTGTCTTAAGACATTCTTGTGGAGGTTCCTCTGGTAGTaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccc Petition 870250086925, dated 09 / 25 / 2025, pp. 178 / 225 79 / 85 tcgccgccgcgttcgccg actaccccg ccacg cgccacaccgtcgatccg gaccg ccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggt gtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccg cgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggagtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgct ccccggagtggaggcggccgagcgcgccggggtgccccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccg aaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgataa (SEQ ID NO: 52, where uppercase letters are the DEAR1 target sequence; bold and underlined letters are the target sites that DEAR1 can specifically recognize and cleave, from whose sense and antisense strands 3 sites (Target 1 to Target 3) can be cleaved by DEAR1, resulting in a double-strand break;and the lowercase letters are the PuroR gene, in whose sequence PuroR is 148 bp away from the ATG translation start site and is therefore in a frameshift state) was inserted at the XbaI cleavage site in the multiple cloning site of the PB513B-1 plasmid of the PiggyBac dual promoter through homologous recombination, and the blasticidin resistance gene (Blasticidin S-deaminase) (atggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatct tcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggg gcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccc tctggttatgtgtgggagggctaa (SEQ ID NO: 53)) was inserted between the NcoI and SalI cleavage sites through homologous recombination.; (2) Construction of the stable DEAR transfection plasmid: the DEAR1 sequence directed by the U6 promoter and terminated with a signal Petition 870250086925, dated 09 / 25 / 2025, pp. 179 / 225 80 / 85 (AGACTAGACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAG AGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTT TTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATTTATCTTGGAAGGAGGAGGACCAAGCGACCGGCCGTT AATCTCTAGGGTGAAAGTCCCGAACTGCGAAGGCAGAAGTAGCAGTTAGCTTAACGCAAGGGTGTCCGTGGTGACGCGGAATCTGAAGGAAGCGGGCGGCAAACTT CCGGTCTGAGGAACACGAACTTCATATAAGGCTAGGTATCATTGGATGAGTTTGCAAGACAAAACAAAGTCAGCTTTGGAGGAGGAGGAGGAGGAGGAATCTGAAGGAAGCGGCGGCAAACTT AGATAGATGGAAGGAAAGATTGTACTCTTACCCGAGGAGGTCTGGGATACGTGAAGTGCGCTTCATAACCTACTTAGTGATAAGTAACTGAACCATCAGAAGTCAGC AGAGGTCATAGTACGAATCGGTCTAGAACGATTCGGAAGGACTGAACAATCAAGAGAAAATAGCCTTGTACTCTCACCGATCGATCGATCGAGGAATGAATCG CTCCCAAGAGAAAGGAAACGGTGAATCCCGTGGGAATCTTTTTGGAGGGTGGAGTGACGACTGGCATAAGAAGATCAGCTATTTACGGAAGGAAGCTTGCGTCATTA TCTTGATTGAACCGCCGTATACGGAACCGTACGTACGGTGGTGTGAGAGGACGGAGGTTAATCACCTCCTCCTACTCGATttttttttggtaccgacattgattattgactagtcatgtctg (SEQ ID NO: 54,where capital letters, in bold and underlined, are the sequence of promoter U6; the capital letters, without being a, Petition 870250086925, dated 09 / 25 / 2025, pp. 180 / 225 81 / 85 in bold and not underlined are the corresponding DNA sequence of DEAR1; and lowercase letters are the transcription termination signal and the partial vector skeleton sequence).or the sequence of DEAR1-NT oriented by the U6 promoter and terminated as the signal (AGACTAGACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAG AGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTT TTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATTTATCTTGGAAGGAGGAGGACCAAGCGACCGGCCGTT AATCTCTAGGGTGAAAGTCCCGAACTGCGAAGGCAGAAGTAGCAGTTAGCTTAACGCAAGGGTGTCCGTGGTGACGCGGAATCTGAAGGAAGCGGGCGGCAAACTT CCGGTCTGAGGAACACGAACTTCATATAAGGCTAGGTATCATTGGATGAGTTTGC TAAGGTAAACAAAGTCCAAGCCTTGGAGGAGAGGAGAGGAGACAACTT GATAGATGGAAGGAAAGATTGTACTCTTACCCGAGGAGGTCTGATGGATACGTGAAGTGCGCTTCATAACCTACTTAGTGATAAGTAACTGAACCATCAGAAGTCAGC AGAGGTCATAGTACGAATCGGTCTAGAACGATTCGGAAGGACTGAACAATCAAGAGAAAATAGCCTTGGATCCATCCATCGATCGATCGATTGAATGAATCG CTCCCAAGAGAAAGGAAACGGTGAATCCCGTGGGAATCTTTTGGAGGGTGGAGTGACTGGCATAAGAAGATCAGCTATTTACGGAAGGAAGCTTGCGTCATTA, Petition 870250086925, of 25 / 09 / 2025, p. 181 / 225 82 / 85 TCTTGATTGAACCGCCGTATACGGAACCGTACGTACGGTGGTGTGAGAGGACGGAGGTTAATCACCTCCTCCTACTCGATttttttttggtaccgacattgattattgactagtcatgtctg (SEQ ID NO: 58, where the uppercase, bold, and underlined letters are the U6 promoter sequence; the uppercase, non-bold, and non-underlined letters are the DEAR1-NT sequence (the non-target control, i.e., the TRS sequence of DEAR1 is altered to TAAGGT in italics, thus preventing it from targeting and cleaving the original DEAR1 target sequence); and the lowercase letters are the transcription termination signal and the partial vector skeleton sequence) was individually inserted between the SfiI and MluI cleavage sites in the PB513B-1 plasmid of the PiggyBac dual promoter via homologous recombination, and the hygromycin resistance gene (HygBR) (atgggtaaaaagcctgaactcaccgcgacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtttccgacctgatgcagctctcggagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatcggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggaattcagcga gagcctgacctattgcatctcccgccgtgcacagggtgtcacgttgcaagacctgcctgaaaccgaactgcccgctgttctgcagccggtcgcggaggcaatggatgcgatcgctgcgg ccgatcttagccagacgagcgggttcggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgcgattgctgatccccatgtgtatcactggcaaactgtgatggacg acaccgtcagtgcgtccgtcgcgcaggctctcgatgagctgatgctttgggccgaggactgccccgaagtccggcacctcgtgcacgcggatttcggctccaacaatgtcctgacggacaatggc cgcataacagcggtcattgactggagcgaggcgatgttcggggattcccaatacgaggtcgccaacatcttcttctggaggccgtggttggcttgtatggagcagcagacgcgctacttcgagcgga ggcatccggagcttgcaggatcgccgcggctccgggcgtatatgctccgcattggtcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggcgcagggtcgatgcgac gcaatcgtccgatccggagccgggactgtcgggcgtacacaaatcgcccgcagaagcgcggccgtctggaccgatggctgtgtagaagtactcgccgatagtggaaaccgacgccccagcactcg tccgagggcaaaggaataa (SEQ ID NO: 26)) foi inserido individualmente Petition 870250086925, dated 09 / 25 / 2025, pp. 182 / 225 83 / 85 between the Ncol and SalI cleavage sites through homologous recombination to obtain individually the stable transfection plasmid of DEAR1 and the stable transfection plasmid of DEAR1-NT. 2. Stable transfection with a plasmid of the target sequence of DEAR and DEAR plasmid, and enrichment mediated by resistance screening.

[0194] HEK-293T cells (ATCC CRL-11268) were cultured in DMEM medium with high glucose content, containing 10% fetal bovine serum at 37°C and 5% CO2, until they reached the logarithmic phase. The cells were digested with 0.25% trypsin, then washed twice with PBS (pH 7.0 to 7.2) and resuspended in Opti-MEM™ medium (Gibco, Cat. No. 31985070), with the cell density adjusted to 5 χ 104 cells^L. Two μg of Integration PB transposase plasmid (System Biosciences) and two μg of stable transfection plasmid of the DEAR1 target sequence were added to 20 μL of cell suspension, and the mixed cell suspension was subjected to electroporation at 450 V (Celetrix Biotechnologies, model: LE+). The electroporated cells were added to DMEM medium with high glucose content and containing 10% fetal bovine serum. 24 h after electroporation, the medium was replaced with a medium containing blasticidin at 10 μg / mL.Antibiotic resistance screening was performed over one week, during which cells were passed based on their growth status. Once the cell status stabilized, a stable transfection cell line containing the DEAR1 target sequence was obtained. Similarly, the stable transfection cell line containing the DEAR1 target sequence was electroporated with 2 μg of Integration PB transposase plasmid (System Biosciences) and 2 μg of DEAR stable transfection plasmid (either the DEAR1 stable transfection plasmid or the DEAR1-NT stable transfection plasmid). 24 h after electroporation, the medium was replaced with a medium containing hygromycin B at 50 μg / mL. Petition 870250086925, dated 09 / 25 / 2025, pp. 183 / 225 84 / 85 Antibiotic resistance screening was performed for one week, during which cells were passed based on their growth status. Once the cell status stabilized, the medium was replaced with a medium containing 10 μg / mL puromycin. Antibiotic resistance screening was performed for one week.

[0195] For the stable transfection cell line containing the DEAR1 target sequence, there was no resistance to puromycin, since the PuroR gene integrated into the cells underwent a frameshift and failed to express the functional protein. DEAR1 (the stable transfection plasmid of DEAR1) was able to cleave the DEAR1 target sequence to induce double-strand breaks in the DNA, and insertion or deletion mutations (INDELs) introduced during the repair of these breaks were able to restore the frameshifted PuroR gene to allow it to express normally, resulting in cell survival under puromycin screening, as shown in FIG. 24A. In contrast, DEAR1-NT (the stable transfection plasmid of DEAR1-NT) failed to cleave the DEAR1 target sequence, and the cells failed to express the functional PuroR gene, resulting in cell death under puromycin screening. As shown in FIG.24B, cells stably transfected with DEAR1 (the stable transfection plasmid DEAR1) survived, while cells stably transfected with DEAR1-NT (the stable transfection plasmid DEAR1-NT) died (scale bar: 500 μm). 3. Verification of genomic DNA cleavage in mammalian cells by DEAR1 through next-generation sequencing. For the surviving cells (stablely transfected with DEAR1, i.e., the stable transfection plasmid of DEAR1) in FIG. 24B, the genome was extracted and a next-generation sequencing library was constructed for the target DEAR1 sequence using the TIANSeq Fast DNA Library Kit (Illumina). Sequencing of new Petition 870250086925, dated 09 / 25 / 2025, pp. 184 / 225 Next-generation sequencing (85 / 85) was performed by Novogene. The next-generation sequencing data were analyzed online using the CRISPRsso2 webpage. Mutations at the three target sites (Target 1 to Target 3) in the DEAR1 target sequence were analyzed individually. The results are shown in FIG. 25A, where the arrow indicates the cleavage site for DEAR1, the short bar indicates the deletion mutation, and the box indicates the insertion mutation. At Target 1, 9.18% of mutations were insertion or deletion mutations; at Target 2, 7.35% of mutations were insertion or deletion mutations; and at Target 3, 0.01% of mutations were insertion or deletion mutations. Specifically, in this example, insertion mutations of 1 to 2 nt in length and deletion mutations of 1 to 25 nt in length were detected near the three target sites. Furthermore, analyzing the full-length DEAR1 target sequence as a whole, as shown in FIG.In Figure 25B, deletion mutations spanning Target 1 and Target 2 with a maximum length of 85 nt were also observed in this example. Analysis of the upstream and downstream sequences of the DEAR1 target sequence showed that, as shown in FIG. 25C, no insertion or deletion mutations were detected upstream and downstream of the DEAR1 target sequence, indicating that the cleavage of genomic DNA in mammalian cells by DEAR1 is specifically guided by TRS.< / biomateriais>

Claims

1. DEAR nucleic acid manipulation system, characterized in that it comprises an RNA molecule derived from a bacterial intron of group IIC, and the RNA molecule comprises a target recognition site that hybridizes with a target sequence in a target nucleic acid.

2. DEAR nucleic acid manipulation system, according to claim 1, characterized in that it comprises at least one of Domain I, Domain II, Domain III, Domain IV, Domain V and Domain VI; and preferably, that the DEAR nucleic acid manipulation system comprises at least Domain I, Domain II, Domain III and Domain V.

3. DEAR nucleic acid manipulation system, according to any one of claims 1 and 2, characterized in that it is in the range of 100 to 5660 nt, preferably 124 to 3897 nt, in length.

4. DEAR nucleic acid manipulation system, according to any one of claims 1 to 3, characterized in that Domain I comprises 2 to 6 stem-loop / hairpin structures in the range of 50 to 400 nt in length, and preferably Domain I comprises 3 to 5 stem-loop / hairpin structures in the range of 65 to 384 nt in length, and / or Domain II comprises 1 to 4 stem-loop / hairpin structures in the range of 10 to 300 nt in length, and preferably Domain II comprises 1 to 3 stem-loop / hairpin structures in the range of 10 to 218 nt in length, and / or Domain III comprises 1 to 3 stem-loop / hairpin structures in the range of 10 to 200 nt in length, and preferably Domain III comprises 1 to 2 structures of Petition handle / clamp 870250086925, dated 09 / 25 / 2025, page.186 / 225 2 / 5 hair in the range of 10 to 140 nt in length, and / or Domain IV comprises 0 to 4 hair shaft / clip structures in the range of 0 to 4500 nt in length, and preferably Domain IV comprises 0 to 4 hair shaft / clip structures in the range of 0 to 3000 nt in length, and / or Domain V comprises 1 hair shaft / clip structure in the range of 20 to 60 nt in length, and preferably Domain V comprises 1 hair shaft / clip structure in the range of 29 to 43 nt in length, and / or Domain VI comprises 1 hair shaft / clip structure in the range of 10 to 200 nt in length, and preferably Domain VI comprises 1 hair shaft / clip structure in the range of 10 to 112 nt in length.

5. DEAR nucleic acid manipulation system, according to any one of claims 1 to 4, characterized in that the group IIC intron is a group IIC intron in which an open reading frame encoding an intron-encoded protein is present or absent in Domain IV, optionally having the open reading frame encoding an intron-encoded protein a length of 0 to 4000 nt, and / or the target recognition site located in Domain I.

6. DEAR nucleic acid manipulation system, according to any one of claims 1 to 5, characterized in that the nucleotide sequence of the RNA molecule is selected from any one of the following: (i) the nucleotide sequence comprises a nucleotide sequence as set forth in any one of the sequences SEQ ID NOs: 1 to 9 and 56; (ii) the nucleotide sequence comprises a nucleotide sequence that is the reverse complement of a sequence as set forth in Petition 870250086925, dated 09 / 25 / 2025, p.187 / 225 3 / 5 established in any of the sequences SEQ ID NOs: 1 to 9 and 56; (iii) the nucleotide sequence comprises the reverse complement of a sequence that is capable of hybridizing with the nucleotide sequence as set out in (i) or (ii) under high rigor hybridization conditions or very high rigor hybridization conditions; and (iv) the nucleotide sequence comprises a sequence with at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98% and even more preferably at least 99%, sequence identity with the nucleotide sequence as set out in (i) or (ii).

7. DEAR nucleic acid manipulation system, according to any one of claims 1 to 6, characterized in that the target recognition site has a length of 6 nucleotides and, preferably, the target recognition site is programmable to hybridize with a different target sequence.

8. DEAR nucleic acid manipulation system, according to any one of claims 1 to 7, characterized in that the target nucleic acid is either DNA or RNA.

9. DEAR nucleic acid manipulation system, according to any one of claims 1 to 8, characterized in that the main cleavage site of the DEAR nucleic acid manipulation system is 0 to 1 nt downstream of the 3' end of the target sequence in the target nucleic acid.

10. Isolated polynucleotide, characterized in that it comprises a nucleotide sequence encoding the DEAR nucleic acid manipulation system, as defined in any one of claims 1 to 9.

11. Nucleic acid construct, characterized in that it comprises the isolated polynucleotide, as defined in Petition 870250086925, dated 09 / 25 / 2025, page 188 / 225 4 / 5 claim 10.

12. Vector, characterized in that it comprises the isolated polynucleotide, as defined in claim 10, or the nucleic acid construct, as defined in claim 11.

13. Reagent or kit, characterized in that it comprises the DEAR nucleic acid manipulation system, as defined in any one of claims 1 to 9, the isolated polynucleotide, as defined in claim 10, the nucleic acid construct, as defined in claim 11, or the vector, as defined in claim 12.

14. Pharmaceutical composition, characterized in that it comprises the DEAR nucleic acid handling system, as defined in any one of claims 1 to 9, the isolated polynucleotide, as defined in claim 10, the nucleic acid construct, as defined in claim 11, or the vector, as defined in claim 12; and optionally a pharmaceutically acceptable carrier.

15. Method for modifying a target nucleic acid, characterized in that it comprises the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system, as defined in any one of claims 1 to 9, the isolated polynucleotide, as defined in claim 10, the nucleic acid construct, as defined in claim 11, the vector, as defined in claim 12, or the reagent or kit, as defined in claim 13.

16. Use of the DEAR nucleic acid manipulation system, as defined in any one of claims 1 to 9, of the isolated polynucleotide, as defined in claim 10, of the nucleic acid construct, as defined in claim 11, or of the vector, as defined in claim 12, characterized in that it is intended for the modification of a target nucleic acid or for the preparation of a reagent or kit to modify a target nucleic acid.

Images