Method for transforming bacteria belonging to the genus bifidobacterium

Description

1 / 76 “METHOD FOR TRANSFORMING BACTERIA BELONGING TO THE GENUS BIFIDOBACTERIUM” Technical Field

[001] The present invention relates to a method for transforming a bacterium belonging to the genus Bifidobacterium. Background of the Technique

[002] Bacteria belonging to the genus Bifidobacterium are obligate anaerobes, gram-positive bacteria, and the main bacteria of the human intestinal flora. They are known to have beneficial effects on human health, such as a regulatory effect on intestinal functions (e.g., improvement in constipation or diarrhea), a suppressive effect on increasing serum cholesterol, and an immunostimulatory effect. Therefore, many commercially available products are sold in forms such as various fermented foods or beverages and viable bacterial preparations.

[003] It has become increasingly evident that bacteria belonging to the genus Bifidobacterium differ in phenotype and genetic composition among bacterial strains, although they are conspecific. This genetic diversity at the strain level is universally observed in major normal human inhabitants, such as Bifidobacterium breve, Bifidobacterium longum, and Bifidobacterium bifidum. When attention is given to a specific gene, inconsistency between the phylogenetic relationship between bacterial strains and the presence or absence of the gene is also frequently observed. A typical example is the xylanase gene (BpXyn10A), which defines the ability to utilize long-chain xylans. Strains possessing the xylanase gene, when plotted on an accurate phylogenetic tree based on genomic information from Bifidobacterium pseudocatenulatum, are dispersed throughout the phylogenetic tree, rather than being concentrated in a specific cluster (Unpatented Literature 1).

[004] In bacteria that reproduce by binary fission, it is considered that the Petition 870250112695, dated 08 / 12 / 2025, page 83 / 158 2 / 76 Horizontal gene transfer (HGT) widely influences genetic diversity at the strain level and gene distribution inconsistent with phyletic relationships. The mechanism of HGT generally involves natural transformation, phage infection, and conjugal plasmid transmission. HGT is capable of extensively altering genetic and phenotypic diversity in the short term. However, the actual status of HGT is unknown regarding bacteria belonging to the genus Bifidobacterium, and there are no previous reports stating that natural transformation occurs in bacteria belonging to the genus Bifidobacterium.

[005] It is also known that bacteria belonging to the genus Bifidobacterium are bacterial species for which artificial gene manipulation is difficult compared to model organisms (Non-Patent Literature 2 to 4). One of the main causes of the difficult gene manipulation is presumably the low transformation efficiency. Therefore, there is a demand for an efficient method to transform a bacterium belonging to the genus Bifidobacterium. List of Citations Non-Patented Literature

[006] Non-Patented Literature 1: Watanabe, Y., Saito, Y., Hara, T. et al. ISME COMMUN. 1, 62, 2021

[007] Non-Patented Literature 2: Vincenzo F. Brancaccio et al. Bioengineered 4: 4, 197-202, 2013

[008] Non-Patented Literature 3: Satoru Fukiya, Atsushi Yokota, KAGAKU TO SEIBUTSU (Chemistry and Organism - Journal of the Japan Society for Bioscience, Biotechnology, and Agrochemistry), Vol. 55, No. 9, 2017.

[009] Non-Patented Literature 4: S. Fukiya, T. Suzuki. et al. “Lactic Acid Bacteria and Bifidobacteria: Current Progress in Advanced Research”, Caister Academic Press, 33-51, 2011 Petition 870250112695, dated 08 / 12 / 2025, p. 84 / 158 3 / 76 Summary of the Invention Technical Problem

[010] The present invention relates to providing a method for transforming a bacterium belonging to the genus Bifidobacterium in an efficient manner. Solution to the Problem

[011] The present inventors have carried out diligent studies on a method for transforming a bacterium belonging to the genus Bifidobacterium and, consequently, have discovered that a bacterium belonging to the genus Bifidobacterium can be efficiently transformed by absorbing donor-derived DNA by statically culturing a recipient bacterium belonging to the genus Bifidobacterium in contact with a donor bacterium or linear DNA in a specific medium.

[012] Specifically, the present invention provides the following items [1] to [7].

[013] [1] A method for transforming a bacterium belonging to the genus Bifidobacterium, the method comprising static culture of a recipient bacterium belonging to the genus Bifidobacterium in contact with a donor bacterium or linear DNA comprising DNA to be introduced into the recipient, wherein a medium for use in static culture is a medium having a pH of 6.0 or higher and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or higher and less than 8.5 and 0.2 x (pH) - 1.7 < x < 0.2 x (pH) - 1.2 when the pH is 8.5 or higher and less than 10.0.

[014] [2] A method for manipulating a genome of a bacterium belonging to the genus Bifidobacterium, the method comprising the static culture of a recipient bacterium belonging to the genus Bifidobacterium in contact with donor linear DNA, wherein a medium for use in static culture is a medium having the pH Petition 870250112695, dated 08 / 12 / 2025, page 85 / 158 4 / 76 of 6.0 or higher and lower than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or higher and lower than 8.5 and 0.2 x (pH) - 1.7 < x < 0.2 x (pH) - 1.2 when the pH is equal to or greater than 8.5 and lower than 10.0; the recipient bacterium belonging to the genus Bifidobacterium is a bacterium belonging to the genus Bifidobacterium without the upp gene; and the linear donor DNA comprises an upstream homology arm, two genes;a selection marker gene and an upp gene, and a downstream homology arm, wherein the two genes are located between the upstream homology arm and the downstream homology arm, and the linear donor DNA further comprises a 3'-terminal region of the upstream homology arm between the two genes and the downstream homology arm, or a 5'-terminal region of the downstream homology arm between the upstream homology arm and the two genes.

[015] [3] The method according to [1] or [2], wherein the recipient bacterium belonging to the genus Bifidobacterium is a bacterium belonging to the genus Bifidobacterium that has, in one genome, at least one selected member of the group consisting of the Tad pilus gene operon, the DNA binding enzyme gene operon (ComEA) / DNA uptake enzyme gene (ComEC), the DNA processing enzyme gene (DprA), the nuclease gene (YraN) and the helicase gene (ComM).

[016] [4] The method according to [1] or [2], wherein the osmotic pressure of the medium is from 110 to 750 mOsm.

[017] [5] The method according to [1] or [2], wherein the medium comprises from 3 to 180 mM of MgCl2.

[018] [6] A means for use in the method for transforming a bacterium belonging to the genus Bifidobacterium according to [1] or in the method for manipulating a genome of a bacterium belonging to the genus Bifidobacterium of Petition 870250112695, dated 08 / 12 / 2025, page 86 / 158 5 / 76 according to [2], the medium with pH equal to or greater than 6.0 and less than 10.0, in which a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 χ (pH) - 1.2 when the pH is 6.0 or greater and less than 8.5 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is 8.5 or greater and less than 10.0.

[019] [7] A kit for use in the method of manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to [2], the kit comprises a medium and linear DNA comprising the selection marker gene and the upp gene, wherein the medium has a pH equal to or greater than 6.0 and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 χ (pH) - 1.2 when the pH is 6.0 or greater and less than 8.5 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is 8.5 or greater and less than 10.0. Advantageous Effects of the Invention

[020] According to the present invention, it is possible to efficiently transform a bacterium belonging to the genus Bifidobacterium that was previously considered difficult to transform, allowing the reproduction of an existing probiotic strain while, for example, editing an arbitrary genomic region in the bacterium belonging to the genus Bifidobacterium or transmitting a new phenotype to a bacterium belonging to the genus Bifidobacterium. Brief Description of the Drawings

[021] Figure 1 illustrates an example of the genomic structure of a strain that has acquired the xylanase (transforming) gene from Bifidobacterium pseudocatenulatum. The corresponding single nucleotide polymorphisms (SNPs) of each strain are indicated by the gray line.

[022] Figure 2 illustrates the proliferation curves of a donor (Bifidobacterium pseudocatenulatum YIT 11027), a recipient (Bifidobacterium Petition 870250112695, dated 08 / 12 / 2025, page 87 / 158 6 / 76 pseudocatenulatum YIT 11956) and a strain that acquired the gene (transformant) in mPY-AX medium.

[023] Figure 3 illustrates the proliferation curves of a donor (Bifidobacterium pseudocatenulatum YIT 11027), a recipient (Bifidobacterium pseudocatenulatum YIT 11956) and a strain that acquired the gene (transformant) in mPY-Starch medium.

[024] Figure 4 illustrates the colony formation of a donor (Bifidobacterium pseudocatenulatum YIT 4072T), a recipient (Bifidobacterium pseudocatenulatum YIT 12824) and a strain that acquired the gene (transforming) in Tc-mGAML medium.

[025] Figure 5 illustrates the transformation frequencies when (A) viable bacterial cells or dead bacterial cells, (B) viable bacterial cells, genomic DNA or PCR products and (C) viable bacterial cells treated with DNase were used as donors.

[026] Figure 6 illustrates the influence of (A) pH, (B) lactose, (D) various salts, (E) magnesium chloride, (F) osmotic pressure, and (G) culture conditions on transformation. nd indicates “not detected”. Figure 6 also illustrates (C) a carbohydrate and a pH range that cause transformation and (H) transformation in commercially available media.

[027] Figure 7 is a schematic view of a markerless genome manipulation system.

[028] Figure 8 illustrates (A) an example of the genomic structure of a Bifidobacterium breve strain that has acquired the gene (transforming), (B) an example of the genomic structure of a Bifidobacterium longum strain that has acquired the gene (transforming), and (C) an example of the genomic structure of a strain derived from a different bacterial species that has acquired the gene (transforming). Single nucleotide polymorphisms are indicated by the gray line.

[029] Figure 9 illustrates (A) the formation of colonies from a donor (strain) Petition 870250112695, dated 08 / 12 / 2025, page 88 / 158 7 / 76 (A) Colony formation of a donor (Bifidobacterium breve BR-Cw104-C2), a recipient (Bifidobacterium breve BRCw104-A1 strain), and a gene-acquired (transforming) strain in Em-mGAML, (B) Colony formation of a donor (Bifidobacterium longum YIT 12812), a recipient (Bifidobacterium longum YIT 12762), and a gene-acquired (transforming) strain in Em-mGAML, and (C) Colony formation of a donor (Bifidobacterium longum LO-Cw098-B4 strain), a recipient (Bifidobacterium breve BR-Cw104-A1 strain), and a gene-acquired (transforming) strain in Em-mGAML.

[030] Figure 10 illustrates the proliferative activity of a Bifidobacterium pseudocatenulatum strain in a medium containing glucose as the only carbohydrate source. Description of the Modalities

[031] In this descriptive report, the notation of a nucleotide sequence, nucleic acid, or similar substance by means of an abbreviation is described by a symbol commonly used in the art, such as the IUPAC-IUB Communication on Biological Nomenclature (Eur. J. Biochem., 138: 9-37, 1984) and “Guidelines for the Description of the Specification etc., including base sequences or amino acid sequences” (edited by the Japan Patent Office). As used in this document, “deoxyribonucleic acid (DNA)” encompasses not only double-stranded DNA, but every single-stranded DNA that constitutes the two strands, i.e., a sense strand and an antisense strand.

[032] In this descriptive report, the identity of nucleotide sequences is a value obtained by aligning both nucleotide sequences so that the bases of the two nucleic acid sequences to be compared coincide as much as possible, and dividing the number of coincident bases by the total number of bases, and expressed as a percentage. Skilled individuals can appropriately set the parameters of software such as BLAST, ClustalX, or Genetyx to determine the identity of nucleotide sequences. Petition 870250112695, dated 08 / 12 / 2025, page 89 / 158 8 / 76

[033] As used in this document, “nucleotide,” “oligonucleotide,” and “polynucleotide” have the same meaning as a nucleic acid and include DNA and RNA. DNA includes all cDNA, genomic DNA, and synthetic DNA. RNA includes all types of total RNA, mRNA, rRNA, and synthetic RNA. “Nucleotide,” “oligonucleotide,” and “polynucleotide” can be double-stranded or single-stranded. “Nucleotide” (or “oligonucleotide” or “polynucleotide”) with a sequence also means, in a comprehensive sense, a “nucleotide” (or “oligonucleotide” or “polynucleotide”) with a sequence complementary to it, unless otherwise specified.

[034] As used in this document, “gene” encompasses double-stranded DNA, including genomic DNA, as well as single-stranded (positive-strand) DNA, including cDNA, single-stranded DNA with a sequence complementary to the positive-strand (complementary strand), and its fragments, and means material that contains some biological information in the sequence of information about the bases that constitute the DNA. “Gene” refers to a control region, a coding region, an exon, and an intron without distinction, unless otherwise specified.

[035] As used in this document, “expressible linkage” between a first gene and a second gene means that the first gene and the second gene are linked in such a way that a protein encoded by the first gene and a protein encoded by the second gene are produced individually when the genes are introduced into the genome of a suitable bacterium. In this context, “linkage” conceptually includes the case where the first gene and the second gene are directly connected to each other and the case where the first gene and the second gene are connected through another nucleotide sequence. The procedures for “expressible linkage” between the first gene and the second gene are well known to those skilled in the art.

[036] As used in this document, “upstream” and “downstream” in relation to Petition 870250112695, dated 08 / 12 / 2025, page 90 / 158 9 / 76 A gene or its nucleotide sequence refers to upstream and downstream in the direction of gene transcription. For example, the "upstream sequence" and "downstream sequence" of a gene refer to sequences located on the 5' side and the 3' side, respectively, of the gene on a sense DNA strand.

[037] As used in this document, “transformation” refers to the natural transformation in which a bacterium absorbs foreign DNA into cells and retains the DNA in its own genomic DNA, without relying on physicochemical treatment typified by electroporation and the like. As used in this document, “donor” refers to an individual who donates DNA, and “recipient” refers to an individual who receives DNA.

[038] The method for transforming bacteria belonging to the genus Bifidobacterium according to the present invention (hereinafter also referred to as the method of the present invention) is a method comprising the static culture of a recipient bacterium belonging to the genus Bifidobacterium in contact with a donor bacterium or linear DNA comprising the DNA to be introduced into the recipient, wherein a medium for use in the static culture is a medium having a pH of 6.0 or higher and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is equal to or greater than 6.0 and less than 8.5 and 0.2 x (pH) 1.7 < x < 0.2 x (pH) - 1.2 when the pH is equal to or greater than 8.5 and less than 10.0.

[039] In the method of the present invention, examples of bacterial species belonging to the genus Bifidobacterium to be transformed, in other words, the recipient bacteria belonging to the genus Bifidobacterium, include, but are not particularly limited to, Bifidobacterium pseudocatenulatum, B. breve, B. longum, B. adolescentis, B. bifidum, B. animalis, B. suis, B. infantis, B. catenulatum, B. lactis, B. globosum, B. angulatum and B. dentium. Among them, Bifidobacterium pseudocatenulatum, B. breve, B. longum, B. adolescentis or B. bifidum are the Petition 870250112695, dated 08 / 12 / 2025, page 91 / 158 10 / 76 preferred, and Bifidobacterium pseudocatenulatum, B. breve or B. longum are the most preferred.

[040] The recipient bacterium belonging to the genus Bifidobacterium is a bacterium belonging to the genus Bifidobacterium that has, in its genome, preferably at least one member, more preferably at least three members, and even more preferably all five selected members of the group consisting of the Tad pilus gene operon, the DNA-binding enzyme gene (ComEA) / DNA uptake enzyme gene (ComEC), the DNA processing enzyme gene (DprA), the nuclease gene (YraN), and the helicase gene (ComM).As shown in the examples described later, all operons of the Tad pilus gene, DNA-binding enzyme gene (ComEA) / DNA uptake enzyme gene (ComEC), DNA processing enzyme gene (DprA), nuclease gene (YraN), and helicase gene (ComM) were found to have expression levels corresponding to the transformation frequencies by the method of the present invention in Bifidobacterium pseudocatenulatum, and these genes were confirmed to contribute to natural transformation by means of tests using a disruptive strain of each gene. Table 1 shows a putative gene product and the SEQ ID NO of each gene and a putative function of each operon or each gene.Each operon, or gene possessed in the genome of the recipient bacterium belonging to the genus Bifidobacterium, encompasses not only the operons or genes consisting of the nucleotide sequences represented by the SEQ ID NOs shown in Table 1, but also the operons or genes corresponding to them. In this context, "corresponding operon" refers to, based on an operon encoding a group of proteins with a predetermined function in one bacterium, an operon encoding a group of proteins with the same or a similar function to that group of proteins in another bacterium. "Corresponding gene" refers to, based on a gene encoding a... Petition 870250112695, dated 08 / 12 / 2025, p. 92 / 158 11 / 76 protein with a predetermined function in one bacterium, a gene that codes for a protein with the same or similar function as the protein in another bacterium. An operon and its corresponding operon, or a gene and its corresponding gene, may have the same nucleotide sequence or may have different nucleotide sequences. The identity of the nucleotide sequences of an operon and its corresponding operon, or of a gene and its corresponding gene, is preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 99% or more. [Table 1] Gene ID Putative gene product (KEGG orthology (or eggNOG description)) Putative function SEQ ID NO YIT12819_00143 flhG, fleN; flagellar biosynthesis protein Tad pilus formation (Extracellular DNA binding) 1 YIT12819_00144 cpaF, tadA; pilus assembly protein 2 YIT12819_00145 tadB; strong adhesion protein B 3 YIT12819_00146 tadC; strong adhesion protein C 4 YIT12819_00147 (Protein of unknown function (DUF4244)) 5 YIT12819_00148 tadE; Strong adhesion protein E 6 YIT12819_00149 (TigRFAM helicase secretion neighborhood similar protein) 7 YIT12819_00675 dprA; DNA processing protein Promotion of homologous recombination 8 YIT12819_00676 comM; magnesium chelatase family protein Nucleic acid dissociation 9 Petition 870250112695, dated 08 / 12 / 2025, page 93 / 158 12 / 76 (helicase ComM) YIT12819_00677 yraN; putative endonuclease Single-stranded DNA nuclease 10 YIT12819_00905 comEA; competence protein DNA binding / uptake 11 YIT12819_00906 comEC; competence protein 12

[041] A viable bacterium in the logarithmic growth phase or in the stationary phase is preferably used as the recipient bacterium belonging to the genus Bifidobacterium. The viable bacterium can be prepared by means of an inoculation approach of an inoculum of the bacterium in a medium that allows the proliferation and culture of the bacterium for a predetermined period. After cultivation, the bacterial cells can be suitably isolated or purified by means of an approach such as centrifugation or filtration.

[042] In the method of the present invention, the donor bacterium is not particularly limited, provided that the donor bacterium comprises the DNA to be introduced into the recipient. The donor bacterium may be a bacterium belonging to any genus and species and, preferably, a bacterium belonging to the phylum Actinomycetota, more preferably a bacterium belonging to the order Bifidobacteriales, more preferably a bacterium belonging to the genus Bifidobacterium, more preferably a bacterium of the same species as the recipient bacterium belonging to the genus Bifidobacterium. Examples of donor bacterium species belonging to the genus Bifidobacterium include the same species illustrated as the recipient bacterium belonging to the genus Bifidobacterium described above.

[043] The donor bacterium can be a viable bacterium or a dead bacterium, and is preferably a dead bacterium from the point of view of handling capacity. A viable bacterium in the logarithmic growth phase or in the stationary phase is preferably used as viable bacteria. Viable bacteria can be prepared by using an inoculation approach with an inoculum of the bacteria. Petition 870250112695, dated 08 / 12 / 2025, page 94 / 158 13 / 76 in a medium that allows proliferation, cultivating the bacteria for a predetermined period and then isolating or purifying the bacterial cells by centrifugation, filtration or similar methods. Dead bacteria can be prepared by subjecting viable bacteria to heat treatment, alcohol treatment or similar methods.

[044] The DNA to be introduced into the recipient, contained in the donor bacterium, may be DNA from an arbitrary region in the bacterium's genome. Preferably, the DNA to be introduced into the recipient comprises a gene. The length of the DNA to be introduced into the recipient is not particularly limited and is preferably 3 to 100 kb, more preferably 5 to 30 kb, and even more preferably 10 to 20 kb.

[045] In the method of the present invention, linear DNA comprising the DNA to be introduced into the recipient can be used as a donor. The donor linear DNA can be isolated from nature or synthesized or can be produced by using a genetic engineering approach. Examples of linear DNA include PCR products, cDNA, genomic DNA and its fragments. A PCR product is preferably used from the point of view of handling capability.

[046] The DNA to be introduced into the recipient, contained in the donor's linear DNA, can be arbitrary DNA. In a preferred embodiment, the DNA to be introduced into the recipient comprises a gene. For example, the DNA to be introduced into the recipient is an expression cassette composed of a promoter, the nucleotide sequence of a gene, and a terminator. The expression cassette may comprise a control region, such as an operator, an enhancer, or a ribosomal binding site. In another preferred embodiment, the DNA to be introduced into the recipient comprises DNA for introducing a mutation (e.g., deletion, substitution, insertion, or addition) into a target region of DNA in the genome of the recipient bacterium belonging to the genus Bifidobacterium by replacing the region Petition 870250112695, dated 08 / 12 / 2025, page 95 / 158 14 / 76 target DNA. This DNA consists of a nucleotide sequence obtained by partially altering the nucleotide sequence of the target region of the DNA, depending on the desired mutation. The linear donor DNA may optionally comprise several sequences known to those skilled in the art (e.g., a restriction enzyme cleavage site and a signal sequence), a selection marker gene, and the like. Preferably, the linear DNA comprises the selection marker gene from the point of view of facilitating the selection of a transformant. Examples of selection marker genes include drug resistance genes, such as the tetracycline resistance gene, the erythromycin resistance gene, the chloramphenicol resistance gene, the ampicillin resistance gene, the kanamycin resistance gene, the spectinomycin resistance gene, and the streptomycin resistance gene.Alternatively, in the case of using a selective medium that requires a specific metabolism for growth, a gene related to that metabolism can be used as a selection marker. Examples of this type of metabolism-related gene include the xylanase gene, which defines the ability to utilize long-chain xylans, and the amylase gene, which defines the ability to utilize starch. Skilled individuals can select and appropriately use these various sequences or factors depending on the recipient bacterium belonging to the genus Bifidobacterium and the conditions, such as a culture medium after transformation. The length of DNA to be introduced into the recipient is not particularly limited and is preferably 3 to 100 kb, more preferably 5 to 30 kb, and even more preferably 10 to 20 kb.

[047] Preferably, the linear donor DNA further comprises an upstream homology arm and a downstream homology arm for homologous recombination upstream and downstream of the DNA to be introduced into the recipient from the point of view of controlling the position or region of introduction of the DNA to be introduced into the recipient. The upstream homology arm consists of a sequence of Petition 870250112695, dated 08 / 12 / 2025, p. 96 / 158 15 / 76 nucleotides homologous to the nucleotide sequence of a region upstream (preferably an adjacent upstream region) of the position or region of introduction of the target DNA into the genome of the recipient bacterium belonging to the genus Bifidobacterium. The downstream homology arm consists of a nucleotide sequence homologous to the nucleotide sequence of a region downstream (preferably an adjacent downstream region) of the position or region of introduction of the target DNA into the genome of the recipient bacterium belonging to the genus Bifidobacterium. The identity of the nucleotide sequence of each homology arm and the corresponding nucleotide sequence of the region in the genome of the recipient bacterium belonging to the genus Bifidobacterium is, independently, 80% or more, preferably 90% or more, preferably 95% or more, preferably 96% or more, preferably 97% or more, preferably 98% or more, preferably 99% or more, preferably 100%.The length of each homology arm is not particularly limited, and each arm independently is preferably 0.5 to 5 kb, more preferably 0.8 to 4 kb, and even more preferably 1 to 3 kb, from the point of view of homologous recombination efficiency and handling capability. This linear donor DNA generally comprises the upstream homology arm, the DNA to be introduced into the recipient, and the downstream homology arm, in order from the 5' side, and comprises the nucleotide sequence of the upstream homology arm, the nucleotide sequence of the DNA to be introduced into the recipient, and the nucleotide sequence of the downstream homology arm, in order from the 5' side.An arbitrary nucleotide sequence may be added to at least one selected position of the group consisting of a position upstream of the nucleotide sequence of the upstream homology arm, a position between the nucleotide sequence of the upstream homology arm and the nucleotide sequence of the DNA to be introduced into the recipient, and a position between the nucleotide sequence of the... Petition 870250112695, dated 08 / 12 / 2025, page 97 / 158 16 / 76 The DNA to be introduced into the recipient and the nucleotide sequence of the downstream homology arm, and a downstream position of the nucleotide sequence of the downstream homology arm, without impairing the efficiency of the transformation.

[048] The medium for use in the method of the present invention is a medium having a pH equal to or greater than 6.0 and less than 10.0, and a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or greater and less than 8.5 and 0.2 x (pH) - 1.7 < x < 0.2 x (pH) - 1.2 when the pH is 8.5 or greater and less than 10.0. The medium may not be limited, provided that the recipient bacterium belonging to the genus Bifidobacterium, preferably the recipient bacterium belonging to the genus Bifidobacterium and the donor bacterium, are able to survive favorably in the medium. Other composition profiles are not particularly limited, provided that the pH and carbohydrate content are within the above ranges. The medium can be solid or liquid, and preferably, from the point of view of transformation efficiency, it is a solid medium.

[049] The pH of the medium is equal to or greater than 6.0 and less than 10.0. The pH refers to the pH at 25 °C before heat sterilization using an autoclave or similar. The pH of the medium is preferably 9.5 or less, more preferably 9.2 or less, from the point of view of transformation efficiency. The pH range of the medium is preferably from 6.0 to 9.5, more preferably from 6.0 to 9.2.

[050] The medium may contain a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium, preferably the recipient bacterium belonging to the genus Bifidobacterium and the donor bacterium. Its content x (% by mass) is an amount that satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or higher and lower than 8.5 and 0.2 x (pH) - 1.7 < x < 0.2 x (pH) - 1.2 when the pH is 8.5 or higher and lower than 10.0. If the content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium is outside the above range, it is not Petition 870250112695, dated 08 / 12 / 2025, page 98 / 158 17 / 76 a favorable transformation will occur. Typical examples of carbohydrates include lactose, glucose, and various oligosaccharides.

[051] Normally, a medium for use in culturing a bacterium belonging to the genus Bifidobacterium (for example, TOS medium, MRS medium, or BL medium) generally contains approximately 1 to 2% by mass of a carbohydrate usable by the bacterium belonging to the genus Bifidobacterium, and this content exceeds the upper limit of the carbohydrate content usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium of the present invention. In the present invention, surprisingly, efficient transformation is obtained using a medium with a low carbohydrate content that can negatively affect the proliferation of the bacterium belonging to the genus Bifidobacterium.

[052] The osmotic pressure of the medium is not particularly limited and is preferably from 110 to 750 mOsm, more preferably from 120 to 720 mOsm, and even more preferably from 130 to 700 mOsm, from the point of view of transformation efficiency. In this context, osmotic pressure refers to the osmotic pressure of the medium in a state in which the constituents are dissolved by heating without being supplemented with a gelling agent, such as agar. Osmotic pressure can be measured by an approach known in the art and can be measured according to, for example, a method for measuring osmotic pressure (Determination of Osmolarity) described in the 18th edition of the Japanese Pharmacopoeia.

[053] Preferably, the medium contains a moderate level of MgCl2 from the point of view of transformation efficiency. The MgCl2 content in the medium is preferably from 3 to 180 mM, more preferably from 5 to 100 mM.

[054] A commercially available medium can be used as a medium for use in the method of the present invention. Some examples include modified GAM medium (Nissui Pharmaceutical Co., Ltd.) (glucose: 0.05% by mass, pH 7.3, osmotic pressure: 289 mOsm (value actually measured)) and cooked meat medium (OXOID Petition 870250112695, dated 08 / 12 / 2025, page 99 / 158 18 / 76 Ltd.) (glucose: 0.2% by mass, pH 7.2 ± 0.2, osmotic pressure: 250 mOsm (value actually measured)).

[055] An approach to contacting the recipient bacterium belonging to the genus Bifidobacterium with the donor bacterium or linear DNA can be appropriately selected depending on the type of medium, the type of donor, and the like, and is not particularly limited. Examples include a method of adding a pre-culture solution of the donor bacterium or linear DNA to a pre-culture solution of the recipient bacterium belonging to the genus Bifidobacterium and a method of directly adding, applying, spreading, or spraying the donor bacterium or linear DNA onto the recipient bacterium belonging to the genus Bifidobacterium. In this case, the recipient bacterium belonging to the genus Bifidobacterium in contact with the donor bacterium or linear DNA can be added to the transformation medium described above and subjected to static culture.Alternative examples include a method of jointly adding a preculture solution of the recipient bacterium belonging to the genus Bifidobacterium and a preculture solution of the donor bacterium or linear DNA to the transformation medium described above, and a method of jointly adding the recipient bacterium belonging to the genus Bifidobacterium and the donor bacterium or linear DNA to the transformation medium described above. In this case, the recipient bacterium belonging to the genus Bifidobacterium in contact with the donor bacterium or linear DNA can be directly subjected to static culture.

[056] The bacterial level of the recipient bacterium belonging to the genus Bifidobacterium and the bacterial level of the donor bacterium for use in the method of the present invention are not particularly limited and are each independently preferably from 10⁵ to 10⁹ organisms, more preferably from 10⁶ to 10⁸ organisms. The ratio between the bacterial level of the recipient bacterium belonging to the genus Bifidobacterium and the bacterial level of the Petition 870250112695, dated 08 / 12 / 2025, pp. 100 / 158 19 / 76 donor bacteria is not particularly limited and is preferably 1:0.5 to 1.5, more preferably 1:0.8 to 1.2. The amount of linear donor DNA for use in the method of the present invention is not particularly limited and is preferably 0.01 pg to 1000 ng, more preferably 100 pg to 100 ng, per 107 organisms as the bacterial level of the recipient bacteria belonging to the genus Bifidobacterium.

[057] Subsequently, the recipient bacterium belonging to the genus Bifidobacterium, in contact with the donor bacterium or with the linear DNA, is statically cultured in the transformation medium described above. The culture temperature can be set between 25 and 46 °C, preferably between 35 and 42 °C, and the culture time can be set between 3 and 30 hours, preferably between 4 and 24 hours, more preferably between 8 and 16 hours. The culture atmosphere can be under aerobic or anaerobic conditions, and the culture is preferably carried out under anaerobic conditions.

[058] The DNA to be introduced into the recipient, contained in the donor, is introduced into the recipient's genome by homologous recombination. Particularly, when the donor's linear DNA comprises an upstream homology arm and a downstream homology arm, in addition to the DNA to be introduced into the recipient, the DNA to be introduced into the recipient, contained in the linear DNA, is introduced into a target DNA introduction position or region in the genome of the recipient bacterium belonging to the genus Bifidobacterium by homologous recombination. In this way, the method of the present invention is capable of manipulating the genome of the recipient bacterium belonging to the genus Bifidobacterium.Based on the results of gene expression analysis in the recipient bacterium belonging to the genus Bifidobacterium shown in the examples described later, it is predicted that donor-derived DNA is introduced from the donor into the recipient through the following mechanism: the recipient pilus captures donor DNA outside the bacterial cells; the captured DNA is single-stranded by... Petition 870250112695, dated 08 / 12 / 2025, pp. 101 / 158 20 / 76 action of an enzyme that converts double-stranded DNA into single-stranded DNA; the single-stranded DNA is transported into bacterial cells by a DNA uptake enzyme; a single-stranded DNA-binding protein recognizes single-stranded DNA and recruits a recombination enzyme; and homologous recombination occurs in the recipient genome.

[059] The transformant of interest obtained by the method of the present invention can be obtained by an approach appropriate to the DNA to be introduced.Examples of this include an appropriate culture method for bacterial cells, thus statically cultured in a medium that allows the survival of the transformant of interest, and the selection of a clone confirmed as having the DNA introduced by PCR as the transformant of interest among the resulting clones; an appropriate culture method for bacterial cells, thus statically cultured in a medium that allows the survival of the transformant of interest, and selecting a clone confirmed as having the DNA introduced by genomic analysis as the transformant of interest among the resulting clones; and an appropriate culture method for bacterial cells thus statically cultured in a selective medium supplemented with an appropriate drug for a selection marker, and selecting the resulting clone as the transformant of interest.In this context, bacterial cells thus statically cultured can be cultivated under usual culture conditions for bacteria belonging to the genus Bifidobacterium. Specifically, the culture can be carried out by appropriately defining various conditions, such as an inoculum quantity, a temperature, a time, and a culture atmosphere suitable for the bacteria belonging to the genus Bifidobacterium to be inoculated into the medium. For example, the inoculum quantity can be defined from 0.01 to 5%, preferably from 0.1 to 1%, the culture temperature can be defined from 25 to 46 °C, preferably from 35 to 42 °C, and the culture time can be defined from 6 to 120 hours, preferably. Petition 870250112695, dated 08 / 12 / 2025, pp. 102 / 158 21 / 76 for 24 to 72 hours. The culture atmosphere can be aerobic or anaerobic, and culture is preferably carried out under anaerobic conditions.

[060] The method of the present invention is capable of efficiently increasing the expression of a gene of interest in a bacterium belonging to the genus Bifidobacterium.

[061] Examples of approaches to increase the expression of the gene of interest include a method for increasing the number of copies of the gene of interest by introducing the gene of interest into the genome of the recipient bacterium belonging to the genus Bifidobacterium by the method of the present invention, and a method for increasing the level of transcription in mRNA by altering a control region or a control gene for the gene of interest in the genome of the recipient bacterium belonging to the genus Bifidobacterium by the method of the present invention.

[062] The method of the present invention is also capable of efficiently inhibiting or suppressing the expression of a gene of interest in a bacterium belonging to the genus Bifidobacterium.

[063] Examples of the approach to inhibiting the expression of the gene of interest include a method of inserting DNA entirely different from the interior of the gene of interest into the genome of the recipient bacterium belonging to the genus Bifidobacterium by the method of the present invention and a method of partial or total deletion of the gene of interest in the genome of the recipient bacterium belonging to the genus Bifidobacterium by the method of the present invention.

[064] Examples of the approach to suppressing the expression of the gene of interest include a method of decreasing the transcription level in mRNA by altering a control region or a control gene to the gene of interest in the genome of the recipient bacterium belonging to the genus Bifidobacterium by the method of the present invention.

[065] The method of the present invention can also manipulate the genome of a Petition 870250112695, dated 08 / 12 / 2025, pp. 103 / 158 22 / 76 A bacterium belonging to the genus Bifidobacterium uses, as a recipient, a bacterium belonging to the genus Bifidobacterium lacking the upp gene encoding uracil phosphoribosyltransferase (UPRTase); and uses, as a donor, linear DNA comprising an upstream homology arm, two genes; a selection marker gene and the upp gene, and a downstream homology arm, wherein the two genes are located between the upstream homology arm and the downstream homology arm, and the donor linear DNA further comprises a 3'-terminal region of the upstream homology arm between the two genes and the downstream homology arm, or a 5'-terminal region of the downstream homology arm between the upstream homology arm and the two genes. In this sense, the two genes, the selection marker gene and the upp gene, correspond to the DNA to be introduced into the recipient.

[066] Specifically, the method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to the present invention is a method comprising the static culture of a recipient bacterium belonging to the genus Bifidobacterium in contact with the donor linear DNA, wherein a medium for use in the static culture is a medium having a pH of 6.0 or higher and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 χ (pH) - 1.2 when the pH is 6.0 or higher and less than 8.5 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is 8.5 or higher and less than 10.0; The recipient bacterium, belonging to the genus Bifidobacterium, is a bacterium belonging to the genus Bifidobacterium without the upp gene; and the donor linear DNA comprises an upstream homology arm, two genes;selection marker gene and upp gene, and a downstream homology arm, wherein the two genes are located between the upstream homology arm and the downstream homology arm, and the linear donor DNA further comprises a 3'-terminal region of the upstream homology arm between the two genes and the downstream homology arm, or a 5'-terminal region of the downstream homology arm between; Petition 870250112695, dated 08 / 12 / 2025, pp. 104 / 158 23 / 76 the upstream homology arm and the two genes.

[067] In this context, the selection marker gene is a positive selective marker to select a bacterial strain with both introduced genes; selection marker gene and upp gene (positive selection), and the drug resistance gene or the metabolism-related gene described above is appropriately used. On the other hand, the upp gene is a negative selective marker to select a bacterial strain that has lost both selection marker gene and upp gene (negative selection). The UPRTase encoded by the upp gene converts 5-fluorouracil (5FU) into 5-fluorouridine monophosphate, which is finally converted into 5-fluoro-dUMP. 5-fluoro-dUMP is a toxic metabolite. Therefore, a bacterial strain without the upp gene is not killed in the presence of 5FU, while a bacterial strain with the upp gene is killed in the presence of 5FU. In this way, the upp gene functions as a lethal negative selective marker in the presence of 5FU.The nucleotide sequence of the upp gene from Bifidobacterium pseudocatenulatum is shown in SEQ ID NO: 13. In the present invention, the upp gene encompasses not only a gene consisting of the nucleotide sequence represented by SEQ ID NO: 13, but also a gene corresponding to it. In this context, "corresponding gene" refers to a gene encoding a protein with a function equal to or similar to that of UPRTase in a bacterium. The upp gene consisting of the nucleotide sequence represented by SEQ ID NO: 13 and a gene corresponding to it may have the same nucleotide sequence or may have different nucleotide sequences. The identity of their nucleotide sequences is preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 99% or more.

[068] In linear donor DNA, the selection marker gene and the upp gene can be directly linked to each other or can be linked through another nucleotide sequence, provided that these genes are linked in a way Petition 870250112695, dated 08 / 12 / 2025, pages 105 / 158 24 / 76 expressive. The order of gene linkage is not particularly limited. Preferably, the linear donor DNA comprises a selection marker gene expression cassette composed of a promoter, the nucleotide sequence of the selection marker gene, and a terminator, and an upp gene expression cassette composed of a promoter, the nucleotide sequence of the upp gene, and a terminator. The expression cassettes may comprise a control region, such as an operator, an enhancer, or a ribosomal binding site.

[069] The linear donor DNA comprises an upstream homology arm, two genes: the selection marker gene and the upp gene (hereinafter collectively referred to as a group of marker genes), and a downstream homology arm. The upstream homology arm consists of a nucleotide sequence homologous to the nucleotide sequence of a region upstream (preferably an adjacent upstream region) of the target DNA insertion position or region in the genome of the recipient bacterium belonging to the genus Bifidobacterium. The downstream homology arm consists of a nucleotide sequence homologous to the nucleotide sequence of a region downstream (preferably an adjacent downstream region) of the target DNA insertion position or region in the genome of the recipient bacterium belonging to the genus Bifidobacterium.In the linear donor DNA, the marker gene cluster is located between the upstream homology arm and the downstream homology arm, and the linear donor DNA further comprises a 3'-terminal region of the upstream homology arm as a direct repeat between the marker gene cluster and the downstream homology arm, or a 5'-terminal region of the downstream homology arm as a direct repeat between the upstream homology arm and the marker gene cluster. The nucleotide sequence identity of each homology arm and the corresponding nucleotide sequence of the region in the genome of the recipient bacterium belonging to the genus Bifidobacterium is, independently, at least 80%, preferably 90%. Petition 870250112695, dated 08 / 12 / 2025, pp. 106 / 158 25 / 76 or more, more preferably 95% or more, more preferably 96% or more, more preferably 97% or more, more preferably 98% or more, more preferably 99% or more, more preferably 100%. The length of each homology arm is not particularly limited and each of them, independently, is preferably from 0.5 to 5 kb, more preferably from 0.8 to 4 kb, even more preferably from 1 to 3 kb, from the point of view of homologous recombination efficiency. The length of the direct repeat is not particularly limited and is preferably from 15 to 100 bp, more preferably from 30 to 70 bp, and even more preferably from 45 to 60 bp, from the point of view of homologous recombination efficiency.This linear donor DNA generally comprises the upstream homology arm, the marker gene group, the direct repeat, and the downstream homology arm, in order from the 5' side, and comprises the nucleotide sequence of the upstream homology arm, the nucleotide sequence of the marker gene group, the nucleotide sequence of the direct repeat, and the nucleotide sequence of the downstream homology arm, in order from the 5' side; or comprises the upstream homology arm, the direct repeat, the marker gene group, and the downstream homology arm, and comprises the nucleotide sequence of the upstream homology arm, the nucleotide sequence of the direct repeat, the nucleotide sequence of the marker gene group, and the nucleotide sequence of the downstream homology arm, in order from the 5' side.An arbitrary nucleotide sequence may be added to at least one selected position of the group consisting of a position upstream of the upstream homology arm, a position between the upstream homology arm and the marker gene group, a position between the marker gene group and the direct repeat, and a position downstream of the downstream homology arm, or at least one selected position of the group consisting of a position upstream of the upstream homology arm, a position between the direct repeat and the marker gene group. Petition 870250112695, dated 08 / 12 / 2025, pp. 107 / 158 26 / 76 marker genes, one position between the marker gene group and the downstream homology arm, and one position downstream of the downstream homology arm, without compromising transformation efficiency.

[070] The recipient bacterium belonging to the genus Bifidobacterium to be manipulated in the genome does not have the upp gene. In this way, the upp gene derived from the donor introduced into the recipient can function as a selective negative marker. The bacterium belonging to the genus Bifidobacterium without the upp gene may be a bacterium belonging to the genus Bifidobacterium without the endogenous upp gene or it may be a bacterium belonging to the genus Bifidobacterium in which the upp gene has been interrupted (e.g., deleted) by the transformation method of the present invention or by a known method. Examples of bacterial species belonging to the genus Bifidobacterium include those described above.

[071] In the method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to the present invention, the approach of contacting the recipient bacterium belonging to the genus Bifidobacterium with the donor linear DNA, the bacterial level of the recipient bacterium belonging to the genus Bifidobacterium, the amount of donor linear DNA, the medium and the form of static culture are the same as in the case of the method for transforming a bacterium belonging to the genus Bifidobacterium according to the present invention.

[072] The marker gene group contained in the donor is introduced into a target DNA insertion position or region in the genome of the recipient bacterium belonging to the genus Bifidobacterium by homologous recombination. A transformant with the introduced marker gene group can be obtained by an approach appropriate to the type of marker gene selection (positive selection). Examples of this include an appropriate culture method of the bacterial cells thus statically cultured in a selective medium supplemented with a drug appropriate for a selection marker and the selection of the resulting clone as the Petition 870250112695, dated 08 / 12 / 2025, pages 108 / 158 27 / 76 transformant of interest. Subsequently, the transformant with the introduced marker gene group is cultivated in a medium containing 5FU so that homologous recombination occurs between the direct repeats to lose the marker gene group from the genome. As a result, the transformant of interest capable of proliferating in the medium containing 5FU can be obtained (negative selection). Thus, the method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to the present invention may further comprise: the selection of transformants comprising the introduced marker gene group with the functional exercise of the selection marker (antibiotic resistance or similar) as an index; and the selection of a transformant that has lost the marker gene group with sensitivity to 5FU as an index of the selected transformants. The concentration of 5FU in the medium containing 5FU is preferably from 50 to 500 mM, more preferably from 50 to 200 mM.Bacterial cells can be cultured under usual culture conditions for bacteria belonging to the genus Bifidobacterium.

[073] The method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to the present invention is capable of manipulating the genome without markers, which alters the genome of the bacterium belonging to the genus Bifidobacterium without leaving any trace of the marker gene. Examples of genome manipulation include deletion, substitution, and insertion. For example, for deletion, linear DNA comprising an upstream homology arm, a marker gene group, and a downstream homology arm can be used, wherein the marker gene group is located between the upstream homology arm and the downstream homology arm, and the linear DNA further comprises a 3'-terminal region of the upstream homology arm as a direct repeat between the marker gene group and the downstream homology arm, or a 5'-terminal region of the downstream homology arm as a direct repeat between the upstream homology arm and the downstream homology arm. Petition 870250112695, dated 08 / 12 / 2025, pp. 109 / 158 28 / 76 upstream homology and the marker gene group. In this case, a target DNA region in the genome of the recipient bacterium belonging to the genus Bifidobacterium is deleted. The length of the target DNA region to be deleted is not particularly limited and is preferably 1 to 10,000 bp, more preferably 1 to 6,000 bp, and even more preferably 1 to 4,000 bp.For example, for replacement or insertion, linear DNA may be used comprising an upstream homology arm, a marker gene group, and a downstream homology arm, wherein the marker gene group is located between the upstream homology arm and the downstream homology arm, and the linear DNA further comprises a 3'-terminal region of the upstream homology arm as a direct repeat between the marker gene group and the downstream homology arm, or a 5'-terminal region of the downstream homology arm as a direct repeat between the upstream homology arm and the marker gene group, and further comprises a desired sequence for insertion or replacement between the direct repeat and the downstream homology arm or between the upstream homology arm and the direct repeat.In this case, the desired sequence is inserted into a target DNA position in the genome of the recipient bacterium belonging to the genus Bifidobacterium, or a target DNA region in the genome of the recipient bacterium belonging to the genus Bifidobacterium is replaced by the desired sequence. The length of the DNA region to be inserted or the target DNA region to be replaced is not particularly limited and is preferably 1 to 10,000 bp, more preferably 1 to 6,000 bp, and even more preferably 1 to 4,000 bp.

[074] A kit for manipulating the genome of a bacterium belonging to the genus Bifidobacterium is a kit for performing the manipulation of the genome of a bacterium belonging to the genus Bifidobacterium according to the method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to the present invention. The kit of the present invention comprises a means and Petition 870250112695, dated 08 / 12 / 2025, page 110 / 158 29 / 76Linear DNA comprising the selection marker gene and the upp gene, in which the medium has a pH equal to or greater than 6.0 and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or greater and less than 8.5 and 0.2 x (pH) - 1.7 < x < 0.2 x (pH) - 1.2 when the pH is 8.5 or greater and less than 10.0. Linear DNA preferably comprises an upstream homology arm, two genes, the selection marker gene and the upp gene, and a downstream homology arm, wherein the two genes are located between the upstream homology arm and the downstream homology arm, and linear DNA further comprises a 3'-terminal region of the upstream homology arm between the two genes and the downstream homology arm, or a 5'-terminal region of the downstream homology arm between the upstream homology arm and the two genes.The kit may include guidance or something similar for performing the method of manipulating the genome of a bacterium belonging to the genus Bifidobacterium according to the present invention.

[075] As demonstrated in the examples described below, Bifidobacterium pseudocatenulatum YIT 13179 (NITE BP-03853) with the ability to utilize glucose, while maintaining excellent viability in a milk medium, was obtained by restoring the deletion of a single nucleotide of a gene (SEQ ID NO: 14) that encodes a glucose transporter causing the loss of the ability to utilize glucose by the transformation method of the present invention using genomic DNA YIT 11057 as the donor and, as the recipient, Bifidobacterium pseudocatenulatum Y 51493 (NITE BP-03852) which lost the ability to utilize glucose, although it has better viability in a milk medium than the parent strain, as a result of creating Bifidobacterium pseudocatenulatum YIT 11057 (NITE BP-02930) with the ability to utilize glucose like the parent strain by UV irradiation and long-term subculture. YIT 13179 was deposited on March 13, 2023, at the National Institute of Technology. Petition 870250112695, dated 08 / 12 / 2025, page 111 / 158 30 / 76 and Evaluation, Patent Microorganisms Depositary (no. 122, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan).

[076] In this context, the ability to utilize glucose refers to having the capacity to proliferate with glucose as a carbon source. Bacteria belonging to the genus Bifidobacterium are known as a bacterial species for which artificial gene manipulation is difficult. The deletion of a single nucleotide is difficult to restore by conventional UV irradiation or long-term subculture. However, the method of the present invention is capable of restoring even a single nucleotide deletion.

[077] The application of bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention is not particularly limited, and the bacteria can be lyophilized or cultures containing the bacteria can be used. In either form, the bacteria are preferably in the state of a viable bacterium.

[078] Bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention can be mixed with a non-toxic solid or liquid carrier for a medicament and used in the form of a common pharmaceutical preparation. Examples of such preparations include solid formulations such as tablets, granules, powders and capsules, liquid formulations such as solutions, suspensions and emulsions, and lyophilized preparations. These preparations can be prepared by usual pharmaceutical approaches. Examples of non-toxic carriers for a medicament include glucose, lactose, sucrose, starch, mannitol, dextrin, fatty acid glyceride, polyethylene glycol, hydroxyethyl starch, ethylene glycol, polyoxyethylene sorbitan fatty acid ester, amino acids, gelatin, albumin, water and saline solution. If necessary, a common additive such as a stabilizer, a wetting agent, an emulsifier, a binder, a tonicity agent or an excipient may be appropriately added.

[079] The bacterium belonging to the genus Bifidobacterium obtained by the method of Petition 870250112695, dated 08 / 12 / 2025, page 112 / 158 31 / 76 The present invention can not only be prepared in the manner described above, but also mixed into a food product or beverage and used. The bacteria, when mixed into a food product or beverage, can be contained as is or along with various nutrients.Specifically, in the case of a mixture of bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention in a food product or beverage, the bacteria can be transformed into a form suitable for consumption, i.e., granules, grains, tablets, capsules, a paste or the like, by means of a common approach, suitably using an additive that can be used for food products or beverages, or can be added for use in various food products, for example, processed food products with meat, such as ham and sausage, processed food products with seafood, such as Kamaboko (fish paste) and Chikuwa (fish sausage), bread, confectionery, butter or milk powder, or can be added for use in beverages, such as water, fruit juice, milk, soft drinks or tea-based beverages. The food product or beverage also includes animal feed.

[080] A fermented dairy food or beverage, such as fermented soy milk, fermented fruit juice, or fermented vegetable juice, containing bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention in the state of a viable bacterium, is suitably used as food or beverage. In particular, a fermented dairy food or beverage is preferably used. The fermented dairy food or beverage can be produced according to a routine method. For example, in the case of the production of fermented milk, bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention are inoculated and cultivated in a sterilized milk medium, alone or in conjunction with another microbe, and the result is homogenized to obtain a fermented milk base. Then, a separately prepared syrup solution is added to the base and mixed with Petition 870250112695, dated 08 / 12 / 2025, page 113 / 158 32 / 76 it, and the mixture is homogenized with a homogenizer and the like. A flavor can be added to it to prepare a final product. The fermented milk-based food or beverage thus obtained can be prepared as a product in any form, such as plain type without syrup (sweetener), soft type, fruit-flavored type, solid or liquid state.

[081] An arbitrary component, such as a sweetener (for example, a syrup), an emulsifier, a thickener (or a stabilizer) or various vitamins, may be mixed into this fermented milk-based food or beverage.The following items may be mixed with it: as syrup, carbohydrates such as glucose, sucrose, fructose, high fructose corn syrup, glucose syrup, palatinose, trehalose, lactose, xylose, galacto-oligosaccharide (GOS), xylo-oligosaccharide (XOS), arabinoxylo-oligosaccharide (AXOS), xylan, arabinoxylan, arabino-oligosaccharide (AOS), arabinan, maltose, honey and molasses, sugar alcohols such as sorbitol, xylitol, erythritol, lactitol, palatinit, reduced sugar syrup and reduced maltose syrup, high-intensity sweeteners such as aspartame, thaumatin, sucralose, acesulfame K and stevia, emulsifiers such as glyceryl fatty acid ester, polyglyceryl fatty acid ester, fatty acid ester of sorbitan and lecithin, and thickeners (or stabilizers) such as agar, gelatin, carrageenan, guar gum, xanthan gum, pectin, locust bean gum, gellan gum, carboxymethylcellulose, soy polysaccharides and propylene glycol alginate.In addition, the following components may be mixed with it: vitamins, such as vitamin A, B vitamins, vitamin C and vitamin E, minerals such as calcium, magnesium, zinc, iron and manganese, acidulants such as citric acid, lactic acid, acetic acid, malic acid, tartaric acid and gluconic acid, dairy fats such as cream, butter and sour cream, flavors such as yogurt, red berries, orange, quince, perilla, citrus fruits, apple, mint, grape, apricot, pear, sour cream, peach, melon, banana, tropical, herbs, black tea and coffee, herbal extracts, brown sugar extracts and the like. Petition 870250112695, dated 08 / 12 / 2025, pp. 114 / 158 33 / 76

[082] In the production of fermented dairy food or beverage, a microbe other than bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention may be used in combination with it. Examples of such microbes include bacteria belonging to the genus Lacticaseibacillus, such as Lacticaseibacillus paracasei, bacteria belonging to the genus Lactobacillus, such as Lactobacillus casei, L. acidophilus, L. plantarum, L. buchneri, L. gallinarum, L. amylovorus, L. brevis, L. rhamnosus, L. kefir, L. paracasei, L. crispatus, L. zeae, L. helveticus, L. salivalius, L. gasseri, L. fermentum, L. reuteri, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. delbrueckii and L. johnsonii, bacteria belonging to the genus Streptococcus, such as Streptococcus thermophilus, bacteria belonging to the genus Lactococcus, such as Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris, bacteria belonging to the genus Enterococcus, such as Enterococcus faecalis and E.Faecium, bacteria belonging to the genus Bacillus, such as Bacillus subtilis, and yeasts belonging to the genera Saccharomyces, Torulaspora, and Candida, such as Saccharomyces cerevisiae, Torulaspora delbrueckii, and Candida kefyr.

[083] In the case of using bacteria belonging to the genus Bifidobacterium obtained by the method of the present invention, the dose is not strictly limited and is preferably 105 to 1013 cfu, particularly 108 to 1012 cfu, per day in terms of the number of viable bacteria. Examples

[084] The present invention will be described in more detail hereafter by referring to the Examples. However, the present invention is by no means limited to these examples. Example 1 Discovery of genomic mosaicism in bacteria belonging to the genus Bifidobacterium.

[085] Analysis of the ability to utilize indigestible polysaccharide and analysis Petition 870250112695, dated 08 / 12 / 2025, pages 115 / 158 34 / 76 genomic studies using bacterial strains belonging to Bifidobacterium pseudocatenulatum revealed that some bacterial strains exhibit the ability to utilize long-chain xylans, which is defined by the xylanase gene (BpXyn10A) residing on the chromosome; and strains possessing the xylanase gene, when plotted on a phylogenetic tree prepared based on genomic information from bacterial strains belonging to Bifidobacterium pseudocatenulatum, are dispersed throughout the phylogenetic tree, rather than being concentrated in a specific cluster (Unpatented Literature 1). This suggests that the xylanase gene is horizontally transferred between bacterial strains. Therefore, the xylanase gene was tested for its horizontal transfer in vitro.

[086] In general, horizontal gene transfer in bacteria is known to have three patterns: natural transformation by uptake of extracellular DNA, transduction by phage infection, and conjugation mediated by the transmission of plasmids and the like. Thus, to allow the detection of all events, two strains of Bifidobacterium pseudocatenulatum with different phenotypes were cultured individually and then co-cultured for a certain time in an agar medium to test horizontal gene transfer. (1) Bacterial strain used

[087] Tetracycline (Tc) sensitive Bifidobacterium pseudocatenulatum strains with the xylanase gene (YIT 11025, YIT 11027, YIT 12242, YIT 12820, YIT 12824 and YIT 12986) were used as donors, and Tc-resistant Bifidobacterium pseudocatenulatum strains without the xylanase gene (YIT 4072T, YIT 11955, YIT 11956, YIT 12228, YIT 12818, YIT 12822 and YIT 12987) were used as recipients. (2) Methods for testing horizontal xylanase gene transfer

[088] Each of the donor and recipient bacterial strains was inoculated into modified GAM liquid medium (mGAM) (Nissui Pharmaceutical Co., Ltd.) supplemented with 0.5 wt% glucose / lactose and cultured to the stage of Petition 870250112695, dated 08 / 12 / 2025, pp. 116 / 158 35 / 76 logarithmic growth. 200 μL of each of the donor and recipient bacterial fluids (number of bacteria: approximately 10⁸⁹ organisms) were mixed and centrifuged, followed by removal of a supernatant using a 200 μL pipette. The granules were suspended using a very small amount of the remaining medium in a tube, and the entire amount of the suspension was then left to stand on mGAM agar medium (Nissui Pharmaceutical Co., Ltd.). After being cultured anaerobically at 37 °C for 16 to 24 hours, the bacterial cells were scraped with a 1 μL loop and inoculated into mPY-AX-Tc (mPY medium; see Non-Patent Literature 1, arabinoxylan (AX): final concentration: 0.5 wt%, Tc: final concentration: 10 μg / mL) in liquid medium in which the donor alone or the recipient alone failed to proliferate. Turbidity was monitored using Eon microplate spectrophotometers (BIOTEC Co., Ltd.).Some combinations that increased turbidity in the selective medium were subcultured in a new medium with the same composition as above to confirm the reproducibility of the turbidity increase. This bacterial liquid was spread on mGAM agar medium containing Tc (final concentration: 10 μg / mL) and then cultured anaerobically overnight at 37 °C, and the resulting single colony was subcultured in the same agar medium as above. The following day, some bacterial cells were inoculated into mPY-AX-Tc liquid medium, while some bacterial cells were suspended in TE buffer, heated to 95 °C for 5 minutes and used as a simple model for PCR. The presence or absence of proliferation in the mPY-AX-Tc medium was confirmed and, when the receptor was YIT 11956, the identification of the bacterial strain and confirmation of the presence or absence of the xylanase gene were performed by PCR using receptor-specific primers (YIT 11956) (BP28-f:. GGGCAAGATCGGCATCATCATCTA (SEQ ID NO: 15), BP28-r: CACATTGGTGGTGTTCACGTC (SEQ ID NO: 16)) and xylanase gene-specific primers (pBpXyn10A-F: CGAGAATGCGAACACACGTACTTC (SEQ ID NO: 17), Petition 870250112695, dated 08 / 12 / 2025, pp. 117 / 158 36 / 76 pBpXyn10A-R: CTGCTCGGTGTTGTAATCGTTG (SEQ ID NO: 18)). A colony confirmed to contain the xylanase gene was cryopreserved. (3) Genomic analysis method

[089] DNA was extracted from the bacterial cells obtained in (2), and a short reading frame and a long reading frame were obtained using a second-generation Miseq sequencer (Illumina, Inc.) and a third-generation MinION sequencer (Oxford Nanopore Technologies plc.). A complete genomic sequence was obtained by hybrid assembly. The genomic sequences of the donor strain, the recipient strain, and the strain that acquired the gene were aligned using snippy (https: / / github.com / tseemann / snippy), and the alignment results were entered into fastGEAR (Mostowy et al., Molecular Biology and Evolution 34 (5), 11671182) to identify a homologous recombination region. Information on single nucleotide polymorphisms (SNPs) was extracted from genomic sequences using the nucmer, delta-filter, and show-snps packages of MUMMER (Kurtz et al., Genome Biology 5, R12, 2004).The format of an output file was adjusted by a custom script, and the homologous recombination region was then visualized using Artemis ACT (Sanger Institute). (4) Results of tests on horizontal gene transfer of xylanase

[090] A donor and a recipient were mixed and then cultured anaerobically overnight on mGAM agar medium and inoculated into mPY-AX-Tc selective liquid medium, and proliferative activity was monitored. As a result, it was found that a plurality of donor and recipient combinations increased turbidity. As a result of genomic analysis of 13 strains that acquired the gene and were obtained with YIT 11956 or YIT 4072T as the recipient and YIT 11025, YIT 11027, YIT 12820 or YIT 12824 as the donor among the combinations, it was confirmed that all strains that acquired the gene had the xylanase gene and were very closely related. Petition 870250112695, dated 08 / 12 / 2025, pages 118 / 158 37 / 76 to the recipient, not the donor. The xylanase gene on the chromosome was found to have been transmitted from the donor, which was a strain possessing the xylanase gene, to the recipient, which was a strain lacking the xylanase gene (Figure 1 and Table 2). The strain with the transmitted xylanase gene was confirmed to be capable of proliferating in mPY-AX medium (Figure 2).

[091] As a result of comparing the genomic sequences in detail at the SNP level, the SNPs in regions from 16.5 to 247 kb, including the newly acquired xylanase gene, as well as the upstream and downstream sites in the gene-acquired strain, were consistent with the donor. Specifically, homologous double-crossing recombination was found to have occurred extensively in the gene-acquired strain, thus causing replacement by donor-derived genomic regions, including the xylanase gene and its upstream and downstream sites, and horizontal transfer of the xylanase gene. The replacement of genomic regions occurred in a genome-wide mosaic pattern, and the replacement regions also differed between bacterial strains. Specifically, donor-derived genomic regions were integrated at a maximum of seven sites per strain and in regions from 0.5 to 247 kb (Figure 1).On the other hand, no trace of phages or plasmids was observed in the replacement regions.

[092] To test the generality of this phenomenon, tests were also attempted to horizontally transfer other genes possessed by Bifidobacterium pseudocatenulatum. First, attention was given to the amylase gene, which defines the ability to utilize starch. A Tc-sensitive Bifidobacterium pseudocatenulatum strain with the amylase gene (YIT 11027) was used as a donor, and a Tc-resistant Bifidobacterium pseudocatenulatum strain without the amylase gene (YIT 11956) was used as a recipient. When the bacterial cells after mixing the strains were inoculated into mPY-St-Tc (starch (St): final concentration: 0.5% by mass, Tc: final concentration: 10 μg / mL) by the same method used in (2), it was Petition 870250112695, dated 08 / 12 / 2025, pp. 119 / 158 38 / 76 confirmed the appearance of a strain with the amylase gene transferred horizontally by genomic mosaicism (Table 2). The strain with the transmitted amylase gene was confirmed to be capable of proliferating in mPY-Starch medium (Figure 3). Further attention was given to the Tc resistance gene. Erythromycin-sensitive (Em) Bifidobacterium pseudocatenulatum strains with the Tc resistance gene (YIT 4072T, YIT 11955, and YIT 12987) were used as donors, and an Em-resistant Bifidobacterium pseudocatenulatum strain without the Tc resistance gene (YIT 12824) was used as a recipient.When the bacterial cells, after mixing the strains, were spread on the modified GAM agar medium supplemented with 0.5 wt% lactose (mGAML) and supplemented with Em (final concentration: 1 μg / mL)-Tc (final concentration: 10 μg / mL) (EmTc-mGAML) using the same approach as in (2), the appearance of a strain with the Tc resistance gene transferred horizontally by genomic mosaicism was confirmed (Table 2). The strain with the transmitted Tc resistance gene was confirmed to be able to proliferate in the Tc-mGAML medium (Figure 4). [Table 2] Donor strain Recipient strain Acquired phenotype LCX+ TcS LCX- TcR YIT 11025 YIT 11956 LCX+ TcR YIT 11027 YIT 11956 LCX+ TcR YIT 12820 YIT 11956 LCX+ TcR YIT 12824 YIT 11956 LCX+ TcR YIT 12824 YIT 4072T LCX+ TcR ST+ TcS ST- TcR YIT 11027 YIT 11956 ST+ TcR EmS TcR EmR TcS YIT 11955 YIT 12824 EmR Tcr YIT 12987 YIT 12824 EmR Tcr YIT 4072T YIT 12824 EmR Tcr Petition 870250112695, dated 08 / 12 / 2025, pages 120 / 158 39 / 76 * LCX+ / -: With the BpXynlOA gene, presence / absence of the ability to utilize long-chain xylans (LCX) * TcS / R: Tetracycline sensitivity / resistance * ST+ / -: Presence / absence of the ability to utilize starch * EmS / R: Erythromycin sensitivity / resistance Example 2: Natural transformation test in bacteria belonging to the genus Bifidobacterium.

[093] The genomic mosaicism of the bacterium belonging to the genus Bifidobacterium was tested to verify whether it is attributable to natural transformation, as no trace of horizontal transfer of phages or plasmids was observed. (1) Bacterial strain used

[094] A Tc-resistant and Em-sensitive YIT 4072T strain of Bifidobacterium pseudocatenulatum was used as the donor, and the Tc-sensitive and Em-resistant YIT 12824 strain of Bifidobacterium pseudocatenulatum was used as the recipient. (2) Method for extracting genomic DNA for use as a donor and preparing the PCR product

[095] YIT 4072T was cultured overnight in mGAML liquid medium, and high molecular weight genomic DNA was purified using the NucleoBond Buffer Set III and NucleoBond AXG20 column (Takara Bio Inc.). Double-stranded DNA was quantified using the Picogreen kit and diluted to 30 ng / μL with TE buffer. Using this genomic DNA as a template, a region of approximately 20 kb comprising the Tc resistance gene (tetW) was amplified by PCR. A high-fidelity enzyme, PrimeSTAR GXL DNA polymerase (Takara Bio Inc.), was used as the PCR enzyme. 0.2 μE of the enzyme, 0.04 μE of each of the 50 μM primers (SEQ ID NO: 19 and 20), 1 μE of template DNA (0.02 ng / μE), 1.6 μE of a dNTP solution, and 4 μE of buffer 5* were mixed, and the amount of reaction solution per PCR tube was set at 20 μE. The PCR products obtained were Petition 870250112695, dated 08 / 12 / 2025, pp. 121 / 158 40 / 76 precipitates were collected in ethanol and then dissolved in TE buffer. Double-stranded DNA was quantified with Picogreen and then diluted to 1 ng / μL with TE buffer, and the dilution was divided into small portions and cryopreserved.

[096] Table 3 shows the primers and PCR conditions used in this example. [Table 3] Primer name Sequence (5'-3') SE Q ID NO Length of amplified product (bp) PCR conditions BpTy20 kF TCCTGTGGATTTCGACGGTGACGAG CAG 19 19645 1 BpTy20 kR GAGTGCGGTTGATGGTGCATACGGC AAG 20 PCR conditions 1. 98 °C 20 s, (98 °C 10 s, 68 °C 10 min) x 30.4 °C « (3) Method for preparing dead bacterial cell

[097] YIT 4072T was cultured in 2 mL of mGAML liquid medium until the late logarithmic growth phase, washed with mPY liquid medium, and then the granules were suspended in 180 μL of the same medium above. A 20 μL aliquot of the suspension was collected in a 1.5 mL screw-capped tube and heated to 80 °C for 10 minutes using a heating block to prepare dead bacterial cells. This treatment was separately confirmed to completely kill the bacterial cells. (4) Horizontal transfer test of antibiotic resistance gene with viable bacterial cell, heat-killed bacterial cell and purified DNA as donors

[098] Frozen bacterial cells of each of the YIT bacterial strains Petition 870250112695, dated 08 / 12 / 2025, pages 122 / 158 41 / 76 4072Te YIT 12824 were inoculated onto mGAML agar medium and cultured anaerobically at 37 °C, and the resulting bacterial cells were then subcultured in 400 μL of the same liquid medium described above. After culturing for 3 to 4 hours, 1600 μL of the same liquid medium described above were added, and the bacterial cells were cultured for 4 to 5 hours until the culture transitioned from the late logarithmic growth phase to the stationary phase. Each bacterial fluid sample was collected, washed with mPY liquid medium, collected again, and suspended in 180 μL of the same medium described above. 5 μL of the recipient bacterial fluid (YIT 12824) and 5 μL of viable donor bacterial fluid (YIT 4072T), the dead bacterial fluid prepared in (3) or the purified DNA prepared in (2) were mixed (number of bacteria: approximately 107-8 organisms each), and the entire amount of the mixture was left to stand on mGAM agar medium.After being cultured anaerobically at 37 °C for 16 to 24 hours, the entire quantity of bacterial cells was scraped with a 1 μL loop, suspended in 60 μL of mPY liquid medium, serially diluted, spread on EmTc-mGAMl agar medium and cultured anaerobically at 37 °C for 2 to 3 days, followed by counting the number of colonies. Some colonies were subjected to genomic analysis in the same way as in Example 1 (3) to confirm the occurrence of homologous recombination. (5) Test of the influence of adding DNA degradation enzyme (DNase I)

[099] Viable bacterial fluids washed from YIT 4072Te and YIT 12824 were prepared in the same manner as in (4). 20 μL aliquots of the respective bacterial fluids washed from the strains were collected in a 1.5 mL tube, mixed and centrifuged, and the pellets were then suspended in 40 μL of 1x DNase I buffer (Takara Bio Inc.). 8 μL of an undiluted liquid (5 U / μL) of recombinant DNase I (Takara Bio Inc.) or 1 / 10 of its dilution (0.5 U / μL) or 3 / 10 of its dilution (1.5 U / μL) with 1x DNase I buffer were added to the suspension. 12 μL of each of the three Petition 870250112695, dated 08 / 12 / 2025, pages 123 / 158 42 / 76 samples per mixture condition were left standing on mGAM agar medium. The agar medium in which the bacterial cells were left standing was cultured anaerobically at 37 °C for 16 hours. Then, the entire quantity of bacterial cells was scraped using a 1 μL loop, suspended in 60 μL of mPY liquid medium, and then diluted appropriately using the same medium as above. To measure the number of bacteria with the horizontally transferred Tc resistance gene, the bacterial liquid was spread on EmTc-mGAML agar medium. To detect the total number of viable bacteria of the Em-resistant strain, the bacterial liquid was also spread on Em-mGAML agar medium. Each agar medium was cultured anaerobically at 37 °C for 2 to 3 days. The ratio of the number of bacteria with mosaicism to the total number of viable bacteria of the Em-resistant strain was considered the mosaicism frequency. (6) Results

[0100] Viable bacterial cells of the donor YIT 4072T (Tc-resistant strain) and the recipient YIT 12824 (Em-resistant strain) were mixed, cultured anaerobically overnight on mGAM agar medium, and studied to verify if a strain resistant to both antibiotics appeared in the selective medium in which the donor alone or the recipient alone could not proliferate. As a result, colonies exhibiting resistance to both antibiotics emerged. As a result of the genomic analysis of six strains thus obtained, the occurrence of homologous recombination in a mosaic pattern in a plurality of regions was confirmed, including the Tc resistance gene and its neighboring regions. The number of recombination regions was 1 to 4, and the maximum length of the recombination region was 22 to 112 kb.

[0101] In the case of using killed bacterial cells as a donor, horizontal transfer of the Tc resistance gene was confirmed, although the frequency was reduced compared to the case of using cells Petition 870250112695, dated 08 / 12 / 2025, pages 124 / 158 43 / 76 viable bacterial cells were used as donors (Figure 5A). Similarly, horizontal transfer occurred even when the donor was replaced with genomic DNA or PCR products (Figure 5B). In the case of using dead bacterial cells as donors, the number of recombination regions was 1 to 2, and the maximum length of the recombination region was 16 to 45 kb, in two strains submitted to genomic analysis. In the case of using genomic DNA as donors, the number of recombination regions was 1, and the maximum length of the recombination region was 12 to 16 kb, in two strains submitted to genomic analysis. In the case of using PCR products prepared with YIT 4072T genomic DNA as a template, the number of recombination regions was 1, and the maximum length of the recombination region was 12 kb, in one strain submitted to genomic analysis.As a result of adding a DNA degradation enzyme to the test system using viable bacterial cells as donors, horizontal gene transfer was inhibited (Figure 5C). This revealed that the pathway of genomic mosaicism involving horizontal gene transfer in the bacterium belonging to the genus Bifidobacterium was natural transformation by uptake of extracellular DNA and homologous recombination. Thus, the frequency of mosaicism described above signifies a frequency of transformation.

[0102] As a result of the confirmation of the universality of natural transformation in Bifidobacterium pseudocatenulatum, horizontal transfer of the Tc resistance gene was recently confirmed in 11 strains using, as a donor, PCR products prepared with YIT 4072T genomic DNA as a template (Table 4). [Table 4] Donor strain Recipient strain Acquired phenotype Tcr TcS YIT 4072T (PCR product) YIT 12989 TcR YIT 4072T (PCR product) YIT 11952 TcR Petition 870250112695, dated 08 / 12 / 2025, pages 125 / 158 44 / 76 YIT 4072T (PCR product) YIT 11953 TcR YIT 4072T (PCR product) YIT 12145 TcR YIT 4072T (PCR product) YIT 12203 TcR YIT 4072T (PCR product) YIT 12232 TcR YIT 4072T (PCR product) YIT 12817 TcR YIT 4072T (PCR product) YIT 12819 TcR YIT 4072T (PCR product) YIT 12820 TcR YIT 4072T (PCR product) YIT 12821 TcR YIT 4072T (PCR product) YIT 12985 TcR * Tcs / r: Tetracycline sensitivity / resistance Example 3: Research on the factor influencing the transformation frequency of bacteria belonging to the genus Bifidobacterium.

[0103] It is considered that the absorption of foreign DNA by natural transformation in bacteria increases genomic diversity and contributes to the environmental adaptation of bacteria. On the other hand, excessive natural transformation can disrupt genomic structures developed over a long period and bring disadvantages to bacteria. Therefore, in many bacterial species that exhibit natural transformation, natural transformation is placed under strict control and exercised only under specific environmental conditions. Thus, to efficiently transform a bacterium belonging to the genus Bifidobacterium, the conditions for the exercise of natural transformation were studied. (1) Bacterial strain used

[0104] Tc-sensitive Bifidobacterium pseudocatenulatum YIT 12819 (GenBank accession number: GCA_020526245.1) was used as the recipient. (2) Preparation of donor DNA

[0105] YIT 12819 with the Tc resistance gene inserted into an intergenic region on the chromosome was prepared. Donor DNA of approximately 20 kb comprising the Tc resistance gene flanked by upstream and downstream homology arms of approximately 10 kb was amplified by DNA PCR. Petition 870250112695, dated 08 / 12 / 2025, pages 126 / 158 45 / 76 genomic strain as a model. (i) Preparation of the strain with the Tc resistance gene inserted into it

[0106] A construct to insert the Tc resistance gene (tetW) from YIT 4072Tm into an intergenic region of YIT 12819 was prepared by PCR. In all PCR operations, the high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo Co., Ltd.) was used, and the final primer concentration was set to 0.3 μM. The upstream homologous region (upstream homology arm) in the insertion construct was amplified by PCR with YIT 12819 genomic DNA as a template using SEQ ID NOs: 21 and 22 primers. The downstream homologous region (downstream homology arm) in the insertion construct was amplified by PCR with YIT 12819 genomic DNA as a template, using SEQ ID NOs: 25 and 26 primers. The Tc resistance gene region was amplified by PCR with YIT 4072T genomic DNA as a template, using SEQ ID NOs: 23 and 24 primers.Agarose gel electrophoresis was performed, and a band of interest was excised, followed by DNA extraction from the gel using a Freeze'N' Squeeze spin column (BioRad Laboratories, Inc.). The concentration difference between the fragments was visually confirmed by agarose gel electrophoresis, and these fragments were mixed to obtain substantially equal concentrations and ligated by overlap extension PCR (OE-PCR) using primers with SEQ ID numbers 21 and 26. Obtaining amplified products of interest was confirmed by electrophoresis. Subsequently, a band of interest was extracted from the gel and precipitated in ethanol, and the obtained DNA was dissolved in TE buffer. This DNA solution and YIT 12819 (number of bacteria: approximately 107 organisms) were mixed, and the bacterial liquid was left to stand on mGAM agar medium supplemented with 50 mM magnesium chloride, cultured anaerobically at 37 °C for 16 hours for transformation.The following day, the bacterial cells were spread on mGAML agar medium containing Tc (final concentration: 10 μg / mL) to obtain a... Petition 870250112695, dated 08 / 12 / 2025, pages 127 / 158 46 / 76 strain with the Tc resistance gene inserted. (ii) Preparation of the PCR fragment

[0107] A PCR fragment of approximately 20 kb comprising the Tc resistance gene was prepared using genomic DNA from YIT 12819 with the Tc resistance gene inserted into it as a template. PrimeSTAR GXL DNA polymerase was used as the PCR enzyme. SEQ ID primers NOs: 27 and 28 were used for fragment amplification. Obtaining amplified products of interest was confirmed by electrophoresis followed by ethanol precipitation. A double-stranded DNA concentration was quantified using Picogreen, and the double-stranded DNA was prepared at 1 ng / μL using TE buffer, dispensed in small portions, and cryopreserved at -30 °C.

[0108] Table 5 shows the primers and PCR conditions used in this example. [Table 5] Name of primer or Sequence (5'-3')a SE Q ID NO Length of amplified product (bp) PCR conditions In-up-f AAGTGTGGTTTTGTCCGTTCG 21 1016 1 In-up-r TAGATGTGCCGAAATCGGGACTTGGTAC 22 III TCGG In-tet-f TACCAAGTCCCGAIIICGGCACATCTAAA CCAAGG 23 2558 2 In-tet-r TAGATGTGCCGAAACCAGTGAATGCCCT 24 CCTGATT Indown-f GGGCATTCACTGG i HCGGCACATCTAA ACCAAGG 25 1886 1 Indown- CGCAAGTGTGTCGT IICTGTT 26 Petition 870250112695, dated 08 / 12 / 2025, pp. 128 / 158 47 / 76 r In-up-f AAGTGTGGTTTTGTCCGTTCG 21 5462 3 Indownr CGCAAGTGTGTCGI IICTGTT 26 20k-f TGGGCGGTGCTTCCGGGTTCCGGTGATTC CTTGTTC 27 19900 4 20k-r CACGGGCGACGGGCTGTTCTACCAACTT CCACGAC 28 a: Underlined overlapping region PCR conditions 1. 94 °C 2 min, (98 °C 10 s, 68 °C 75 s) x 30.4 °C « 2. 94 °C 2 min, (98 °C 10 s, 65 °C 30 s, 68 °C 90 s) x 30.4 °C « 3. 94 °C 2 min, (98 °C 10 s, 68 °C 3 min) x 30.4 °C « 4. 98 °C 20 s, (98 °C 10 s, 68 °C 10 min) x 30, 4 °C « (3) Transformation method

[0109] Frozen bacterial cells from YIT 12819 were inoculated onto mGAML agar medium and cultured anaerobically in a glove box at 37 °C, and the resulting bacterial cells were then subcultured in 400 pL of mGAML liquid medium. After culturing for 3–4 hours, 1600 pL of the same liquid medium were added, and the bacterial cells were cultured for 3–4 hours until the culture transitioned from the late logarithmic growth phase to the stationary phase. The bacterial cells were harvested from the bacterial fluid, washed with mPY liquid medium, harvested again, and suspended in 180–220 pL of the same medium to prepare a bacterial fluid for transformation. The bacterial fluid (number of bacteria: approximately 107-8 organisms) and donor DNA (2) were mixed in equal volumes, and 10 pL of the mixture were left in each of the five locations in various agar media provided below (N = 5).After being cultured anaerobically at 37 °C for 16 hours, the entire quantity of bacterial cells left standing was scraped with a 1 pL loop and suspended in 60 pL. Petition 870250112695, dated 08 / 12 / 2025, pages 129 / 158 48 / 76 of mPY liquid medium. The suspension was appropriately diluted using the same medium as above. The CFU of transformants was measured by spreading the dilution over mGAML agar medium containing Tc, while the total CFU was measured by spreading the dilution over mGAML agar medium supplemented without Tc. The ratio between the CFU of transformants and the total CFU was considered as the transformation frequency. (4) Medium used (i) Medium with altered pH

[0110] mGAM liquid medium was prepared and its pH was measured (actual measured value without adjustment: pH 7.0). The pH was adjusted from 5.5 to 8.5 in 0.5 intervals with the addition of hydrochloric acid or sodium hydroxide. Then, Bacto Agar (final concentration: 1.5%) was added to the medium, which was sterilized by autoclaving, distributed into Petri dishes, and dried for 1 to 1.5 hours in a biological safety cabinet. (ii) Medium supplemented with various salts and carbohydrates

[0111] Sodium chloride (50, 100, and 200 mM), potassium chloride (50 mM), ammonium chloride (50 mM), magnesium chloride (5, 20, 50, 100, and 200 mM), or lactose (2.5, 5.0, and 50 mM, corresponding to approximately 0.086, 0.17, and 1.71 wt%, respectively) (all final concentrations) were added to mGAM agar medium (pH 7.0), which was then sterilized by autoclaving, distributed into Petri dishes, and dried for 1 to 1.5 hours in a biological safety cabinet. Since the mGAM medium originally contains 0.05 wt% glucose, the degradable carbohydrate content of the medium is the total glucose and lactose content and is approximately 0.136, 0.22, and 1.76 wt%, respectively. Although mGAM agar medium also contains 0.5% by mass of soluble starch, the YIT 12819 used in this experiment does not have the capacity to utilize soluble starch. Therefore, soluble starch is not considered a degradable carbohydrate in this experiment. Petition 870250112695, dated 08 / 12 / 2025, pp. 130 / 158 49 / 76 (iii) Medium with altered pH supplemented with carbohydrate

[0112] The mGAM liquid medium was prepared, and its pH was adjusted from 7 to 10 in 1-hour intervals by the addition of sodium hydroxide. Then, lactose (final concentration: 0, 0.25, 0.50, 0.75, and 1.00 wt%) and Bacto Agar (final concentration: 1.5%) were added to the medium, which was then sterilized by autoclaving, distributed into Petri dishes, and dried for 1 to 1.5 hours in a biological safety cabinet. (iv) Medium adjusted to osmotic pressure

[0113] Sodium chloride (final concentration: 0, 25, 50, 75, 100, 125, 150 and 200 mM, actual measured osmotic pressure value: 65, 102, 134, 211, 417, 593, 681 and 761 mOsm, respectively) was added to Trypticase-modified soy agar medium (1.5 wt% Trypticase, 0.05 wt% soy peptone and 1.5 wt% Bacto Agar) (pH 7.0), which was then sterilized by autoclave, dispensed into Petri dishes and dried for 1 to 1.5 hours in a biological safety cabinet. (v) Commercially available medium

[0114] Modified GAM agar medium (Nissui Pharmaceutical Co., Ltd.), MRS agar medium (BD Difco), TOS propionate agar medium (Yakult Pharmaceutical Industry Co., Ltd.), trypticase soybean agar medium (BD BBL), cooked meat agar medium (OXOID Ltd.) (supplemented with 1.5% (final concentration) Bacto Agar) were prepared. (5) Results

[0115] As a result of performing the transformation at different pHs of the mGAM agar medium, it was found that the pH of the medium influenced the transformation frequency (Figure 6A). The transformation occurred at pH 6.0 to 8.5, and the transformation frequency was maximized at pH 6.5 and, conversely, drastically reduced at pH 6.0. From this, it was found that an acidic environment Petition 870250112695, dated 08 / 12 / 2025, pages 131 / 158 50 / 76 inhibited the transformation. A carbohydrate (lactose) easily degradable by bifidobacteria suppressed the transformation in a manner dependent on the amount of carbohydrate added (Figure 6B). The carbohydrate suppressed the transformation, probably because an acid resulting from the carbohydrate's metabolism lowered the ambient pH of the bacterial cells. From this, it was predicted that an alkaline medium could alleviate the suppressive effect of carbohydrate addition on the transformation. As a result of a test, it was confirmed that the transformation occurs even in the presence of a large amount of carbohydrate when the medium is made alkaline (Figure 6C). The results of the tests, when summed, revealed that the relationship between the pH of the medium and the amount of carbohydrate added that causes the transformation is represented by the following mathematical expressions (Figure 6C).

[0116] The pH is 6.0 or higher and lower than 10.0, and a carbohydrate content x (% by mass) satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or higher and lower than 8.5 and 0.2 x (pH) - 1.7 < x < 0.2 x (pH) - 1.2 when the pH is 8.5 or higher and lower than 10.0

[0117] It was found that several salts also influence the transformation frequency (Figure 6D). A moderate concentration of sodium chloride, potassium chloride, ammonium chloride, or magnesium chloride promoted the transformation. Magnesium chloride added in an amount of 5 to 100 mM promoted the transformation well (Figure 6E). Salts other than magnesium chloride added in equal amounts also resulted in almost the same values ​​of the natural transformation frequency. Therefore, the influence of the osmotic pressure of the medium was predicted. To test this, the frequency of the natural transformation was measured using a medium with its osmotic pressure adjusted with sodium chloride. As a result, the natural transformation occurred in media from 134 to 681 mOsm, while no natural transformation occurred in media of 102 mOsm or less and 761 mOsm (Figure 6F). The transformation frequency peaked near 417 mOsm. Thus, Petition 870250112695, dated 08 / 12 / 2025, pages 132 / 158 51 / 76 it was discovered that osmotic pressure influences the transformation.

[0118] Next, a gelling agent for media was tested for its influence. As a result of measuring the frequencies of natural transformation in mGAM agar medium and mGAM liquid medium (static culture and rotary shaking culture at 10 rpm), natural transformation occurred most efficiently in the agar medium among these three conditions. On the other hand, natural transformation rarely occurred in the rotary shaking liquid culture medium (Figure 6G).

[0119] Finally, commercially available media were tested to verify whether they caused natural transformation (Figure 6H). Natural transformation was confirmed in mGAM agar medium, as well as in cooked meat (CM) and Trypticase soy agar (TS) media. All media had osmotic pressure, pH, and degradable carbohydrate content within the ranges described above. On the other hand, no natural transformation occurred in TOS propionate agar medium (containing 1 wt% galactooligosaccharide) and MRS agar medium (containing 2 wt% dextrose), which are commonly used in bifidobacteria culture. Both media were rich in degradable carbohydrates and were therefore considered as suppressors of transformation due to the pH reduction attributable to acid production.

[0120] In this study, the transformation frequency was maximized in mGAM agar medium supplemented with 50 mM magnesium chloride and, in this case, the efficiency of obtaining transformants was 2.5 χ 108 transformants per μg of donor DNA. This numerical value was 65.7 times greater than the maximum value reported as the efficiency of obtaining transformants from bifidobacteria using plasmids (3.8 χ 106 transformants / μg of DNA; Non-Patented Literature 4). Example 4: Establishing a labelless genome manipulation system for bacteria belonging to the genus Bifidobacterium.

[0121] Example 3(2)(i) demonstrated that the resistance gene to Petition 870250112695, dated 08 / 12 / 2025, pages 133 / 158 52 / 76 drugs can be inserted at an arbitrary position in the genome of a recipient using Bifidobacterium pseudocatenulatum as the recipient and linear DNA as the donor. Thus, it is expected that a similar manipulation will disrupt an arbitrary target gene by replacing the target gene with the drug resistance gene (marker) or similar genes contained in the linear DNA. On the other hand, multiple disruption is difficult using the gene disruption method based on replacement with the marker gene. Therefore, there is a demand for the establishment of a markerless genome manipulation system capable of freely editing a target region without leaving any trace of the marker gene in the genome.

[0122] A general markerless genome manipulation system consists of two stages: the introduction of a construct using a positive selection marker (positive selection) and the removal of an unnecessary sequence using a negative selection marker (negative selection). As positive selection by the transformation method of the present invention was obtained as shown in Examples 2 and 3, the search for the negative selection marker and studies on the markerless genome manipulation system were carried out (1) Bacterial strain used

[0123] Tc-sensitive Bifidobacterium pseudocatenulatum YIT 12819 was used as a recipient. (2) Confirmation of sensitivity to 5-fluorouracil

[0124] YIT 12819 was cultured in mGAML liquid medium in an anaerobic glove box until the late logarithmic growth phase. Then, 50 μL of an undiluted liquid or a 10-fold dilution of the culture solution was spread over mGAML agar medium supplemented with 5-fluorouracil (5FU) (final concentration: 100 μg / mL) and cultured anaerobically. The same culture solution as above was appropriately diluted and spread over mGAML agar medium, and the total number of bacteria in the culture solution was measured. The number of bacteria resistant to Petition 870250112695, dated 08 / 12 / 2025, pages 134 / 158 53 / 76 5FU, which represents the total number of bacteria, was considered as the rate of appearance of colonies resistant to 5FU. (3) Preparation of the construct for upp deletion

[0125] The upstream and downstream regions of the upp gene encoding uracil phosphoribosyltransferase (UPRTase) from YIT 12819 were ligated by OE-PCR to prepare a construct for the upp deletion. KOD-Plus-Neo was used as a PCR enzyme. The upstream region was amplified by PCR with YIT 12819 genomic DNA as a template using primers with SEQ ID NOs: 29 and 30. The downstream region was amplified by PCR with YIT 12819 genomic DNA as a template, using primers with SEQ ID NOs: 31 and 32. Their respective fragments were extracted from gels after agarose gel electrophoresis and mixed in substantially equal concentrations. OE-PCR was performed using the mixture as a template with SEQ ID primers NOS: 29 and 32. After agarose gel electrophoresis, a band of interest was extracted from the gel. Finally, precipitation with ethanol was performed, and the DNA was dissolved in TE buffer and used in the tests presented below.The DNA comprises an upstream homology arm, comprising a nucleotide sequence homologous to the upstream region of the upp gene, and a downstream homology arm, comprising a nucleotide sequence homologous to the downstream region of the upp gene, in the 5' side order.

[0126] Table 6 shows the primers and PCR conditions used in this example. [Table 6] Name of primer or Sequence (5'-3')a SE Q ID NO Length of amplified product (bp) PCR conditions upp- GCGTTCCTGAATGGGAAGTA 29 3389 1 Petition 870250112695, dated 08 / 12 / 2025, pp. 135 / 158 54 / 76 up-f uppupOE-r TTTCCTCGCGATTATGGCCGCATCAGAG CTCAACC 30 uppdown- OE-f TGAGCTCTGATGCGGCCATAATCGCGAG GAAAAGC 31 3498 1 uppdown- r TGAAGTACCGTTCGTTCGTG 32 uppup-f GCGTTCCTGAATGGGAAGTA 29 5665 2 uppdown- r TGAAGTACCGTTCGTTCGT 32 a: Underlined overlapping region PCR conditions 1. 94°C 2 min, (98°C 10 s, 68°C 2 min) x 30.4°C ~ 2. 94 °C 2 min, (98 °C 10 s, 65 °C 30 s, 68 °C 4 min) x 30, 4 °C « (4) Preparation of the upp deficient strain

[0127] Frozen bacterial cells from YIT 12819 were inoculated onto mGAML agar medium and cultured anaerobically, and the resulting colony was then subcultured in 400 μL of mGAML liquid medium. After culturing for 3 to 4 hours, 1600 μL of the same liquid medium were added, and the bacterial cells were cultured for 4 to 5 hours until the late logarithmic growth phase. After centrifugation, the bacterial cell pellets were washed once with 1 mL of mPY liquid medium, and the pellets were suspended in 200 μL of the same liquid medium. The bacterial liquid and the DNA construct solution for the ascending deletion of (3) were mixed in equal volumes (5 μL each, number of bacteria: approximately 107-8 organisms), and 10 μL of the mixed solution were Petition 870250112695, dated 08 / 12 / 2025, pages 136 / 158 55 / 76 cells were carefully spread on mGAM agar medium supplemented with 50 mM magnesium chloride using a 10 μL pipette and left to stand for several minutes until the liquid dried, followed by anaerobic culture at 37 °C for 16 hours. The following day, the entire quantity of bacterial cells was scraped with a 1 μL loop, suspended in 60 μL of mPY liquid medium, then spread on mGAML agar medium supplemented with 5FU (final concentration: 100 μg / mL) and cultured at 37 °C. The following day, the resulting colony was subcultured on the same agar medium as above, then partially suspended in TE buffer, heated to 95 °C for 5 minutes and used as a PCR template. To confirm the presence or absence of upp, real-time PCR was performed with primers for upp gene detection (139q-f: CGATCATTGTGCCTGTGCTG (SEQ ID NO: 33), 139q-r: TGATCTGCTGGGTTGGGTTC (SEQ ID NO: 34)) and ABI7500. A strain without a detectable upp gene was subjected to PCR using primers to confirm the deletion site (upp-del-check-f: GACAATTCCAAGTGGGGTTC (SEQ ID NO: 35), upp-delcheck-r: GTCGCGGAAAACTGGAGTAA (SEQ ID NO: 36)). The fragment length of the PCR products was confirmed by agarose gel electrophoresis to confirm that a fragment of the predicted size (879 bp) was obtained in the deficient strain. Furthermore, sequencing was performed using the Sanger method with this PCR product as a template to confirm the absence of an unintentional mutation in the nucleotide sequence. In this way, an upp-deficient strain (YIT 12819Δ upp) was obtained. (5) Upp-tetW cassette preparation

[0128] A construct was prepared to insert the Tc resistance gene (tetW) into an intergenic region downstream of the upp gene of YIT 12819. KOD-PlusNeo was used as the PCR enzyme. The upstream homology arm was amplified by PCR with YIT 12819 genomic DNA as a template using primers with SEQ IDs 37 and 38. The downstream homology arm was amplified by PCR with the Petition 870250112695, dated 08 / 12 / 2025, pages 137 / 158 56 / 76 Genomic DNA from YIT 12819 was used as a template, with primers SEQ ID NOs: 41 and 42. The Tc resistance gene region was amplified by PCR using genomic DNA from YIT 4072T as a template, with primers SEQ ID NOs: 39 and 40. Their respective fragments were extracted from gels after agarose gel electrophoresis and mixed in substantially equal concentrations. OE-PCR was performed with the mixture as a template using primers SEQ ID NOs: 37 and 42. After agarose gel electrophoresis, a band of interest was extracted from the gel. Finally, precipitation with ethanol was performed, and the DNA was dissolved in TE buffer. The DNA comprises an upstream homology arm consisting of a nucleotide sequence homologous to the region immediately upstream of the upp gene, the upp gene, and the tetW gene, and a downstream homology arm consisting of a nucleotide sequence homologous to the region immediately downstream of the upp gene, in order from the 5' side.

[0129] The transformation was performed in the same way as in (4), except for the use of YIT 12819 and the construct. Bacterial cells were spread on mGAML agar medium supplemented with Tc (final concentration: 10 μg / mL) to isolate a Tc-resistant colony. A region comprising a putative promoter sequence of the upp gene and a putative terminator sequence of the tetW gene was amplified by PCR with genomic DNA from the colony as a template using primers with SEQ ID NOs: 43 and 44 to prepare the upp-tetW cassette.

[0130] Table 7 shows the primers and PCR conditions used in this example. [Table 7] Name of the primer or Sequence (5'-3')a SE Q ID NO Length of the amplified product (bp) PCR conditions Petition 870250112695, dated 08 / 12 / 2025, pages 138 / 158 57 / 76 upptet-up-f TCATGCACCTGAACCGACT 37 1850 1 upptet-upOE-r TTAGATGTGCCGAAAGAAACGAGCCAAC C GTACCT 38 tet-OE- f TTTCGGCACATCTAAACCAAGG 39 2558 1 tet-OEr CCAGTGAATGCCCTCCTGATT 40 upptetdownOE-f GAGGGCATTCACTGGCACAGTGCGATG ACTGGTTC 41 1257 1 upptetdown-r GTACGAAATCGTCCCGIIIG 42 upptet-up-f TCATGCACCTGAACCGACT 37 5665 2 upptetdown-r GTACGAAATCGTCCCGTTTG 42 upp-tccassett ef GCTTGCCGAACT HTGCTAT 43 3553 3 upp-tccassett er TCTGCACCCACCTCTGTACC 44 a: Underlined overlapping region PCR conditions 1. 94°C 2 min, (98°C 10s, 65°C 30s, 68°C 90s) x 30.4°C ~ 2. 94°C 2 min, (98°C 10 s, 65°C 30 s, 68°C 4 min) x 30. 4°C ~ 3. 94°C 2 min, (98°C 10 s, 68°C 2 min) x 30.4°C ~ Petition 870250112695, dated 08 / 12 / 2025, pp. 139 / 158 58 / 76 (6) Preparation of the construct for target gene deletion

[0131] The YIT 12819_00675 to YIT 12819_00677 genes of YIT 12819 were used as a target gene. The upstream and downstream regions of the gene in the YIT 12819 genome were ligated to the upp-tetW cassette of (5) by OE-PCR to prepare a construct for the deletion of the target gene. KOD-Plus-Neo was used as the PCR enzyme. The upstream region was amplified by PCR with YIT 12819 genomic DNA as a template using primers with SEQ IDs 45 and 46. The downstream region was amplified by PCR with YIT 12819 genomic DNA as a template using primers with SEQ IDs 47 and 48. In this regard, the nucleotide sequence of a region adjacent to the upp-tetW cassette in the downstream region was inserted as a direct repeat at a site flanked by the upstream region and the cassette. Their respective fragments were extracted from the gels after agarose gel electrophoresis. The fragments from the downstream region and the upp-tetW cassette were mixed in substantially equal concentrations.OE-PCR was performed using the mixture as a template with SEQ ID NOs 45 and 44 primers. After agarose gel electrophoresis, a band of interest was extracted from the gel, and the resulting fragment and the fragment from the upstream region were mixed in substantially equal concentrations. OE-PCR was performed using the mixture as a template with SEQ ID NOs 45 and 48 primers. After agarose gel electrophoresis, a band of interest was extracted from the gel. Finally, ethanol precipitation was performed, and the DNA was dissolved in TE buffer and used in the tests presented below. The DNA comprises an upstream homology arm (comprising the direct repeat in a 3'-terminal region) consisting of a nucleotide sequence homologous to the upstream region of the target gene, the upp gene, the tetW gene, the direct repeat, and a downstream homology arm consisting of a nucleotide sequence homologous to the downstream region of the target gene, in order from the 5' side. Petition 870250112695, dated 08 / 12 / 2025, pp. 140 / 158 59 / 76

[0132] Table 8 shows the primers and PCR conditions used in this example. [Table 8] Primer Name Sequence (5'-3')a SEQ ID NO Amplified Product Length (bp) PCR Conditions com-up-f ATAATGGAA CGGCTCACC AC 45 1050 1 com-up-r CAAAAGTTC GGCAAGCAA GCCTGCACA GATCAACG 46 com-down-f AGAGGTGGG TGCAGACGT GGTTATGCG TGTCTGATG CGTATGIIIT CGATGGATT CCGTTGATC TGTGCAGGC TTGATTCAA GTCCAGCAG AAAGGA 47 1844 2 com-down-r GAGACGAAG GTGGTGGTG AT 48 com-up-f ATAATGGAA CGGCTCACC AC 45 4603 3 Petition 870250112695, dated 08 / 12 / 2025, pp. 141 / 158 60 / 76 upp-tccassette-r TCTGCACCC ACCTCTGTA CC 44 com-up-f ATAATGGAA CGGCTCACC AC 45 6447 3 com-down-r GAGACGAAG GTGGTGGTG AT 48 a: Single line: overlapping region, double line: direct repetition PCR conditions 1. 94°C 2 min, (98°C 10 s, 68°C 2 min) x 30.4°C ~ 2. 94 °C 2 min, (98 °C 10 s, 65 °C 30 s, 68 °C 90 s) x 30.4 °C « 3. 94 °C 2 min, (98 °C 10 s, 65 °C 30 s, 68 °C 4 min) x 30, 4 °C « (7) Preparation of the target gene deficient strain

[0133] The transformation was performed in the same way as in (4), except that YIT 12819Δ upp and the construct for the deletion of the target gene from (6) were used. Bacterial cells were spread on mGAML agar medium supplemented with Tc, and replicates of the colonies obtained were then subcultured on mGAML agar medium supplemented with Tc and mGAML agar medium supplemented with 5FU. A plurality of Tc-resistant and 5FU-sensitive colonies were selected, and the bacterial cells were suspended in TE buffer, heated to 95 °C for 5 minutes and used as PCR templates.The presence or absence of the upp gene, the tetW gene, and the target gene was confirmed by real-time PCR using primers for upp gene detection (SEQ ID NOs: 33 and 34), primers for tetW gene detection (tetW-f: TCGCTGTCCCCGGAAATAGTC (SEQ ID NO: 49), tetW-r: CTGTCACCGCATCCATCAACG (SEQ ID NO: 50)), primers for YIT 12189_00675 detections (675q-f: CATCCTGGCCGAAAGCAATC (SEQ ID NO: 51), 675q-r: GGTGATGTTGCCATGCTGTG (SEQ ID NO: 52)), primers for YIT 12189_00676 detections (676q-f: CGCATGACTGCTTGAACGAC (SEQ ID NO: 51)). Petition 870250112695, dated 08 / 12 / 2025, pp. 142 / 158 61 / 76 53), 676q-r: CTTGCATACGCCTTGATCGC (SEQ ID NO: 54)) and primers for YIT detections 12189_00677 (677q-f: CGCATGGCTGGAAAGACAAG (SEQ ID NO: 55), 677q-r: CGCCTGGTTTTGACTTCGAC (SEQ ID NO: 56)) to select a strain with the inserted tetW gene and upp gene and without the target gene. Each colony was inoculated into mGAML liquid medium and cultured to the late logarithmic growth phase, and 50 μL of the bacterial liquid was then spread onto mGAML agar medium supplemented with 5FU. The following day, replicates of the obtained colonies were subcultured onto mGAML agar medium supplemented with Tc and mGAML agar medium supplemented with 5FU. A colony sensitive to Tc and resistant to 5FU was selected. Bacterial cells were suspended in TE buffer, heated to 95 °C for 5 minutes, and used as a template in PCR to confirm the presence or absence of the upp gene, the tetW gene, and the target gene.The nucleotide sequence of a recombination site was determined by the Sanger method for a strain in which none of the genes were detected. (8) Results

[0134] Attention has been given to a 5FU) / upp system reported as a negative selection marker in Bacillus subtilis and similar bacteria (Fabret et al., Mol. Microbiol. 46 (1) 25-36, 2002). This system exploits the properties by which the UPRTase encoded by the upp gene converts 5FU, a uracil analog, into 5-fluorouridine monophosphate, and a toxic metabolite (5-fluoro-dUMP) is ultimately produced to kill bacterial cells. In a descriptive report, a strain without the upp gene is not killed in the presence of 5FU, while the foreign upp gene is expected to function as a lethal negative selection marker.

[0135] The 5FU / upp system works on the premise that bacterial cells with the upp gene exhibit lethality in a medium supplemented with 5FU. YIT 12819 has been confirmed to contain the upp gene through genomic analysis. Subsequently, a culture solution of YIT 12819 was spread on 1.6 χ 108 or Petition 870250112695, dated 08 / 12 / 2025, pages 143 / 158 62 / 76 1.6 χ¹⁰⁷ CFU was used as the number of bacteria in an agar medium supplemented with 5FU. As a result, the number of bacteria resistant to 5FU was as small as 10⁵ or 8 CFU, and most bacteria were killed. The frequency of appearance of colonies resistant to 5FU was as low as 6.5 χ¹⁰⁻⁷ or 4.9 χ¹⁰⁻⁷, a value lower than that of Bacillus subtilis in which the 5FU / upp system works. This suggests that the 5FU / upp system also functions as a negative selection marker in a bacterium belonging to the genus Bifidobacterium.

[0136] An attempt was made to prepare a target gene-deficient strain (gene group YIT 12819_00675 to YIT 12819_00677) by the transformation method of the present invention using YIT 12819Δ upp and upp-tetW cassette. Figure 7 illustrates a schematic view of this example. A strain in which the target gene was replaced by the upp-tetW cassette could be obtained by positive selection of a colony with the upp-tetW cassette inserted into it. This result demonstrated that, by exploiting natural transformation, an arbitrary target gene can be replaced by the drug resistance gene (marker) or similar genes contained in linear DNA and thus disrupted. Subsequently, the strain with the replaced upp-tetW cassette was spread in a medium supplemented with 5FU, so that recombination occurred between direct repeats to obtain a strain completely deficient in the target gene that exhibited resistance to 5FU.

[0137] The results described above demonstrated that genome manipulation can be achieved by the transformation method of the present invention combined with the 5FU / upp system. Example 5 Identification of the gene related to transformation of Bifidobacterium pseudocatenulatum (1) RNAseq

[0138] Each mGAM agar medium was prepared under the conditions found in Example 3 to promote transformation (addition of magnesium chloride). Petition 870250112695, dated 08 / 12 / 2025, pages 144 / 158 63 / 76 (final concentration: 50 mM) and osmotic pressure adjustment (50 mM (final concentration) of unusable carbohydrate fucose and 50 mM (final concentration) of sodium acetate)) or to suppress transformation (pH 6.0 or pH 9.0). Two samples of a bacterial liquid from YIT 12819 mixed with donor DNA from Example 3(2) were left standing on each agar medium and cultured anaerobically overnight. Then, the transformation frequency was confirmed using one of the samples, and total RNA was extracted from the remaining sample. It was confirmed that each medium promoted or suppressed the transformation frequency as expected, and gene expression levels were comprehensively analyzed by RNAseq. Total RNA was extracted by the hot phenol method. The DNA was degraded with DNase I and then subjected to PCI treatment and ethanol precipitation, and the resulting RNA was dissolved in nuclease-free water.RNA purity was confirmed using the Bioanalyzer 2100 and the RNA 6000 Nano LabChip kit (Agilent Technologies Japan, Ltd.) to confirm that all samples had an RIN value of 9 to 10. After rRNA removal using the QIAseq FastSelect-5S / 16S / 23S (Qiagen NV), a cDNA library was prepared using the QIAseq Stranded RNA Lib Kit (Qiagen NV). 75 bp end pair data were obtained by sequencing using Miseq and the Miseq Reagent V3 Kit (150 cycles) (Illumina, Inc.). After quality control using fastp (Chen et al., Bioinformatics 34 (17), i884-i890), the rRNA sequence was removed using SortMeRNA (Kopylova et al., Bioinformatics 28 (24), 3211-3217). The reads were mapped to the YIT 12819 genomic sequence using Bowtie2 (Langmead et al., Nature methods 9, 357-359), and the number of reads mapped to each gene was counted using featureCounts (Liao et al., Bioinformatics 30 (7), 923930).After calculating the TPM, a group of genes was sought whose expression level corresponded to a transformation frequency. (2) Preparation of the gene-deficient strain

[0139] A strain deficient in each gene found in (1) was prepared Petition 870250112695, dated 08 / 12 / 2025, pages 145 / 158 64 / 76 using the labelless genome manipulation method of Example 4. Tables 9-1 and 9-2 show the primers and PCR conditions used in preparing the deficient strain. The upstream and downstream regions of each gene were amplified by PCR, and their respective fragments and the upp-tetW cassette were then ligated by OE-PCR to prepare a construct. The strain deficient in each gene was prepared by the genome manipulation method described in Example 4. [Table 9-1] Name of primers Target gene Sequence (5'-3')a SEQ ID NO Length of the amplified product (bp) PCR conditions piliup-f YIT1281 9_0014 3-00149 Mounting region GAGACGGTTCAGGIIICCAG 5 7 1537 1 piliup-r AGCAAAAGTTCGGCAAGCATCGCA GGGTTCCTCCA 5 8 pilidow n -f Region downstream of AGAGGTGGGTGCAGACCTGGAAC GTATGGCATGGTTGCGCAATGCGG TC GCGCATCGGTGGAGGAACCCTGC GA TTGGTGCGGAACGGTACA 5 9 2034 1 pilidow nr CGTGTCAAAGAAGAAGCAGGA 6 0 comp-f YIT1281 9_0067 Reg ion ATAATGGAACGGCTCACCAC 4 5 1050 2 Petition 870250112695, dated 08 / 12 / 2025, pp. 146 / 158 65 / 76 com- up-r 5 a mon tant e CAAAAGTTCGGCAAGCAAGCCTGC ACAGATCAACG 4 6 675dow nf Reg ião a jusa nte AGAGGTGGGTGCAGACGTGGTTAT GCGTGTGTCTGATGCGTATGTTTTC GAT GGATTCCGTTGATCTGTGCAGGCT 3 675dow nr GATCAAGGCGTATGCAAGGT 6 2 676up-f YIT1281 9_0067 6 Reg ião a mont e CTCCATGCTGATTCGTGAGA 6 3 1302 4 676- up-r AAAAGTTCGGCAAGCGAGAACCCACATAC 64g Reg ião a jusa nte AGAGGTGGGTGCAGATGACAGGGT CT CATCGTCGATGGCGGTTGCGTTG ACGCTCGTATCGGCGGTTGTGTTC TCTCAGAACGCTCCTTCGATATG 6 5 131 2 3 676dow nr TATTCCGG IIICCTCGGTTC 617 618 Y-up-6 9_0067 7 Upstream region GTTGATGCGTTCCACAGGAG 6 7 1253 2 677up-r AAAAGTTCGGCAAGCGTCCACCAT ATCGAAGGAGC 6 8 Petition 870250112695, of 08 / 12 / 2025, p. 147 / 158 66 / 76 677dow nf Reg ião a jusa nte AGAGGTGGGTGCAGATGAGACCCA 6 9 1859 3 CGGAAAGCGCGCTGCCGATAGCCA T CAGAACGCTCCTTCGATATGGTGG ACGATTCAAGTCCAGCAGAAAGGA comdow nr GAGACGAAGGTGGTGGTGAT 4 [Table 9-2] Name of the starters Target gene Sequence (5'-3')a SEQ ID NO Length of the amplified product (bp) PCR conditions with EAup-f YIT1281 9_0090 5-00906 Upstream region TACTACCGCGACACCAACACAC 7 0 1246 5 with EAup-r AAAAGTTCGGCAAGCCGAAGGATG GGAGTTATCCA 7 1 with EA-down nf Downstream region AGAGGTGGGTGCAGAGGTGGGAA CCGIIICCGCATAAGGCGACGACC CG AACATGTGGATAACTCCCATCCTT CGGTCCACCGATACAGCGAGAT 7 2 1515 6 with EA-down nr TGAGGATGATGGTGTTGTCG 7 3 Petition 870250112695, dated 08 / 12 / 2025, pp. 148 / 158 67 / 76 a: Single line: overlapping region, double line: direct repeat. PCR conditions. 1. 94°C 2 min, (98°C 10 s, 55°C 30 s, 68°C 3.5 min) x 30.4°C « 2. 94°C 2 min, (98°C 10 s, 55°C 30 s, 68°C 1.5 min) x 30.4°C « 3. 94°C 2 min, (98°C 10 s, 68°C 4 min) x 30.4°C ~ 4. 94°C 2 min, (98°C 10 s, 68°C 2 min) x 30.4°C ~ 5. 94°C 2 min, (98°C 10 s, 68°C 2 min) x 30.4°C ~ 6. 94 °C 2 min, (98 °C 10 s, 68 °C 3.5 min) x 30, 4 °C « (3) Measurement of transformation frequency in the genetically deficient strain

[0140] The transformation frequency of each genetically deficient strain was measured according to Example 3(3). (4) Results

[0141] As a result of the search for a gene whose expression level referred to the transformation frequency, several gene groups were found. A strain deficient in each gene was prepared using a labelless genome manipulation system to confirm the influence on the transformation frequency. As a result, the Tad pilus gene operon (YIT 12189_00143 to 00149), the DNA binding enzyme (ComEA) / DNA uptake enzyme (ComEC) gene operon (YIT 12189_00905 to 00906), the DNA processing enzyme (DprA) gene (YIT 12189_00675), the nuclease gene (YraN) (YIT 12189_00677), and the helicase gene (ComM) (YIT 12189_00676) were identified as genes whose deletion completely inhibited transformation (Table 10). These genes were considered transformation-related genes.A putative function of each gene was in good agreement with a molecular model of natural transformation in Gram-positive bacteria (Johnston, Calum, Bernard Martin, Gwennaele Fichant, Patrice Polard, and Jean-Pierre Claverys. 2014. Nature Reviews Microbiology 12 (3): 181-96). All amino acid sequences of the proteins encoded by the identified genes had approximately 30% homology with the amino acid sequences of the corresponding species-possessed proteins. Petition 870250112695, dated 08 / 12 / 2025, pages 149 / 158 68 / 76 bacteria were confirmed as causing natural transformation. Therefore, even this level of amino acid homology was considered a functional preservative. [Table 10] Gene ID Putative gene product (KEGG orthology (or eggNOG description)) Putative function SEQ ID NO YIT12819_00143 flhG, fleN; flagellar biosynthesis protein Tad pilus formation (Extracellular DNA binding) 1 YIT12819_00144 cpaF, tadA; pilus assembly protein 2 YIT12819_00145 tadB; strong adhesion protein B 3 YIT12819_00146 tadC; strong adhesion protein C 4 YIT12819_00147 (Protein of unknown function (DUF4244)) 5 YIT12819_00148 tadE; Strong adhesion protein E 6 YIT12819_00149 (TigRFAM helicase secretion neighborhood similar protein) 7 YIT12819_00675 dprA; DNA processing protein Promotion of homologous recombination 8 YIT12819_00676 comM; magnesium chelatase family protein Nucleic acid dissociation (ComM helicase) 9 YIT12819_00677 yraN; putative endonuclease Single-stranded DNA nuclease 10 Petition 870250112695, dated 08 / 12 / 2025, pages 150 / 158 69 / 76 YIT12819_00905 comEA; competence protein Binding / absorption of 11 YIT12819_00906 comEC; competence protein DNA 12

[0142] Based on the results described above, it is predicted that donor-derived DNA will be introduced from the donor bacterium into the recipient bacterium belonging to the genus Bifidobacterium by means of the following mechanism: the recipient pilus captures the donor DNA outside the bacterial cells; the captured DNA is single-stranded by the action of an enzyme that converts double-stranded DNA into single-stranded DNA; the single-stranded DNA is transported into the bacterial cells by a DNA uptake enzyme; a single-stranded DNA-binding protein recognizes the single-stranded DNA and recruits a recombination enzyme; the helicase dissociates the double-stranded DNA in the genome; and homologous recombination occurs in the recipient genome. Example 6: Gene distribution in bacteria belonging to the genus Bifidobacterium

[0143] The gene distributions shown in Table 10 above were analyzed in the major native human bacterial species belonging to the genus Bifidobacterium. The genomes of 486 strains of the five major native human bifidobacteria species (Table 11) were downloaded from a public database and searched for homologs (sequences that satisfied the evaluation value < 1e - 10 in the blastp search with amino acid sequences as queries) of the genes shown in Table 10 above, and the proportion of strains possessing homologs was calculated for each of the bacterial species. Table 12 shows the results concerning essential genes. It was found that almost all bacterial species and the bacterial strain possessed the homologs of the genes, except for YIT 12819_00148. [Table 11] Petition 870250112695, dated 08 / 12 / 2025, pages 151 / 158 70 / 76 Number of strains B. pseudocatenulatum 102 B. adolescentis 49 B. longum subsp. longum 151 B. breve 99 B. bifidum 85 [Table 12] Gene ID B. pse B. ado B. Ion B. bre B. bif YIT12819_00143 100 % 100 % 100 % 99 % 100 % YIT12819_00144 100 % 100 % 100 % 99 % 100 % YIT12819_00145 100% 100% 100% 100% 100% YIT12819_00146 100% 100% 100% 100% 95% YIT12819_00147 100% 100% 100% 100% 100% YIT12819_00148 100% 100% 0% 99% 51% YIT12819_00149 100% 100% 100% 100% 100% YIT12819_00675 100% 100% 100% 99 % 100 % YIT12819_00676 100 % 100 % 100 % 99 % 100 % YIT12819_00677 100 % 100 % 100 % 100 % 100 % YIT12819_00905 100 % 100 % 100% 100% 100% YIT12819_00906 100% 98% 100% 100% 100% Example 7: Transformation test of bacteria belonging to the genus Bifidobacterium

[0144] Two bacterial species (Bifidobacterium breve and Bifidobacterium longum) different from Bifidobacterium pseudocatenulatum were also tested to see if they cause transformation. (1) Bacterial strain used

[0145] Bifidobacterium breve was tested using an Em-resistant strain (strain BR-Cw104-C2) and an Em-sensitive strain (strain BR-Cw104-A1). Bifidobacterium longum was tested using an Em-sensitive strain capable of using galactan (YIT 12762) and an Em-resistant strain unable to use galactan (YIT Petition 870250112695, dated 08 / 12 / 2025, pp. 152 / 158 71 / 76 12812). Em-resistant Bifidobacterium longum (strain LO-Cw098-B4) and Em-sensitive Bifidobacterium breve (strain BR-Cw104-A1) were used in tests between different bacterial species. (2) Transformation

[0146] For Bifidobacterium breve, heat-killed bacterial cells of the Em-resistant strain (strain BR-Cw104-C2) were prepared using the same operation as in Example 2(3). The transformation was performed in the same way as in Example 2(4), using the heat-killed bacterial cells as donors and the Em-sensitive strain (strain BR-Cw104-A1) as the recipient, and a bacterial liquid was spread over mGAML agar medium supplemented with Em (1 μg / mL) (Em-mGAML). After obtaining a single colony, the genomic analysis of the transformant thus obtained was performed in the same way as in Example 1(3).

[0147] For Bifidobacterium longum, the transformation was carried out in the same way as in Example 2(4), using viable bacterial cells from YIT 12762 and viable bacterial cells from YIT 12812. The bacterial cells thus transformed were inoculated into mPY medium containing galactan (final concentration: 0.5%) and Em (1 μg / mL) (PY-galactan-erythromycin medium). On the second day, a bacterial fluid that showed proliferation was subcultured again in a 1% quantity in a new medium with the same composition as above. Two more days later, a bacterial fluid that showed proliferation was subcultured in a 1% quantity in a fresh medium with the same composition as above. The following day, the bacterial fluid that proliferated was spread by seeding onto mGAM agar medium supplemented with Em to obtain a single colony. The genomic analysis of the transformant thus obtained was carried out in the same way as in Example 1(3).

[0148] For Bifidobacterium longum and Bifidobacterium breve in combination, the transformation was carried out in the same way as in Example 2(4), using heat-killed bacterial cells of the Em-resistant strain (strain LO-Cw098-B4) from Petition 870250112695, dated 08 / 12 / 2025, pages 153 / 158 72 / 76 Bifidobacterium longum obtained by the same operation as in Example 2(3) as the donor and the Em-sensitive strain (BR-Cw104-A1) of Bifidobacterium longum as the recipient, and a bacterial liquid was spread on mGAML agar medium supplemented with Em (1 μg / mL) (Em-mGAML). After obtaining a single colony, genomic analysis of the transformant thus obtained was performed in the same way as in Example 1(3). (3) Results

[0149] It was confirmed that transformation occurred in Bifidobacterium breve, such that the Em resistance gene on the donor chromosome was transmitted to the recipient (Figure 8A). A strain with the transmitted Em resistance gene was confirmed to be able to proliferate in Em-mGAML medium (Figure 9A).

[0150] Similarly, transformation into Bifidobacterium longum was also confirmed, such that the Em resistance gene on the donor chromosome was transmitted to the recipient (Figure 8B). It was confirmed that a strain with the transmitted Em resistance gene was able to proliferate in Em-mGAML medium (Figure 9B).

[0151] Transformation was also confirmed in a combination of Bifidobacterium longum as donor and Bifidobacterium breve as recipient, such that the Em resistance gene on the donor chromosome was transmitted to the recipient (Figure 8C). It was confirmed that a strain with the transmitted Em resistance gene was able to proliferate in Em-mGAML medium (Figure 9C). This revealed that transformation occurs not only between the same species, but also between different species.

[0152] Based on the results described above, it was found that transformation does indeed occur in bacterial species with the preserved genes from Table 10 above. Transformation also occurred even in Bifidobacterium longum without YIT12189_00148 (Figure 8B), demonstrating that the Tad pilus can be Petition 870250112695, dated 08 / 12 / 2025, pages 154 / 158 73 / 76 formed to cause the transformation, without that gene. Example 8: Restoring the ability to utilize glucose by exploiting the transformation of bacteria belonging to the genus Bifidobacterium.

[0153] Bifidobacterium pseudocatenulatum YIT 11057 is a novel probiotic candidate strain that is expected to actively metabolize carbohydrates in the intestine and produce organic acids. In order to increase viability in a milk medium, considering its use in fermented milk production, YIT 11057 was created by UV irradiation and long-term subculture to obtain Bifidobacterium pseudocatenulatum Y 51493 with greater viability in a milk medium. However, Y 51493 lost the ability to utilize glucose during the reproduction process. As a result of genomic analysis, Y 51493 caused the deletion of a single nucleotide of a C base at position 369 of a gene (SEQ ID NO: 14) that encodes a glucose transporter (EIICBA component of the beta-glucoside PTS system). Therefore, it was considered that the frameshift significantly alters the amino acid sequence and, consequently, prevents glucose from being transported into the cells.It is desirable to maintain the ability to utilize glucose from the perspective of carbohydrate metabolism in the intestines. On the other hand, restoring base deletion through conventional UV irradiation or long-term subculture is not realistic. Therefore, the ability to utilize glucose was restored through reproduction according to the transformation method of the present invention, using Y 51493 as a mother strain, i.e., a receptor. (1) Bacterial strain used

[0154] Bifidobacterium pseudocatenulatum Y 51493 was used as the recipient. (2) Donor DNA

[0155] YIT 11057 was cultured overnight in mGAML liquid medium, and genomic DNA was extracted from 1 mL of the resulting bacterial liquid using the method of Petition 870250112695, dated 08 / 12 / 2025, pages 155 / 158 74 / 76 phenol in granules and used. (3) Transformation and selection of the bacterial cell that restored the ability to use glucose

[0156] All operations were performed in an anaerobic glove box. Frozen bacterial cells of Y 51493 were inoculated onto mGAML agar medium and cultured anaerobically overnight. The following morning, a plurality of colonies were scraped off at once and subcultured in 400 μL of the same liquid medium described above. After culturing for 3–4 hours, 1600 μL of the same liquid medium described above were added, and the bacterial cells were cultured for 4–5 hours. After centrifugation, the bacterial cell pellets were washed once with 500 μL of mPY liquid medium, and the pellets were resuspended in 180 μL of the same liquid medium described above.Bacterial fluid and a DNA solution (YIT 11057 genomic DNA precipitated in ethanol and then dissolved in TE buffer) were mixed in equal volumes, and 10 pL of the mixed solution were spread on mGAM agar medium supplemented with 50 mM magnesium chloride and left to stand for several minutes until the fluid dried, followed by anaerobic culture at 37 °C. The agar medium used was sterilized by autoclaving on the day of use. 16 hours later, the entire quantity of bacterial cell granules was scraped with a 1 pL loop and suspended in 500 pL of mPY liquid medium. A 50 pL aliquot of this suspension was collected and suspended in 640 pL of mPY liquid medium supplemented with 0.5% glucose. A 200 pL aliquot of this suspension was collected from each well of a 96-well plate, 50 pL of mineral oil was poured over it, and then a proliferation curve was obtained using a PowerWave 340 microplate reader (BIOTEC Co., Ltd.).The remaining bacterial fluid was cultured anaerobically at 37 °C in a 1.5 mL tube. When elevated turbidity was confirmed on a PC screen, 10 µL of the bacterial fluid in the 1.5 mL tube were subcultured in 500 µL of fresh liquid medium with a. Petition 870250112695, dated 08 / 12 / 2025, pages 156 / 158 75 / 76 same composition as above and divided into a 96-well plate and a 1.5 mL tube, and proliferation was monitored again. When proliferation was confirmed, the bacterial fluid in the 1.5 mL tube was then dropwise spread onto mGAML agar medium. A single colony was isolated, then suspended in glycerol and preserved at -80 °C. Bacterial cells of the isolated strain were suspended in mPY liquid medium supplemented with 0.5% glucose to confirm proliferative activity. The complete genome of the isolated strain was determined by the procedures described in Example 1(3). (4) Glucose utilization capacity test

[0157] A frozen bacterial fluid from the isolated strain obtained in (3) was inoculated onto mGAML agar medium and cultured overnight, and the resulting colony was scraped, inoculated onto mGAML liquid medium and pre-cultured. 5 to 6 hours later, the OD600 was measured with a PowerWave 340 microplate reader. 100 μL of the remaining bacterial fluid was centrifuged and, after removing a supernatant, the bacterial cells were suspended with OD600 = 0.2 in mPY medium. 198 μL of mPY medium supplemented with 0.5% glucose were distributed into each well of a 96-well plate. 2 μL of bacterial fluid were added to each well, and 50 μL of mineral oil were poured over them, followed by culture at 37 °C in a PowerWave 340 to obtain a proliferation curve. (5) Analysis of the mutation site

[0158] A mutation that occurred in the bacterial strain obtained in (3) was investigated with the complete genome of YIT 11057 referring to it. First, the SNPs were identified using the snippy. Large-scale genomic changes and SNPs that were not detected by the snippy were visually confirmed using mauve (Darling et al., Genome Research 14, 1394-1403). (6) Results

[0159] As a result of transformation using DNA extracted from YIT 11057 Petition 870250112695, dated 08 / 12 / 2025, pages 157 / 158 Using 76 / 76 as the donor and viable bacterial cells of Y 51493 as the recipient, a transforming Bifidobacterium pseudocatenulatum YIT 13179 was obtained that proliferated in a liquid medium with glucose as the sole carbohydrate source. As a result of confirming the ability of YIT 13179 to utilize glucose, it was confirmed that this strain utilizes glucose (Figure 10).

[0160] The complete genome of YIT 13179 was determined, and the nucleotide sequence of the glucose transporter gene was confirmed. As a result, the single nucleotide deletion that occurred in Y 51493 was restored in YIT 13179, which therefore had the complete gene sequence identical to that of YIT 11057.

[0161] Mutations were introduced at 15 loci in the genome during the breeding process from YIT 11057 to Y 51493. Therefore, it is presumed that these mutations contribute to improved viability in a milk medium. In YIT 13179, only one of these loci was restored to the sequence of YIT 11057. The restored mutation was the deletion of the glucose transporter gene.

[0162] The results described above have demonstrated that the transformation method of the present invention can easily produce even a strain that has restored the deletion of a single nucleotide, which is difficult to obtain by a conventional breeding method. Petition 870250112695, dated 08 / 12 / 2025, p. 158 / 158

Claims

1 / 3 CLAIMS 1. A method for transforming a bacterium belonging to the genus Bifidobacterium, the method CHARACTERIZED in that it comprises the static culture of a recipient bacterium belonging to the genus Bifidobacterium in contact with a donor bacterium or linear DNA comprising the DNA to be introduced into the recipient, wherein a medium for use in the static culture is a medium having a pH of 6.0 or higher and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 χ (pH) - 1.2 when the pH is equal to or greater than 6.0 and less than 8.5 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is equal to or greater than 8.5 and less than 10.

0.

2. Method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium, the method CHARACTERIZED by the fact that it comprises the static culture of a recipient bacterium belonging to the genus Bifidobacterium in contact with donor linear DNA, wherein a medium for use in the static culture is a medium that has a pH of 6.0 or higher and less than 10.0, in which a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 χ (pH) - 1.2 when the pH is 6.0 or higher and less than 8.5 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is equal to or greater than 8.5 and less than 10.0; The recipient bacterium, belonging to the genus Bifidobacterium, is a bacterium belonging to the genus Bifidobacterium without the upp gene.and the donor linear DNA comprises an upstream homology arm, two genes, the selection marker gene and the upp gene, and a downstream homology arm, wherein the two genes are located between the upstream homology arm and the downstream homology arm, and the donor linear DNA further comprises a 3'-terminal region of the upstream homology arm between the two genes and the downstream homology arm, or a 5'-terminal region of the downstream homology arm between the upstream homology arm and the two genes.

3. Method, according to claim 1 or 2, CHARACTERIZED in that the recipient bacterium belonging to the genus Bifidobacterium is a bacterium belonging to the genus Bifidobacterium that has, in its genome, at least one selected member of the group consisting of the Tad pilus gene operon, the DNA-binding enzyme gene operon (ComEA) / DNA uptake enzyme gene (ComEC), the DNA processing enzyme gene (DprA), the nuclease gene (YraN) and the helicase gene (ComM).

4. Method, according to claim 1 or 2, CHARACTERIZED in that the osmotic pressure of the medium is from 110 to 750 mOsm.

5. Method according to claim 1 or 2, CHARACTERIZED in that the medium contains from 3 to 180 mM of MgCl2.

6. Medium for use in the method for transforming a bacterium belonging to the genus Bifidobacterium, according to claim 1, or the method for manipulating the genome of a bacterium belonging to the genus Bifidobacterium, according to claim 2, CHARACTERIZED in that the medium has a pH equal to or greater than 6.0 and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 x (pH) - 1.2 when the pH is 6.0 or greater and less than 8.5 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is 8.5 or greater and less than 10.

0.

7. Kit for use in the method of manipulating the genome of a bacterium belonging to the genus Bifidobacterium, according to claim 2, the kit CHARACTERIZED in that it comprises a medium and linear DNA comprising the selection marker gene and the upp gene, wherein the medium has a pH equal to or greater than 6.0 and less than 10.0, wherein a content x (% by mass) of a carbohydrate usable by the recipient bacterium belonging to the genus Bifidobacterium in the medium satisfies 0 < x < 0.2 χ (pH) - 1.2 when the pH is 6.0 or greater and less than 8.

5. Petition 870250087573, dated 09 / 26 / 2025, p. 10 / 13 3 / 3 and 0.2 χ (pH) - 1.7 < x < 0.2 χ (pH) - 1.2 when the pH is 8.5 or higher and lower than 10.

0. Petition 870250087573, dated 09 / 26 / 2025, page 11 / 13

Images